Mining the Microbiome to Modulate Host Defense Against Clostridioides Difficile Infections

Mining the Microbiome to Modulate Host Defense Against Clostridioides difficile Infections

Von der Fakultät für Lebenswissenschaften

der Technischen Universität Carolo-Wilhelmina zu Braunschweig

zur Erlangung des Grades einer

Doktorin der Naturwissenschaften

(Dr. rer. nat.)

genehmigte

D i s s e r t a t i o n

von Nathiana Smit aus Haarlem, Niederlande

1. Referent: Prof. Dr. Dieter Jahn 2. Referent: Prof. Dr. Till Strowig eingereicht am: 18-12-2019 mündliche Prüfung (Disputation) am: 01-09-2020

Druckjahr 2020

Vorveröffentlichungen der Dissertation

Teilergebnisse aus dieser Arbeit wurden mit Genehmigung der Fakultät für Lebenswissenschaften, vertreten durch den Mentor der Arbeit, in folgenden Beiträgen vorab veröffentlicht:

Publikationen Lagkouvardos, I., Lesker, T.R., Hitch, T.C.A., Gálvez, E.J.C., Smit, N., Neuhaus, K., Wang, J., Bained, J.F., Abt, B., Stecher, B., Overmann, J., Strowig, T., Clavel, T.: Sequence and cultivation study of Muribaculaceae reveals novel species, host preference, and functional potential of this yet undescribed family. Microbiome 7: 28 (2019). doi:10.1186/s40168-019-0637-2

Ünal C.M., Berges, M., Smit, N., Schiene-Fischer, C., Priebe C., Strowig, T., Jahn, D., Steinert, M.: PrsA2 (CD630_35000) of Clostridioides difficile is an active parvulin-type PPIase and a virulence modulator. Frontiers of Microbiology 9: 2913 (2018). doi: 10.3389/fmicb.2018.02913

Tagungsbeiträge

Smit, N., Lesker, TR., Kirstein, S., Neumann-Schaal, M., Stecher, B., Clavel, T., Strowig, T.: Exploring Oligo-MM12 mice to study precision microbiome reconstitution against Clostridium difficile infections. (Presentation). Vortragstagung der Deutschen Gesellschaft für Hygiene und Mikrobiologie, Bochum, Deutschland (2018).

Posterbeiträge Smit, N., Lesker, TR., Kirstein, S., Neumann-Schaal, M., Stecher, B., Clavel, T., Strowig, T.: Exploring Oligo-MM mice to study precision microbiome reconstitution against Clostridioides difficile infections. (Poster) 12. Vortragstagung der Clostpath 11, Leiden, Netherlands (2019).

III

Acknowledgements

The previous four years I have been working on my PhD research. However, I could not have completed it without the help and support of a lot of people, friends and family. In this section I would like to show my gratitude and appreciation to all of those who made it possible for me to finish this thesis. To start, I would like to thank my supervisor, Prof. Dr. Till Strowig, for giving me the opportunity to conduct my research and to learn and work in the exciting field of microbiology and microbiota research. I am grateful for his help and support throughout my PhD studies, and his guidance that made the completion of this thesis possible. Additionally I would like to thank Prof. Dr. Dieter Jahn for agreeing to be my mentor and both members of my thesis committee, Prof. Dr. Petra Dersch and Dr. Matthias Lochner, for their time, valuable insights, suggestions to continue my work and to improve my research project. I also want to thank Prof. Dr. Stefan Dübel for agreeing to chair my disputation. My work would not have been possible without the support of numerous colleagues and collaborations. Most importantly I would like to thank the staff of the animal facility and the genome analytics core facility of the HZI, and additionally the help and advice of Dr. Meina Neumann-Schaal and Dr. Kerstin Schmidt-Hohagen concerning bile acids. Another thanks goes to the colleagues within the CDIFF consortium. I also would like to acknowledge my past and current colleagues from the MIKI group, not only for support and help during the work hours, but also next to work, for all the fun moments and enjoyable events we shared during the past years. However, a special thank you goes to Till Robin Lesker, who helped me analyze a lot of different data. I also want to thank Sophie Thiemann, who was my former supervisor during my Master thesis and the reason I got interested in microbiota research in the first place and why I started my PhD here at the HZI. In the time I was living in Braunschweig, I had the pleasure to meet and become friends with numerous people. I have learned so much new things next to learning about the microbiota, infections and C. difficile. During these years, I learned how to do scuba diving, climbing, bouldering and salsa dancing. I specifically want to name Tanya, Lisa, Simon, Charlotte and Richard for making my life great!

I also don’t want to forget to thank the friends I still have in the Netherlands (and Belgium): Evelien, Hilde, Amy, Serena and Jayron. Thank you for not forgetting about me, you are the best! I want to thank my family for their love and support during my life, including the time I spend performing my PhD. A thank you to my parents: my mom, Remco and my dad, who always believed I could do it, even in times I did not believe it myself and Remco for helping and instructing me in fields I was unfamiliar with. I also want to thank my grandparents for always being there for me and for always supporting me. Another thank you goes to Yoran and Glenn, my two “little” brothers for being in my life. And a special thank you goes to Ronald and Pauline who were always willing to drive back and forth for me! Last but definitely not least: a very special thank you and a lot of appreciation and gratitude goes to Jan-Maarten, who listened to me, supported me, believed in me, encouraged me and was at my side during the hardest parts of this thesis. You gave me the strength to keep going during the difficult times. Thank you for being there for me and believing in me.

~To the stars who listened and to the dreams that were answered~

Sarah J. Maas

VII

VIII

Summary

The intestinal microbiota consists of numerous and diverse microbes forming a dynamic ecosystem in close association with the host. One of the many functions of the microbiota is the colonization resistance against intestinal pathogens. Alterations in the composition of the microbiota, for example caused by antibiotics, may cause the loss of colonization resistance, making the host vulnerable towards infections, e.g. with Clostridioides difficile. C. difficile is a spore-forming anaerobic bacterium which can cause severe diarrhea and life-threatening complications in infected individuals. In many developed countries, C. difficile infection is now a major cause of antibiotic-related nosocomial infections. The disease affects mostly elderly individuals. Antibiotics are the standard treatment, however, up to 30% of the patients are suffering from recurrent C. difficile infections. Transfer of fecal matter from a healthy individual to the patient (fecal transplant) is able to cure these infections. Recent studies have demonstrated that the conversion of primary to secondary bile acids by specific commensal bacteria is important for this colonization resistance, but further evidence suggested that the restoration of the secondary bile acid production may not be sufficient for complete protection against this pathogen. In the present study, the effect of the microbiota on C. difficile infection has been explored. Therefore, a C. difficile mouse model has been established initially by exploring the effect of different ages and microbiota compositions on the severity of C. difficile infections. Second, the effect of specific mutations in the genome of C. difficile on the ability to colonize mice and to produce spores has been examined. Third, the inhibitory effect of specifically isolated commensal bacteria of the microbiota of resistant mouse models on C. difficile infections has been explored in depth in order to create a consortium of bacteria that protects the host against C. difficile. Our findings confirm that the age of the mice, comparable as in humans, is important for the severity of the disease of mice. They also confirm that secondary bile acids are indeed important to protect the host against C. difficile infections. However, in our model, adding a secondary bile acid producer to the microbiota is not sufficient for complete protection of the mice, but that together with other commensal bacteria, secondary bile acid producing bacteria are able to provide complete resistance against C. difficile induced pathogenesis.

Zusammenfassung

Die intestinale Mikrobiota bezeichnet ein komplexes Ökosystem aus zahlreichen und diversen Mikroorganismen, welches in enger Verbindung mit dem Wirt steht. Eine Hauptfunktion der Mikrobiota stellt die Besiedelungsresistenz gegen intestinale Pathogene dar. Veränderungen in der Zusammensetzung, zum Beispiel durch den Einsatz von Antibiotika, kann zum Verlust der Besiedelungsresistenz führen und den Wirt anfällig für Infektionen, mit z.B. Clostridioides difficile machen. C. difficile ist ein sporenbildendes, anaerobes Bakterium, welches besonders in immunsupprimierten und älteren Individuen schwere Durchfälle, bis hin zu lebensbedrohlichen Komplikationen führen kann. In Industrieländern ist C. difficile der häufigste Erreger nosokomialer und Antibiotika- assoziierter Durchfallerkrankungen. Nach Standardtherapie mit Antibiotika leiden bis zu 30% der Patienten an wiederkehrenden C. difficile Infektionen. Eine wirkungsvolle Alternativbehandlung stellen Stuhltransfers dar, bei der Bakterien gesunder Person auf den Patienten übertragen werden. Studien haben belegt, dass die Umwandlung von primären zu sekundären Gallensäuren durch spezifische Bakterien ein wichtiger Faktor für die Besiedelungsresistenz gegen C. difficile darstellt, dieser allein aber nicht ausreichend ist, um einen kompletten Schutz gegen Infektionen mit diesem Pathogen zu erreichen. In dieser Arbeit wurde der Einfluss der Mikrobiota bei C. difficile Infektionen näher untersucht. Im ersten Schritt wurden Mäuse in unterschiedlichem Alter und mit verschiedenen Mikrobiota-Zusammensetzungen hinsichtlich ihrer Anfälligkeit gegenüber C. difficile verglichen. Im zweiten Schritt, wurden spezifische C. difficile Mutanten auf ihre Besiedelungsfähigkeit und Sporenproduktion hin bewertet. Im letzten Schritt, wurden verschiedene kommensale Bakterien aus der Mikrobiota resistenter Mäuse isoliert und ihre potentiell protektiven Eigenschaften gegenüber C. difficile getestet, um ein spezifisches Konsortium schützender Bakterien gegen Infektionen mit C. difficile zu entwickeln. Die Ergebnisse dieser Studie konnten zeigen, dass vergleichbar zum Menschen das Alter der Mäuse und die Fähigkeit sekundäre Gallensäuren zu produzieren wichtige Einflussfaktoren für die Anfälligkeit gegen C. difficile Infektionen sind. In anfälligen Mäusen war die alleinige Gabe von Gallensäure produzierenden Bakterien nicht ausreichend für eine Kolonisierungsresistenz, jedoch konnte durch die zusätzliche Gabe weiterer kommensaler Bakterien ein dauerhafter und kompletter Schutz vor C. difficile induzierter Pathogenese erreicht werden.

Table of contents

Vorveröffentlichungen der Dissertation...... III Acknowledgements ...... V Summary ...... IX Zusammenfassung ...... X Table of contents ...... XI 1. Introduction ...... 1 1.1. Gastrointestinal tract ...... 1 1.2. Gut microbiota ...... 2 1.3. Antibiotics and the microbiota...... 10 1.4. Clostridioides difficile ...... 11 1.5. Oligo-mouse-microbiota ...... 26 1.6. Aims of the study ...... 28 2. Materials ...... 30 2.1. Experimental mouse models ...... 30 2.2. Bacterial strains ...... 31 2.3. Reagents ...... 33 2.4. Buffers and solutions ...... 37 2.5. Bacterial media and agar recipes ...... 39 2.6. Equipment ...... 47 2.7. Materials ...... 48 2.8. Software and algorithms ...... 49 3. Methods ...... 50 3.1. Culturing Clostridioides difficile ...... 50 3.2. Anaerobic culturing and isolating of bacteria ...... 52 3.3. Microbiota manipulation ...... 56 3.4. DNA isolation ...... 58 3.5. 16S rRNA gene microbial community sequencing ...... 59 3.6. Clostridioides difficile inhibition assays ...... 60 3.7. Clostridioides difficile infection ...... 61 3.8. Sacrifice and dissection of mice ...... 63 3.9. Examining CFU in infected mice ...... 64

3.10. Enzyme-linked immunosorbent assay ...... 65 3.11. Collection of samples for secondary bile acid analysis ...... 66 3.12. Quantitative PCR (qPCR) ...... 66 3.13. Metagenomics ...... 68 3.14. Statistical analysis ...... 68 4. Results ...... 69 4.1. The effect of age on Clostridioides difficile infections in mice ...... 69 4.2. Impact of antibiotics in mice on the severity of Clostridioides difficile infections ...... 74 4.3. The effect of mutants of Clostridioides difficile 630∆erm on colonization ...... 82 4.4. Mouse-specific SBAP bacteria compared to human-specific SBAP bacteria ...... 87 4.5. Isolation of bacteria from Clostridioides difficile infection-resistant mice ...... 89 4.6. The effect of the bacteria of the limited consortium on Clostridioides difficile ...... 93 4.7. The effect of colonization of the LC and E. muris on Clostridioides difficile ...... 95 4.8. Contamination of SBAP bacteria in WTBL/6-OMM mice ...... 106 5. Discussion ...... 109 5.1. The importance of Clostridioides difficile research ...... 109 5.2. Aging is a risk factor for Clostridioides difficile infections ...... 109 5.3. Colonization resistance and antibiotics react similar in different microbiota settings ...... 111 5.4. CDprsA2 is involved in the colonization of Clostridioides difficile ...... 113 5.5. The Rnf-complex is involved in the production of spores in early infection ...... 114 5.6. Dangers of fecal transplants and the advantage of limited consortia ...... 115 5.7. The difference between C. scindens and E. muris ...... 116 5.8. Muribaculaceae species and its functions within the microbiota ...... 118 5.9. The in vitro and ex vivo inhibitory effect of the bacteria of the limited consortium ...... 120 5.10. The protective effect of the LC and SBAP bacteria...... 121 5.11. The protective effect of the contamination on Clostridioides difficile infections ...... 122 5.12. Future experiments ...... 124 5.13. Limitations of the study ...... 126 Abbreviations ...... 129 List of figures ...... 133 List of tables ...... 135 References ...... 137

