A Genetic Analysis of the Life Cycle of Volvariella volvacea
by He Xiaoyi
Thesis submitted as partial fulfillment for the degree of Master of Philosophy
February, 1996 Division of Biology Graduate School The Chinese University ofHong Kong
RECEIVED - 5 AUG 199? ^M^
(n 2 2 m 1998 jiJ ^¾ U^'IVERSiTY ~iM \^>vLiBRARY SYSTEMyW X^^^
iK^SffliMMMMBBMHHlB^BBHMMMW———M^^BM^MI^^^^^^^^^^MI^M^MIMB Statement
All the experimental works reported in this thesis were performed by the author unless specially stated otherwise in the text.
He Xiaoyi Abstract
Volvariella volvacea is the most popular fresh mushroom in Hong Kong. Li order to find out whether genetic variation exists in V. volvacea’ a genetical analysis was carried out. Strain V34 was used and AP-PCR (arbitrarily-primed polymerase chain reaction) was employed to detect genetic variations. The released protoplasts from vegetative mycelium were regenerated and the regeneration frequency in this study was 10.9%. F1 and F2 single spore progenies of V34 were also isolated. Growth rates of six protoplast regenerants, ten F1 single spore isolates and ten single spore isolates of two fertile F1 progenies (F2) were studied by measuring their colony diameters and biomass gain after 4 days incubation. F1 single spore isolates were cultivated in compost to examine their fruiting abilities. Results showed that great variations existed among V34 progenies, in the aspects of colony morphology, growth rate and fhiiting ability. Protoplast regenerants also showed differences in colony morphology and growth rate. Two out of ten F1 isolates could fruit in straw based compost and produced the F2 progenies. Individuals with different morphologies and growth rates were examined by two arbitrary primers, M13sq and M13rs. However, none of the primers used in this study revealed any polymorphism among six randomly choosen protoplast regenerants and their parental strain V34. As for F1 progenies, both M13sq and M13rs yielded highly similiar DNA profiles with those ofthe strain V34.
The results from this study confirmed the persistence of phenotypic variations in V. volvacea. Several possible mechanisms to induce these variations are discussed. Mitochondrial genome may play an important role. Acknowledgments
I would like to express my sincere gratitude to my supervisors: Dr. Siu-Wai Chiu and Prof. Shu-Ting Chang, who not only gave me the opportunity to study in the establishment of mushroom Volvariella volvacea, but also have been leading me and offering me countless ideas, advices and encouragement. I would also like to thank Dr. J. A. Buswell and Dr. H. S. Kwan for acting as members of my Thesis Committee. Thanks for their patience, advices and criticism. Moreover, I would like to send my thanks to my external examiner, although I do not know yet who he is. My appreciation also extends to Mr. S. N. Mok for teaching me cultivate mushrooms, to technicians in Biology Department for technical assistance and to Ms. M. Y. Yu, Mr. H. X. Wang, Mr Y. J. Cai，Ms S. J. Chapman and all the other classmates for their helping me overcome many difficulties. Finally but not means the least, I wish to thank my family, for the support, encouragement and endless love they always give me. Content Page
List ofTables I List ofIllustrations 11 List of Abbreviations HI Chapter 1 Introduction 1 1.1 Fungal life cycles 1 1.1.1 Heterothallism 1 1.1.1.1 Bipolar incompatibility 2 1.1.1.2 Tetrapolar incompatibility 2 1.1.2 Homothallism 2 1.1.2.1 Primary homothallism 2 1.1.2.2 Secondary homothallism 3 1.2 Biology ofhomothallic Volvariella volvacea 3 1.3 Genetic mechanisms generating variations in fungi 8 1.3.1 Meiotic recombination 8 1.3.2 Mitotic recombination 9 1.3.3 Fungal mitochondrial genomes 11 1.3.3.1 Structure of fungal mitochondrial genome 11 1.3.3.2 Mitochondrial plasmids 14 1.3.3.3 Mitochondrial inheritance 14 1.3.3.4 Mitochondrial polymorphisms 15 1.3.4 Transposons 16 1.4 Genetic studies of mushrooms by molecular and protoplast tools 17 1.4.1 Genetic markers 17 1.4.1.1 Restriction fragement length polymorphisms (RFLPs) 18 1.4.1.2 Polymerase chain reaction (PCR) 18 1.4.1.2.1 Arbitrarilyprimed PCR (AP-PCR) 20 1.4.2 Protoplasts 23 1.4.2.1 Protoplast isolation - 23 1.4.2.2 Mycolytic enzymes 24 1.4.2.3 Osmotic stabilizers 26 1.4.2.4 Physiological condition ofmycelium 27 1.4.2.5 Protoplast regeneration 28 1.4.2.6 Application ofprotoplasts 28 1.5 Purpose and significance ofthis genetic study on V. volvacea 29 Chapter 2 Materials and Methods 30 2.1 Organism 30 2.2 Cell cultivation and maintenance 30 2.3 Solutions and chemicals 30 2.3.1 Solutions for DNA isolation 30 2.3.2 Solutions for agarose gel electrophoresis 31 2.3.3 PCR primers and reagents 31 2.4 DNA extraction and purification 31 2.5 Agarose gel electrophoresis 32 2.6 Arbitrarily primed polymerase chain reaction (AP-PCR) 33 2.7 Protoplast isolation and regeneration 34 2.7.1 Preparation ofprotoplasts 34 2.7.2 Regeneration of protoplasts 34 2.8 Single spore isolation and germination 35 2.9 Growth rate measurement 36 2.9.1 Colony diameter measurement 36 2.9.2 Biomass gain measurement 37 Chapter 3 Results 38 3.1 Genomic DNA extraction - 38 3.2 Genetic analyses of V34 and its progenies 3 8 3.2.1 Protoplast regenerants ^ 8 3.2.1.1 Protoplast preparation 3 8 3.2.1.2 Protoplast regeneration 42 3.2.1.3 Morphology of V34 protoplast regenerants 42 3.2.1.4 Growth rate measurement 44 3.2.1.5 AP-PCR analysis ofV34 protoplast regenerants 44 3.2.2 V34 single spore isolates (SSIs) - F1 progenies 48 3.2.2.1 Single spore isolation and germination 48 3.2.2.2 Morphology ofFl progenies 48 3.2.2.3 Growth rate measurement 48 3.2.2.4 AP-PCR analysis of 10 V34 single spore isolates 51 3.2.2.5 Fruiting ability of F1 progenies 51 3.2.3 Single spore isolates from F1 progenies-F2 progenies 54 3.2.3.1 Colony morphology and growth rate 54 Chapter 4 Discussion ^^ 4.1 Protoplast isolation and regeneration 59 4.2 Phenotypic variations in Volvariella volvacea 61 4.2.1 Colony morphology 61
^~— I •ii^^^M—^^^—I^M^—^M^I^M^MMMMTmMITMffMlllHIII^III i|l|iHIWIillll|i|ii IWH|ll_WHiUMU'mimi_I 4.2.2 Growth rate 61 4.2.3 Fruiting ability 62 4.3 Genetic mechanisms for phenotypic variations in V. volvacea 63 4.4 AP-PCR analyses 65 4.5 Possible sources ofvariations 66 4.5.1 Mitochondrial DNA (mtDNA) 67 4.5.2 Spontaneous mutations - 67 Conclusion 69 References 70 List ofIllustrations
Fig. 1 Haploid life cycle of Volvariella volvacea (Chiu, 1993). 7 Fig. 2 Meiotic crossing-over in fungi (modified from Bos & Swart, 1995). 10 Fig. 3 Recombination during mitosis in fungi (modified from Bos & Swart，1995). 12 Fig. 4 A typical scan spectrum ofgenomic DNA sample from Volvariella volvacea strain V34 and its progenies. 39 Fig. 5 Agarose gel showing the genomic DNAs from Volvariella volvacea isolates. 40 Fig. 6 Protoplast yield from different ages ofmycelia and different times of exposure to lytic enzymes. 41 Fig. 7 Colony morphologies of V34 protoplast regenerants. 43 Fig. 8 The biomass gain by six V34 protoplast regenerants after 4-day incubation. 45 Fig. 9 AP-PCR profiles of six protoplast regenerants of V. volvacea V34 using primer M13sq. 46 Fig. 10 AP-PCR profiles of six protoplast regenerants of V. volvacea V34 using primer M13rs. 47 Fig. 11 Colony morphologies of V34 single spore isolates (F1). 49 Fig. 12 The biomass gain by ten V34 single spore isolates (F1) after 4-day incubation. 50 Fig. 13 AP-PCR profiles of 10 single spore isolates ofV34 using primer M13sq. 52 Fig. 14 AP-PCR profiles of 10 single spore isolates of V34 using primer M13rs. 53 Fig. 15 Colony morphologies of single spore isolates ofNo.33 (the F2 progeny). 55 Fig. 16 Colony morphologies of single spore isolates ofNo. 10 (the F2 progeny). 56 Fig. 17 The biomass gain by ten single spore isolates of No. 10 isolate after 4-day incubation. 57 Fig. 18 The biomass gain by ten single spore isolates ofNo. 33 isolate after 4-day incubation. 58 List of Tables
Table 1 Nomenclature for mitochondrial genes (Hudespeth, 1992). 13 Table 2 Properties of RFLPs and RAPDs/AP-PCR (modified from Rafalski & Tingey，1993). 22 Table 3 Protoplast isolation system in some edible mushrooms (sources: Selitrennikoff& Bloomfield， 1984; Kitamoto et al., 1988; Peberdy, 1991). 25 Table 4. The regeneration frequency of protoplasts 42 Table 5. The colony diameters ofprotoplast regenerants (4 day cultures) 42 Table 6. Germination frequency of V34 spores 48 Table 7. The colony diameters of single spore isolates (SSIs) (4 day cultures) 48 Table 8. Fruiting test of F1 progeny 51 Table 9. The colony diameters of single spore isolates of No.lO F1 progeny (4 day cultures) 54 Table 10. The colony diameters ofsingle spore isolates of No.33 F1 progeny (4 day cultures) 54 List of Abbreviations
AP-PCR: Arbitrarily primed polymerase chain reaction bp: base pair CM: Complete medium dNTPs: deoxyribonucleotide triphosphates EDTA: Ethylenediaminetetra-acetic acid Kb: Kilobase pairs Mb: Megabase pairs MCM: Mannitol complete medium MI: First meiotic division MtDNA: Mitochondrial DNA PCR: Polymerase chain reaction PD: Potato dextrose broth PDA: Potato dextrose agar RAPDs: Random amplified polymorphic DNAs RFLPs: Restriction fragement length polymorphisms SDS: Sodium dodecyl sulfate SSI: Single spore isolate Tris: Tris (hydroxymethyl) aminomethane Chapter 1. Introduction
1.1 Fimgal life cycles The prospect for breeding programmes ofany organisms depends upon an understanding ofthe life cycle and this is as essential for lower organisms as it is for the most highly evolved organisms. Numerous kinds of life cycles have been revealed in fungi. Different fungi showed variations in their nuclear components at different stages in their life cycles: the niunber of nuclei per cell, the ploidy and genotype may vary greatly (Elliott, 1972). But the basic life cycle of the higher fungi is: a spore germinates to form mycelium which in tum bears fruiting bodies and from fhiiting bodies spores are produced. Sexuality of Basidiomycetes was first described by Bensaude (1918) in Coprinus fimetarius and Kniep (1920) in Schizophyllum commune (cited in Miles, 1991). Fungi can be classified as homothallic (self-fertile) or as heterothallic (self-sterile). According to Burnett (1975), homothallism is probably the most common mode of sexual reproduction in fungi as a whole, but in higher fungi, it represents only about 10% of all species investigated. The other 90% shows heterothallism.
1.1.1 Heterothallism Cross-mating between homokaryotic mycelia is necessary to establish the fertile mycelium in heterothallic species (Tanaka & Koga，1972; Raper, 1976). The three phases of sexual reproduction, plasmogamy, karyogamy and meiosis, are found in their life histories. Mating in heterothallic species is determined by one of the two incompatibility mechanisms: bipolar and tetrapolar (Raper, 1966; Fincham et aL, 1979; Elliott, 1982).
1 fotroduction
1.1.1.1 Bipolar incompatibility There is only one single mating type factor which in most cases possesses two alleles, A and a. It is also referred as unifactorial system. Jn the case of biallelic system, the two mating types segregate in a ratio of 1:1 in a cross of A X a matings. Li Basidiomycetes, about 25% species are unifactorial heterothallic (Bumett, 1975). Lentinula edodes shows this mating system (Chang, 1993b).
1.1.1.2 Tetrapolar incompatibility There are two unlinked mating type factors, A and B, each of which has multiple alleles. It is also referred as bifactorial system. Four mating types: AxBx, AxBy, AyBx and AyBy are produced in a 1:1:1:1 ratio in a cross oiAxBx X AyBy. Only combinations that are heteroallelic for both mating type factors are fertile. Li Basidiomycetes, 65% are bifactorial heterothallic (Burnett, 1975). Agaricus bitorquis shows this mating system (Chang, 1993b).
1.1.2 Homothallism Homothallic species can complete their life cycle by a single spore without mating (Raper, 1966; Chang & Yau，1971; Elliott, 1972). Plasmogamy is not required for karyogamy and meiosis to take place. There are two forms ofhomothallism: primary and secondary.
1.1.2.1 Primary homothallism Primary homothallic species produce fmiting bodies by a single spore with a single postmeiotic nucleus. The presence ofincompatibility factors has not yet been detected. Volvariella volvacea, one of the conunonly
2 fotroduction
cultivated mushrooms, is thought to be primary homothallic (Chang & Yau, 1971).
1.1.2.2 Secondary homothallism Secondary homothallic species produce fruiting bodies by a single spore possessing two compatible nuclei. It involves incompatibility factors. Agaricus bisporus displays this kind oflife cycle (Chang, 1993b).
