Heteroduplex Rejection During Single-Strand Annealing Requires Sgs1 Helicase and Mismatch Repair Proteins Msh2 and Msh6 but Not Pms1

Heteroduplex rejection during single-strand annealing requires Sgs1 helicase and mismatch repair proteins Msh2 and Msh6 but not Pms1

Neal Sugawara*†, Tamara Goldfarb†‡, Barbara Studamire‡§, Eric Alani‡, and James E. Haber*†¶

*Rosenstiel Center and Department of Biology, Brandeis University, Waltham, MA 02454-9110; and ‡Department of Molecular Biology and Genetics, Cornell University, Ithaca, NY 14853-2703

Edited by Maurice S. Fox, Massachusetts Institute of Technology, Cambridge, MA, and approved May 7, 2004 (received for review September 8, 2003) Recombination between moderately divergent DNA sequences is otides in size (14–16, 20, 21). msh2⌬, pms1⌬, and mlh1⌬ mutants impaired compared with identical sequences. In yeast, an HO are equally defective in mismatch correction during DNA rep- endonuclease-induced double-strand break can be repaired by lication and in repairing heteroduplex DNA in meiosis (22, 23). single-strand annealing (SSA) between flanking homologous se- Double mutants, such as pms1⌬ mlh1⌬ or mlh1⌬ msh2⌬, exhibit quences. A 3% sequence divergence between 205-bp sequences epistasis, implying that these genes work in the same repair flanking the double-strand break caused a 6-fold reduction in pathway (24). repair compared with identical sequences. This reduction in het- In both vegetative and meiotic yeast cells, the presence of even eroduplex rejection was suppressed in a mismatch repair-defective a few mismatches can markedly reduce recombination (12, msh6⌬ strain and partially suppressed in an msh2 separation-of- 25–31). These studies have also shown that mismatch repair function mutant. In mlh1⌬ strains, heteroduplex rejection was mutations including msh2, msh6, pms1, and mlh1 can elevate the greater than in msh6⌬ strains but less than in wild type. Deleting level of recombination events involving homeologous sequences PMS1, MLH2,orMLH3 had no effect on heteroduplex rejection, but (32, 33). a pms1⌬ mlh2⌬ mlh3⌬ triple mutant resembled mlh1⌬. However, In addition to their role in mismatch correction and reduction correction of the mismatches within heteroduplex SSA intermedi- in homeologous recombination, Msh2p and Msh3p play a third role in recombination, independent of Mlh1p, Pms1p, and ates required PMS1 and MLH1 to the same extent as MSH2 and Msh6p. During both gene conversion and single-strand anneal- MSH6. An SSA competition assay in which either diverged or ing (SSA), nonhomologous 3Ј-ended single-strand DNA ends identical repeats can be used for repair showed that heteroduplex must be clipped off before a 3Ј end is exposed that can be used DNA is likely to be unwound rather than degraded. This conclusion to prime new DNA synthesis (34–36). Removal of nonhomolo- is supported by the finding that deleting the SGS1 helicase also gous tails at the junction between base-paired and unpaired suppressed heteroduplex rejection. DNA requires the Rad1p–Rad10p endonuclease and the Msh2p–Msh3p complex. enetic recombination depends on the efficient and accurate For this study we used S. cerevisiae to examine the effect of Gsearch for homology between recipient and donor DNA mismatch repair on the formation and repair of heteroduplex substrates. Studies in both prokaryotes and eukaryotes have DNA that results by means of the SSA pathway. This process shown that mismatch repair proteins play a critical role in involves the repair of a single double-strand break (DSB) induced in vivo that occurs between repeated sequences. DNA regulating this homology search during strand invasion (1, 2). A Ј role for mismatch repair proteins in regulating recombination resection occurs at the 5 ends resulting in single-stranded tails was first obtained in transformation studies performed in Pneu- that can anneal and ultimately create a deletion (Fig. 1A). A mococcus. A small number of base–base differences between decrease in SSA is observed when a 3% sequence divergence is donor and recipient molecules significantly decreased the for- introduced within 205-bp repeats flanking the DSB (34). We show that the decrease in SSA because of sequence divergence mation of stable transformants. This decrease, known as het- depends much more on Msh6p than on the Mlh proteins, of hexA eroduplex rejection, was suppressed by mutations in and which only Mlh1p has a discernable effect. In contrast, mis- hexB, homologs of the Escherichia coli mismatch repair proteins matches formed during SSA are still subject to mismatch MutS and MutL, respectively (3, 4). The MutS and MutL correction by both the Msh2p–Msh6p and Mlh1p–Pms1p com- proteins play key roles in the repair of base pair mismatches; plexes. Evidence suggesting that heteroduplexed DNA strands MutS binds to mispairs and MutL appears to interact with