XII

1. Introduction 1.1. Gastrointestinal tract

The gastrointestinal tract (GI tract) is a series of connected and hollow organs that start at the mouth, continue in the upper GI tract (esophagus, stomach, duodenum, jejunum and ileum) and end in the lower GI tract (the cecum, colon, rectum and anus). The total surface of the human GI tract is 250-400 m2 and is in contact with the outside environment.1 Other organs that are connected to, but not part of the GI tract, are the salivary glands, liver, pancreas and gallbladder. These organs release digestive enzymes into the GI tract. One of the main functions of the GI tract is the digestion and absorption of food and nutrients that are ingested by the host. The esophagus transfers the food from the mouth to the stomach, where it is mixed with gastric acid and digestive enzymes and subsequently is transferred to the duodenum, jejunum and ileum. In this part, the proteins, fats and carbohydrates are broken down into smaller parts, which then can be absorbed. When the leftover mixture enters the colon, it is called feces, and it is being prepared to leave the host via the anus.2 To ensure that the whole process is working in a coordinated way, many different cell types work at the same time, like absorptive and secretory epithelial cells and enteroendocrine cells (EECs). EECs are important for the secretion, motility and regulation of the metabolism.3 The remaining layers of the GI tract consist of a submucosal layer containing nerves, lymphatics and connective tissue, a layer of both longitudinal and circular smooth muscle and an outer serosal layer.2 The smooth muscle layers cause the motility and contractibility modulated by interstitial cells of Cajal. These cells create an spontaneous electrical flow in the presence of a stimulus, causing the smooth muscle layers to contract.4,5 The intestinal motility is under control of multiple systems, including the enteric nervous system, central nervous system, specific GI hormones and paracrine agents. During the day, the GI tract secretes up to nine liter of fluids per day, which consists of water, mucus, digestive enzymes, bile and ions. Most of the digestive processes and absorption of food and electrolytes occur in the small intestine. The large intestine reabsorbs the water, solidifying the contents into feces and at the end store the feces prior to expulsion.2 The gastrointestinal tract also functions as a barrier between the outside and inside of the body. Gastric acid, pancreatic juice and production of antimicrobial substances serve as a defense against 1 pathological substances and microbes. In addition, the existence of tight junctions and the mucosal border close to the intestinal cells allow a protection against pathogens.6 However, not everything gets blocked from assessing the cells. Particles of food can be taken up via passive transfer, transcellular transfer via aqueous pores, active carrier-mediated absorption and endocytosis.7

1.2. Gut microbiota

The intestinal tract contains a great number of bacteria, archaea, viruses and eukarya which together are called the gut-microbiota. The gut microbiota has multiple functions, including digestion of food, production of nutrients and colonization resistance, and it performs numerous processes in the host’s intestines. This chapter will cover how to identify the specific bacteria from the microbiota, how the microbiota is developed and maintained and what the functions are of the microbes in the intestinal tract.

1.1.1. Identification of bacteria by 16S rRNA gene sequencing In the past, knowledge about the composition of the microbiota originated from labor-intensive culture-based methods.8–10 However, in the past two decades we have the ability to identify species of the microbiota by culture-independent approaches like high-throughput and low-cost sequencing methods. The most targeted gene in this approach is the bacterial 16S ribosomal RNA (16S rRNA) gene.11,12 The 16S rRNA gene is present in every bacteria and archaea and contains conserved areas between all bacterial species. Importantly, this gene also contain nine variable regions, V1 till V9, which allows species to be identified. Suau et al showed in one of the earlier 16S rRNA gene sequencing studies that 76% of the sequences originated from novel species that were not found by the previously used culturing-based techniques.13 A common technique used these days is focused on a small region of this 16S rRNA gene. The Human Microbiome Project and MetaHit have provided a comprehensive view of a numerous human-associated microbes.14,15 In a study where the authors compiled the data from two other studies, it was described that in total 2172 species were isolated, identified and classified into twelve different phyla.16 93.5% of these bacteria belonged to four phyla, namely Proteobacteria, Firmicutes, Actinobacteria and Bacteroidetes. From the species found, 386 are strictly anaerobic.16 For identifying the bacterial gut microbiota composition via 16S rRNA gene sequencing, the V4 region is often used as

2 reference region, as it shows to be the most prominent region to achieve good domain specificity, a high coverage and a broader spectrum in the bacteria domain.17,18

Figure 1: The 16S rRNA gene.

The 16S rRNA gene contains multiple variable and conserved regions, which allows species to be identified. 515F – 806R primers are used to sequence the V4 regions during Illumina sequencing giving an idea of the species, while 27F and 1492R primers are used for the complete 16S rRNA gene for Sanger sequencing, enabling to find the exact identity of the bacterium.

1.1.2. Development and maintenance of the microbiota The microbiota has co-evolved with the host and they form a mutually beneficial relationship.19,20 Until 2014, it was stated that the microbiota contained 10 times more cells compared to host cells.21 However, using a different method, it was shown that the amount of microbes only outnumber the host cells in a factor of 1.3:1, with an uncertainty of 25% and a variation of 53%, in a standard 170 cm, 70 kg male with an age between 20-30 years old.22 The microbiota harvests energy from the food consumed by the host. In return, the microbiota offers multiple benefits to the host. In the case of a healthy microbiota, the microbes help strengthen the gut integrity, shape the intestinal epithelium, protect against intestinal pathogens and regulate the host immune system. However, in case of a dysbiosis, which is a state of an altered and disturbed microbiota caused for example by antibiotics, these mechanisms can be disrupted.23,24 Until now, it is generally accepted and believed that the development of the microbiota starts at birth, but this dogma is being challenged by a number of studies that show a detection of microbes in the placenta and other womb tissues.25–27 However, contrary to these studies, two studies performed in 2018 and 2019 showed that there were no bacteria detected in the placenta. This is supported by the methods of how germ-free mice models are generated by sterile cesarean delivery after which the mice remain germ-free.28,29 After birth, the GI tract is rapidly colonized

3 with microbes. Diet changes, illnesses and antibiotics can cause (dramatic) shifts in the composition of the microbiota.30 The mode of delivery, e.g. cesarean or vaginal, also influences the early microbiota. Cesarean delivery causes an colonization of facultative anaerobes like Clostridium species and a delayed colonization of Bacteroides compared to vaginal delivery, which causes an high abundance of Lactobacillus species.31–34 The composition of the microbiota in the early stages of the development is low in diversity, but within the first year the diversity increases and the composition shifts towards an adult-like microbial profile.35 After 2.5 years the microbiota composition, diversity and functionality resembles the adult microbiota.26,30 During adult life the microbiota stays mostly stable until there are major disruptions caused, for example, by antibiotics.36 However, in elderly individuals (age above 65), the composition of the microbiota starts to shift again, with most emphasis on the increase of species from the Bacteroidetes phylum and Clostridium cluster IV where younger adults have a higher prevalence of Clostridium cluster XIVa.37 The functionality of the microbiota is also changing in elderly, for example, the ability to produce short-chain fatty acids (SCFAs) is reduced compared to younger adults.38 The density and composition of the microbiota are also shaped by physiological and environmental influences within the GI tract, and thus differs in different organs. Factors that affect the density and composition are chemical, nutritional and immunological differences along the GI tract.39 The small intestine has a low pH and high levels of acids, oxygen and antimicrobials. Food transits rapidly in this part of the GI tract which provides an advantage for fast growing facultative anaerobes. Lactobacillaceae largely dominate the small intestine in mice.40 In contrast to the small intestine, the colon lacks oxygen, supporting a dense and diverse community containing mostly anaerobic bacteria. These bacteria have often the capability to utilize complex carbohydrates that are not digested in the small intestine, like Prevotellaceae, Lachnospiraceae and Rikenellaceae.40 There is also a significant difference in the composition in the lumen and in the mucosa; for example, Bacteroidetes abundance is higher in luminal samples compared to mucosal samples as opposed to Firmicutes like Clostridium cluster XIVa which are enriched in the mucus layer compared to the lumen.41–43 Diet has a large and immediate effect on the microbiota. The ileal microbiota for instance is largely driven by the capacity of the specific microbes to uptake and metabolize simple sugars, which are abundant in the ileum.44 In the colon the microbiota is affected and formed by the availability of microbiota-accessible carbohydrates. These are found in dietary fibers and enriches

4 distinct bacterial species of the GI tract.45,46 The effect that nutrition has on the microbiota can cause considerable differences in the composition. For example, children in Europe consume a diet rich in sugar, starch and animal fat that rural African children do not consume. The microbiota of the European children has a significantly reduced amount of bacteria belonging to the Actinobacteria and Bacteroidetes phyla compared to the rural African children (6.7% against 10.1% for Actinobacteria and 22.4% against 57.7% for Bacteroidetes) while the rural African children harbor Prevotella species which were largely absent in European children.47 The same trend is being found in individuals eating low amounts of insoluble fibers and high amounts of carbohydrates and simple sugars.48 When mice are fed a diet with a low amount of microbiota- accessible carbohydrates, the diversity of the microbiota will be reduced compared to mice that are fed a normal diet.49 Other environmental and/or host factors can also influence the composition of the microbiota, like smoking, surgery, medication usage, geographical location and even depression.26,50–52 Xenobiotics, substances that are not naturally present in the host, like drugs, carcinogens and food additives, significantly shape the physiology and gene expression of the gut microbiota.53 More specifically, the microbiota gets greatly disrupted during antibiotic treatment, for short-term periods but also persisting over longer time periods.54 Not only the host produces nutrients that give rise to the large diversity of bacteria in the microbiota, also the bacteria themselves provide nutrients for each other, called microbial cross- feeding. For example, specific carbohydrate fermentation products, including lactate and succinate, can serve as substrates for other bacteria, for example for propionate and butyrate producing bacteria.55,56 As example: Lactobacilli and bifidobacteria are species that produce lactate, that can be converted into butyrate by Eubacterium hallii and Anaerostipes caccae.57,58 There are many bacteria, including some specific pathogenic bacteria, that lack the specific enzymes to make a specific substrate but do need the substrate themselves. These species rely on other bacteria to provide them with that specific substrate. For example, Clostridioides difficile lacks sialidase, and thus lacks the possibility to cleave sialic acids from complex carbohydrates. However, it does contain genes dedicated to sialic acid metabolism. C. difficile can obtain these substrates because other members of the microbiota are producing and excreting them into the lumen.59

The microbiota is also formed by the host immune system. In the GI tract, antimicrobials like angiogenin 4, α-defensins, histatins, lipopolysaccharide- (LPS-)binding proteins, lectins and others are produced by Paneth cells. These antimicrobials are highly abundant in the mucus, however are absent from the lumen, and thus are not in contact with the bacteria in the lumen.60,61 This influences the microbial composition on both sites.

1.1.3. Digestion of food and production of nutrients The microbiota is highly involved in the digestion of food and thus the production of nutrients. The most compelling evidence about the connection between food and the microbiota is found in germ-free mice: they require a significantly higher caloric intake of about 30% more calories to maintain their body weight compared to mice with a normal microbiota.62 The microbiota influences this by two mechanisms: they extract extra calories from food that the host is not able to extract and they promote the uptake and utilization of nutrients.63 The microbiota can digest or synthesize specific nutrients like vitamins, polyamines and short chain fatty acids (SCFAs).64,65 For example, Bifidobacterium bifidumand and Bifidobacterium longus are examples of bacteria that are known to synthesize folic acid.66,67 Vitamin B12, which is an essential vitamin that can be produced by bacteria but not by humans or animals, is also synthesized by the microbiota.68 Also thiamine, folate, biotin, riboflavin, pantothenic acid and up to half of the daily required vitamin K are vitamins synthesized by the microbiota.64 Many bacterial species of the microbiota have the potential to ferment non-digestible substrates like dietary fibers, which accounts for a significant part of the energy source for the host.69,70 Individuals consuming a diet with a high amount of microbiota-accessible carbohydrates have an increase in SCFA production, like acetate, propionate and butyrate. SCFAs play an important role in host health, for example via anti-inflammatory mechanisms.71 Butyrate is also a main source of energy for human colonocytes. They derive up to 70% of their energy directly from butyrate. Butyrate also activates intestinal gluconeogenesis and has in general a beneficial effect on the host’s energy homeostasis and glucose levels.72 Propionate regulates the gluconeogenesis and the satiety signaling in the liver by interaction with the gut fatty acid receptors.72 Acetate is an essential metabolite important for the growth of other beneficial microbiotal bacteria. It is also involved in the host cholesterol metabolism and lipogenesis, and regulates and reduces the appetite

6 of the host.73 Trials have shown that a higher production of SCFAs correlates with decreased diet- induced obesity and lower insulin resistances.74,75 The microbiota is also involved in the synthesis of essential amino acids. Up to 20% of the circulating leucine, lysine and threonine is synthesized by the gut microbiota.76–78 Torrallardona et al. showed that for microbial synthesis of essential amino acids to happen, the microbiota derives several other essential substrates from dietary carbohydrates.79 In addition, the microbiota contributes to the nitrogen balance by performing urea nitrogen salvaging, metabolizing urea, that 80 is present in the GI tract, into ammonia and CO2. Afterwards this ammonia can be used in the amino acid synthesis or be taken up by the host for other processes.81 Additionally, the microbiota is involved in the lipid metabolism. The first evidence found was that germ-free (GF) mice contain around 40% less body fat compared to mice containing a microbiota, even though germ-free mice ate more compared to normal mice and they had a lower metabolic rate. GF mice showed to have lower concentrations of eighteen phosphatidylcholine species and higher concentrations of triglyceride species compared to wildtype mice.82 The model used by Bäckhed et al. suggested that the microbiota stimulates the increase of hepatic triglyceride production. It also inhibits the activity of an lipoprotein lipase inhibitor, thus promoting storage of adipocyte triglycerides.83 By using germ-free models colonized with the human gut microbiota from humans consuming a Western diet, it was shown that there was an increase in adiposity in those mice.84 These studies provide evidence that the bacteria from the microbiota indeed have an influence in the lipid metabolism of the host.

