BRCA1 LOCALIZATION TO THE TELOMERE AND ITS LOSS UPON DNA DAMAGE
A Dissertation Submitted to the Faculty of the Graduate School of Arts and Sciences of Georgetown University in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biochemistry and Molecular & Cellular Biology
By
Rahul D. Ballal, M.S.
Washington, DC February 4, 2010
Copyright 2010 by Rahul D. Ballal All Rights Reserved
ii
BRCA1 LOCALIZATION TO THE TELOMERE AND ITS LOSS UPON DNA DAMAGE
Rahul D. Ballal, MS
Mentor: Eliot M. Rosen, MD, PhD
ABSTRACT
BRCA1, a tumor suppressor, participates in DNA damage signaling and repair.
Previously, we showed that BRCA1 over-expression caused inhibition of telomerase activity and telomere shortening in breast and prostate cancer cells. We now report that
BRCA1 knockdown causes increased telomerase reverse transcriptase (TERT) expression, telomerase activity, and telomere length. Studies utilizing a combination of
BRCA1 and TERT siRNAs suggest that BRCA1 also regulates telomere length independently of telomerase. Using telomeric ChIP assays, we detected BRCA1 at the telomere and demonstrated time-dependent loss of BRCA1 from the telomere following
DNA damage. Further studies suggest that BRCA1 interacts with TRF1 and TRF2 in a
DNA-dependent manner and that some of the nuclear BRCA1 colocalizes with TRF1/2.
Our findings further suggest that Rad50 is required to localize BRCA1 at the telomere and that the association of BRCA1 with Rad50 does not require DNA. Finally, we found that BRCA1 regulates the length of the 3’ G-rich overhang in a manner that is dependent upon Rad50. Our findings suggest that BRCA1 is recruited to the telomere in a Rad-50- dependent manner and that BRCA1 may regulate telomere length and stability through its presence at the telomere.
iii
ACKNOWLEDGEMENTS
I would like to thank Dr. Eliot Rosen who served as my mentor throughout my
PhD. I am grateful for his scientific acumen, the intellectual freedom he allowed, and most importantly for his mentorship. I would also like to thank my committee members,
Dr. Partha Banerjee (chair), Dr. Albert Fornace Jr., and Dr. Vicente Notario. Each one of them has enriched my education, contributed to this work, and supported me through the challenges of life and science. From the Rosen Lab I would like to thank Dr. Tapas Saha for teaching me early in my scientific career and Dr. Jingwen Xu, who always kept me grounded in reason. I would also like to thank the Biochemistry department and program for supporting my career. Finally, I would like to thank the Broad Institute of
MIT/Harvard for allowing me to continue my scientific pursuits.
I would like to thank my Georgetown friends who helped me get through the
PhD: Julie, Daniel, Laurent, Geoffrey, Caitlin, Pete (Johnson), Malena, and Tabari. I would also like to thank my family. From my parents and sister to my in-laws and sister- in-law, you have truly made this project possible. Without you, I would have not been able to complete this work. Finally, to my wife Sonia who is my dream, redemption, and savior; I love you. To my amazingly talented Meenu, I hope to inspire you as many have inspired me.
iv
DEDICATION
This dissertation is dedicated to my wife Sonia and daughter Sameena. I love you both.
v
LIST OF ABBREVIATIONS
Chapter I
BRCA1-breast cancer susceptibility gene 1 BASC-BRCA1 associated genome complex ATM-ataxia telangiectasia, mutated protein kinase ATR- ATM and Rad3-related protein kinase CHk2-checkpoint homolog 2 DDR-DNA damage response DSB-double strand break BARD1-BRCA1 associated RING domain 1 MRN Complex-Mre11-Rad50-Nbs1 NLS-nuclear localization signal Ser-Serine RNA Pol II-RNA polymerase II CStF-50-cleavage stimulation factor CtIP-C-terminal binding protein-interacting protein TRF1/2-telomere repeat binding factors 1/2 PARP-poly-(ADP-ribose)-polymerase Tankyrase-TRF1 interacting ankryin-related poly-(ADP-ribose)-polymerase TIN2-TRF1 interacting nuclear protein 2 NHEJ-non-homologous end joining HR-homologous recombination POT1-protector of telomeres 1 TPE-telomere position effect TERT-telomerase reverse transcriptase TR-telomerase RNA component ALT-alternative lengthening of telomeres PML-promyelocyctic leukemia DNA-PK-DNA protein kinase
Chapter II
TPG-total product generated (telomerase assay) siRNA-small interfering RNA RT-PCR-reverse transcriptase polymerase chain reaction Q-PCR-quantitative polymerase chain reaction TRF-telomere repeat fragment (telomere length assay) SEM-standard error of mean
vi Chapter III
ADR-adriamycin CDDP-cis-diaminodichloroplatinum (cis-platinum) ChIP-chromatin immunoprecipitation FISH-fluorescence in situ hybridization IP-immunoprecipitation IgG-immunoglobulin G
Chapter IV
HPA-hybridization protection assay DSN-double strand nuclease assay AE-Acridinium Ester
Chapter V
SWI/SNF-switch sucrose non-fermentable (yeast nucleosome) T-loop HR-telomere loop homologous recombination
vii
TABLE OF CONTENTS
Chapter I 1.A. Introduction 1 1.B. BRCA1: Structure & Function 5 1.C. Telomere Machinery: Structure & Function 14 1.D. Telomere Machinery: Cancer & DNA Repair 24 1.E. Statement of Purpose 30 1.F. Figure Legends 33 1.G. Figures 36
Chapter II 47 2.A. Abstract 48 2.B. Materials & Methods 49 2.C. Results 53 2.D. Discussion 55 2.E. Acknowledgements 58 2.F. Figure Legends 59 2.G. Figures 62
Chapter III 68 3.A. Abstract 69 3.B. Materials & Methods 70 3.C. Results 76 3.D. Discussion 83 3.E. Acknowledgements 88 3.F. Figure Legends 89 3.G. Figures 98
Chapter IV 115 4.A. Abstract 116 4.B. Materials & Methods 117 4.C. Results 119 4.D. Discussion 122 4.E. Acknowledgements 125 4.F. Figure Legends 126 4.G. Figures 130
Chapter V 136 5.A. Conclusions & Future Studies 137
References 144
viii
LIST OF FIGURES
Chapter I
Figure 1: BRCA1 Functional Domains and Selected Binding Partners 36 Figure 2: BRCA1 Functionality and Network 37 Figure 3: Model for BRCA1 mediated DNA Repair 38 Figure 4: Function of BRCA1 in Cell Cycle Checkpoints 39 Figure 5: Proposed Lariat Structure of Telomere (T-loop/D-Loop) 40 Figure 6: Telomeres Switch between Open and Closed Conformations 41 Figure 7: Main Components of the Shelterin Complex and their Binding Partners 42 Figure 8: Model for G-strand Overhang Creation 43 Figure 9: Model for Telomere Elongation by Telomerase 44 Figure 10. The Telomeric Cancer Hypothesis 45 Figure 11. DDR proteins localizes to the Telomere 46
Chapter II Figure 12: BRCA1 knockdown causes increased expression of the human telomerase reverse transcriptase (hTERT) 62 Figure 13:BRCA1 knockdown does not alter expression of TRF1, TRF2, hTR, or POT1 in T47D cells 63 Figure 13G: BRCA1 knockdown does not alter expression of TRF1, TRF2, or hTR in MCF-7 cells. 64 Figure 14: BRCA1 knockdown causes an increase in telomerase activity 65 Figure 15:BRCA1 knockdown causes telomere lengthening 66
Chapter III Figure 16: Telomeric chromatin immunoprecipitation (ChIP) assays to detect BRCA1 protein at the telomere in T47D cells 98 Figure 16G. Telomeric chromatin immunoprecipitation (ChIP)assays to detect BRCA1 protein at the telomere in MCF-7 cells 99 Figure 17: Adriamycin (ADR) and cis-platinum (CDDP) cause loss of BRCA1 from the telomere in T47D cells 100 Figure 17G: Adriamycin (ADR) and Cis-platinum (CDDP) cause loss of BRCA1 from the telomere in MCF-7 cells 101 Figure 18: BRCA1 reappears at the telomere following washout of ADR 102 Figure 18G: Adriamycin (ADR) treatment does not alter hTERT expression 103 Figure 19: Knockdown of the telomeric repeat binding protein TRF1 or TRF2 causes loss of BRCA1 from the telomere in T47D cells 104
ix Figure 19G: Knockdown of the telomeric repeat binding protein TRF1 or TRF2 causes loss of BRCA1 from the telomere in MCF-7 cells 105 Figure 20: Knockdown of BRCA1 does not cause loss of TRF1 or TRF2 from the telomere 106 Figure 20G: BRCA1 associates with TRF1 and TRF2 in vivo 107 Figure 21: BRCA1 association with TRF1 and TRF2 is mediated by DNA 108 Figure 21G: BRCA1 association with TRF1 is disrupted by treatment with Bal-31 109 Figure 22: Colocalization of BRCA1 with TRF1 and TRF2 in T47D cells 110 Figure 22G: Knockdown of BRCA1, TRF1, or TRF2 reduces protein expression 111 Figure 23: Teli-FISH of BRCA1 colocalization with telomeric probe in T47D cells 112 Figure 23G: Colocalization of BRCA1 with TRF1 and TRF2 in MCF-7 cells 113 Figure 23H: Teli-FISH analysis shows BRCA1 co-localizes with the Telomere in MCF-7 cells. 114
Chapter IV Figure 24: BRCA1-siRNA blocks telomere shortening due to TERT knockdown 130 Figure 25: Rad50 knockdown causes loss of telomeric BRCA1 in T47D cells 131 Figure 25G: BRCA1 association with Rad50 does not require DNA 132 Figure 26: BRCA1 regulates 3’ G-strand overhang length: hybridization protection assay 133 Figure 26G: ADR exposure for up to 72 hr causes little or no change in telomere length 134 Figure 27: BRCA1 regulates G-strand overhang length: double-strand nuclease (DSN) assays 135
x
CHAPTER I
xi 1.A INTRODUCTION
Breast cancer ranks as the number one cause of cancer incidence and the second
leading cause of cancer mortality among women (16,78,119). Approximately 5-10% of
breast cancer incidence is based on the inheritance of mutations in cancer susceptibility
genes (87). It is estimated that approximately half of the hereditary breast cancer cases
are due to mutations in Breast Cancer Gene 1 (BRCA1). Carriers of the BRCA1
mutation have a significantly increased chance (50-80%) of developing breast cancer by the age of 70, as well as an elevated risk to develop ovarian cancer (~40%) by the same age (31,36). While hereditary cases make up a small fraction of total breast cancer incidence, a large proportion of sporadic breast cancers (~60%) show decreased or absent
BRCA1 expression (67). This suggests a much wider role for BRCA1 in breast cancer progression.
The BRCA1 gene product is an 1863 amino acid nuclear phosphoprotein with a conserved N-terminal RING domain and acidic C-terminal transcriptional activation domain (78,86). BRCA1 has a wide array of function that includes repairing DNA damage, regulating gene transcription, and modulating in cell cycle checkpoints. In DNA damage response, BRCA1 forms the BRCA1-associated genome complex [BASC], is phosphorylated by ATM/ATR or CHk2, and mediates homology-directed repair in cooperation with BRCA2 and the MRN complex (88,120). BRCA1 also has an array if binding partners, which consist of oncogenes, cell cycle regulators, transcriptional activators, and DNA damage response proteins. Despite the abundance of BRCA1, very
1 little is known about how BRCA1 suppresses tumorigenesis. BRCA1 does appear to function as a tumor suppressor because mutation associated cancers exhibit a loss of the wild type allele in tumor cells; however, it is unclear as to what the suppression controls
(89,102,103). Exploring decreased BRCA1 expression will help identify details about its tumor suppressor function and provide insight as to how normal expression prevents tumorigenesis.
Telomere machinery (i.e. telomere components, telomerase) may help elucidate BRCA1 tumor suppressor function. Telomeres are found at the end of chromosomes and are comprised of guanine-rich tandem repeating DNA sequences. These duplex d(TTAGGG) repeats protect the chromosome from base-pair loss, end-to-end fusions, and other recombination events (11,68). Telomeres are critical for the preservation and stability of the genome. As telomeres length reduces, they reach a critical length prompting replicative senescence or programmed cell death. Telomere structure is comprised of the Telomere Loop (T-loop), which is created by the telomere duplex folding back on itself. The Displacement Loop (D-Loop) is formed by the 3' G-rich overhang intercalating with the T-loop. Both the T-loop and D-loop are associated with a complex of telomere-specific proteins known as Shelterin, which safeguards the telomere
(29,62). Telomere length is predominantly maintained by Telomerase, a ribonucleoprotein complex. It consists of an RNA template (TR or TERC) and a protein subunit with reverse transcriptase activity (TERT). Telomerase catalyzes the addition of further telomeric repeats via interactions with the telomere 3’ G-rich overhang.
2 Telomerase activity is generally absent in normal somatic cells but is detectable in
specialized cell lines, such as stem cells (10,44).
BRCA1 interactions with telomere machinery warrant study for several reasons in addition to revealing tumor suppressor function. First, recent data has linked telomere machinery to several DNA damage response proteins (e.g. Ku, DNA-Pkcs, RAD51D, and
the MRN complex) (62,93,96). This may explain why telomeres avoid being seen as
double strand breaks (DSBs) and are protected from DNA damage response (DDR).
Studies have also shown that telomere specific binding proteins (e.g. TRF2) can vacate
the telomere and respond to DNA damage occurring elsewhere (15). This interplay
between telomere protection and DDR suggests BRCA1 may be localized at the
telomere. Second, both BRCA1 and telomeres stabilize the cell via seemingly disparate
mechanisms. BRCA1 has been referred to as a “caretaker” gene, responding to DNA
damage, aiding transcription, and modulating cell cycle checkpoints. Telomeres stabilize
chromosomes by enabling lagging strand completion, by offering protection from DDR,
and forcing older cells into replicative senescence (3,29,95). If BRCA1 is present at the
telomere it may support chromosomal stability and thus decreased expression may result
in destabilization and tumorigenesis. Third, there is evidence that telomerase may enable
cancer cells to proliferate indefinitely and avoid cell death (telomerase hypothesis for
cancer). It has been shown that approximately 75% of cancer cell lines express high
levels of telomerase activity versus no activity in normal cells (44,80). If BRCA1 is
localized to the telomere it could help modulate telomerase access, have telomerase
independent effects, and influence telomere length. Finally, data in our laboratory has
3 already published some key findings regarding BRCA1 and telomere machinery. The lab found that the exogenous BRCA1 gene decreased telomerase enzymatic activity and caused telomere shortening in various breast and prostate cancer cell lines (116).
In the present work we wish to identify BRCA1 tumor suppressor function by examining its interaction with telomere machinery. We also hope to increase knowledge on telomeres and DDR protein association, understand how BRCA1 and telomere machinery may provide chromosomal stability, and begin to identify how telomerase gets reactivated in cancer. To complement the previous work done in our laboratory, we will approach these studies via a decreased BRCA1 expression model.
4 1.B BRCA1: STRUCTURE & FUNCTION
BRCA1 Domain Structure
Significant progress on the domain structure of BRCA1 has been made since it
was first cloned by Mark Skolnick and Myriad Genetics in 1994 (78). The BRCA1 gene
consists of 24 exons that encode for a 1,863 amino acid protein. Conservation among mammalian species is low except for two domains in the N-terminus (RING finger domain) and the C-terminus (BRCT motifs) (59,72,86). The RING finger domain was among the early structures identified and encompasses the first 109 amino acids (Figure
1). Interestingly, this domain does not bind directly to DNA but rather interacts with a
BRCA1 associated RING domain (BARD1) to access DNA. BARD1 is structurally related to BRCA1 and has both an N-terminus RING domain and C-terminus BRCT motifs. BRCA1 and BARD1 heterodimerize via a four helix bundle formed by helices that flank the core RING domains. Studies show that this heterodimerization provides stability to both proteins, is important in the structural integrity of BRCA1, and is disturbed by BRCA1 mutations (17,18). In fact, a study of BRCA1 missense mutations
(critical Zn2+ binding residues) significantly decreased heterodimerization with BARD1
(75). Recent evidence has also suggested that the BRCA1-BARD1 complex function in
ubiquitylation when the cell is undergoing replication stress (50). These observations
suggest that the RING domain is an important structural component of BRCA1 and decreased function could be implicated in tumorigenesis.
5 BRCT motifs, located at the C-terminus, are equally important structural
components of BRCA1 (Figure 1). They are ~100 amino acid domains and serve to
mediate several BRCA1 protein interactions. For example, BRCA1 interacting partners
such as C-terminal binding interacting protein (CtIP) and p300 bind through BRCT motifs (Figure 1) (20,38). Recent data has shown that BRCT motifs can operate as phosphopeptide-binding sites and mediate interactions with a spectrum of phosphoproteins (e.g. phosphorylated CtIP). BRCT motifs also appear in a wide range of
DNA damage response proteins that include XRCC1 and MDC1 (111). Interestingly,
BRCT missense and truncating mutations destabilize the coupling of the motifs and are thought to impair BRCA1 damage response. Likewise, BRCA1 mutants regularly display mutations in BRCT motifs. These data suggest that normal BRCT motif function could play a role in preventing tumor progression and binding to phosphoproteins.
There are several structural domains between the N-terminus (RING domain) and the C-terminus (BRCT motifs) that could be implicated in tumorigenesis. A summary can be seen below (14,78,86,119):
• NLS Domains: The BRCA1 nuclear localization signal (NLS) domains have
several critical binding partners. First, the NLS domain binds to ZBRK1, which
is a zinc-finger protein that suppresses transcription through an interaction with
GADD45. The NLS domain is also where p53, Myc, and RB bind to BRCA1.
Mutation of this domain effects both BRCA1 nuclear localization and p53 tumor
suppressor initiation.
6 • DNA Binding Domain: The DNA-binding domain contributes to the DNA-
repair-related functions of BRCA1, which are partly mediated through proteins
that make up the BRCA1-associated surveillance complex (BASC). This includes
the MRN complex (Mre11-Rad50-Nbs1), ATM, and CHK2. Interestingly, the
BASC complex is made up of several tumor suppressors and hence mutation of
this DNA binding domain could block their function.
• SCD Sequences: BRCA1 has several SQ cluster domains (SCDs) between amino
acids 1,280 and 1,524. These are preferred sites of ATM phosphorylation and are
highly relevant in functional DNA damage response. Non functioning SCDs
could inhibit downstream DNA damage response and enable tumorigenesis.
BRCA1 Function
The domain structure of BRCA1 lends itself to a wide spectrum of functionality.
In order to identify new tumor suppressor function, it is important to illustrate several known roles of BRCA1. These include roles in DNA damage response (DDR), transcriptional control, and cell-cycle checkpoint maintenance (Figure 2).
DDR consists of a vast signal amplification cascade that senses DNA damage, arrests partitioning of daughter cells, and coordinates repair efforts. A DDR response is highly specific to the type of DNA damage, which includes double strand breaks (DSBs) and single strand exposure (92). Evidence for BRCA1 involvement in DDR is multifold.
First, BRCA1 is hyperphosphorylated in response to DNA damage and migrates to sites of replication forks bound by Proliferating Cell Nuclear Antigen (PCNA). Second, in
7 response to ionizing radiation, BRCA1 is phosphorylated and bound to Ataxia
Telangiecta Mutated Kinase (ATM). Both ATM and closely related Ataxi Telangiecta
Rad-3 related kinase (ATR) are considered to be key protein kinases activated early in
DDR (40,88,99). There is also evidence that BRCA1 is phosphorylated at other sites.
For example, CHK2, a cell cycle control kinase, phosphorylates BRCA1 at Ser988 upon exposure to ionizing radiation (8,41). It is unclear as to how phosphorylation effects
BRCA1 function or if that phosphorylation is inhibitory or activating in the context of
DDR.
The third piece of evidence for BRCA1 involvement in DDR comes from examination of BRCA1-deficient embryonic stem (ES) cells. Mutant ES cells that lack
BRCA1 are hypersensitive to oxidative reagents, γ-irradiation, and hydrogen peroxide.
These mutant ES cells also show impaired homology directed repair function and defective transcription-coupled repair. Interestingly, mutant ES cells lacking BRCA1 showed similar phenotypes to mutant ES cells lacking Rad51 (Rec A homolog) or
BRCA2 (42,90). This suggests that there may be a functional link between BRCA1 and
Rad51 mediated DDR. It is also important to note that these mutant ES cells suffered from increased chromosomal aberrations, which could be a result of faulty DDR (63). A
fourth line of evidence for involvement in DDR is the various BRCA1 binding partners
(Figure 2). BRCA1 colocalizes and regulates Rad50, which in turn effects function of the
Mre11-Rad50-Nbs1 (MRN) complex. The MRN complex has various roles in DDR that
include removing flush ends at DSBs to make single stranded DNA (ssDNA) overhangs
for HR mediated repair (101,106,122). BRCA1 also colocalizes with γ-H2AX (H2AX)
8 in the form of distinct nuclear foci surrounding the site of DNA damage. One component
in DDR response is changes to chromatin structure as demonstrated by phorsphorlyation of Ser139 of H2AX (84,85). BRCA1-H2AX foci are missing in H2AX deficient cells, suggesting that BRCA1 may have some functional role aiding H2AX phosphorylation
post DNA damage.
One major role of BRCA1, which may provide insight into tumor suppressor
function, is its involvement in DSB repair. DSB in DNA are caused by a variety of
mechanisms and are powerful activators of DDR. The two major types of DSB repair are
homologous recombination (HR) and nonhomologous end joining (NHEJ). HR is
typically error free due to use of a homologous sequence. NHEJ on the other hand, uses
no sequence homology and often results in a variable sequence change at the DSB
(5,100). Phosphorylated BRCA1 (via ATM) plays a direct role in HR by recruiting
BRCA2 and Rad51, which facilitates filament formation, recruitment of other complexes,
and strand invasion (Figure 3) (24,88). Some recruitment specifics remain a mystery. It
is not known how BRCA1 controls the MRN complex and if it solely regulates its arrival
to DSBs. Furthermore, it is unclear if BRCA1 detection of DSBs is exclusively through
the BASC complex or some other means. Despite these issues BRCA1 does have an
important role in both detection and repair of DSBs via HR. Recent studies have also
begun to link BRCA1 function to NHEJ. One current model for NHEJ involves the
Ku70/Ku80 heterodimer, which binds to DSBs and is required for NHEJ. BRCA1 may
play a role in Ku-independent form of NHEJ, known as “error free” NHEJ. Interestingly,
9 Ku70 has been shown to localize to the telomere and functions to protect the telomere against DNA Damage Response (DDR) (51,97).
BRCA1 also exerts transcriptional control on several genes implicated in DDR and cancer. Examining this function may provide insight as to possible tumor suppressor roles. Early evidence of BRCA1 transcriptional control was seen when BRCA1 enhanced transcription of GAL4 promoters due to GAL4 binding. The C-terminus and
BRCT motifs interact with several other transcriptional repressors or enhancers. For example, the C-terminus fuses with RNA polymerase II (RNA Pol II) via RNA helicase
A. It is believed that BRCA1 functions as a transcriptional activator for RNA Pol II
(19,23,73). One of the BRCT motifs stimulates p53 dependent transcription of the p21 promoter. More recent studies have suggested that BRCA1 is a co-activator of p53 and p53 is stabilized by overexpression of BRCA1. Interestingly, overexpression of BRCA1 is known to also increase transcription of stress response factors, such as p21 and
GADD45 (45,46). Related to p21, BRCA1 may also increase transcription of STAT1, which is known to be important in immune response and induction of γ-IFN regulated genes (79). The transcriptional control over stress response factors suggests that BRCA1 may help coordinate DDR in response to cellular stresses. This could be an important tumor suppressor function of BRCA1.
In addition to the C-terminus, the N-terminus of BRCA1 plays a role in transcriptional control through the RING finger domain. A recent study showed the
BRCA1-BARD1 complex inhibits CStF-50, a cleavage stimulation factor. CStF-50 creates cleavage for polyadenylation by binding to the 3’ end of newly synthesized RNA.
10 This inhibition may help prevent incorrect RNA processing due to upstream DNA damage (57). Perhaps of more interest, there is evidence that BRCA1 interacts with c-
Myc, a known oncogene, through its Myc binding regions near the N-terminus.
Overexpression of c-Myc, has been shown to cause tumor formation in mouse mammary glands. When BRCA1 is overexpressed in the same system tumor formation, due to c-
Myc, is markedly reduced in a dose dependent manner (76). This suggests that the tumor suppressor properties of BRCA1 may reduce the transforming abilities of c-Myc and other oncogenes (e.g. H-ras). More recent data has found that sites very close to the N- terminus of BRCA1 are responsible for blocking transcriptional activation of the estrogen receptor (ER-α). This is also relevant to BRCA1 tumor suppressor function because ER-
α activation has been implicated in approximately 70% of human breast cancers (32).
Several observations link BRCA1 to cell cycle control. First, BRCA1 message levels change over the course of the cell cycle, suggesting different points of regulatory
influence. BRCA1 expression levels increase in the late G1 phase and peak at G1-S
transition. The peak in G1 is accompanied by hyperphosphorylation and there is transient
dephosphorylation after M phase (25). Second, BRCA1 associates with several cell cycle
proteins that include E2F, CDC2, and various members of the cyclin family. Third,
BRCA1 is a co-activator of p53 mediated gene transcription, which plays an important
role in checkpoint control (60,117). A loss of BRCA1 may trigger activation of the p53-
p21 mediated checkpoint, which would target cells for death. This may help explain why
BRCA1-null embryos have severe developmental delays.