are unwound rather than degraded is supported by the finding GENETICS MutS-mispair complexes to initiate downstream mismatch repair that heteroduplex rejection also requires the Sgs1 helicase. We steps (5–8). Subsequent studies in bacteria, yeast, and humans propose that the decrease in SSA as the result of sequence showed that mismatch repair plays a critical role in repressing divergence results from a heteroduplex DNA rejection mecha- recombination between moderately divergent (homeologous) nism that is distinct from the repair of mismatches in hetero- sequences (9–12). duplex DNA. In Saccharomyces cerevisiae repair of mismatches arising during DNA replication or through heteroduplex DNA formation Materials and Methods during recombination depends on the activity of several MutS Strains. Strain tNS1379 carries a duplication of 205-bp URA3 and MutLhomologs. Msh2p, Msh3p, Msh6p, and two MutL sequences (designated A-A) separated by 178 bp of pUC9 DNA, homologs, Mlh1p and Pms1p, have been shown to play major roles in mismatch repair, whereas two other MutL homologs, Mlh2p and Mlh3p, play specialized roles (13–19). These proteins This paper was submitted directly (Track II) to the PNAS ofﬁce. appear to function as heterodimers in mismatch repair, because Abbreviations: SSA, single-strand annealing; DSB, double-strand break. Msh2p–Msh3p, Msh2p–Msh6p, Mlh1p–Pms1p, Mlh1p–Mlh3p, †N.S., T.G., and J.E.H. contributed equally to this work. and Mlh1p–Mlh2p complexes have been identified (20). Fur- §Present address: Department of Biochemistry and Molecular Biophysics, Columbia Uni- thermore, the Msh2p–Msh6p complex shows a strong selectivity versity College of Physicians and Surgeons, New York, NY 10032. for base pair substitutions, whereas Msh2p–Msh3p preferentially ¶To whom correspondence should be addressed. E-mail: [email protected]. recognizes loop insertion͞deletion heterologies up to 12 nucle- © 2004 by The National Academy of Sciences of the USA

www.pnas.org͞cgi͞doi͞10.1073͞pnas.0305749101 PNAS ͉ June 22, 2004 ͉ vol. 101 ͉ no. 25 ͉ 9315–9320 Downloaded by guest on September 27, 2021 Fig. 1. SSA by using a homeologous substrate. (A)Anin vivo DSB created between two repeated sequences initiates the 5Ј to 3Ј resection of one DNA strand, creating 3Ј single-strand DNA tails. Annealing of single-strand DNA at complementary sequences creates an intermediate with mismatched base pairs. Nonhomologous tails are removed by Rad1p–Rad10p endonuclease with the assistance of Msh2p–Msh3p, and the gaps are ﬁlled in and ligated. If mismatches are not corrected by mismatch repair, progeny containing both genotypes (sectored colony) will result. (B) SSA substrates contain an HO cut site ﬂanked by two or three 205-bp sequences derived from URA3. Black boxes indicate the repeated sequences.

the HO cut site (117 bp) derived from MATa, and 2.3-kb ␭ DNA (Fig. 1B; described in refs. 34 and 37). In strain tNS1357, the leftward URA3 repeat was replaced by sequences derived from strain FL100 and differs by seven single-site mutations (Fig. 4, which is published as supporting information on the PNAS web site); this arrangement is designated F-A (34). The A-A-A (tNS2038) and A-F-A (tNS2041) strains (Fig. 1B) were made by respectively transforming tNS1366 and tNS1116 with pNSU255 cut with PvuI, so that there are two repeats, separated by 2.9 kb, Fig. 2. Southern hybridization analysis of SSA. (A) HO endonuclease cleaves at its recognition site between 205-bp repeats of ura3 sequence (solid boxes) to the left of the HO cleavage site. These strains contained leading to a deletion. The ura3 sequence on the left consists of either the pJH727 (LEU2 GAL::HO ARS CEN)orGAL10::HO integrated ura3-A or ura3-FL100 allele, whereas the right sequence contains ura3-A. The into the ADE3 locus (38). Additional details are provided in probe used for Southern blotting is a HindIII–BamHI fragment downstream of Supporting Materials, which is published as supporting informa- URA3.