1.1.4. Direct and indirect colonization resistance Colonization resistance is the resistance that the bacteria from the microbiota provide to protect the host against pathogenic bacteria. Colonization resistance can be divided into two categories: direct and indirect colonization resistance. Direct colonization resistance is largely mediated by direct inhibition of invading pathogens by the commensal bacteria of the microbiota. Direct inhibition can be pursued in different ways, for example by competition for nutrients and niche or by releasing inhibitory substances and metabolites like bacteriocins or secondary bile acids.85 It has been demonstrated that Lactococcus lactis produces nisin (a class I bacteriocin) which targets a wide range of Gram-negative bacteria, including C. difficile by inhibiting spore germination and vegetative cell growth.86 Bifidobacterium bifidum secretes specific metabolites like galacto-

7 oligosaccharides which inhibit the growth of Salmonella enterica serovar typhimurium.87 Indirect colonization resistance is accomplished by commensals priming protective components of the host’s immune system.85 For example, segmented filamentous bacteria (SFB) are able to induce T helper 17 (TH17) cell differentiation. TH17 cells produce the cytokine interleukin- (IL)-17 during infections. IL-17 increases the production of antimicrobial peptides and the recruitment of neutrophils.88,89 Because of this, mice have a better protection against with Citrobacter rodentium infection, which is the mouse model pathogen for enterohaemorrhagic and enteropathogenic Escherichia coli (EHEC and EPEC).88 The gut microbiota also prevents bacterial infections by its contribution to the maintenance of the intestinal barrier, most importantly the mucus layer, thus separating the bacteria from the IECs. In the stomach and colon the mucus layer consists of two layers. The inner layer is very compact and few bacteria are present there.90 The outer layer, which is looser compared to the inner layer, harbors a lot of bacteria and hosts a distinct microbial niche that serves as a carbon source for other bacteria from the microbiota.91,92 For example, the enzyme 2-α-ʟ-fructosyl-transferase 2 (FUT2) which is expressed by host goblet cells adds fucose residues to the intestinal mucins. The fucose residues bind to the mucin which then serves as a substrate for distinct bacterial species in the gut microbiota, preventing outgrowth of pathogenic bacteria.93,94 Not only is the mucus layer important for the microbiota, the microbiota is also important for proper development of this mucus layer. FUT2 expression in enhanced by SFB and LPS. SFB and LPS induce the secretion of IL-22 by innate lymphoid cells (ILCs) which is required for FUT2 expression.95 Germ-free mice have, compared to mice with a normal microbiota, a significantly thinner mucus layer. This layer is also significantly more penetrable by bacteria. By colonizing germ-free mice with a conventional microbiota, the mucus layer will eventually turn into a normal functioning mucus layer.96 Not only bacteria, but also bacterial products like LPS are by itself sufficient enough to thicken the mucus layer.97 Direct and indirect colonization resistance generates protection for the host against numerous gastrointestinal bacterial infections, like, among other things, Campylobacter jejuni98– 100, different Enterococcus spp.101,102, Salmonella enterica103–106, Citrobacter rodentium88 and Clostridioides difficile107. Figure 2 shows how the microbiota, by providing colonization resistance, protects the host against these bacterial pathogens.

Figure 2: Direct and indirect colonization resistance against pathogenic bacteria.

The microbiota confers colonization resistance against pathogenic bacteria in two ways: direct and indirect colonization resistance. (A) Indirect colonization resistance caused by the recognition of bacterial flagellin, which stimulates CD103+ dendritic cells (DCs) to produce IL-23, which actives innate lymphoid cells (ILCs) to produce IL-22. This causes the production of regenerating islet-derived protein 3 gamma (REGIIIγ) which inhibits pathogenic Enterococcus species. (B) Direct colonization resistance against C. jejuni, by still unknown substances produced by E. faecalis and L. acidophilus. (C) Indirect colonization resistance against C. rodentium. Segmented Filamentous Bacteria (SFB) promote Th17 cell differentiation by increasing serum amyloid A (SAA). Th17 cells produce IL-22 and IL-17. Because of this, the host secretes antimicrobial peptides that inhibit the pathogen. (D) Direct and indirect colonization resistance against S. enterica. B. bifidum produces galacto-oligo-saccharides that inhibit the growth of extracellular S. enterica. Intracellular S. enterica is inhibited by yet unknown bacteria that promote interferon gamma (IFNγ) producing cells to produce IFNγ. (E) Direct colonization resistance against C. difficile. Multiple different bacteria are able to inhibit C. difficile. B. thuringiensis inhibits C. difficile by producing bacteriocins, which are not affecting the commensal microbes. Secondary bile acid producing (SBAP) bacteria convert primary bile acids to secondary bile acids, which directly inhibit the pathogen. Figure adapted from Buffie et al.85

1.3. Antibiotics and the microbiota

Antibiotics are used in humans and animals as treatment against bacterial infections. Since the beginning of the antibiotic era, mortality caused by bacterial infections is decreased. Antibiotics, together with improved sanitation and vaccination, have increased the longevity of humans. However, in the last decades, numerous bacterial pathogens acquired antibiotic resistances. There are two different ways antibiotics work against bacteria. Bacteriostatic antibiotics inhibit the growth of bacteria while bactericidal antibiotics directly kill them. There are different origins of antibiotics. Antibiotics can be natural products produced by other organisms, for example by fungi.108 There are also semisynthetic and synthetic antibiotics, which applies to most modern antibiotics.109 The semisynthetic antibiotics are modifications of the natural antibiotics. For example, the current beta-lactam antibiotics are based on penicillin which are produced by a fungus of the genus Penicillium.110 The effect of the antibiotic on the host, the microbiota and the infection depends on multiple factors, like the route of administration, pharmacokinetics and the route of excretion. Antibiotics are used in the lowest dose possible, called the minimal inhibitory concentration (MIC). It is defined as the lowest concentration of the antibiotic that inhibits the growth of a specific pathogen after a specified amount of time.111 However, antibiotics do not only affect the pathogen it is used against, it also affects the hosts microbiota. Not only the antibiotics in the first place affect the microbiota, also the different metabolites which are produced when the antibiotic is broken down can affect it.112 Dethlefsen et al. showed that the abundance of 30% of the bacteria of the microbiota in the intestines was affected after healthy humans were exposed to the broad-spectrum antibiotic ciprofloxacin.36,113 Other antibiotics, like amino salicylates and azolidines mostly target members of the family Firmicutes.114,115 Polymyxins, polyenes and sulfonamides affect the Bacteroidetes and Firmicutes.116–118 In addition, the members of the Firmicutes are targeted by quinolones, which also affect Proteobacteria.119 Antibiotic usage is associated with a decrease in number of species (taxonomic richness) and diversity (structure of the community), which largely recovers within a month after the antibiotic treatment. Clindamycin can cause significant changes in the microbiota for up to four months after treatment.120 The mucus layer, which in normal healthy circumstances is a natural barrier against pathogens, is impaired by antibiotics. This leads to an increased likelihood of a bacterial invasion.121 The impact of the

10 antibiotics also largely rely on the different compositions of microbiota between individuals, which can give rise to different outcomes in the dynamic behavior and resilience of the microbiota.122 The behavior of the microbiota can also be different in individuals that have been treated with multiple courses of antibiotics in a short time period and in infants or elderly. Treatment of antibiotics in early-life has showed to increase the risk of asthma and weight gain, leading to obesity and metabolic diseases later in life.123–125 Antibiotic treatment within the first week of life has been reported to cause reduced abundances of Bifidobacteria and Lactobacillus and increased abundances of Enterobacteriaceae and the opportunistic pathogen Enterococcus in the beginning of their lives.126,127 Antibiotics not only alter the composition and richness of the microbiota, it also can affect the colonization resistance of the microbiota. Already 60 years ago, it was described that mice treated with antibiotics have a 10,000-fold higher susceptibility against Salmonella enterica serovar Typhimurium compared to mice that did not receive antibiotic treatment.103

1.4. Clostridioides difficile

Clostridioides difficile, formerly known as Clostridium difficile, is a gram-positive, rod-shaped, anaerobic, spore-forming bacterium. It was first described by Hall and O’Toole in 1935.128 The bacteria, originally named Bacillus difficilis, was first isolated from the microbiota of a healthy new-born; however, they found that it was able to cause disease in animals. It was only in 1978 that it was discovered that C. difficile was a cause of pseudomembranous colitis.129 C. difficile is now known to be a leading cause of nosocomial antibiotic-associated diarrhea and a common healthcare-associated infection.107,130,131 Figure 3 shows the infection cycle of C. difficile. In short, a healthy microbiota protects the host against C. difficile infections. After an antibiotic treatment, (Figure 3A) the microbiota loses its colonization resistance and is susceptible for C. difficile colonization. Without encountering C. difficile spores (Figure 3B), the microbiota and the colonization resistance will eventually recover. When C. difficile spores are encountered (Figure 3C), they will enter the intestinal tract, germinate and become toxin-producing vegetative cells. These toxins are the cause of the symptoms like diarrhea. The common treatment against C. difficile infections are antibiotics (Figure 3D) and over time the microbiota recovers to its normal state (Figure 3E). However, in 30% of the cases turns into a recurrent disease (Figure 3F). Fecal transplants (Figure 3G) however are able to treat the disease and restore the microbiota and colonization resistance. 11

Figure 3: Clostridioides difficile infection cycle.

(A) The normal healthy microbiota protects the host against C. difficile by colonization resistance (CR). However, after receiving for example antibiotics, the CR is lost, and the microbiota turns into a dysbiotic state. (B) Over time, the microbiota recovers as well as the CR. (C) When the microbiota is in a dysbiotic state and it encounters C. difficile spores, the spores are able to germinate and produce toxins, causing a C. difficile infection. (D) C. difficile infections can be treated with antibiotics, (E) where after the microbiota can recover to its normal state and acquire back the CR. (F) However, in 30% of the cases, the infection reoccurs. This can result in an infinite loop of recurrent infections. (G) A promising treatment is fecal transplantation, whereby the microbiota of a healthy individual is transferred into the patient, causing the recovery of the CR and turning the microbiota into a healthy state again. Adjusted from Britton et al.132

1.4.1. Epidemiology 75% of all antibiotic associated colitis cases are estimated to be caused by C. difficile infections.133,134 In the annual Epidemiological Report for 2016 of the European Centre for Disease Prevention and Control (ECDC), it is described that 7711 Clostridioides difficile infection (CDI) cases were reported in 20 European Union (EU)/European Economic Area (EEA) countries, from which 74.6% was health-care associated. From the health-care associated cases, almost 8% were

12 recurrent infections and 20,7% of the patients died, from which 3.9% of the cases CDI was named to be contributed to the fatal outcome. The medium age was 75 years. Participating countries were Austria, Belgium, Croatia, Czech Republic, Estonia, Finland, France, Greece, Hungary, Ireland, Italy, Latvia, Lithuania, Malta, the Netherlands, Poland, Slovakia, Slovenia, Spain and the UK- Scotland.135 In Germany, 2803 cases were reported in 2017, from which 97% were health-care associated. 7% were recurrent cases, however, this is much lower than the numbers of the three years before (36% (2014), 35% (2015) and 33% (2016). The reason this is lower is because there are new criteria for assigning recurrent infections. In total, 25% of the cases had a fatal outcome.136 According to a European study, there is still an underdiagnosis for CDI caused by absence of suspicion of infection in addition to suboptimum diagnostic methods and the large variations among countries in the means of diagnosing C. difficile.137 The Center for Disease Control and Prevention (CDC) reported that at least 250.000 patients get infected with C. difficile and 14.000 die annually from the consequences of the infection in the United States.134 Additionally, there is an increasing number of severe infection cases that are caused by hypervirulent and multi antibiotic resistant strains like B1/NAP1/027. This strain is resistant against clindamycin, cephalosporins and fluoroquinolones.138–141 Multi-resistant strains make it even more important to find additional treatments against C. difficile infections.

1.4.2. Characterization of C. difficile strains C. difficile encloses different strains that are able to infect humans with different virulence and infectivity. It is important to be able to characterize the strain that is causing the infection in the patient. The different strains contain different toxins, transcription factors, genes and mutations. The strains can thus have a significant difference in infectivity, virulence and severity of disease. Some strains cause epidemics and can be traced back to one hospital or one patient. In addition, there are strains that do not possess any toxins and thus are not virulent. Additionally, there are laboratory strains, that are used in experiments, like the C. difficile VPI 10463 strain and C. difficile 630 strain used in this study. Multiple reference methods are available to characterize the specific strain which include PCR ribotyping, toxinotyping, pulsed-field gel electrophoresis, multilocus variable-number tandem repeat analysis and whole genome sequencing.