11 A more interesting function of BRCA1 may be how it links checkpoint control
with DNA damage response (Figure 4). Cell checkpoints play a critical role in DDR by
preventing DNA from being replicated until fixed. Recent studies have shown that both
BRCA1 and ATM are required for effective S-phase and DNA damage induced G2/M
phase checkpoints. There is also evidence that expression of BRCA1 variants defective
in ATM mediated phosphorylation result in G2/M arrest (118). This implies that
phosphorylation of BRCA1 by ATM may a critical step in activating both checkpoint
control and DDR. BRCA1 may additionally regulate G2/M checkpoints via activation of
the Chk1 signaling cascade, which is essential for G2/M checkpoint function. Finally,
ionizing radiation studies on BRCA1-defecient cells failed to induce the correct G2/M
arrest, suggesting that BRCA1 is needed for G2/M checkpoint activation (25,118).
The examination of BRCA1 structure and function reveals a complex network of
biological interactions that include DDR, transcriptional regulation, and cell cycle
checkpoint control. BRCA1 may be one common thread in these seemingly disparate cellular processes. Interestingly, through its involvement in protecting, repairing, and
controlling DNA, BRCA1 has been referred to as a “caretaker” gene. By aiding DDR,
managing transcription, and stopping cellular division, BRCA1 does keep the genome
safe from deleterious forces. However, several questions about BRCA1 persist. One in
particular is BRCA1 function as a tumor suppressor. Does tumor suppressor function
incorporate a subset of aforementioned BRCA1 functions? More importantly, does tumor suppressor function consists of alternate but related “caretaker” function. These
questions remain important in unlocking how BRCA1 is involved in cancer initiation and
12 progression. They also point us another cellular process that requires protection from
DDR, regulates transcription, and is vital for continued cellular division. BRCA1 regulation of telomere machinery in the context of cancer may help unlock a novel tumor suppressor role and add to the growing list of caretaker functionality.
13 1.C TELOMERE MACHINERY: STRUCTURE & FUNCTION
Telomeres
Telomeres are terminal protein-DNA structures that form a “cap” at the end of chromosomes. They consist of varying length DNA sequences in the form of 5’-
TTAGGG-3’ repeats. Both the sequence and length vary across species. Telomeres primary role is to protect the genome by providing stability during replication and preventing chromosomal ends from being treated as dangerous DSBs (9,68,74). They do not contain protein-encoding genes but may have a peripheral impact on transcription through positioning (7). Telomeres also play a role in buffering the “end replication” problem. The extra d(TTAGGG) repeats allow DNA polymerase to extended the leading strand through the telomere and provide a template to complete the lagging strand.
Telomeres gradually shorten over the course of cell divisions due to telomerase inactivation and cellular degradation (9). Cells with populations of very short telomeres activate DDR (e.g. p53/Rb inactivation) and enter a two stage proliferation barrier. In mortality stage 1 (M1) cells stop dividing and reach senescence. In mortality stage 2
(M2) cells are considered in crisis and are targeted for programmed cell death via various intracellular mechanisms (e.g. apoptosis) (56). While not well understood, cells that can extend their telomeres in M2 can avoid programmed cell death, start replicating, and become immortal. Several types of tumor cells employ telomere extension (via telomerase re-activation) to escape M2 and restart cell division (107).
14 Telomere biology has been around since the 1930s and the field has seen an
evolution of both structure and function. One evolving view in the telomere biology field
has been telomere organization. Classical views suggest that telomere structures are linear; however, more recent work has described telomere DNA as folding back on itself to form a lariat structure (Figure 5) (43). More interesting is the view that telomere structure is dynamically shifting between open and closed conformations (Figure 6).
This may explain why younger cells, in closed lariat conformation, have greater protection from DDR and cell senescence pathways. This closed conformation may also preclude telomerase from accessing and elongating the telomere. As cells begin to age, the telomere structure is more often found in an open conformation paving the way for eventual recognition by DDR pathways and entry into cellular crisis. The open conformation may also illicit rogue nuclease activity, telomerase docking, and
recruitment of various protein complexes (81). There is little known about how or when
telomeres switch from closed to open confirmation. Recent studies have suggested that
the open-closed transition is coordinated with cell cycle checkpoints. Other studies have
suggested that the open conformation is a result of telomere shortening, which suggests
older cells have telomeres that are more susceptible to damage.
The main structural component of telomeres is a protein complex that regulates
length, preserves integrity, and controls function. Recently, this complex has been given
the name Shelterin to reflect its protective role against DDR and other cellular stresses.
Two major components of the Shelterin complex are Telomere repeat binding proteins
one and two (TRF1/TRF2) (29,43). TRF1 has been shown to regulate telomere length,
15 while TRF2 modulates both telomere length and telomere capping. TRF1, a homodimer, is located in the double strand portion of the telomere and it helps in T-loop formation and stability (Figure 7). Early research found that over-expression of TRF1 results in sustained telomere shortening and under-expression of TRF1 (via dominant negative mutants) leads to telomere elongation (11,11,29). This observation led to further examination of TRF1 components. A key family of TRF1 associated proteins are tankyrase 1 and 2 (TRF1-interacting ankyrin-related poly-(ADP-ribose)-polymerase).
These proteins are primarily responsible for ribosylation of TRF1. Ribosylation likely sequesters TRF1 from the double strand portion of the telomere and enables telomerase access to the 3’ G-strand overhang (94). It is unknown whether this ribosylation is an initiator of telomere conformational change. Knowledge of tankyrase function is still limited but early evidence suggests that it may be a positive regulator of telomere length via TRF1 inhibition. On the flip side, parallel research discovered a negative regulator of telomere length TIN2 (TRF1-interacting nuclear protein 2). TIN2 appears to cause conformational changes in TRF1 that may prevent tankyrase binding (55). TRF1 has about four times higher affinity for telomeric DNA than TRF2, which is likely due to a presence of arginine residues versus lysine residues.
The other major component of the Shelterin complex is TRF2. TRF2 is found in two different locations: the double-stranded portion of the telomere and near the junction of the 3’ G-strand overhang and t-loop (Figure 7) (11). Early evidence found that over- expression of TRF2 prompts telomere attrition while expression of the dominant negative mutants removes TRF2 from telomere regions and leads to growth arrest (29). TRF2 has
16 several roles that contribute to telomere structure. In conjunction with TRF1, TRF2 helps
form both The T-loop structure and the D-loop structure. The T-loop is formed by the
telomere folding back to form a lariat structure; the D-loop is created when the 3’ G-
strand overhang invades the existing double stranded telomere repeat. The loop
structures are thought to protect telomeres from being seen as DSBs and from other
degradation mechanisms (e.g. nuclease activity) (43). The loop structure also
characterizes the closed telomere conformation, which may help prevent telomerase
docking and telomere extension (Figure 6). Recent studies on the TRF2 complex have
shown that it interacts with a wide range of proteins that include ones associated with
DDR. TRF2 binds with the MRN complex (Mre11/Rad50/NBS1), which plays a central
role in DSB repair. It also binds with XPF/ERCC1 nuclease, which involved in
nucleotide excision repair pathways. Most recently Ku70/80, heterodimers that promote
the non-homologous end-joining (NHEJ) of DNA breaks, have been shown to associate with the TRF2 complex (Figure 7) (6,11,82). The functional significance of these DDR
proteins at the telomere is still being defined and new protein associations are being
discovered. Another interesting twist to this DDR-telomere relationship is the
observation that TRF2 may localize to sites of DNA damage in non-telomeric regions.
Recent studies have shown that TRF2 rapidly moves to sites of laser induced DNA
damage (15). While it has not been shown that TRF2 is a part of DDR response, it is
interesting to note the fluid exchange between DDR proteins and telomere machinery.
Finally, there is evidence that TRF2 stabilizes the G-strand overhang (see below). The
G-strand overhang is a critical marker for telomere stability and studies have shown that
17 overexpression of dominant negative TRF2 (dn-TRF2) causes significant overhang loss.
This leads to increased telomere fusions and growth arrest.
The G-strand overhang is another unique telomere structure that enables telomerase to dock and add duplex d(TTAGGG) repeats. The overhang is ~150-250 nucleotides long and is found on the 3’ terminus on both sides of the chromosome. As described earlier, the closed telomere conformation is partly due to G-strand overhang invasion of the duplex telomere (9,13). This D-loop creation may be stabilized by G- quadraplex structures, which are a result of the Guanine (G) rich residues forming a square tetrad bond. This may help telomeres to maintain the D-loop and T-loop structures and keep in closed conformation. G-strand overhang formation is partially explained by the “end of replication” problem created by linear DNA replication.
Lagging strand synthesis requires the additional of RNA primers that serve as precursors to Okazaki fragments. When the RNA primer of the most distal Okazaki fragment is removed by DNA polymerase a gap is created at the end of the lagging strand. Hence, the leading strand forms a G-strand overhang to compensate. Recent evidence has suggested that the removal of the RNA primer is not sufficient to create a G-strand overhang. Instead there is nucleolytic digestion of the in the 5’Æ3’ direction on both the leading and lagging strand (Figure 8) (30,65,109). The combination of the two processes is thought to create the G-strand overhang.
The G-strand overhang is critical to telomere stability and function. Recent studies have shown that elimination of G-strand overhangs causes activation of DDR pathways on telomeres, increased telomere fusions, and formation of multi-centric
18 chromosomes (30). Furthermore, loss of TRF2 reduces G-strand overhang signal by over
50% and also initiates DDR pathways. Interestingly, new evidence has shown that
increased G-strand overhang length may also initiate HR versus NHEJ (29). Hence, it is
becoming increasing clear that the G-strand overhang length must be closely modulated
by telomeric proteins. Protection of Telomeres one (Pot1) is one protein that regulates
the G-strand overhang. It exclusively binds to ssDNA but also indirectly binds to the
TRF1 complex (Figure 7). Recent evidence has shown that Pot1 binding to TRF1 is
important for correct Pot1 loading on the G-strand overhang. Recent studies have also
shown that decreased Pot1 expression reduces G-strand overhang length but actually
induces telomere extension (53,58,61). Pot1 is thought to protect the telomere in several ways. First, Pot1 regulates G-strand length. Second, Pot1 prevents telomerase binding to
the G-strand overhang by steric hindrance. Finally, there is evidence that Pot1 suppresses
ATR-mediated telomeric specific DDR. It is believed that the mechanism involves Pot1
unwinding the G-strand overhang from the duplex telomere and promoting reinvasion
(53).
In addition to the several functions described, telomeres also play a role in
transcriptional repression of specific genes. In yeast this function, known as the telomere position effects (TPE) exists in long telomeres and is dependent on proximity to the telomere (7). TPE is just beginning to be observed in human disease (e.g. facioscapulohumeral muscular dystrophy). Another function of telomeres is chromosomal reorganization in meiosis (11). Finally, new evidence suggests that
19 telomeres may be subject to epigenetic regulation due to their association with nucleosomes (68).
Telomerase
Telomerase is a multi-domain ribonucleoprotein that is responsible for maintaining telomere length via additions of d(TTAGGG) repeats to the 3’ end. Its main function is to elongate telomeres that would otherwise be subject to gradual attrition via replication cycles (Figure 9). Telomerase has unique processivity because it can add significant nucleotide repeats to telomeres at one time. These additions enable cells to proliferate and avoid the aforementioned proliferation barriers (74). Interestingly, telomerase is only active in a small population of specialized cells, which include germ line cells and stem cells. Telomerase is also “re-activated” in the majority of cancer cells allowing them to proliferate indefinitely and evade cell death. The telomerase complex is made up of two core components, TR (or TERC) and TERT. The TR subunit is a RNA template that pairs with telomere 3’ G-strand overhang and provides the correct nucleotide sequence for telomere extension. The TR subunit is 451 nucleotides long but only 11 nucleotides are used as the template for telomere extension (26,44,77). Like other RNA species, TR needs associated co-factors for stability and processivity. These include, Dyskerin, NHP2, and NOP10. Dyskerin is particularly interesting because recent studies found that Dyskerin or TR deficiencies led to two distinct forms of
Dyskeratosis Congenita, a disease which affects proliferative tissues in the body. The finding conveys the importance of Dyskerin as a co-factor in TR, as well as its relevance
20 in adding telomere repeats to telomeres. There are other studies that point to TR
relevance. An early study found that genetic disruption of mouse TR (mTR) stopped
telomerase activity and reduced telomere length in mice. These mice also had a lower
propensity for tumor formation in later generations, which suggests telomerase re-
activation may promote tumorigenesis (35,44).
The TERT component of telomerase functions as a classical reverse transcriptase
and has very high specificity for telomere repeats. Its main role is to add nucleotides to
the 3’ G-strand overhang that is bound to the TR subunit (26,35). Once the new
nucleotide repeats are added by TERT, the DNA replication machinery completes telomere extension by adding corresponding nucleotides to lagging strand. The domain structure of TERT encompasses four main functions. First, TERT contains seven motifs that work together to provide reverse transcriptase functionality. Second, the N-terminal domain plays a role in nucleic acid binding. Third, TERT has an RNA binding domain
that probably cross-talks with the TR component (35). Though the exact mechanism is
unknown, disruption of this interaction may have an effect on how many repeats TERT
adds. Finally, there is the C-terminal domain that is relevant in enzyme processivity (35).
Telomerase regulation throughout cellular development occurs partly through
transcriptional regulation of TERT. There is evidence that TERT undergoes alternative
splicing and a dominant negative variant (TERT-α) inhibits telomerase function (110).
Furthermore, while the TR component of telomerase is expressed ubiquitously in
mammalian cells, TERT expression is limited to cells with active telomerase (10,54).
This suggests that TERT may be the limiting component in telomerase function. Recent
21 studies have shown that increases in TERT expression may signal tumor activity or
neoplastic growth (10,54). This has lead to further studies on TERT regulation and control. Recent findings suggest that several tumor suppressors may negatively regulate
TERT expression: Mad1 via c-Myc, TGFβ via SIP1, and Menin via direct binding to the
TERT promoter. Work in the Rosen lab has also established BRCA1 as a regulator of
TERT expression. Studies show that wtBRCA1 inhibited the expression TERT but had
no effect on the expression of a subset of other components of the telomerase. BRCA1
may partially regulate TERT via its ability to suppress c-Myc transcriptional activity.
However, the Rosen lab also found that wtBRCA1 alone was sufficient to inhibit TERT
promoter activity, TERT expression, and telomerase activity (116). This suggests that
BRCA1 may be directly implicated at the telomere. Figuring out how BRCA1 functions
at the telomere is a major thrust of this project.
It is estimated that 10-15% of cancer cells stabilize their telomeres through a
telomerase independent mechanism referred to as ALT (Alternative Lengthening of
Telomeres). ALT is believed to function via a novel Promyelocytic Leukemia (PML)
body known as APB (ALT Associated PML bodies). APBs are circular nuclear
structures that contain telomeric DNA, TRF1, TRF2, and the PML protein. Interestingly, immuno-staining suggests that APBs may also contain RAD51 and RAD52, two co- factors involved in DNA synthesis and recombination (21). This may suggest that ALT functions via some recombination mechanism that has not been elucidated to date. ALT activity may also co-exist with re-activated telomerase function. In fact, recent in vivo data suggests that cancer cells can switch between ALT and telomerase-based telomere
22 maintenance. As more information about the ALT mechanism is revealed there will be greater opportunity to understand it within the context of telomere machinery structure and function.
23 1.D TELOMERE MACHINERY: CANCER & DNA REPAIR
Cancer
While the interaction between telomere machinery is fascinating, in most somatic cells neither telomerase nor ALT activity is detectable. Telomere shortening occurs over the course of cell division followed by activation of DDR and entry into the M1 proliferation barrier. If telomeres continue to shorten the cell may enter the M2 barrier, which is also referred to as cellular crisis. The M2 barrier is characterized by widespread chromosomal instability, neoplastic formation, and telomere fusions. Furthermore, cells in M2 are targeted for death via programmed mechanisms (e.g. apoptosis) (28,54,56). It remains unclear if entry into either M1 or M2 is characterized by shorter than average telomeres or by a small population of very short telomeres. It is also unclear as to whether cell division is the only telomere shortening mechanism. Recent studies have pointed to rogue nucleases, oxidative stress, and replication errors as other ways to degrade telomeres (62). Occasionally, a small number of cells survive the M2 barrier and re-activate telomerase, ALT, or potentially both. These cells have several characteristics.
First, they have stable telomere lengths due to activation of telomerase or ALT. Second, they have unlimited replicative capacity and can bypass the Hayflick limit, which states cells have limited division capacity. Finally, most cells surviving the M2 barrier have significant genomic instability that often promotes tumorigenesis (54,62).
The steps from immortalization to tumorigenesis remain complex. Recent studies have shown that telomerase re-activation is critical in tumorigenesis (54). One study
24 showed conversion of human fibroblasts to transformed cancer cells involved TERT expression and the Ras oncogene. Another study showed inhibition of telomerase in human cancer cell lines leads to rapid apoptosis or increased cell senescence (11).
Finally, the vast majority of cancer cells (~85%) have re-activated telomerase or renewed
ALT activity. These findings, in part, have led to the “telomeric hypothesis for cancer,” which states that telomere length maintenance allows cancer cells to become immortalized (Figure 10) (11). Telomerase re-activation provides needed stability so short telomeres can avoid the M1 or M2 proliferation barriers. On the other hand, telomerase re-activation does not mean cells will necessarily become tumorigenic.
Several studies have shown that ectopic expression of telomerase in cells fails to confer immortality or tumorigenesis (39). Telomerase re-activation may require high levels of genomic instability or chromosomal damage to make cells tumorigenic. Furthermore, other genomic caretakers, such as BRCA1, may lose functionality, which could further aid tumor formation.
DNA Repair
DSBs in mammalian cells are repaired by HR and NHEJ mechanisms. In HR a homologous stretch of DNA on a sister chromatid serves as a template to guide repair of the damaged strand. In NHEJ two DNA ends are directly joined together without establishing sequence homology. Both HR and NHEJ employ a variety of cofactors and steps to accomplish DSB repair. HR based repair involves creation of a 3’ single strand overhang, which is most likely mediated by the MRN complex. The new overhangs are
25 bound by RPA, which is eventually replaced by the Rad51 complex. Both the Rad51 complex and the single strand overhang invade intact homologous sequences to initiate strand exchange and eventually recombination. NHEJ is also initiated by the MRN complex but requires the Ku70/Ku80 heterodimer. Ku70/80 complex associates with the
DSB and recruits DNA-dependent protein kinases (DNA-PKcs), which self- phosphorylate in the presence of ATM. Finally, XRCC4 and XLF repair the break by utilizing ligase IV. Response to DSBs is almost immediate and DDR involves both transcriptional repression and cell cycle controls (27,93).
Telomeres have the critical role of preventing ends of chromosomes from being seen as DSBs and activating DDR. Linear ends of chromosomes are similar to DSBs because they are exposed DNA structures, have single stranded overhangs, and threaten the genomic stability of the cell (39). Telomeres employ several different mechanisms to protect these ends from DDR and associated repair machinery. First, they utilize structural remodeling, which is driven largely by the Shelterin complex. Both TRF1 and
TRF2 protein complexes help form protective T-loop and D-loop structures. Another component of Shelterin, Pot1, helps the G-strand overhang invade the duplex telomere repeats and form the D-loop (11,29,95). While this insertion is considered an abnormal structure, the G-strand overhang no longer is recognized as single stranded DNA and thus avoids DDR (112). Second, and perhaps most fascinating, is recent evidence that DDR proteins are localized to the telomere and interact with the Shelterin complex. This observation presents an intriguing paradox in telomere biology (Figure 11) (112). How can the same DDR proteins that characterize telomeres as DSBs be localized at the
26 telomere? The answer to this puzzle is quite complex; however, recent studies may help
shed light on this unusual phenomenon.
As discussed, the MRN complex is an integral part of DDR. It also plays an
important role in telomere maintenance and chromosomal stability. Both Rad50 and
Mre11 associate with the TRF2 protein complex and are localized to the telomere. In S-
phase of the cell cycle NBS1 joins Rad50 and Mre11 via TRF2 binding (68). Recent
evidence has shown that Rad50 and Mre11 stabilize the T-loop structure and NBS1
binding promotes the opening of the telomere complex for telomere access. Interestingly,
down regulation of any component of the MRN complex causes a transient reduction in
G-strand overhang length (22). This suggests that the MRN complex is stabilizes the
telomere in multiple ways. Finally, new evidence has shown that the MRN complex is
needed for ATM phosphorylation of TRF1. This finding is of interest because ATM
phosphorylates many of its substrates, such as BRCA1, at the site of DNA damage. It
also suggests that DDR proteins retain their function despite being localized at the
telomere (62). Another class of DDR proteins found at the telomere is DNA protein
kinase (DNA-PK). DNA-PK is made of two components, the catalytic subunit (DNA-
PKcs) and the Ku70/80 heterodimer. The Ku70/80 family plays a major role in NHEJ of
DSBs and is thought to recruit DNA-PKcs to the site of DNA damage. At the telomere
DNA-PK has multiple functions. First, the Ku70/80 heterodimer localizes to the
telomere by binding to the TRF2 protein complex. Like the MRN complex, Ku70/80 helps stabilize the T-loop structure. Ku70/80 is also thought to help G-strand overhang formation by stimulating 5’Æ3’ exonuclease activity on the lagging strand (47,93). On
27 the flip side, DNA-PKcs recognizes short telomeres and helps telomerase elongate them
to prevent DDR. While the mechanism has not been elucidated, evidence suggests that
DNA-PKcs and TERT may form a temporary holoenzyme complex.
Most relevantly, recent studies have suggested that BRCA1 may also help
telomeres avoid DDR. The evidence comes from several places. First, the Rosen lab has shown that BRCA1 over-expression inhibited hTERT expression and telomerase activity in human breast carcinoma cell lines. Reduced hTERT expression was due, in part, to inhibition of TERT promoter activity via the c-Myc E-box element. Furthermore, over- expression of BRCA1 caused telomere shortening. Although wild-type BRCA1- transfected cell lines showed much shorter telomeres, these cells continued to proliferate and did not enter into senescence or apoptosis, suggesting that BRCA1 may contribute to telomere stabilization (116). Second, BRCA1 colocalizes with the Rad50 component of the MRN complex, suggesting that it may play a role directly at the telomere (122).
Finally, BRCA1 colocalizes with TRF1, which may suggest it may help protect T-loop formation much like the MRN complex and Ku70/80 (37,116). What is not known to date is how BRCA1 dysfunction, as seen in sporadic cancers, impacts telomere machinery. Furthermore, the location of BRCA1 in the context of telomere structure has not been established. It remains unclear if BRCA1 is present directly at the telomere or through the Shelterin complex. It is also not known how BRCA1 is recruited to the telomere. While, several BRCA1 partners, such as the MRN complex, are found at the telomere it is unclear whether BRCA1 drives recruitment or is recruited by telomere bound DDR complexes. If BRCA1 is recruited to the telomere is it important to consider
28 how BRCA1 content can be increased or decreased. Most importantly, the functional role of BRCA1 at the telomere has not been established. This role could be critical in further understanding how telomeres evade DDR, as well as elucidate an important new tumor suppressor function.
29 1.E STATEMENT OF PURPOSE
Specific Aim 1: To investigate the impact of decreased BRCA1 expression on telomere machinery.
Previous studies in the Rosen lab have shown that over-expression of BRCA1 inhibited hTERT expression and telomerase activity in human breast carcinoma cell lines
(116). Reduced hTERT expression was due, in part, to inhibition of TERT promoter activity via the c-Myc E-box element. Over-expression of BRCA1 also caused telomere shortening. Interestingly, recently published studies suggest tumor suppressors may negatively regulate telomerase activity (e.g. Menin binding to TERT). In this aim we explore how decreased BRCA1 expression, as seen in ~70% of sporadic breast cancers, modulates telomere machinery. The goal is to show that decreased BRCA1 expression causes increased hTERT expression and increased telomere length. This observation would help prove that BRCA1 is a negative regulator of TERT and telomere length. It may also help define one tumor suppressor function of BRCA1.
Specific Aim 2: To determine if BRCA1 is localized at the telomere and how it modulates telomere machinery.
Recent evidence suggests that DDR proteins are localized to the telomere and interact with the Shelterin complex (29,104). These include the MRN complex, DNA-
PK, and several others. The goal of this aim is to explore if BRCA1 is localized to the telomere, if its localization can be perturbed by inducing DNA damage in the cell, and if
30 it interacts with the core components of the Shelterin complex. This work will provide insight as to how BRCA1 regulates telomere length. Furthermore, it will provide key evidence as to the interplay between BRCA1 as a DDR factor and as a negative regulator of telomere length. The goal is to prove that BRCA1 is localized to the telomere and binds to telomeric DNA via components of the Shelterin complex. We also anticipate that inducing DNA damage will alter the BRCA1 content associated with the telomere.
These studies will shed light onto how BRCA1 is integrated at the telomere and how it may regulate telomere length. Furthermore, it may help explain how BRCA1 operates both as a DRR factor and as a component recruited to protect the telomere.
Specific Aim 3: Identify a functional role for BRCA1 localization at the telomeres.
BRCA1 localizes to the telomere and associates with TRF1 and TRF2, which are two core components in the Shelterin complex. While this finding helps explain how decreased BRCA1 expression may cause changes in telomerase activity and telomere length, it does not establish a functional role for BRCA1. In this aim we will attempt to identify a functional role for telomeric BRCA1 by first examining how other DDR factors influence the telomere. For example, decreases in the proteins that make up the
MRN complex have been associated with shorter G-strand overhangs and telomere instability (22). It is likely that the DDR factors at the telomere operate similarly to protect from DDR mechanisms. Hence, we will examine how BRCA1 could impact G- strand overhang length. Another important strategy is to see how BRCA1 interacts with other DDR factors at the telomere. This will provide insight as to how BRCA1 is
31 recruited to the telomere. An important outcome of this aim will be greater insight as to
how DDR factors modulate telomere stability. In previous studies we have shown that wt-BRCA1 transfected cell lines had shorter but more stable telomeres (116). However, the mechanism that increased stability was not understood. By further exploring the role of BRCA1 at the telomere we will get greater insight into telomere stability and identify a novel tumor suppressor function.