(B) DNA was extracted and digested with BglII from wild-type strains, tion on the PNAS web site. tNS1379 and tNS1357 (A-A and F-A respectively), and the following derivatives of tNS1357: msh6⌬ (tNS1600), msh2-R730W (tNS1826), sgs1⌬ (EAY994), pms1⌬ Analysis of SSA. HO was induced by addition of galactose (2% (tNS1394), mlh1⌬ (tNS1396), mlh2⌬ (tNS1916), mlh3⌬ (tNS1909), exo1⌬ ⌬ wt͞vol final concentration) to cultures grown in yeast extract͞ (tNS1678), and srs2 (tNS1631). Southern blots show the uncut band before ͞ induction, the HO-cleaved band (4.8 kb) at 0.5 h, and the product band (5.5 kb) peptone lactate medium (37). DNA was extracted at intervals after5hofinduction. after induction, digested with BglII, and analyzed by Southern hybridization (37). The efficiency of SSA was also determined by comparing the viability of cells after GAL::HO induction to DSB between 205-bp repeated segments near the URA3 gene. those of the preinduced culture, corrected for cells that had lost Induction of a GAL::HO gene carried on a centromeric plasmid the GAL::HO TRP1 plasmid pFH800, as described in ref. 34. Cell efficiently induced SSA and created deletion products that could viabilities in the competition assay were determined by plating be monitored by Southern hybridization (Fig. 2). When the equal numbers of cells on selective medium lacking leucine (to repeat regions were identical (A-A substrate), SSA occurred maintain the GAL::HO plasmid pJH727) and containing either efficiently, as shown by densitometric analysis of deletion prod- galactose or glucose. The PCR assay of SSA product was carried ucts (Fig. 2B and Table 1). In contrast, when the flanking regions out by adjusting the genomic DNA so that equal amounts of final differed by seven single base pair heterologies (F-A), consisting SSA product were formed. Primers (5Ј to 3Ј) were TGAGTAG- of six single base pair substitutions and one 1-bp insertion͞ CAGCACGTTCC and GCACCATATGCGGTGTG (to assay deletion, SSA was reduced about 6-fold. As shown in Fig. 2 and SSA) and AGAAAGGGGGTATTATCAATGGCTC and AG- Table 1, the reduction in SSA observed with homeologous GAAAATCACGGCGCAAAA (arg5,6). substrates (F-A) was largely suppressed in msh6⌬ strains (P Ͻ Mismatch repair was assayed by inducing cells for 1 hr with 0.001). Similar results were obtained by assaying cell viability, galactose (2% wt͞vol) and extracting DNA from cultures derived which measures how often SSA repairs the DSB. Whereas the from unbudded cells that had been isolated by micromanipula- ratio of cell survival for F-A vs. A-A strains was 0.20 for wild tion within a 30-min period. DNA was analyzed by Southern type, it was 0.77 for msh6⌬. We were unable to determine the analysis for the presence of the MspI site in ura3-FL100 and effect of msh2⌬ or msh3⌬ mutations because Msh2p–Msh3p is absence in ura3-A (Fig. 4) (39). required for the excision of nonhomologous single-strand tails during SSA (34). Results Unlike msh6⌬, single deletions of MutL-homolog genes had The Effect of Mismatch Repair-Null Mutations on SSA Between Ho- little or no effect on SSA of either the A-A or F-A constructs. meologous DNA Sequences. We developed an assay to monitor Surprisingly, pms1⌬ was not different from wild type in the SSA between homologous and homeologous repeats (Fig. 1A). level of SSA product formed (Fig. 2 and Table 1). The increase In this system, HO endonuclease was induced to create a single in SSA product formation for the F-A substrate in mlh1 strains

9316 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0305749101 Sugawara et al. Downloaded by guest on September 27, 2021 Table 1. Effect of mismatch repair and sgs1⌬ mutations on the Table 2. Mismatch correction of heteroduplexes arising during efﬁciency of SSA SSA between F and A ﬂanking sequences Product formation No. of colonies Percent Genotype A-A substrate F-A substrate Mutant MspIϩ (F) MspIϪ (A) Mixed (F-A) mixed

Wild type 0.92 (0.23) 0.15 (0.05) Wild type 22 4 4 13 msh6⌬ 1.11 (0.27) 0.71 (0.20) msh6⌬ 3 3 14 70 msh2-R730W (pEAA83)* 0.92 (0.18) 0.40 (0.09) msh2-R730W 4 4 17 68 MSH2 (pEAA54)* 1.03 (0.13) 0.23 (0.03) pms1⌬ 22 969 mlh1::LEU2 0.86 (0.06) 0.26 (0.10) mlh1::LEU2 4 3 16 70 mlh1⌬::KANMX 0.79 (0.21) 0.38 (0.09) mlh2⌬ 16 3 1 5 pms1⌬ 0.87 (0.10) 0.13 (0.02) mlh3⌬ 20 6 4 13 mlh2⌬ 1.25 (0.39) 0.13 (0.02) mlh1⌬msh6⌬ 5 3 21 72 mlh3⌬ 1.07 (0.18) 0.12 (0.04) pms1⌬msh6⌬ 02 880 mlh1::LEU2 pms1⌬ n.d. 0.17 (0.01) sgs1⌬ 12 4 1 6 mlh1::LEU2 mlh2⌬ n.d. 0.23 (0.04) exo1⌬ 21 5 4 13 mlh1::LEU2 mlh3⌬ n.d. 0.37 (0.10) Colonies were derived from unbudded cells after1hofgalactose induction mlh2⌬mlh3⌬ n.d. 0.15 (0.03) and analyzed for the presence of the MspI site (see Materials and Methods) ⌬ ⌬ pms1 mlh3 0.82 (0.01) 0.22 (0.03) present in the ura3-FL100 (F) allele. Mixed colonies contain cells with and ⌬ ⌬ pms1 mlh2 n.d. 0.08 (0.02) without the MspI site. pms1⌬mlh2⌬mlh3⌬ n.d. 0.39 (0.04) pms1⌬mlh1⌬::KANMX 0.79 (0.19) n.d. pms1⌬mlh1⌬::KANMX mlh3⌬ 0.69 (0.10) n.d. conferred by this mutation was independent of whether it was on sgs1⌬ 0.72 (0.13) 0.75 (0.06) a plasmid or integrated into its endogenous chromosomal loca- srs2⌬ 0.38 (0.18) 0.06 (0.03) tion (data not shown). Thus, SSA in msh2-R730W strains with the exo1⌬ 