A Functional C–G Polymorphism in the CYP7B1 Promoter Region and Its Different Distribution in Orientals and Caucasians

A functional C–G polymorphism in the CYP7B1 promoter region and its different distribution in Orientals and Caucasians

J Jakobsson1 ABSTRACT 1 Cytochrome P450 (CYP) 7B1 is involved in many metabolic processes H Karypidis including androgen metabolism. Genetic variation in the CYP7B1 gene may 2 J-E Johansson play a role in predisposition to prostate cancer. Here, we screened the human H-K Roh3 CYP7B1 gene for possible polymorphisms. Only one single polymorphism A Rane1 was detected, a C–G change in the promoter –104 base pair from the 1 transcription start site. The allele frequency was investigated in Swedish men L Ekstro¨m and compared to a Korean population, as it is known that the frequency of 1Department of Laboratory Medicine, Division of prostate cancer is low among Orientals. We found that the frequency of the Clinical Pharmacology, Karolinska Institutet, G-allele was 4.04% in Swedes (n ¼ 150) but only 0.33% among Koreans Huddinge University Hospital, Stockholm, (n ¼ 153). Computer analysis indicated that the two variants bind with 2 Sweden; Department of Urology, O¨ rebro different affinities to a CCAAT-box binding protein. Expression studies with University Hospital, O¨ rebro, Sweden; 3Department of Internal Medicine, Division of reporter constructs showed significantly higher transcriptional activity of the Clinical Pharmacology, Inha University Hospital, G variant in Hek293 cells (2.7-fold, Po0.05). In conclusion, we report here Inchon, Korea for the first time the detection of a single polymorphism in the CYP7B1 gene. This polymorphism is associated with phenotypic differences in an expression Correspondence: system and a widely different allele frequency in two ethnic populations, with J Jakobsson, Department of Laboratory Medicine, Division of Clinical Pharmacology, great differences in the incidence of prostate cancer. Karolinska Institutet, Huddinge University The Pharmacogenomics Journal (2004) 4, 245–250. doi:10.1038/sj.tpj.6500236 Hospital, SE-14186 Stockholm, Sweden. Published online 9 March 2004 Fax: þ 46-8-58581185 E-mail: [email protected] Keywords: CYP7B1; genetic polymorphism; prostate cancer; androgen metabolism

INTRODUCTION Recent studies indicate that the estrogen receptor b (ERb) exhibits antiprolifera- tive action in prostate, possibly balancing the stimulatory effect of ERa.1 Weihua et al 2 demonstrated that 5a-androstane-3b,17b-diol (3bAdiol) is an endogenous ERb ligand. Cytochrome P450 (CYP) 7B1 and 3b-hydroxysteroid dehydrogenase (3b-HSD) are two enzymes that may determine the 3bAdiol levels available at the ERb and hence affect the regulation of prostate proliferation. CYP7B-knockout mice show lower proliferation rate of the prostate compared to the WT-mice.3 Polymorphisms in the 3b-HSD gene have been associated with prostate cancer risk.4,5 CYP7B1 is known to be involved in the synthesis of bile acids from cholesterol. Two pathways have been described (see Chiang6 for a review). One is the neutral Received: 19 September 2003 or microsomal pathway and involves an initial 7alpha hydroxylation of Revised: 07 November 2003 Accepted: 10 December 2003 cholesterol by CYP7A. The second is the acidic or mitochondrial pathway Published online 9 March 2004 initiated by CYP27, which transforms cholesterol into 27-hydroxycholesterol C–G polymorphism in CYP7B1 promoter J Jakobsson et al 246

that is further metabolized by CYP7B1.7,8 CYP7B1 is widely PCR amplified fragments of À194 to þ 39 region numbering expressed in humans being particularly abundant in liver, from the transcription start site, with either a C or a G at the brain and kidney.9 polymorphic site were obtained from two homozygous The human CYP7B1 gene consists of six exons and shares individuals and subcloned into pGL3-Enhancer Luciferase the intron–exon organization with the CYP7A1 gene. It is vector. As shown in Figure 2, a 2.7-fold higher normalized located on chromosome 8q21.3 in close linkage to the luciferase activity was observed for the pGL3G as compared CYP7A1 gene, suggesting that these genes have evolved via to pGL3C in Hek293 cells. No significant difference was gene duplication.10 The human CYP7B1 promoter is GC- detected in HepG2 cells (data not shown). Hek293 and rich and contains three GC-boxes essential for the basal HepG2 cells were chosen due to high CYP7B promoter transcription.11 activity, as well as the high abundance of the C/EBP No common polymorphism has been reported in the transcription factor in these tissues. human CYP7B1 gene to date. In this study, we used the human expressed sequence tag (EST) database to search for polymorphisms in the CYP7B1 gene together with single- strand conformation polymorphism (SSCP) analysis. One C– G substitution in the 50-region was discovered. Allele frequencies were determined in relation to risk for prostate cancer as well as in two different ethnic groups with high or low morbidity in this disease, namely in Swedes and Korean individuals. Finally, the activity of the various promoter variants was evaluated in a reporter system.