1.2 Biology of homothallic Volvariella volvacea Mushrooms are generally considered as a special group of higher fungi, which are fleshy macrofungi with distinctive fruiting bodies producing, bearing and discharging spores (Chang, 1993a). Most of them are edible and have served as human food throughout the history because of their nutrition and delicacy, and some for medical or tonic contributions. It is now well known that mushrooms have a high protein content of good quality, which contains the nine amino acids essential to human diet, especially rich in lysine and leucine which are lacking in most staple cereal foods. Mushrooms also contain many vitamins, fiber and minerals and they are low in calories, sodium, fat and cholesterol (Chang, 1980). As with the development of the society, demanding for mushrooms is increasing fast. From 1986-1991, world production of cultivated mushrooms went up by 96.4% (Chang, 1993b). In addition, mushrooms are also playing an important role in biological cycling in nature through breaking down lignocellulosic plant debris and agricultural, industrial and forest wastes. Cellulose, hemicellulose and lignin, the main components of these wastes which are relatively resistant to biological degradation, can be degraded by a wide range ofextracellular hydrolytic and oxidative
* 3 fotroduction
enzymes produced by mushrooms (Wood & Fermor, 1982; Wood, 1984). Therefore, cultivation of mushrooms can provide a solution to many problems including protein shortage, resource recovery and reuse, and environmental pollution. Volvariella volvacea, commonly known as the Chinese straw mushroom or paddy straw mushroom, belongs to the family Pluteaceae of the Basidiomycetes. It is an edible mushroom ofthe tropics and subtropics. It has long been cultivated in China and the first record can be traced back to 1700 (Chang, 1977). Because it grows at the relatively high temperature range of 30-36°C, it is also called "warm mushroom" and is very suitable for South Asian countries. Nowadays, this mushroom is extensively cultivated in Thailand, Lidonesia, Vietnam, Philippines and Malaysia. China is the top producer (Chang, 1993c). Following Agaricus
bisporus, Lentinula edodes, Pleurotus spp. and Auricularia spp； V. volvacea is the fifth most important cultivated mushroom in the world (Chang, 1993b). Li nature, V. volvacea is found growing on rotten paddy straw during the rainy seasons in tropics and subtropics. Any highly rich carbohydrate- containing substrate, including cotton waste, bagasse, banana leaves，oil pahn pericarp, sorghum straw and fiber crop wastes, can also be used to cultivate this mushroom (Chang, 1993c). K volvacea grows very fast. From spawn to mature fhiiting bodies it takes only 10 days under favorable conditions. Thus it is considered as one of the easiest mushrooms to grow. However, the difficulty to obtain high, consistant yield and the inability to enhance its post-harvest shelf life make V. volvacea also the most difficult to handle. Its position in the world popularity list dropped from the third in 1986 to the fifth in 1991 (Chang, 1993b).
4 fotroduction
V. volvacea is not only highly nutritious but also possesses a fine texture and soft flesh. Many people even prefer it to the cultivated white mushroom, A. bisporus. Li Hong Kong, V. volvacea is the most popular fresh mushroom. However, most research activities of V. volvacea have been carried out only in the past thirty years. Our knowledge of this mushroom is much less compared to that of^. bisporus. V. volvacea is a large pileate fungus with a dark gray cap (Chang & Ymi， 1971). Li its maturing fruiting bodies, the volva is well developed and remains distinct. This trait makes V. volvacea very different from many other mushrooms such as L. edodes, A. bisporus and P. sajor-caju (Chang, 1991). The traditional cultivating substrate for V. volvacea was paddy straw. Jn 1971, cotton waste was first introduced as a material to grow V. volvacea and resulted in a significant increase (2-3 folds) of production and more stable yield (Yau & Chang，1972). The substrate-degradative enzymes of V. volvacea have been studied (Wang, 1982; Buswell et aL, 1993; Cai, 1994). These studies showed that V. volvacea produces several enzymes for the hydrolysis of cellulose and hemicellulose, including endo- and exoglucanases, p-glucosidase, xylanase and p-xylosidase but lack the ability to synthesize phenol-oxidizing and lignin-transfonning enzymes. These results supported that V. volvacea grows well on a rich cellulosic substrate such as cotton waste, in which the amount of lignified components is negligible. The initial information on life history of V. volvacea came from a study of nuclear behaviour in basidia and a cytological study of its spore germination (Chang & Ghu，1969; Chang, 1969). V. volvacea possessed multinucleate hyphae and the clamp connections were absent. This is quite similiar to A. bisporus. Basidiospores of V. volvacea typically were
5 fotroduction
uninucleate (Chang & Chu，1969). However, the production of fruiting bodies by both sexual basidiospores and asexual multinucleate chlamydospores suggested that this mushroom may be a primary homothallic fungus (Chang, 1969). Since 1969，Chang and colleagues have showed that a single basidiospore of V. volvacea can germinate and fortn fruiting bodies by itself without any mating (Chang & Yau，1971; Li, 1977; Chang et al., 1981; Li, 1991). Thus V. volvacea is thought to be primary homothallic. - Basidiospores of V. volvacea were also studied with respect to their ploidy, using gamma radiation as a tool (Quaye, 1986). The radiation survival curve implied the haploidy of basidiospores. Royse et al. (1987) also deduced a haploid nature of basidiospores of K volvacea from the segregation of isozyme markers of a constructed heterokaryon. The haploid life cycle in V. volvacea was also demonstrated from microspectrophotometric measurements of DNA content per nucleus and observations of nuclear behaviour (Chiu, 1993) (Fig. 1). A haploid uninucleate basidiospore germinates to haploid multinucleate mycelium and forms fruiting bodies. Then, a uninucleate hymenial initial divides mitotically to a binucleate condition, and karyogamy leads to a transient diploid stage. DNA replicates to 4N content. Basidiospores are formed through meiosis and the life cycle is completed. Despite of these evidences, genetics of the life cycle of V. volvacea is still uncertain, in comparison with other commonly cultivated mushrooms such as A. bisporus, L edodes andP. sajor-caju (Chang, 1993b).
6 fotroduction
^x-^ZT^ Jk^" ,1A
vk- "kMki r N --r ftrRk )丄 ^=^^^ V_y ^ \ Mciosis Fruiiing / \^ and ><^ m0rph0gcncsi5 Z \^ sporulalion f ] y^ ^^_^ Fig. 1 Haploid Hfe cycle of Volvariella volvacea (Chiu, 1993). Phenotypic variations among the progenies in another straw mushroom,
Volvariella bombycina, in the aspects of colony morphology, growth rate7 fotroduction
and fruiting ability were observed (Elliott & Challen，1985; Chiu & Chang, 1987). Variations among single spore isolates of V. volvacea were also found by some of the previous studies (Chang & Yau，1971; Li & Chang, 1978; Chang et al., 1981; Li, 1991). Elliott and Challen (1985) proposed a tetraploid-diploid secondarily homothallic life cycles for V. bombycina and V. volvacea. However, Chiu and Chang (1987) concluded that V. bombycina had a haploid primary homothallic life cycle through cytological and genetical analysis using auxotrophic mutants. Because of the lack in genetic markers, it is difficult to fmd out where and how do these variations happen in V. volvacea. Furthermore, strain preservation and improvement of V. volvacea through breeding efforts has also been hindered due to a lack of basic genetic information to develop a rational breeding programme (Royse & May，1992).
1.3 Genetic mechanisms generating variations in fungi Most groups of fungi appear to be haploid for the major part of their life cycle. At the sexual stage, karyogamy takes place in specialized binucleate hyphal cells and is followed by meiosis. Additional mitotic divisions may happen and result in haploid and multiple nuclei in spores (Raper, 1966; Fincham et al., 1979).
1.3.1 Meiotic recombination The meiotic mechanism in eukaryotes is essentially similar. Meiosis consists oftwo divisions, the first ofwhich is special (reductional), while the second resembles a mitotic division (equational). Li the prophase of the first meiotic division (MI) the homologous chromosomes synapse to form bivalents and later they become thicker by contraction. During synapsis, the four chromatids of a pair of chromosomes can undergo
8 fotroduction
exchange and is called crossingover (Bos & Swart，1995) (Fig. 2). Crossingover between sister chromatids is genetically ofno consequence, since sister chromatids are identical and no recombinants can occur. Crossingover between nonsister chromatids is of genetic importance, if the homologous chromosomes carry different alleles at one or more loci. Such crossingovers result in recombination of genes that are located on the same chromosome. Genes that are on the same chromosome belong to one linkage group, but if two genes are located far from each other, the frequency of crossingover can be high enough to show independent segregation. hi the anaphase ofMI, the homologous chromosomes segregate to the two poles of the cell, hi this way, a reassortment of non-homologous chromosomes is possibly achieved.
1.3.2 Mitotic recombination During mitosis, homologous chromosomes behave independently. At metaphase the chromosomes move to the equatorial plane and the sister chromatids separate during the anaphase, resulting in two daughter cells with the original number of chromosomes. Jn this way, each daughter cell receives the same genetic information. Usually the homologous chromosomes do not pair during mitosis. However, there is genetic evidence that homologous chromosomes can exchange parts of nonsister chromatids, probably during the four-strand stage. There is also evidence that unequal crossing-over can occur during mitosis, resulting in duplications O^ga and Roper, 1968).
*
9 fotroduction
a b + ===¢== ： “^ 丨。 [1] (21 " I + + c -
Crossing over events In region Genotype of progeny
===== - a b + n - + + c
n 1 ^ + + === 1 + b c
n 2 a b c , 2 + + + _= 1 2 a + c 0 丨’‘ , 1,2 + b +
Fig. 2 Meiotic crossing-over in fiingi. One pair of homologous chromosomes is drawn to illustrate the process of meiotic crossing-over, a, b，c represent different genes. + represents the wild type allele of a particular gene. Homologous chromosomes are tightly paired during the first meiotic division and exchange between chromatids take place (modified from Bos & Swart，1995).
In somatic diploid nuclei, two recombination processes may occur: mitocic crossingover between nonsister chromatids of homologous chromosomes and haploidization (Kafer, 1977; Papa, 1977; Bos and
10 fotroduction
Swart, 1995). Mitotic crossingover results in recombinant chromatids. Haploidization results from mitotic nondisjunction of sister chromatids which leads to aneuploid nuclei and by successive losses of chromosomes ultimately to haploid nuclei. During haploidization, genes on the same chromosome segregate as a linkage group. Mitotic crossingover results in recombination of genes within a linkage group (Bos & Swart，1995) (Fig.
3). Mitotic recombination has been found (Bos & Swart，1995). However, the frequency of mitotic crossingover is much lower than that of meiotic crossingover. During meiosis, many crossingover events occurred in each meiocyte, whereas in artificially induced unstable diploids ofNeurospora 3 • crassa the mitotic crossingover occurred at a frequency of 10' (Smith, 1974).
1.3.3 Fungal mitochondrial genomes 1.3.3.1 Structure offungal mitochondrial genome Mitochondrial genome refers to nucleic acids found in organelle mitochondrion (Hudspeth, 1992). This kind of extrachromosomal genome is invariably present as simple DNA molecules, not as the chromosomes of the nucleus which have bound proteins. As a general rule, mitochondrial DNAs are circular and encode a limited set of gene products which are constituents either of the mitochondrial translation apparatus, or of the respiratory chain and oxidative ATP synthase complexes. A minimum set of 22 tRNAs is sufficient to translate 20 amino acids. All other genes related to mitochondrial functions are usually nuclear-encoded (Crossman and Hudspeth, 1985; Hudespeth, 1992) (Table 1).
11 fotroduction
Table 1 Nomenclature for mitochondrial genes (Hudespeth, 1992). Gene Function Translational apparatus ml L-RNA large ribosomal subunit RNA ms S-RNA small ribosomal subunit RNA tsl tRNA synthesis locus varl small ribosomal subunit protein S-5 small ribosomal subunit protein
Respiratory chain 一 coxl COI, oxi3 cytochrome c oxidase subunit 1 cox2 COII, oxil cytochrome c oxidase subunit 2 cox3 COIII, oxi2 cytochrome c oxidase subunit 3 cob cytb apocytochrome b ndhl urfl ND1 NADH dehydrogenase subunit 1 ndh2 urf2 ND2 NADH dehydrogenase subunit 2 ndh3 urf3 ND3 NADH dehydrogenase subunit 3 ndh4 urf4 ND4 NADH dehydrogenase subunit 4 ndh41 urf4L ND4L NADH dehydrogenase subunit 4L ndh5 urf5 ND5 NADH dehydrogenase subunit 5 ndh6 urf6 ND6 NADH dehydrogenase subunit 6
ATP synthase atp6 oli2, 4 ATP synthase subunit 6 atp8 urfA6L, aapl ATP synthase subunit 8 atp9 mal，olil, 3 ATP synthase subunit 9
General
ORF open reading frame URF unidentified reading frame
12 fotroduction
+ A B + A B Q= = • g= = '0- 0= == _ ^ __^____= C + \+ C —+ B 0= == _ [non-disjunction 1
aneupioids 2n + 1 , 2n-1
/ \
+ A B / \ Q= / \ |J= , � 0= I '3- _ I
+ A B C + +
non-disjunction diploid haploidization Fig. 3 Recombination during mitosis in fungi. One pair of homologous chromosomes is drawn to illustrate the recombination events during mitosis. A, B, C represent different genes with + representing the wild type allele. (1) Mitotic crossing-over leads to homozygosity distal ofthe point of exchange. (2) Nondisjunction of chromatids results in aneuploids which will finally lead to a diploid or a haploid nucleus (modified from Bos & Swart, 1995). ]ji comparison to the nuclear genome sizes determined by electrophoretic karyotyping, of which the largest genome of 47 Mb reported for
13 fotroduction
Neurospora crassa (Orbach et al., 1988) and the smallest genome of 13.8 Mb for Schizosaccharomyces pombe (Smith et al., 1987), the mitochondrial DNAs offungi are very small and usually exhibit large size variation: from a minimum of 17.6 kb in Schizosaccharomyces pombe to a maximum of 172 kb 'mAgaricus bitorquis (Hudspeth, 1992). As a common concept, mtDNAs are circular molecules. But, linear exceptions have been discovered. Linear mitochondrial DNAs have been found with high frequency in the yeast genera Williopsis and Pichia by pulsed field gel electrophoresis (Fukuhara et al., 1993).
1.3.3.2 Mitochondrial plasmids Mitochondrial plasmids exist widely in higher fungi (Arganoza et al., 1994) and they are regarded as genetic elements in the mitochondrion. M Neurospora intermedia, the presence of a linear 9.6 kb Kalilo mitochondrial plasmid is associated with senescence (Bertrand et al., 1985; Myers et al., 1989) and in K crassa, senescence is caused by another linear mitochondrial plasmid, marDNA, which is 7 kb long (Court et al., 1991; Court & Betrand，1992). The cause of aging is through the disruption of mtDNA function as a result of plasmid insertion and progressive replacement of mtDNA (Myers et al., 1989). Jn contrast, in Podospora anserina, a linear plasmid pAL2-l can integrate into mtDNA and is involved in the expression oflongevity (Hermanns et al., 1994).