0.73 (0.20) 0.11 (0.02) A-A substrate occurred at Ϸ90% of the wild-type level (Table 1). The intensity of the product band 5 hr after HO induction was divided by With the F-A repeats, msh2-R730W strains displayed a 2-fold the intensity of the 0-h uncut band. This ratio was normalized to the same ratio increase in SSA compared with wild type (Table 1), indicating derived from an uncut control sequence and corrected for the fraction of that the msh2-R730W mutation can partially suppress hetero- colonies containing pFH800 (GAL10::HO TRP1) prior to induction. One SD of duplex rejection. the mean is shown in parentheses. n.d., not determined. *Centromere plasmids pEAA83 and pEAA54 bearing msh2-R730W or MSH2, MLH1, PMS1, MSH2, and MSH6 Are Necessary for Mismatch Repair of respectively, were transformed into a msh2⌬ strain. F-A Heteroduplex DNA. When SSA occurs between the F and A repeats, heteroduplex DNA will contain several mispairs. If these mismatches are corrected, then descendants of the is statistically significantly different from wild-type strains original cell will have the same genotype, but if not, each strand based on a t test (P Ͻ 0.01) but also statistically different from ⌬ ⌬ will be used as a template for DNA replication and both alleles msh6 (Table 1). We analyzed mlh1 ::KANMX, a complete will be found among the progeny. One of the seven heterol- deletion, and mlh1::LEU2, a deletion of the MLH1 promoter ogies contains an MspI restriction site in the F sequence. and the first 100 aa (17), where the remaining segment might Hence, the progeny from each SSA event from an F-A strain still be fortuitously transcribed and translated. The can be scored to determine whether they are all MspIϩ (F), all mlh1::LEU2 allele appears to retain some activity in suppress- MspIϪ (A), or a mixture (F and A) by analyzing MspI -digested ing spontaneous homeologous recombination (S. Jinks- DNA extracted from a culture derived from a G1 cell. Cells Robertson, personal communication). Consistent with this were grown in liquid medium, induced for HO expression for activity, the mlh1::LEU2 allele was similar to wild type when 1 hr, and then streaked on agar plates so that unbudded (G1) ͞ measured by cell survival, yielding a (F-A) (A-A) ratio of 0.21 cells could be isolated by micromanipulation and grown into ϭ (wild type 0.20). colonies. A previous study indicated that Mlh3p preferentially acts in In a wild-type strain, 81% of SSA colonies were homozygous ͞ ϩ Ϫ the correction of insertions deletions in runs of mononucleoti- for MspI (F) or MspI (A), whereas 13% were mixed (F-A) des, particularly in runs of Ts (21). One of the seven heterologies (Table 2). Similar ratios of mixed and unmixed colonies were GENETICS ͞ in the 205-bp substrates is an insertion deletion in a run of Ts also found for mlh2⌬, mlh3⌬, and sgs1⌬ strains, indicating that ⌬ ⌬ (10 vs. 11 bp) (Fig. 4). However, neither the mlh3 nor mlh2 mismatch repair is proficient in these strains. In contrast, Ϸ70% mutations affected SSA in the A-A or F-A strains (Table 1). of the colonies were mixed for the F and A alleles in msh6⌬, None of the double-mutant combinations of pms1⌬, mlh2⌬,or pms1⌬, mlh1::LEU2, and msh2-R730W strains, which signifies a mlh3⌬ exhibited any suppression of heteroduplex rejection defect in mismatch repair. We conclude that Pms1p is required (Table 1); however, the triple mutant pms1⌬ mlh2⌬ mlh3⌬ was for mismatch repair, although it is not used in heteroduplex similar to mlh1⌬::KANMX. This result suggests that Mlh1p might rejection. act with any of three heterodimeric partners to carry out Among the colonies that accomplished mismatch repair, there heteroduplex rejection; alternatively, the absence of Mlh1p or all was a 6:1 bias in favor of the F allele. This ratio may reflect a of its Mlh͞Pms partners might have an indirect effect on the repair bias intrinsic to the C͞A mismatch in this context, or it abundance or activity of Msh2p–Msh6p. could reflect the influence of nearby heterologies. Alternatively, it could be caused by a directed bias in mismatch correction in Separation of Function Mutations in MSH2 Partially Suppress Hetero- much the same way as mismatch repair is biased during strand duplex Rejection. We isolated the msh2-R730W mutant that is invasion during mitotic DSB-induced gene conversion (41, 42). defective in mismatch repair, as judged by an elevated sponta- No apparent preference for the A or F allele was observed in neous mutation frequency, but is capable of removing nonho- strains defective in mismatch repair, suggesting that a residual mologous ends of DNA in an SSA assay (40). The defect repair pathway is unlikely to possess such a bias.

