Multiple Imprinted and Stemness Genes Provide a Link Between Normal and Tumor Progenitor Cells of the Developing Human Kidney

Research Article

Multiple Imprinted and Stemness Genes Provide a Link between Normal and Tumor Progenitor Cells of the Developing Human Kidney

Benjamin Dekel,1 Sally Metsuyanim,1 Kai M. Schmidt-Ott,5 Edi Fridman,2 Jasmin Jacob-Hirsch,3 Amos Simon,3 Jehonathan Pinthus,4 Yoram Mor,4 Jonathan Barasch,5 Ninette Amariglio,3 Yair Reisner,6 Naftali Kaminski,7 and Gideon Rechavi3

Departments of 1Pediatrics, 2Pathology, 3Pediatric Hemato-Oncology, and 4Urology, Chaim Sheba Medical Center, Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv, Israel; 5Department of Medicine, Columbia University College of Physicians and Surgeons, New York, New York; 6Department of Immunology, Weizmann Institute of Science, Rehovot, Israel; and 7Simmons Center for Interstitial Lung Disease, University of Pittsburgh Medical Center, Pittsburgh, Pennsylvania

Abstract Introduction Wilms’ tumor (WT), the embryonic kidney malignancy, is Metanephroi are the primordia of adult mammalian kidneys (1). suggested to evolve from a progenitor cell population of The metanephric blastema contains multipotential precursors uninduced metanephric blastema, which typically gives rise that give rise to all cell types of the nephron (2). Errors in to nephrons. However, apart from blastema, WT specimens nephrogenesis that lead to human disease are common (1). They frequently contain cells that have differentiated into renal include congenital abnormalities (e.g., renal dysplasia) and cancer. tubular or stromal phenotypes, complicating their analysis. Wilms’ tumor (WT) or nephroblastoma is a pediatric kidney cancer We aimed to define tumor-progenitor genes that function believed to arise from multipotent embryonic renal precursors of in normal kidney development using WT xenografts (WISH- the metanephric blastema (3), which fail to terminally differentiate WT), in which the blastema accumulates with serial pas- into epithelium and continue to proliferate, thus forming blastemal sages at the expense of differentiated cells. Herein, we did elements in the tumor. Nevertheless, WTs contain structures at transcriptional profiling using oligonucleotide microarrays different stages of maturation that mimic those present in the of WISH-WT, WT source, human fetal and adult kidneys, nephrogenic zone of the growing fetal kidney (tubular epithelia and and primary and metastatic renal cell carcinoma. Among stromal elements in addition to uninduced blastema), and also the most significantly up-regulated genes in WISH-WT, other mesoderm elements (rhabdomyoblats, cartilage), suggesting we identified a surprising number of paternally expressed that blastemal cells have differentiated at least in part (3). Derived genes (PEG1/MEST, PEG3, PEG5/NNAT, PEG10, IGF2,and from primitive embryonic tissue and being strongly associated with DLK1), as well as Meis homeobox genes [myeloid ecotropic various congenital syndromes, WT is an attractive model to study viral integration site 1 homologue 1 (MEIS1) and MEIS2], which developmental pathways leading to cancer. In fact, WT had already suppress cell differentiation and maintain self-renewal. A provided significant information regarding the genetic and comparison between independent WISH-WT and WT sam- epigenetic events leading to the development of cancer in general ples by real-time PCR showed most of these genes to be (4–7). Global gene profiling during kidney development has highly overexpressed in the xenografts. Concomitantly, provided novel insights into the genetic program that control they were significantly induced in human fetal kidneys, murine and human nephrogenesis (8–11). Furthermore, molecular strictly developmentally regulated throughout mouse nephro- signatures of normal human kidney development set a reference genesis and overexpressed in the normal rat metanephric for abnormal one (12). Accordingly, we could also show that the blastema. Furthermore, in vitro differentiation of the unin- overall gene expression profile of a WT specimen was most similar duced blastema leads to rapid down-regulation of PEG3, to that observed for an 8-week human gestation kidney (11). DLK1,andMEIS1. Interestingly, ischemic/reperfusion in- Li et al. (13) have recently done more detailed experiments jury to adult mouse kidneys reinduced the expression of involving gene expression profiling in WT. They identified 357 PEG3, PEG10, DLK1, and MEIS1, hence simulating embryo- genes as differentially expressed between favorable histology WTs genesis. Thus, multiple imprinted and stemness genes that and fetal kidneys (16-22 weeks of gestation). To determine stage- function to expand the renal progenitor cell population specific expression of these genes, they compared their data set may lead to evolution and maintenance of WT. (Cancer Res to that previously obtained for normal rat nephrogenesis (8). One 2006; 66(12): 6040-9) hundred twenty-four matches to genes on the microarray used by Stuart et al. (8) were found. Mapping between the two data sets showed that WTs systematically overexpressed genes corres- ponding to the earliest stage of metanephric development. Never- theless, profiling gene expression in whole heterogeneous tissues, Note: Supplementary data for this article are available at Cancer Research Online such as WT, is complicated by mixed populations of cells and is (http://cancerres.aacrjournals.org/). Requests for reprints: Benjamin Dekel, Laboratory for Developmental and therefore less powerful for discovering genes involved in specific Regenerative Nephrology, Department of Pediatrics, Safra Children’s Hospital, Sheba developmental processes. In addition, it is becoming clear that Medical Center, 52621 Tel Hashomer, Israel. Phone: 972-3-5302517; Fax: 972-3-5305787; many, if not most, malignancies arise from a rare population of E-mail: [email protected]. I2006 American Association for Cancer Research. cells that exclusively maintain the ability to self-renew and sustain doi:10.1158/0008-5472.CAN-05-4528 the tumor via the expression of tumor-progenitor genes (14, 15).