Hypothesis: We believe that decreased BRCA1 expression will cause telomere lengthening and increase telomerase activity, which is the converse of over-expression studies. We anticipate the changes in telomere length and telomerase activity will be gradual and occur over the course of several cell divisions. Since other DDR machinery has been implicated at the telomere, we believe that BRCA1 may regulate telomeres and telomerase, in part, by being localized at the telomere site. While we expect to find that
BRCA1 interacts with the Shelterin components, it is unclear as to which specific components recruit BRCA1. We anticipate that an intact telomere structure is needed for
BRCA1 localization and other DDR proteins, such as the MRN complex, maybe needed for localization. Finally we expect BRCA1 to have a discrete function at the telomere,
which may be similar to other DDR proteins at the telomere (e.g. Rad50). We anticipate
BRCA1 function at the telomere involves supporting the Shelterin complex and
protecting the telomere from being seen as a DSB by DDR machinery.
Work presented in this thesis was published as follows: Ballal, R. D., T. Saha, S. Fan, B. R.
Haddad, and E. M. Rosen. 2009. BRCA1 Localization to the Telomere and Its Loss from the Telomere in
Response to DNA Damage. J.Biol.Chem. 284:36083-36098
32
1.F FIGURE LEGENDS
Figure 1. BRCA1 Functional Domains and Selected Binding Partners. BRCA1, an
1863 amino acid protein, has several key functional domains that interact with a wide array of partners (78).
Figure 2. BRCA1 Functionality and Network. BRCA1 has roles in a variety of cellular processes that include DNA damage response (DDR), transcriptional control, and cell-cycle checkpoint maintenance (78).
Figure 3. Model for BRCA1 mediated DNA Repair. BRCA1 plays an important role in DSB repair. BRCA1 is phosphorylated by ATM in response to DSBs, recruits the
MRN complex and cooperates with BRCA2 and Rad51 to coordinate DNA repair (83).
Figure 4. Function of BRCA1 in Cell Cycle Checkpoints. BRCA1 plays an important role in coordinating cell cycle checkpoints after DNA damage. ATM is activated by ionizing radiation and phosphorylates CtIP to release BRCA1. Phosphorylated BRCA1 in combination with ATM may be important in regulating the G2/M cell cycle checkpoint
(83).
33 Figure 5. Proposed Lariat Structure of Telomere (T-loop/D-Loop). Telomeres,
which cap chromosomes, were originally seen as linear structures. However, more recent
research has revealed that telomeres may fold back on themselves to form a protected
lariat structure (96).
Figure 6. Telomeres Switch between Open and Closed Conformations. Telomeres
may change conformations to accommodate replication, telomerase docking, and protein
associations. The Model shows how protein complex may interact with different
telomere conformations (blue, telomere G-strand, red, telomere C-strand, green, G-strand
overhang (81).
Figure 7. Main Components of the Shelterin Complex and their Binding Partners.
TRF1/2 are major components of the Shelterin complex, which protects telomeres from being recognized as DSBs. Panel A and B show how TRF1/2 complexes bind to the open and closed telomere conformation. Panel Ca and Cb depict the various binding partners of TRF1/2, which include DDR proteins like Ku86 (11).
Figure 8. Model for G-strand Overhang Creation. Lagging strand synthesis produces
a lagging strand product with a short overhang (vs. blunt end leading strand product). It
is believed that additional nucleolytic digestion occurs in the 5’Æ3’ direction on both the
leading and the lagging strand to create the G-strand overhang (104).
34 Figure 9. Model for Telomere Elongation by Telomerase. Telomerase adds
d(TTAGGG) repeats to the 3’ end of telomeres by TR (or TERC) binding and TERT
extension. Standard DNA replication machinery extends the complimentary strand (step
4) (28).
Figure 10. The Telomeric Cancer Hypothesis. Telomeres in somatic cells gradually
shrink with cell divisions until they are recognized by DDR and cells undergo growth arrest (M1). If telomeres continue to shrink, the cell can be targeted for cell death (M2).
The telomeric hypothesis for cancer suggests that cells in M2 survive and become
immortalized by telomere extension. This can be accomplished, in part, by telomerase
activation or the ALT mechanism (80).
Figure 11. DDR proteins localizes to the Telomere. Recent evidence has suggested that telomeric complexes (green) recruit DDR proteins (orange) to help protect the telomere from being seen as a DSB. Recent evidence has shown that TRF2, which is an integral part of the Shelterin complex, may also function as a DDR protein (112).
35 1.G FIGURES
Figure 1: BRCA1 Functional Domains and Selected Binding Partners
Adapted from: Narod, S. A. and W. D. Foulkes. 2004. BRCA1 and BRCA2: 1994 and beyond. Nat Rev Cancer 4:665-676.
36
Figure 2: BRCA1 Functionality and Network
Adapted from: Narod, S. A. and W. D. Foulkes. 2004. BRCA1 and BRCA2: 1994 and beyond. Nat Rev Cancer 4:665-676.
37
Figure 3: Model for BRCA1 mediated DNA Repair
Adapted from: Rezler, E. M., D. J. Bearss, and L. H. Hurley. 2002. Telomeres and telomerases as drug targets. Current Opinion in Pharmacology 2:415-423.
38
Figure 4: Role of BRCA1 in Cell Cycle Checkpoints
Adapted from: Rezler, E. M., D. J. Bearss, and L. H. Hurley. 2002. Telomeres and telomerases as drug targets. Current Opinion in Pharmacology 2:415-423.
39
Figure 5: Proposed Lariat Structure of Telomere (T-loop/D-Loop)
Adapted from: Stewart, S. A. and R. A. Weinberg. 2006. Telomeres: Cancer to Human Aging. Annual Review of Cell and Developmental Biology 22:531-557.
40
Figure 6: Telomeres Switch between Open and Closed Conformations
Adapted from: Price, C. 2001. How many proteins does it take to maintain a telomere? Trends in Genetics 17:437-438.
41
Figure 7: Main Components of the Shelterin Complex and their Binding Partners
Adapted from: Blasco, M. A. 2005. Telomeres and human disease: ageing, cancer and beyond. Nat Rev Genet 6:611-622
42
Figure 8: Model for G-strand Overhang Creation
Adapted from: Verdun, R. E. and J. Karlseder. 2007. Replication and protection of telomeres. Nature 447:924-931.
43
Figure 9: Model for Telomere Elongation by Telomerase
Adapted from: De Boeck, G., R. G. Forsyth, M. Praet, and P. C. Hogendoorn. 2009. Telomere-associated proteins: cross-talk between telomere maintenance and telomere- lengthening mechanisms. J Pathol 217:327-344.
44
Figure 10: The Telomeric Cancer Hypothesis.
Adapted from: Pendino, F., I. Tarkanyi, C. Dudognon, J. Hillion, M. Lanotte, J. Aradi, and E. Segal-Bendirdjian. 2006. Telomeres and Telomerase: Pharmacological Targets for New Anticancer Strategies? Current Cancer Drug Targets 6:147-180.
45
Figure 11: DDR proteins localizes to the Telomere
Adapted from: Williams, R. S., M. S. Lee, D. D. Hau, and J. N. M. Glover. 2004. Structural basis of phosphopeptide recognition by the BRCT domain of BRCA1. Nat Struct Mol Biol 11:519-525
46
CHAPTER II
47 2.A ABSTRACT
Previous studies in the Rosen lab have shown that over-expression of BRCA1
inhibited hTERT expression and telomerase activity in human breast carcinoma cell lines
(116). Reduced hTERT expression was due, in part, to inhibition of TERT promoter
activity via the c-Myc E-box element. Over-expression of BRCA1 also caused telomere
shortening. Interestingly, recently published studies suggest tumor suppressors may
negatively regulate telomerase activity (e.g. Menin binding to TERT). In this aim we
explore how decreased BRCA1 expression, as seen in ~70% of sporadic breast cancers,
modulates telomere machinery. The goal is to show that decreased BRCA1 expression
causes increased hTERT expression and increased telomere length. This observation
would help prove that BRCA1 is a negative regulator of TERT and telomere length. It
may also help define one tumor suppressor function of BRCA1.
Work presented in Chapter II was published as follows: Ballal, R. D., T. Saha, S. Fan, B. R.
Haddad, and E. M. Rosen. 2009. BRCA1 Localization to the Telomere and Its Loss from the Telomere in
Response to DNA Damage. J.Biol.Chem. 284:36083-36098.
48 2.B MATERIALS AND METHODS
Cell lines and culture. Human breast cancer (T47D and MCF-7) and prostate cancer (DU-145) cells were originally obtained from the American Type Culture
Collection (Manassas, VA). T47D, MCF-7, and DU-145 cells were cultured in
Dulbecco’s Modified Eagle’s medium (DMEM) supplemented with 10% fetal calf serum,
non-essential amino acids (100 mM), L-glutamine (5 mM), streptomycin (100 μg/ml),
and penicillin (100 U/ml) [all purchased from BioWhittaker, Walkersville, MD], as
described before (33,116). All cell lines were maintained at 37ºC in a humidified atmosphere of 95% air and 5% CO2 and sub-cultured weekly, using trypsin.
Small interfering RNAs (siRNAs). Proliferating cells (at about 20-30% of
confluency) were treated with 100 nM of the indicated siRNA, using siPORT Amine
transfection reagent (Ambion, Foster City, CA) according to the manufacturer’s
instructions. The efficacy of the knockdown was confirmed by Western blotting. The
siRNAs used in this study were as follows: 1) BRCA1-siRNA, two siRNAs custom
synthesized by Dharmacon (Chicago, IL): si-2, CAGCUACCCUUCCAUCAUA and si-
5, CUAGAAAUCUGUUGCUAUG (5’→3’); 2) BRCA1 control-siRNA, D-001810-01
(Dharmacon); 3) TRF1-siRNA, sc-36722 (Santa Cruz Biotechnology, Santa Cruz, CA);
4) TRF1 control-siRNA, sc-37007 (Santa Cruz); 5) TRF2-siRNA, sc-38505 (Santa Cruz);
and 6) TRF2 control-siRNA, sc-44230 (Santa Cruz). For multiple siRNA treatments,
cells were harvested 72 hr after initial treatment (approximately three population
doublings) and treated again with siRNA (100 nM) at the same time as they were plated.
49 Semi-quantitative RT-PCR analysis. Rigorously controlled semi-quantitative
RT-PCR analysis was performed as described earlier (33,116). Total cell RNA was extracted using the RNase Easy Mini Kit (Qiagen, Valencia, CA). Aliquots (200 μg) of total RNA were reverse-transcribed using 50 units of Superscript III reverse transcriptase
(Invitrogen, Pleasanton, CA) in a 20 μl reaction volume. One-μl of the transcribed cDNA was used for PCR amplification, using hot start Taq polymerase (Denville, South
Plainfield, NJ). For each amplified product, the PCR conditions and cycle numbers were adjusted so that all reactions occurred within the linear range of product amplification.
The PCR primer sequences and predicted sizes of the amplified products are listed in
Table 1. PCR products were analyzed by electrophoresis through 0.8% agarose gels containing 0.1 mg of ethidium bromide per ml; and the gels were photographed under ultraviolet illumination. The mRNA levels were quantitated by densitometry of the cDNA bands and expressed relative to that of the control gene (β-actin).
Telomerase activity assays. Telomerase enzymatic activity was quantitated using the TRAPEZE-RT Telomerase Detection Kit (catalog #7710, Millipore, Bedford, MA), according to the manufacturer’s instructions. This assay quantifies telomerase activity by measuring real-time fluorescence emission using quantitative PCR (qPCR). Briefly, following the indicated cell treatments, cells were lysed using 200-μl of CHAPS buffer.
Aliquots of total cell lysate (1 μg of protein per well) were assayed in a 96-well qPCR plate. Wells were set aside for generation of the standard curve (TSR8 control template), negative control (no sample), and a PCR amplification efficiency control (TSK, K1).
Telomerase activity [measured as Total Product Generated (TPG)] was calculated by
50 comparing the average Ct values from the sample wells against the standard curve
generated by the TSR8 control template. TRAPEZE-RT assays were carried out on an
ABI 7500 qPCR machine (Applied Biosystems, Foster City, CA).
Telomere length assays. Telomere length was determined by Southern blot
analysis, using the TeloTAGG Telomere Length Assay Kit (catalog #12209136001,
Roche Diagnostics, Mannheim, Germany). Aliquots of 2 μg of purified genomic DNA
were digested by incubating mixing HinfI (20 MU) and RsaI (20 MU) [Roche] for 2 hr at
37°C. The samples were separated by 1% agarose gel electrophoresis in Tris-acetate-
EDTA buffer (pH 8.0). Gels were transferred to a Brightstar plus positively charged nylon membrane (catalog #AM10102, Ambion) and cross-linked using ultraviolet light
for 2 min. Hybridization was performed according to the manufacturer’s instructions.
Membranes were incubated for 2 hr in a pre-hybridization solution at 42°C and then
hybridized for 3 hr under the same conditions by adding 2-μl of the digoxigenin-labeled
telomere-specific probe. After hybridization, the membranes were washed twice at 25ºC
for 15 min in washing solution and then twice at 50°C in 0.5X washing solution for 20
min. Membranes were then incubated with a digoxigenin-specific antibody covalently
coupled to alkaline phosphatase. The products were visualized using alkaline phosphatase
metabolizing CDP-Star, a chemiluminescent substrate (Roche) and recorded on X-ray
film. The mean telomere restriction fragment (TRF) length was calculated by
densitometric segmenting of the output signal into grids and calculating the signal within each grid as a function of the corresponding molecular weight. TRF length was determined based on three independent experiments per cell line.
51 Western blotting. Western blotting was performed as described before (116).
Equal aliquots of total cell protein (50 μg) or the contents of an IP were electrophoresed on a 4-20% Tris-glycine gel and transferred to a polyvinylidene fluoride membrane
(Millipore). The membrane was blocked for 1 hr in blocking buffer (Sigma) and blotted using the desired primary antibody. The membranes were incubated with the appropriate species-specific horseradish peroxidase-conjugated secondary antibody (Santa Cruz,
1:10,000 dilution). Blotted proteins were visualized using the enhanced chemiluminescence system (Santa Cruz). Kaleidoscope pre-stained protein markers
(BioRad, Hercules, CA) were used as size standards. Primary antibodies were (all from
Santa Cruz): BRCA1 (C-20, 1:200), Rad50 (sc-36641), TRF1 (C-19, 1:200), TRF2 (H-
300, 1:200), hTERT (L-20, 1:200), α-actin (I-19, 1:400).
Statistical methods. Data are presented as mean ± SEM from at least three independent experiments. Comparisons were made using the two-tailed Student's t-tests, where appropriate.
52 2.C. RESULTS
BRCA1 knockdown causes increased hTERT expression
Knockdown of BRCA1 using siRNA (100 nM x 72 hr) caused a 1.4-fold increase
in hTERT mRNA levels in T47D breast cancer cells (Figure 12A), which was significant as compared with control (CON)-siRNA (P < 0.05, two tailed t-test), when quantified with densitometry, based on three independent experiments. Similarly, BRCA1-siRNA caused a significant (1.45-fold) increase in hTERT protein levels, determined by Western blotting (P < 0.05) [Figure 12B]. BRCA1-siRNA caused comparable increases in hTERT mRNA (P < 0.05) and protein (P < 0.05) levels in MCF-7 breast cancer cells (Figures
12C and 12D, respectively). In these studies, the BRCA1-siRNA reduced the BRCA1
mRNA and protein levels to about 25% of the control values.
In contrast to hTERT, BRCA1 knockdown had little or no effect on the mRNA or
protein levels of the telomere repeat-binding factors TRF1 and TRF2 in T47D (Figures
13A and 13B). Similarly, BRCA1-siRNA had little or no effect on the levels of hTR, the
RNA component of the telomerase enzyme, in T47D (Figure 13C) or on the mRNA
levels of POT1 (protector of telomeres 1) [Figure 13D]. Similar results were observed in
MCF-7 cells (Figure 13G). Thus, BRCA1 under-expression leads to higher levels of the
catalytic subunit hTERT but not the RNA component or several subunits of the Shelterin
complex.
BRCA1 knockdown increases telomerase enzymatic activity
53 We next, tested the effect of BRCA1 under-expression on telomerase activity, using the TRAPEZE-RT assay, a commercial fluorescence detection assay that utilizes quantitative PCR amplification (qPCR). As shown in Figure 14A, BRCA1-siRNA caused about a 45% increase in telomerase activity in T47D, as compared with either CON- siRNA or vehicle-treated cells (P < 0.05). The efficacy of the BRCA1 knockdown is illustrated in Figure 14A (right panel). Similarly, BRCA1-siRNA caused modest but reproducible increases in telomerase activity in MCF-7 (Figure 14B) and DU-145 (Figure
14C) cells (P < 0.05). The TSK control is an internal control for the PCR efficiency; and the negative control is a no sample PCR control. Similar results were observed using the standard telomerase repeat amplification protocol (TRAP) [data not shown], suggesting that BRCA1-siRNA causes a modest but consistent increase in telomerase enzymatic activity.
BRCA1 knockdown causes lengthening of telomeres.
To test the effect of BRCA1 under-expression on telomere length, cells were treated with BRCA1-siRNA (vs. control-siRNA or vehicle only) over a period of 21 days, with harvesting and re-plating in fresh medium with fresh siRNA every three days.
They were then assayed for telomere length by Southern blotting, as described in the
Methods section. As shown in Figures 15A and 15B, BRCA1 knockdown caused significant increases in telomere length [quantified as telomere restriction fragment
(TRF) length] (P < 0.05) in T47D, MCF-7, and DU-145 cells. In T47D cells, the mean
TRF length increased from 4.8 kbp (vehicle-treated cells) to 8.1 kbp (BRCA1-siRNA
54 treated cells); while in MCF-7 cells, the corresponding increase was from 4.3 to 7.9 kbp; and in DU-145 cells, the telomere length increased from 5.1 kbp to 7.6 kbp. Figure 15C shows the effect of BRCA1-siRNA on hTERT and BRCA1 protein levels after several siRNA treatments and validates that the treatment maintained low BRCA1 levels and increased hTERT levels.
2.D DISCUSSION
We used various human cancer cell lines to explore how decreased BRCA1 expression modulates telomerase enzymatic activity and telomere length. Using targeted
BRCA1-siRNA we found a significant increase in both mRNA and protein expression of the hTERT component of telomerase holoenzyme. However, this increase was not seen in the hTR component of telomerase or in several core proteins that make up the
Shelterin complex (TRF1, TRF2, Pot1). Higher hTERT expression translated into a modest but consistent increase in telomerase enzymatic activity, as well as significant increases in telomere length. These results were the converse of previous studies in the
Rosen lab that showed BRCA1 over-expression reduced hTERT expression and telomere length (116). The combination of the two findings suggests that BRCA1 is a negative regulator of telomerase activity and telomere length. They also show that regulation occurs over a wide spectrum of BRCA1 expression levels. These findings are consistent with another set of studies that showed BRCA1 disruption, via expression of a dominant negative truncated mutant (trBRCA1), led to increased telomere length (37).
55 The modest increase in telomerase activity does not match the sizable rise in telomere length. There are several possible explanations for this. First, BRCA1 siRNA treatment only reduces BRCA1 expression levels by ~80%. The remaining BRCA1 could preclude telomerase loading onto the telomere or inhibit telomerase enzymatic activity once loaded onto the G-strand overhang. While it is hard to imagine that expelled BRCA1 would further increase hTERT expression, it is possible that hTR expression may change with complete BRCA1 absence. Second, decreased BRCA1 expression may inhibit telomere degradation pathways that regulate telomere structure.
One possible pathway is the nucleolytic digestion of the 5’Æ3’ of the leading strand, which helps form the G-strand overhang. Recent studies have suggested that the
Artemis-like nuclease Apollo, which is localized to the telomere via TRF2, provides this
5Æ3’ exonuclease function (62). BRCA1 absence may preclude correct telomere digestion, lead to shortened G-strand overhangs, and prevent telomerase docking. A shorter G-strand overhang may also prevent G-strand invasion and put the telomere at risk of being seen as a DSB in need of repair. Finally, the significant increase in telomere length may be due to an unknown telomerase independent mechanism. While the ALT mechanism comes to mind, it is unlikely to be activated concurrently with telomerase.
Previous studies have also shown the human cancer cell lines used in these studies are
ALT negative (81). That being said, there is evidence that cells can switch between ALT and telomerase activity and decreased BRCA1 expression could play a role in this transition (21). A recent study has shown that decreased BRCA1 expression caused formation of anaphase bridges in ALT positive cells, which reflects telomere instability
56 (37). It is clear the BRCA1 modulates telomerase activity and telomere length across a
wide range of expression levels. Recent evidence has shown that several tumor suppressors negatively regulate telomerase activity (3). By establishing BRCA1 as a
negative regulator of telomerase activity and telomere length we have begun to identify a
novel tumor suppressor function.
The observed increases in telomere length may have more far reaching
implications. Upon first glance, longer telomeres suggest increased chromosomal
stability; however, this may not be the case. In previous studies we showed that BRCA1
overexpression resulted in shorter but more stable telomeres (116). The cells with short
telomeres did not reach proliferation barriers (e.g. senescence) and continued to grow at
normal rates. It is unclear how BRCA1 functions to protect short telomeres and to
potentially destabilize long telomeres. Another consideration is if the increases in
telomere length imply an “open” conformational state. It is believed that the “open”
conformation enables telomerase docking, telomere elongation, and eventual DDR
activation (3,81). Furthermore, recent evidence has shown that the likelihood of a
telomere “open” state is inversely proportional to telomere length (28). It remains
unknown as to what drives the telomere to switch between states and how telomere
proteins remodel around the different conformations. It is possible that BRCA1 may play
a role in toggling telomere conformation; however, it is unclear as to its specific function.
Finally, the increases in telomere length are not accompanied by increases in expression
of core Shelterin proteins. This means there is less protein per unit length of telomere.
57 This could lead to decreased telomere protection in spite of the increases in length, as
well as foster genomic instability.
We believe that the telomere length increases are not due to differences in cell
proliferation rates. To ensure this we conducted control experiments that charted cell
growth during and after BRCA1 siRNA treatment. None of the treatments caused any
significant changes in cell proliferation rates. We also found that decreased BRCA1 had little effect on TRF1 and TRF2 expression levels, which make up the core of the
Shelterin complex. This suggests that BRCA1 is likely a peripheral component of telomere structure and may rely on core telomere proteins to modulate telomerase activity and telomere length. What is not clear is if BRCA1 is physically located at the telomere and by what mechanism it regulates telomerase activity and telomere length. Further studies on these two points form the basis for the next two chapters.
2.E ACKNOWLEDGEMENTS
This work was supported by grants from the United States Public Health Service (RO1-
CA80000, RO1-CA82599, and RO1-CA104546, to EMR), a pre-doctoral award from the
American Federation for Aging Research (AFAR) [to RDB], and the Cosmos Scholars
Foundation (Henry H. Work Science Award, to RDB).
58 2.F FIGURE LEGENDS
Figure 12. BRCA1 knockdown causes increased expression of the human telomerase
reverse transcriptase (hTERT). Subconfluent proliferating T47D (A, B) and MCF-7
(C,D) cells were treated with BRCA1-siRNA (100 nM), control (CON)-siRNA (100 nM),
or vehicle only for 72 hr and harvested for semi-quantitative RT-PCR assays (A, C) or for
Western blotting (B,D) to detect hTERT, BRCA1, and actin (control protein). The
amplified PCR products and the protein bands were quantitated by densitometry, expressed relative to the actin control, and normalized to the control (vehicle-treated cells). Values plotted are means ± SEM of at least three independent experiments. *P <
0.05 (two-tailed t-test).
Figure 13. BRCA1 knockdown does not alter expression of TRF1, TRF2, hTR, or
POT1 in T47D cells. Subconfluent proliferating T47D cells were treated as described for
Figure 1; and semi-quantitative RT-PCR assays (A) and Western blotting (B) were
carried out to detect TRF1, TRF2, BRCA1, and actin (control gene). Panels C and D
shows semi-quantitative RT-PCR assays for the human telomerase RNA component
(hTR) and POT1, respectively. The amplified PCR products and protein bands were
quantitated by densitometry, expressed relative to actin, and normalized to the vehicle-
treated control cells. Values plotted are means ± SEM of at least three independent
experiments. *P < 0.05.
59 Figure 13G. BRCA1 knockdown does not alter expression of TRF1, TRF2, or hTR in MCF-7 cells. Subconfluent proliferating MCF-7 cells were treated with BRCA1-
siRNA (100 nM), control (CON)-siRNA (100 nM), or vehicle only for 72 hr and
harvested for semi-quantitative RT-PCR assays (A, C) or for Western blotting (B) to
detect TRF1, TRF2, or hTR. The amplified PCR products and the protein bands were
quantitated by densitometry, expressed relative to the actin control, and normalized to the control (vehicle-treated cells). Values plotted are means ± SEM of at least three independent experiments. *P < 0.05 (two-tailed t-test).
Figure 14. BRCA1 knockdown causes an increase in telomerase activity.
Subconfluent proliferating T47D (A), MCF-7 (B), and DU-145 (C) cells were treated with BRCA1-siRNA (100 nM), control (CON)-siRNA (100 nM), or vehicle for 72 hr and harvested for TRAPEZE-RT assays (which utilize qPCR), as described in the Methods section. Western blots to confirm the BRCA1 knockdown are provided for each cell line.
Telomerase activity values were calculated as TPG units and normalized to the vehicle control. Values are means ± SEM of at least three independent experiments. *P < 0.05
(two-tailed t-test). Note: TSK is an internal control for standardization of the assay; and a no sample negative control is included.