Sugawara et al. PNAS ͉ June 22, 2004 ͉ vol. 101 ͉ no. 25 ͉ 9317 Downloaded by guest on September 27, 2021 A Competition Assay Suggests Heteroduplex Rejection Occurs by DNA Unwinding. Heteroduplex rejection could occur in several different ways. One process would be similar to mismatch repair itself, in that excision of DNA on one strand of the heteroduplex could destroy the SSA intermediate if the excision of the mismatch extends to the end of the annealed sequence. Similarly, two independent resections beginning on different strands could destroy the intermediate entirely. Alternatively the two annealed strands could simply be unwound. To distinguish among these mechanisms, we constructed two strains that have three regions of 205-bp homology in the vicinity of the DSB (Fig. 3A). The first strain carries three identical A repeats (A-A-A). When a DSB is created, SSA can occur with either of the two A sequences on the left side of the DSB, creating two different-sized deletions that can be distinguished on a Southern blot (Fig. 3B). Densitometric analysis showed that Ϸ50% of the deletions use the closer homology (Table 3). In the second strain, the middle sequence was changed to F (designated A-F-A). In this instance, nearly all of the deletions were formed between the identical A sequences, (93%, Table 3 and Fig. 3B). Significantly, cell viability was statistically indistinguishable (74%) from the case in which all three sequences were identical (79%; P Ͼ 0.05). These data support models in which the annealed intermediate is unwound rather than largely destroyed by nucleases. We assume that 50% of the initial encounters between single strands were between the closer pair, as seen when all sequences are identical. If this scenario also occurred in the case in which the middle sequence is divergent, then unwinding the sequence would allow the centromere proximal A segment to continue its search for a partner until the more distal A region was found. If the heteroduplex formed between F and A led to its complete destruction by nucleases, then there would no longer be a chance for SSA to occur, and viability should have dropped by 50% relative to the A-A-A strain. If only one of the two strands were degraded at random, then there should have been a 25% decrease, where the inviability results from removal of the A repeat. This decrease was not observed. By using 30-min time points, we were unable to see a difference in the time of appearance of the large and small deletion products in A-A-A or A-F-A strains (Fig. 3B) in wild-type, msh6⌬,orsgs1⌬ backgrounds. The effect of msh6⌬ is shown Fig. 3. A competition assay to examine the mechanism of heteroduplex quantitatively in Fig. 3C. We also observed similar kinetics when rejection. (A) A DSB was created so that the URA3 sequence to the right of the comparing F-A wild-type and msh6⌬ strains in a PCR assay for break can anneal with one of two 205-bp segments to the left to form a small which the amounts of genomic DNA were adjusted so that the or a large deletion. The three repeats are either all identical A sequences amount of final product formation was the same in the wild-type (A-A-A) or the middle repeat contains the 3% mismatched F sequence (A-F-A). and msh6 strains (Fig. 3D). This result suggests that the mech- (B) Southern blots (as described in Fig. 2) show that nearly all of the deletions anisms of heteroduplex rejection and mismatch repair do not in the A-F-A substrate (EAY1139) are to the distal, perfectly matched partner, in contrast to the A-A-A substrate in the wild-type (EAY1137), msh6⌬ A-F-A, or alter the initial kinetics of product formation; instead, they limit sgs1⌬ A-F-A strains. (C) Densitometric analysis of the kinetics of forming large the amount of product formed. (■) and small (F) deletions in wild-type and msh6⌬ A-F-A strains and large (ᮀ) and small (E) deletions in a wild-type A-A-A strain. (D) Wild-type (tNS1357) Sgs1 Helicase Is Required for Heteroduplex Rejection During SSA. To and msh6⌬ (tNS1600) F-A strains were induced and DNA was extracted at the test whether heteroduplex rejection occurs through an unwind- time points shown. SSA product was formed with the same kinetics when ing mechanism, we examined SSA in sgs1⌬, srs2⌬, and exo1⌬ assayed by PCR with primers ﬂanking the repeats. Reverse images are shown. strains. The Sgs1 helicase was previously implicated in suppress- Quantities of genomic DNA were adjusted so that equal amounts of ﬁnal SSA ⌬ ing homeologous recombination between inverted repeated product were formed by using DNA from wild-type and msh6 strains. sequences occurring by spontaneous gene conversion (43). The Srs2 helicase facilitates the removal of nonhomologous DNA A-F-A and A-A-A strains (Table 3 and Fig. 3). Both msh6⌬ and ends during DSB-induced gene conversion (35) and