Cancer Res 2006; 66: (12). June 15, 2006 6040 www.aacrjournals.org

Moreover, these ‘‘cancer stem cells’’ are often biologically distinct Ischemia/reflow experiments. For unilateral ischemia/reflow, a flank from the bulk of differentiated cancer cells that characterize the incision was made and the left renal pedicle was clamped for 40 minutes disease. In that regard, the analysis of WT xenografts established using a vascular clamp (Fine Science Tools, Inc., Foster City, CA). The and propagated in immunodeficient mice, which pressure for meta- abdomen was covered with gauze moistened in PBS, and the mice were j nephric blastemal maintenance/proliferation and the disappearance maintained at 37 C using a warming pad. After 40 minutes, the clamp was removed and reperfusion was confirmed visually. To determine the extent of of differentiated tubular and stromal structures, is advantageous. acute injury, control mice were sacrificed 24 hours after ischemia/reflow, The selection of a more homogenous subset of early metanephric and kidneys were collected and processed for histology using H&E and cancer cells is of paramount importance as these are the cellular sirius red staining. characteristics that might be clinically linked to morbidity. RNA isolation. Total RNA from human and mouse samples was isolated Here, we present molecular analysis of these authentic WT xeno- from each sample using TRIZOL (Life Technologies, Invitrogen, Carlsbad, grafts, concomitant with fetal and adult kidneys, and renal cell carcino- CA).8 Total RNA from rat metanephric mesenchymes was extracted using ma. By comparing the gene expression profiles and analyzing models RNeasy mini kit (Qiagen, Valencia, CA) with on-column DNase digestion of murine kidney development and regeneration, we have identified according to the instructions of the manufacturer. An Agilent Bioanalyzer multiple imprinted and stemness-related genes that participate in early was used to confirm RNA integrity. nephrogenesis and also signify maintenance and expansion of WT Microarray analysis. Malignant adult and fetal kidney specimens were obtained from kidneys removed for stage I clear cell carcinoma or WT. blastema. Thus, epigenetic changes, which regulate imprinted genes, Adult kidney specimens were obtained from the normal kidneys removed may serve as a driving force for the human renal progenitor cell for stage I clear cell carcinoma. Metastatic renal cell carcinoma was population affecting both organogenesis and tumorigenesis. obtained from surgical remnants of biopsies. Fetal kidney tissue was obtained following curettage. Studies with human embryonic kidney tissue were approved by the Helsinki Ethical Committee. Total RNA was extracted Materials and Methods and used as a template to generate double-stranded cDNA and biotin- Animals and surgical procedures. Severe combined immunodeficient labeled cRNA, as recommended by the manufacturer of the arrays and as (SCID) (c.b-17/Icr beige or nonobese diabetic), nude (BALB/c nu/nu), and previously described (17). Hybridization to a Genechip Human Genome C57BL/6 mouse strains were obtained from the Weizmann Institute Animal HU95A oligonucleotide arrays containing 9,632 probe sets was done Breeding Center (Rehovot, Israel). Animals used were 6- to 10-week-old. as described in the Affymetrix human_datasheet.pdf 9 (Affymetrix, Santa In all the surgical procedures, mice were anesthetized with i.p. injections Clara, CA).10 Data files were imported into a microarray database and then of 100 mg/kg ketamine and 10 mg/kg xylazine. median scaled. Based on our previous experience, all expression levels <0.01 Establishment of WT xenografts. WT xenografts were established from were brought to 0.01. For statistical and cluster analysis, we used the WT stage I with favorable histology. The original surgical samples were Cluster, Gene Cluster, Treeview programs, and Scoregene gene expression placed on ice, minced into 3 to 5 mm pieces, and implanted s.c. into SCID package.11 A detailed description of the scoring methods and our approach mice. After an initial latency period of 2 months, tumor growth was noted in to analysis of microarray data have been published (17). Genes were 90% of the mice. Thereafter, the tumor was serially passaged s.c. with classified into functional groups using Go Annotation tools (DAVID: Matrigel (Becton Dickinson, Bedford, MA) as minced tumor pieces or by Database for Annotation, Visualization, and Integrated Discovery).12 direct injection of single cell suspension. Overrepresentation calculations were done using Ease (17). Functional Maintenance of WT xenografts. The xenografts were maintained by classifications with an Ease score <0.05 were marked as overrepresented. serial passages in SCID and nude mice by harvesting the tumors under The complete set of gene array data can be found online.13 sterile conditions and placing them immediately in cooled HBSS (Sigma- Quantitative reverse transcription-PCR. cDNA was synthesized using Aldrich Co., Ltd., St. Louis, MO). Tumor cells were dissociated under sterile Omniscript Reverse Transcriptase (Qiagen) on total RNA. Real-time PCR of conditions, first by mincing the tissue with scissors to small fragments and human and mouse samples was done using an ABI7900HT sequence then by gentle mechanical homogenization through a stainless steel mesh. detection system (Perkin-Elmer/Applied Biosystems, Foster City, CA) in the Viable cells were separated from debris by layering over Ficoll-Paque 400 presence of SYBR green (SYBR green PCR kit; Qiagen, Hilden, Germany). This (Pharmacia Biotech AB, Uppsala, Sweden) and centrifugation at 500 Â g for fluorochrome incorporates stoichiometrically into the amplification prod- 20 minutes. Viable cells at the interface were collected, counted, and uct, providing real-time quantification of double-stranded DNA PCR resuspended in cooled HBSS in a concentration of 2 Â 107/mL. For product. Primers were designed to amplify an 80 to 120 bp fragment with orthotopic implantation, 100 AL tumor cell suspension (2 Â 106 cells) were 50jCto65jC annealing temperature (Supplementary Table S1). The relative directly injected into several spots of the mouse kidney using a 27-gauge initial amount of mRNA of a particular gene was extrapolated from a needle. The musculature layer of the abdominal wall and the skin were standard curve. For standard curve determination, we used a pool of all the separately closed with 4-0 absorbable Vycril sutures. Tumor growth was samples, serially diluted in four log2 steps and run in parallel to the samples. determined by caliper measurements of length, width, and depth, and the The total volume of each reaction was 20 AL, containing 300 nmol/L of each tumor volume (mm3) was approximated using the formula length Â width forward and reverse primer and 125 ng cDNA. Appropriate negative controls Â depth Â 05236 (16). Doubling time of the tumor growth was calculated were run for each reaction. All of the reactions were done in triplicate. during the logarithmic growth of s.c. growing tumors. Optimization of the real-time PCR reaction was done according to the Dissection of rat metanephric mesenchymes. Metanephric mesen- instructions of the manufacturer. For each analysis, transcription of the gene chymes were dissected from E13.5 rats after trypsinization and mechanical of interest was compared with transcription of the housekeeping gene disruption of embryonic kidneys using minutien pins. Cross-contamination b-actin, whose level of expression was not changed significantly according to between ureteric buds and metanephric mesenchymes was ruled out the microarray data (data not shown) and which was amplified in parallel. by visual inspection and staining with dolichos bifloris lectin, which The real-time PCR reaction for rat samples contained iQ SYBR green selectively stains the ureteric bud at this stage (10). For organ culture, rat super mix (Bio-Rad, Hercules, CA), 200 nmol/L of each primer, and 0.2 AL metanephric mesenchymes were placed on filters (Corning Transwell, Corning, NY; collagen coated, 0.4-Am pore size) and grown in DMEM/F12 with insulin (5 Ag/mL), transferrin (5 Ag/mL), selenium (5 ng/mL), 8 http://www.invitrogen.com. A A 9 http://www.affymetrix.com/support/technical/datasheets/human_datasheet.pdf. dexamethasone (5 g/mL), prostaglandin (5 g/mL), T3 (5 ng/mL; Sigma), 10 fibroblast growth factor-2 (FGF-2, 3 nmol/L), transforming growth factor-a http://www.affymetrix.com/index.affx. 11 http://www.cs.huji.ac.il/labs/compbio/scoregenes. (TGF-a, 3 nmol/L), and leukemia inhibitory factor (LIF; 50 ng/mL; all 12 http://apps1.niaid.nih.gov/David/upload.asp. cytokines from R&D Systems, Minneapolis, MN). 13 http://eng.sheba.co.il/genomics. www.aacrjournals.org 6041 Cancer Res 2006; 66: (12). June 15, 2006

Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2006 American Association for Cancer Research. Cancer Research template in a 25 AL reaction volume. The following primers were used after Cruz Biotechnology, Santa Cruz, CA) and Cy2- or Cy3-labeled secondary exclusion of primer dimer formation and nonspecific amplicons for each antibodies (Jackson ImmunoResearch, West Grove, PA). Confocal images primer set. Rat E-cadherin (Cdh1; Genbank accession no. NM_031334): were obtained using a Zeiss LSM 510 META scanning confocal microscope sense, ACAACGCTCCCATCTTCAAC; antisense, TGTGGAAGGGACAAGA- (Zeiss, Thornwood, NY). GACC. Rat DLK1 (Genbank accession no. NM_053744): sense, GCAGTGT- Immunohistochemistry. Tissue microarray multi–tissue block was GTCTGCAAGGAAG; antisense, ATCGTTCTCGCATGGGTTAG. Rat Meis1 prepared as previously described (18). The tissue microarray block (Genbank accession no. XM_223643): sense, ACCAACCTCAAGCCATTCAC; contained in addition to WT xenografts and primary WT, samples of antisense, GTCCACTCATTGTCGGGTCT. Rat Peg3 (Genbank accession no. normal human lung, liver, renal cortex, and renal medulla tissues used as XM_218226): sense, ACGTTGAAGAGCCAGAAGGA; antisense, GAGAGGCG- internal positive and negative controls. Primary and xenografted WT GTCATTGAAGAG. Rat h-actin (Genbank accession no. BC063166.1): sense, samples were also embedded in separate paraffin blocks. All primary WT CTAAGGCCAACCGTGAAAAG; antisense, TCTCAGCTGTGGTGGTGAAG. tumor samples were triphasic, including tubular, blastemal, and stromal Specific fragments were verified by sequencing. Amplification was carried components, which were present in different proportions. Sections, 4-Am out using the MyiQ Single-Color Real-time PCR Detection System (Bio-Rad) thick, were cut from whole and tissue microarray blocks for with incubation times of 2 minutes at 95jC, followed by 50 cycles of immunohistochemistry and pro cessed within 1 week to avoid oxidation 95jC/30 seconds and 60jC/30 seconds. Specificity of the amplification was of antigens. Before immunostaining, sections were treated with buffer checked by melting curve analysis and agarose gel electrophoresis. Relative citrate (pH 6.0) in a microwave oven for antigen retrieval. The slides levels of mRNA expression were calculated according to the DDCT method. were subsequently stained by an automated immunostainer (NexES, Individual expression values were normalized by comparison to h-actin Ventana, Tuscon, AZ) using an avidin-biotin complex staining procedure. mRNA expression. To estimate the statistical significance of the results, Anti-KI-67, CD34, vimentin, and P53 mouse mono clonal antibodies one-way ANOVA followed by Dunnett’s test was used. (Zymed Laboratories, Inc., San Francisco, CA), at a dilution of 1:50, were Immunofluorescence. Whole-mount metanephric mesenchymes were used. Controls were prepared by omitting the primary antibodies or by stained with antibodies to E-cadherin (R&D Systems) and WT-1 (Santa substituting the primary antibodies with goat IgG isotype.

Figure 1. Characterization of WISH-WT. A, WITH-WT WT xenograft growth curve. Ten male nonobese diabetic/SCID mice were injected s.c. with 5 Â 106 WITH-WT1 cells together with Matrigel (v/v, 1:1). Weekly measurements of tumor volume were done. Points, mean; bars, SE. B, orthotopic growth of WITH-WT xenograft with in the right kidney. Note the metastatic retroperitoneal lymph node. C, histology (H&E staining) of WT source (top) and WISH-WT (bottom) showing in low magnification (original magnification, Â40) the triphasic structure comprising blastema with renal epithelial elements separated by stromal component (left, top), and in higher magnification (original magnification, Â400) the appearance of renal epithelial elements even in areas where the blastemal components are predominant (right, top, arrows). In contrast, WISH-WT shows a blastemal phenotype with major loss of differentiated elements (left and middle, bottom; original magnifications, Â40 and Â400, respectively). Rosette-like structures found within the blastema (arrows) represent partial differentiation (right, bottom, arrowheads; original magnification, Â400).

Cancer Res 2006; 66: (12). June 15, 2006 6042 www.aacrjournals.org

Figure 2. Immunostaining of WISH-WT. Tissue microarray (TMA) of WISH-WT, primary tumor predominantly tubular area, and primary tumor predominantly blastemal area was immunostained for KI-67, CD34, vimentin, and P53 (A-D, respectively; top, original magnification, Â100; bottom, original magnification, Â400). Note the increased expression of all markers in WISH-WT even when compared with primary tumor predominantly blastemal area. E, immunostaining for KI-67 in the entire block of xenograft after taking the tissue microarray cores ($), holes; original magnifications, Â20 and Â40, respectively. Note the diffuse KI-67 staining.

Results separate mice and derived from passages 3 (WISH-WT3) and Xenograft characterization. WITH-WT originates from a 5 (WISH-WT5) of the xenografts, five human fetal kidney tissues donor representing the common variant of WT with favorable (12-18 gestational weeks) and six adult kidney tissues, and six histology and typical clinical behavior. WITH-WT has rapid growth primary and two metastatic renal cell carcinomas. We subjected rate with a doubling time of 3.5 days (Fig. 1A). Not infrequently, the expression profiles of all samples to a hierarchical clustering metastasis can be detected in the retroperitoneal lymph nodes analysis to investigate similarities among them (17). Unsupervised and in the liver following orthotopic implantation to the mouse hierarchical clustering of 9,362 valid genes done for all samples kidney (Fig. 1B). The histologic features of fifth-generation clearly distinguished embryonic-derived tissues ( fetal kidney, xenografts show blastemal expansion and major loss of differenti- WISH-WT0,3,5) from adult-derived tissues (adult kidney, and ated tubular and stromal structures in comparison with original WT primary and metastatic renal cell carcinoma) with close similar- donor and other primary favorable histology WTs (Fig. 1C). More- ities of all WISH-WT samples and fetal kidney tissues (Fig. 3). In over, immunohistochemistry of a tissue array, which included WISH- addition, cluster analysis of gene expression profiles showed WTand primary WTand control sections, showed overexpression of embryonic and adult renal tumors (WISH-WT0,3,5, and primary the cell proliferation marker KI-67, the stem cell marker CD34, and metastatic renal cell carcinoma) to be more similar than vimentin, and P53 in WISH-WT, indicating dedifferentiation in situ normal kidney tissues (fetal and adult), especially WISH-WT5 and and a more aggressive disease phenotype (Fig. 2; refs. 19, 20). metastatic renal cell carcinoma, suggesting universal nonspecific Microarray analysis and hierarchical clustering. Gene markers for advanced cancer. Data set containing expression levels expression profiles were determined in a sample of the WT donor of all genes and comparisons among the groups can be found 13 tissue (WISH-WT0), six WISH-WT tumor samples obtained from online. The microarray expression profile of all WISH-WT www.aacrjournals.org 6043 Cancer Res 2006; 66: (12). June 15, 2006