Figure 15. BRCA1 knockdown causes telomere lengthening. Subconfluent proliferating T47D (A), MCF-7 (A), and DU145 (B) cells were treated with BRCA1- siRNA (100 nM), control (CON)-siRNA (100 nM), or vehicle only over a period of 21
60 days with replating in fresh medium containing fresh siRNA every three days. The cells
were then harvested and assayed to determine telomere length via Southern blot
hybridization (see Methods section). Telomere length was quantitated and expressed as
the mean telomere repeat fragment (TRF) length. Values plotted are means ± SEM of at
least three independent experiments. *P < 0.05. Panel C shows Western blots of hTERT and BRCA1 after different numbers of siRNA treatments of T47D cells.
Table 1. Primers used for RT-PCR in this study. A summary of the different primers
used in this study.
61 2.G FIGURES
Figure 12: BRCA1 knockdown causes increased expression of the human telomerase reverse transcriptase (hTERT).
AB T47D T47D bp hTERT (146 bp) kDa 100- 130- hTERT (132 kDa) 300- BRCA1 (292 bp) 204- BRCA1 (220 kDa) β-Actin (432 bp) 400- 39- α-Actin (43 kDa) 2 hTERT BRCA1 2 hTERT BRCA1 1.5 * 1.5 * 1 1 0.5 0.5 Fold Change Fold Fold Change Fold 0 0 Vehicle CON BRCA1 Vehicle CON BRCA1 siRNA siRNA siRNA siRNA
CD MCF-7 bp MCF-7 hTERT (146 bp) kDa 100- hTERT (132 kDa) 130- 300- BRCA1 (292 bp) 204- BRCA1 (220 kDa) β-Actin (432 bp) 400- 39- α-Actin (43 kDa)
2 hTERT BRCA1 2 hTERT BRCA1 1.5 * 1.5 * 1 1 0.5 0.5 Fold Change Fold Fold Change Fold 0 0 Vehicle CON BRCA1 Vehicle CON BRCA1 siRNA siRNA siRNA siRNA
62
Figure 13: BRCA1 knockdown does not alter expression of TRF1, TRF2, hTR, or POT1 in T47D cells.
A B
bp kDa 92- 100- TRF1 (112 bp) TRF1 (60 kDa) 92- 500- TRF2 (525 bp) TRF2 (70 kDa) 300- BRCA1 (292 bp) BRCA1 (220 kDa) 204- 400- β-Actin (432 bp) 39- α-Actin (43 kDa)
2 TRF1 2 TRF1 TRF2 TRF2 1.5 1.5 1 1 0.5 0.5 Fold Change Fold Change Fold 0 0 Vehicle CON BRCA1 Vehicle CON BRCA1 siRNA siRNA siRNA siRNA CD
bp bp hTR (655 bp) POT1 (614 bp) 600- 600- 300- 300- BRCA1 (292 bp) BRCA1 (292 bp)
400- β-Actin (432 bp) 400- β-Actin (432 bp)
2 hTR BRCA1 2 POT1 BRCA1 1.5 1.5 1 1 0.5 0.5 Fold Change Fold Fold Change 0 0 Vehicle CON BRCA1 Vehicle CON BRCA1 siRNA siRNA siRNA siRNA
63
Figure 13G: BRCA1 knockdown does not alter expression of TRF1, TRF2, or hTR in MCF-7 cells.
AB C
bp kDa 92- TRF1 (60 kDa) bp 100- TRF1 (112 bp) 92- hTR (655 bp) 500- TRF2 (525 bp) TRF2 (70 kDa) 600- 300- 300- BRCA1 (292 bp) BRCA1 (292 bp) 204- BRCA1 (220 kDa) α-Actin (43 kDa) β-Actin (432 bp) 400- β-Actin (432 bp) 39- 400-
2 TRF1 2 TRF1 2 hTR BRCA1 TRF2 TRF2 1.5 1.5 1.5 1 1 1 0.5 0.5 0.5 Fold Change Fold Fold Change Fold Fold Change Fold 0 0 0 Vehicle CON BRCA1 Vehicle CON BRCA1 Vehicle CON BRCA1 siRNA siRNA siRNA siRNA siRNA siRNA
64
Figure 14: BRCA1 knockdown causes an increase in telomerase activity.
A Sample TSK Control 2 T47D T47D 1.5 * 1 kDa BRCA1 (220 kDa) TPG Units TPG 204-
(Fold Change) 0.5 39- α-Actin (43 kDa) 0 Vehicle CON BRCA1 Negative siRNA siRNA Control B Sample 2 TSK Control MCF-7 MCF-7 1.5 *
1 kDa
TPG Units TPG BRCA1 (220 kDa) 0.5 204- (Fold Change) 39- α-Actin (43 kDa) 0 Vehicle CON BRCA1 Negative siRNA siRNA Control C Sample 2 DU145 TSK Control DU145 1.5 * 1 kDa TPG Units TPG 0.5 204- BRCA1 (220 kDa) (Fold Change) 0 39- α-Actin (43 kDa) Vehicle CON BRCA1 Negative siRNA siRNA Control
65
Figure 15: BRCA1 knockdown causes telomere lengthening
DU145 A B
kbp
-21.2
kbp
21.2- -5.1 -3.6 5.1- 3.6- -1.9 1.9- -0.9 0.9- 12 12 MCF-7 T47D 10 10 8 * * 8 * 6 6 4 4 2 2 Mean TRF (kbp) TRF Mean Mean TRF (kbp) 0 0 Vehicle CON siRNA BRCA1 Vehicle CON BRCA1 siRNA siRNA si RNA C 13 6Passage No. Vehicle +- -+--+- - CON siRNA - + - - + - - + - BRCA1 siRNA - - + - - + - - + T47D kDa 130- hTERT (132 kDa)
204- BRCA1 (220 kDa)
39- α-Actin (43 kDa)
66
Table 1: Primers used for RT-PCR in this study.
Annealing Size Gene Direction Primer sequence (5’→3’) Temp. (bp) BRCA1 Forward TTGCGGGAGGAAAATGGGTAGTTA 50oC 292 Reverse TGTGCCAAGGGTGAATGATGAAAG hTERT Forward CGGAAGAGTGTCTGGAGCAA 52oC 146 Reverse GGATGAAGCGGAGTCTGGA hTR Forward GAAGGGCGTAGGCGCCGTGCTTTTGC 55oC 655 Reverse GTTTGCTCTAGAATGAACGGTGGAAGG TRF1 Forward CTAAGGAGCAGATGGCAGAAAC 54oC 112 Reverse GACTACGAGCTAAAGGAGACG TRF2 Forward TCAGACAGTCCGGGACATCAT 54oC 525 Reverse CCTTCCTTCTATTTGTCGGTCG β-Actin Forward AAATCTGGCACCACACCTTC 49oC 432 Reverse CCATCTCTTGCTCGAAGTCC POT1 Forward TCAGTCTGTTAAACTTCATTGCCC 61ºC 614 Reverse TGCACCATCCTGAAAAATTATATCC
67
CHAPTER III
68 3.A ABSTRACT
Recent evidence suggests that DDR proteins are localized to the telomere and interact with the Shelterin complex (29,104). These include the MRN complex, DNA-
PK, and several others. The goal of this aim is to explore if BRCA1 is localized to the telomere, if its localization can be perturbed by inducing DNA damage in the cell, and if it interacts with the core components of the Shelterin complex. This work will provide insight as to how BRCA1 regulates telomere length. Furthermore, it will provide key evidence as to the interplay between BRCA1 as a DDR factor and as a negative regulator of telomere length. The goal is to prove that BRCA1 is localized to the telomere and binds to telomeric DNA via components of the Shelterin complex. We also anticipate that inducing DNA damage will alter the BRCA1 content associated with the telomere.
These studies will shed light onto how BRCA1 is integrated at the telomere and how it may regulate telomere length. Furthermore, it may help explain how BRCA1 operates both as a DRR factor and as a component recruited to protect the telomere.
Work presented in Chapter III was published as follows: Ballal, R. D., T. Saha, S. Fan, B. R.
Haddad, and E. M. Rosen. 2009. BRCA1 Localization to the Telomere and Its Loss from the Telomere in
Response to DNA Damage. J.Biol.Chem. 284:36083-36098.
69 3.B MATERIALS AND METHODS
Telomere length assays Telomere length was determined by Southern blotting,
using the TeloTAGG Telomere Length Assay Kit (Roche Diagnostics, Mannheim,
Germany). Aliquots of purified genomic DNA (2 μg) were digested by incubation with
HinfI (20 MU) and RsaI (20 MU) for 2 hr at 37°C. The samples were separated by electrophoresis on a 1% agarose gel. Gels were transferred to a Brightstar Plus positively
charged nylon membrane (Ambion) and cross-linked by UV light for 2 min. Membranes
were incubated for 2 hr in a pre-hybridization solution at 42°C; hybridized for 3 hr under
similar conditions by addition of 2-μl of digoxigenin-labeled telomere-specific probe;
washed twice at 25ºC for 15 min in washing solution and twice at 50°C in 0.5X washing
solution for 20 min; and incubated with a digoxigenin-specific antibody coupled to
alkaline phosphatase. The products were visualized using a chemiluminescent substrate
(alkaline phosphatase metabolizing CDP-Star) and recorded on X-ray film. The mean
telomere restriction fragment (TRF) length was calculated by densitometric segmenting
of the output signal into grids and calculating the signal within each grid as a function of
the corresponding molecular weight. TRF length was calculated based on three
independent experiments per cell line.
MTT assays of cell viability. This assay is based on the ability of viable
mitochondria to convert MTT, a soluble tetrazolium salt, into an insoluble formazan
precipitate, which is dissolved in DMSO and quantified by spectrophotometry (2).
Subconfluent proliferating cells were seeded into 96-well dishes (3000 cells/well) in
70 growth medium, incubated for 24 hr to allow attachment, and treated with adriamycin or
cis-platinum (Sigma Chemical Co., St. Louis, MO) as indicated. They were then post-
incubated for 24-hr in fresh drug-free medium, after which cell viability was measured
based on MTT dye conversion (absorbance difference at 570 nm and 630 nm) relative to
sham-treated control cells. Cell viability was expressed as the mean ± SEM of three
independent experiments, each of which used 8 replicate wells per assay condition.
Telomeric chromatin immunoprecipitation (ChIP) assays. Assays were carried out as described before (61), using a ChIP-IT Kit (Active Motif, Carlsbad CA). After the indicated cell treatments, formaldehyde was added to the culture medium to a final concentration of 1%. Fixation was carried out at 22°C for 10 min and stopped by addition of glycine (final concentration 0.125 M). The cells were collected by centrifugation; rinsed in PBS; re-suspended in lysis buffer (ChIP-IT kit); incubated at 0ºC for 30 min; and homogenized at 0oC to release the nuclei. The nuclei were pelleted by micro-
centrifuge (5000g x 10 min @ 4°C); re-suspended in 1.0 ml of digestion buffer (ChIP-IT
kit); incubated at 37°C for 5 min; and then incubated with an enzymatic shearing cocktail
(200 U/ml) for 10 min to shear the chromatin to an average length of about 600-bp. The
samples were incubated with EDTA (0.5 M) for 10 min at 0oC and centrifuged (13500g x
10 min @ 4°C) to collect the sheared chromatin.
Chromatin (6 µg unless otherwise specified) was incubated with the indicated
antibody for 12-16 hr at 4°C. The IP antibodies were: BRCA1 (combination of Ab-1 plus
Ab-2, Calbiochem); TRF1 (C-19, Santa Cruz); TRF2 (H-300, Santa Cruz); or normal
mouse IgG, rabbit IgG, or goat IgG (Santa Cruz). Each IP used 5 µg of IgG. Incubations
71 were carried out in ChIP Buffer #1 containing Protease Inhibitor Cocktail (ChIP-IT kit)
along with protein-G magnetic beads. The beads were washed twice with ChIP Buffer #1
and ChIP Buffer #2 and collected via a magnetic stand. The chromatin was eluted using
Elution Buffer AM2 (ChIP-IT kit), reverse cross-linked with Reverse Cross-linking
Buffer (ChIP-IT kit) and incubated at 94°C for 15 min. Samples were treated with
Proteinase K (1 hr @ 25°C) and Proteinase K stop solution (ChIP-IT kit). The remaining
DNA was transferred to a Brightstar Plus positively charged nylon membrane via dot- blotting and cross-linked via UV light for 2 min. Telomeric DNA was detected using the
TeloTAGG Telomere Length Assay Kit (see above), quantified by densitometry, and expressed relative to the input signal as means ± SEM of three independent experiments.
ChIP assays for BRCA1 association with Alu repeats. Assays were performed
as above, except using a DNA probe (5’-CGGGAAGCAGAGGTTGTAGTGAGCC-3’)
to the 3’ end of the Alu repeat element modified by addition of a 3’-digoxigenin label
(Integrated DNA Technologies, San Diego, CA). The Alu sequence (Alu-C) was derived
from the highly diverged 3’ end of the Alu-type repeat, as described earlier (108).
Hybridization and detection of the DNA Alu probe (0.1 μg/ml) was performed using a
DIG Luminescent Detection Kit (Roche).
Immunoprecipitation (IP). Subconfluent proliferating cells in 150-cm2 dishes
were harvested; and whole cell extracts were prepared and subjected to IP as described
before (64). Each IP was performed using 5 μg of antibody or antibody combination and
500 μg of cell protein. In some experiments, 500 μg of cell extract was incubated with
100 units/ml of DNase I (Qiagen) at 37°C for 30 min prior to IP. Precipitated proteins
72 were collected using protein-G beads, washed, eluted in boiling Laemmli sample buffer,
and subjected to Western blotting. The IP antibodies were: BRCA1 (combination of mouse monoclonals Ab-1 plus Ab-2, Calbiochem); TRF1 (C-19, Santa Cruz); TRF2 (H-
300, Santa Cruz); Rad50 (sc-36641, Santa Cruz); normal (non-immune) IgG (mouse IgG, goat IgG, or rabbit IgG, Santa Cruz).
In additional experiments to test if the association of TRF1 and BRCA1 required telomeric DNA, genomic DNA (5 µg aliquots) was prepared as above and incubated with
Bal-31 (40 U/ml) [New England Biolabs, Ipswich, MA] for 30 min at 30°C for varying
times, followed by inactivation in 20 mM of EDTA at 65°C for 10 min. Bal-31 is an
exonuclease that degrades both 3' and 5' termini of duplex DNA without generating
internal cuts (49). The Bal-31 digested DNA was then subjected to telomere length
assays, as described above, to confirm digestion of chromosome ends. To test the effect
of Bal-31 on BRCA1/ TRF1 association, cell lysates were treated with Bal-31 for 120
min prior to IP-Western blotting.
Confocal microscope analysis. Cells cultured in four-well Culture Slide
Chambers (Becton-Dickinson, Raleigh, NC) were fixed for 8 min at 37°C with 2.0%
paraformaldehyde in fixation buffer (274 mM NaCl, 10 mM PIPES, 4 mM EGTA, 11 mM glucose). After three rinses with PBS, the cells were permeabilized with 0.5% Triton
X-100 at 25ºC in fixation buffer for 20 min; washed three times with PBS; blocked with
10% donkey serum in PBS at 25ºC (90 min); incubated overnight with primary antibody
at 4ºC; incubated with blocking solution at 37°C for 20 min; rinsed; and incubated with
secondary antibody. Cells were then washed twice with PBS; and coverslips were applied
73 using Prolong Gold Anti-Fade plus DAPI mounting medium (Invitrogen). Primary
antibodies were: BRCA1 (Ab-1, Calbiochem), TRF1 (C-19, Santa Cruz), and TRF2 (H-
300, Santa Cruz). Secondary antibodies were: donkey anti-mouse IgG conjugated to
Alexa Fluor 488 (green), donkey anti-goat IgG conjugated to Alexa Fluor 594 (red), and
donkey anti-rabbit IgG conjugated to Alexa Fluor 594 (Invitrogen).
The stained cells were examined with an Olympus confocal laser fluorescence microscope with a 60X objective (LSM 410, Carl Zeiss, Oberkochen, Germany) using simultaneous lasers with excitation wavelengths of 594 (red), 546 (Cy3), 488 (green), and
364 nm (DAPI). Detection was carried out using red and green narrow-band filters.
Images were collected every 2-μm in the vertical plane, overlaid to generate focus composite images, and stored as TIFF files. Quantitative colocalization analysis was performed using Metamorph v6.2 software (Molecular Devices, Sunnyvale, CA).
Randomly chosen confocal images were analyzed to establish a positive threshold for each filter. The threshold for positive slides was adjusted to exclude obvious background or non-specific staining. Green and red images were merged by the Metamorph colocalization module (48). Positive fluorescence (yellow) was collected as the number of pixels and automatically converted to percentage colocalization. Manual counting of colocalization was done on randomly chosen cells (N=25) by counting yellow granules as
a percent of the total number of telomere granules (yellow plus red) in the same area.
Values were expressed as the means ± SEM of three independent experiments.
Teli-FISH assays. Combined telomere DNA staining (FISH probe) and
immunostaining (BRCA1 or TRF1) was performed as described before (70). Cells
74 cultured in four-well Culture Slide Chambers (Becton-Dickinson) were fixed for 8 min at
37°C with 2.0% paraformaldehyde and rinsed three times with PBS. Fixed samples were
placed in deionized water followed by deionized water plus 0.2% Tween-20 (Sigma).
Samples then underwent antigen retrieval in citrate buffer (Vector Laboratories,
Burlingame, CA) followed by a 5 min 95% ethanol treatment and air drying. Samples
were hybridized with a Cy3-labeled telomere-specific peptide nucleic acid (PNA) probe
with nucleotide sequence 5’-CCCTAACCCT AACCCTAA-3’ (Dako, Carpinteria, CA)
[0.3 µg/ml PNA in 70% formamide, 10 mM Tris, pH7.5, 0.5% B/M Blocking reagent].
Slides were washed twice in PNA wash solution (70% formamide, 10 mM Tris, pH7.5,
0.1% albumin) (Sigma); washed three times in PBS plus Tween-20; blocked with 10%
donkey serum in PBS at 25°C for 90 min; incubated overnight with primary antibody at
4°C; blocked at 37°C for 20 min; rinsed; and incubated with secondary antibody conjugated to Alexa Fluor dye. Cells were then washed twice with PBS; and coverslips were applied as above. The primary and secondary antibodies were the same as above.
Three independent experiments were performed per assay type per cell line.
Statistical methods. Data are presented as mean ± SEM from at least three
independent experiments. Comparisons were made using the two-tailed Student's t-tests,
where appropriate.
75 3.C RESULTS
BRCA1 is present at the telomere and is lost following DNA damage.
To test whether some of the nuclear BRCA1 is localized at telomeres, we used a telomeric chromatin immunoprecipitation (ChIP) assay in which protein-associated telomeric DNA is detected by quantitative hybridization using a digoxigenin-labeled telomere-specific probe, visualized by dot blots, and quantified by densitometry. As
Telomeric DNA was detected in BRCA1 IPs of T47D cells, but a control IP carried out using the same quantity of non-immune IgG yielded no telomeric DNA (Figure 16A).
The graph on the right shows the relationship between the telomeric DNA signal/input ratio for the BRCA1 IP and quantity of chromatin used and is based on at least three independent experiments. Based on these results, we chose 6 μg of chromatin, which was within the linear region of the curve, for subsequent assays. As a control for the BRCA1 association with telomeric DNA, we tested the ability of BRCA1 to associate with Alu
DNA repeat elements by performing ChIP assays using a digoxigenin-labeled Alu probe
(20). The signal/input ratio for the BRCA1 IP using the Alu probe was less than 10% of that using the telomere-specific probe, suggesting that BRCA1 association with telomeric
DNA is not a non-specific finding. MCF-7 cells gave quantitatively similar association of
BRCA1 with telomeric DNA to T47D cells (data not shown).
Next, we tested the effect of DNA damage on the telomeric BRCA1 content, using adriamycin (ADR), a topoisomerase IIα inhibitor. Here, T47D cells were sham- treated or exposed to ADR (7 μM) for 2-8 hr; and ChIP assays were carried out using IP
76 antibodies against BRCA1 or TRF1 and the corresponding non-immune antibodies as
negative controls. There was little or no change in the telomeric content of TRF1 for up
to 8 hr of ADR treatment (Figure 16B). While the telomeric BRCA1 content was
unchanged for up to 6 hr of exposure to ADR, at the 8 hr time point, the BRCA1 content
was decreased. It is unlikely that the loss of BRCA1 after 8 hr of ADR treatment was due to a generalized reduction in BRCA1 protein levels, since the whole cell BRCA1 content
(determined by Western blotting) was remained unchanged (Figure 16C). Similar results were obtained using MCF-7 cells (Figure 16G). Control IPs using goat IgG (for TRF1) or mouse IgG (for BRCA1) yielded no telomeric DNA.
In similar experiments using cis-platinum (CDDP), a DNA cross-linking agent, exposure of T47D cells to CDDP (12 μM) for 2-4 hr did not alter the presence of BRCA1 at the telomere; but after 6 hr, there was a significantly reduced BRCA1 content at the telomere (P < 0.05) [Figure 16D]. As with ADR, the telomeric TRF1 content did not change in response to exposure to CDDP. Again, the exposure to CDDP did not cause any obvious change in the total cell content, as demonstrated by Western blotting (Figure
16E).
Figure 17A shows telomeric ChIP assays of T47D cells exposed to ADR (7 μM) for 8 hr
and 24 hr. Consistent with previous experiments, the telomeric BRCA1 content was
significantly decreased (P < 0.05) after 8 hr of ADR and remained reduced (P < 0.05)
after 24 hr of ADR. In contrast, there was no reduction of telomeric TRF1 content at the
8 hr or 24 hr time points. Figure 17B shows survival curves for T47D cells treated with
different doses of ADR for different exposure, obtained by measurement of MTT dye
77 reduction 24 hr after the end of the exposure to ADR. These curves indicate cell viability values of about 45-56% for cells treated with 7 μM of ADR for 8-24 hr. As shown in
Figure 17C, ADR treatment for 8 hr or 24 hr did not cause any obvious change in total cellular content of BRCA1 or TRF1. Results obtained for MCF-7 (Figure 17G) were similar to those described above for T47D cells. Finally, neither an 8 hr nor a 24 hr exposure of T47D cells to ADR caused a significant change in the cellular levels of hTERT protein (see Figure 18G).
Similar to ADR, treatment of T47D cells with 12 μM of CDDP for 6-24 hr resulted in continued significantly reduced levels of BRCA1 at the telomere (P < 0.05) with no changes in the telomeric TRF1 content (Figure 17D), with cell viability values in the range of 55-60% (Figure 17E) and no obvious changes in the whole cell content of
BRCA1 or TRF1 (Figure 17G). A similar pattern of CDDP-induced loss of BRCA1 from the telomere was observed in MCF-7 cells (Figure 17G).
BRCA1 reappears at telomere after removal of ADR.
We next tested if removal of ADR would result in reaccumulation of BRCA1 at the telomere. T47D cells were exposed to ADR (7 μM) for 8 hr to deplete BRCA1 from the telomere, washed, and allowed to recover in fresh medium for 48, 72 or 96 hr prior to
ChIP assays or Western blotting. Here, the BRCA1 content at the telomere was restored to control levels by 48 hr of recovery and remained at these levels for at least 96 hr
(Figure 18A). The TRF1 content remained unchanged under all experimental conditions.
Western blots revealed no changes in the whole cell levels of hTERT or BRCA1 during
78 the ADR treatment or recovery phases of the experiment (Figure 18B). An IP-Western
blot for BRCA1 protein showed no obvious changes in the amount of BRCA1 that could
be immunoprecipitated under the different treatment conditions (Figure 18C). This study
rules out the possibility that post-translational modification of BRCA1 to a form not
recognized by the IP antibody could explain the loss of BRCA1 from the telomere due to
the 8 hr ADR exposure (or its reappearance during recovery). Figures 18D-18F show an
experiment similar to that of Figures 18A-18C, except that the cells were sham-treated
rather than exposed to ADR. As expected, there were no changes in telomeric BRCA1 or
TRF1 content, total cellular hTERT or BRCA1 content, or immunoprecipitatable BRCA1
protein.
TRF1 and TRF2 are required to localize BRCA1 at the telomere.
To determine if TRF1 or TRF2 are required to localize BRCA1 to the telomere,
cells were treated with TRF1-siRNA or TRF2-siRNA (100 nM x 72 hr) prior to telomeric
ChIP assays. Here, treatment of T47D cells with TRF1-siRNA caused a significant loss
of both TRF1 (P < 0.05) and BRCA1 (P < 0.05) from the telomere (Figure 19A). On the
other hand, TRF1-siRNA did not cause any obvious change in the total cellular levels of
BRCA1 (Figure 19B). Likewise, TRF2-siRNA caused loss of BRCA1 from the telomere
without causing a reduction in the total cellular levels of BRCA1 in T47D (Figures 19C
and 19D). Similarly, knockdown of either TRF1 or TRF2 in MCF-7 cells caused a significant reduction in the telomeric content of BRCA1 (Figure 19G).
79 Conversely, we tested whether BRCA1 knockdown could alter the content of
TRF1 or TRF2 at the telomere. As shown in Figure 20A, BRCA1-siRNA caused a
significant reduction in BRCA1 content at the telomere (P < 0.05) but had little or no
effect on the telomeric content of TRF1 or TRF2 in T47D cells. While the BRCA1-
siRNA effectively knocked down total cellular levels of BRCA1, it had little or no effect
on the total cell levels of TRF1 or TRF2 (Figure 20B). Similar results were obtained
using MCF-7 cells (Figures 20C and 20D). These findings suggest that TRF1 and TRF2
are each required for localization of BRCA1 at the telomere but BRCA1 is not required
for telomeric localization of TRF1 or TRF2.