appears to sgs1⌬ restored the fraction of F-A annealings to nearly the level have overlapping functions with Sgs1p (44, 45). Exo1p has been ⌬ implicated in mismatch repair through interactions with Msh2p. observed with the wild-type A-A-A strain. In contrast, the mlh1 In addition, exo1⌬ strains are moderately defective in preventing and msh2-R730W mutants behaved similarly to wild type in homeologous recombination between inverted repeat sequences preventing homeologous recombination (Table 3). These data (32, 46–48). As shown in Table 1 and Fig. 2, the sgs1⌬ mutation provide additional evidence that MSH6 and SGS1 play a primary suppressed heteroduplex rejection at a level similar to that seen role in preventing homeologous recombination, whereas MLH1 in msh6⌬. The srs2⌬ and exo1⌬ mutations showed no effect in plays a much less significant role. One explanation for why the our assay. mlh1⌬ and msh2-R730W mutants display nearly wild type phe- We also examined msh6⌬ and sgs1⌬ for their effect on SSA in notypes in A-F-A strains is that, in contrast to strains with only

9318 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0305749101 Sugawara et al. Downloaded by guest on September 27, 2021 Table 3. Effect of mismatch repair and sgs1⌬ mutations on the heterology in the more complicated case where a single strand distribution of A-A and F-A SSA events invades duplex DNA and where Pms1p clearly plays a role (12, A-A-A substrate A-F-A substrate 30, 31). One difference between our assays and those used in previous studies is that SSA occurs without the assistance of the Genotype Small ⌬ Large ⌬ Small ⌬ Large ⌬ strand exchange protein Rad51 (50, 51), whereas HO-induced Wild type 47.4 (1.7) 52.6 (1.7) 7.1 (2.6) 92.9 (2.6) gene conversions primarily proceed by strand exchanges medi- msh6⌬ 49.1 (1.2) 50.9 (1.2) 37.8 (2.1) 62.2 (2.1) ated by Rad51p (52–54). There may be additional complexities sgs1⌬ 49.9 (0.3) 50.1 (0.3) 32.7 (2.3) 67.2 (2.3) when mismatches are encountered in the context of a Rad51 mlh1⌬::KANMX 44.9 (3.0) 55.1 (3.0) 11.8 (1.2) 88.2 (1.2) protein filament involving both the single-stranded invading msh2-R730W 45.1 (1.5) 54.9 (1.5) 16.3 (0.6) 83.7 (0.6) strand and the template duplex DNA. The idea that mismatch repair proteins may operate in the context of such a filament was The relative intensities (ϮSD) of the small and large deletion products are raised by the studies of E. coli MutS protein associated with the shown 5 h after inducing HO expression. In all experiments, the overall Rad51p homolog, RecA (55). We note also that the 6-fold product formation was similar to the intensity of the starting substrate prior inhibition of SSA caused by 3% heterology in our study is less to HO induction. The (total product):(initial substrate) ratio for A-A-A strains was 1.0 Ϯ 0.07 for wild type, 0.92 Ϯ 0.21 for msh6⌬, and 0.90 Ϯ 0.21 for sgs1⌬. than the 14- to 50-fold inhibition caused by 1% heterology in For the A-F-A strains, the ratio was 1.1 Ϯ 0.03 for wild type, 0.65 Ϯ 0.16 for spontaneous recombination assays of gene conversion and cross- msh6⌬, and 0.74 Ϯ 0.06 for sgs1⌬. ing-over (12, 30, 31). How heteroduplex rejection is accomplished is not fully understood. Our data suggest strongly that it does not occur F-A, the A-F-A strains have a homologous sequence available simply by the normal mismatch repair process in which a that can be used for repair after an initial rejection͞unwinding mismatched base and a substantial amount of surrounding DNA event. In F-A strains, only a homeologous substrate is available, are removed nucleolytically. Given that SSA must occur within but it might be used in repeated rounds of annealing͞rejection a 205-bp region, extensive excision of DNA around mismatched before the cells die. bases during an attempt at homeologous SSA would preclude subsequent annealing at a more distant homologous locus. Discussion Rather, our data suggest that the mismatched DNA strands are Efficient recombination begins with a search for a homologous unwound so that they can continue to search for homology. We partner. Important steps in this process are the assessment of also considered the possibility that the F sequence in the A-F-A sequence identity and then the rejection or correction of strain was preferentially degraded, allowing only the A se- mismatched heteroduplex intermediates. In the SSA process quences to anneal. Our results from the F-A strains, however, described here, Sgs1p and Msh6p (and presumably Msh2p) showed that there was a strong bias to repair in favor of the F play important roles in heteroduplex rejection. In contrast, sequence rather than the A sequence, which would not occur if Pms1p and Mlh1p are very important for mismatch repair of the F sequence were preferentially degraded. In support of the SSA intermediates but play a