1.3.3.3 Mitochondrial inheritance The inheritance of mtDNA is usually matemal as demonstrated in Phytophthora infestans by Whittaker and coworkers (1994). But complex situations exist in other fimgi. bi Neurospora, matemal, patemal and recombinant mitochondrial DNAs were segregated in the progeny (Lee &
14 fotroduction
Tayior, 1993; Yang & Griffiths，1993). Li Agaricus bisporus, mitochondrial DNA is mostly inherited uniparentally (Jin et al., 1992). 1.3.3.4 Mitochondrial polymoiphisms MtDNA in higher fungi is usually present at high copy number (Grossman & Hudspeth，1985). Polymorphisms of mtDNA are conmionly encountered in many fungi. As for any genetic polymorphism, mitochondrial variants can be associated with disruption of functions leading to phenotypic abnormality, or they can be apparently neutral with no detectable phenotypic effect (Griffiths et al., 1995). Length mutations are prevalent in the mtDNA variation. Many studies showed that the basis for mitochondrial polymorphisms could come from nucleotide pair substitution, deletion, insertion, inversion and the presence or absence of free plasmids or plasmid inserts (Griffiths et al., 1995). MtDNA polymorphisms have been used extensively in population analysis; Fukuda and colleagues (1994) studied the restriction fragment length polymorphisms (RFLPs) in mtDNA in 51 wild strains from different geographical populations of Lentinula edodes and their result suggested that L. edodes included some distinct groups with genetic divergence in both mitochondrial and nuclear genomes. Nevertheless, the inheritance of mitochondria and nuclei is independent as demonstrated in Agaricus bitorquis and might be dependent on nuclear-mitochondrial interaction (Hintz et al., 1988). Further studies are needed，therefore, to incorporate the genetic relatedness among strains of a population based on nuclear phenotypes and mitochondrial phenotypes.
1.3.4 Transposons Transposable elements or transposons are typically a piece of DNA that can move from one position to another and that consists of one or several
15 fotroduction
genes in the middle flanked by end sequences that are the same as each other. Within an end segment, there may be shorter repetitive sequences (terminal repeats) which are believed to help in the insertion and excision ofthe element (Ayala & Kiger，1984). The first transposable element discoverd was described in maize by Barbara McClintock in 1940s. She was able to show that certain genetic elements within the maize genome modified the expression of other genes at adjacent sites and from time to time disappear and reappear at different locations. Later in 1960s, transposable elements were discovered in E. coli as the cause of one type of spontaneous mutation. These mutations completely abolished the expression of the gene in which they occurred. Since then various transposons have been identified in many species including yeast, fruitfly and mice (Ayala & Kiger，1984). Transposition seems to happen notjust within nuclear DNA, but also between the genes of nuclei and mitochondria. Transposons exhibit the following genetic properties: (i) the ability to transpose and the functions required for transposition are coded by themselves; (ii) precise excision; (iii) produce gene mutations such as deletions and invertions; and (iv) interaction between other genetic elements and chromosomes. Because of these characteristics, especially that they can move around in the genome，it is very difficult to detect them.
1.4 Genetic studies ofmushrooms by molecular and protoplast tools 1.4.1 Genetic markers The aim of mushroom breeders is to bring together an optimum combination of genes that control characteristics of commercial importance (Elliott, 1982; Miles & Chang, 1986). Detailed genetic information is essential for the establishment of a breeding programme.
16 fotroduction
A genetic research requires reliable markers. Morphological markers or physiological markers do not possess the reliability because they are usually affected by different environmental and/or nutritional factors. Genetic markers obey the Mendelian Laws and can serve as reference points in the genome. These markers are widely used in fungal genetic studies to quantify genetic variability among strains and to track the process ofinheritance (Anderson, 1991).
Auxotrophic markers were the first to be used to establish the basic facts of life cycle of the most commonly cultivated mushroom, A. bisporus (Raper et al., 1972; Elliott, 1985). However, the number of auxotrophs currently available is very small because of the difficulties to obtain them and the process to induce such mutations may result in unintended damage to the strain (Anderson, 1991). More recently, genetic markers that are naturally existing have been detected and developed in some fungi (Royse and May, 1982; Kerrigan & Ross, 1989; Wang et al., 1991). These markers include allozyme and DNA based markers. AUozymes are enzymes differing in electrophoretic mobility as the result of allelic differences in a single gene (Royse & May，1992). Allozyme electrophoresis has been used to study the life histories of mushrooms since the early 1980s (May & Royse，1981) and has shown its ability to analyse genetic information (Spear et al., 1983; Royse et al.’ 1987; Bowden et al, 1991). However, the availability of allozyme markers is also small and the expression of such markers is still under physiological and genetic controls (Anderson, 1991). Nowadays, emphasis is placed on DNA based markers such as restriction fragment length polymorphisms (RFLPs), random amplified polymorphic DNAs (RAPDs) and arbitrarily primed polymerase chain reaction (AP-PCR). They provide direct
17 fotroduction
examination of the genome and have practically inexhaustible source (Anderson, 1991).
1.4.1.1 Restriction fragement length polymorphisms (RFLPs) RFLPs are based on variations in banding patterns produced by restriction endonuclease and brought about by point mutations or rearrangements. Allelic relationship between individuals is shown by hybridization patterns of enzyme-digested genomic “ DNA with specific probe(s) (Southern, 1975; Anderson, 1991). It is one ofthe conmionly used DNA markers in genetic studies. Li mushrooms, such as A. bisporus and L edodes, RFLPs have been used to analyse DNA polymorphisms and construct genetic maps (Bostein et al., 1980; Castle et al., 1987; KuUcami, 1991).
1.4.1.2 Polymerase chain reaction (PCR) 12 years ago (1983)，a novel method, the polymerase chain reaction (PCR), was discovered that permits the in vitro replication of selected nucleic acids (Mullis and Faloona, 1987). It is so sensitive that even a single gene copy can be detected following nuclei acid amplification (Mullis etal； 1986; Mullis & Faloona，1987; Bej, 1991). The PCR components include: the segment of DNA to be amplified (double-stranded DNA or cDNA from RNA, referred to as template); two single stranded olignonucleotide primers flanking the target region; a DNA polymerase; four deoxyribonucleotide triphosphates (dNTPs), a suitable buffer and magnesium ions. The typical method consists of repetitive cycles ofthree steps:
18 fotroduction
(i) DNA denaturation: double-stranded template DNA is dissociated to single-stranded DNA by incubation at a high temperature (usually 94°C or 95°C). (ii) Primer annealing: two primers arnieal to their complementary template strands at a lower temperature of30°C - 60 °C. (iii) Chain extension: primers are extended through addition of nucleotides to their 3’ ends by the action ofthe polymerase at 72°C. PCR products can mostly be resolved on agarose gel or polyacrylamide gel (Foster et al., 1993). By exponentially amplifying a target sequence, PCR significantly enhances the possibility of detecting target gene in complex mixtures of DNA and also faciliates the cloning and sequencing ofgenes. Amplification ofDNA by PCR have been applied in many areas of biological research, including molecular biology, biotechnology and medicine (Kwok & Sninsky，1989; Amheim et al., 1990; Ochman et al., 1990;WelshWa/., 1990). In fungi, one of the first use of PCR was the amplification of ribosomal DNA sequences and the determination of their evolutionary relationships OVhite et al., 1989). Now it has spread to many areas such as cloning, sequencing, gene manipulation and so on.
1.4.1.2.1 Arbitrarily primed PCR (AP-PCR) Conventional PCR requires prior information on target gene sequences and thus restricts the use range of this technique. Many modifications have been developed shortly after the first report of PCR and expanded considerably its utilization (Foster et al., 1993). The arbitrarily primed PCR (AP-PCR), or random amplified polymorphic DNAs (RAPDs), which use non-specific primer(s) to produce DNA fingerprints relieved the requirements of any prior sequence information and thus used in
19 Introduction
many organisms, especially mushrooms about which genetic information is scarce. AP-PCR and RAPDs were devised in 1990 by Welsh and McClelland and Williams et al., respectively. These methods use arbitrary primer(s) and low stringency conditions for primer annealing. RAPDs uses short oligodeoxynucleotide primer which contains 50-80% G+C composition and no palindromic sequence, while AP-PCR has no restriction on the chosen primers. These primers are now available commercially. For example, Operon Technologies (Alameda, California) sells kits of 20 different random 10-mers. The lower primer annealing temperature allows various regions of the target DNA to be amplified (Welsh et al., 1990; Williams et al., 1990). The polymorphisms between individuals result from sequence differences in one or both ofthe primer binding sites and are visible as the presence or absence of a particular AP-PCR or RAPDs band (Rafalski & Tingey，1993). AP-PCR and RAPDs have been widely used in fingerprinting genomes, analysing linkage relationships and mapping, phylogenic studies and detecting genetic variations. Various organisms have been studied, ranging from bacteria (Fekete et al., 1992) to fimgi (Wyss & Bonfante， 1993), plants (Rafalski & Tingey，1993) and animals including human being (Welsh & McClelland，1990). Jn mushrooms, AP-PCR and RAPDs have been used in the genetic studies of A. bisporus, L edodes, Coprinus cinereus and Volvariella volvacea (Kerrigan et al., 1992; Khush et al,, 1992; Kwan et al., 1992; Pukkila, 1992; Chen, 1994). Kerrigan et al. (1992) generated 64 natural genetic markers, including 2 allozyme markers, 24 RFLPs markers and 38 RAPDs markers. By following the transmission of these 64 markers in the offspings, they
20
M^^M^^^^—^—^^^M^^^^^——^MI^^———^^—^^^^^^^^—^^M^^—IM^^——^—^M^M^———WWB^mni • 111Hlli— \Wili_ || I _W fotroduction
demonstrated conventional meiosis behaviour in A. bisporus in which both independent assortment and joint segregation of markers occurred but crossing-over was infrequent. They also constructed the genetic map of this mushroom. For the first time, the genome oiA. bisporus could be surveyed extensively and loci determining economically important traits in this fungi could be localized. This study 'mA, bisporus, as well as another study conducted by Khush et al in 1992, in which they showed the use of RAPDs markers in strain differentiation and the identification and isolation of homokaryons/heterokaryons, proved the value of RAPDs in mushroom genetic research. Chiu et al (1992) had demonstrated from their studies with L edodes by AP-PCR that AP-PCR can be used to: 1. Typing, i.e., strain identification, 2. Confirmation ofprotoplast fusion products%brids, 3. Identification ofspecies-specific DNA markers, 4. Establishing monokaryon-dikaryon relationships, 5. Demonstration of dedikaryonization, 6. Generation ofpolymorphic molecular markers which may be used as genetic markers in progeny analysis. AP-PCR and RAPDs share the same methodology and in comparison with RFLPs, they have several advantages (Rafalski & Tingey，1993) (Table 2). First, the results are rapid, the whole analysis, from reaction to gel, can be completed within one working day, while RFLPs requires at least three days. Second, the method is simple. There is no hybridization or detection techniques required. Third, they do not need gene library or any form of a clone required as a probe. Fourth, AP-PCR and RAPDs analysis requires very small quantities ofDNA, whereas for RFLPs, much
21 Introduction
larger amount of DNA with good quality is required. With these advantages, especially the ignorance of any background DNA information, AP-PCR and RAPDs have great potential in the genetic studies ofmushrooms which are still lacking ofbasic information. In V. volvacea, use of AP-PCR or RAPDs was just started in 1994 by Chen to distinguish three V. volvacea strains: V14, V22 and V34. Other applications are not found yet.
Table 2 Properties of RFLPs and RAPDs/AP-PCR (modified from Rafalski & Tingey，1993). RFLPs RAPDs/AP-PCR principle endonuclease restriction DNA amplifacation with southern blotting random primers hybridization type of polymorphism single base changes single base changes insertions insertions deletions deletions genomic abundance high very high level of polymorphism medium medium dominance codominant dominant amount ofDNA required 2-10 ^ig 10-25 ng sequence information required? no no radioactive detection required? yes/no no development costs medium low start-up costs mediumMgh ]^
22
^•^^—^^M^^—^M^——^——^^^M——l^^^——I^^MM^1^—^^M^^—————^^^^^^M^M^——W—M—_l_l|i^_IIIMII_l|ii_ll_l«HII»l 111 1111inm^onF***^*-"^'—™-^- fotroduction
]n V. volvacea, use of AP-PCR or RAPDs was just started in 1994 by Chen to distinguish three K volvacea strains: V14, V22 and V34. Other applications are not found yet.
1.4.2 Protoplasts One of the most significant development of mushroom biotechnology during recent years has been the isolation, culture and fusion of protoplasts (Cocking, 1972). Neurospora crassa was the first reported filamentous ftmgus from which protoplasts were isolated (Emerson & Emerson, 1958; Bachmami & Bonner，1959). Since then, protoplasts have been obtained from more and more filamentous fungi (Meinecke, 1960; Moore, 1975; Chang et al., 1984; Kitamoto et al., 1988, Tamova et al., 1993) and these structures have become the tool in several key areas of fungal biology such as transformation, cell wall synthesis (Peberdy, 1995).
1.4.2.1 Protoplast isolation Protoplast isolation has been described in many Basidiomycetes including the commonly cultivated edible mushrooms A. bisporus, L edodes, P. sajor-caju and V. volvacea (Chang et aL, 1984; Peberdy & Fox^ 1991; Peberdy, 1995). The basic system for protoplast isolation includes (Peberdy, 1995): i) fungal material: cells, mycelium or spores; ii) an enzyme mixture that digests the hyphal wall; iii) an inorganic salt or organic solute to make the solution isotonic with the cytoplasmic contents and iv) a buffer.
23 fotroduction
Enzyme, osmotic stabilizer and buffer are all subject to variation for different fungal materials (Peberdy, 1991). A variety of systems used in the most commonly cultivated mushrooms is listed in Table 3.
1.4.2.2 Mycolytic enzymes Mycolytic enzymes which digest away fungal cell wall to liberate protoplasts are mostly of microbial origin (Peberdy, 1991). Liitially, strains of Streptomyces species isolated from soil samples were found to cause lysis of fungal cell walls and were used in the production of lytic enzymes. Later the lytic activity in Trichoderma harzianum was also discovered (Peberdy, 1985). Most enzymes produced in recent years have been derived from strains of Trichoderma harzianum. Some lytic enzymes which have been used to release protoplasts are compiled in Table 3. Mbrmation on wall composition in edible mushrooms is very scanty (Mendoza et al., 1987; Peberdy, 1991). The current available results revealed that the major components were chitin, p-glucan and a-glucan, indicating the requirement of corresponding hydrolytic enzymes for digestion. Lytic enzymes usually exist as a mixture of several hydrolytic enzymes, mainly chitinase, P-glucanase and a-glucanase (Hamlyn et al., 1981). Studies on several lytic enzymes including Novozym 234 OSFovo Industries Ltd, Bagsvaerd, Denmark); lywallzyme (prepared from Trichoderma longibrachiatum Rifai by Guangdong Listitute of Microbiology, China) and Cellulase CP (John & E. Sturge Ltd, Selby, North Yorkshire, England) by Yu and Chang in 1987 showed that
24 fotroduction
Novozym 234 provided the best chitinase, P-glucanase and a-glucanase activities. Novozym 234 produced satisfactory protoplast yield in many ftmgi including edible mushrooms such as V. volvacea, Pleurotus and Lentinus (Lau et aL, 1985). However, its action is not universal against all fungi and why the walls of some fungi are resistant to Novozym 234 are unknown (Hocart & Peberdy，1990). Table 3 Protoplast isolation system in some edible mushrooms (sources: klitrennikoff&Bloomfield，1984; Kitamoto etal； 1988; Peberdy, 1991) organism stablizer lytic enzyme used Agaricus 0.5M MgSO4 induced lytic enzyme bisporus 0.6M MgSO4 lywallzyme 0.6M sucrose induced lytic enzyme 0.5M MgSO4, chitinase, Novozym 234 lmM CaCl2
Lentinula 0.5M MgSO4 induced lytic enzyme edodes 0.6M MgSO4 p-glucuronidase, celluase 1.2M MgSO4 induced lytic enzyme 0.5M mannitol celluase, chitinase, Zymolase 60,000 0.6M mannitol celluase, chitinase
Pleurotus 0.4M MgSO4 lywallzyme sajor-caju 0.6M MgSO4 celluase, Novozyme 234 0.7M mannitol p-glucuronidase, celluase
Volvariella volvacea 0.5M MgSO4 induced lytic enzyme 0.6M MgSO4 Novozym 234 1.2M MgSO4 induced lytic enzyme, Novozym 234 1.2M KC1 induced lytic enzyme, Novozym 234 0.6M NaCl Novozym 234 0.6/0.8M mannitol lywallzyme Novozym 234
25 fotroduction
Activity of a lytic enzyme is also subject to batch variation with respect to yields ofprotoplasts resulted (Peberdy, 1995). bi digestion complex, their activities will also be affected by other factors such as osmotic stabilizer (Yu & Chang，1987). Therefore, optimized conditions for protoplast yield are different from strain to strain (Peberdy, 1991).