RESULTS Detection of a Promoter Polymorphism Table 1 shows the putative new polymorphisms resulting in nonconservative amino-acid changes in the CYP7B1 gene according to a BLAST search. None of the indicated polymorphisms could be verified by direct sequence analysis. Figure 1 PCR-SSCP analysis of the promoter region of the human CYP7B1 gene. The six exons and the promoter region were However, SSCP analysis was carried out on all exons and separately amplified from genomic DNA. Electrophoretic separation the promoter region, using DNA from 12–30 individuals in of single-stranded DNA fragments was carried out on polyacryla- order to investigate any common polymorphic alleles in the mide gels. The figure shows the SSCP pattern of the promoter CYP7B1 gene. No polymorphisms were detected in the region in five different subjects. Altered SSCP pattern (arrow) was coding parts of the gene. SSCP analysis of the promoter detected in one of the subjects (lane 3). Sequencing results are region showed an altered electrophoretic pattern in one of reported at the bottom of the gel. 12 subjects (Figure 1). Sequence analysis revealed a C–G substitution at nucleotide position –104 from the transcription start site (as numbered in GenBank accession #AF127089). A computerized analysis by the transcription Hek293 factor database search program, MatInspector 2.2 12 indi- 8 cated that the affinity for the CCAAT-box binding proteins 7 (C/EBP) should differ between the two promoter variants. 6 The C–G alteration at –104 creates a putative C/EBPb binding site. 5 4 Transcriptional Activity of the Promoter Variants 3 To determine whether the polymorphism in the human 2 CYP7B promoter will affect the transcription of the gene, 1 relative Luciferase Activity 0 pGL3G pGL3C

Table 1 Predicted CYP7B polymorphisms detected in silico Figure 2 Transcriptional activity of the human CYP7B1 promoter using the Blast tool variants. Human CYP7B1 promoter fragments, including either G or C at the polymorphic site, were subcloned into the pGL3 Enhancer Amplified region Nucleotide change Amino-acid change vector and transiently transfected in Hek293 cells. The bars represent mean 7SEM from five experiments performed in Exon 3 A664T L222Stop duplicate. The luciferase expression was normalized to the Exon 4 G971A R324H transfection efficiency by b-galactosidase expression. The statistical Exon 6 T1312A G1323C C1331T Y438A P441P T441I significance (P ¼ 0.0452) was determined by t-test.

The Pharmacogenomics Journal C–G polymorphism in CYP7B1 promoter J Jakobsson et al 247