much less prominent role in unwinding model, we found that the Sgs1p helicase was essential heteroduplex rejection. Surprisingly pms1⌬ had no effect on for heteroduplex rejection but not mismatch repair and that the heteroduplex rejection. A partial deficiency in heteroduplex Msh2-associated exonuclease Exo1p does not play an important rejection was only observed when PMS1, MLH2, and MLH3 role in heteroduplex rejection. In addition, sgs1-hd, which dis- were all deleted. Mlh1p has been previously shown to form rupts the helicase activity of SGS1 (56), confers a phenotype in ⌬ heterodimers with Pms1p, Mlh2p, and Mlh3p (20). Either the SSA F-A assay that is indistinguishable from the sgs1 Mlh1p functions indiscriminately with any heterodimeric part- mutation (T.G. and E.A., unpublished data). It is possible that ner in this process, or the absence of all three partner proteins there could be redundant exonucleases, as there are in mismatch reduces the abundance of Mlh1p. We conclude that mismatch repair in bacteria (57), but studies of Amin et al. (48), which repair and heteroduplex rejection are distinctly different pro- looked for additional genes involved in mismatch repair, failed cesses and that heteroduplex rejection occurs by unwinding a to support this possibility. heteroduplex intermediate rather than by destroying the in- We imagine heteroduplex rejection requires the Sgs1 heli- termediate by excision repair. case that takes its cue from Msh2p–Msh6p. In support of this SSA is a nonconservative process that appears to play a role in idea, a physical interaction between Sgs1 and Msh6 proteins repairing DSBs arising within repeated tandem arrays, such as in was reported using tandem affinity purification analysis (58), ͞ the rRNA-encoding DNA locus of S. cerevisiae (49). Such arrays and BLM, a RecQ Sgs1P homolog, was shown to interact with maintain a very high degree of sequence homogeneity. Here we human Msh6p both in vivo and in vitro (59). Alternatively, the GENETICS investigated how the processes of heteroduplex rejection and mis- Msh2p–Msh6p complex could bind to mismatches as they form match repair act to conserve homogeneity when repairing a DSB by in heteroduplex DNA and block further annealing. Evidence SSA. SSA is a unique process for investigating mismatch repair and for such a mechanism was obtained by Worth and Modrich heteroduplex rejection because it provides a straightforward way of (55), who showed that mutS prevented RecA-mediated strand generating heteroduplex DNA in vivo. In contrast, other studies of transfer between divergent sequences. Although SSA does not the role of mismatch repair proteins in homeologous recombination require Rad51p, the yeast recA homolog, it is conceivable that in mitotic cells have analyzed spontaneous gene conversion and Msh2p complexes interfere with the annealing of strands crossing-over that presumably involve the encounter of a single mediated by other gene products. Whether this type of inter- strand with an intact double-stranded DNA template. In these ference would lead to the results seen with the A-F-A com- studies, msh2⌬ exhibits a 3-fold stronger suppression of homeolo- petition strain depends on whether the trapped heteroduplex gous recombination than mlh1⌬ (S. Jinks-Robertson, personal could be reversed. communication); similarly, when sequence divergence was 6–9%, We thank members of the Alani and Haber laboratories for their msh2⌬ increased homeologous recombination more than pms1⌬ suggestions. This work was supported by a Natural Sciences and Engi- (12). In our study, PMS1 appears to have no antirecombination role neering Research Council of Canada Post Graduate Scholarship B in SSA. Award (to T.G.), National Institutes of Health Grants GM53085 (to The clear distinction between msh6⌬ and pms1⌬ in our study E.A.) and GM20056 (to J.E.H.), and a New York State Fellowship and suggests that there could be additional steps in the assessment of a Cornell University Anonymous Donor Fellowship (to B.S.).

Sugawara et al. PNAS ͉ June 22, 2004 ͉ vol. 101 ͉ no. 25 ͉ 9319 Downloaded by guest on September 27, 2021 1. Evans, E., Sugawara, N., Haber, J. E. & Alani, E. (2000) Mol. Cell 5, 789–799. 31. Datta, A., Hendrix, M., Lipsitch, M. & Jinks, R. S. (1997) Proc. Natl. Acad. Sci. 2. Pa៮ques, F. & Haber, J. E. (1999) Microbiol. Mol. Biol. Rev. 63, 349–404. USA 94, 9757–9762. 3. Humbert, O., Prudhomme, M., Hakenbeck, R., Dowson, C. G. & Claverys, J. P. 32. Nicholson, A., Hendrix, M., Jinks-Robertson, S. & Crouse, G. F. (2000) (1995) Proc. Natl. Acad. Sci. USA 92, 9052–9056. Genetics 154, 133–146. 4. Prudhomme, M., Martin, B., Mejean, V. & Claverys, J. P. (1989) J. Bacteriol. 33. Welz-Voegele, C., Stone, J. E., Tran, P. T., Kearney, H. M., Liskay, R. M., 171, 5332–5338. Petes, T. D. & Jinks-Robertson, S. (2002) Genetics 162, 1131–1145. 