1.4.2.3 Osmotic stabilizers Osmotic stabilizer is required to keep the fragile protoplasts from bursting after they are released from the cell walls. Results from many studies showed that, generally, inorganic salts (except heavily-charged cation and anion), sugars and sugar alcohols are good for filamentous fungi (Davis, 1985; Yu & Chang, 1987; Peberdy, 1991). MgSO4, mannitol and sucrose have been the most commonly used in Basidiomycetes (Yu & Chang， 1987; Peberdy, 1991). The types of osmotic stabilizer vary in each laboratory and the determination of the most effective osmoticum for a given fungus is empirical (Peberdy, 1991). Jn fact, the mechanism involved in the digestion has not been understood yet. The osmotic stabilizer and the lytic enzyme interact each other in the digestion mixture (Peberdy, 1991). Yu and Chang (1987) observed that chitinase was the most sensitive to inhibition by the various compounds tested. For inorganic salts, the inhibition increased in the order: NO3-，C1' < SO4^" < PO43-, and Na+，K+ < Mg〗+，Ca� +However. , MgSO4 has been shown to be equally efficient as KC1 and NH4Cl for protoplast liberation (Davis, 1985). For organic compounds, Yu and Chang (1987) showed sucrose at a concentration of 600 mmol/1 had no effect on chitinase or P- glucanase activity, but there was a 50% inhibition ofa-glucanase activity.
26 fotroduction
Mannitol and sorbitol enhanced chitinase activity about 2-fold, had no effect on p-glucanase but produced a 20-30% inhibition ofa-glucanase.
1.4.2.4 Physiological condition ofmycelium The importance of the physiological condition of mycdium used for protoplast isolation has been reported for many fungi (Peberdy, 1989). Most reports indicated poorer protoplast yield in Basidiomycetes when compared to other species. Mycelia of most Basidiomycetes grow very slowly and the different phases of growth are less distinct. However, whether it is an important factor in poor protoplast production is unknown (Peberdy, 1995). Jn P. sajor-caju, Lau et al. (1985) found that protoplast release was markedly affected by the age of the mycelium. One day old mycelium gave a yield of 3.2 X 10W, while four day old mycelium gave only 7.0 X 10Vml.
1.4.2.5 Protoplast regeneration The process of new wall formation on the protoplast surface and regeneration to the normal cell form are the crucial events in the application of protoplasts in genetic manipulation (Peberdy, 1991). Regeneration frequency is normally assessed on the basis of counts ofthe colony forming units. Jn many fimgi, especially Basidiomycetes, such frequency is low, less than 10% (Chang et al., 1985; Lau et al., 1985; Peberdy, 1989; Zhao & Chang，1993). As with protoplast isolation, the optimization of conditions for regeneration is also empirical with external factors such as osmotic stabilizer and lytic enzymes used (Peberdy, 1991). Lau et al. (1985) found in their study that mannitol, when compared with KC1 and MgSO4,
27 fotroduction
is the most effective osmoticum in the regeneration of protoplasts of P. sajor-caju. Zhao and Chang also showed in their study in 1993 the suitability of mannitol for protoplast regeneration in the several edible mushrooms they tested.
1.4.2.6 Application ofprotoplasts Protoplasts have played an important role in genetic study and manipulation in fungi. A new experimental approach to karyotype analysis, called pulse-field gel electrophoresis (PFGE), involving subjecting intact chromosomes to a pulse field in an agarose gel matrix has been used widely in ftmgal genetic research since its first development in 1984 (Walz, 1995). The prerequisite for a successful karyotyping by PFGE is the isolation of an adequate quantity of protoplasts as the source ofintact chromosomes. In genetic manipulation, protoplasts are used in two areas: fusion and transformation (Peberdy，1991). Through protoplast fusion, it is possible to bring together whole genomes of related or unrelated strains and promote recombinations leading to production of novel strains. This technology has been adopted with several mushrooms such as Coprinus, Pleurotus and Lentinula (Peberdy， 1991). Transformation is the introduction of the gene of interest into the cell through a vector DNA molecule. Up to now, most successful methods to introduce DNA into fimgal cells have been using protoplasts (Peberdy, 1995). In other areas, such as strain improvement and detection of pharmacologically important drugs, protoplasts also provide a useful tool.
28 Introduction
1.5 Purpose and significance ofthis genetic study on V. volvacea In order to find out whether and how genetic variations exist in V. volvacea, a genetic analysis was carried out. The F1 and F2 progenies were obtained to examine inheritance pattern. AP-PCR (arbitrarily primed polymerase chain reaction) is one of the most commonly used PCR methods in DNA fingerprinting. Since it requires no prior sequence information, it was used in this study to detect any genetic variation in V. volvacea about which the DNA sequenc& information is still unavailable. In addition, morphological and physiological characters such as colony morphology and growth rate of the progenies were also examined. This study can detect evidence for the existence of genetic variations in V. volvacea. Thus, further studies on the variation-generating mechanisms and other details in the life cycle ofthis mushroom can be carried out.
29
——^^—•^^^^^^^•^^•——^^^^—^^^^^^M^^^^^^^—l^—I^^^^^^^^^^^^^^^^^^^^B^——^M^—BaaB»—iiAKJJ」Ji_lll_ ljWWmMPwnrwj_uwui Chapter 2. Materials and Methods
2.1 Organism Volvariella volvacea strain V34 was used. This strain originates from Thailand.
2.2 Cell cultivation and maintenance Cultures were maintained at 32°C on potato dextrose agar (PDA) which contains 200 gm of potato infusion and 20 gm of bacto-dextrose. To mass produce mycelium for DNA extraction, agar blocks of 1 cm in diameter carrying mycelium were aseptically inoculated into potato dextrose (PD) broth. The cultures were kept at 32°C stationary in darkness for 3-4 days.
2.3 Solutions and chemicals 2.3.1 Solutions for DNA isolation (a) Lysis Buffer: 50 mM Tris-HCl, pH 7.2; 50 mM EDTA, pH 7.2; 3% sodium dodecyl sulfate (SDS); 1% 2-mercaptoethanol. (b) TE buffer: 10 mM Tris-HCl (pR 8.0); 0.1 mM EDTA. (c) Phenol: Phenol (molecular biology grade, Sigma) was melted at 60°C and saturated with 1 M Tris-HCl ^pH 8.0). (d) Phenol: chloroform: isoamyl alcohol (25:24:1, pH 8.0±2): from Amesco or Pharmacia Biotechnology Ltd. (e) DNAase-free pancreatic RNase solution: Dissolve pancreatic RNase (RNase A) at concentration of 10 mg/ml in 10 mM Tris-HCl Q>H 7.5)
30
HHH^HHHBI^H^^H^^HIH^HI^^^BIHHII^HHHII^H^^HIHmHIHHHHHBBIHBmB^BUSffiWffiByaffiHBR Materials and Methods
and 15 mM NaCl. Heat at 100°C for 15 minutes. Allow to cool slowly to room temperature. Store at -20°C.
2.3.2 Solutions for agarose gel electrophoresis (a) 5 X TBE buffer: 0.089 M Tris base; 0.089 M boric acid; 0.002 M EDTA (pH 8.0). Store at room temperature. (b) 6 X gel loading buffer: 0.25% bromophenol blue, 0.25% xylene cyanol; 30% glycerol in distilled H2O. (c) 10 mg^nl ethidium bromide: 100 mg ethidium bromide in 10 ml distilled H2O. Store at 4°C in darkness.
2.3.3 PCR primers and reagents Primers: (a) M13 forward sequence (M13sq): 5'- CGCCAGGGTTTTCCCAGTCACGAC -3， (b) M13 reverse sequence (M13rs): 5'- AGCGGATAACAATTTCACACAGGA -3' Reagents:
Replica-Pack Reagent Set (Boehringer Mannheim).
2.4 DNA extraction and purification
Fresh mycelium was freeze-dried and ground in liquid nitrogen using a set of sterilized and precooled mortar and pestle. Genomic DNA was extracted and purified following the mini-preparation method (Lee & Taylor，1990). The ground mycelium was transferred into a 1.5 ml eppendorf tube and 400
31 Materials and Methods
^1 lysis buffer was added. Then the content was mixed by a pipette tip to obtain a homogenous solution, which was then incubated in a 65°C water bath for 1.5 hours with occasional inversion. Then one volume of phenol: chloroform: isoamyl alcohol (25:24:1) was added, and the tube was inverted gently to mix. The clear top phase was transferred to a new tube after 10 min of centrifugation at 14,000 x g. Phenol extraction could be repeated 2-3 times to remove the proteins. Then, 0.1 volume of 3 M sodium acetate and 1 volume of ice-chilled isopropanol were added and mixed gently. The tube was left at -20°C for 2 hours and the precipitated DNA was pelleted by centrifugation at 14,000 x g for 2 min. The pellet was rinsed with 70% ice- cold ethanol, air dried and resuspended in 100 ^1 TE buffer. RNA was removed by adding 5 ^il of 10 mg/ml RNaseA solution and incubating at 37°C for 1 hour. Then 100 mg of cesium chloride (CsCl) was added and the tube was gently shaken to dissolve the CsCl. After centrifugation at 14,000 x g for 15 min, the supernatant containing purified DNA was transferred to a new tube. Three volumes of TE buffer were added, and followed by 1 volume of isopropanol. Then the solution was centrifuged again. DNA pellet was rinsed with ice-cold 70 % ethanol, air dried and resuspended in 100 ^il TE.
2.5 Agarose gel electrophoresis DNA samples were loaded and resolved on agarose gel (LE grade, FMC). A 100 bp ladder (Pharmacia) or HinAlll digest of phage lambda DNA (Pharmacia) was loaded in parallel to serve as DNA size marker. After electrophoresis at 80 v for 120 min (for PCR products), or, at 100 v for 90
32 Materials and Methods
min (for genomic DNAs), the gel was stained by 0.5 ^g/ml ethidium bromide for 20 min, destained in H2O for 2 min and photographed under UV transillumination using Polaroid fibn (type 667，speed = ISO 3000) or pictured with video camera and saved as a computer file using the gel documentation system (BIO-RAD, model no.: GS 670).
2.6 Arbitrarily-primed polymerase chain reaction (AP-PCR) In 50 ul PCR reaction mixture, there were the following components: lx PCR buffer (Boehringer Mannheim), 10 ng of genomic DNA, 4 mM MgCl2, 0.2 mM each of dNTPs (Boehringer Mannheim), 1 ^M primer, (Operon Technologies, Alameda) and 2.5 U Taq DNA polymerase (Boehringer Mannheim). The mixture was overlaid with mineral oil (Sigma). The reaction was performed in a thermal cycler (minicycler, MJ) programmed as: 2 low stringency cycles at first (94�C， min5 ; 35�C， min5 ; 72�C， min)5 , then 38 high stringency cycles (94°C，1 min; 55°C, 1 min; 72�C， min2 ) and a fmal 10 min chain extension at 72°C. Amplification product was checked by resolving 5 ^il ofPCR mixture on 3 % NuSieve agarose (FMC) as mentioned in section 2.5. The experiment was repeated at least once.
2.7 Protoplast isolation and regeneration 2.7.1 Preparation ofprotoplasts Volvariella volvacea was grown on PDA plates at 32°C for 1 week. Then agar blocks (1 cm in diameter) carrying mycelium were transferred into 100 ml PD broth contained in a 250 ml conical flask and cultured for 3 days at 32°C stationary. Mycelium was harvested by filtering through a sterilized
33 Materials and Methods
nickel sieve and washed with sterilized 0.8 M mannitol solution. It was soaked-dry by sterilized absorbent paper. Then the mycelium was suspended in filter-sterilized lywallzyme solution (10 mg/ml in 0.8 M majmitol) (Guangdong Listitute of Microbiology, China) and was digested for 1.5 hours at 30°C at 100 rpm. To harvest protoplasts, hyphal fragments were removed by filtration through about 5 mm thick cotton packed in a 5 ml syringe. Protoplasts were collected from the filtrate by centrifugation (3,000 rpm at room temperature for 10 minutes). Pellets were resuspended in 0.8 M mannitol. The optimum condition for protoplast yield used in this study was determined by digesting mycelium of various ages (2 - 4 day old) with lywallzyme for different times (1 hr, 1.5 hr, 2 hr and 2.5 hr). Protoplast concentration was measured by haemocytometer.
2.7.2 Regeneration of protoplasts Protoplasts in 0.8 M mannitol were diluted to around 10^ protoplasts/ml. Then 0.1ml diluted suspension was spread onto a MCM plate (2 g/1 yeast extract; 2 g/1 peptone; 0.5 g/1 MgSO4 • 7压0; 0.46 g/1 KH2PO4； 1 g/1 K2HPO4； 20 g/l glucose; 0.8 M mannitol) and incubated at 32°C. Regenerated protopasts were picked up with a needle and transferred to fresh CM medium (0.5 g/1 MgSO4 • 7氏0; 0.46 g/1 KH2PO4； 1.5 g/1 K2HPO4； 2.0 g/1 peptone; 15 g/l glucose; 2.0 g/1 yeast extract; 0.5 mg/1 Thiamin HC1). The regeneration frequency was calculated according to the average number of regenerated protoplasts on four MCM plates. Viable hyphal fragments could form colonies on both types of plates while regenerated protoplasts could survive only on MCM plates. Jn parallel, protoplast suspension was
34 Materials and Methods
also spread onto MCM plates without mamutol as control. For each type of media, four plates were spread. R. F. = no. ofregenerated protoplasts X 100% no. oftotal protoplasts R. F.: regeneration frequency Where number of regenerated protoplasts is counted by deduction of the number of colonies on MCM without mannitol from the number of colonies on MCM.