Determination of the Allele Frequency mately 20% whereas no enhancement of the activity was We could genotype all Swedish Caucasians but failed to observed with HepG2 cells. The well-characterized protein genotype two Korean individuals, despite several attempts. C/EBPb is a transcription factor known to bind to the The frequency of the uncommon allele among Swedish CCAAT-box element required for the basal expression of Caucasians controls was 4.04%, which should be compared many TATA-less genes.13 It is also involved in different to the allele frequency among Koreans, which was only 0.33 regulatory events such as apoptosis, inflammation and is percent (w2-test, P ¼ 0.002) (Table 2). known to interact with many other factors such as Ap1 and There was no difference in the genotype or allele NFkB to regulate gene expression (reviewed by Ramji and frequency between cases of prostate cancer and Swedish Foka14). control subjects (Table 3). Variation in the abundance of C/EBPb and/ or other proteins between HepG2 and Hek293 cells could explain the different pattern observed in promoter activity of the DISCUSSION polymorphic variants. Further studies, for example, EMSA CYP7B1, together with 3a-HSD, 3b-HSD and 5a-RED are are required to evaluate the exact transcriptional mechan- enzymes known to determine the levels of androgens and ism behind the altered transcription activity of the CYP7B their metabolites. Genetic variations in these genes are promoter observed in Hek293 cells. important to study in human populations in order to The reason for not identifying the predicted polymorph- understand the ethnic differences observed in prostate isms in our population is most likely that CYP7B1 cDNA cancer incidence. Here, we have identified a C–G substitu- sequences are poorly represented in the EST database. The tion in the 50-region by SSCP analysis. A striking interethnic likelihood of detecting polymorphisms increases if the gene difference in the allele frequency was found between a of interest is represented by a greater number of full-length Swedish and a Korean population sample. The two variants cDNAs from different cDNA libraries representing a larger show different affinity for the CCAAT-box enhancer protein number of individuals.15 C/EBPb, as indicated by a computer analysis. We observed a The CYP7B1 enzyme demonstrates a broad substrate difference between the mutant variants in promoter activity specificity towards oxysterols, neurosteroids and sex hor- in Hek293 cells. Our results are consistent with a previous mones.9 The enzyme has been implicated to play a role in promoter study 9 showing that the inclusion of the CCAAT- diseases such as prostate cancer 3 and atherosclerosis.16 box increases the promoter activity in Hek293 by approxi- Here, we show for the first time a polymorphism in the CYP7B1 gene that is associated with an altered promoter activity. The fact that the promoter polymorphism identi- Table 2 Genotype and allele frequencies in a Korean popula- fied here is associated with an altered phenotype provides an tion important SNP tool for future association studies. In order to study the possible influence of this poly- Korean healthy subjects morphism in the development of prostate cancer, we determined the allele-frequency in prostate cancer patients %(n) and in matched healthy individuals. We could not find any CC genotype 98.1 (153) significant association between the genotype and prostate GG genotype 0 (0) cancer. However, since the genotype frequency was quite CG genotype 0.64 (1) low this could be due to lack of statistical power. Allele 1 98.4 (307) The significant difference in allele frequencies observed Allele 2 0.33 (1) between Swedes and Koreans may indicate a role of this polymorphism in the development of prostate cancer. This is a common disease among Caucasians (incidence 88 per 100 000 among Swedish men in 2001) (The Cancer Registry. Table 3 Genotype and allele frequencies in a Swedish Cancer incidence in Sweden 2001. Stockholm: National population sample of prostate cancer cases and controls. The Board of Health and Welfare. 2003) but uncommon among controls were men matched for age and area of residence Asians (incidence 10.1 per 100 000 in South Koreans from 17 Swedes 1985 to 1999). If the CYP7B1 enzyme is of importance for the activity of ERb through modulation of its important Prostate cancer Controls % (n) 3bAdiol ligand concentration, our results are consistent with cases % (n) this theory. The luciferase reporter system has demonstrated a higher activity of the G-variant, which is more common in CC genotype 93.8 (165) 93.2 (150) Caucasians, and would then reduce the ligand concentra- GG genotype 0.57 (1) 1.24 (2) tion. Further and larger studies are needed to confirm such CG genotype 5.68 (10) 5.59 (9) an association. Since the allele frequency among Swedes of this polymorphism was low (4.04%) it will not play a major Allele 1 96.6 (340) 96.00 (309) role in the development of prostate cancer in this popula- Allele 2 3.41 (12) 4.04 (13) tion. It is most likely that alterations in multiple genes