5. Grilley, M., Welsh, K. M., Su, S. S. & Modrich, P. (1989) J. Biol. Chem. 264, 34. Sugawara, N., Pa៮ques, F., Colaiacovo, M. & Haber, J. E. (1997) Proc. Natl. 1000–1004. Acad. Sci. USA 94, 9214–9219. 6. Lahue, R. S., Au, K. G. & Modrich, P. (1989) Science 245, 160–164. 35. Pa៮ques, F. & Haber, J. E. (1997) Mol. Cell. Biol. 17, 6765–6771. 7. Ban, C. & Yang, W. (1998) Cell 95, 541–552. 36. Kearney, H. M., Kirkpatrick, D. T., Gerton, J. L. & Petes, T. D. (2001) Genetics 8. Ban, C., Junop, M. & Yang, W. (1999) Cell 97, 85–97. 158, 1457–1476. 9. Matic, I., Taddei, F. & Radman, M. (1996) Trends Microbiol. 4, 69–72. 37. Sugawara, N. & Haber, J. E. (1992) Mol. Cell. Biol. 12, 563–575. 10. Modrich, P. & Lahue, R. (1996) Annu. Rev. Biochem. 65, 101–133. 38. Sandell, L. L. & Zakian, V. A. (1993) Cell 75, 729–739. 11. te Riele, H., Maandag, E. R. & Berns, A. (1992) Proc. Natl. Acad. Sci. USA 89, 39. Rose, M., Grisafi, P. & Botstein, D. (1984) Gene 29, 113–124. 5128–5132. 40. Studamire, B., Price, G., Sugawara, N., Haber, J. E. & Alani, E. (1999) Mol. 12. Chen, W. & Jinks-Robertson, S. (1998) Mol. Cell. Biol. 18, 6525–6537. Cell. Biol. 19, 7558–7567. 13. Johnson, R. E., Kovvali, G. K., Prakash, L. & Prakash, S. (1996) J. Biol. Chem. 41. Ray, B. L., White, C. I. & Haber, J. E. (1991) Mol. Cell. Biol. 11, 5372–5380. 271, 7285–7288. 42. Haber, J. E., Ray, B. L., Kolb, J. M. & White, C. I. (1993) Proc. Natl. Acad. Sci. 14. Habraken, Y., Sung, P., Prakash, L. & Prakash, S. (1997) Curr. Biol. 7, 790–793. USA 90, 3363–3367. 15. Marsischky, G. T., Filosi, N., Kane, M. F. & Kolodner, R. (1996) Genes Dev. 43. Myung, K., Datta, A., Chen, C. & Kolodner, R. D. (2001) Nat. Genet. 27, 10, 407–420. 113–116. 16. Prolla, T. A., Christie, D. M. & Liskay, R. M. (1994) Mol. Cell. Biol. 14, 44. Mankouri, H. W., Craig, T. J. & Morgan, A. (2002) Nucleic Acids Res. 30, 407–415. 1103–1113. 17. Prolla, T. A., Pang, Q., Alani, E., Kolodner, R. D. & Liskay, R. M. (1994) 45. Gangloff, S., Soustelle, C. & Fabre, F. (2000) Nat. Genet. 25, 192–194. Science 265, 1091–1093. 46. Fiorentini, P., Huang, K. N., Tishkoff, D. X., Kolodner, R. D. & Symington, 18. Harfe, B. D., Minesinger, B. K. & Jinks-Robertson, S. (2000) Curr. Biol. 10, L. S. (1997) Mol. Cell. Biol. 17, 2764–2773. 145–148. 47. Tishkoff, D. X., Boerger, A. L., Bertrand, P., Filosi, N., Gaida, G. M., Kane, 19. Durant, S. T., Morris, M. M., Illand, M., McKay, H. J., McCormick, C., Hirst, M. F. & Kolodner, R. D. (1997) Proc. Natl. Acad. Sci. USA 94, 7487–7492. G. L., Borts, R. H. & Brown, R. (1999) Curr. Biol. 9, 51–54. 48. Amin, N. S., Nguyen, M. N., Oh, S. & Kolodner, R. D. (2001) Mol. Cell. Biol. 20. Wang, T.-F., Kleckner, N. & Hunter, N. (1999) Proc. Natl. Acad. Sci. USA 96, 21, 5142–5155. 13914–13919. 49. Ozenberger, B. A. & Roeder, G. S. (1991) Mol. Cell. Biol. 11, 1222–1231. 21. Flores-Rozas, H. & Kolodner, R. D. (1998) Proc. Natl. Acad. Sci. USA 95, 50. Ivanov, E. L., Sugawara, N., Fishman, L. J. & Haber, J. E. (1996) Genetics 142, 12404–12409. 693–704. 22. Strand, M., Prolla, T. A., Liskay, R. M. & Petes, T. D. (1993) Nature 365, 51. Sugawara, N. & Haber, J. E. (2000) Mol. Cell. Biol. 20, 5300–5309. 274–276. 52. Malkova, A., Ivanov, E. L. & Haber, J. E. (1996) Proc. Natl. Acad. Sci. USA 93, 23. Kolodner, R. D. & Marsischky, G. T. (1999) Curr. Opin. Genet. Dev. 9, 89–96. 7131–7136. 24. Alani, E., Reenan, R. A. & Kolodner, R. D. (1994) Genetics 137, 19–39. 53. Signon, L., Malkova, A., Naylor, M. L., Klein, H. & Haber, J. E. (2001) Mol. 25. Chambers, S. R., Hunter, N., Louis, E. J. & Borts, R. H. (1996) Mol. Cell. Biol. Cell. Biol. 21, 2048–2056. 16, 6110–6120. 54. Ira, G. & Haber, J. E. (2002) Mol. Cell. Biol. 22, 6384–6392. 26. Hunter, N., Chambers, S. R., Louis, E. J. & Borts, R. H. (1996) EMBO J. 15, 55. Worth, L., Jr., Clark, S., Radman, M. & Modrich, P. (1994) Proc. Natl. Acad. 1726–1733. Sci. USA 91, 3238–3241. 27. Selva, E. M., New, L., Crouse, G. F. & Lahue, R. S. (1995) Genetics 139, 56. Mullen, J. R., Kaliraman, V. & Brill, S. J. (2000) Genetics 154, 1101–1114. 1175–1188. 57. Viswanathan, M. & Lovett, S. T. (1998) Genetics 149, 7–16. 28. Selva, E. M., Maderazo, A. B. & Lahue, R. S. (1997) Mol. Gen. Genet. 257, 58. Gavin, A. C., Bosche, M., Krause, R., Grandi, P., Marzioch, M., Bauer, A., 71–82. Schultz, J., Rick, J. M., Michon, A. M., Cruciat, C. M., et al. (2002) Nature 415, 29. Chen, W. & Jinks-Robertson, S. (1999) Genetics 151, 1299–1313. 141–147. 30. Datta, A., Adjiri, A., New, L., Crouse, G. F. & Jinks, R. S. (1996) Mol. Cell. Biol. 59. Pedrazzi, G., Bachrati, C. Z., Selak, N., Studer, I., Petkovic, M., Hickson, I. D., 16, 1085–1093. Jiricny, J. & Stagljar, I. (2003) Biol. Chem. 384, 1155–1164.

9320 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0305749101 Sugawara et al. Downloaded by guest on September 27, 2021