2.8 Single spore isolation and germination Volvariella volvacea mycelium was grown on PDA plates at 32°C for 4 days and then inoculated into plastic bags (size: 36 cm x 15 cm) 2/3 filled with compost (88% straw; 10% wheat bran; 2% lime; 60% moisture content). These bags were incubated at 34°C to let the mycelium run for 12-14 days. Then they were opened under the conditions of 28-32°C with humidity controlled at 85-95%. These bags were watered and illuminated every day in the following two weeks to harvest mature fruiting bodies. Spores were collected by placing a fruiting body in a petri dish with a sterile dry filter paper and incubated at 32°C for 4-5 hours. Then a small piece of the filter paper was cut and dipped into sterile distilled H2O to prepare a spore suspension. Spore concentration was counted using a haemocytometer and fmther diluted to arornid 10^ spores/ml. An aliquot of 0.1 ml ofthe diluted spore suspension was spread onto a CM plate and incubated at 32°C for 2 days. Germinated single spores were counted, then picked out with a needle and transferred to fresh CM plates using aseptic techniques.
35
^•!^^^^••^^^^^•^•••••^^^••^^^^^^^^^^^^^•!^^•^^^^^^^^^HIH^^^^^HIHII^^^^^^^^^^^^^^^IHII^^^^^^^^HHI^^^^^BHS^R^RSIMSMSRKSQS^SSmi Materials and Methods
The germination frequency was determined by average numbers of germinated spores on four CM plates: G. F. = average no. of germinated spores X 100% no. of spores spread G. F.: germination frequency
2.9 Growth rate measurement 2.9.1 Colony diameter measurement - Mycelial plugs of the same diameter (1 cm) of strain V34, a single spore isolate or a protoplast regenerant was transferred to fresh CM plates. After inoculation, the plates were incubated at 32� Cfor 4 days. Then colony diameter of each individual was measured at three different dimensions. Three replicates for one individual were made.
2.9.2 Biomass gain measurement Mycelial plugs of a strain (parental, single spore isolate or protoplast regenerant) was inoculated into PD broth and incubated for 4 days. Then wet mycelium was harvested and transferred into 15 ml fresh CM broth. This mycelium was homogenised in a sterilized blender cup using a Waring blender. A suitable volume (1 ml in this study) of mycelial suspension was pipetted into a 150 ml flask containing 20 ml of fresh CM broth to have similiar inoculum size. All flasks were incubated at 32°C stationary for 4 days. Then, mycelium was collected from each flask by filtering through nickel sieve and blotted dry with Whatman 3MM paper. The fresh mycelial
36 Materials and Methods
weight from each flask was then measured. For one isolate, three cultures were performed.
37 Chapter 3 Results
3.1 Genomic DNA extraction Genomic DNAs of V. volvacea strain V34, its protoplast regenerants and F1 progenies were extracted. DNA concentration and purity were checked by 0.7% agarose gel electrophoresis (Fig. 5) and spectrophotometty. The average yield ofDNA extraction in this study was 300 ug per gram offreeze- dried mycelium. In general, the absorbance ratios of 260 nm: 280 rnn and 260 nm: 230 nm were 1.9 and 1.8，respectively (Fig. 4). These DNAs were then used for polymerase chain reaction.
3.2 Genetic analyses ofV34 and its progenies 3.2.1 Protoplast regenerants 3.2.1 • 1 Protoplast preparation The effects of mycelial age and digestion time on protoplast yield were shown in Figure 6. Three-day old broth cultures gave the highest yield of protoplasts after digestion for 1.5 hr (Fig. 6): 1.27 土 0.08 x 10^ protoplasts / ml (mean value ofthree repeats).
38
—^^^^»^—^^^^^^^—^^^^—^^^^^^^^^^^^——^——^^—^^^^^^^^^^—^^^^^^——^H^^^^^^^^^—*^^^^^^^^^™WWWMBHaMi!,JaiBBBUWW— iN：^
1 \
0 1 • t _ I • I I , • ； • , . , 220 230 240 250 260 270 280 290 Wavelength (nm)
Fig. 4 A typical scan spectrum of genomic DNA sample from Volvariella volvacea strain V34 and its progenies.
39 Result3
1 1 3 4 5 6 1 8 BBB|
i»i ^ ™iH^I _MM w^^mt^mam I^HI^HHHBI WKtKM ^^^K^^^^^K^^^ Fig. 5 Agarose gel showing the genomic DNAs from Volvariella volvacea isolates. Lanes 1 and 8，DNA size standard: \'HinA\\l\ Lanes 2-7, genome DNA samples.
40 16 .
14 - 12 12.733
” i T ^ r 1- »^JM I ''''' • 9.292M:H 9.06 mycehum r^^^®-_ f, age (day) 動 门 Bj^^9_ ^^ ^9 _ I I mm I o2: 動 丨_3: ^ J ^^ I I i I I I =0.393 0.4 0.266 [“^ _ M^^ rnm^^ y^ , ‘ I ‘ > ； 1 1.5 2 2.5 Incubation time (hr)
Fig. 6 Protoplast yield from different ages of mycelia and different times of exposure to lytic enzymes.
41 Result3
3.2.1.2 Protoplast regeneration After spreading the protoplast solution onto MCM plates with mannitol and MCM plates without mannitol (as control), colonies appeared on the plates after 2-3 days. Number of regenerated protoplasts on both kinds of plates were counted and the regeneration frequency was calculated according to the equation in section 2.7.2 (Materials and Methods). The protoplast regeneration frequency in this study was about 10.9% as shown in Table 4.
Table 4. The regeneration frequency ofprotoplasts
average no. ofregenerated regeneration frequency = no. of protoplasts on a MCM plate regenerated protoplasts / no. of total protoplasts x 100%
with mannitol without mannitol 10.9 士 2.6 %
43.0i2.7 28.5 士 1.3
3.2.1.3 Morphology of V34 protoplast regenerants Different colony morphologies and growth rates were observed among V34 protoplast regenerants (Fig. 7). The colony diameters of six randomly choosen protoplast regenerants were measured (Table 5).
Table 5. Thecolony diameters ofprotoplast regenerants (4 day cultoe) protoplast no.3~~ no.5 no.7 no.9 no. 10 no.l4 V34 regenerants colony diameter(cm) 8.5土0.1 6.6土0.1 7.0士0.1 8.5士0.0 8.5士0.0 5.8士0.1 8.5士0.0
42 Results
|^^H .T # 1發
^^^|^^^^B^^^9 ^^ Ki^^ESiKl
Fig. 7 Colony morphologies of V34 protoplast regenerants.
43
^Ji^[j^^g^^jj^^^^[n^mi^jji^^^j^j^jimjjii^[mm^[i^jj[mjj^^jmiu^[mm^^mum^j^^[^^m^^^[[^^^[mjjj^^^^j^^jfl^^^^pi^^^§^^^^^^^^jj^j^^j3^^j^^^ Result3
3.2.1.4 Growth rate measurement Then mycelium of the protoplast regenerants and V34 were collected and their weight were measured, respectively (Fig. 8). The protoplast regenerants exhibited different growth rates: faster, slower, or similiar to that ofV34. Li this study, offsprings were divided into 3 groups based on their linear growth rates and the abundance of aerial hyphae. Fast-growing group, of which individuals had full petri dish growth and plenty of aerial hyphae. Li this group, they were similiar to V34. Medium-growing group, of which individuals had more than halfbut not covering the whole petri dish and less aerial hyphae; and the slow-growing group, of which individuals had less than halfpetri dish ofgrowth. For F1 progeny, isolates no. 8，no. 10 and no. 33 belonged to fast-growing group; isolates no. 3，no. 7，no. 23，no. 26 and no. 36 belonged to medium-growing group and isolates no. 6 and no. 9 belonged to slow-growing group.
3.2.1.5 AP-PCR analysis of V34 protoplast regenerants The two arbitrary primers: M13sq and M13rs, used in this study did not show any polymorphisms among the six tested protoplast regenerants and V34 (Figs. 9 and 10).
44 Result3
7 1 5.813 - 5.815
6 一 T T ^ - ^8 461^ 5.。53 5.04 ^^ I J I m _ _ i a
I 3 謹 _ _ _ • _ ^ \m m 霸•識• m
^ - I i i 1 i ； I
1- I 1 i 腹 _ i 圓 J圏w變丨1 1,1 11 1 3 5 7 9 10 14 V34 No. of protoplast regenerants Fig. 8 The biomass gain by six V34 protoplast regenerants after 4-day
incubation.
45 Result3
^^^^^^8
•
Fig. 9 AP-PCR profiles of six protoplast regenerants of V. volvacea V34 using primer M13sq. Lane 1，DNA size standard: A,-/f/>zdIII; lane 2-7, protoplast regenerants no.3, no.5, no.7, no.9, no.lO and no.l4; lane 8, V34.
46 Result3
^^^^^^^^^^^^^^3M ^
^^^^^|H^^^^^^^^^H^"'' ^^^K ^M^HP [^U^^^if1 f Hg^^^gnU^^^K im^^^^^^^^^^^^^^K
Fig. 10 AP-PCR profiles of six protoplast regenerants of V. volvacea V34 using primer M13rs. Lane 1，DNA size standard: X-Hin&ll', lane 2-7, protoplast regenerants no.3, no.5, no.7, no.9, no.lO and no.l4; lane 8, V34.
47 Result3
3.2.2 V34 single spore isolates (SSIs) - F1 progenies 3.2.2.1 Single spore isolation and germination V34 was cultured and fruiting was carried out. Spores from mature fruiting bodies were collected and germinated. Germination frequency was 31.1% in this study (Table 6).
Table 6. Germination frequency ofV34 spores no. of spores spread on each CM plate (a) 185
average no. of spores germinated (b) 57.5士 7.7
percentage of germinated spores=b/a xlOO 31.1 ±4.2
3.2.2.2 Morphology ofFl progenies Different colony morphologies and growth rates were also observed among germinated spores (F1 progeny) (Fig. 11). Colony diameters of ten randomly choosen single spore isolates were measured (Table 7).
Table 7. The colony diameters ofsingle spore isolates (SSIs) (4 day cultures) ~~SSIs no.3 no.6 no.7| no.8 no.9|no.lO|no.23 no.26 no.33 no.36 V34 colony diameter^-^-^-^ 4.0±0.1 8.5±0.18.5+0.03.0±0.18.5+0.05.5±0.1 7.5±0.18.5±0.07.5±0.18.5±0.0 (cm)
3.2.2.3 Growth rate measurement The weights of F1 progenies were measured. (Fig. 12). Highly variable growth rates among F1 progenies and V34 parent were observed.
48 Result3
^^Tf^- ： •^ 7^iP^|
^^^^A^^il^^^^^*^ii^f j^^^^^^^^n |
Fig. 11 Colony morphologies of V34 single spore isolates (F1).
49 7 n — I 6.358 5.996 ^ 6 - 1^ H 4.984 ^ H 5 ‘ 藝 • B 4.424 4.382 _iJls Q ^S MH ^a I^B 'fea i^i ^^ _[1» ^ ^ Hi~- 3 6 7 8 9 10 23 26 33 36 V34 No. ofSSIs
Fig. 12 The biomass gain by ten V34 single spore isolates (F1) after 4-day
incubation.
50 Result3
3.2.2.4 AP-PCR analysis of 10 V34 single spore isolates The two primers: M13 sq and M13rs, were used to detect ifDNA polymorphism existed in F1 progenies. The tested isolates gave highly similiar DNA profiles with parental strain V34 using arbitrary primers, M13 sq and M13rs (Figs. 13 and 14). Rare susceptible polymorphic DNA bands were observed but were not reproducible when the experiment was repeated.
3.2.2.5 Fruiting ability ofFl progenies Ten SSIs (Single Spore Isolates) of V34 were grown in compost bags to examine their fruiting ability (Table 8). All individuals with slow or medium growth rate could not even grow in compost. Among three fast growing individuals: no.8, no.lO and no.33 single spore isolates, two ofthem, no. 10 and no. 33，could fruit normally as V34 parent. No.8 could grow to primordial stage，but all primordia died shortly after their appearance. Table 8. Fruiting test ofFl progeny
n。T no.3 no.6 no.7 no.8 no.9 no.lO no.23 no.26 no.33 no.36 V34 SSls vegetative growth1 m. 一 _ _ + - + - - + - + composf fruitingin
b - - - P * - F - - F 一 F compost a: “-，，； no myceliimi growth; "+": with mycelium growth. b： “—，，； no primordia or growth; "P*": primordia aborted; "F": mature fruiting bodies.
51 Result3
^^^^j^^^^^^^on^2 9Hi99 mStSm ^^^^^^^^^HT VK^^^K2^^^^B •
Fig. 13 AP-PCR profiles of 10 single spore isolates of V34 using primer M13sq. Lane 1，1 kb DNA size standard; lane 2-11, SSIs no.3, no.6, no.7, no.8, no.9, no.lO, no.23, no.26, no.33 and no.36; lane 12，V34.
52 Results
12 11 10 9 8 7 6 5 4 3 2 1 m^HH^H^^H^^^H|^^^^^^^^^^_
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^|^^^H ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^H
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^H
|^^^^^^^^^^|H^^^[^lf|^^HI^^H{^g^^^^^^^^^^^^^|
^^^^^^^^^^MHHflfl^^^^^H^^^^^^^^^^^^^^^^^| ^^^H^^B^I^B^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^I IH|K2|^^M^H^^^H^^^| ^^^^^^^^H^^^^jjl^^^^^^^^^^^^^^^^^g ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^*^^^^^^^^^^^^^^^^^ Fig. 14 AP-PCR profiles of 10 single spore isolates of V34 using primer M13rs. I (i« Lane 1, 1 kb DNA size standard; lane 2—11，SSIs no.3, no.6, no.7，no.8, no.9, no.lO, no.23, no.26, no.33 and no.36; lane 12, V34.
53
^^M^—ii^^^—^M^M^M^^——^^—MMI—iMMWMllmilllll_IIBIII_illll ' Results
3.2.3 Single spore isolates from F1 progenies-F2 progenies 3.2.3.1 Colony morphology and growth rate Spores were collected from two F1 progenies which did fruit: no.lO and no.33. After germination, morphological variations in the F2 progenies still existed (Figs. 15 and 16). The colony diameters of the F2 progenies were measured (Tables 9 and 10). Their gowth rates were also measured (Figs. 17 and 18).