www.nature.com/tpj C–G polymorphism in CYP7B1 promoter J Jakobsson et al 248

involved in androgen metabolism and regulation, rather Study Population and Sample Selection than a single polymorphism may affect the prostate cancer The study design was a population based case–control study risk at a detectable rate. Several candidate polymorphisms of 337 Caucasians living in the county of O¨ rebro in Sweden. have been reviewed by Hsing et al.18 Other mechanisms that The cases were 176 patients, age 51–79 years, with prostate regulate the expression of CYP7B1, such as epigenetic cancer, who were recruited consecutively between May 1994 regulation, may contribute to the promotion of prostate and February 1996. In all, 81% agreed to participate. The cancer growth. controls were men, who were randomly selected every 3 months from the county population register and frequency MATERIALS AND METHODS matched for age (50–59, 60–69 and 70–79 years). They were In Silico Analysis asked to participate by mail and 161 individuals agreed to Potential polymorphisms in the CYP7B1 gene were identi- participate, giving a response rate of 79%. Further descrip- fied using the EST database and a BLAST alignment tool as tion of the study population has been already published previously described.15,19,20 When the indicated mutations since this study population has been utilized in the (Table 1) gave rise to a nonconservative amino-acid change, evaluation of other polymorphisms involved in the andro- 21–23 we performed a PCR-direct sequence analysis in 10 subjects gen metabolism. The Ethics Committee of the Regional ¨ to verify these potential polymorphisms. Hospital of Orebro/Uppsala University, Sweden approved the study and all patients gave informed consent to Single-stranded Conformation Polymorphism Analysis participate. SNPs in the CYP7B1 gene were analysed by PCR-single- In another part of the study, we investigated 156 stranded conformation polymorphism (SSCP) analysis in a Korean individuals randomly selected from two previous Swedish population. PCR reactions were performed with 2 U studies.24,25 The DNA samples were decoded and no data Taq-Polymerase (Applied Biosystem), 0.15 mM dNTP (Amer- were available about those individuals concerning prostate sham), genomic DNA (0.1 mg) using primers listed in Table 4. cancer morbidity or heredity. The population consisted of Amplification of the GC-rich exon 1 required the use of a healthy unrelated men and women from different areas in GC-kit (Clontech). PCR was carried out in 30 cycles, each Korea. The Ethics committee of Karolinska Institutet at involving denaturation at 941C for 1 min, annealing (tem- Huddinge University Hospital approved this part of the perature see Table 4) for 45 s and extension at 721C for 45 s. study. The PCR products were verified in an ethidium bromide- stained agarose gel. For the analysis, 3 ml of the PCR products was mixed with 27 ml loading buffer, containing 95% PCR Assay formamide, 20 mM EDTA, and 0.05% bromophenol blue. Blood samples were collected in tubes containing EDTA and Before loading, the samples were denatured at 1001C for stored at À201C. DNA was extracted using standard 5 min and cooled on ice. Electrophoretic separation of procedures and stored at À201C until analysed. single-stranded DNA fragments was then analysed in 8.5% The fluorogenic 50 nuclease polymerase chain reaction polyacrylamide gels. The gels were run in 2 Â Tris-borate– (TaqMans) was employed for genotyping according to the EDTA buffer at 41C for 3–6 h at 140 V. The DNA fragments principle reviewed by Livak et al.26 We used a PE Applied were visualized by silver staining (PlusOne DNA Silver Biosystems (Foster City, CA) ABI Prisms7700 Sequence Staining Kit, Amersham). The PCR products were purified Detector. Reagents and optical 96-well plates used in the using PCR purification kit (Qiagen) and sequence analysed assay were purchased from PE Applied Biosystems. using Big Dye Terminator Kit v2 (Applied Biosystem) and an The design of primers and probes was performed using ABI Prism 377 DNA sequencer. Perkin ElmersPrimer Expresst Software Primers, and probes

Table 4 Primers used for PCR-SSCP analysis of the CYP7B1 gene

Amplified region Primer sequence (50–30) Size of amplified Annealing temp (1C) fragment (bp)

Promoter (À194)À39a Forward: ctcccgtccaactaagaagcg Reverse: gctgaatgacaaaagttcgtg 240 55 Exon 1/promoter Forward: ctcccgtccaactaagaagcg Reverse: gtcagaacttgctgcggggta 640 50 Exon 2 Forward: gagacccggtgagcctccat Reverse: accaagaagaactgtgaaag 140 60 Exon 3a Forward: gaaagtacataacatttatc Reverse: tttccatatatagttgtaaa 337 53 Exon 3b Forward: gaactgtatccattctgcag Reverse: ctcctatttcaaggtcctcg 315 53 Exon 4 Forward: cacatcatttaggctttctct Reverse: agattaggctgtccaattgtt 200 55 Exon 5 Forward: aaagcagcatttttgaagct Reverse: tctggagcttcaaagatttcagg 180 55 Exon 6 Forward: gagtttagatatgatcgttt Reverse: tttctttccttttagcttct 305 55 aAF127089.