Figure 3. Microarray analysis of normal and malignant embryonic and adult renal tissues. A, unsupervised hierarchical clustering of 9,379 valid genes distinguishes embryonic tissues (fetal kidney tissues, WT source, and WISH-WT) from adult tissues (adult kidney tissues, primary and metastatic renal cell carcinoma) and tumors (primary and metastatic renal cell carcinoma, WT source, and WISH-WT) from normal tissues (adult and fetal). B, significantly overexpressed genes (P < 0.01, >2.0-fold ratio) in WISH-WT versus renal cell carcinoma (RCC), and renal cell carcinoma versus WISH-WT were classified into functional groups using Go Annotation tools (DAVID: Database for Annotation, Visualization, and Integrated Discovery; http://apps1.niaid.nih.gov/David/ upload.asp). Pie diagrams illustrating the percentage of various functional groups in WISH-WT versus renal cell carcinoma (left) and renal cell carcinoma versus WISH-WT (right).

samples (including WT0) was examined by comparison with all cell character with MEIS1 (26), was also significantly elevated in renal cell carcinoma samples. This way, the ‘‘universal’’ cancer WISH-WT (expression fold, 2.8). markers were excluded, whereas active developmental pathways Paternally expressed genes and MEIS1 are overexpressed in were determined. In addition, microarray experiments and data WISH-WT compared with favorable histology WT. The obser- analysis were extremely robust when all embryonic and adult vation that IGF2, DLK1, PEG1/MEST, PEG3, PEG5/NNAT, PEG10, tumor samples were included in single groups. A total of 779 genes and MEIS1 are all highly overexpressed in the embryonic versus were found to be differentially expressed (P < 0.01, >2.0-fold ratio), adult renal cancer microarrays lead us to examine whether these with 279 genes significantly overexpressed in WISH-WT and 500 genes are associated with progression of WT. We therefore genes down-regulated. Functional annotation of the differentially analyzed transcript levels of selected genes in independent samples expressed genes according to DAVID, database for annotation, of favorable histology WT and WISH-WT5 (three samples of each) revealed that although most of those overexpressed in WISH-WT using real-time PCR (list of primer sets are summarized in Materials function in cell cycle, DNA-dependent transcription, and regulation and Methods). Quantitative reverse transcription-PCR (qRT-PCR) of transcription (49.4% of the genes), renal cell carcinoma shows a showed that IGF2, DLK1, PEG1, PEG3, PEG10, and MEIS1 mRNA predominance of defense response, inflammatory, and immune levels were all significantly elevated in WISH-WT5 compared with response genes (38.3%), with a decreased proportion of regulatory favorable histology WT (Fig. 4A). We could not establish a reaction genes (17.5%; Fig. 3). As expected, WISH-WT overexpressed the for PEG5/NNAT as we might have had a poorly working primer nephrogenic patterning genes, PAX2, LIM1, EYA1, SIX1, SALL1, set or a splice variant in WT. Thus, positive selection of the meta- FOXC1, and WT1. In addition, we identified genes of the Wnt/h- nephric blastema and WT progression in vivo is accompanied by catenin signaling pathway (FZD2, FZD7, SFRP1, and CTNNBIP1), up-regulation of these genes. which has recently emerged as a critical regulator of self-renewal WISH-WT overexpressed genes are developmentally regu- signals of stem and cancer cells (21). These genes have been lated during mouse nephrogenesis. Having established that a thoroughly described in kidney development (22, 23). cluster of paternally expressed genes and MEIS1 are significantly Fifty genes that were the most significantly elevated in WISH-WT elevated in WISH-WT, we determined their expression in normal compared with renal cell carcinoma (average fold ratio >3) are nephrogenesis. A microarray comparison between human fetal listed in Table 1. Strikingly, six of the highest ranked elements are and adult kidney tissues showed 550 genes to be differentially classified as paternally expressed, maternally imprinted genes expressed (expression fold, >2.0) of which 260 genes were up- (IGF2, DLK1, PEG1/MEST, PEG3, PEG5/NNAT, and PEG10), where regulated in fetal kidney tissues. Similar to WISH-WT, functional only the paternal allele is activated, whereas the maternal one is annotation revealed that the most abundant gene categories are silenced by promoter hypermethylation (6). Of these genes, only related to cell cycle and regulation of transcription. IGF2, DLK1, NNAT and IGF2 have been previously implicated in WT PEG1/MEST, PEG3, PEG5/NNAT, PEG10, and MEIS1, were all signi- tumorigenesis (6, 13), where loss of imprinting of the IGF2 has ficantly elevated, suggesting a role in human nephrogenesis been described in 70% of WTs (24). Moreover, we identified (Supplementary Table S2). The fact that, for instance, HOXA9 was additional highly overexpressed genes yet to be described in WT not similarly overexpressed in fetal kidney tissues indicated that it is carcinogenesis. For instance, the Meis homeobox genes, myeloid not intrinsic to normal development but rather to WT progression. ecotropic viral integration site 1 homologue 1 (MEIS1) and MEIS2, Nevertheless, the microarray experiment did not include which encode for homeoproteins, are shown to be crucial for the temporal expression throughout nephrogenesis, which can better self-renewal of hematopoietic stem cells and the program of a define developmental expression. We approached this by analyzing cancer stem cell character as well as for the control of blastema quantitative gene expression in sequential samples of developing cells during vertebrate limb regeneration (25–27). Interestingly, mouse kidneys (E12,E13,E15,E19, 2 weeks, adult kidney). Here again, HOXA9, which has been shown to cooperatively maintain the stem we could not establish a qRT-PCR analysis for NNAT. The temporal

Cancer Res 2006; 66: (12). June 15, 2006 6044 www.aacrjournals.org

Table 1. WISH-WT compared with renal cell carcinoma (50 most significantly up-regulated genes separated into functional categories)