Table 9. The colony diameters of single spore isolates ofNo.lO F1 progeny (4 day cultures) SSIs no.l no.2 no.3 no.4 no.5 no.6 no.7 no.8 no.9 no.l4 No.lO colony
diametei8.5±0.0 8.5+0.0 8.510.0 8.5±0.1 8.5±0.1 8.5±0.14.0±0.1 3.9±0.1 3.7±0.1 1.6±0.1 8.5±0.0 (cm) Table 10. The colony diameters of single spore isolates ofNo.33 F1 progeny (4 day cultures) SSIs no.l no.2 no.4 no.5 no.6no.7 no.9 tio.lO no.ll no.l2 No..33 colony diameter8.5±0.0 8.5±0.0 8.510.1 8.510.0 8.5±0.0 8.5±0.1 5.2±0.5 7.5±0.1 5.210.4 6.110.1 8.5±0.0 (cm)
54
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^m^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^M^^^^^^^^^^^^^^^^^^^^^^^^M^^^^^^^M^^^^^I^^^^^^^M^^^^^M^^^^^^BBBS^^*j^Mi^^^^^^^^^^^^ Results
|^lJ ^^^mm^m^^¾ 1^¾ HKH^
Fig. 15 Colony morphologies of single spore isolates of No.33 (the F2 progeny).
55
i^^i^^i^^^i^^^^^^^^^^^^^^^i^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^i^^^^^^^^^^^^^^^i^^^^^^i^^^^^^^^wis^K^si^^Bj^s^^^^^^^ Result3 ^^m
^Hj^3^^^^^^^^^^E^^| ^KKl ^^^^^BH ^m^^^^^^^^^^^^^^m^^^M
pi|^B^KH
56
mmI Fig. 16 Colony morphologies of single spore isolates of No.lO (the F2 progeny). 7 ^ G.24 , 6.07 6 i jlj _ m _ f ‘ ‘ 4.31 I I ^ A [^ W _ 'p 外-3.53 朽 ^i 3.47 3.5 3.47 麗 t;||ii|| || E I 1 二雾• i f 1.4 1.39 1.43 I I :illyjjjjjiLi 1 2 3 4 5 6 7 8 9 14 S10
No. of single spore isolates ofS10
Fig. 17 The biomass gain by ten single spore isolates ofNo. 10 after 4-day
incubation.
57 8 6 1 ^^i^liii%i s 6 力2 ^¾¾¾^^^ ^ n“^““^—TT““n”n! J ^^n^^^ia^ 4 ^ t^ (3) ul^pM ^^££^^^s^^p^s
2 ,_^^^iii^^3 ^ S ^ S lumlsxol * ^g^^^ -isiii i n t^^s,广(.f^.^.v^t4c^ € - o S H”-iw5#Fwd ii^ 1 Fr^_2 1 K ^^ ？ # ^^^3 : . |v f ^^ ^ e s >«^^- . o m 8 ^ 1 aJ 5 9 1 < 6 - ¾2 4 o ”” 5 ^ ^ .du ^ ^ ^ s ^ .2 I • ^^ _ .^ J n 1 ^ -a-^.J I I ^ I .細 遣 8 •阮•咖 1 T ^ a 3 r ^ n ^ .u . 譯
对
5 Chapter 4 Discussion
4.1 Protoplast isolation and regeneration The isolation of protoplasts is a total result of the interactions of many factors. The three major factors are: lytic enzyme, osmotic stabilizer and the physiological state of the mycelium. Although Novozym 234 was reported in many studies to give the highest chitinase, p-glucanase and a- glucanase activities and also very satisfactory protoplast yield in many fungi, including Volvariella volvacea (Chang et aL, 1985; Yu & Ghang, 1987; Peberdy, 1995), it is too expensive to be widely used. The lywallzyme used in this study is derived from Trichoderma longibrachiatum and was very effective in the lysis of several edible mushrooms such as Agaricus, Lentinula and Pleurotus (Chang et aL, 1985; Zhao & Chang 1993). Result of protoplast yield from this study (1.27 土 0.08 X 10^ protoplast/ml) also proved its effectiveness for Volvariella volvacea.
As an osmotic stabilizer, mannitol was choosen because it has been one of the most commonly used in Basidiomycetes and it was also shown to enhance chitinase activity in digestion mixture (Yu & Chang，1987). In the prelinmiary experiments, both spores and vegetative mycelium were used to release protoplasts but spores were more resistant to lytic enzymes than vegetative mycelium and gave much lower yield. Another tissue tried was young gills of fruiting bodies at the button stage. They gave rather high yield comparable with that ofvegetative mycelium. They were not used because fruiting bodies are not easily available as with vegetative mycelium.
59 Discussion
Regeneration of protoplasts is a very important step to apply protoplasts in genetic manipulations. However, in many fungi, especially Basidiomycetes, regeneration frequencies are low (Peberdy, 1989). Jn P. sajor-caju and V. volvacea, Chang and co-workers (1985) observed that the regeneration frequencies of both fungal protoplasts were lower than 1%. Lau et al. (1985) showed a 4-6% regeneration frequency in P. sajor- caju. Zhao and Chang (1993) showed in their study that, among the several mushrooms examined, the highest regeneration frequency of 9.6% was found with P. florida and the lowest of 0.96% with L edodes. Li this study, the regeneration frequency was 10.9% in Volvariella volvacea. The reason for low regeneration frequency is still not known (Peberdy, 1995). Santiago (1982) observed that the cytoplasm in a mycelial cell during protoplast release was repeatedly constricted to divide into two or more spherical bodies. Some of them had no nuclei. Moreover, it is also possible that protoplasts which possess nuclei might have lost some other important organelles, such as mitochondria, resulting in insufficient energy production and biosynthesis of proteins/reserve materials which are needed in cell growth. Even if there is no loss of nuclei or mitochondria, the protoplasts isolated from fungal mycelium are very heterogeneous because of the spatial differentiation of biochemical activities in the growing hyphae. The poor regeneration of protoplasts from many fungi may be a reflection of the heterogeneity (Peberdy, 1995). The attempt to isolate protoplasts from spores was to produce a more homogeneous preparation with a presumed higher regeneration frequency. However, regeneration frequency of spore protoplasts was still significantly lower than 90% (Bos, 1985). This could be because some spores may not be fully developed or matured.
60 Discussion
External factors also affect regeneration of protoplasts, such as presence oflytic enzymes. These enzymes are used to iyse cell walls and therefore liberate protoplasts. If they are not completely removed from protoplast preparation, the residue enzyme, even only a very small amount, is able to inhibit cell wall formation.
4.2 Phenotypic variations in Volvariella volvacea 4.2.1 Colony morphology It was found that there were wide variations in colony morphology among V34 protoplast regenerants, F1 single spore isolates and F2 single spore isolates (Figs 7，11，15, 16). Offspring individuals can be easily divided into "parental" and "non-parental" groups in which "parental" group have plenty of mycelium and aerial hyphae, while "non-parental" group does not. However, it is difficult to subdivide them because of the great variations among individuals such as presence or absence of concentric rings, abundance of aerialhyphae (Figs. 7, 11，15, 16).
4.2.2 Growth rate Two methods were used in this study to measure growth rate of the individuals: colony diameter measurement and biomass gain measurement. Colony diameter measurement, also called linear growth rate measurement, is a very simple method to measure fungal growth. It involves only the transfer of mycelial plugs with the same diameters and colony morphology can be observed directly from the agar plates. Biomass gain measurement, however, requires more manipulations and time and thus is slower and more complicated. Colony morphology information cannot be provided by the latter method. But colony diameter can roughly present the growth rate since mycelia usually grow radially in
61 Discussion
all directions. Those growing inside the agar cannot be measured. Moreover, there is no correlation between the spread area of a mycelial front on a solid surface and the total amount the fungus produced. On the contrary, biomass gain measurement provides accurate data on growth rate and thus is a better criterion in growth rate test. For instance, among F1 single spore isolates, No.3, No.7, No.8, No.lO and No.33 had the same colony diameters (8.5±0.0 cm or 8.510.1 cm) but their biomass gains were very different, ranging from 2.09±0.12 g to 6.36±0.15 g (Table 7，Fig. 12).
4.2.3 Fruiting ability Since 1969, Chang and colleagues have repeatedly shown that a single basidiospore of V. volvacea can germinate and form fruiting bodies by itself without any mating (Chang & Yau，1971; Li，1977; Chang et al., 1981; Li, 1991). Thus V. volvacea is taken as homothallic. Great variations among its single spore isolates were also observed in these studies. Li and Chang (1979), Chang and coworkers (1981) demonstrated that there was no correlation between the mycelial colony morphology, linear growth rate and self-fertility. Both "normal" isolates which grew vigorously to form a greyish-white colony with abundant aerial hyphae, and the "abnormal" isolates which differed from "normal", could be either fertile or sterile. Jn this study, 10 F1 single spore isolates were examined for their fruiting ability. The data agreed mostly with those previous description (Table 8). Both self-fertile and self-sterile individuals occurred among single spore isolates. All those individuals which could fhiit normally as their parent V34 were fast-growing ones. All medium or slow-growing isolates
62 Discussion
showed very poor or no vegetative growth in compost. However, not every fast-growing isolates can fruit normally. No.8 isolate, which was very fluffy and fast-growing, could only reach primordia stage and No.36 was sterile.
4.3 Genetic mechanisms for phenotypic variations in V, volvacea Li fungi, two mechanisms have been recognized to generate genetic variations: meiotic recombination and mitotic recombination (Raper, 1966; Fincham et al., 1979; Bos and Swart, 1995). ln the anaphase offirst meiotic division (MI)，homologous chromosomes segregate to the different poles of the spindle. In this way, a reassortment of non- homologous chromosomes is achieved. Before the chromosome seperation, exchange between sister or non-sister chromatids happens. If the homologous chromosomes carry different alleles at one or more loci, crossingovers between non-sister chromatids will result in recombination ofgenes (Fig. 1). Homologous chromosomes behave independently during mitosis. Sister chromatids separate during the anaphase resulting in two daughter cells with the same genetic information. However, genetic evidence in Aspergillus ^Sfga and Roper, 1968) demonstrated that homologous chromosomes can exchange parts of nonsister chromatids and unequal crossingover can occur during mitosis, resulting in duplication. Mitotic crossingovers also result in recombination ofthe genes (Fig. 2). Studies on nuclear behaviour and ploidy level at different developmental stages, sensitivity to radiation and segregation of isozyme markers proved the haploid life cycle of V. volvacea (Quaye, 1986; Royse et al., 1987; Chiu, 1993). Chiu (1993) concluded that a haploid uninucleate basidiospore germinates to haploid multinucleate mycelium and forms
63 Discussion
fruiting bodies. Then, a uninucleate hymenial initial divides mitotically to a binucleate condition, and karyogamy leads to a transient diploid stage. DNA replicates to 4N in content. Basidiospores are formed through meiosis and life cycle of V. volvacea is completed (Fig. 3). The transient diploid stage provides possibility for V. volvacea to generate meiotic recombinations leading to the formation of haploid, uninucleate basidiospores carrying genetic variations, bi principle, mitotic crossingover cannot occur when the nuclei of the fungus are haploid (Raper, 1966; Bos and Swart, 1995). JnAspergillus, it was observed that occasionally, two nuclei in a hypha cell can fuse and give rise to diploid condition (Bos and Swart, 1995). bi V. volvacea, since the vegetative mycelium is multinucleate, crowding of nuclei was commonly encountered (Li, 1977). Whether mitotic recombination exists in V. volvacea or not is uncertain. Mitotic recombination has been found (Smith, 1974; Bos and Swart, 1995). However, the frequency of mitotic crossingover is much lower than that ofmeiotic crossingover (Bos and Swart, 1995). During meiosis, many crossingover events occurred in each meiocyte, whereas mitotic crossingover in artificially induced unstable diploids could occur at a frequency as high as 10'^ in Neurospora crassa (Smith, 1974). Since basidiospores are meiotic products, they should bear higher frequency of genetic variation than protoplasts, which come from mitotic vegetative mycelium. Therefore, higher frequency of phenotypic variations should be observed in basidiospores. If we assume that phenotypic variations observed in this study were arisen from meiotic or
64 Discussion
mitotic recombinations, then these results agreed with the observations in which F1 single spore isolates did exhibit much more variations in their colony morphologies and growth rates (Fig. 11) than protoplast regenerants (Fig. 7).
4.4 AP-PCR analyses AP-PCR generates unique DNA profiles for every individual as demonstrated in many organisms such as bacteria, plant and man (Welsh & McClelland，1990; Fekete et al., 1992; Rafalski & Tingey, 1993). In mushroom L edodes, AP-PCR has been used for typing strains (Chiu et al., 1992; Chiu, 1993; Kwan et al., 1992). AP-PCR has been widely used in detecting genetic variations. The polymorphic bands generated from AP-PCR behave as dominant genetic markers (Rafalski & Tingey，1993). In V. volvacea, AP-PCR was first used by Chen (1994) to type three strains: V14, V22 and V34. Four arbitrary primers (Del, Eco, M13sq and Gal) were used and three of them (Del, Eco and M13sq) gave different banding patterns among the three strains. Jn this study, two arbitrary primers: M13sq and M13rs, were used to analyse V34 protoplast regenerants. Six randomly choosen protoplast regenerants and V34 itself were analysed. However, no polymorphism was detected by any of the primers (Figs. 9,10). Ten randomly choosen F1 single spore isolates were also tested. Results were surprising, too: all 10 F1 progenies as well as their parent V34, no matter how different their phenotypes were, their DNA banding patterns were similiar using primer M13rs and M13sq, respectively (Figs. 13，14).
65 Discussion
Different phenotypes may reflect variations in genetic makeup. Genetic information generally transfers from DNA to RNA and finally to poteins/peptides. DNA variations which can be expressed is able to be printed on RNA, resulting in polymorphisms in RNA fingerprint. These polymorphisms, however, do not mean the differences in DNA because of the gene expression regulation in DNA. Thus, RNA fingerprinting cannot be used to detect DNA variations. To hunt for the mechanisms generating DNA variation, it is crucial to understand the possible mechanisms.
4.5 Possible sources for variations Expression of morphological characters depends not only on the genetic information but also on environmental factors. However, the role of environmental factors is not taken into account in this study as well as previous studies on morphological variations among single spore isolates since all cultures were grown in uniform conditions as far as possible. Li and Chang (1979) suggested the differences among the progenies may due to either spontaneous mutations, or expression of pre-existed morphological mutants by recombination, or even chromosomal aberrations. Mitotic recombinations have been demonstrated in Neurospora (Smith, 1974)，although there is not enough evidence for V. volvacea yet. Also, in ftmgal nuclear divisions, asynchronous movement of chromosomes is very common (Heath, 1978). Mitotic nondisjunction of sister chromatids may lead to aneuploidy. Such genetic variation cannot be detected since there are normal nuclei in the same thallus (Chiu & Chang，1987). Other sources of variation may come from other genetic materials besides the nucleus, such as mitochondrial genome or transponsons.
66 Discussion
Transposons, if present, can move around in the genome. Thus there is induced variation in the phenotype. Detection of the transposons is difficult as they are not stably inherited and the random movement in the genome.