PCR ribotyping depends on the presence of several alleles of the rRNA gene operon. Ribotype-specific patterns are found after genomic amplification and migration, by sequencing the length polymorphism of the intergenic spacer regions between the 16S and 23S rRNA genes.142 Toxinotyping is performed by using a PCR-restriction based technique. They are defined by the differences in the pathogenicity locus (PaLoc) compared to the reference strain C. difficile VPI 10463. The PaLoc consists of five genes. Two of these genes encode toxin A and toxin B. Two other genes, tcdR and tcdC, are essential for the regulation of the toxins and the tcdE gene is important for the transport of the toxins.143 Since C. difficile strains are known to possess a great genetic variability, they are divided in different toxin-types, based on the genetic variations between these genes.144 In nontoxigenic strains, a short 115 base pair mutation is typically found in the insertion site instead of the PaLoc. For now, there are thirty-four different toxinotypes.143 Compared to PCR ribotyping, it was found that toxinotyping was less discriminative.145 Pulsed-field gel electrophoresis (PFGE) is another way of strain determination. It was developed in the 1980s. The results between PFGE and PCR ribotyping are in good concordance, but PFGE is more discriminatory than PCR ribotyping.146,147 Some strains however cannot be assigned using this technique and also the degradation of the DNA can cause problems with the analysis. Other issues are that PFGE is very labor-intensive and there is a no standardization, hence it is hard to compare between laboratories.148 PCR ribotyping, toxinotyping or PFGE are not always sensitive enough to prove the nosocomial spread of a single strain. For discriminating if the spread originates from one or multiple strains, multilocus variable-number tandem repeat analysis (MLVA) can be applied. MLVA relies on the variability of these tandem repeats at specific loci. This way, the genetic similarities can be measured.149 The most sensitive way of characterization and discrimination is whole genome sequencing (WGS), where the whole genome, and thus every nucleotide, is being sequenced. Comparison of the whole genome gives a more complete picture of the strain and the genes the strain contains. This method can be used for genome comparison and lineage analysis and can identify rapidly the transmission of specific strains.150,151

1.4.3. Ribotypes in C. difficile As mentioned before, different strains of C. difficile are able to infect humans. Multiple studies have been performed within countries or among multiple different countries to find 1) which ribotypes (RT) have a high transferred efficiency, 2) which ribotypes are associated with a increased virulence and mortality rate and 3) which ribotypes have antibiotic resistance genes incorporated in their genomes. In a study performed on C. difficile infections in 106 laboratories in thirty-four countries in Europe, it was discovered that the incidence of C. difficile infections and the ribotype distribution varied greatly. In total 65 different ribotypes in 389 different C. difficile isolates were identified.152 The most common ribotypes were RT014/020, RT001 and RT078. In the UK and Ireland, the most common ribotype recovered was RT106. Another multicenter study performed in Europe included 482 hospitals. They found 125 different ribotypes among 1196 C. difficile isolates.153 The most common ribotype found was RT027; 19% of the ribotypes were identified as such. Also RT001/072, RT014/020 and RT078 isolates were encountered in high percentages. In Germany a study has been performed by assessing 393 isolates of C. difficile. The most common ribotypes were RT001 and RT027, but also RT078 and RT014/066 were frequently found.154 RT027 is a hypervirulent epidemic strain in Europe, first reported in England in 2005.155 RT027 belongs to toxinotype III and produces, in addition to toxin A and B, the binary toxin. This ribotype contains two mutations: an eighteen base pair deletion, and a deletion on position 117 in the tcdC gene. These mutations result in the inactivation of the toxin repressor TcdC and, as a consequence, the production of toxins is significantly increased. The strain produces a sixteen-fold higher amount of toxin A and a twenty-three-fold higher amount of toxin B compared to other ribotypes.156 In addition, the strain is resistant to erythromycin and moxifloxacin. This causes the strain to be associated with a higher rate of complications.157 RT176 is closely related to RT027 and also belongs to toxinotype III.158 Both strains contain a deletion on position 117 in the tcdC gene which caused some RT027 strains to be wrongly assigned and were later reassigned to RT176.159 RT176 is mostly encountered in East Europe. However, the strain spreads rapidly around the hospitals where they were found, showing that a rapid nosocomial spread is possible also to other areas. Additionally, the strain is known to be multidrug resistant and thus harder to treat with antibiotics.153,160

RT078 produces toxin A, B and binary toxin. It belongs to toxinotype V and is able to be identified because of a thirty-nine base pair deletion in the tcdC gene. RT078 is one of the common ribotypes found in Europe.161 RT078 strains are more frequently associated with community acquired C. difficile infections in younger patients instead of health-care acquired infections in elderly.162 RT078 has been found to be resistant to fluoroquinolones and erythromycin.163 RT087, better known as VPI 10463 produces toxin A and B, but not the binary toxin. It belongs to toxinotype 0, since it is the reference strain. This strain is used in the laboratory and is able to infect mice after antibiotic treatment.143 RT012 is better known as C. difficile 630 strain and is a virulent clinical isolate. The strain was isolated from a patient in Switzerland and is used as a reference strain for laboratory studies. It is resistant against erythromycin, however, there is also a strain produced that is called C. difficile 630Δerm that is not resistant against the antibiotic.164 The genome consists of around 11% mobile genetic elements, like conjugative transposons.165 The strain is frequently being used for genetic modification. The erythromycin resistant strain is particularly useful for insertional mutants using ClosTron.166

1.4.4. Spore production C. difficile produces spores consisting of a partial dehydrated core containing around 1 M calcium- dipicolinic acid (Ca-DPA). This dehydrated state causes the maintenance of the dormancy.167,168 The DNA inside the core is supercoiled. Multiple small, acid-soluble proteins are bound to the DNA strains, which are hypothesized to block transcription and protect against DNA damage.169,170 An inner membrane is surrounding the spore core and protects the spore core against chemicals that might damage it.171 Around the inner membrane lies the cell wall and around that the spore cortex. The spore cortex is a thick layer of peptidoglycans that are essential for specific hydrolysis by cortex lytic enzymes.171,172 Surrounding the cortex are the outer membrane and spore coat. In these layers enzymes are present that are involved in cortex hydrolysis.173–175 The outermost layer, called the exosporium, is a highly permeable layer that consists of carbohydrates and plays a major role in host-pathogen interactions and spore persistence.176–178 In vitro, sporulation is triggered by a limited amount of nutrients. A spore is formed by the formation of a septum, which divides a cell into two unequal compartments. The bigger compartment is the mother cell, the smaller one is the forespore. The forespore develops into a

16 spore, while the mother cell helps to prepare the forespore. The matured spore is released into the environment through lysis of the mother cell. When the environment is favorable again, spores can germinate and form vegetative cells. Dormant spores can remain viable for hundreds of years and are resistant to numerous environmental situations and stresses, like oxygen, low pH, high or low temperatures, ethanol, disinfectants based on ethanol and radiation.179,180 The in vivo conditions for sporulation are not exactly known yet, however, the mechanism of spore forming in vitro is well described. Sporulation is initiated by signaling through sensor histidine kinases. This results in the phosphorylation and thus activation of the transcription factor stage 0 sporulation protein (Spo0A). There are many genes that are directly regulated by phosphorylated Spo0A and it drives the sporulation regulatory network. Spo0A is essential for spore forming, since mutants that do not contain a working Spo0A gene, do not produce any spores, thus only existing in the form of vegetative cells. In addition, these mutants are significantly less infective compared to C. difficile strains that contain the Spo0A gene. Spo0A levels are controlled by specific genes that suggest that C. difficile represses sporulation in an environment containing abundant nutrients. For example, CodY can repress the transcription of multiple operons in C. difficile, including the toxin locus and two regulators of sporulation. CodY binds to the DNA in the presence of GTP and branched-chained amino acids. Catabolite control protein A (CcpA) regulates carbon catabolite repression, and directly represses spo0a transcription. Two other oligopeptides, opp and app, are also important for spore repression. A deletion of these two decreases the ability of C. difficile to take up nutrients from peptides from the environment. Because of this deletion, cells are faster in a starvation state. When C. difficile has a deletion in one of these two peptides, there is an increase in the expression of Spo0A, resulting in a higher spore production and virulence in these strains. Spo0A is a critical regulator for sporulation since it regulates four compartment sporulation- specific RNA polymerase sigma factors, namely σF, σE, σG and σK.181 The sigma factors activate transcriptional regulation during sporulation in B. subtilis and are conserved in C. difficile.182–184

1.4.5. Spore germination Germination has been studied in multiple organisms, however, the most frequently studied bacteria are Bacillus spp. In these species, germination comprises of three major steps, namely: 1) the germinant binds with the cognate Ger-type receptor at the inner spore membrane, which triggers the release of monovalent cations and Ca-DPA (which is stored within the core). 2) Ca-DPA is 17 released and exchanged for H2O, the rehydration leads to the activation of spore cortex lytic enzymes. 3) The spore cortex lytic enzymes degrade the peptidoglycan cortex layer, causing the core to fully rehydrate and resume the metabolism.172,180 Since C. difficile predominantly enters the human intestine via spores, the initiation of the disease starts with the germination of the spores into toxin producing vegetative cells. The spores are able to endure the low pH in the stomach and can transition into vegetative cells in the small intestine.185,186 The germination of the spores is activated in response to primary bile acids like taurocholic acid (TCA) and cholic acid (CA), which are produced by the liver of the host and bind to specific amino acids, like glycine or alanine.187 This reaction can occur within minutes in response to these specific environmental germinants. Bile acids are essential to activate the germination of C. difficile, however, they are not sufficient to cause the germination by themselves. The amino acids are important co-factors of the germination, and different amino acids have distinct efficiencies in spore germination. Glycine is the most stimulating amino acid in C. difficile, but also alanine, histidine and serine are able to serve as co-germinant.187–190 Additionally, Ca2+ was identified as an important co-factor for spore germination. It was found that in bacterial growth medium, supplemented with the primary bile acid TCA, but without the addition of Ca2+, C. difficile was unable to germinate, while it was able to germinate in growth medium containing Ca2+. It was hypothesized that Ca2+ plays a role in activation of specific proteases that are important in starting the process of germination, rather than being a co-germinant.191 C. difficile does not contain the Ger-type receptors found in Bacillus spp., C. perfringens and C. botulinum. Instead, C. difficile uses the CspC pseudoprotease as its bile acid germinant receptor.167,192–194 CspC is located in the spore coat/outer membrane.192 When C. difficile produces its spores, three subtilisin-like serine protease proteins are transferred into the spore. Upon activation of CspC, CspB, activates cortex hydrolase SleC, which degrades the cortex, leading to a release of Ca-DPA from the spore core.195 Two important regulators of spore germinators are GerG and GerS. Donelly et al. found that a deletion of the gerG gene resulted in spores with a germination defect displayed by a reduced responsiveness towards the primary bile acids. Hypothesized was that this was caused by a lowered amount of the three subtilisin-like serine protease proteins in the spores.196 Fimlaid et al. found that gerS gene mutants failed to degrade the spore cortex. In vivo, this resulted in an attenuated virulence which demonstrates the importance of the protein.181

1.4.6. Toxin production The vegetative cells of C. difficile can possess genes that have the possibility to express three different toxins: toxin A, toxin B and binary toxin. Not all strains contain these three toxins, some only possess Toxin A and/or B, while some strains to not possess any toxins at all. All toxins found in C. difficile are part of the large clostridial glycosylating toxin (LCGT) family.197,198 The toxins found in C. perfringens and C. sardellii are also part of this family.199 Toxin A and B are considered the main virulence factors of C. difficile and the genes are located on the pathogenicity locus. The PaLoc contains the genes tcdA and tcdB, which encodes for the toxins themselves, but also for consists of other genes important for the production of the toxins. Three other genes are tcdR, a positive regulator of the toxin expression, tcdC, a potential negative regulator, and tcdE, which is a holin required for the extracellular toxin secretion.200 Since C. difficile RT027 contains a mutation in its tcdC gene, it produces larger amounts of toxin compared to other strains.156 The expression of the two toxins depends on the environmental conditions and regulators, for example the availability of specific nutrients, an alteration of the redox potential or changes in temperature.201–203 Normally, the toxins are produced when the cell enters the stationary phase, during situations where there is a limited amount of nutrition present or when there is inhibition of growth by specific substances.204,205 There are also specific amino acids, like cysteine and proline, and carbon sources like glucose, that are able to inhibit the expression of the toxin genes.205–207 A cascade of actions are needed for the delivery of the toxins into the host cells. First, the toxin has to bind to the host receptor, where the toxins are internalized through receptor-mediated endocytosis. The endosome containing the toxins is acidified, pores are formed and the toxins are released into the cytoplasm. GTPases are then inactivated by glycosylation, causing the cytopathic and cytotoxic effects. Toxin A and B break the intestinal barrier by targeting host GTPases like specific Rho proteins, specific Rac proteins, TC10 and Cdc42.208 These GTPases influence the polymerization of actin, which is important for the maintenance of the tight junctions between IECs. By targeting and thus inactivating these proteins, the tight junctions become weaker, colonocytes die and there is a loss of intestinal barrier function. This results in mild to severe diarrhea and possibly life-threatening toxic mega-colon.209,210 In multiple animal experiments and in human studies, it has been shown that toxin B might be the more important toxin to cause pathological damage.211,212

C. difficile transferase (CDT), is a binary toxin closely related to the binary toxin found in C. perfringens.199 Not all strains of C. difficile can produce the CDT, and there are strains that only produce the CDT and no toxin A or B. Patients infected with strains only producing CDT are afflicted with colitis, but the symptoms are moderate. In addition, it has been found that these strains do not cause severe enteritis in experimental animal models.197,213,214 CDT does not bind to the GTPases Rho and Rac but rather to lipolysis-stimulated lipoprotein receptor, which is a type I single-pass transmembrane protein.215 The toxin inhibits actin polymerization, which causes changes in cell morphology, loss of barrier function and, in the end, cell death.216,217