Gene name Symbol Accession no. Fold change Probe set ID

Cell adhesion KIAA0644 gene product KIAA0644 AB014544 3.39 34214_at Cell communication G protein-coupled receptor 39 GPR39 AI936826 5.19 38749_at Signal transducer and activator of transcription 4 STAT4 L78440 4.25 906_at Cell communication and development Frizzled homologue 2 (Drosophila) FZD2 L37882 4.06 36799_at,628_at Midkine (neurite growth-promoting factor 2) MDK M94250,X55110 4.20 38124_at,577_at Cell cycle* (2.98EÀ18) Cyclin B1 CCNB1 M25753 3.61 1945_at,34736_at Cyclin B2 CCNB2 AL080146 4.43 32263_at BUB1 budding uninhibited by benzimidazoles 1 BUB1B AF053306 3.76 35699_at homologue b (yeast) Kinesin family member 2C KIF2C U63743 3.76 36837_at Centromere protein F, 350/400 ka (mitosin) CENPF U30872 5.25 37302_at TPX2, microtubule-associated protein homologue TPX2 AB024704 4.44 39109_at (Xenopus laevis) Kinetochore associated 2 KNTC2 AF017790 3.55 40041_at Kinesin family member 11 KIF11 U37426 3.53 40726_at Growth arrest-specific1 GAS1 L13698 3.80 41839_at,661_at Cell cycle* (2.98EÀ18), development Pituitary tumor-transforming 1 PTTG1 AA203476 4.55 40412_at Cell growth and/or maintenance* (4.9EÀ6) v-Myc myelocytomatosis viral-related oncogene, MYCN Y00664 3.52 35158_at neuroblastoma derived (avian) High mobility group AT-hook 2 HMGA2 X92518 4.93 35200_at Thymosin, b, identified in neuroblastoma cells TMSNB D82345 4.65 36491_at ALL1-fused gene from chromosome 1q AF1Q U16954 3.84 36941_at Enhancer of zeste homologue 2 (Drosophila) EZH2 U61145 3.93 37305_at Cellular retinoic acid–binding protein 2 CRABP2 M97815 4.74 1057_at,41783_at Glypican 3 GPC3 U50410 5.15 39350_at Cell proliferation* (3.63EÀ17) Wilms’ tumor 1 WT1 X51630 5.24 1500_at Insulin-like growth factor 2 (somatomedin A) IGF2 J03242,M13970 4.27 1591_s_at,2079_s_at,36782_s_at Ubiquitin-conjugating enzyme E2C UBE2C U73379 4.49 1651_at Antigen identified by monoclonal antibody Ki-67 MKI67 X65550 3.48 419_at Development d-Like 1 homologue (Drosophila) DLK1 U15979 5.29 32648_at Frizzled homologue 7 (Drosophila) FZD7 AB017365 3.42 33222_at Eyes absent homologue 1 (Drosophila) EYA1 AJ000098 4.00 37073_at Neuronatin NNAT U31767 4.35 39051_at Metabolism WAS protein family, member 3 WASF3 S69790 3.81 1058_at Ubiquitin carboxyl-terminal esterase L1 UCHL1 X04741 3.82 36990_at (ubiquitin thiolesterase) Mesoderm specific transcript homologue (mouse) MEST D78611 4.56 37749_at Topoisomerase (DNA) II a 170 kDa TOP2A AI375913,J04088,L47276 3.57 1592_at,40145_at,904_s_at Collagen, type II, a1 (primary osteoarthritis, COL2A1 L10347 5.15 37605_at spondyloepiphyseal dysplasia, congenital) KIAA0101 gene product KIAA0101 D14657 4.01 38116_at Nucleobase, nucleoside, nucleotide, and nucleic acid metabolism* (3.438EÀ13) Forkhead box M1 FOXM1 U74612 3.49 34715_at Centromere protein A, 17 kDa CENPA U14518 3.74 527_at KIAA0186 gene product KIAA0186 D80008 3.54 39677_at Regulation of transcription* (0.00258) Homeobox D1 HOXD1 AW001001 3.57 33130_at

(Continued on the following page)

www.aacrjournals.org 6045 Cancer Res 2006; 66: (12). June 15, 2006

Table 1. WISH-WT compared with renal cell carcinoma (50 most significantly up-regulated genes separated into functional categories) (Cont’d)

Gene name Symbol Accession no. Fold change Probe set ID

Homeobox B5 HOXB5 M92299 3.58 34251_at Cbp/p300-interacting transactivator, with Glu/Asp-rich CITED1 U65092 4.51 35976_at carboxy-terminal domain, 1 Mesenchyme homeobox 1 MEOX1 U10492 4.21 36010_at Transducin-like enhancer of split 4 [E(sp1) homologue, TLE4 AF068197 3.56 38364_at Drosophila] Paternally expressed 3 PEG3 AB006625 3.36 39701_at MEIS1, myeloid ecotropic viral integration site 1 MEIS2 AF017418 3.68 41388_at homologue 2 (mouse) Unclassified HG2846-HT2983 3.41 1178_at MEIS1, myeloid ecotropic viral integration site 1 MEIS1 U85707 4.03 40763_at homologue (mouse) Preferentially expressed antigen in melanoma PRAME U65011 3.39 157_at Lamin B1 LMNB1 L37747 3.51 37985_at Paternally expressed 10 PEG10 AB028974 4.96 39696_at G protein-coupled receptor 64 GPR64 X81892 4.76 38853_at

*Overrepresentation calculations of functional categories were done using Ease (17). Functional classifications with an Ease score <0.05 were marked as overrepresented.