4.5.1 Mitochondrial DNA (mtDNA) Because of the genes encoding subunits of the respiratory chain complex and ATPase in mtDNA, defects in mitochondrial genome usually be expressed in the progenies as affecting their growth rates. Li Neurospora and yeast, mitochondrial DNA mutations occur at rather high frequency in wild type strains, such as certain types of yeast petites (deletion mutation in mtDNA) arose at 10"^ (Griffiths et al., 1995; Marotta et al., 1982). Such spontaneous mutations in mtDNA, and also the interactions with nuclear genome, are possible to account for the phenotypic variations in growth rate of V. volvacea because of the widely observed different growth rate. Li comparison with nuclear genome, fungal mitochondrial DNA is very small (Smith et aL, 1987; Orbach et al., 1988, Hudspeth, 1992). Therefore, the amplified AP-PCR profile mostly reflects the genetic makeup ofnuclear genome.
4.5.2 Spontaneous mutations Spontaneous mutations are very rare events, hi Neurospora, such mutation rate is about 10'^ (Ayala & Kiger，1984). Unlike Neurospora and many other fungi, which have single or a few nuclei in each cell, vegetative mycelium of V. volvacea is multinucleate. Chang and Ling in 1970 observed that, the number of nuclei in each mycelial cell was very high, ranging from 3-105，with a mean value of 22.10 土 1.54. Ifmutations
67 Discussion
oceur in only one nucleus, it may not be able to be detected or expressed in phenotype. But with so many nuclei and in each of them DNA duplication and nuclear division are undergoing, there is not only more chances to accumulate mutation effect leading to the change of phenotype, but also the increasement of accumulated mutation events. Thus, for V. volvacea, spontaneous mutation has a higher possibility to cause phenotypic variations in progenies than for many other fungi. However, spontaneous mutation cannot be detected unless the whole genome is to be screened.
As a summary of these possible sources, mtDNA genome should be examined in the future.
68
I^^^^BBB^^^^MBBI^^^^^^^BI^^M^^^^^B^M^B^M^—^—^———Ml^MMMwmnmw«ranwr_i___iii_i_则丨丨 Conclusion
The present study confirmed that variations in Volvariella volvacea do exist. In F1 single spore isolates, colony morphology, growth rate and fertility are highly variable; even from F1 to F2 progeny, these variations still persist; in protoplast regenerants, phenotypic variations showed less variablility. No distinct relationship between colony morphology, growth rate and fertility have been found. However, with these great phenotypic variations among V34, its protoplast regenerants and single spore isolates, AP-PCR analysis using two arbitrary primers did not detect DNA polymorphisms. These results provide evidence for the primary homothallic life cycle of V. volvacea. The mechanisms in V. volvacea generating such wide variations may not from nuclear genome only. Among these possible sources, mitochondrial genome, which controls the ATP synthesis, growth rate and life span, might have contributed to the observed variations in V. volvacea.
69 References
Anderson, J. B. 1991. Molecular tools in breeding Agaricus. Li: Genetics and Breeding of Edible Mushrooms (eds. Chang, S. T., Buswell, J. A. and Miles, P. G.), pp. 207-223. Gordon and Breach Sci. Pub.: Philadelphia.
Arganoza, M. T.，Min, J.，Hu, Z. Y. and Akins, R. A. 1994. Distribution of seven homology groups of mitochondrial plasmids in Neurospora: evidence for widespread mobility between species in nature. Current Genetics 26: 62-73.
Amheim, N., Li, H. H. and Cui, X. F. 1990. PCR analysis of DNA sequences in single cells-single sperm gene mapping and genetic disease diagnosis. Genomics 8: 415-419.
Ayala, F. J. and Kiger, J. A. 1984. Modern Genetics, pp. 243-244 & pp. 672-676. The Benjamin/Cummings Pub. Company Jnc.: London.
Bachmann, B. J. and Bonner, D. M. 1959. Protoplasts from Neurospora crassa. Journal of Bacteriology 78: 550-556.
Bej, A. K. 1991. Amplification of nucleic acid by polymerase chain reaction (PCR) and other methods and their applications. Critical Reviews in Biochemistry and Molecular Biology 26: 301-334.
70 References
d
Bprtrand, H., Chan, B. S. S. and Griffiths, A. J. F. 1985. Insertion ofa foreign nucleotide sequence into mitochondrial DNA causes senescence in Neurospora intermedia. Cell 41: 877-884.
Bos, C. J. 1985. Protoplasts from fimgal spores. Hi; Fungal protoplasts (eds. Peberdy, J. F. and Ferenczy, L.), pp. 189-203. Marcel Dekker: New York.
Bos, C. J. and Swart, K. 1995. Genetics of Aspergillus, bi: The Mycota: Genetics and Biotechnology (eds. Esser, K. and Lemke, P. A.), pp. 19-33. Spring-Verlag: Berlin, Heideberg.
Bostein, D., White, R., SkoMck, M. and Davis, R. W. 1980. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. American Journal of Human Genetics 32: 314-331.
Bowden, C. G., Royse, D. J. and May, B. 1991. Linkage relationships of allozyme encoding loci in Lentinula edodes. Genome 34: 652- 657.
Bumett, J. H. 1975. Mycogenetics. John Wiley and Sons: London.
Buswell, J. A.，Cai, Y. J. and Chang, S. T. 1993. Fungal- and substrate-associated factors affecting the ability of individual mushroom species to utilize different lignocellulosic growth substrates. Li: Mushroom Biology and Mushroom Products (eds.
71 References
f
Chang, S. T.，Buswell, J. A. and Chiu, S. W.), pp. 141-150. The Chinese University Press: Hong Kong.
Cai, Y. J., Buswell, J. A. and Chang, S. T. 1994. Production of cellulase and hemicellulase by the straw mushroom, Volvariella volvacea. Mycological Research 98: 1019-1024.
Castle, A. J., Horgen, P. A. and Anderson, J. B. 1987. Restriction fragment length polymorphisms in the mushrooms Agaricus brunnescem and Agaricus bitorquis. Applied and Environmental Microbiology 53: 816-822.
Chang, S. T. 1969. A cytological study of spore germination of Volvariella volvacea. The Botanical magazine 82: 102-109.
Chang S. T. 1977. The origin and early development of straw mushroom cultivation. Economic Botany 31: 374-376.
Chang, S. T. 1978. Volvariella volvacea. In: The Biology and Cultivation of Edible mushrooms (eds. Chang, S. T. and Hayes, W. A.), pp. 573-605. Academic Press: New York.
Chang, S. T. 1980. Mushrooms as human food. Bioscience 30: 399- 401.
Chang, S. T. 1991. Cultivated mushrooms. In: Handbook of Applied Mycology, volume 3: Foods and Feeds (eds. Arora, D. K.,
72
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^HHHHH^HH^HmHBBHHHHHB^^BE^HmESBBnsBn^^KKnHi^Bm References
Mukerji, K. G. and Marth, E. H.), pp. 221-240. Marcel Dekker: New York.
Chang, S. T. 1993a. Mushroom and mushroom biology, hi: Genetics and Breeding of Edible Mushrooms (eds. Chang, S. T., Buswell, J. A. and Miles, P. G.), pp.M3. Gordon & Breach Pub. Inc: Philadelphia.
Chang, S. T. 1993b. Mushroom biology: the impact on mushroom production and mushroom products. In: Mushroom Biology and Mushroom Product (eds. Chang, S. T.，Buswell, J. A. and Chiu, S. W.), pp. 3-17. The Chinese University Press: Hong Kong.
Chang, S. T. 1993c. Biology and cultivation technology of Volvariella volvacea. In: Mushroom Biology and Mushroom Product (eds. Chang, S. T., Buswell, J. A. and Chiu, S. W.), pp. 73-83. The Chinese University Press: Hong Kong.
Chang, S. T. and Chu, S. S. 1969. Nuclear behaviour in the basidium of Volvariella volvacea. Cytologia 34: 293-299.
Chang, S. T. and Ling, K. Y. 1970. Nuclear behaviour in the basidiomycete，Volvariella volvacea. American Journal of Botany 57: 165-171.
Chang, S. T. and Yau, C. K. 1971. Volvariella volvacea and its life history. American Journal ofBotany 58: 552-562.
73 References
Chang, S. T., Miles, P. G. and Wai, C. C. 1981. A study of monosporous isolates of Volvariella volvacea. Mushroom Science 11，603-619.
Chang, S. T.，Li, G. S. F. and Peberdy, J. F. 1985. Isolation of protoplasts from edible fungi. MIRCENJournal 1: 185-194.
Chen, M. J. 1994. Molecular Studies on the Chinese Straw Mushroom, Volvariella volvacea. M. Phil thesis. The Chinese University of Hong Kong: Hong Kong.
Chiu, S. W. 1993. Evidence for a haploid life-cycle in Volvariella volvacea fi:om microspectrophotometric measurements and observations of nuclear behavior. Mycological Research 97: 1481-1485.
Chiu, S. W. and Chang, S. T. 1987. Volvariella bombycina and its life history. Mushroom Journalfor the Tropics 7: 1-12.
Chiu, S. W.，Kwan, H. S. and Cheng, S. C. 1992. Application of arbitrarily-primed polymerase chain reaction in molecular studies of mushroom species with emphasis on Lentinula edodes. In: Genetics and Breeding of Edible Mushrooms (eds. Chang, S. T., Miles, P. G. and Buswell, J. A.), pp. 265-284. Gordon & Breach Pub. Lic: Philadelphia.
74
1^M^^B^—^^M—M^MM^^^BM^^BMl^^BMBW^MMI^WM—WWMWl—MM—MMWi_i__iiim™_iiiii References
Clutterbuck, A. J. 1993. Aspergillus nidulans. In: Genetic Maps (eds. O'Brien, S. J.), pp. 234-268. Cold Srping Harbor Laboratory Press: New York.
Cocking, E. C. 1972. Plant cell protoplasts-isolation and development. Annual Review of Plant Physiology 23: 29-50.
Court, D. A. and Bertrand, H. 1992. Genetic organization and structural features of maranhar, a senescence-inducing mitochondrial plasmid of Neurospora crassa. Current Genetics 22: 385-397.
Court, D. A.，Griffiths, A. F. J., Kraus, S. R.，Russell, P. J. and Bertrand, H. 1991. A new senescence-inducing mitochondrial linear plasmid in field-isolated Neurospora crassa strains from India. Current Genetics 19: 129-137.
Crossman，L. L. and Hudspeth, M. E. S. 1985. Fungal mitochondrial genomes. Li: Gene Manipulation in Fungi (eds. Bennet, J. W. and Lasure, L.), pp. 65-103. Academic Press: New York.
Davis, B. 1985. Factors influencing protoplast isolation. Li: Fungal Protoplasts (eds. Peberdy, J. F. and Ferenczy, L.)，pp. 45-71. Marcel Dekker: New York.
Dinouel, N., Drissi，R.，Miyakawa, 1.，Sor, F., Rousset, S., Fukuhara, H. 1993. Linear mitochondrial DNAs of yeasts: closed-loop
75 References
Structure of the termini and possible linear-circular conversion mechanisms. Molecular and Cellular Biology 13: 2315-2323.
Elliott, T. J. 1972. Sex and the single spore. In: Mushroom Science 8:
11-18.
Elliott, T. J. 1982. Genetics and breeding of cultivated mushrooms, ][n: Tropical Mushrooms-Biological Nature and Cultivation Methods (eds. Chang, S. T. and Quimio, T. H.). The Chinese University Press: Hong Kong.
Elliott, T. J. and Challen, M. P. 1985. The breeding system of the silver-siUc straw mushroom, Volvariella bombycina. Mushroom Newsletter for the Tropics 6: 3-8.
Emerson, S. and Emerson, M. R. 1958. Production, reproduction and reversion of protoplast like structures in the osmotic strain of Neurospora crassa. Proceedings of the National Academy of Science, U.S.A. 44: 668-671.
Fekete, A., Bantle, J. A.，Hailing，S. M. and Stich, R. W. 1992. Amplification fragment length polymorphism in Brucella strains by use of polymerase chain reaction with arbitrary primers. Journal ofBacteriology 174: 7778-7783.
Finchan, J. R. S., Day, P. R. and Radford, A. 1979. Fungal Genetics. Blackwell Scientific Publifications Ltd: Oxford.
76 References
Foster, L. M., Kozak, K. R., Loftus, M. G., Stevens, J. and Ross，L 1993. The polymerase chain reaction and its application to filamentous fungi. Mycological Research 97: 769-781.
Fukuda, M., Nakai, Y. F., Hibbet, D. S.，Matsumoto, T. and Hayashi, Y. 1994. Mitochondrial DNA restriction fragment length polymorphisms in natural populations of Lentinula edodes. Mycological Research 98: 169-175.
Fukuhara, H.，Sor, S., Drissi, R.，Dinouel, N., Miyakawa, I.，Rousset, S. and Viola, A. M. 1993. Linear mitochondrial DNAs of yeast: frequency of occurrence and general features. Molecular and CellularBiology 13(4): 2309-2314.
Griffiths, A. F. J. and Bertrand, H. 1984. Unstable cytoplasms in Hawaiian strains of Neurospora intermedia. Current Genetics 8: 387-398.
Griffiths, A. F. J., Collins, R. A. and Nargang, F. E. 1995. Mitochondrial genetics of Neurospora. Hi: The Mycota: Genetics and Biotechnology (eds. Esser, K. and Lemke, P. A.)，pp. 93-105. Spring-Verlag: Berlin Heideberg.
Grossman, L. L. and Hudspeth, M. E. S. 1985. Fungal mitochondrial genomes. Li: Gene Manipulations in Fungi (eds. Bennett, J. W. and Lasure, L.), pp. 65-103. Academic Press: New York.
77 , References
Hamlyn, P. F.，Bradshaw, R. E., Mellon, F. M., Santiago, C. M.， Wilson, J. M. and Peberdy, J. F. 1981. Efficient protoplast isolation from fungi. Enzyme and Microbiological Technology 3: 321-325.
Heath, I. B. 1978. Experimental studies of mitosis in the fungi. In: Nuclear Division in the Fungi (ed. Heath, I. B.), pp. 89-176. Academic Press: New York.
Hermanns, J., Asseburg，A. and Osiewacz, H. D. 1994. Evidence for a life span-prolonging effect of a linear plasmid in a longevity mutant of Podospora anserina. Molecular & General Genetics 243: 297-307.
Hintz, W. E. A., Anderson, J. B. and Horgen, P. A. 1987. Nuclear migration and mitochondrial inheritance in the mushroom Agaricus bitorquis. Genetics 119:35-41.
Hocart, M. J. and Peberdy, J. F. 1990. Protoplasts and the improvement of fungi used in biological control. Li: Biotechnology of Fungi for Improving Plant Growth (eds. Whipps, J. M. and Lumsden, R. D.)，pp. 235-258. Cambridge University Press: Cambridge.
Hudspeth, M. E. S. 1992. The fungal mitochondrial genome - a broader prospective. Jn: Applied Mycology. Vol 4. Fungal Biotechnology (eds. Arora, D. K.，Lander, R. P. E. and Mukeri, K. G), pp. 213- 242. Marcel Dekker Lic: New York, Basel and Hong Kong.