1.4.7. PPIases Peptidyl-prolyl-cis/trans-isomerases (PPIases) are omnipresent proteins that can be divided in three major classes: FK-506 binding proteins, cyclophilins and parvulins.218,219 There are differences between the amino acid sequences and structures, however, all classes have the function of catalyzing the rate limiting isomerization of peptidyl-prolyl bonds during protein folding.220–222 By catalyzing these processes, they contribute to the stability, activity and translocation of proteins within bacteria.223,224 PPIases are involved in stress tolerance, protein homeostasis and secretion. It also has been discovered that PPIases are contributing to the virulence and pathogenicity in Gram-negative and Gram-positive bacteria, for example macrophage infectivity potentiator (Mip), belonging to Legionella pneumophila, and the parvulin- type PPIase PrsA2 of Listeria monocytogenes (LmPrsA2).225–229 There are reports that under laboratory conditions, many deletions and mutations in PPIases do not present any phenotypic changes, or only show very subtle changes. For example, deletion of all known periplasmic PPIases of Yersinia pseudotuberculosis did not results in any differences when grown in vitro. However, the mutated strain actually presented growth impairment during colonization in vivo in a mouse model.230–233 LmPrsA2 is part of the parvulin class of the PPIases. It is a lipoprotein that localizes to the cytoplasmic membrane. It has a homolog in Bacillus subtilis, and both the PrsA2 of Listeria monocytogenes and Bacillus subtilis are involved in the facilitation of folding and efficient secretion of extracellular proteins.226,234,235 In multiple studies it was found to be a factor that promotes the activity and/or efficient secretion of several other virulence factors, thus influencing the outcome of infection in both cell cultures as animal models.236–239 For example, LmPrsA2 20 homologs in Staphylococcus aureus, Streptococcus equi and Streptococcus suis have been described in context of virulence.240–243 Clostridioides difficile also contains a close homolog to LmPrsA2 in respect to its biochemistry as well as contribution to physiology and infection.244

1.4.8. The Rnf-complex The Rhodobacter nitrogen fixation (Rnf-) complex is important in the energy production of Clostridia species. The Rnf-complex, which is a membrane ferrodoxin:NAD+ oxidoreductase, is hypothesized to cause a proton gradient that causes it to synthesize ATP by an H+-translocating ATPase. In C. ljungdahlii, the Rnf-complex is the only proton pump responsible for a proton motive force that is necessary for ATP synthesis during in vivo growth. Additionally, the Rnf- complex participates in energy conservation.245 The Rnf-complex is located on the membrane and consists of multiple parts, including RnfA, RnfB, RnfC, RnfD, RnfE and RnfG.246 C. difficile also contains the Rnf-complex, but the function is not known.247 Also the effect on virulence, spore production and colonization is not discovered yet.

1.4.9. Direct colonization resistance against C. difficile The undisturbed microbiota is able to completely resist C. difficile infections. A decrease in some distinct bacterial families like Lachnospiraceae or Ruminococcaceae are correlated with an increased infection rate.248–252 Additionally, an increased abundance of Lactobacillaceae and Enterococcaceae in combination with a decreased abundance of Bacteroides, Prevotella and Bifidobacteria are associated with C. difficile infections. Recent studies have shown that secondary bile acids (SBA), converted by distinct bacteria of the microbiota, causes resistance against C. difficile infections by inhibiting germination of spores and outgrowth of vegetative cells, while primary bile acids (PBA) promote the germination of C. difficile spores.187 For example, Clostridium scindens, a bacterial species isolated from the human microbiota, is identified as one of the microbes able to convert PBAs to SBAs.253 The enzyme responsible for this conversion is 7α-dehydroxylase, and it converts for example cholic acid (CA), which is a PBA, to deoxycholic acid (DCA), which is an SBA. SBAs inhibit the vegetative growth of C. difficile in vitro in addition to reducing C. difficile to colonization of the gastrointestinal tract.254–256 Certain antibiotic treatments lead to a decrease in the abundance of 7α- dehydroxylating bacteria, leading to an increase of PBAs and a decrease of SBAs. This gives

C. difficile the opportunity to grow out and initiate the infection.257 Animal experiments have confirmed that mice with decreased levels SBA and increased levels of PBAs have an increased susceptibility for C. difficile infections.258 Figure 4A and B show the effect of different primary and secondary bile acids on the lifecycle of C. difficile. Bacterial species from the Ruminococcaceae and Lachnospiraceae that are able to produce short chain fatty acids (SCFAs) like butyrate have been studied in regard to inhibiting C. difficile infections. Since these bacteria are depleted in infected patients, it was hypothesized that SCFAs are important in conferring colonization resistance against C. difficile.248 SCFAs are the main energy source for the intestinal epithelium, in addition to its anti-inflammatory characteristics. They stimulate defense barriers and increase the production and abundance of antimicrobial peptides.259 A study showed that germ-free mice colonized with a distinct Lachnospiraceae species presented a less severe infection compared to mice colonized with a non-SCFA producing bacterium (E. coli).260 In contract, in another mouse study it was shown that the administration of SCFAs to C. difficile infected mice was not able to reduce the infection.261 There is thus no conclusive evidence for the inhibitory effect of SCFAs on C. difficile infections. There is also evidence that the microbiota confers direct colonization resistance by consuming sialic acids as nutrients, which is then unavailable for C. difficile to consume. In a transcriptomic study it was shown that C. difficile uses sialic acid as a nutrient source to be able to reach a high abundance of cells.262 After an antibiotic treatment, sialic acids are made but there are no sufficient consumers, causing increased abundances of sialic acids in the intestines, promoting C. difficile growth.263 Another way of direct colonization resistance could be caused by the production of the bacteriocins. Thuricin CD, produced by a Bacillus thuringensis strain demonstrated to have an antibiotic activity against C. difficile in vitro, but not against multiple other commensal bacteria like L. casei and B. lactis.264 This makes it an interesting research target since it selectively inhibits C. difficile growth without disrupting the microbiota.

Figure 4: Production of bile acids and the effect on the lifecycle of C. difficile.

Primary bile acids (PBAs) are produced in the liver by the host, while secondary bile acids (SBAs) are produced in the cecum and colon by distinct commensal bacteria. Primary and secondary bile acids have promoting or inhibiting effects on the germination and/or growth of C. difficile. (A) The PBA taurocholic acid (TCA) induces germination of the spores, while the SBA deoxycholate acid (DCA) induces germination but inhibits the outgrowth. The SBA ursodeoxycholic acid (UDCA), lithocholic acid (LCA) and the mouse-specific omega-muricholic acid (ωMCA) all inhibit germination and outgrowth of C. difficile. In healthy microbiota settings, the SBAs produced by the commensals of the microbiota inhibit the outgrowth. (B) In certain dysbiotic microbiota settings, which for example can be caused by antibiotics, the commensals that are able to convert PBAs to SBAs are not present anymore and thus C. difficile can germinate, grow out, produce toxins and cause disease. Figure adapted from Winston et al.265

1.4.10. Indirect colonization resistance against C. difficile Clostridioides difficile colonization is not only inhibited by direct colonization resistance, but also by indirect colonization resistance as a result of microbiota-activated immune-mediated mechanisms. The innate and adaptive immune system can reduce inflammation and recurrence of the infection. Yet unidentified commensal bacteria are capable of activating nucleotide-binding oligomerization domain-containing protein 1 (NOD1), myeloid differentiation primary response 88 (MyD88) and IL-1β signaling which increases the recruitment of neutrophils, that enhance the

23 bactericidal activity.266–268 Commensal-derived flagellin stimulates Toll-like receptor 5 (TLR5) and thus also contributes to defense against C. difficile infections by inducing production of host- derived antimicrobial peptides.269

1.4.11. Immune system and C. difficile Not only the microbiota but also the innate and adaptive immune system of the host targets C. difficile. The first step in protecting itself against C. difficile is preventing and delaying the binding of the toxins to the intestinal epithelium by producing mucus. However, together with multiple other pathogens, C. difficile has evolved mechanisms to reduce the hosts mucin production.270,271 The second step is producing antimicrobial peptides. Cathelicidin and defensins produced by leukocytes and Paneth cells significantly reduce the inflammation and damage to intestinal cells caused by toxin A and B.272,273 In response to the toxins, epithelial cells will release IL-8 and macrophage inflammatory protein 2 (MIP-2) to initiate an immune response.274 When the intestinal barrier breaks and C. difficile proteins, toxins and cells come into contact with macrophages, monocytes and dendritic cells, an inflammatory cascade is initiated resulting in the release of proinflammatory cytokines.275 Localized mast cells degranulate and cause an increase of the permeability of the intestines, causing fluid loss and diarrhea.276 In addition to the innate immune system, the adaptive immune system is activated as well. In response to the initial infection, the host releases IL-10 and IL-4. This stimulates the maturation of B-cells into Ig-producing cells and memory B-cells.277 The host produces antibodies against C. difficile and its toxins. Asymptomatic individuals have a significantly higher amount of IgG antibodies against toxin A compared to individuals with a C. difficile infection. Asymptotic individuals were also correlated with the increased production antibodies against toxin B and non- toxin antigens but there was no significance found between the groups.278 Also, low levels of IgA and reduction in IgA producing cells are associated with prolonged C. difficile symptoms and recurrence.279 In addition, IgM is negatively associated with severity and recurrence. Patients producing high concentrations of serum IgM antibodies three days post infection were less likely to develop recurrent C. difficile infection, while patients with a low concentration had a twenty- five-fold increased risk of developing recurrent disease.280

1.4.12. Treatments of C. difficile infections Standard treatment against C. difficile infection is the administration of antibiotics. For an initial episode of infection, vancomycin or fidaxomicin are recommended, however, metronidazole is also a possible treatment.281 10-35% of patients with a C. difficile infection develop a recurrent infection, which causes significant clinical complications and increased mortality. An alternative treatment to antibiotics is a fecal transplantation (FT). FTs are shown to be efficient in treating initial but also recurrent and antibiotic resistant C. difficile infections.282,283 There are however concerns about the safety of FT. Not one FT is the same, since every donor has a different microbiota composition and even a donation from the same donor on different days present differences in the composition. It is not clear what exactly is being transferred since the microbiota consists of many different microbes and metabolites. FTs pose a significant risk of transferring opportunistic pathogens. Additional studies, like the study described in this thesis, are required to understand and identify distinct members of the intestinal microbiota, which are highly effective against C. difficile infections. This could eventually replace the FT. In July 2019, two patients that received a FT ended up with an infection of a multi-resistant bacterial strain, which caused the death of one of them.284

1.4.13. Clostridioides difficile mouse models C. difficile mouse models are widely used to study C. difficile infections, e.g. the mechanisms of pathogenicity, host defense and the role of the microbiota.285 Similar as in humans, mice require an antibiotic treatment before C. difficile is able to colonize.286 Specific antibiotics are needed for C. difficile to be able to colonize and cause disease. Theriot et al. found that one dose of cefoperazone, clindamycin and vancomycin diminishes the colonization resistance against C. difficile, but metronidazole and kanamycin did not show a lower colonization resistance.287 One study showed that disease severity was correlating with the decrease of Lachnospiraceae and an increase or Enterobacteriaceae, and that mono-colonization of germ-free mice with isolates from the Lachnospiraceae showed a decrease in C. difficile colonization.260,288 This demonstrates that specific species of commensal bacteria are sufficient to exert colonization resistance against C. difficile. Germ-free mice are highly susceptible for C. difficile infections, but also the oligo- mouse-microbiota mice, which are gnotobiotic mice containing twelve mouse-specific gut bacteria, are susceptible, even without an antibiotic treatment.289 Most studies do not take the age

25 of the mice into account, however, there are a few studies examining the effect of age on the severity of C. difficile infections in mice. The first one examined the difference between old (eighteen months) and young (eight weeks) mice. Higher mortality was found in aged mice compared to young mice, which they claimed to be caused by differences in the microbiota. However, they didn’t use the two groups of mice with the same starting microbiota and thus this result of the age experiment remains uncertain.290 Another study examined old (eighteen months) and younger (two-four months) mice. They found that the old mice had a higher mortality rate compared to the younger mice when infected with C. difficile, where 50% of the old mice died compared to none of the young ones.291

1.5. Oligo-mouse-microbiota

The Oligo-mouse-microbiota (OMM) mice are C57BL/6 mice that are colonized with only 12 bacterial species. These species are all mouse-specific bacteria, isolated from healthy intestinal mouse-microbiota. In the paper of Brugiroux et al., who established this mouse model, they argue that mice containing mouse-specific bacteria are a more natural tool to study host-microbiota interactions compared to mice that are colonized with human microbiota. This is because the microbiota and the host have a long-term co-evolution and thus the collaboration between the microbiota and host is more optimized when you use a host-specific bacterial strain. In the end, the specific bacteria are not important, the function of these bacteria is important. Bacteria can be different species in different hosts, but can have similar or even the same functions and can produce the same metabolites in the end.292 The twelve bacterial strains that colonize the OMM mice originate from the five most abundant and prevalent phyla of the intestinal mouse microbiota. Seven species were assigned to the phylum Firmicutes, two were assigned to the Bacteroidetes, one to the Actinobacteria, one to the Betaproteobacteria and one strain to the Verrucomicrobia. Akkermansia muciniphila (YL44) is the strain that belongs to the Verrucomicrobia.293 Bacteroides caecirmuris (I48) is one of the two strains that belongs to the Bacteroidetes phylum. This strain is part of the mouse intestinal bacterial collection (miBC), and was isolated in 2016.294 Muribaculum intestinale (YL27) is the second strain that belongs to the Bacteroides phylum, which is also part of the miBC. Turicimonas muris (YL45) is the strain that belongs to the