Association of BRCA1 with TRF1 and TRF2.
Next, we tested whether BRCA1 could physically associate with TRF1 or TRF2 by reciprocal IP-Western blotting. As shown in Figure 21A, in T47D cells, IP of BRCA1 coprecipitated BRCA1 and TRF1; while IP of TRF1 co-precipitated TRF1 with BRCA1.
On the other hand, the control IPs using the corresponding types of non-immune IgG did not yield detectable BRCA1 or TRF1. Similarly, BRCA1 was found to coprecipitate with
TRF2 in reciprocal IP experiments (Figure 21B). Similar results were observed using
MCF-7 cells (Figure 20G). Although it is difficult to draw quantitative conclusions from these assays, they suggest that at least a fraction of the BRCA1 and TRF1/TRF2 are associated with each other in vivo in T47D and MCF-7 cells.
To test whether the association of BRCA1 with TRF1 or TRF2 is DNA- dependent, experiments were carried out in which T47D lysates were treated ± DNAse I
80 prior to IP-Western blotting. As shown in Figure 21C, DNAse I treatment did not alter the ability to IP BRCA1 or TRF1, but effectively blocked the association of the BRCA1 and TRF1 proteins. Similarly, DNAse I blocked the association of BRCA1 with TRF2, without affecting the ability to IP TRF2 protein (Figure 21D). DNAse I treatment had no effect on the levels of BRCA1, TRF1, or TRF2 in the input lanes showing non- precipitated whole cell protein (Figure 21E). Figure 21G shows the effect of DNAse I treatment on the DNA present in a T47D whole cell lysate following electrophoresis on a
1% agarose gel.
Bal-31 is an exonuclease that digests linear DNA from both ends. As shown in
Figure 21G, Bal-31 progressively digested telomeric DNA until it reached a size of < 0.9 kbp by 120 min. When T47D lysates were digested with Bal-31 for 120 min, the association of BRCA1 with TRF1, determined by IP-Western blotting, was disrupted
(Figure 21G). Figure 21G panel D shows that although a 120 min exposure to Bal-31 degraded telomeres, a significant quantity of high molecular weight DNA was still present. These findings suggest that the interaction of BRCA1 with TRF1/2 is DNA- dependent, and the association of BRCA1 with TRF1 is probably dependent upon telomeric DNA.
Colocalization of nuclear BRCA1 with TRF1 and TRF2.
Here, we tested whether BRCA1 colocalized with TRF1 or TRF2 in T47D cells that were either sham-treated or exposed to ADR (7 μM) for 8 hr, using confocal laser scanning microscopy. Nuclei were detected by DAPI staining (blue), while BRCA1
81 (green), TRF1 (red), and TRF2 (red) were detected by immunostaining. As illustrated in
Figure 22A (top row), in sham-treated cells, a fraction of the BRCA1 and TRF1 colocalized, as indicated by yellow granules in the merged image. The extent of colocalization of BRCA1 and TRF1 appeared to be significantly reduced in T47D cells treated with ADR for 8 hr (Figure 22A, second row). In the graph shown on the right, the percent colocalization was quantified using Metamorph software (see Methods section).
Using this technique, ADR caused a reduction in the degree of colocalization of BRCA1 with TRF1 from about 50% to 12%. Qualitatively and quantitatively similar results were observed for BRCA1 colocalization with TRF2 (Figure 22B). A significant degree of colocalization of BRCA1 and TRF1 and of BRCA1 and TRF2 was also observed in
MCF-7 cells (see Figure 21G). These findings suggest colocalization of a portion of the nuclear pool of BRCA1 with TRF1 and TRF2 and disruption of the colocalization of
BRCA1/TRF1 and BRCA1/TRF2 after DNA damage.
As a further test of the methodology utilized in the confocal microscopy experiments, we tested the effects of siRNA treatments on the immunofluoresence detection of BRCA1, TRF1, and TRF2 in T47D cells. As illustrated in Figure 22G,
BRCA1-siRNA (top right), TRF1-siRNA (top left), and TRF2-siRNA (bottom left) each strongly reduced the amount of their target protein detectable by confocal microscopy, validating the specificity of the immunofluorescence detection of these proteins.
Colocalization of BRCA1 with telomeric probe in cultured cells.
82 To determine if a subset of nuclear BRCA1 can be visualized at telomeres in
intact cells, T47D cells were subjected to combined staining of telomeric DNA (using a
Cy3-labeled telomere-specific peptide nucleic acid (PNA) probe) and immunostaining for
BRCA1 (or TRF1/TRF2 as positive controls). We found that a fraction of the BRCA1
colocalized with the telomeric probe in a reproducible fashion (yellow granules in the top right panel, Figure 23). The extent of colocalization as determined by manual counting of
overlapping (yellow) granules as a percent of the total number telomere granules (yellow
plus red) in the same area or by the use of Metamorph software was consistently in the range of 20-25% for T47D (Figure 23) and MCF-7 (Figure 23G, upper right panel) cells.
By comparison, TRF1 and TRF2 showed colocalization frequencies with the telomeric
probe in the range of 65-80% in T47D and MCF-7 cells (Figure 23 and Figure 23G,
middle and lower right panels). In these (and previous) confocal figures, it was noted that
not all of the TRF1 and TRF2 was localized at the telomere, although a large majority of
telomeres contained immunodetectable TRF1 and TRF2.
3.D DISCUSSION
In this chapter we used various human cancer cell lines to explore if BRCA1 is
localized to the telomere, if its localization can be perturbed by inducing DNA damage,
and if it interacts with the core components of the Shelterin complex. We found that a
portion of nuclear BRCA1 is localized at the telomere. This was documented by both
telomeric ChIP assays and confocal microscopic imaging. To ensure the specificity of the
83 telomeric ChIP assays, we ran control experiments using a probe derived from the Alu repeat element. The results showed relatively little BRCA1 association with the Alu probe, suggesting that the association of BRCA1 with telomeric DNA was not due to non-specific binding. Furthermore, confocal imaging of a telomeric probe and BRCA1 immunofluorescence revealed that a fraction of the nuclear BRCA1 could be detected at telomeres. Based on image analysis or manual counting, we estimate that about 20-25% of telomeres in T47D or MCF-7 cells contain BRCA1; while about 65-80% of telomeres contain TRF1 or TRF2. We found that BRCA1 content at the telomere was decreased when induced by ADR (a topoisomerase IIα inhibitor that causes single- and double- strand DNA breaks) or CDDP (an alkylating agent that causes DNA cross-linking).
BRCA1 loss from the telomere was not accompanied by changes in total cellular content
of BRCA1, TRF1, and TRF2 or in the telomeric content of TRF1. Interestingly, the loss
of telomeric BRCA1 did not occur immediately but was observed only after 8 hr of
treatment with ADR and 6 hr of treatment with CDDP. This finding was corroborated by
confocal imaging data that showed reduced colocalization of BRCA1 with TRF1 and
TRF2 after 8 hr treatment with ADR. Finally, we were able to show that BRCA1 content
at the telomere was restored when ADR treatment was removed and cells were able to
recover for 48 hrs.
This chapter also explored how BRCA1 interacted with two core components of
the Shelterin complex, TRF1 and TRF2. We found that a fraction of telomeric BRCA1
associated with TRF1 and TRF2 (by IP-Western blotting) and colocalized in nuclear granules with TRF1 and TRF2 (by confocal imaging). Interestingly we found that TRF1
84 and TRF2 were both required for BRCA1 localization at the telomere. Both TRF1-
siRNA and TRF2-siRNA each caused loss of telomeric BRCA1 protein with no apparent
change in total BRCA1 protein levels. In contrast, BRCA1 knockdown did not cause loss
of TRF1 or TRF2 from the telomere or altered the total cell content of the two proteins.
Interestingly, the association of BRCA1 with TRF1 and TRF2 was found to be DNA- dependent, since the co-precipitation of BRCA1/TRF1 and BRCA1/ TRF2 was blocked when the cell lysate was pre-incubated with DNase I.
BRCA1 localization to the telomere provides more evidence of novel tumor suppressor function. Localization also may help explain how BRCA1 absence drives telomerase activity and telomere length increases. It remains unclear as to what specifically BRCA1 is doing at the telomere but it is likely to be effecting telomere conformation, telomere proteins, and telomerase access. It is also unclear if BRCA1 is localized to every telomere and if that localization is transient. Using the Telo-FISH assay we saw that BRCA1 was present at 20-25% of telomeres. While assay conditions may alter the antigenicity of the proteins, it seems more likely that all of the telomeres do not have BRCA1. One possible explanation is that BRCA1 may localize to the telomere in a cell cycle dependent manner. Recent evidence has shown that during late S-G2 phase both telomere T-loop and D-loop structures are temporarily lost (39). This loss may make telomeres briefly look like DSBs. In budding yeast, the MRX complex
(analog of MRN complex) preferentially binds to telomeres at late S-G2 phase and protects telomeres from DDR (62). BRCA1 may have a similar role to the MRX complex in humans. In fact, a recent study showed BRCA1 was found to colocalize with
85 TRF1 and other APB proteins, particularly during the late S-G2 phase of the cell cycle.
However, without supporting cell cycle data this hypothesis remains untested.
Alternatively, the there may be a baseline number of BRCA1 molecules present at all
telomeres and an larger concentration associated with cells in the S-G2 phase of the cell
cycle (113). The baseline amount could be too small to be detected, which is why we
may only see the BRCA1 associated with cells in late S-G2 phase.
BRCA1 localization expands the notion of DDR factors protecting the telomere from being seen as DSBs. Previous reports have shown that other DDR factors associate with the telomere (e.g. Ku70/ heterodimer, MRN complex, DNA-PKs) and provide various surveillance functions. BRCA1 may also provide surveillance and this feature
may be one part of its tumor suppressor role. Absence of BRCA1 may elongate
telomeres but may also make telomeres more susceptible to attack by DDR machinery.
Of particular interest is the relationship between BRCA1 and the MRN complex.
BRCA1 colocalizes with the MRN complex in radiation-induced nuclear foci (34); and this complex, which includes another BRCA1-associated protein (CtIP) may facilitate the process of homology-directed DNA repair (4). The MRN complex also associates with telomeres, where they may regulate TRF1 function and telomere lengthening via telomerase (1,69). The relationship between BRCA1 and the MRN complex will be further explored in the next chapter.
Another interesting finding in this study was the reduction in BRCA1 content at the telomere upon treatment with DNA damage agents. A couple conclusions can be drawn from this observation. First, telomeric BRCA1 may be a reserve pool for use by
86 various cellular activities, such as cell cycle checkpoints or DDR. In the case of DNA
damage, excess telomeric BRCA1 would migrate to support DDR. This conclusion
seems viable based on the observation that BRCA1 left the telomere upon DNA damage
but returned when the cells recovered. However, since the telomeric BRCA1 was not
tagged we cannot say for certain that telomeric BRCA1 was used in DDR. An additional
confounding observation was that the telomeric BRCA1 took significant time to
transition away. This could be related to DNA damage-induced cell cycle arrest or to the
cell passing a specific threshold of DNA damage. Second, it is worth noting that BRCA1
is not the only protein that leaves the telomere due to environmental changes in the cell.
Recent evidence has shown that that TRF2 localizes to sites of DNA damage in non-
telomeric regions (15). TRF2 may be an early responder in the DDR and actually precede other early responders, such as ATM and NBS1 (15). It remains unknown if
BRCA1 helps chaperon TRF2 to sites of DNA damage or it independently leaves the telomere.
BRCA1 association and colocalization with TRF1 and TRF2 suggest that it is not an integral part of the Shelterin complex. Decreased BRCA1 expression had no obvious effect on TRF1 or TRF2 content at the telomere. Furthermore, other DDR proteins, such as the Ku70/80 heterodimer do not alter the Shelterin content (29,47). One interesting
finding was that BRCA1 association with TRF1 and TRF2 were predicated on the
presence of telomeric DNA and an intact telomere structure. When samples were treated
with DNase I association of BRCA1 and TRF1 or TRF2 was non-existent. When
samples were treated with Bal-31 exonuclease that removed just the telomeric ends,
87 BRCA1 and TRF1 did not associate (Figure 21G). These observations are not entirely
unexpected. The Shelterin complex remains the primary protector of the telomere and if
disrupted associated factors, such as BRCA1, could not bind to the telomere. That being
said, BRCA1 association with TRF1 and TRF2 raises the possibility that BRCA1 may
function at the telomere through interactions with these proteins. BRCA1 may regulate
the function of the Shelterin complex in shaping and protecting telomeres. Whether this
activity contributes to the tumor suppressor function of BRCA1 is uncertain, but several recent studies suggest that TRF2 may actually function as an oncogene in mice (37,105).
While TRF1 negatively regulates telomere length (114), it is unclear whether or not
BRCA1 contributes to this function. Finally, BRCA1 may interact with other DDR factors that also localized to the telomere (e.g. MRN complex, Ku70/80 heterodimer).
Establishing a functional role for BRCA1 at the telomere remains the challenge and is the subject of the ensuing chapter.
3.E ACKNOWLEDGEMENTS
This work was supported by grants from the United States Public Health Service (RO1-
CA80000, RO1-CA82599, and RO1-CA104546, to EMR), a pre-doctoral award from the
American Federation for Aging Research (AFAR) [to RDB], and the Cosmos Scholars
Foundation (Henry H. Work Science Award, to RDB).
88 3.F FIGURE LEGENDS
Figure 16. Telomeric chromatin immunoprecipitation (ChIP) assays to detect
BRCA1 protein at the telomere in T47D cells. T47D cells were subjected to ChIP assays using anti-BRCA1 as the IP antibody and using different quantities of chromatin.
The immunoprecipitated DNA was hybridized with a telomeric probe (A, top) or an Alu probe (A, bottom) [see Methods section]. Dot blots are shown using either anti-BRCA1 or normal mouse IgG (negative control) as the IP antibody. The graph on the right shows the signal/input ratio from the BRCA1 IPs as a function of the quantity of chromatin used in the assay. The values plotted are means ± SEM of three independent experiments.
Panels B and D show dot blots and densitometry quantification for telomeric ChIP assays performed after treatment of T47D cells with adriamycin (ADR, 7 μM) (B) or cis- platinum (CDDP, 12 μM) (D) for the indicated time intervals. Assays were performed using 6 μg of chromatin with IP antibodies against TRF1 and BRCA1, as well as the corresponding normal IgG types. The graphs on the right show densitometric quantification of the telomeric content of TRF1 and BRCA1. The values plotted are means ± SEM of three independent experiments (*P < 0.05 relative to sham-treated control). Panel C and E show Western blots for TRF1 and BRCA1 for T47D cells treated without or with ADR or CDDP.
Figure 16G. Telomeric chromatin immunoprecipitation (ChIP) assays to detect
BRCA1 protein at the telomere in MCF-7 cells. MCF-7 cells were subjected to
89 telomeric ChIP assays using anti- BRCA1 as the IP antibody and using different
quantities of chromatin. Dot blots are shown on cells using input DNA to establish a
linear range for the Alu and Telomere probes. The graph on the right shows the signal from the input DNA as a function of the quantity of chromatin used in the assay. The values plotted are means ± SEM of three independent experiments for each cell line.
Panel B shows dot blots and densitometry quantification for telomeric ChIP assays
performed after treatment of MCF-7 cells with adriamycin (ADR, 7 µM). Assays were
performed using 6 µg of chromatin with IP antibodies against TRF1 and BRCA1, as well
as the corresponding normal IgG types. Panel C shows Western blots for TRF1 and
BRCA1 for MCF-7 cells treated without or with ADR.
Figure 17. Adriamycin (ADR) and cis-platinum (CDDP) cause loss of BRCA1 from
the telomere in T47D cells. Subconfluent proliferating T47D cells were sham-treated or
exposed to ADR or CDDP for the indicated time intervals and then harvested for
telomeric ChIP assays to detect TRF1 and BRCA1 (A and D). As negative controls, ChIP
assays were performed using non-immune goat IgG (control for TRF1 IP) and non-
immune mouse IgG (control for BRCA1 IP). The ChIP assay dot blots were quantified
using densitometry, normalized to the input dot blots, and expressed relative to the sham-
treated control cells, as means ± SEM of at least three independent experiments
(*represents P < 0.05 as compared with sham-treated cells). Panels B and E show cell
viability assays for cells treated with different concentrations of ADR or CDDP for 8, 16,
or 24 hr and harvested for MTT assays 24 after treatment. Panels C and F provide
90 Western blots to show the effects of ADR or CDDP treatment on TRF1, BRCA1, and α actin (loading control) protein levels.
Figure 17G. Adriamycin (ADR) and Cis-platinum (CDDP) cause loss of BRCA1 from the telomere in MCF-7 cells. Subconfluent proliferating MCF-7 cells were sham treated or exposed to ADR or CDDP for the indicated time intervals and then harvested for telomeric ChIP assays to detect TRF1 and BRCA1 (A and D). As negative controls,
ChIP assays were performed using non-immune goat IgG (control for TRF1 IP) and non- immune mouse IgG (control for BRCA1 IP). The ChIP assay dot blots were quantified using densitometry, normalized to the input dot blots, and expressed relative to the sham treated control cells, as means ± SEM of at least three independent experiments
(*represents P < 0.05 as compared with sham-treated cells). Panels B and E show cell viability assays for cells treated with different concentrations of ADR or CDDP for 8, 16, or 24 hr and harvested for MTT assays 24 after treatment. Panels C and F provide
Western blots to show the effects of ADR or CDDP treatment on TRF1, BRCA1, and α- actin (control) protein levels.
Figure 18. BRCA1 reappears at the telomere following washout of ADR. T47D cells were exposed to ADR for 8 hr and then washed to remove the ADR and allowed to recover in fresh culture medium for the indicated times. Telomeric ChIP assays were performed using IP antibodies against BRCA1 and TRF1 (A). As negative controls, ChIP assays were performed using non-immune mouse or goat IgG. The ChIP assays dot blots
91 were quantified by densitometry, normalized to the input, and expressed relative to the
sham treated control cells, as means ± SEM of three independent experiments (*P <
0.05). Panel B shows Western blots for hTERT, BRCA1, and actin corresponding to the
same treatment conditions. In panels C, cells were subjected to IP-Western blotting for
BRCA1, to show the BRCA1 IP efficiency under the different cell treatment conditions.
A control IP using the same quantity of non-immune IgG was performed as a negative
control; and an input lane is provided corresponding to 10% of the amount of cell protein
used for the IP. Panels D-F shows similar experiments to those in panels A-C, except that
the cells were sham-treated for 8 hr prior to the washout rather than being treated with
ADR.
Figure 18G. Adriamycin (ADR) treatment does not alter hTERT expression.
Subconfluent proliferating T47D cells were sham treated or exposed to ADR for the indicated time intervals and then harvested for Western blotting. The protein bands were quantitated by densitometry, expressed relative to the actin control, and normalized to the control (vehicle-treated cells). Values plotted are means ± SEM of at least three independent experiments. *P < 0.05 (two-tailed t-test).
Figure 19. Knockdown of the telomeric repeat binding protein TRF1 or TRF2
causes loss of BRCA1 from the telomere in T47D cells. Subconfluent proliferating
T47D cells were treated with TRF1-siRNA (100 nM) (A,B) or TRF2-siRNA (100 nM)
(C,D), control-siRNA (100 nM) or vehicle only for 72 hr and harvested for telomeric
92 ChIP assays using antibodies against TRF1, TRF2, BRCA1, or the corresponding non- immune IgG as negative controls (goat IgG for TRF1, rabbit IgG for TRF2, and mouse
IgG for BRCA1). In A and C, the left panels show representative ChIP assay dot blots, while the right panels show densitometric quantification. Values are means ± SEM of at least three independent experiments. (*P < 0.05 as compared with the vehicle control).
Panels B and D contain Western blots to document the TRF1 or TRF2 knockdown.
Figure 19G. Knockdown of the telomeric repeat binding protein TRF1 or TRF2 causes loss of BRCA1 from the telomere in MCF-7 cells. Subconfluent proliferating
MCF-7 cells were treated with TRF1-siRNA (100 nM) or TRF2-siRNA (100 nM), control-siRNA (100 nM) or vehicle only for 72 hr and harvested for telomeric ChIP assays using antibodies against TRF1, TRF2, BRCA1, or the corresponding non-immune
IgGs as negative controls (goat IgG for TRF1, Rabbit IgG for TRF2, and mouse IgG for
BRCA1). The left panels show representative ChIP assay dot blots; while the middle panels shows densitometric quantification; and the right panels are Western blots to document the TRF1 or TRF2 knockdown. Values are means ± SEM of at least three independent experiments. *P < 0.05.
Figure 20. Knockdown of BRCA1 does not cause loss of TRF1 or TRF2 from the telomere. Subconfluent proliferating T47D (A,B) or MCF-7 (C,D) cells were treated with BRCA1-siRNA (100 nM), control-siRNA (100 nM) or vehicle only for 72 hr and harvested for telomeric ChIP assays using antibodies against TRF1, TRF2, BRCA1, or
93 the corresponding non-immune IgGs as negative controls (goat IgG, rabbit IgG, and
mouse IgG, respectively). The left panels show representative ChIP assay dot blots; while
the middle panels shows densitometric quantification; and the right panels show Western
blots to document the BRCA1 knockdown. Values plotted are means ± SEM of at least
three independent experiments (*P < 0.05 as compared with the vehicle control).
Figure 20G. BRCA1 associates with TRF1 and TRF2 in vivo. Subconfluent
proliferating MCF-7 cells were harvested and subjected to IP for BRCA1 and Western
blotting for BRCA1 and TRF1 (A) or TRF2 (B). The cells were also subjected to IP for
TRF1 (A) and for TRF2 (B) followed by Western blotting for BRCA1 and TRF1 or
TRF2.
Figure 21. BRCA1 association with TRF1 and TRF2 is mediated by DNA. Extracts
from subconfluent proliferating T47D cells were subjected to reciprocal IP-Western
blotting for BRCA1/TRF1 (A,C) or BRCA1/TRF2 (B,D). In panels B and D, IPs were
carried out with or without pre-treatment of cell lysates with DNAse I (100 units/ml for
30 min at 37ºC). For each IP, a control IP using the same quantity and type of non-
immune IgG was performed as a negative control; and an input lane is provided
corresponding to 10% of the amount of cell protein used for the IP. Panel E contains
Western blots of unprecipitated T47D cell lysates treated ± DNAse I; while panel F
shows electrophoresis of T47D cell lysates that were pre-treated ± DNAse I on a 1%
agarose gel.
94 Figure 21G. BRCA1 association with TRF1 is disrupted by treatment with Bal-31.
(A) Genomic DNA from T47D cells processed for telomere length measurements but was first digested with Bal-31 for different time intervals from 30-120 min. (B and C). T47D cell lysates were treated with Bal-31 (40 U/ml) for 120 min (see Methods section) and subjected to IP-Western blotting using IP antibodies directed against BRCA1 (B) or
TRF1 (C). For each IP, a control IP using the same quantity and type of non-immune IgG was performed as a negative control; and an input lane is provided corresponding to 10% of the amount of cell protein used for the IP. Panel D shows the effect of Bal-31 on DNA present in the cell lysate via a 1% agarose gel.
Figure 22. Colocalization of BRCA1 with TRF1 and TRF2 in T47D cells.
Subconfluent proliferating T47D cells were sham-treated or exposed to ADR (7 μM) for
8 hr and then processed for confocal microscopy (see Methods section). Images are shown of DAPI stain (nuclei); immunostaining for BRCA1 (green); immunostaining for
TRF1 or TRF2 (red); and merged BRCA1 plus TRF1 (A) or BRCA1 plus TRF2 (B) images. Yellow granules in the merged images indicate regions of colocalization.
Quantification of colocalization of BRCA1/TRF1 and BRCA1/TRF2 was carried out using Metamorph v6.2 software (N=25 cells), as described in the Methods section.
Figure 22G. Knockdown of BRCA1, TRF1, or TRF2 reduces protein expression.
Subconfluent proliferating T47D cells were treated with BRCA1-siRNA, TRF1-siRNA,
or TRF2-siRNA (100nM) and then processed for confocal microscopy, as described in
95 the Methods section. Images are shown of DAPI-stain (nuclei); immunostaining for
BRCA1 (green); immunostaining for TRF1 or TRF2 (red); and merged DAPI plus
BRCA1 or DAPI plus TRF1 or TRF2 images.
Figure 23. Teli-FISH of BRCA1 colocalization with telomeric probe in T47D cells.
Subconfluent proliferating T47D cells on slides were fixed and hybridized to a Cy3-
labeled telomere-specific peptide nucleic acid (PNA) probe. The slides were then subjected to immunostaining with BRCA1, TRF1, or TRF2 primary antibody and appropriate secondary antibody conjugated to Alexa Fluor dye; and the slides were
processed for confocal imaging, as described in the Methods section. Images are shown
of DAPI stain (blue), PNA probe (red), BRCA1 (green), TRF1 (green), or TRF2 (green).
Quantification of colocalization of BRCA1, TRF1, or TRF2 with the PNA probe (yellow granules in the merged images) was carried out using Metamorph v6.2 software (N=28) or by manual counting of the percentage of total telomeric granules (yellow+red) that is colocalized (yellow) with BRCA1, TRF1, or TRF2 (N=3 cells).
Figure 23G. Colocalization of BRCA1 with TRF1 and TRF2 in MCF-7 cells.
Subconfluent proliferating MCF-7 cells were processed for confocal microscopy, as described in the Methods section. Images are shown of DAPI-stain (nuclei); immunostaining for BRCA1 (green); immunostaining for TRF1 or TRF2 (red); and merged BRCA1 plus TRF1 or BRCA1 plus TRF2 images. Yellow granules in the merged images indicate regions of colocalization of BRCA1 with TRF1 or with TRF2.