expression patterns of IGF2, DLK1, PEG1, PEG3, and PEG10 during during mouse kidney regeneration by real-time PCR. IGF2 was mouse nephrogenesis appear in Fig. 4B and show mostly discrete excluded from this analysis as its role in kidney repair has been peaks of expression in early and midgestation and rapid down- previously suggested (30). Mice were subjected to ischemia/ regulation in the neonatal (2 weeks) and adult kidneys (PEG3 mRNA reperfusion renal injury and total RNA was extracted from regene- is down-regulated only in the adult kidney), suggesting that they are rating kidney tissues at times ranging from 24 hours to 4 weeks strictly developmentally regulated. Unexpectedly, in contrast to the after ischemia. As shown in Fig. 4C, whereas levels of PEG1 mRNA chip data, MEIS1 was found only at very low levels (average CT f35), did not change significantly over this time course, DLK1, PEG3, and was therefore precluded from this analysis. These results PEG10, and MEIS1 transcript levels were all temporally induced with indicated that the imprinted genes are expressed during mouse significant elevation observed with time, especially at 2 and 4 weeks nephrogenesis in a developmentally regulated manner. following ischemia. Thus, an acute ischemic insult, which triggers Regulation of WISH-WT overexpressed genes during the kidney regeneration, can induce up-regulation of these metanephric differentiation of the rat metanephric mesenchyme. To further genes in the adult kidney, simulating early embryogenesis. suggest a role for the selected genes in normal nephrogenesis, we examined their expression levels in a recently published data set comparing genes in the rat metanephric mesenchyme and tips of Discussion ureteric buds (10). For PEG1/MEST and PEG10, there is no known rat Microarray experiments, which efficiently survey thousands of sequence to date and both genes could not be located on the genes, have opened new vistas for studying normal and abnormal microarray. Analysis of PEG3, PEG5/NNAT, DLK1, IGF2, and MEIS1 nephrogenesis (12). However, they must be supplemented and gene levels showed all to be overexpressed in the metanephric integrated with additional techniques and experimental models to mesenchyme with average expression ratios (metanephric mesen- reveal the roles of various genes in these processes. Here, we applied chyme/ureteric bud tip) of 3.1, 2.1, 5.6, 2.75, and 15.1, respectively. We a strategy based on the molecular global analysis of a progressive then studied their expression levels during in vitro differentiation WT xenograft, human fetal kidneys, and their counterparts—human of the rat metanephric mesenchyme. As shown in Fig. 5, DLK1, adult kidney and renal cell carcinoma. To our knowledge, this is MEIS1, and PEG3 were significantly down-regulated with differen- the first time that expression profiles of normal and malignant tiation of the metanephric blastema into tubular epithelia. Although, embryonic and adult human kidney tissues have been concomitantly similar to DLK1, IGF2 peaked at 24 hours after induction, the fold analyzed and catalogued. Given the intimate connection between changes thereafter were insignificant. We could not establish a WT and renal development (31), we hypothesized that novel genes reproducible qRT-PCR for rat PEG5/NNAT. Thus, most of the genes appearing as most significantly overexpressed in the WISH-WT analyzed are overexpressed in the undifferentiated metanephric versus renal cell carcinoma microarray data will be important in mesenchyme and silenced along its maturation. both renal embryonic tumorigenesis and normal organogenesis. Induction of WISH-WT overexpressed genes following A comparison between WISH-WT and fetal kidney tissues would ischemic kidney injury. Because developmental pathways can be highlight genes important in WT carcinogenesis, but not necessarily activated during tissue regeneration (28, 29), we sought to determine normal nephrogenesis [STAT4 and PRAME, the most significantly whether these genes, which are silent in the normal adult kidney, induced genes in WISH-WT versus fetal kidney tissues (Supplemen- participate in its repair. We therefore analyzed gene expression tary Table S3), were not elevated in the human fetal kidney tissue

Cancer Res 2006; 66: (12). June 15, 2006 6046 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2006 American Association for Cancer Research. Imprinted Genes in Wilms’ Tumor Xenografts data set]. Furthermore, because WISH-WT displays blastemal observed a surprising large number of paternally expressed genes accumulation and dedifferentiation compared with favorable (IGF2, DLK1, PEG1, PEG3, PEG5, and PEG10) in the highest-ranking histology WT, which contain cells that have matured into tubular gene list and, therefore, went on to examine this group. Although epithelia and stroma, such genes are anticipated to regulate several other significantly elevated genes that are not known to be progenitor abundance by suppressing differentiation and maintain- involved in kidney development or WT carcinogenesis could have ing self-renewal of the metanephric blastema. Accordingly, we been also chosen for further analysis (e.g., PTTG or MEOX1), new

Figure 4. A, qRT-PCR analysis of PEG1/ MEST, PEG3, PEG10, IGF2, DLK1, and MEIS1 mRNA levels in three independent samples of WISH-WT and favorable histology WT. Normalization was done against control h-actin expression. Columns, average; bars, SD. For all genes analyzed, WISH-WT versus WT, P < 0.01 (t test). B, qRT-PCR analysis of PEG1/ MEST, PEG3, PEG10, IGF2, and DLK1 mRNA levels in the developing mouse kidney. Representative examples of three independent experiments. Total RNA was isolated from pooled mouse embryonic kidney (E13,E14,E15, and E17), neonatal kidney (2 weeks), and adult kidney (n = 3-5 kidneys in each time point). C, temporal expression patterns of PEG1/MEST, PEG3, PEG10, DLK1, and MEIS1 mRNA following ischemia/ reperfusion (IR) injury to murine kidneys. Real-time PCR of kidneys at different time points after ischemia was done. Three kidneys were analyzed for each time point. Points, average; bars, SD. Significant induction of PEG3, PEG10, DLK1, and MEIS1 mRNA is noted with time, P < 0.01, time point 4 weeks compared with time point 24 hours.

www.aacrjournals.org 6047 Cancer Res 2006; 66: (12). June 15, 2006

Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2006 American Association for Cancer Research. Cancer Research discoveries in stem cell biology that show a putative role for MEIS1 in self-renewal of stem cells and in programming cancer stem cell character (25, 26) lead to us to concomitantly study this gene. Indeed, these genes were verified to be significantly elevated in progressive WT xenografts compared with FH-WT and were also overexpressed in developing versus mature human kidneys. To further address the question of biological relevance of these marker genes, we asked whether these mRNAs were differentially expressed in mouse and rat nephrogenesis. We could show that most of the genes (a) are expressed in a developmentally regulated manner during mouse kidney development (IGF2, DLK1, PEG1/ MEST, PEG3,andPEG10), (b) are overexpressed in the rat metanephric mesenchyme by comparison to the ureteric bud (IGF2, DLK1, PEG3, PEG5/NNAT, and MEIS1), and (c) are down- regulated with differentiation of the rat metanephric mesenchyme (DLK1, PEG3, and MEIS1), suggesting a role, at least for these genes, in the uninduced metanephric mesenchyme (PEG3 and MEIS1)or early stages of metanephric mesenchyme commitment (DLK1, peaking 24 hours after induction followed by rapid down- regulation). We could further show that these genes (DLK1, PEG3, MEIS1, and PEG10) can be reactivated in adulthood following the introduction of an ischemic insult to the kidney, which triggers a regenerative response. It is noteworthy that during human mesenchymal stem cell differentiation, DLK1 maintains the size of the progenitor cell pool by inhibiting the formation of mature osteoblasts and adipocytes (32). Moreover, expression of DLK1 in hematopoietic cells results in inhibition of differentiation and proliferation (33). In addition, expression of DLK1 has been shown to be critical for glioma cell survival and proliferation (34). PEG3 is a zinc finger gene previously identified in a screen to isolate muscle stem cell regulators that has been implicated in the myogenic and neuronal lineages (35). It has been more recently characterized as a mediator of the p53 signaling pathway and necessary for the p53 apoptotic response (36). PEG10 has been Figure 5. Regulation of imprinted genes during differentiation of metanephric shown to decrease the cell death mediated by SIAH1, a new member mesenchyme. Freshly dissected rat metanephric mesenchymes were grown in of the human Siah family that is induced in response to p53 (37). culture medium supplemented with FGF-2, TGF-a, and LIF. Bright-field images from differentiating mesenchymes after 2 days (A), 4 days (B), and 7 days (C) Thus, these observations suggest a role for these genes in in culture. D, immunofluorescence for E-cadherin (Cy2; green) after 7 days determining cell death versus survival in the metanephric blastema of culture reveals development of tubular epithelia. Mesenchymal and proximal and in maintaining multipotentiality of the cells (nonrenal lineages) nephron cells are positive for WT1 (Cy3; red). E, real-time RT-PCR using primers specific for E-cadherin (Cdh1), DLK1, MEIS1, and PEG3 on metanephric along with the nephric lineage genes. From a practical point of view, mesenchymes at baseline (0), and after 1, 2, 3, 4, 5, and 7 days of culture. multipotential progenitor cells of the metanephric blastema Whereas E-cadherin is significantly up-regulated, imprinted genes DLK1 and (normal and transformed) can be isolated on the basis of surface PEG3 as well as MEIS1 are down-regulated with differentiation. ANOVA is significant (P < 0.0005) for all four genes (n = 6). Dunnett’s multiple comparison cell antigen expression. For instance, NCAM (CD56), previously test reveals significant differences (P < 0.01) compared with time point 0 days (*) localized to the mouse metanephric condensates (38) and overex- or time point 1 day (#). pressed in both WISH-WT and fetal kidney tissues, is a potential marker. Similarly, DLK1 is a type I membrane protein and can cancer (40). We found that although BMI-1 was not differentially therefore be useful for the isolation of DLK (+) cells from both expressed in either the developing versus mature human kidneys progressive WISH-WT and early human fetal kidney tissues. (similar to HOXA9) nor in the embryonic versus adult kidney cancer, Interestingly, embryonic liver progenitors that give rise to hepato- there were high expression levels for BMI-1 in both WISH-WT and cytes and biliary epithelial cells have been isolated on the basis of renal cell carcinoma microarrays (data not shown). Thus, although DLK expression by magnetic beads (39). Although our goal was to clearly not specific to WT, BMI-1 can also contribute to the identify novel common pathways that would possibly characterize ‘‘cooperative differentiation arrest’’ of WT progenitors. both normal and transformed blastemal progenitor population, it is Genomic imprinting is parent-of-origin–specific allele silenc- clear that both of these cell types also differ. Accordingly, HOXA9, ing, or relative silencing of one parental allele compared with the which is significantly elevated in WISH-WT but not fetal kidney other parental allele (6). It is maintained, in part, by differentially tissues, can specifically join MEIS1, which is already induced in methylated regions within or near imprinted genes and is normally the normal blastema to establish a more complete differentiation reprogrammed in the germ line (6, 7). Loss of IGF2 imprinting in block in WT blastemal cells, as these transcription factors target the chromosome 11p15–imprinted gene cluster has been previously independent differentiation pathways (25). Recently, the BMI-1 implicated in the evolution of WT (6, 7, 24). Loss of IGF2 imprinting oncogene–driven gene expression pathway has been shown to be can arise in the germ line or very early in development in Beckwith- essential for the self-renewal of cells from multiple types of human Wiedemann syndrome, which causes prenatal overgrowth