Proteobacteria. This one also originates from the miBC. In the phylum Actinobacteria, Bifidobacterium longum subsp. Animalis (YL2) was chosen to represent the phylum in the OMM mice.295,296 The Firmicutes is the most represented phylum. Seven out of the twelve bacteria from the OMM mice belong to this phylum. The first one is Enterococcus feacalis (KB1). It was first described in 1906 by Andrewes and Foulerton.297 It was classified as a Streptococcus spp. for a long time, until in 1984 Schleifer and Klipper-Balz discussed that it should be classified as Enterococcus faecalis.298 The second strain that belongs to the phylum Firmicutes is Acutalibacter muris (KB18), which was isolated in 2016 and belongs to the miBC. Clostridium clostridioforme (YL32) is the third Firmicutes that was added to the OMM. It was found in 1906, and was called Bacterium clostridioforme.299 In 1974, Kaneuchi et al. renamed the bacterium Clostridium clostridioforme.300 Flavonifractor plautii (YL31) is the fourth species belonging to the Firmicutes. It was first identified in 1928, when it was named Fubacterium plautii301 but reassigned as Flavonifractor plautii in 2010 by Carlier et al.302 Strain number five is Blautia coccoides (YL58), first described in 1976, and originally named Clostridium coccoides.303 In 2008 it was reclassified as Blautia coccoides.304 Lactococcus reuteri (I49) is the sixth species belonging to the Firmicutes isolated in 1980 by Kandler et al. The last species that belongs to the Firmicutes phylum is Clostridium innocuum (I46), which was discovered in 1962.305 The OMM mice are highly susceptible for C. difficile infections as demonstrated by Studer et al.289 None of the twelve bacteria that make up the microbiota contain the 7α-dehydroxylating gene, which means that there are no secondary bile acids produced in these mice. The study shows that when a bacterial strain is added, which contains the 7α-dehydroxylating gene, in this case Clostridium scindens, the colonization resistance is higher compared to OMM mice without this bacterial species. However, the mice do not restore the colonization resistance completely and mice will still develop a C. difficile infection. One day after infection, a significant difference in the amount of C. difficile was found between the non-colonized mice and mice colonized with the secondary bile acid producer, however, three days post infection, there is no difference in the amount of spores and vegetative cells between the two groups.289

1.6. Aims of the study

The microbiota affects the hosts susceptibility towards C. difficile infections. Specifically, a well- balanced and functional microbiota is able to prevent the colonization of the pathogen, while a disturbed microbiota might even promote C. difficile growth. The composition of the microbiota can be altered by diet or antibiotic and medicine usage. Most patients infected by C. difficile are elderly who already suffer from an underlying disease or infection for which they get treated for with antibiotics. This causes the loss of the colonization resistance against C. difficile. The occurrence of antibiotic resistances in C. difficile strains in addition to the fact that the patient is often already weaker, a mortality of 20.7% is found in these patients. The common treatment for C. difficile infections is the use of antibiotics, but in 30% of the cases, the patient develops a recurrent infection. An alternative approach to cure and prevent recurrent C. difficile infections is fecal transplantation. Even though in Germany it is not an approved treatment, in other parts of the world, for example in the USA and even in the neighboring country the Netherlands, this treatment has often been able to successfully treat (recurrent) infections in patients. Even though fecal transplants show to be effective to treat C. difficile infections, there are also issues with fecal transplants. Recently, two patients were infected with an antibiotic-resistant pathogen caused by the fecal transplant, and caused death in one of the patients. Culture-independent approaches like 16S rRNA gene sequencing and shotgun metagenome sequencing have given clues, associations and correlations between specific bacterial phyla or even between distinct bacterial genus and/or the functions of specific bacteria and gastrointestinal infections like C. difficile. Identification, culturing and mechanistic studies of bacteria from the microbiota that prevent C. difficile infections are important and critical for finding new treatments against C. difficile. Recent studies in both humans and mice have shown a correlation between secondary bile acids and C. difficile. Multi-omic approaches have found that a decrease in secondary bile acids correlates positively with the presence of C. difficile. Also in in vitro studies it was found that SBAs were able to inhibit C. difficile germination and growth. However, secondary bile acids are not enough for a complete protection against the pathogen. Specifically, Studer et al. demonstrated that the colonization with Clostridium scindens, a secondary bile acid producer, in a mouse model containing twelve other bacteria in the microbiota was not able to stably protect mice from

C. difficile infections. This finding raises the question if secondary bile acid producing bacteria need assistance from other bacteria, or that the fact that a human-specific bacteria (C. scindens) was chosen instead of a mouse-specific bacteria causes problems with the colonization and subsequently the production of secondary bile acids. This study was performed to get a deeper understanding of the effect of specific members of the microbiota on C. difficile infections and the mechanisms of how the microbiota confers protection against C. difficile. To be able to perform experiments, the first aim was to establish a mouse infection model for C. difficile. Since it is known that the microbiota composition as well as the age as well as the use of antibiotics influences the ability of C. difficile to infect the mice, we characterized these specific parameters. C. difficile uses diverse different molecular machineries and metabolic adaptations to colonize the intestine but they are not yet fully understood. Hence, our second aim was to test different mutants of C. difficile generated within collaboration projects in the newly established in vivo infection model. If these genes, which are mutated, are required for efficient infection, these mechanisms could potentially become targets to treat the infection. The third aim of the thesis was to investigate the effect of specific members of the mouse- microbiota, for example a mouse-specific secondary bile acid producer (SBAP) alone or in combination with other mouse-specific bacterial species, on the ability of C. difficile to colonize and infect mice. Since in the study of Studer et al. the secondary bile acid producer was not able to confer resistance against C. difficile, different bacterial species from the microbiota of healthy and resistant mouse models were isolated. Distinct bacterial growth media and different culture techniques were used to isolate these bacteria. They were chosen based on their function and the presence or absence of secondary bile acid producing genes. The bacteria were used to colonize mice to examine the effect on the ability to generate resistance against C. difficile. All experiments together contribute to our understanding of the functionality of bacteria originating from the microbiota in C. difficile infections and more specifically the functionality of secondary bile acid producing bacteria, secondary bile acids themselves and their inhibitory effect on C. difficile infections. Understanding the functionality of bacteria that confer resistance against C. difficile is important in order to create better treatments for patients and thus decreasing the mortality of patients infected with C. difficile.

2. Materials 2.1. Experimental mouse models

Wild-type C57BL/6N mice were used in this study. Wild-type (WTBL/6-SPF1) mice were bred and maintained at the animal facilities of the Helmholtz Centre for Infection Research (HZI) under enhanced specific pathogen-free conditions (SPF). Wild-type germ-free C57BL/6N mice (WTBL/6-GF mice) were bred in isolators (Getinge) in the germ-free animal facility of the HZI. Wild-type OMM C57BL/6N mice (WTBL/6-OMM mice) were obtained from the isolators from the animal facility of the Medical School Hannover (MHH) or were bred in isolators in the germ- free animal facility of the HZI. When the mice were transferred from MHH, the mice were contained in an airtight container, to prevent contamination of the microbiota. Other used wild- type C57BL/6N mice with different microbiota compositions were purchased from either Janvier Labs (barrier 1A or 10C) (WTBL/6-SPF2A or 2B mice), Harlan Sprague Dawley Inc (barrier 2) (WTBL/6-SPF3 mice) or obtained from the National Cancer Institute (NCI) (WTBL/6-SPF4 mice) and bred under conventional housing conditions at the HZI without rederivation. NLRP6-/- mice were obtained from Yale University and bred under conventional housing conditions at the HZI (N6BL/6). The mice used for experiments were gender and age matched, unless otherwise described.

Table 1: Origin and housing of the different mouse lines and different microbiota

Mouse microbiota Origin Barrier WTBL/6-GF HZI HZI - Isolators WTBL/6-OMM HZI HZI - Isolators WTBL/6-OMM MHH Isolators WTBL/6-SPF1 HZI HZI - SPF WTBL/6-SPF2A Janvier Labs 1A WTBL/6-SPF2B Janvier Labs 10C WTBL/6-SPF3 Harlan 2 WTBL/6-SPF4 NCI HZI - conventional housing N6BL/6-SPF1 HZI HZI - conventional housing

All mice used in the experiment were provided ad libitum with sterilized water and food under a strict 12-hour light cycle. WTBL/6-SPF and N6BL/6 mice were housed in individually ventilated cages (IVC) in groups up to six (female) or five (male) mice per cage. WTBL/6-OMM and WTBL/6-GF mice were kept in airtight ISOcages in groups up to six (female) or five (male) mice per cage, which contain a HEPA-filter, to prevent contamination of the microbiota. During C. difficile infections, all mice were kept in airtight ISOcages, in groups up to six (female) or five (male) mice per cage. Mice were weighed every day after infection, and when below 90% of their bodyweight, mice were weighed two times a day, in accordance with the animal protocol. All animal experiments have been performed with the permission of the local government of Lower Saxony, Germany under the following protocol numbers: “Die Rolle der Darmflora in enterobakteriellen Infektionen des Magen-Darm-Trakts“: 33.9-42502-04-14/1415 and “Charakterisierung der Wechselwirkungen zwischen Clostridium difficile und der Darm- mikrobiota“: 33.19-42502-04-19/3126.

2.2. Bacterial strains

Bacteria used in this study were obtained in multiple ways. Five bacteria were isolated from healthy mice donors. Two bacteria were purchased from the Leibniz-Institute German Collection of Microorganisms and Cell Cultures (Leibniz-Institute DSMZ). When derived from healthy mice donor, the bacteria were directly grown out of cecal and colon samples. When purchased from the DSMZ, the received bacterial strains were freeze dried and revived in the medium that was recommended by the DSMZ. The Clostridioides strain used during this study were the VPI 10463 strain, the 630∆erm and the 630∆erm mutant strains. The VPI strain was obtained from the group of Dr. Matthias Lochner at the Institute for Infection Immunology, Twincore, Centre for Experimental and Clinical Research in Hannover. The Clostridioides difficile 630∆erm strains were obtained from collaboration partners at the Technical University of Braunschweig All bacteria used for microbiotal colonization and infection of WTBL/6-OMM mice are noted in table 2, with additional information about the origin and which medium is used.

Table 2: Bacterial strains used during mice microbiota colonization and infection

Bacteria Phylum Family Origin Medium

Anaerostipes spp. Super Medium (See: Firmicutes Lachnospiraceae WTBL/6-SPF4 nov. table 24 and table 25) Anaerobe basal broth (See: table 11 and Clostridium Firmicutes Clostridiaceae WTBL/6-SPF4 table 12) or Super clostridioforme Medium (see: table 24 and table 25)

Wilkins Chalgren Clostridium DSMZ Anaerobe Broth + Firmicutes Clostridiaceae scindens (Number 5576) Glucose (See: table 28 and table 29) Brain Heart Infusion Clostridioides Peptostrepto- ATCC Firmicutes + Yeast Extract (See: difficile VPI 10463 coccaceae (Number 43255) table 15 and table 16) Brain Heart Infusion Clostridioides Peptostrepto- DSMZ Firmicutes + Yeast Extract (See: difficile 630∆erm coccaceae (number 28645) table 15 and table 16) Clostridioides Brain Heart Infusion Peptostrepto- difficile Firmicutes Ünal et al.244 + Yeast Extract (See: coccaceae 630∆erm∆prsA2 table 15 and table 16) Clostridioides Brain Heart Infusion Peptostrepto- difficile Firmicutes TU Braunschweig + Yeast Extract (See: coccaceae 630∆erm∆rnfC table 15 and table 16) Clostridioides Brain Heart Infusion difficile Peptostrepto- Firmicutes TU Braunschweig + Yeast Extract (See: 630∆erm∆rnfC coccaceae table 15 and table 16) +prnfC

Mucus Medium (See: Duncaniella muris Bacteroidetes Muribaculaceae N6BL/6 table 22 and table 23) Lennox and Miller Enterobacteria- bacterial culture Escherichia coli Proteobacteria WTBL/6-SPF2A ceae medium (See: table 20 and table 21) Wilkins-Chalgren DSMZ Extibacter muris Firmicutes Lachnospiraceae Anaerobe Broth (See: (Number 28561) table 26 and table 27) Clostridia Anaerobe basal broth (class), is not (See: table 11 and Intestinimonas DSMZ Firmicutes assigned to an table 12) or Mucus butyriciproducens (Number 26097) order or family Medium (See: table yet. 22 and table 23) De Man, Rogosa and Sharpe agar (See: Lactobacillus table 19) or Brain Firmicutes Lactobacillaceae WTBL/6-SPF3 murinus Heart Infusion medium (See: table 13 and table 14)

2.3. Reagents

2.3.1. Primers Different primers were used in this study. Most of these primers were used to identify specific bacteria (E_muris_SpPr, C_scindens_SpPr, D_muris_SpPr, Dorea_Bai_SpPr and Anaerostipes_SpPr), or to identify bacteria in general (16S_SangerSeq or the 16S_V4seq primers) (Figure 1). One primer set, the Bai_CD primers, was solely used for qPCR to measure the abundance of the bacterial secondary bile producing gene in samples. Table 3 contains a list of all the primers used in this study. The 16S_SangerSeq primers were also used for qPCR, to normalize the results obtained from the Bai_CD qPCR.