78 References
Jin, T.，Sonnemberg, A. S. M., Van Griensven, L. J. L. D. and Horgen, P. A. 1992. Investigation of mitochondrial transmission in selected matings between homokaryons from commercial and wild-collected isolates of Agaricus bisporus {=Agaricus bmnnescens). Applied and Environmental Microbiology 58(11): 3553-3560.
Kafer, E. 1977. Meiotic and mitotic recombination in Aspergillus and its chromosomal aberrations. Advances in Genetics 19: 33-131.
Kerrigan, R. W. and Ross, L K. 1989. Allozymes of a wild Agaricus bisporus population: new alleles, new genotypes. Mycologia 81: 433-443.
Kerrigan, R. W., Royer, J. C., Baller, L. M., Kohli, Y., Horgen, P. A. and Anderson, J. B. 1992. Meiotic behavior and linkage relationship in the secondarily homothallic fungus Agaricus bisporus. Genetics 133: 225-236.
Khush, R. S.，Becker, E. and Wach, M. 1992. DNA amplification polymorphisms of the cultivated mushroom Agaricus bisporus. Applied and Environmental Microbiology: 2971-2977.
Kitamoto, Y.，Mori, N.，Yamamoto, M., Phiwa, T. and Ichikawa, Y. 1988. A simple method for protoplast formation and improvement of regeneration from various fungi using an enzyme from
79 References
Trichoderma reesei. Journal of General Microbiology 131: 1339- 1347.
Kohli, J. 1987. Genetic nomenclature and gene list ofthe fission yeast Schizosaccharomyces pombe L. Current Genetics 11: 575-590.
KuUcami, R. K. 1991. DNA polymorphisms in Lentinula edodes, the shiitake mushroom. Applied and Environmental Microbiology 57: 1735-1739.
Kwan, H. S., Chiu, S. W., Pang, K. M. and Cheng，S. C. 1992. Strain typing in Lentinula edodes by polymerase chain reaction. ExperimentalMycology 16: 163-166.
Kwok, S. and Sninsky, J. J. 1989. Application ofPCR to the detection ofhuman infectious disease. In: PCR Technology: Principles and
Applications for DNA Amplification (ed. Erlich, H. A.)，pp. 235- 250. Stockton University Press: New York.
Lau, W. C., Dhillon, E. K. S. and Chang, S. T. 1985. Isolation and reversion of protoplasts of Pleurotus sajor-caju. MIRCEN Journal 1: 345-353.
Lee，S. B. and Taylor, J. W. 1993. Uniparental inheritance and replacement of mitochondrial DNA in Neurospora tetrasperma. Genetics 134(4): 1063-1075.
80 References
Li, A. and Horgan, P. A. 1993. Evidence for cytogine methylation in ribosomal RNA genes and in a family of dispersed repetitive DNA elements in Agaricus bisporus and selected Agaricus species. Experimental Mycology 17: 356-361.
Li, G. S. F. 1977. Cytological and Genetical Analysis on the Life Cycle of Volvariella volvacea. M Phil, thesis. The Chinese University ofHong Kong: Hong Kong.
Li, S. F. and Chang, S. T. 1978. Variation in the homothallic basidiomycete, Volvariella volvacea. Mushroom Science 10: 171- 184.
Li, S. X. 1991. Genetical and Cytological Studies on Variations of Volvariella volvacea. Ph.D thesis. The Chinese University of Hong Kong: Hong Kong.
Marota, R., Colin, Y., Goursot, R. and Bemadi, G. 1982. A region of extreme instability in the mitochondrial genome of yeast. EMBO Journal 1: 529-534.
May, B. and Royse, D. J. 1981. Applications of the electrophoretic methodology to the elucidation of genetic life histories of edible mushrooms. Mushroom Science 11: 799-817.
Meinecke, G. 1960. Protoplasts from Penicillium glaucum. Nature, London 188: 246.
81 References
Mendoza, C. G., Avellan, M. A., Sanchez，E. and Novaes-Ledieu, M. 1987. Differentiation and wall chemistry of Agaricus bisporus vegetative and aggregated mycelia. Archives ofMicrobiology 148: 68-71.
Miles, P. G. 1991. Biological background for mushroom breeding. In: Genetics and Breeding of Edible Mushrooms (eds. Chang, S. T., Buswell, J. A. and Miles, P. G.), pp.37-63. Gordon and Breach Sci. Pub: Philadelphia.
Miles, P. G. and Chang, S. T. 1986. Application of biotechnology in strain selection and development of edible mushrooms. ASEAN Food Journal 2: 3-10.
Moore, D. 1975. Production of Coprinus protoplasts by use of chitinase and helicase. Transactions of the British Mycological Society 65: 134-136.
Mullis, K. B., Faloona, F. A.，Scharf, S.，Saiki, R., Hom, G. and Erlich, H. 1986. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harbor Symposium on Quantitive Biology 51: 263-273.
Mullis K. B. and Faloona F. A. 1987. Specific synthesis of DNA in vitro via a polymerase catalysed chain reaction. Methods in Enzymology 155: 335-350.
82 References
Myers, C., Griffiths, A. F. J. and Bertrand, H. 1989. Linear Kalio DNA is a Neurospora mitochondrial plasmid that integrate into the mitochondrial DNA. Molecular and General Genetics 220: 113- 120.
Nga, B. H. and Roper, J. A. 1968. Quantitative intrachromosomal changes arising at mitosis in Aspergillus nidulans. Genetics 58: 193-209.
Ochman, H., Medhora，M.，Garza, D. and Hartl, D. L. 1990. Amplification of flanking sequences by inverse PCR. Li: PCR Protocols (eds. Innis, M.，Gelfand，D.，Sninsky, J. and White, T.), pp. 219-227. Academic Press: New York.
Orbach, M. J., Volkath, D., Davis, R. W. and Yanofsky, C. 1988. An electrophoretic karyotype of Neurospora crassa. Molecular and CellularBiology%: 1469-1473.
Papa, K. E. 1977. The parasexual cycle in Aspergillus parasiticus. Mycologia 70: 766-773.
Peberdy, J. F. 1985. Mycolytic enzymes. In: Fungal protoplasts (eds. Peberdy, J. F. and Ferenczy, L.)，pp. 31-44. Marcel Dekker: New York.
83 References
Peberdy, J. F. 1989. Fungi without coats-protoplasts as tools for mycological research. Mycological Research 93: 1-20.
Peberdy, J. F. 1991. Fungal protoplast. Jn: More Gene Manipulations in Fungi (eds. Bennett, J. W. and Lasure，L. A.), Academic Press: San Diego.
Peberdy, J. F. 1995. Fungal protoplasts. In: The Mycota: Genetics and
Biotechnology (eds. Esser, K. and Lemke, P. A.)，pp. 49-60. Spring Verlag: Berlin, Heideberg.
Peberdy, J. F. and Fox, H. M. 1991. Protoplast technology and edible mushrooms, bi: Genetics and Breeding of Edible Mushrooms (eds. Chang, S. T., Miles, P. G. and Buswell, J. A.)，pp. 125-155. Gordon & Breach Sci. Pub: Philadelphia.
Plummer, K. M. and Howlett, B. J. 1993. Major chromosome length polymorphisms are evident after meiosis in the phytopathogenic fungus Leptosphaeria maculans. Current Genetics 24: 107-113.
Pukkila, P. J. 1992. Methods of genetic manipulation in Coprinus cinereus. Li: Genetics and Breeding of Edible Mushrooms (eds. Chang, S. T.，Miles，P. G. and Buswell, J. A.)，pp. 249-264. Gordon & Breach Sci. Pub: Philadelphia.
Quaye, J. R. 1986. Evidence for haploidy of the basidiospores of Volvariella volvacea from gamma radiation studies. Mushroom Journal for the Tropics 7: 39-44.
84 References
Rafalski, J. A. and Tingey, S. V. 1993. Genetic diagnostics in plant breeding: RAPDs, microsatellites and machines. Trends in Genetics 9: 275-280.
Raper, C. A. 1976. Sexuality and life cycle ofthe edible WiXAAgaricus bitorquis. Journal of General Microbiology 95: 54-66.
Raper, J. R. 1966. Genetics of Sexuality in Higher Fungi. Ronald Press: New York.
Raper, J. R. and Raper, C. A. 1972. Life cycle and prospects for interstrain breeding in Agaricus bisporus. Mushroom Biology 8: 1-9.
Royse, D. J. and May, B. 1992. Multilocus enzyme electrophoresis for the genetic analysis of edible mushrooms. Hi: Genetics and Breeding of Edible Mushrooms (eds. Chang, S. T., Miles, P. G. and Buswell, J. A.)，pp. 225-247. Gordon & Breach Sci. Pub: Philadelphia.
Royse, D. J., Jodon, M. H.，Antonio, G. G. and May, A. P. 1987. Confirmation of intraspecific crossing and single and joint segregation of biochemical loci of Volvariella volvacea. ExperimentalMycology 11: 11-18.
85 References
Santiago, C. M. 1982. Production of Volvariella protoplasts by use of Trichoderma enzyme. Mushroom Newsletter for the Tropics 3: 3-
6.
Selitremiikoff, C. P. and Bloomfield, E. C. 1984. Formation and regeneration of protoplasts of wild-type Neurospora crassa. CurrentMicrobiology 11: 113-118.
Smith, C. L.，Matsumoto, T.，Niwa, O.，Klco, S., Fan, J. B., Yanagida, M. and Canter, C. R. 1987. An electrophoretic karyotype for Schizosaccharomyces pombe strain by pulse field gel electrophoresis. NucleicAcids Research 15: 4481-4488.
Smith, D. A. 1974. Unstable diploids of Neurospora amd a model for their somatic behaviour. Genetics 76: 1-17.
Smith, M. L. and Anderson, J. B. 1994. Mitochondrial DNAs of the fungus Armillaria ostoyae.. restriction map and length variation. Current Genetics 25: 545-553.
Sonnerberg, A. S., Wessels, J. G. H. and Van Griensven, L. J. 1988. An efficient protoplastingA*egeneraton system for Agaricus bisporus and Agaricus bitorquis. Current Microbiology 17: 285- 291.
86
M^Bl^M—^^^^M——M^M^—^H^—^—^^^——lWMfM—l———M,_"MiWiff___iii_i_,w___/i rii,i_ _•__••__ References
Southern, E. M. 1975. Detection of specific sequences among DNA fragements seperated by gel electrophoresis. Journal ofMolecular Biology 98: 503-517.
Spear, M. C.，Royse, D. J. and May, B. 1983. Atypical meiosis and segregation ofbiochemical loci mAgaricus brunnescens. Journal ofHeredity 74: 417-420.
Tamova, G.，Betina, V. and Farkas, V. 1993. An efficient method for producing protoplasts from Trichoderma virude. Folia Microbiology 38: 214-218.
Tanaka, R. and Koga, I. 1972. Karyological studies on Lentinus edodes, a basidiomycete. Janpanese Journal ofBotany 47: 289- 296.
Vickery, D. B. and Griffiths, A. J. F. 1993. Transcription ofthe kalio linear senescence plasmid from Neurospora intermadia. Plasmid 29(3): 180-192.
Walz, M. 1995. Electrophoretic karyotyping. Li: The Mycota: Genetics and Biotechnology (eds. Esser, K. and Lemke, P. A.)，pp. 61-73. Spring-Verlag: Berlin Heideberg.
Wang, C. W. 1982. Cellulolytic enzymes of Volvariella volvacea. In: Tropical Mushrooms: Biological Nature and Cultivation Methods
87 References
(eds. Chang, S. T. and Quimio, T. H.), pp. 167-186. The Chinese University Press: Hong Kong.
Wang, Z. S., Liao, J. H., Li, F. G. and Wang, H. C. 1991. Studies on genetic basis ofesterase isozyme loci Est A, B, and C mAgaricus bisporus. Mushroom Science 13，3-9.
Welsh, J. and McClelland, M. 1990. Fingerprinting genomes using PCR with arbitrary primers. Nucleic Acids Research 18: 7213- 7218.
Welsh, J.，Liu, J. P. and Efstratiadis, A. 1990. Cloning of PCR- amplified total cDNA: construction of a mouse oocyte cDNA library. GeneticAnalysis: Techniques andApplications 7: 5-17.
White, T. J., Bruns, T., Lee，S. and Taylor, R J. 1989. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Jn: PCR Protocols (eds. Innis, M., Gelfand, D., Sninsky, J. and White, T.), pp. 315-322. Academic Press: New York.
Whittaker, S. L., Assinder, S. L. and Shaw, D. S. 1994. Inheritance of mitochondrial DNA in Phytophthora infestans. Mycological Research 98: 569-575.
Williams, J. G. K., Kubelik, A. R., Livak, K. L., Rafalski, J. A. and Tingey, S. V. 1990. DNA polymorphisms amplified by arbitrary
88
iimillilllililMlillll I lll_l lllMlM^MII References
primers are useful as genetic markers. Nucleic Acids Research 18: 6531-6535.
Wood, D. A. 1984. Microbial process in mushroom cultivation: a large scale solid substrate fermentation. Journal of Chemical Technology and Biotechnology 34B: 232-240.
Wood, D. A. and Fermor, T. R. 1982. Nutrition of Agaricus bisporus in compost. The Mushroom Journal 114: 194-197.
Wyss, P. and Bonfante, P. 1993. Amplification of genomic DNA of arbuscular-mycorrhizal (AM) fungi by PCR using short arbitrary primers. Mycological Research 97: 1351-1357.
Yanagi, S. 0., Monma, M.，Kawasumi, T., Hino, A., Kito, M. and Takebe, L 1985. Conditions for isolation of and colony formation by mycelial protoplasts of Coprinus macrorhizus. Agricultural and Biological Chemistry 49: 171-179.
Yang, X. and Griffiths, A. J. F. 1993. Male transmission of linear plasmids and mitochondrial DNA in the fungus Neurospora. Genetics 134(4): 1055-1062.
Yau, C. K. and Chang, S. T. 1972. Cotton waste for indoor cultivation of straw mushroom. World Crops 24: 302-303.
89
^^^BHI^H^^^^^^HHII^^^^^^^^^^^^^^^^^^^IBHI^^^^^^^H^HHBI^^^HI^H^^^^HHI^HHIH^^^^^B^HasamMmnwrafl^rasKii^n^tffnneftan^^Ki References
Yu, M. Y. and Chang, S. T. 1987. Effects of osmotic stabilizer on the activities of mycolytic enzymes used in fungal protoplast liberation. MIRCENJournal 3: 161-167.
Zhao, J. and Chang, S. T. 1993. Monokaryotization by protoplasting heterothallic species of edible mushrooms. World Journal of Microbiology and Biotechnology 9: 538-543.
90
I^M^MM^BM^^^^M^^B^^—^^—^^—l^^—^—^B^^^^———nmMi—MnMMimmmihi_i_i__i"ii_TrmimmnrrnKinm_ii_"_•••_
CUHK Libraries __llll_l : 0D3SflT37^