Cancer Res 2006; 66: (12). June 15, 2006 6048 www.aacrjournals.org

(including nephromegaly—overgrowth of the whole kidney), birth methylation (41). In addition, loss of imprinting has been recently defects, and predisposition to various embryonal tumors of shown to be much more common in sporadic WTs, from which childhood, including WT. Here, loss of imprinting and a double WISH-WT was established compared with WTs from syndromic dose of IGF2 expression affect each and every renal embryonic cases (Denys-Drash and WT-aniridia syndromes; ref. 42). Overall, cell, leading to proliferation and kidney growth, and with the our findings in WT support the recently proposed epigenetic advent of a second genetic hit to multiple WTs (6). In addition, progenitor model of human cancer (7), where nonneoplastic but loss of imprinting has been shown to arise sporadically as a epigenetically disrupted stem/progenitor cells are suggested as a somatic mosaic epigenetic alteration in some kidney cells. fundamentally common basis for malignancy. Accordingly, it Premalignant nephrogenic rests containing embryonic renal cells remains to be determined whether treatment of embryonic that have been maintained in the postnatal kidney are one such kidney progenitor transplants established in immunodeficient example. Because our results implicate growth-promoting mice (43) with the drug combination 5-aza-2¶-deoxycytidine, a imprinted genes in the expansion of the renal blastemal stem/ demethylating agent, and trichostatin A, an inhibitor of histone progenitor population, it is likely that epigenetic changes and loss deacetylases, can result in altered growth and development or of imprinting might cause and also maintain WT by altering more dramatically in a malignant phenotype switch. these and may be other stemness genes by specifically increasing the progenitor cell population. Validation of this claim requires Acknowledgments formal studies of loss of imprinting for these genes, as well as patterns of DNA methylation in fetal kidney tissues, adult kidney Received 12/21/2005; revised 3/23/2006; accepted 4/10/2006. tissues, WT, and WISH-WT. Nevertheless, aberrant epigenetic Grant support: ‘‘Talpiut’’ Sheba Career Development Award, Moriss Kahn Career Development Award, and the Israel Science Foundation Bat-Sheva De Rothschild gene activation or silencing is apparent, as among the most Physician-Scientist Grant Award (B. Dekel). highly overexpressed tumor progenitor genes in WISH-WT is the The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance one encoding for the polycomb group protein enhancer of zeste with 18 U.S.C. Section 1734 solely to indicate this fact. homologue 2 (EZH2), very recently shown to directly control DNA We thank the Kahn Family Foundation for supporting our research.