Table 3: List of PCR and qPCR primers used in this study

Oligonucleotide Sequence Annealing temperature (ºC) 16S_V4Seq 515F: 5’GTGCCAGCMGCCGCGGTAA 55 806R: 5’GGACTACHVGGGTWTCTAAT 16S_SangerSeq 27F: 5´AGAGTTTGATCMTGGCTCAG 55-61 1492R :5´TACGGYTACCTTGTTACGACTT E_muris_SpPr 246F: 5’GTAGTTGGTGCGGTAACGGCGC 67 1016R: 5’TCCGCTGCCCCGAAGGGAACA C_scindens_SpPr 212F: 5’GGCGGCCAAAGCCCCGGC 64 651R: 5’CTCTCCGACACTCCAGCCACG Bai_CD F: 5’GGMTTTGAYGCRSTIGARTT 60 R: 5’ CRACICCSAYWACMGGDAT D_muris_SpPr 151F: 5’ATGCAAGTCGAGGGGCAKCGG 67 634R: 5’CACGGAGTTAGCCGATGCTTTTTCT Dorea_Bai_SpPr 247F: 5’TGTCAGGAGCGCTTGTGACAAGC 63 828R: 5’GGCGTATGCCCCATGTGCATGC Anaerostipes_SpPr 618F: 5’TGTAAAGGGTGCGTAGGTGGCATGGT 65 1144R: 5’GACAACCATGCACCACCTGTCTTAACTGT

2.3.2. Chemicals and commercial assays For the preparation of bacterial growth media and buffers, different chemicals were used in this study. Table 4 is a list of all chemicals used in the experiments in alphabetical order and the vendor where the chemicals were purchased from. Commercial assays were used to perform ELISAs, to purify DNA samples or to perform PCRs and qPCRs. Table 5 contains a list of assays used and the vendor where the assays were purchased from.

Table 4: List of chemicals used in this study

2-Propanol Avantor Performance Materials α-Lipoic Acid Sigma Aldrich Aluminum potassium sulfate dodecahydrate Sigma Aldrich (AlK(SO4)2 x12H2O) Anaerobe basal broth (ABB) Oxoid Bacto Agar BioLegend Biotin Sigma Aldrich

Boric acid (H3BO3) Sigma Aldrich Brain Heart Infusion Broth (BHI) Oxoid Brain Heart Infusion Broth (BHI) Sigma Aldrich

Calcium chloride (CaCl2 x2H2O) Carl Roth Clindamycin hypochloride Sigma Aldrich

Cobalt(II) nitrate hexahydrate (Co(NO3)2) Sigma Aldrich

Copper(II) sulfate pentahydrate (CuSO4 x5H2O) Sigma Aldrich De Man, Rogosa and Sharpe agar (MRS agar) Oxoid D-Panthothen acid hemicalcium salt Sigma Aldrich Ethanol Avantor Performance Materials Ethylenediaminetetraacetic acid disodium salt Carl Roth dihydrate (EDTA) Fetal Bovine Serum Sigma Aldrich Folic Acid Sigma Aldrich Glycerol Carl Roth

Iron(II) sulfate heptahydrate (FeSO4) Sigma Aldrich LB broth (Lennox) Powder Sigma Aldrich LB broth with agar (Miller) Powder Sigma Aldrich L-Cysteine Carl Roth

Magnesium chloride (MgCl2) Carl Roth

Magnesium sulfate heptahydrate (MgSO4 x 7H2O) Sigma Aldrich

Manganese sulfate monohydrate (MnSO4 x H2O) Sigma Aldrich

MEM non Essential Amino Acids Biowest Menadione crystalline Sigma Aldrich NaOH Sigma Aldrich

Nickel(II) chloride hexahydrate (NiCl2 x6H2O) Sigma Aldrich Nicotinic Acid Sigma Aldrich P-Aminobenzoic acid Sigma Aldrich Pipemidic acid Sigma Aldrich Polymerase Q5 High-Fidelity NEB Polymerase TSG BioBasic Polymyxin B sulfate salt Sigma Aldrich Pyridoxine hydrochloride Sigma Aldrich Riboflavin Sigma Aldrich Rnase AppliChem Roti-Phenol/Chloroform/Isoamyl alcohol Carl Roth Sheep blood (defibrinated) Thermo Fisher Scientific Sodium Acetate solution (3 M, pH 5.2) Panreac Applichem

Sodium carbonate (Na2CO3) Merck Sodium Chloride (NaCl) Carl Roth

Sodium molybdate (Na2MoO4) Sigma Aldrich

Sodium selenite (Na2SeO3) Sigma Aldrich

Sodium tungstate dihydrate (Na2WO4 x2H2O) Sigma Aldrich Taurocholate acid Carl Roth TE Buffer (1x) pH 8.0 Panreac AppliChem Thiamine Hydrochlorid Sigma Aldrich Thioglycollate Medium BD Bioscience Vitamin B-12 Sigma Aldrich Wilkins-Chalgren Anaerobe Broth (WCAB) Thermo Scientific Yeast Extract Sigma Aldrich

Zinc sulfate heptahydrate (ZnSO4 x7H2O) Sigma Aldrich

Table 5: Commercial assays used in this study

Commercial Kits Source Lipocalin-2 ELISA R&D systems NEBNext Ultra DNA library Kit New England Biolabs Spin Column PCR Product Purification Kit BioBasic Toxin A/B ELISA Antibodies-Online TSG polymerase kit BioBasic 5x HOT FIREPol EvaGreen qPCR Mix Plus (no ROX) Solis Biodyne

2.4. Buffers and solutions

In this study, multiple buffers and solutions were used. Table 6 shows the recipe for Buffer A, that was used during DNA isolation. Table 7 contains the recipe for 10x phosphate buffered saline, which is an isotonic water-based salt solution buffer. Table 8 and table 9 show the recipes of the trace mineral supplement mixture and wolves vitamin solution mixture. These two mixtures are important ingredients in specific bacterial growth media. The recipe for the ELISA washing buffer is described in table 10. The washing buffer is important to remove any left-overs of the samples that could interfere with the ELISA signal.

Table 6: Recipe for Buffer A (for DNA isolation)

Component Mass Final concentration NaCl 11.6 g 200 mM Tris 24.2 g 200 mM EDTA-diNa 7.4 g 20 mM

Add up to 1 L with dH2O and set the pH to 8. Filter sterilize it before use.

Table 7: Recipe for 10 x phosphate buffered saline (PBS)

Component Mass NaCl 80 g KCl 2 g

Na2PO4 14.4 g

KH2PO4 2.4 g

Dissolve in 1 L of dH2O and set the pH to 7.4. Autoclave at 121fºC for 15 minutes. To make a

1 x PBS, dilute 100 mL of 10 x PBS in 900 mL of dH2O. Autoclave at 121fºC for 15 minutes.

Table 8: Trace Mineral Supplement Mixture

Number Substance Concentration (mg/mL)

1 EDTA x 2Na x 2H2O 63,69

2 MgSO4 x 7H2O 300

3 MnSO4 x H2O 50 4 NaCl 100

5 FeSO4 10

6 Co(NO3)2 10

7 CaCl x2H2O 13,25

8 ZnSO4 x7H2O 10

9 CuSO4 x5H2O 100

10 AlK(SO4)2 x12H2O 183

11 H3BO3 25

12 Na2MoO4 100

13 Na2SeO3 10

14 Na2WO4 x4H2O 100

15 NiCl2 x6H2O 200

The substances were all dissolved in 1mL of dH2O. To prepare the Trace Mineral Supplement Mixture, 1 mL of number 1-8 was used, for number 9, 10 and 12-15, 10 µL was added and for number 11, 25 µL. The mixture was filled up to 100 mL with dH2O.

Table 9: Wolves Vitamin solution mixture

Number Substance Amount (mg/mL) Solvent 1 Folic acid 2 1 M NaOH

2 Pyridoxine hydrochloride 10 dH2O 3 Riboflavin 5 0,1 M NaOH 4 Biotin 2 EtOH

5 Thiamine hydrochloride 5 dH2O 6 Nicotinic acid 5 1 M NaOh

7 D-Panthothen acid hemicalcium salt 5 dH2O

8 Vitamin B12 0.1 dH2O 9 P-Aminobenzoic acid 5 EtOH 10 α-Lipoic acid 5 EtOH All substances, when prepared, should be separately frozen at -80fºC. The mixture contains 100fµL of all substances, except for number 4, from which 1 mL is needed for the mixture. The mixture is made by dissolving 90 mg of KH2PO4 in 50 mL dH2O, adding the vitamins to it, and filling the mixture up to 100 mL dH2O. Freeze the mixtures at -20fºC.

Table 10: Recipe for ELISA washing buffer

Component Volume Final concentration PBS 1000 mL n/a Tween 20 500 µL 0.05% (w/v)

2.5. Bacterial media and agar recipes

For this study, numerous bacterial growth media were used to isolate and culture different bacteria. In the following chapter, these media are listed and the recipes are described.

Table 11: Recipe for Anaerobe basal broth (liquid)

Component Mass Anaerobe basal broth 35,4 g

Add the powder to 1 L of dH2O. Heat up until the powder is dissolved into the water. Afterwards, autoclave for 15 minutes at 121fºC.

Table 12: Recipe for Anaerobe basal broth (agar)

Component Mass Bacto Agar 18 g

Add 500 mL dH2O, and autoclave for 15 minutes at 121fºC, let it cool down to 60fºC Anaerobe basal broth 35,4 g

Add the powder to 500 mL of dH2O. Heat up until the powder is dissolved. Afterwards, autoclave for 15 minutes at 121fºC. Add the agar and broth together, pour 25 mL per petri dish.

Table 13: Recipe for BHI medium (liquid)

Component Mass Final concentration BHI 37 g n/a Cystein 0.5 g 0.5 g/L

Add together, add up to 1 L with dH2O and filter sterilize the mixture.

Table 14: Recipe for BHI medium (agar)

Component Mass Final concentration Bacto Agar 18 g n/a

Add 500 mL dH2O, and autoclave for 15 minutes at 121fºC, let it cool down to 60fºC BHI 37 g n/a Cystein 0.5 g 0.5 g/L

Add the BHI and cysteine together, add up with dH2O to 500 mL and filter sterilize the mixture. Afterwards add the filtered mixture to the autoclaved Bacto Agar and add 25 mL per petri dish.

Table 15: Recipe for BHIS medium (liquid)

Component Mass Final concentration BHI 37 g n/a Cystein 0.5 g 0.5 g/L Yeast extract 5 g n/a

Add together, add up to 1 L dH2O and autoclave the mixture for 15 minutes at 121fºC.

Table 16: Recipe for BHIS medium (agar)

Component Mass Final concentration Bacto Agar 18 g n/a

Add 500 mL dH2O, and autoclave for 15 minutes at 121fºC, let it cool down to 60fºC BHI 37 g n/a Cystein 0.5 g 0.5 g/L Yeast extract 5 g n/a

Add together, add up with dH2O to 500 mL and autoclave the mixture for 15 minutes at 121fºC. Afterwards, add the agar to the BHI mixture and pour 25 mL per petri dish.

Table 17: Recipe for BHIST medium (liquid)

Component Mass Final concentration BHI 37 g n/a Cystein 0.5 g 0.5 g/L Yeast extract 5 g n/a

Add together, add 950 mL dH2O and autoclave the mixture for 15 minutes at 121fºC. Taurocholate 1 g 0.1%

Add to 50 mL dH2O and filter sterilize it. Let the autoclaved part cool down to at least 60fºC and add the two parts together.

Table 18: Recipe for BHIST medium (agar)

Component Mass Final concentration Bacto Agar 18 g n/a

Add 500 mL dH2O, and autoclave for 15 minutes at 121fºC, let it cool down to 60fºC BHI 37 g n/a Cystein 0.5 g 0.5 g/L Yeast extract 5 g n/a

Add together, add 450 mL dH2O and autoclave the mixture for 15 minutes at 121fºC. Let the autoclaved part cool down to at least 60fºC Taurocholate 1 g 0.1%

Add to 50 mL dH2O and filter sterilize it. and add the two parts together. Add the three parts together and pour 25 mL per petri dish.

Table 19: Recipe for de Man, Rogosa and Sharpe (agar)

Component Mass De Man, Rogosa and Sharpe agar 62 g

Add the powder to 1 L of dH2O. Mix until the powder is completely dissolved into the water. Afterwards, autoclave for 15 minutes at 121fºC. Add the agar and broth together, pour 25 mL per petri dish.

Table 20: Recipe for LB broth (Lennox) medium (liquid)

Component Mass LB Broth (Lennox) Powder 20 g

Add the powder to 1 L of dH2O. Mix until the powder is completely dissolved in the water. Afterwards, autoclave for 15 minutes at 121fºC.

Table 21: Recipe for LB broth with agar (Miller) medium (agar)

Component Mass LB Broth with agar (Miller) Powder 40 g

Add the powder to 1 L of dH2O. Mix until the powder is completely dissolved in the water. Afterwards, autoclave for 15 minutes at 121fºC. Add the agar and broth together, pour 25 mL per petri dish.