96 Quantification of positive fluorescent signals was performed using Metamorph 6.2
(n=25). Positive fluorescence was collected as a number of pixels and converted to a
percentage by the colocalization module. Threshold for positive slides was adjusted to exclude background and non-specific staining.
Figure 23H. Teli-FISH analysis shows BRCA1 co-localizes with the Telomere in
MCF-7 cells. Subconfluent proliferating MCF-7 cells on slides were fixed and
hybridized to a Cy3-labeled telomere specific peptide nucleic acid (PNA) probe. The
slides were subjected to immunostaining with BRCA1 or TRF1/TRF2 primary antibodies
and appropriate secondary antibody conjugated to Alexa Fluor dye. Samples were then
processed for confocal microscopy, as described in the Methods section. Images are
shown of DAPI-stain (nuclei); PNA probe for the telomere (red); immunostaining for
BRCA1, TRF1 or TRF2 (green). Merged images are of the PNA probe plus BRCA1, or
PNA probe plus TRF1 or TRF2. Quantification of positive fluorescent signals was
performed using Metamorph 6.2 (n=25). Positive fluorescence was collected as a number
of pixels and converted to a percentage by the colocalization module. Threshold for
positive slides was adjusted to exclude background and non-specific staining. Manual
counting of colocalization was done on samples (n=3), as described in the methods
section.
97 3.G FIGURES
Figure 16: Telomeric chromatin immunoprecipitation (ChIP) assays to detect BRCA1 protein at the telomere in T47D cells.
A IP BRCA1 g) μ g) g) g) g) μ μ μ μ (1.2 (1.2 (6 (6 (9 Input DNA (3 (3 Mouse IgG (12 1.2 Telomere Probe 1 0.8 IP BRCA1 0.6 Telomere g) 0.4 g) g) g) g) Alu μ μ μ μ 0.2 Mouse IgG (6 (6 (3 (3 (9 (9 (1.2 μ (12 Ratio (Signal/Input) Input DNA Input 0 Alu 024681012 Probe Chromatin Input (μg) ADR (7 μM) B No ADR C (Sham) 2 hr 4 hr 6 hr 8 hr Input DNA 2 hr 8 hr 20% CON ADR kDa Goat IgG + + 92- TRF1 (60 kDa) TRF1 IP: 204- BRCA1 (220 kDa)
Mouse IgG Fold Change α-Actin (43 kDa) BRCA1 39-
D CDDP (12 μM) E No CDDP 2 hr 6 hr (Sham) 2 hr 4 hr 6 hr CON CDDP Input DNA kDa ++ 20% 92- TRF1 (60 kDa) Goat IgG 204- BRCA1 (220 kDa) TRF1 Fold Change IP: 39- α-Actin (43 kDa) Mouse IgG BRCA1
98 Figure 16G: Telomeric chromatin immunoprecipitation (ChIP) assays to detect BRCA1 protein at the telomere in MCF-7 cells.
A Input DNA (μg)
3.6 2.4 1.2 0.6 No Input Telomere 1 Probe 0.8
Input DNA (μg) 0.6 Telomere 0.4 No Input 3.6 1.22.4 0.6 Density Alu
Alu 0.2 Probe 0 01234 Chromatin Input (μg) ADR (7 μM) BCNo ADR (Sham) 2 hr 4 hr 6 hr 8 hr
Input DNA CON 2 hr 8 hr 20% kDa ++ADR 92- Goat IgG TRF1 (60 kDa) TRF1 BRCA1 (220 kDa) IP: 204- Mouse IgG Change Fold 39- α-Actin (43 kDa) BRCA1
99
Figure 17: Adriamycin (ADR) and cis-platinum (CDDP) cause loss of BRCA1 from the telomere in T47D cells.
ADR (7 μM) ABNo ADR TRF1 C (Sham) 8 hr 24 hr 1 100 8 hr Input DNA 16 hr 0.5 20% 80 24 hr CON 8 hr 24 hr Fold Change Fold Goat IgG 0 60 kDa + + ADR Sham 8 hr 24 hr 92- 40 TRF1 (60 kDa) TRF1 1 ADR IP: BRCA1 204- BRCA1 (220 kDa) Cell Viability
(% of Control) (% 20 Mouse IgG 0.5 * * α-Actin (43 kDa) 0 39-
BRCA1 Change Fold 0 0 2.5 5 7.5 10 Sham 8 hr 24 hr ADR (μM) ADR CDDP (12 μM) No CDDP TRF1 D (Sham) 6 hr 24 hr EF 1 Input DNA 100 8 hr 20% 0.5 16 hr 8 hr 24 hr 80 24 hr CON Goat IgG Change Fold kDa CDDP 0 60 + + Sham 6 hr 24 hr 92- TRF1 TRF1 (60 kDa) CDDP 40 IP: 1 Mouse IgG BRCA1 20 204- BRCA1 (220 kDa) (% of (% Control) 0.5 Cell Viability * * 39- α-Actin (43 kDa) BRCA1 0 Fold Change 0 0 3 6 9 12 15 Sham 6 hr 24 hr CDDP (μM) CDDP
100
Figure 17G: Adriamycin (ADR) and Cis-platinum (CDDP) cause loss of BRCA1 from the telomere in MCF-7 cells.
A No ADR ADR (7 μM) TRF1 B C (Sham) 8 hr 24 hr 1 Input DNA 8 hr 0.5 100 20% 16 hr 80 Fold Change 24 hr 8 hr 24 hr Goat IgG 0 CON Sham 8 hr 24 hr 60 kDa + + ADR TRF1 ADR 40 92- TRF1 (60 kDa) IP: 1 BRCA1 Cell Viability 20 BRCA1 (220 kDa) (% of of Control) (% 204- Mouse IgG 0.5 * * 39- α-Actin (43 kDa) BRCA1 0
Fold Change 0 Sham 8 hr 24 hr 0 2.5 5 7.5 10 CDDP (12 μM) ADR ADR (μM) No CDDP D (Sham) 6 hr 24 hr TRF1 E F Input DNA 1 8 hr 20% 100 0.5 16 hr 80 24 hr
Fold Change 8 hr 24 hr Goat IgG 0 CON Sham 6 hr 24 hr 60 kDa + + ADR TRF1 CDDP 92- 1 40 TRF1 (60 kDa) IP: BRCA1 Cell Viability Mouse ofControl) (% 20 204- BRCA1 (220 kDa) IgG 0.5 ** 39- α-Actin (43 kDa) BRCA1 Change Fold 0 0 Sham 6 hr 24 hr 03691215 CDDP CDDP (μM)
101
Figure 18: BRCA1 reappears at the telomere following washout of ADR. TRF1 Recovery Recovery A No ADR 8 hr ADR B
kDa SHAM 48 hr 72 hr 96 hr (Sham) (7 μM) 48 hr 72 hr 96 hr hr ADR 8 Input DNA 130- hTERT (132 kDa) 20%
Goat IgG 204- BRCA1 (220 kDa) Recovery TRF1 BRCA1 IP: 39- α-Actin (43 kDa) Mouse IgG BRCA1
C IP: BRCA1 Recovery Recovery Fold Change SHAM Input (10%) Control IP 8 hr ADR 48 hr 72 hr 96 hr Recovery BRCA1 (220 kDa) TRF1 Recovery D No ADR 8 hr E (Sham) SHAM 48 hr 72 hr 96 hr Recovery Input DNA 8 hr SHAM 8 kDa SHAM 48 hr 72 hr 96 hr 20% Goat IgG 130- hTERT (132 kDa)
TRF1 Recovery 204- BRCA1 (220 kDa) IP: BRCA1 Mouse IgG α-Actin (43 kDa) 39- BRCA1
F IP: BRCA1 Recovery Recovery Fold Change SHAM Input (10%) Input Control IP 8 hr SHAM 48 hr 72 hr 96 hr
BRCA1 (220 kDa) Recovery
102 Figure 18G: Adriamycin (ADR) treatment does not alter hTERT expression.
A 2 CON 8 hr 24 hr hTERT BRCA1 kDa ++ADR 1.5
130- hTERT (132 kDa) 1
204- BRCA1 (220 kDa) Fold Change 0.5 α-Actin (43 kDa) 39- 0 Sham 8 hr ADR 24 hr ADR
103
Figure 19: Knockdown of the telomeric repeat binding protein TRF1 or TRF2 causes loss of BRCA1 from the telomere in T47D cells.
A CON TRF1 B 1 Vehicle siRNA siRNA TRF1 Input DNA 20% 0.5 *
Goat IgG Fold Change 0 kDa Vehicle CON TRF1 92- TRF1 siRNA siRNA TRF1 (60 kDa) IP: 1 BRCA1 204- BRCA1 (220 kDa) Mouse IgG 0.5 * 39- α-Actin (43 kDa) BRCA1
Fold Change 0 Vehicle CON TRF1 siRNA siRNA CDCON TRF2 Vehicle siRNA siRNA 1 TRF2 Input DNA 20% 0.5 *
Rabbit IgG Fold Change 0 kDa Vehicle CON TRF2 92- TRF2 (70 kDa) siRNA siRNA 1 BRCA1 (220 kDa) IP: TRF2 BRCA1 204- 39- α-Actin (43 kDa) Mouse IgG 0.5 *
BRCA1 Fold Change 0 Vehicle CON TRF2 siRNA siRNA
104 Figure 19G: Knockdown of the telomeric repeat binding protein TRF1 or TRF2 causes loss of BRCA1 from the telomere in MCF-7 cells.
A CON TRF1 B Vehicle siRNA siRNA kDa 1 Input DNA TRF1 92- 20% TRF1 (60 kDa) 0.5 * 204- BRCA1 (220 kDa
Goat IgG Fold Change 0 39- α-Actin (43 kDa) Vehicle CON TRF1 TRF1 siRNA siRNA IP: 1 BRCA1 Mouse IgG 0.5 * BRCA1 Fold Change Fold 0 Vehicle CON TRF1 siRNA siRNA CON TRF2 C Vehicle D siRNA siRNA 1 kDa Input DNA TRF2 20% 92- TRF2 (70 kDa) 0.5 * 204- BRCA1 (220 kDa Rabbit IgG Fold Change Fold 0 39- α-Actin (43 kDa) Vehicle CON TRF2 TRF2 siRNA siRNA IP: 1 BRCA1 Mouse IgG 0.5 * BRCA1 Fold Change 0 Vehicle CON TRF2 siRNA siRNA
105
Figure 20: Knockdown of BRCA1 does not cause loss of TRF1 or TRF2 from the telomere.
2 A TRF1 TRF2 B T47D CON BRCA1 Vehicle 1.5 siRNA siRNA Input DNA 1 20% 0.5
Fold Change T47D Goat IgG kDa 0 92- TRF1 Vehicle CON siRNA BRCA1 TRF1 (60 kDa) siRNA 92- Rabbit IgG 1 TRF2 (70 kDa) IP: TRF2 BRCA1 0.5 BRCA1 (220 kDa) Mouse IgG * 204- α-Actin (43 kDa) BRCA1 Change Fold 0 39- Vehicle CON BRCA1 siRNA siRNA CDMCF-7 CON BRCA1 Vehicle siRNA siRNA 2 TRF1 TRF2 Input DNA 1.5 20% 1 Goat IgG 0.5
Fold Change Fold MCF-7 kDa TRF1 0 92- TRF1 (60 kDa) IP: Rabbit IgG Vehicle CON siRNA BRCA1 siRNA 92- 1 TRF2 (70 kDa) TRF2 BRCA1 0.5 BRCA1 (220 kDa) Mouse IgG 204- * α-Actin (43 kDa)
BRCA1 Fold Change 39- 0 Vehicle CON BRCA1 siRNA siRNA
106 Figure 20G: BRCA1 associates with TRF1 and TRF2 in vivo.
A B
kDa kDa 204- BRCA1 (220 kDa) 204- BRCA1 (220 kDa) 92- TRF1 (60 kDa) 92- TRF2 (70 kDa)
kDa kDa 204- BRCA1 (220 kDa) 204- BRCA1 (220 kDa) 92- TRF1 (60 kDa) 92- TRF2 (70 kDa)
107
Figure 21: BRCA1 association with TRF1 and TRF2 is mediated by DNA. A B C + - --DNase I - + --Control IP - - + - Input (10%) + - - + IP: BRCA1 kDa kDa kDa 204- BRCA1 (220 kDa) 204- BRCA1 (220 kDa) 204- BRCA1 (220 kDa) 92- 92- 92- TRF1 (60 kDa) TRF2 (70 kDa) TRF1 (60 kDa)
+ -- -DNase I - + --Control IP kDa kDa -- + - Input (10%) --+ BRCA1 (220 kDa) BRCA1 (220 kDa) + IP: TRF1 204- 204- kDa 92- 92- TRF1 (60 kDa) TRF2 (70 kDa) 204- BRCA1 (220 kDa) 92- TRF1 (60 kDa) D + -- -DNase I E - + --Control IP DNase I - + -- + - Input (10%) Input (10%) + + --+ + IP: BRCA1 204- BRCA1 (220 kDa) kDa 92- TRF2 (70 kDa) 204- BRCA1 (220 kDa) 92- 92- TRF2 (70 kDa) F TRF1 (60 kDa)
+ -- -DNase I Marker + -- - + --Control IP T47D Lysate - + + -- + - Input (10%) DNase I - - + --+ + IP: TRF2 kDa 204- BRCA1 (220 kDa) 92- TRF2 (70 kDa)
108 Figure 21G: BRCA1 association with TRF1 is disrupted by treatment with Bal-31.
A
B
D C
109
Figure 22: Colocalization of BRCA1 with TRF1 and TRF2 in T47D cells. T47D DAPI BRCA1 TRF1 Merge 20 μm
No ADR (Sham) 100 75 50 TRF1 25
% Colocalization % 0 8 hr ADR Sham 8 hr ADR
DAPI BRCA1 TRF2 Merge 20 μm
No ADR (Sham) 100 75 TRF2 50 25
% Colocalization 0 8 hr ADR Sham 8 hr ADR
110
Figure 22G: Knockdown of BRCA1, TRF1, or TRF2 reduces protein expression.
T47D T47D DAPI BRCA1 Merge DAPI TRF1 Merge
Vehicle Vehicle
CON siRNA CON siRNA
BRCA1 siRNA TRF1 siRNA
20 μm 20 μm T47D DAPI TRF2 Merge
Vehicle
CON siRNA
TRF2 siRNA
20 μm
111
Figure 23: Teli-FISH of BRCA1 colocalization with telomeric probe in T47D cells. T47D DAPI BRCA1 PNA Probe (Cy3) Merge 20 μm 100
75
50
25
% Colocalization % 0 Manual Metamorph DAPI TRF1 PNA Probe (Cy3) Merge
100
75
50
25
% Colocalization % 0 Manual Metamorph DAPI TRF2 PNA Probe (Cy3) Merge
100
75
50
25
% Colocalization % 0 Manual Metamorph
112
Figure 23G: Colocalization of BRCA1 with TRF1 and TRF2 in MCF-7 cells.
MCF-7 DAPI BRCA1 TRF1 Merge 20 μm 100
75
50
25
% Colocalization 0 TRF1 DAPI BRCA1 TRF2 Merge 100
75
50
25
% Colocalization 0 TRF2
113 Figure 23H: Teli-FISH analysis shows BRCA1 co-localizes with the Telomere in MCF-7 cells.
MCF-7 DAPI BRCA1 PNA Probe (Cy3) Merge 100
75
50
25
20 μm Colocalization % 0 DAPI TRF1 PNA Probe (Cy3) Merge Manual Metamorph 100
75
50
25
% Colocalization % 0 Manual Metamorph DAPI TRF2 PNA Probe (Cy3) Merge 100
75
50
25
% Colocalization % 0 Manual Metamorph
114
CHAPTER IV
115 4.A ABSTRACT
BRCA1 localizes to the telomere and associates with TRF1 and TRF2, which are
two core components in the Shelterin complex. While this finding helps explain how
decreased BRCA1 expression may cause changes in telomerase activity and telomere
length, it does not establish a functional role for BRCA1. In this aim we will attempt to
identify a functional role for telomeric BRCA1 by first examining how other DDR
factors influence the telomere. For example, decreases in the proteins that make up the
MRN complex have been associated with shorter G-strand overhangs and telomere
instability (22). It is likely that the DDR factors at the telomere operate similarly to
protect from DDR mechanisms. Hence, we will examine how BRCA1 could impact G-
strand overhang length. Another important strategy is to see how BRCA1 interacts with other DDR factors at the telomere. This will provide insight as to how BRCA1 is recruited to the telomere. An important outcome of this aim will be greater insight as to how DDR factors modulate telomere stability. In previous studies we have shown that wt-BRCA1 transfected cell lines had shorter but more stable telomeres (116). However, the mechanism that increased stability was not understood. By further exploring the role of BRCA1 at the telomere we will get greater insight into telomere stability and identify a novel tumor suppressor function.
Work presented in Chapter IV was published as follows: Ballal, R. D., T. Saha, S. Fan, B. R.
Haddad, and E. M. Rosen. 2009. BRCA1 Localization to the Telomere and Its Loss from the Telomere in
Response to DNA Damage. J.Biol.Chem. 284:36083-36098.
116 4.B MATERIALS AND METHODS
Hybridization protection assay (HPA). This assay uses an acridinium ester
(AE)-labeled probe that is hybridized to the 3’ overhang (98). The mislabeled or unbound
AE is inactivated by hydrolysis; but the hybridized AE probe is protected from hydrolysis
and measured by chemiluminescence. Aliquots of genomic DNA (5 μg) were incubated
with an AE-labeled telomere probe (5'-CCCTAACCCTAACC*CT
AACCCTAACCCTA-3’, *AE position) in hybridization buffer (0.1 M lithium succinate buffer, pH4.7, containing 200 g/L lithium lauryl sulfate, 1.2 M lithium chloride, 20 mM
EDTA, 20 mM EGTA) at 60°C for 20 min. AE-labeling of telomere probe was performed by Integrated DNA Technologies. Hydrolysis of the unbound AE was carried out by incubation in hydrolysis buffer (0.6 M sodium tetraborate buffer, pH8.5, containing 0.5% Triton X-100) at 60°C for 10 min. After cooling at 0oC for 1 min,
luminescence was measured for 5 sec with a luminometer and Gen-Probe detection
reagent kit (Gen-Probe, Inc., San Diego, CA). The luminescence was normalized to Alu
DNA. To detect Alu DNA, the Alu probe (5'-TGTAATCCCA*G CACTTTGGGAGGC-
3', *AE position) was hybridized to genomic DNA (5 μg), as described before (25). As a negative control, genomic DNA was treated with Exo I (0.2 U/μg DNA) (New England
Biolabs) in exonuclease buffer (67 mM Glycine-KOH, 6.7 mM MgCl2, 10 mM 2- mercaptoethanol) at 37°C for 2 hr and heat inactivated at 80°C for 20 min, before G- strands were assayed. Exo I removes nucleotides from single-stranded DNA in the 3'-5' direction. G-strand overhang was also measured after incubation of genomic DNA with
117 T7 exonuclease (1 U/μg DNA) (New England Biolabs) in NE-Buffer 4 at 25°C for 60
sec. T7 exonuclease acts in the 5'-3' direction to remove 5' nucleotides from duplex DNA.
The reaction was stopped by addition of 20 mM of EDTA at 65°C for 10 min.
Double-strand nuclease (DSN) assay. This assay uses a nuclease (DSN) that
digests double-stranded DNA, while preserving single-stranded DNA (121). The G-
strand overhang remains intact after incubation with DSN and is measured by
hybridization to a C-rich digoxigenin-labeled probe and Southern blotting. Genomic
DNA (5 μg) was digested with DSN (2 U/μg DNA) (Axxora, San Diego, CA) at 65°C for
20 min. The digestion was stopped by adding 5 μl of 2X DSN stop solution per the manufacturer’s instructions. As a control, Exo I (0.2 U/μg DNA) was added to genomic
DNA prior to DSN treatment and incubated at 37°C for 2 hr to digest 3′ overhangs. After an equal volume of formamide (Sigma) was added, samples were heated at 65°C for 5 min, loaded on a 6% denaturing polyacrylamide gel containing 8 M urea, and run in 0.5X
Tris-borate-EDTA (TBE) buffer. DNA was then transferred to a Brightstar positively charged membrane (Ambion) for 90 min in 0.5X TBE. The membrane was air-dried, UV cross-linked and hybridized to a C-rich digoxigenin-labeled probe
(CCCTAACCCTAACCCTAA) and processed using the TeloTAGG Telomere Length
Assay Kit (Roche). The mean sizes of overhangs were calculated as described for the telomere length assays.
Statistical methods. Data are presented as mean ± SEM from at least three
independent experiments. Comparisons were made using the two-tailed Student's t-tests,
where appropriate.
118 4.C RESULTS
BRCA1-siRNA causes telomere lengthening in the setting of hTERT knockdown.
We performed telomere length assays similar to ones in performed previously
(Figure 15A), except that BRCA1-siRNA and TERT-siRNA were tested, alone and in combination. After passage 6 (and to a lesser extent passage 3), TERT-siRNA alone caused a reduction in telomere length from 4.8 to 1.8 kbp (Figures 24A and 24B).
Addition of BRCA1-siRNA to TERT-siRNA completely blocked this reduction in telomere length; and BRCA1-siRNA alone caused an increase in telomere length to 8 kbp. The telomerase activity (Figure 24C) and TERT protein levels (Figure 24D) were similar in cells treated with TERT-siRNA alone vs. TERT-siRNA combined with
BRCA1-siRNA. Taken together, these findings suggest that BRCA1 knockdown caused increased telomere length by both TERT-dependent and TERT-independent mechanisms.
Rad50 is required for telomeric localization of BRCA1.
Rad50 is a component of the “MRN” complex (Mre11-Rad50-NBS1) that both interacts with BRCA1 (122) and appears to play significant functional roles at the telomere (22,115,123). To test whether Rad50 is required for recruitment of BRCA1 to telomeres, T47D cells were treated with Rad50-siRNA and then subjected to telomeric
ChIP assays. Here, Rad50 knockdown caused a sharp reduction in the telomeric content of both Rad50 and BRCA1 (Figure 25A). In contrast, BRCA1 knockdown had little or no effect on the telomeric Rad50 content (Figure 25B). Neither Rad50 knockdown, nor
119 BRCA1 knockdown had a significant effect on the total cellular content of the other protein (Figure 25C). Treatment of cells with ADR caused a loss of telomeric Rad50 with a similar time course to that observed for loss of telomeric BRCA1 (Figures 25D and
25E); but ADR had no obvious effect on the total cellular Rad50 or BRCA1 abundance.
In contrast to TRF1/2, treatment of cell lysates with DNAse I did not disrupt the association of Rad50 and BRCA1 (Figure 25G). Taken together, these findings suggest that Rad50 may be required for the recruitment of BRCA1 to telomeres.
BRCA1 regulates 3’ G-strand overhang length.
The HPA assay employs an acridinium ester-labeled telomeric probe to obtain a relative measure of 3’ G-strand overhang length (98). An AE-labeled Alu DNA probe was used to normalize the assay. The luminescence signal for the telomeric probe is an integrated reflection of the number of telomeres and the length of each telomere. Over the range of genomic DNA tested (3-12 μg), the telomeric and Alu probes each gave a linear signal (Figure 26A); and 5 μg aliquots of genomic DNA were used in subsequent experiments. Compared with vehicle or control-siRNA, T47D cells treated with BRCA1- siRNA showed a large reduction in overhang length (P < 0.05) (Figure 26B). Conversely, transfection of a wtBRCA1 expression vector caused an increase in the signal (P < 0.05)
(Figure 26C); while Rad50-siRNA caused a similar reduction in signal intensity to
BRCA1-siRNA (P < 0.05) (Figure 26D). The combination (Rad50-siRNA+wtBRCA1) yielded only a modest increase in signal intensity, compared with Rad50-siRNA alone; while (Rad50-siRNA+BRCA1-siRNA) gave results similar to Rad50-siRNA alone
120 (Figures 26E, 26F). Knockdown of TERT yielded no change in telomere overhang signal
(Figure 26G). In additional experiments, knockdown of TRF2 caused a marked reduction in the telomere overhang signal, while knockdown of TRF1 had little or no effect on the signal (data not shown). Finally, Figure 26H provides a positive control using T7 exonuclease, which removes nucleotides from duplex DNA in a 5' to 3' direction, and thus increases the overhang signal.
We used double-strand nuclease (DSN) assays (121) to confirm some of the HPA results. This assay uses DSN to digest away duplex DNA, leaving the 3’ overhang, which is detected using a C-rich digoxigenin-labeled probe. Compared to control-siRNA or vehicle, T47D cells treated with BRCA1-siRNA showed a loss of longer 3’ G-strand overhangs (Figure 27A, left), with a reduction in mean overhang length (P < 0.05)
(Figure 27A, right). Conversely, wBRCA1-transfected cells showed loss of shorter overhangs and increased mean overhang length (P < 0.05) (Figure 27B). Like BRCA1- siRNA, Rad50-siRNA caused a decrease in overhang length (P < 0.05) (Figure 27C). As in HPA assays, treatment of DNA with Exo I, an enzyme that excises nucleotides from single-stranded DNA in the 3' to 5' direction, effectively degraded the 3’ G-strand overhangs. Figure 27D shows that DSN digests duplex genomic DNA to fragments ≤ 20- bp in length. Taken together, our findings suggest that BRCA1 regulates telomere overhang length. The significance of the data will be considered in the Discussion.
Finally, we tested the effect of ADR treatment on overall telomere length and 3’
G-strand overhang length in T47D cells. As shown in Figure 26G, treatment of cells with
ADR for 24-72 hr either in the absence or presence of BRCA1-siRNA had little or no
121 effect on telomere length. This finding may reflect the fact that changes in overall
telomere length related to loss of BRCA1 requires a number of population doublings to
occur (see Figures 15A and 24A-B). However, we observed a modest but significant
reduction in G-strand overhang length after 8 hr of ADR treatment (P < 0.05) (Figure
26GD), which is the minimum time required for loss of telomeric BRCA1. These
findings suggest a correlation between loss of telomeric BRCA1 and shortening of the 3’
overhang.