The Pharmacogenomics Journal C–G polymorphism in CYP7B1 promoter J Jakobsson et al 249

were synthesized by Applied Biosystems UK and constructed b-galactosidase activity were determined according to the as follows: manufacturer’s description (Promega). b-Galactosidase va- lues were corrected for endogenous cellular galactosidase Primer forward: GGGCTGGTTCTTGGGAAATC activity. Primer reverse: TCCCGGGCAGGAAGAAG Probe 1 TCTAACCCCTTcCTTGG Probe 2 CTAACCCCTTgCTTGG ACKNOWLEDGEMENTS The Taqmans MGB probe 1 was labelled in the 50end with This work was supported by grants from the Swedish Cancer Society, the World Anti-Doping Agency (WADA) and the Swedish Founda- fluorescent dye 6-FAM and the Taqmans MGB probe 2 with tion for Strategic Research. Professor Ralf Morgenstern, Institute of fluorescent dye VIC. The reactions were prepared in a 96- Environmental Medicine, Karolinska Institute kindly provided s well format using a TaqMan Universal Master Mix, 5 ng HepG2 cells and Dr Mary Hunt, Department of Clinical Chemistry, genomic DNA, 0.45 mM of each primer and 0.075 mM of each Karolinska Institute kindly provided HEK293 cells. probe. The thermal cycling started with 2 min at 501C, followed by 951C for 10 min and finally 37 cycles were taken through 951C for 15 s and 601C for 1 min. REFERENCES The data from the ABI Prisms 7700 Sequence Detector 1 Risbridger G, Wang H, Young P, Kurita T, Wang YZ, Lubahn D et al. Evidence that epithelial and mesenchymal estrogen receptor-alpha were plotted in a graph in which the outcome and quality of mediates effects of estrogen on prostatic epithelium. Dev Biol 2001; the allelic discrimination, was assessed. Nontemplate con- 229: 432–442. trols were used for detection of DNA contamination, but no 2 Weihua Z, Makela S, Andersson LC, Salmi S, Saji S, Webster JI et al. A such contamination was detected during the investigation. role for estrogen receptor beta in the regulation of growth of the ventral 2 prostate. Proc Natl Acad Sci USA 2001; 98: 6330–6335. Genotype and allele associations were assessed with w 3 Weihua Z, Lathe R, Warner M, Gustafsson JA. An endocrine pathway in test, binary and nominally logistic regression using Mini- the prostate, ERbeta, AR, 5alpha-androstane-3beta,17beta-diol, and tabs statistical software package (version 12.1, Minitab Inc., CYP7B1, regulates prostate growth. Proc Natl Acad Sci USA 2002; 99: USA). 13589–13594. 4 Chang BL, Zheng SL, Hawkins GA, Isaacs SD, Wiley KE, Turner A et al. Joint effect of HSD3B1 and HSD3B2 genes is associated with hereditary Cell Culture and sporadic prostate cancer susceptibility. Cancer Res 2002; 62: HepG2 cells were cultured in MEM, 10% heat-inactivated 1784–1789. fetal calf serum, nonessential amino acids and 1 mM sodium 5 Devgan SA, Henderson BE, Yu MC, Shi CY, Pike MC, Ross RK et al. Genetic variation of 3 beta-hydroxysteroid dehydrogenase type II in pyruvate. Hek293 cells were cultured in MEM, 5% fetal three racial/ethnic groups: implications for prostate cancer risk. Prostate bovine serum and 1 mM sodium pyruvate. All culture media 1997; 33: 9–12. and their ingredients were obtained from Invitrogen. 6 Chiang JYL. Regulation of bile acid synthesis. Front Biosci 1998; 3: D176–93. 7 Martin KO, Budai K, Javitt N. B, Cholesterol and 27-hydroxycholesterol Gene Reporter Constructs 7 alpha-hydroxylation: evidence for two different enzymes. J Lipid Res Two CYP7B promoter-containing plasmids were constructed 1993; 34: 581–588. by PCR amplification using human genomic DNA as 8 Schwarz M, Lund EG, Setchell KD, Kayden HJ, Zerwekh JE, Bjorkhem I et template with the forward and reverse promoter primers al. Disruption of cholesterol 7alpha-hydroxylase gene in mice. II. Bile acid deficiency is overcome by induction of oxysterol 7alpha-hydro- (Table 4), a region known to include the cis-acting elements xylase. J Biol Chem 1996; 271: 18024–18031. required for the basal expression.11 The PCR reactions were 9 Wu Z, Martin KO, Javitt NB, Chiang JY. Structure and functions of carried out using the same conditions as described above. human oxysterol 7alpha-hydroxylase cDNAs and gene CYP7B1. J Lipid The 233 bp products were then subcloned into a pCR2.1 Res 1999; 40: 2195–2203. 10 Setchell KD, Schwarz M, O’Connell NC, Lund EG, Davis DL, Lathe R et vector (Invitrogen), cleaved with KpnI and XhoI, gel purified al. Identification of a new inborn error in bile acid synthesis: mutation of (Qiagen) and subcloned into KpnI/XhoI sites of pGL3- the oxysterol 7alpha-hydroxylase gene causes severe neonatal liver Enhancer Luciferase vector (Promega), resulting in the disease. J Clin Invest 1998; 102: 1690–1703. constructs pGL3C and pGL3G, respectively. The sequences 11 Wu Z, Chiang JY. Transcriptional regulation of human oxysterol 7 alpha-hydroxylase gene (CYP7B1) by Sp1. Gene 2001; 272: were verified by sequence analysis as described above. 191–197. Plasmids were purified using the Qiagen Endotoxin Free 12 Quandt K, Frech K, Karas H, Wingender E, Werner T. MatInd and kit. Plasmids used were from different purifications in order MatInspector: new fast and versatile tools for detection of consensus to exclude differences in plasmid quality. matches in nucleotide sequence data. Nucleic Acids Res 1995; 23: 4878–4884. 13 Kurioka H, Kishi H, Isshiki H, Tagoh H, Mori K, Kitagawa T et al. Isolation Transfection Assay and characterization of a TATA-less promoter for the human RAG-1 Cells were plated in 35 mm six-well plates at a density of gene. Mol Immunol 1996; 33: 1059–1066. 2 Â 105 cells/well and incubated overnight. HepG2 and 14 Ramji DP, Foka P. CCAAT/enhancer-binding proteins: structure, function and regulation. Biochem J 2002; 365(Part 3): 561–575. Hek293 cells were transfected using 20 ml Transfectin 15 Tetlow N, Liu D, Board P. Polymorphism of human Alpha class (Invitrogen), 5 mg of pGL3-enhancer plasmid and 5 mgof glutathione transferases. Pharmacogenetics 2001; 11: 609–617. b-galactosidase vector (Promega). The cells were incubated 16 Brown AJ, Jessup W. Oxysterols and atherosclerosis. Atherosclerosis in serum-free media at 371C for 3–5 h. The transfection 1999; 142: 1–28. 17 Cheon J, Kim CS, Lee ES, Hong SJ, Cho YH, Shin EC et al. Survey of solution was then replaced with fresh media containing incidence of urological cancer in South Korea: a 15-year summary. Int J serum. Cells were harvested 48 h later and luciferase and Urol 2002; 9: 445–454.