References 17. Kaminski N, Friedman N. Practical approaches to 30. Hammerman MR. The growth hormone-insulin-like analyzing results of microarray experiments. Am J growth factor axis in kidney. Am J Physiol 1989;257: 1. Woolf AS. The life of the human kidney before birth: Respir Cell Mol Biol 2002;27:125–32. F503–14. its secrets unfold. Pediatr Res 2001;49:8–10. 18. Pinthus JH, Fridman E, Dekel B, et al. ErbB2 is a 31. Rivera MN, Haber DA. Wilms’ tumour: connecting 2. Al-Awqati Q, Oliver JA. Stem cells in the kidney. tumor associated antigen and a suitable therapeutic tumorigenesis and organ development in the kidney. Kidney Int 2002;61:387–95. target in Wilms’ tumor. J Urol 2004;172:1644–8. Nat Rev Cancer 2005;5:699–712. 3. Lee SB, Haber DA. Wilms’ tumor and the WT1 gene. 19. Droz D, Rousseau-Merck MF, Jaubert F, et al. Cell 32. Abdallah BM, Jensen CH, Gutierrez G, Leslie RG, Exp Cell Res 2001;264:74–99. differentiation in Wilms’ tumor (nephroblastoma): an Jensen TG, Kassem M. Regulation of human skeletal 4. Coppes MJ, Pritchard-Jones K. Principles of Wilms’ immunohistochemical study. Hum Pathol 1990;21: stem cells differentiation by Dlk1/Pref-1. J Bone Miner tumor biology. Urol Clin North Am 2000;27:423–33. 536–44. Res 2004;19:841–52. 5. Feinberg AP, Williams BR. Wilms’ tumor as a model for 20. Sredni ST, de Camargo B, Lopes LF, Teixeira R, 33. Li L, Forman SJ, Bhatia R. Expression of DLK1 in cancer biology. Methods Mol Biol 2003;222:239–48. Simpson A. Immunohistochemical detection of p53 hematopoietic cells results in inhibition of differentia- 6. Feinberg AP, Tycko B. The history of cancer epige- protein expression as a prognostic indicator in Wilms’ tion and proliferation. Oncogene 2005;24:4472–6. netics. Nat Rev Cancer 2004;4:143–53. tumor. Med Pediatr Oncol 2001;37:455–8. 34. Purow BW, Haque RM, Noel MW, et al. Expression of 7. Feinberg AP, Ohlsson R, Henikoff S. The epigenetic pro- 21. Reya T, Clevers H. Wnt signalling in stem cells and Notch-1 and its ligands, Delta-like-1 and Jagged-1, is genitor origin of human cancer. Nat Rev Genet 2006;7:21–33. cancer. Nature 2005;434:843–50. critical for glioma cell survival and proliferation. Cancer 8. Stuart RO, Bush KT, Nigam SK. Changes in global gene 22. Yoshino K, Rubin JS, Higinbotham KG, et al. Secreted Res 2005;65:2353–63. expression patterns during development and matura- Frizzled-related proteins can regulate metanephric 35. Relaix F, Weng X, Marazzi G, et al. Pw1, a novel zinc tion of the rat kidney. Proc Natl Acad Sci U S A 2001;98: development. Mech Dev 2001;102:45–55. finger gene implicated in the myogenic and neuronal 5649–54. 23. Kuure S, Vuolteenaho R, Vainio S. Kidney morpho- lineages. Dev Biol 1996;177:383–96. 9. Schwab K, Patterson LT, Aronow BJ, Luckas R, Liang genesis: cellular and molecular regulation. Mech Dev 36. Relaix F, Wei X, Li W, et al. Pw1/Peg3 is a potential HC, Potter SS. A catalogue of gene expression in the 2000;92:31–45. cell death mediator and cooperates with Siah1a in p53- developing kidney. Kidney Int 2003;64:1588–604. 24. Steenman MJ, Rainier S, Dobry CJ, Grundy P, Horon mediated apoptosis. Proc Natl Acad Sci U S A 2000;97: 10. Schmidt-Ott KM, Yang J, Chen X, et al. Novel IL, Feinberg AP. Loss of imprinting of IGF2 is linked to 2105–10. regulators of kidney development from the tips of the reduced expression and abnormal methylation of H19 in 37. Okabe H, Satoh S, Furukawa Y, et al. Involvement of ureteric bud. J Am Soc Nephrol 2005;16:1993–2002. Wilms’ tumour. Nat Genet 1994;7:433–9. PEG10 in human hepatocellular carcinogenesis through 11. Dekel B, Amariglio N, Kaminski N, et al. Engraftment 25. Calvo KR, Knoepfler PS, Sykes DB, Pasillas MP, interaction with SIAH1. Cancer Res 2003;63:3043–8. and differentiation of human metanephroi into func- Kamps MP. Meis1a suppresses differentiation by G- 38. Bard JB, Gordon A, Sharp L, Sellers WI. Early nephron tional mature nephrons after transplantation into mice CSF and promotes proliferation by SCF: potential formation in the developing mouse kidney. J Anat 2001; is accompanied by a profile of gene expression similar mechanisms of cooperativity with Hoxa9 in mye- 199:385–92. to normal human kidney development. J Am Soc loid leukemia. Proc Natl Acad Sci U S A 2001;98: 39. Tanimizu N, Nishikawa M, Saito H, Tsujimura T, Nephrol 2002;13:977–90. 13120–5. Miyajima A. Isolation of hepatoblasts based on the 12. Dekel B. Profiling gene expression in kidney devel- 26. Wang GG, Pasillas MP, Kamps MP. Meis1 programs expression of Dlk/Pref-1. J Cell Sci 2003;116:1775–86. opment. Nephron Exp Nephrol 2003;95:e1–6. transcription of FLT3 and cancer stem cell character, 40. Glinsky GV, Berezovska O, Glinskii AB. Microarray 13. Li CM, Guo M, Borczuk A, et al. Gene expression in using a mechanism that requires interaction with Pbx analysis identifies a death-from-cancer signature pre- Wilms’ tumor mimics the earliest committed stage in and a novel function of the Meis1 C-terminus. Blood dicting therapy failure in patients with multiple types of the metanephric mesenchymal-epithelial transition. 2005;106:254–64. cancer. J Clin Invest 2005;115:1503–21. Am J Pathol 2002;160:2181–90. 27. Mercader N, Tanaka EM, Torres M. Proximodistal 41. Vire E, Brenner C, Deplus R, et al. The polycomb 14. Huff CA, Matsui W, Smith BD, Jones RJ. The paradox identity during vertebrate limb regeneration is regulated group protein EZH2 directly controls DNA methylation. of response and survival in cancer therapeutics. Blood by Meis homeodomain proteins. Development 2005;132: Nature 2006;439:871–4. 2006;107:431–4. 4131–42. 42. Yuan E, Li CM, Yamashiro DJ, et al. Genomic pro- 15. Weissman IL. Normal and neoplastic stem cells. 28. Snider L, Tapscott SJ. Emerging parallels in the filing maps loss of heterozygosity and defines the Novartis Found Symp 2005;265:35–50. generation and regeneration of skeletal muscle. Cell timing and stage dependence of epigenetic and ge- 16. Gleave ME, Hsieh JT, Wu HC, von Eschenbach AC, 2003;113:811–2. netic events in Wilms’ tumors. Mol Cancer Res 2005;3: Chung LW. Serum prostate specific antigen levels in 29. Dekel B, Biton S, Yerushalmi GM, et al. In situ 493–502. mice bearing human prostate LNCaP tumors are activation pattern of Met docking site following renal 43. Dekel B, Burakova T, Arditti FD, et al. Human and determined by tumor volume and endocrine and growth injury and hypertrophy. Nephrol Dial Transplant 2003; porcine early kidney precursors as a new source for factors. Cancer Res 1992;52:1598–605. 18:1493–504. transplantation. Nat Med 2003;9:53–60. www.aacrjournals.org 6049 Cancer Res 2006; 66: (12). June 15, 2006

Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2006 American Association for Cancer Research. Multiple Imprinted and Stemness Genes Provide a Link between Normal and Tumor Progenitor Cells of the Developing Human Kidney

Benjamin Dekel, Sally Metsuyanim, Kai M. Schmidt-Ott, et al.

Cancer Res 2006;66:6040-6049.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/66/12/6040

Cited articles This article cites 43 articles, 13 of which you can access for free at: http://cancerres.aacrjournals.org/content/66/12/6040.full#ref-list-1

Citing articles This article has been cited by 12 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/66/12/6040.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/66/12/6040. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.