4.D DISCUSSION
In this chapter we used various human cancer cell lines to explore the functional
role of BRCA1 at the telomere. First, we found that the combination of BRCA1-siRNA
and TERT-siRNA kept telomere length constant as opposed to reducing it. This suggests
that decreased BRCA1 expression may promote telomerase independent extension or
prevent telomere degradation from occurring. As discussed in chapter I, studies have
suggested that the Artemis-like nuclease Apollo may provide the 5Æ3’ exonuclease
function that degrades telomeres and enables G-strand overhang formation (62). Second, we showed that BRCA1 and the MRN complex interact at the telomere through the
Rad50 component. We also found that the Rad50 component was required for BRCA1 localization to the telomere through a series of Telo-ChIP assays. On an another note, the kinetics of ADR-induced Rad50 loss from the telomere was similar to that of ADR- induced BRCA1 loss. This suggests that BRCA1 and the MRN complex may respond to
122 cellular stress in similar ways. Most importantly we found that BRCA1 positively
regulates G-strand overhang length based on two different assay systems. Over-
expression of BRCA1 by itself increased overhang length but did not effectively rescue
the reduction in overhang length due to Rad50 knockdown. Furthermore, combined
knockdown of Rad50 and BRCA1 did not reduce overhang length below that of Rad50-
siRNA alone, which suggests BRCA1 and Rad50 may modulate the same pathway. We
also confirmed that Rad50 regulates G-strand overhang length, which is consistent with an earlier report (22). Finally, we found that inducing DNA damage did not significantly
alter telomere length but did modestly reduce the G-strand overhang after 8 hrs of ADR
treatment. This could be due to BRCA1 or Rad50 content reductions at the telomere
around the same time frame.
Positive regulation of the G-strand overhang by BRCA1 raises several
conundrums. The first relates to telomere extension and degradation. By enabling G-
strand extension BRCA1 could help G-strand overhang invasion to form the D-loop.
This would provide added protection from DDR factors and likely help stabilize the
telomere. It would also preclude telomerase enzymatic activity, which was reduced in
BRCA1 overexpression studies. On the flip side, decreased BRCA1 expression would
hinder D-loop formation but would promote telomerase loading and telomere extension.
While this model is supported by our data, some concerns still remain. For example, if
BRCA1 promotes telomere protection then it seems odd that degradation mechanisms, as discussed in Chapter II, would be activated. One explanation is that degradation mechanisms only operate in a small window when the telomere is replicating and in an
123 open conformation. However, it is not known if G-strand length drives telomeres to
switch conformations. Another concern is the location of BRCA1 in relation to the G-
strand overhang. Since BRCA1 colocalizes with TRF1 and TRF2, it is unlikely that it
localizes onto the G-strand itself. This brings up the issue of how BRCA1 exerts
influence on the G-strand overhang. A final concern is the lack of change in Pot1
mRNA expression levels with decreased BRCA1 expression (Figure 13D). Pot1 binds
selectively to the G-strand overhang and one would assume shorter G-strands would yield
reduced Pot1 expression. A possible explanation is that the excess Pot1 is migrating to another location. In fact, recent data has shown Pot1 is also integrated into the TRF1 complex (53,61).
A major concern with our model is that there is no visible change in telomere stability when BRCA1 expression is decreased. Studies have shown the G-strand overhang is critical for T-loop formation and telomere stability An interesting recent study tested the effect of disrupting BRCA1 function (by expressing a dominant negative
truncated BRCA1 mutant protein) in a telomerase positive and ALT positive cell line. In
both cell lines, disruption of BRCA1 caused the formation of anaphase bridges and
increased telomere fusions (37). We did not observe anaphase bridges or chromosomal
rearrangements in karyotypes of BRCA1-siRNA-treated cells (unpublished results). One
possible explanation is that our knockdowns reduced BRCA1 protein levels to about 10-
25% of the control, which may not be sufficient to cause visible chromosomal aberrations. Additionally, a reduction in G-strand overhang could be an early sign of
124 telomere instability that eventually would manifest as an anaphase bridge if successive siRNA treatments were done.
Our results also raise the possibility that Rad50 and BRCA1 work in concert with each other at the telomere. Based on our results it seems that Rad50 may recruit BRCA1 to the telomere but BRCA1 presence may be needed at the G-strand overhang for Rad50 to operate. Combination treatment with Rad50-siRNA and BRCA1 siRNA did not further reduce G-strand overhang length, suggesting that these proteins may modulate the same pathway. This provides interesting insight as to how DDR factors function together to provide telomere stability and protection. Finally, we tested the effect of ADR treatment on G-strand overhang length. It is unclear if the modest reduction in G-strand overhang length is due to ADR treatment or the combination of BRCA1 and Rad50 leaving the telomere.
4.E ACKNOWLEDGEMENTS
This work was supported by grants from the United States Public Health Service (RO1-
CA80000, RO1-CA82599, and RO1-CA104546, to EMR), a pre-doctoral award from the
American Federation for Aging Research (AFAR) [to RDB], and the Cosmos Scholars
Foundation (Henry H. Work Science Award, to RDB).
125 4F. FIGURE LEGENDS
Figure 24. BRCA1-siRNA blocks telomere shortening due to TERT knockdown. (A and B). T47D cells were treated with BRCA1-siRNA (100 nM), TERT-siRNA (100 nM),
BRCA1-siRNA plus TERT-siRNA (100 nM each), or control-siRNA (200 nM). The total siRNA concentration was kept constant at 200 nM by the addition of control-siRNA.
Cells were passaged every three days into fresh medium containing fresh siRNA. Cells were assayed at the indicated passage for telomere length by Southern blotting as in
Figure 1. Values plotted are means ± ranges of two independent experiments (C). Cells were assayed for telomerase activity after passage 6 (see Figure 1). Values are means ±
SEM of three experiments. (D). Western blots are provided to show the effects of siRNA treatments on BRCA1 and TERT levels after passage 6.
Figure 25. Rad50 knockdown causes loss of telomeric BRCA1 in T47D cells. (A and
B). Cells were treated with Rad50-siRNA (A), BRCA1-siRNA (B), control-siRNA (100
nM), or vehicle for 72 hr and harvested for telomeric ChIP assays using IP antibodies
against Rad50, BRCA1, and TRF1 and normal IgGs as controls [goat IgG (TRF1), mouse
IgG (Rad50, BRCA1)]. Typical dot blots and densitometry quantitation based on three
independent experiments are shown (*P < 0.05). (C). Western blots to document the
Rad50 and BRCA1 knockdowns. (D-F). Cells were sham-treated or exposed to ADR for
the indicated time intervals and then harvested for telomeric ChIP assays to detect Rad50,
BRCA1, and TRF1 (D and E). Representative dot blots and densitometric quantification
126 based on three experiments are shown (*P < 0.05). (F). Western blots to show the effects
of ADR on whole cell Rad50, BRCA1, and α-actin protein levels.
Figure 25G. BRCA1 association with Rad50 does not require DNA. (A and B).
Subconfluent proliferating T47D cells were harvested and whole cell lysates were prepared. The lysates were treated ± DNAse I; and reciprocal IP-Western blotting was performed using IP antibodies directed against BRCA1 (A) or Rad50 (B) or the corresponding type of non-immune IgG (control IP). Panel C contains a 1% agarose gel showing the effect of DNAse I on DNA present in the T47D lysate.
Figure 26. BRCA1 regulates 3’ G-strand overhang length: hybridization protection
assay. (A). Standard curves of luminescence (relative units) vs. genomic DNA input
were obtained using an acridinium ester (AE)-labeled telomeric probe (left) or an AE-
labeled Alu DNA probe (right). Data are shown for DNA treated ± Exo I, which removes
single-stranded DNA. (B-G). Cells were treated as with the indicated siRNAs and/or
transfected overnight with wild-type (wt) BRCA1 or empty pcDNA3 vector; and
genomic DNA (5 μg) was assayed for to determine the ratio of luminescence (arbitrary
units, a.u.) obtained using the telomeric and Alu probes. Controls using Exo I and, in
some cases, negative controls (no DNA) are provided. Panel C shows a Western blot to
document over-expression of BRCA1 in cells transfected with wtBRCA1. (H). This panel
shows the telomeric probe signal for genomic DNA (5 μg) treated with T7 exonuclease
127 (which digests duplex DNA, but not single-stranded DNA, in a 5’ to 3’ direction) for
different time intervals. All data are means ± SEM of three independent experiments.
Figure 26G. ADR exposure for up to 72 hr causes little or no change in telomere
length. (A). Subconfluent proliferating T47D cells were sham-treated or treated with
ADR (7 μM) for 24 hr, 48 hr, and 72 hr. The genomic DNA was isolated and Southern blotting was performed to detect telomeric DNA. (B). T47D cells were treated with
BRCA1-siRNA or control-siRNA (100 nM for 72 hr) and then exposed to ADR for 72 hr
and harvested for Southern blotting to detect telomeric DNA. (C). Quantitation of
telomere length based the experiment described for panel B. Values plotted are means ±
ranges for two independent experiments. (D). T47D cells were sham-treated or exposed
to adriamycin (ADR, 7 μM) for 8 hr and then harvested for HPA assays of 3’ G-strand
overhang length (see Methods section). Values plotted are means ± SEM of three
independent experiments (*P < 0.05).
Figure 27. BRCA1 regulates G-strand overhang length: double-strand nuclease
(DSN) assays. (A-C). T47D cells were treated with the indicated siRNAs or transfected
with wtBRCA1 or empty pcDNA3 vector, and the genomic DNA was isolated. Aliquots
of genomic DNA (5 μg) were treated with DSN, incubated ± Exo I, electrophoresed on a
denaturing polyacrylamide gel containing 8 M urea, transferred to a Brightstar
membrane, hybridized to a C-rich digoxigenin-labeled probe, and processed to calculate
the mean sizes of overhangs as in the telomere length assays. Values are means ± SEM of
128 three independent experiments. (D). Genomic DNA (5-μg) was incubated ± DSN for 7 min at 65o. Digested products were then electrophoresed on a 4% agarose gel and
visualized via ethidium bromide staining.
129 Figure 24: BRCA1-siRNA blocks telomere shortening due to TERT knockdown.
AB
Passage 6
C D
130 Figure 25: Rad50 knockdown causes loss of telomeric BRCA1 in T47D cells.
AB
D
C
E
F
131 Figure 25G: BRCA1 association with Rad50 does not require DNA.
ABC
132
Figure 26: BRCA1 regulates G-strand overhang length: hybridization protection assays (HPA). A B
C D
E F
G H
133 Figure 26G: ADR exposure for up to 72 hr causes little or no change in telomere length
-- -++ +-- 72 hrs ADR (7 µM) + - - + - - - - Vehicle AB- + - - + - - - CON siRNA ADR 7 µM - - + - - + - - BRCA1 siRNA ------+ - DNA Low Control
DNA Markers - - - - - DNA High Control kbp kbp - - + 21.2- 21.2- C
5.1- 5.1-
3.6- 3.6- 1.9- 1.9-
0.9- 0.9-
D
134
Figure 27: BRCA1 regulates G-strand overhang length: double-strand nuclease (DSN) assays
Exo I (+) Exo I (-)
Exo I (-) Exo I (+)
bp bp pcDNA3 Vehicle Vehicle CON siRNA Vehicle pcDNA3 wtBRCA1 Vehicle wtBRCA1 CON siRNA Rad50 siRNA Rad50 siRNA 250- 250-
200- 200-
150- 150-
100- 100-
50- 50- Exo I (-) Exo I (+) +--10 bp Marker - + - DSN - + + Control DNA
bp Vehicle CON siRNA Vehicle CON siRNA siRNA BRCA1 siRNA BRCA1 250- 330- 200-
150- 100- 100-
50- 10-
135
CHAPTER V
136 5A. CONCLUSIONS & FUTURE STUDIES
This body of work set out to discover novel tumor suppressor function for
BRCA1 by examining its interaction with telomere machinery. Our findings suggest that
BRCA1 may modulate telomere machinery by multiple mechanisms that include: regulation of telomerase activity, possible control of telomerase-independent mechanisms, changes to G-strand overhang length, and potentially regulating telomere degradation processes. This project provides critical insight into BRCA1 tumor suppressor function and paves the way to understand how tumor suppressor dysfunction leads to tumorigenesis. It also provides insight as to how telomere machinery utilizes select DDR factors for protection and stability.
Despite the progress in understanding how BRCA1 and telomere machinery interact, there remain several unanswered questions. Paramount among them is how
BRCA1 modulates telomere machinery in normal cell lines (e.g. HMECs). There are several reasons why we did not attempt studies in normal cell lines. First, it likely these cell lines have very low or non-existent telomerase activity. Hence, it would be difficult to correlate our findings with cancer cell lines, which often have re-activated telomerase.
Second, normal cell lines have much longer telomeres than cancer cell lines. This may muddy the ability to compare changes in G-strand overhang length and telomere stability.
Finally, normal cells have functional tumor suppressor mechanisms. For example, cellular senescence (M1) is considered a powerful tumor suppression mechanism (3).
Cancer cell lines have already bypassed this proliferative barrier, as well as overcome
137 other tumor suppressor controls. Identifying novel tumor suppressor function in such
disparate cell systems would be challenging. That being said, studying normal cell lines
would help determine if BRCA1 is a transient player at telomeres or has a more
permanent role. Furthermore, it would provide insight as to how loss of BRCA1
expression modulates telomere length without telomerase activity. Another topic for
future studies is if BRCA1 alters telomere length by remodeling telomere specific
chromatin. Recent evidence has shown that BRCA1 participates in chromatin
remodeling by associating with the SNI/SNF complex (12). There is also evidence that
changes in telomeric chromatin structure may lead to irregular telomere elongation and
increased genomic instability (104). Decreased BRCA1 expression could cause a loss of
heterochromatic features and make telomeric chromatin less compact. This would lead to
telomere structure that was more accessible for elongation but inherently less stable.
Studying BRCA1 and telomeric chromatin could resolve our current findings and further understand BRCA1 function at the telomere.
A second unanswered question relates to how decreased BRCA1 expression modulates telomeric proteins that are not part of the Shelterin complex. Of particular interest is the TRF1 interacting ankyrin-related poly (ADP-ribose) polymerase
(Tankyrase I/II) family of proteins. Tankyrases are specialized Poly (ADP-ribose) polymerases (PARP) that cause ADP-ribosylation of various telomere proteins. One study found that Tankyrase I associates with TRF1 and causes disassociation with the telomere via ADP-ribosylation (61,80). This allows for better telomerase access and results in telomere elongation. Interestingly, the primary structure of PARP-1 consists of
138 an N-terminal DNA-binding domain and internal automodification region, which includes a BRCA1 C-terminal domain (BRCT). PARP is synthesized in response to
DNA damage and has similar cell surveillance functions as BRCA1 (94). Furthermore, a recent study found that inhibition of Tankyrase I was selectively lethal to cells with
BRCA1 (or BRCA2) deficiency (66). It would be interesting to see if the two proteins modulate telomere machinery along the same pathway.
BRCA1 localization to the telomere and possible recruitment by Rad50 were novel findings in this project. However, understanding how BRCA1 leaves the telomere and where it goes would be an important future direction. Unfortunately, this task has several hurdles the most obvious being selectively tagging only telomeric BRCA1. If one could accomplish this, it would be possible to see if telomeric BRCA1 is being localized to nuclear foci around sites of DNA damage and if that same BRCA1 returns upon cell recovery. New tools such as tandem scanning confocal microscopy could provide an in- vivo real time picture of this movement. This type of experimentation may also provide clues as to how BRCA1 leaves the telomere. In our studies, cells treated with ADR showed reductions in both telomeric BRCA1 and Rad50 content after 8 hours (Figure
25D and E). It is possible that both these proteins leave the telomere to support DDR and return once the damage is below a threshold. However, the 8 hour time lag could mean that both telomeric Rad50 and BRCA1 leave in conjunction with other cellular events
(e.g. DNA damage induced cell cycle arrest). Doing in-vivo kinetics on BRCA1 loss from the telomere could be a key future study. It would also be interesting to explore what proteins are required to bring BRCA1 back to the telomere after it has left. Our
139 studies suggest that intact telomere structure is important for BRCA1 localization (Figure
21D and Figure 21GB), but there could be several other factors implicated in re- localization to the telomere. Likewise, there could be a variety of DDR factors associated with BRCA1 at the telomere. Exploring those would provide greater insight into BRCA1
recruitment and disappearance from the telomere.
Telomere shortening has been shown to activate DDR and cause telomere fusions
via the NHEJ pathway (62). However, telomeres also need protection from unwarranted
HR, which could have deleterious effects on telomere stability. There two main types of
HR that telomeres require protection from: T-loop HR and interstitial telomeric DNA. T-
loop structures provide protection from DDR but are also targets for resolution by
holliday junction resolvases. In T-loop HR, a holliday junction forms when the 5’ end of
the telomere pairs with the D-loop and branch migration occurs in the direction of the
centromere. The resulting structure would cause T-loop deletion and shorten the
telomere. These T-loop deletions are dependent on the presence of Mre11 and Xrcc3,
which is a Rad51 paralog (29). Interestingly BRCA1 plays a direct role in HR by
recruiting BRCA2 and Rad51, which facilitates filament formation, recruitment of other
complexes, and strand invasion (Figure 3) (83). Hence, it is possible that overexpression
of BRCA1 increases T-loop HR and hence results in shorter telomeres. Vice versa,
decreased BRCA1 expression may reduce T-loop HR and contribute to longer telomeres.
Finally, it is possible that telomeres recruit BRCA1 to the telomere in order to exact some
level of control on T-loop HR. The second type of HR that could be dangerous telomeres
is recombination between telomeres and interstitial telomeric DNA. While not common
140 in human cells, recombination between these elements could cause extrachromosomal
fragments, inversions, and translocatons. Mouse cells that lack Ercc1/Xpf have
significant increases in Double Minute Chromosomes (TDM), which are formed by this recombination pathway (29). Like BRCA1, Ercc1/Xpf is localized to the telomere and may protect telomeres from interstitial telomeric DNA. Exploring this recombination event could shed light on how DDR factors specifically protect telomeres. This knowledge would also be useful in further characterizing how BRCA1 protects the telomere.
The complexity of the telomere structure makes it difficult to understand where
exactly BRCA1 is localized. While we showed that BRCA1 regulates the G-strand overhang, it is unclear if BRCA1 is localized at the G-strand overhang or exerts influence by being in close proximity. A simple experiment that may shed light on this is to see if
BRCA1 localization at the telomere decreases with Pot1 knockdown. It would also be
helpful to understand if Pot1 and BRCA1 co-localize and associate with each other. One
would have to be careful about making conclusions since recent evidence has shown that
Pot1 binds to TRF1 in addition to the G-strand overhang (52). It would be interesting to
see if BRCA1 regulation of the G-strand overhang is transient. Recent evidence has
shown that despite persistent Mre11 knockdown, G-strand overhang length recovered
over time (22). This suggests that the telomere may compensate for loss of Mre11 by
utilizing other DDR factors. It would be interesting to see if combined BRCA1 and
Mre11 knockdown made shortening persistent. Finding out if BRCA1 is localized to
every G-strand overhang would also be an important future study. Preliminary Teli-FISH
141 experiments on human cancer cells in metaphase showed BRCA1 presence at select telomeres. It is unlikely that BRCA1 is localized to every G-strand overhang; however, assay conditions and telomere structure may have precluded our antibody from binding to all the telomeric BRCA1. Along those lines, it could be fascinating to see if BRCA1 localization to the telomere is dependent on a telomere “open” or “closed” conformation.
Telomeres that have escaped proliferation barriers are likely short and in the “open” conformation (3). It would be important to see if changes in BRCA1 expression could help shift telomeres structure towards an “open” or “closed” state.
Correlating our findings in actual human breast cancer tissue is an important future aim. Recent studies have found that in infiltrative mammary ductal carcinomas, approximately 33 samples out of every 100 have decreased BRCA1 expression (91).
This decrease is often associated with lower nuclear staining and higher cytoplasmic staining. Preliminary Teli-FISH assays performed on paraffin embedded formalin fixed tissue had mixed results. In a small subset of samples we were able to see reduced nuclear BRCA1 staining and increased telomere length (via measurement of telomere signal). However, in several instances reduced nuclear staining was concomitant with very short telomeres. In examining the literature on mammary ductal carcinoma tissue we found that there was a wide distribution in telomere length. Interestingly, 10-15% of telomeres are considered “long” while the vast majority is either very short or medium length (71). Decreased BRCA1 expression may be associated with the longer telomere population; however, extensive studies would need to occur to prove this hypothesis.
142 The heterogeneity of telomere length remains a major conundrum in telomere
research. To date, it remains unknown if average telomere length leads to M1/M2 or if a
few select telomeres are responsible for entry into senescence. This same heterogeneity
is seen in G-strand overhang lengths. A recent study of several cancer cell lines showed a wide distribution of G-strand overhangs (from 23% to 204% of the 92-202bp control).
This suggests that like telomere length, the G-strand overhang is regulated by many factors that include BRCA1 and the MRN complex. Interestingly, the same study showed that G-strand overhang length did not correlate with Pot1 expression. This could
explain why decreased BRCA1 expression did not change Pot1 mRNA expression levels
(Figure 13D). Finally, it remains unclear as to how G-strand overhang length correlates
to telomere length and genomic instability. It would be interesting to study these
relationships because it would provide more insight into how BRCA1 modulates
telomeres.
It is clear from our studies that telomeres are in a constant state of flux. From
switching between “open” and “closed” states to associating with a wide array of
proteins, telomeres remain an elegant but confounding cellular phenomenon. One vexing
concept is how telomeres harness antagonistic DDR factors for protection. Another
challenging notion is how cancer cells harness telomere machinery to avoid cell
senescence and crisis. In our studies we have shown that the absence of BRCA1 helps
cancer cells extend their telomeres, decrease their G-strand overhangs, and gravitate
towards increased instability. This work helps establish a tumor suppressor function for
BRCA1. Moreover, it reveals how truly interconnected cellular systems are.
143
Reference List
1. Al Wahiby, S. and P. Slijepcevic. 2005. Chromosomal aberrations involving telomeres in BRCA1 deficient human and mouse cell lines. Cytogenet Genome Res 109:491-496.
2. Alley, M. C., D. A. Scudiero, A. Monks, M. L. Hursey, M. J. Czerwinski, D. L. Fine, B. J. Abbott, J. G. Mayo, R. H. Shoemaker, and M. R. Boyd. 1988. Feasibility of Drug Screening with Panels of Human Tumor Cell Lines Using a Microculture Tetrazolium Assay. Cancer Research 48:589-601.
3. Aubert, G. and P. M. Lansdorp. 2008. Telomeres and Aging. Physiol.Rev. 88:557-579.
4. Bae, I., J. K. Rih, H. J. Kim, H. J. Kang, B. Haddad, A. Kirilyuk, S. Fan, M. L. Avantaggiati, and E. M. Rosen. 2005. BRCA1 regulates gene expression for orderly mitotic progression. Cell Cycle 4:1641-1666.
5. Bae, N. S. and P. Baumann. 2007. A RAP1/TRF2 Complex Inhibits Nonhomologous End-Joining at Human Telomeric DNA Ends. Molecular Cell 26:323-334.
6. Bailey, S. M., J. Meyne, D. J. Chen, A. Kurimasa, G. C. Li, B. E. Lehnert, and E. H. Goodwin. 1999. DNA double-strand break repair proteins are required to cap the ends of mammalian chromosomes. Proceedings of the National Academy of Sciences of the United States of America 96:14899-14904.
7. Baur, J. A., Y. Zou, J. W. Shay, and W. E. Wright. 2001. Telomere Position Effect in Human Cells. Science 292:2075-2077.
8. Bell, D. W., J. M. Varley, T. E. Szydlo, D. H. Kang, D. C. Wahrer, K. E. Shannon, M. Lubratovich, S. J. Verselis, K. J. Isselbacher, J. F. Fraumeni, J. M. Birch, F. P. Li, J. E. Garber, and D. A. Haber. 1999. Heterozygous Germ Line hCHK2 Mutations in Li-Fraumeni Syndrome. Science 286:2528-2531.
9. Blackburn, EH. 1997. The telomere and telomerase: nucleic acid-protein complexes acting in a telomere homeostasis system. A review. Biochemistry (Mosc) 62:1196-1201.
10. Blackburn, EH. 1999. The telomere and telomerase: how do they interact? Mt Sinai J Med 66:292-300.
144 11. Blasco, M. A. 2005. Telomeres and human disease: ageing, cancer and beyond. Nat Rev Genet 6:611-622.
12. Bochar, D. A., L. Wang, H. Beniya, A. Kinev, Y. Xue, W. S. Lane, W. Wang, F. Kashanchi, and R. Shiekhattar. 2000. BRCA1 Is Associated with a Human SWI/SNF-Related Complex: Linking Chromatin Remodeling to Breast Cancer. Cell 102:257-265.
13. Bodnar, A. G., M. Ouellette, M. Frolkis, S. E. Holt, C. P. Chiu, G. B. Morin, C. B. Harley, J. W. Shay, S. Lichtsteiner, and W. E. Wright. 1998. Extension of life-span by introduction of telomerase into normal human cells. Science 279:349-352.
14. Boulton, S. J. 2006. Cellular functions of the BRCA tumour-suppressor proteins. Biochem.Soc.Trans. 34:633-645.
15. Bradshaw, P. S., D. J. Stavropoulos, and M. S. Meyn. 2005. Human telomeric protein TRF2 associates with genomic double-strand breaks as an early response to DNA damage. Nat Genet 37:193-197.