www.nature.com/tpj C–G polymorphism in CYP7B1 promoter J Jakobsson et al 250

18 Hsing AW, Reichardt JK, Stanczyk FZ. Hormones and prostate 22 Wadelius M, Andersson AO, Johansson JE, Wadelius C, Rane E. Prostate cancer: current perspectives and future directions. Prostate 2002; 52: cancer associated with CYP17 genotype. Pharmacogenetics 1999; 9: 213–235. 635–639. 19 Board PG, Chelvanayagam G, Jermiin LS, Tetlow N, Tzeng HF, Anders 23 Wadelius M, Autrup JL, Stubbins MJ, Andersson SO, Johansson JE, MW et al. Identification of novel glutathione transferases and Wadelius C et al. Polymorphisms in NAT2, CYP2D6, CYP2C19 and polymorphic variants by expressed sequence tag database analysis. GSTP1 and their association with prostate cancer. Pharmacogenetics Drug Metab Dispos 2001; 29(Part 2): 544–547. 1999; 9: 333–340. 20 Forsberg L, de Faire U, Morgenstern R. Low yield of polymorphisms 24 Roh HK, Dahl ML, Johansson I, Ingelman-Sundberg M, Cha YN, L. from EST blast searching: analysis of genes related to oxidative stress Debrisoquine and S-mephenytoin hydroxylation phenotypes and and verification of the P197L polymorphism in GPX1. Hum Mutat 1999; genotypes in a Korean population. Pharmacogenetics 1996; 6: 441–447. 13: 294–300. 25 Roh HK, Dahl ML, Tybring G, Yamada H, Cha YN, Bertilsson L. CYP2C19 21 Soderstrom T, Wadelius M, Andersson SO, Johansson JE, genotype and phenotype determined by omeprazole in a Korean Johansson S, Granath F et al. 5alpha-reductase 2 polymorphisms population. Pharmacogenetics 1996; 6: 547–551. as risk factors in prostate cancer. Pharmacogenetics 2002; 12: 26 Livak KJ. Allelic discrimination using fluorogenic probes and the 50 307–312. nuclease assay. Genet Anal 1999; 14: 143–149.

The Pharmacogenomics Journal