16. Brody, L. C. and B. B. Biesecker. 1998. Breast Cancer Susceptibility Genes: BRCA1 and BRCA2. Medicine 77.
17. Brzovic, P. S., J. R. Keeffe, H. Nishikawa, K. Miyamoto, D. Fox, M. Fukuda, T. Ohta, and R. Klevit. 2003. Binding and recognition in the assembly of an active BRCA1/BARD1 ubiquitin-ligase complex. Proceedings of the National Academy of Sciences of the United States of America 100:5646-5651.
18. Brzovic, P. S., J. E. Meza, M. C. King, and R. E. Klevit. 2001. BRCA1 RING Domain Cancer-predisposing Mutations. J.Biol.Chem. 276:41399-41406.
19. Callebaut, I. and J. P. Mornon. 1997. From BRCA1 to RAP1: a widespread BRCT module closely associated with DNA repair. FEBS Letters 400:25-30.
20. Cantor, S. B., D. W. Bell, S. Ganesan, E. M. Kass, R. Drapkin, S. Grossman, D. C. R. Wahrer, D. C. Sgroi, W. S. Lane, D. A. Haber, and D. M. Livingston. 2001. BACH1, a Novel Helicase-like Protein, Interacts Directly with BRCA1 and Contributes to Its DNA Repair Function. Cell 105:149-160.
21. Cesare, A. J. and R. R. Reddel. 2008. Telomere uncapping and alternative lengthening of telomeres. Mech Ageing Dev 129:99-108.
22. Chai, W., A. J. Sfeir, H. Hoshiyama, J. W. Shay, and W. E. Wright. 2006. The involvement of the Mre11/Rad50/Nbs1 complex in the generation of G- overhangs at human telomeres. EMBO Rep 7:225-230.
145 23. Chapman, M. S. and I. M. Verma. 1996. Transcriptional activation by BRCA1. Nature 382:678-679.
24. Chen, J., D. P. Silver, D. Walpita, S. B. Cantor, A. F. Gazdar, G. Tomlinson, F. J. Couch, B. L. Weber, T. Ashley, D. M. Livingston, and R. Scully. 1998. Stable Interaction between the Products of the BRCA1 and BRCA2 Tumor Suppressor Genes in Mitotic and Meiotic Cells. Molecular Cell 2:317-328.
25. Cortez, D., Y. Wang, J. Qin, and S. J. Elledge. 1999. Requirement of ATM- Dependent Phosphorylation of Brca1 in the DNA Damage Response to Double- Strand Breaks. Science 286:1162-1166.
26. Counter, C. M., M. Meyerson, E. N. Eaton, and R. A. Weinberg. 1997. The catalytic subunit of yeast telomerase. Proc Natl Acad Sci USA 94:9202-9207.
27. d'Adda di Fagagna, F. 2008. Living on a break: cellular senescence as a DNA- damage response. Nat Rev Cancer 8:512-522.
28. De Boeck, G., R. G. Forsyth, M. Praet, and P. C. Hogendoorn. 2009. Telomere-associated proteins: cross-talk between telomere maintenance and telomere-lengthening mechanisms. J Pathol 217:327-344.
29. De Lange, T. 2005. Shelterin: the protein complex that shapes and safeguards human telomeres. Genes Dev 19:2100-2110.
30. Dionne, I. and R. Wellinger. 1996. Cell cycle-regulated generation of single- stranded G-rich DNA in the absenceΓÇëofΓÇëtelomerase. Proceedings of the National Academy of Sciences of the United States of America 93:13902-13907.
31. Easton, D. F., D. Ford, and D. T. Bishop. 1995. Breast and ovarian cancer incidence in BRCA1-mutation carriers. Breast Cancer Linkage Consortium. Am J Hum Genet 56:265-271.
32. Fan, S., J. A. Wang, R. Yuan, Y. Ma, Q. Meng, M. R. Erdos, R. G. Pestell, F. Yuan, K. J. Auborn, I. D. Goldberg, and E. M. Rosen. 1999. BRCA1 Inhibition of Estrogen Receptor Signaling in Transfected Cells. Science 284:1354-1356.
33. Fan, S., J. A. Wang, R. Q. Yuan, Y. X. Ma, Q. Meng, M. R. Erdos, L. C. Brody, I. D. Goldberg, and E. M. Rosen. 1998. BRCA1 as a potential human prostate tumor suppressor: modulation of proliferation, damage responses and expression of cell regulatory proteins. Oncogene 16:3069-3082.
34. Fan, S., R. Yuan, Y. X. Ma, J. Xiong, Q. Meng, M. Erdos, J. N. Zhao, I. D. Goldberg, R. G. Pestell, and E. M. Rosen. 2001. Disruption of BRCA1 LXCXE
146 motif alters BRCA1 functional activity and regulation of RB family but not RB protein binding. Oncogene 20:4827-4841.
35. Feng, J., W. D. Funk, S. S. Wang, S. L. Weinrich, A. A. Avilion, C. P. Chiu, R. R. Adams, E. Chang, R. C. Allsopp, and J. Yu. 1995. The RNA component of human telomerase. Science 269:1236-1241.
36. Ford, D., D. F. Easton, D. T. Bishop, S. A. Narod, and D. E. Goldgar. 1994. Risks of cancer in BRCA1-mutation carriers. The Lancet 343:692-695.
37. French, J. D., J. Dunn, C. E. Smart, N. Manning, and M. A. Brown. 2006. Disruption of BRCA1 function results in telomere lengthening and increased anaphase bridge formation in immortalized cell lines. Genes Chromosomes Cancer 45:277-289.
38. Friedman, L. S., E. A. Ostermeyer, C. I. Szabo, P. Dowd, E. D. Lynch, S. E. Rowell, and M. C. King. 1994. Confirmation of BRCA1 by analysis of germline mutations linked to breast and ovarian cancer in ten families. Nat Genet 8:399- 404.
39. Gasser, S. M. 2000. A sense of the end. Science 288:1377-1379.
40. Gatei, M., B. B. Zhou, K. Hobson, S. Scott, D. Young, and K. K. Khanna. 2001. Ataxia Telangiectasia Mutated (ATM) Kinase and ATM and Rad3 Related Kinase Mediate Phosphorylation of Brca1 at Distinct and Overlapping Sites. J.Biol.Chem. 276:17276-17280.
41. Gatei, M., B. B. Zhou, K. Hobson, S. Scott, D. Young, and K. K. Khanna. 2001. Ataxia Telangiectasia Mutated (ATM) Kinase and ATM and Rad3 Related Kinase Mediate Phosphorylation of Brca1 at Distinct and Overlapping Sites. J.Biol.Chem. 276:17276-17280.
42. Gowen, L. C., A. V. Avrutskaya, A. M. Latour, B. H. Koller, and S. A. Leadon. 1998. BRCA1 Required for Transcription-Coupled Repair of Oxidative DNA Damage. Science 281:1009-1012.
43. Greider, C. W. 1999. Telomeres do D-loop-T-loop. Cell 97:419-422.
44. Hahn, W. C., S. A. Stewart, M. W. Brooks, S. G. York, E. Eaton, A. Kurachi, R. L. Beijersbergen, J. H. Knoll, M. Meyerson, and R. A. Weinberg. 1999. Inhibition of telomerase limits the growth of human cancer cells. Nat Med 5:1164-1170.
147 45. Hakem, R., J. L. de la Pompa, A. Elia, J. Potter, and T. W. Mak. 1997. Partial rescue of BRCA1 early embryonic lethality by p53 or p21 null mutation. Nat Genet 16:298-302.
46. Harkin, D. P., J. M. Bean, D. Miklos, Y. H. Song, V. B. Truong, C. Englert, F. C. Christians, L. W. Ellisen, S. Maheswaran, J. D. Oliner, and D. A. Haber. 1999. Induction of GADD45 and JNK/SAPK-Dependent Apoptosis following Inducible Expression of BRCA1. Cell 97:575-586.
47. Hsu, H. L., D. Gilley, S. A. Galande, M. P. Hande, B. Allen, S. H. Kim, G. C. Li, J. Campisi, T. Kohwi-Shigematsu, and D. J. Chen. 2000. Ku acts in a unique way at the mammalian telomere to prevent end joining. Genes Dev 14:2807-2812.
48. Igbavboa, U., J. M. Pidcock, L. N. A. Johnson, T. M. Malo, A. E. Studniski, S. Yu, G. Y. Sun, and W. G. Wood. 2003. Cholesterol Distribution in the Golgi Complex of DITNC1 Astrocytes Is Differentially Altered by Fresh and Aged Amyloid beta -Peptide-(1-42). J.Biol.Chem. 278:17150-17157.
49. Jiang, L., D. B. Carter, J. Xu, X. Yang, R. S. Prather, and X. C. Tian. 2004. Telomere lengths in cloned transgenic pigs. Biol Reprod 70:1589-1593.
50. Joukov, V., J. Chen, E. A. Fox, J. B. A. Green, and D. M. Livingston. 2001. Functional communication between endogenous BRCA1 and its partner, BARD1, during Xenopus laevis development. Proceedings of the National Academy of Sciences of the United States of America 98:12078-12083.
51. Kanaar, R., J. H. J. Hoeijmakers, and D. C. van Gent. 1998. Molecular mechanisms of DNA double-strand break repair. Trends in Cell Biology 8:483- 489.
52. Kelleher, C., I. Kurth, and J. Lingner. 2005. Human protection of telomeres 1 (POT1) is a negative regulator of telomerase activity in vitro. Mol Cell Biol 25:808-818.
53. Kelleher, C., I. Kurth, and J. Lingner. 2005. Human protection of telomeres 1 (POT1) is a negative regulator of telomerase activity in vitro. Mol Cell Biol 25:808-818.
54. Kim, N. W., M. A. Piatyszek, K. R. Prowse, C. B. Harley, M. D. West, P. L. Ho, G. M. Coviello, W. E. Wright, S. L. Weinrich, and J. W. Shay. 1994. Specific association of human telomerase activity with immortal cells and cancer. Science 266:2011-2015.
148 55. Kim, S. h., P. Kaminker, and J. Campisi. 1999. TIN2, a new regulator of telomere length in human cells. Nat Genet 23:405-412.
56. Kiyono, T., S. A. Foster, J. I. Koop, J. K. McDougall, D. A. Galloway, and A. J. Klingelhutz. 1998. Both Rb/p16INK4a inactivation and telomerase activity are required to immortalize human epithelial cells. Nature 396:84-88.
57. Kleiman, F. E. and J. L. Manley. 1999. Functional Interaction of BRCA1- Associated BARD1 with Polyadenylation Factor CstF-50. Science 285:1576- 1579.
58. Kondo, T., N. Oue, K. Yoshida, Y. Mitani, K. Naka, H. Nakayama, and W. Yasui. 2004. Expression of POT1 is associated with tumor stage and telomere length in gastric carcinoma. Cancer Res 64:523-529.
59. Lane, T. F., C. Deng, A. Elson, M. S. Lyu, C. A. Kozak, and P. Leder. 1995. Expression of Brca1 is associated with terminal differentiation of ectodermally and mesodermally derived tissues in mice. Genes & Development 9:2712-2722.
60. Larson, J. S., J. L. Tonkinson, and M. T. Lai. 1997. A BRCA1 Mutant Alters G2-M Cell Cycle Control in Human Mammary Epithelial Cells. Cancer Research 57:3351-3355.
61. Loayza, D. and T. De Lange. 2003. POT1 as a terminal transducer of TRF1 telomere length control. Nature 423:1013-1018.
62. Longhese, M. P. 2008. DNA damage response at functional and dysfunctional telomeres. Genes Dev 22:125-140.
63. Ludwig, T., D. L. Chapman, V. E. Papaioannou, and A. Efstratiadis. 1997. Targeted mutations of breast cancer susceptibility gene homologs in mice: lethal phenotypes of Brca1, Brca2, Brca1/Brca2, Brca1/p53, and Brca2/p53 nullizygous embryos. Genes & Development 11:1226-1241.
64. Ma, Y., P. Katiyar, L. P. Jones, S. Fan, Y. Zhang, P. A. Furth, and E. M. Rosen. 2006. The breast cancer susceptibility gene BRCA1 regulates progesterone receptor signaling in mammary epithelial cells. Mol Endocrinol 20:14-34.
65. Makarov, V. L., Y. Hirose, and J. P. Langmore. 1997. Long G Tails at Both Ends of Human Chromosomes Suggest a C Strand Degradation Mechanism for Telomere Shortening. Cell 88:657-666.
149 66. McCabe, N., M. A. Cerone, T. Ohishi, H. Seimiya, C. J. Lord, and A. Ashworth. 2009. Targeting Tankyrase 1 as a therapeutic strategy for BRCA- associated cancer. Oncogene 28:1465-1470.
67. McCoy, M., C. Mueller, and C. Roskelley. 2003. The role of the breast cancer susceptibility gene 1 (BRCA1) in sporadic epithelial ovarian cancer. Reproductive Biology and Endocrinology 1:72.
68. McEachern, M. J., A. Krauskopf, and E. H. Blackburn. 2000. Telomeres and their control. Annu Rev Genet 34:331-358.
69. McPherson, J. P., M. P. Hande, A. Poonepalli, B. Lemmers, E. Zablocki, E. Migon, A. Shehabeldin, A. Porras, J. Karaskova, B. Vukovic, J. Squire, and R. Hakem. 2006. A role for Brca1 in chromosome end maintenance. Hum Mol Genet 15:831-838.
70. Meeker, A. K., W. R. Gage, J. L. Hicks, I. Simon, J. R. Coffman, E. A. Platz, G. E. March, and A. M. De Marzo. 2002. Telomere length assessment in human archival tissues: combined telomere fluorescence in situ hybridization and immunostaining. Am J Pathol 160:1259-1268.
71. Meeker, A. K., J. L. Hicks, C. A. Iacobuzio-Donahue, E. A. Montgomery, W. H. Westra, T. Y. Chan, B. M. Ronnett, and A. M. De Marzo. 2004. Telomere length abnormalities occur early in the initiation of epithelial carcinogenesis. Clin Cancer Res 10:3317-3326.
72. Miki, Y., J. Swensen, D. Shattuck-Eidens, P. A. Futreal, K. Harshman, S. Tavtigian, Q. Liu, C. Cochran, L. M. Bennett, W. Ding, and a. et. 1994. A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science 266:66-71.
73. Monteiro, A. N., A. August, and H. Hanafusa. 1996. Evidence for a transcriptional activation function of BRCA1 C-terminal region. Proc Natl Acad Sci 93:13595-13599.
74. Morin, G. B. 1989. The human telomere terminal transferase enzyme is a ribonucleoprotein that synthesizes TTAGGG repeats. Cell 59:521-529.
75. Morris, J. R., N. H. Keep, and E. Solomon. 2002. Identification of Residues Required for the Interaction of BARD1 with BRCA1. J.Biol.Chem. 277:9382- 9386.
76. Murray, M. M., P. B. Mullan, and D. P. Harkin. 2007. Role played by BRCA1 in transcriptional regulation in response to therapy. Biochem.Soc.Trans. 035:1342-1346.
150 77. Nakamura, T. M., G. B. Morin, K. B. Chapman, S. L. Weinrich, W. H. Andrews, J. Lingner, C. B. Harley, and T. R. Cech. 1997. Telomerase catalytic subunit homologs from fission yeast and human. Science 277:955-959.
78. Narod, S. A. and W. D. Foulkes. 2004. BRCA1 and BRCA2: 1994 and beyond. Nat Rev Cancer 4:665-676.
79. Ouchi, T., S. W. Lee, M. Ouchi, S. A. Aaronson, and C. M. Horvath. 2000. Collaboration of signal transducer and activator of transcription 1 (STAT1) and BRCA1 in differential regulation of IFN-+¦ target genes. Proceedings of the National Academy of Sciences of the United States of America 97:5208-5213.
80. Pendino, F., I. Tarkanyi, C. Dudognon, J. Hillion, M. Lanotte, J. Aradi, and E. Segal-Bendirdjian. 2006. Telomeres and Telomerase: Pharmacological Targets for New Anticancer Strategies? Current Cancer Drug Targets 6:147-180.
81. Price, C. 2001. How many proteins does it take to maintain a telomere? Trends in Genetics 17:437-438.
82. Ranganathan, V., W. F. Heine, D. N. Ciccone, K. L. Rudolph, X. Wu, S. Chang, H. Hai, I. M. Ahearn, D. M. Livingston, I. Resnick, F. Rosen, E. Seemanova, P. Jarolim, R. A. DePinho, and D. T. Weaver. 2001. Rescue of a telomere length defect of Nijmegen breakage syndrome cells requires NBS and telomerase catalytic subunit. Current Biology 11:962-966.
83. Rezler, E. M., D. J. Bearss, and L. H. Hurley. 2002. Telomeres and telomerases as drug targets. Current Opinion in Pharmacology 2:415-423.
84. Rogakou, E. P., C. Boon, C. Redon, and W. M. Bonner. 1999. Megabase Chromatin Domains Involved in DNA Double-Strand Breaks in Vivo. J.Cell Biol. 146:905-916.
85. Rogakou, E. P., D. R. Pilch, A. H. Orr, V. S. Ivanova, and W. M. Bonner. 1998. DNA Double-stranded Breaks Induce Histone H2AX Phosphorylation on Serine 139. J.Biol.Chem. 273:5858-5868.
86. Rosen, E. M., S. Fan, and Y. Ma. 2006. BRCA1 regulation of transcription. Cancer Lett 236:175-185.
87. Rosen, E. M., S. Fan, R. G. Pestell, and I. D. Goldberg. 2003. BRCA1 gene in breast cancer. J Cell Physiol 196:19-41.
88. Scully, R., J. Chen, A. Plug, Y. Xiao, D. Weaver, J. Feunteun, T. Ashley, and D. M. Livingston. 1997. Association of BRCA1 with Rad51 in Mitotic and Meiotic Cells. Cell 88:265-275.
151 89. Scully, R. and D. M. Livingston. 2000. In search of the tumour-suppressor functions of BRCA1 and BRCA2. Nature 408:429-432.
90. Sharan, S. K., M. Morimatsu, U. Albrecht, D. S. Lim, E. Regel, C. Dinh, A. Sands, G. Eichele, P. Hasty, and A. Bradley. 1997. Embryonic lethality and radiation hypersensitivity mediated by Rad51 in mice lacking Brca2. Nature 386:804-810.
91. Shen, J., M. B. Terry, I. Gurvich, Y. Liao, R. T. Senie, and R. M. Santella. 2007. Short Telomere Length and Breast Cancer Risk: A Study in Sister Sets. Cancer Research 67:5538-5544.
92. Shiloh, Y. 2006. The ATM-mediated DNA-damage response: taking shape. Trends in Biochemical Sciences 31:402-410.
93. Slijepcevic, P. 2006. The role of DNA damage response proteins at telomeres--an "integrative" model. DNA Repair (Amst) 5:1299-1306.
94. Smith, S., I. Giriat, A. Schmitt, and T. de Lange. 1998. Tankyrase, a Poly(ADP-Ribose) Polymerase at Human Telomeres. Science 282:1484-1487.
95. Smogorzewska, A., B. van Steensel, A. Bianchi, S. Oelmann, M. R. Schaefer, G. Schnapp, and T. De Lange. 2000. Control of human telomere length by TRF1 and TRF2. Mol Cell Biol 20:1659-1668.
96. Stewart, S. A. and R. A. Weinberg. 2006. Telomeres: Cancer to Human Aging. Annual Review of Cell and Developmental Biology 22:531-557.
97. Taccioli, G. E., T. M. Gottlieb, T. Blunt, A. Priestley, J. Demengeot, R. Mizuta, A. R. Lehmann, F. W. Alt, S. P. Jackson, and P. A. Jeggo. 1994. Ku80: product of the XRCC5 gene and its role in DNA repair and V(D)J recombination. Science 265:1442-1445.
98. Tahara, H., M. Kusunoki, Y. Yamanaka, S. Matsumura, and T. Ide. 2005. G- tail telomere HPA: simple measurement of human single-stranded telomeric overhangs. Nat Meth 2:829-831.
99. Thomas, J. E., M. Smith, J. L. Tonkinson, B. Rubinfeld, and P. Polakis. 1997. Induction of phosphorylation on BRCA1 during the cell cycle and after DNA damage. Cell Growth Differ 8:801-809.
100. Varley, H., H. A. Pickett, J. L. Foxon, R. R. Reddel, and N. J. Royle. 2002. Molecular characterization of inter-telomere and intra-telomere mutations in human ALT cells. Nat Genet 30:301-305.
152 101. Venkitaraman, A. R. 2001. Functions of BRCA1 and BRCA2 in the biological response to DNA damage. J Cell Sci 114:3591-3598.
102. Venkitaraman, A. R. 2002. Cancer Susceptibility and the Functions of BRCA1 and BRCA2. Cell 108:171-182.
103. Venkitaraman, A. R. 2004. Tracing the network connecting brca and fanconi anaemia proteins. Nat Rev Cancer 4:266-276.
104. Verdun, R. E. and J. Karlseder. 2007. Replication and protection of telomeres. Nature 447:924-931.
105. Wang, X., L. Liu, C. Montagna, T. Ried, and C. X. Deng. 2007. Haploinsufficiency of Parp1 accelerates Brca1-associated centrosome amplification, telomere shortening, genetic instability, apoptosis, and embryonic lethality. Cell Death Differ 14:924-931.
106. Wang, Y., D. Cortez, P. Yazdi, N. Neff, S. J. Elledge, and J. Qin. 2000. BASC, a super complex of BRCA1-associated proteins involved in the recognition and repair of aberrant DNA structures. Genes & Development 14:927-939.
107. Wei, S., W. Wei, and J. M. Sedivy. 1999. Expression of Catalytically Active Telomerase Does Not Prevent Premature Senescence Caused by Overexpression of Oncogenic Ha-Ras in Normal Human Fibroblasts. Cancer Research 59:1539- 1543.
108. Weisberg, T. F., B. K. Cahill, and C. P. H. Vary. 1996. Non-radioisotopic detection of human xenogeneic DNA in a mouse transplantation model. Molecular and Cellular Probes 10:139-146.
109. Wellinger, R. J., K. Ethier, P. Labrecque, and V. A. Zakian. 1996. Evidence for a New Step in Telomere Maintenance. Cell 85:423-433.
110. Wick, M., D. Zubov, and G. Hagen. 1999. Genomic organization and promoter characterization of the gene encoding the human telomerase reverse transcriptase (hTERT). Gene 232:97-106.
111. Williams, R. S., M. S. Lee, D. D. Hau, and J. N. M. Glover. 2004. Structural basis of phosphopeptide recognition by the BRCT domain of BRCA1. Nat Struct Mol Biol 11:519-525.
112. Wright, W. E. and J. W. Shay. 2005. Telomere-binding factors and general DNA repair. Nat Genet 37:116-118.
153 113. Wu, G., W. H. Lee, and P. L. Chen. 2000. NBS1 and TRF1 colocalize at promyelocytic leukemia bodies during late S/G2 phases in immortalized telomerase-negative cells. Implication of NBS1 in alternative lengthening of telomeres. J Biol Chem 275:30618-30622.
114. Wu, G., X. Jiang, W. H. Lee, and P. L. Chen. 2003. Assembly of Functional ALT-associated Promyelocytic Leukemia Bodies Requires Nijmegen Breakage Syndrome 1. Cancer Research 63:2589-2595.
115. Wu, Y., S. Xiao, and X. D. Zhu. 2007. MRE11-RAD50-NBS1 and ATM function as co-mediators of TRF1 in telomere length control. Nat Struct Mol Biol 14:832-840.
116. Xiong, J., S. Fan, Q. Meng, L. Schramm, C. Wang, B. Bouzahza, J. Zhou, B. Zafonte, I. D. Goldberg, B. R. Haddad, R. G. Pestell, and E. M. Rosen. 2003. BRCA1 inhibition of telomerase activity in cultured cells. Mol Cell Biol 23:8668- 8690.
117. Xu, X., Z. Weaver, S. P. Linke, C. Li, J. Gotay, X. W. Wang, C. C. Harris, T. Ried, and C. X. Deng. 1999. Centrosome Amplification and a Defective G2-M Cell Cycle Checkpoint Induce Genetic Instability in BRCA1 Exon 11 Isoform- Deficient Cells. Molecular Cell 3:389-395.
118. Yarden, R. I., S. Pardo-Reoyo, M. Sgagias, K. H. Cowan, and L. C. Brody. 2002. BRCA1 regulates the G2/M checkpoint by activating Chk1 kinase upon DNA damage. Nat Genet 30:285-289.
119. Zhang, J. and S. N. Powell. 2005. The Role of the BRCA1 Tumor Suppressor in DNA Double-Strand Break Repair. Molecular Cancer Research 3:531-539.
120. Zhang, J., H. Willers, Z. Feng, J. C. Ghosh, S. Kim, D. T. Weaver, J. H. Chung, S. N. Powell, and F. Xia. 2004. Chk2 Phosphorylation of BRCA1 Regulates DNA Double-Strand Break Repair. Mol.Cell.Biol. 24:708-718.
121. Zhao, Y., H. Hoshiyama, J. W. Shay, and W. E. Wright. 2007. Quantitative telomeric overhang determination using a double-strand specific nuclease. Nucl.Acids Res.gkm1063.
122. Zhong, Q., C. F. Chen, S. Li, Y. Chen, C. C. Wang, J. Xiao, P. L. Chen, Z. D. Sharp, and W. H. Lee. 1999. Association of BRCA1 with the hRad50-hMre11- p95 complex and the DNA damage response. Science 285:747-750.
123. Zhu, X. D., B. Kuster, M. Mann, J. H. Petrini, and T. De Lange. 2000. Cell- cycle-regulated association of RAD50/MRE11/NBS1 with TRF2 and human telomeres. Nat Genet 25:347-352.
154