Table 22: Recipe for Mucus medium (liquid)

Component Stock Volume/mass Final concentration Brain Heart Infusion n/a 18.5 g n/a Trypticase soy broth n/a 15 g n/a Yeast extract n/a 5 g n/a

K2HPO4 n/a 2.5 g 2.5 g/L

Add 500 mL dH2O, and autoclave for 15 minutes at 121fºC, let it cool down to 60fºC Hemin 1000x 1 mL 1 mg/L Glucose n/a 0.5 g 0.5 g/L

Na2CO3 100x 10 mL 0.4 g/L Cystein n/a 0.5 g 0.5 g/L Menadione crystalline n/a 0.5 g 0.5 g/L FBS n/a 30 mL 3%

Add together, add up with dH2O to 490 mL and filter sterilize the mixture. Cover it from the light, because menadione is light-sensitive. Mucin 100x 10 mL 0.025% Autoclave the mucin two times for 15 minutes at 121fºC, let it cool down to 60fºC. Afterwards, add the autoclaved mixture and mucin to the filter sterilized mixture. Cover it from the light. * FBS needs to be complement inactivated for 30 minutes at 56fºC, store at -20fºC

$ Na2CO3 (100x) Dilute 0.8 g in 20 mL dH2O, store at room temperature # Hemin (1000x) Dilute 10 mg in 10 mL Ethanol, add 10 M NaOH solution until hemin dissolves, store at -20fºC

Table 23: Recipe for Mucus medium (agar)

Component Stock Volume/mass Final concentration Bacto Agar n/a 18 g n/a

Add 500 mL dH2O, and autoclave for 15 minutes at 121fºC, let it cool down to 60fºC Brain Heart Infusion n/a 18.5 g n/a Trypticase soy broth n/a 15 g n/a Yeast extract n/a 5 g n/a

K2HPO4 n/a 2.5 g 2.5 g/L

Add 250 mL dH2O, and autoclave for 15 minutes at 121fºC, let it cool down to 60fºC Hemin# 1000x 1 mL 1 mg/L Glucose n/a 0.5 g 0.5 g/L $ Na2CO3 100x 10 mL 0.4 g/L Cystein n/a 0.5 g 0.5 g/L Menadione crystalline n/a 0.5 g 0.5 g/L FBS* n/a 30 mL 3%

Add together, add up with dH2O to 240 mL and filter sterilize the mixture. Cover it from the light. Mucin 100x 10 mL 0.025% Autoclave the mucin two times for 15 minutes at 121fºC, let it cool down to 60fºC. Afterwards, add the autoclaved mixture and mucin to the filter sterilized mixture. Cover it from the light. Add the autoclaved agar, to the mixture and pour 25 mL per petri dish. Keep it covered from light. * FBS needs to be complement inactivated for 30 minutes at 56fºC, store at -20fºC

$ Na2CO3 (100x) Dilute 0.8 g in 20 mL dH2O, store at room temperature # Hemin (1000x) Dilute 10 mg in 10 mL Ethanol, add 10 M NaOH solution until hemin dissolves, store at -20fºC

Table 24: Recipe for Super Medium (liquid)

Component Stock Volume/mass Final concentration BHI n/a 37 g n/a Cystein n/a 0.5 g 0.5 g/L Wolves Vitamin Solution n/a 10 mL 10 mL/L Trace Mineral Supplement Mix n/a 10 mL 10 mL/L MEM non Essential Amino Acids 100x 10 mL 1x Menadione crystalline 0.5 g/L 1 mL 0.5 mg/L FBS n/a 100 mL 10%

Combine the ingredients, add up with dH2O to 1 L and filter sterilize the mixture. Cover it from the light, because the vitamins are light-sensitive.

Table 25: Recipe for Super Medium (agar)

Component Stock Volume/mass Final concentration Bacto Agar n/a 18 g n/a

Add 500 mL dH2O, and autoclave for 15 minutes at 121fºC, let it cool down to 60fºC BHI n/a 37 g n/a Cystein n/a 0.5 g 0.5 g/L Wolves Vitamin Solution n/a 10 mL 10 mL/L Trace Mineral Supplement Mix n/a 10 mL 10 mL/L MEM non Essential Amino Acids 100x 10 mL 1x Menadione crystalline 0.5 g/L 0.5 g 0.5 mg/L

Add together, add up with dH2O to 450 mL and filter sterilize the mixture. Cover it from the light. Sheep blood n/a 50 mL 5% Add the blood, the agar and the mixture together; pour 25 mL per petri dish. Cover it from the light.

Table 26: Recipe for WCAB medium (liquid)

Component Mass Wilkins-Chalgren Anaerobe broth 33 g

Add the powder to 1 L of dH2O. Heat up until the powder is dissolved in the water. Afterwards, autoclave for 15 m at 121fºC.

Table 27: Recipe for WCAB medium (agar)

Component Mass Bacto Agar 18 g

Add 500 mL dH2O, and autoclave for 15 minutes at 121fºC, let it cool down to 60fºC Wilkins-Chalgren Anaerobe broth 33 g

Add the powder to 500 mL of dH2O. Heat up until the powder is dissolved in the water. Afterwards, autoclave for 15 minutes at 121fºC. Combine the agar and broth and pour 25 mL per petri dish.

Table 28: Recipe for WCAB medium with glucose (liquid)

Component Mass Final concentration Wilkins-Chalgren Anaerobe broth 33 g n/a

Add the powder to 950 mL of dH2O. Heat up until the powder is dissolved into the water. Afterwards, autoclave for 15 minutes at 121fºC. D-glucose 10 g 10 g/L

Dissolve the glucose in 50 mL of dH2O and filter sterilize it. Add it to the autoclaved WCAB medium.

Table 29: Recipe for WCAB medium with glucose (agar)

Component Mass Final concentration Bacto Agar 18 g n/a

Add 500 mL dH2O, and autoclave for 15 minutes at 121fºC, let it cool down to 60fºC Wilkins-Chalgren Anaerobe broth 33 g n/a

Add the powder to 450 mL of dH2O. Heat up until the powder is dissolved into the water. Afterwards, autoclave for 15 minutes at 121fºC. D-glucose 10 g 10 g/L

Dissolve the glucose in 50 mL of dH2O and filter sterilize it. Add it to the autoclaved WCAB medium. Combine the agar, glucose and broth and pour 25 mL per petri dish.

2.6. Equipment

Table 30: List of equipment used in this study

Equipment Source Anaerobic Chamber Coy Laboratory Anaerobic Jar 2.5 L Oxoid Anaerobic Jar 3.5 L Oxoid BioPhotometer Plus Eppendorf Cam12 Coy Laboratory Catalyst box S/N Coy Laboratory Centrifuge 5424R Eppendorf Centrifuge 5430 R Eppendorf Crimper n.a. Decapper n.a. FlexCycler2 Analytik Jena Heratherm incubator Thermo Fisher Scientific Light cycler 480 Instrument Roche Diagnostics Mini-Beadbeater-96 Bio Spec

Model 2000 Incubator Coy Laboratory MS2 minishaker IKA works Multitron incubator Infors HT NanoDrop 1000 Spectrophotometer Thermo Fisher Scientific PeqTWIST vortex VWR Polytron PT 2500E Kinematica Safe 2020 Class II Biological Safety Cabinets Thermo Fisher Scientific Savant DNA SpeedVac Thermo Fisher Scientific Systec VX-65 Systec-Lab Thermo Mixer comfort Eppendorf Tuttnauer 5850 Systec-Lab

2.7. Materials

Table 31: List of materials used in this study

Material Vendor Anaerobic Gas Mix Lindt AnaeroGen 2.5L Thermo Scientific AnaeroGen 3.5L Thermo Scientific Anaerotest Merck Clostridium difficile agar plates (CLO-plates) BioMerieux Glass vials for glycerolstock n.a.

2.8. Software and algorithms

Table 32: List of software and algorithms used in this study

FastTree Price Geneious Prime 2019 Graphpad Prism v 7.0 Graphpad Prism v 8.0 Greengenes reference database LEfSe Mega6 NCBI Basic Local Alignment Search Tool (BLAST) OUT picking with UCLUST Phyloseq Quantitative insights into microbial Ecology (QIIME) v 1.8.0 R statistical programming environment; R version 3.3.0 (2016-05-03) Ribosomal Database Project (RDP) classifier Silva Ref NR database

3. Methods 3.1. Culturing Clostridioides difficile

3.1.1. Culturing Clostridioides difficile from spores C. difficile is able to produce robust spores that are able to survive in a, for vegetative cells, hazardous environment for a long lasting time period. To generate a proliferating culture from spores, 1000 spores were added to 5fmL BHIST medium in a 15 mL Falcon tube (see: table 16). The supplemented TCA, a primary bile acid, is important since it promotes to germination of spores and the ability to grow out. After the spores were added to the medium, the Falcon tubes were placed into an anaerobic jar with the lids not completely closed, to ensure air exchange. Afterwards an AnaeroGen 3.5fL sachet was added to the jar. AnaeroGen sachets convert the aerobic atmosphere to an anaerobic atmosphere. The anaerobic sachet reduces the oxygen in the atmosphere to <1% within one hour and <0.1% after 2.5 hours and retains a CO2 level of 7-15% within twenty-four hours. To be certain that the AnaeroGen sachet works correctly, it has to be added to the jar or box within one minute after opening the package. The jar was transferred into a 37fºC incubator and incubated for twenty-four hours. Additionally, germination was also performed on BHIST agar plates (see: table 17). 1000 spores were streaked out on agar plates containing taurocholate and placed into anaerobic jars containing AnaeroGen 3.5fL sachets. The plates were incubated for three days at 37fºC.

3.1.2. Culturing Clostridioides difficile from a glycerol stock C. difficile glycerol stocks are stored at -80fºC. To recover a culture from the glycerol stock, 500 µL of C. difficile in 15% glycerol were added to 5 mL BHIST medium (see table 16) in a 15 mL Falcon tube. The Falcon tubes were placed into an anaerobic jar with the lids not completely closed and an AnaeroGen 3.5 L sachet was added to the jar. The jar was transferred into a 37fºC incubator and incubated for twenty-four hours. Additionally, reviving C. difficile from glycerol stocks was also performed on BHIST agar plates (see: table 17) by adding 500 µL of the glycerol stock onto agar plates. The plates were placed into anaerobic jars containing AnaeroGen 3.5 L sachets and incubated anaerobically at 37fºC for 48-72 hours.

3.1.3. Culturing Clostridioides difficile from live cultures/colonies Picking colonies from agar plates and passaging of cultures were performed aerobically. In case of an agar plate, one colony was picked and added to a 15fmL Falcon tube containing 5fmL BHIS medium (see: table 14). In case of passaging liquid cultures, 250fµL of bacterial culture were added to a Falcon tube containing 5fmL BHIS. The tubes were placed into the anaerobic jar containing a AnaeroGen 3.5L sachet and incubated for twenty-four hours at 37fºC.

3.1.4. Culturing Clostridioides difficile from feces samples Fecal samples were collected and processed within two hours after acquiring. 1 mL of PBS was added to the samples together with 100fµg of 1 mm beads. The samples were bead-beated two times for twenty seconds with a two minute break in between. After bead-beating, a ten-fold dilution series was prepared up to seven dilutions with PBS, and afterwards were plated on C. difficile Agar Plates (CLO agar plates), which were purchased at BioMerieux. These plates contain specific antibiotics, namely 100fµg/mL cycloserine, 8fµg/mL cefoxitin and 2fµg/mL amphotericin B, however, they do not contain any taurocholate. To grow C. difficile spores, 0.1% of taurocholate was added to the CLO plates and pre-reduced for two days in the anaerobic chamber. After streaking out the samples, the plates were placed in an anaerobic jar containing an AnaeroGen sachet 3.5fL and incubated at 37fºC for three days.

3.1.5. Production of spores The protocol used for production of spores is loosely based on the protocol of Edwards et al.306 The biggest difference is the washing step with aerobic 1x PBS, in addition to the use of BHIS medium for sporulation. A fresh, C. difficile liquid culture, which was cultured for twenty-four hours anaerobically at 37fºC, was spinned down at 3000xfG for ten minutes. The pellet was washed by aerobic 1x PBS and spinned down again. This process was repeated and the OD600 was adjusted to 0.2 by adding aerobic PBS. 1 mL was added to a BHIS agar plate (See: table 15) and placed into an anaerobic jar containing an AnaeroGen 3.5L sachet. Afterwards the plates were incubated at 37fºC for seven days to stimulate sporulation. After seven days, the plates were removed and the cells were collected using an inoculation loop in 2 mL of 1x PBS. The cells were then heated for twenty minutes at 65fºC to inactivate and kill the vegetative cells. To count the amount of spores collected,

51 a ten-fold dilution series was prepared up to seven dilutions. The dilution series was produced by adding 25fµL to 225fµL of 1x PBS. 25fµL of these dilutions were plated on BHIS and BHIST agar plates (see table 15 and table 17). The plates were incubated anaerobically at 37fºC for 3 days. On the BHIS plates, the amount of residual vegetative cells were counted, while on the BHIST plates, the spores were counted. When the amount of residual vegetative cells was more than 2.5% of the total spores, the samples were heated again for twenty minutes at 65fºC and the process was repeated. When the residual vegetative cells were below 2.5% of the total spores, the spore stock was diluted with 1x PBS to 1000 spores per µL.

3.1.6. Storage of Clostridioides difficile C. difficile spores were stored at 4fºC, aerobically, in 1x PBS, at a concentration of 1000 spores per µL. Over a time period of four years, the same spore stock was able to be used, although the amount of spores that were able to germinate decreased over time to 300 spores per µL Another way of storing C. difficile is by producing glycerol stocks from a fresh culture. C. difficile was cultured anaerobically for twenty-four hours at 37fºC in 5fmL BHIS and afterwards the culture was spinned down at 3000x G for 10 minutes. The pellet was resuspended in 500 µL BHIS and added to a 500 µL 30% glycerol in BHIS medium. The samples were immediately placed on dry ice and subsequently stored at -80fºC.

3.2. Anaerobic culturing and isolating of bacteria

3.2.1. Anaerobic atmosphere Apart from C. difficile, all other anaerobic culturing was performed in the anaerobic chamber The atmosphere in the anaerobic chamber is a mixture of 70% nitrogen, 20% CO2 and 10% hydrogen. All materials and media that were used during anaerobic culturing were pre-reduced to anaerobic conditions in the anaerobic chamber two days before usage. The anaerobic chamber, purchased by Coy laboratories contains an airlock to transfer materials in and out of the chamber. The airlock exchanged the aerobic air by performing two cycles with nitrogen followed by one cycle of the gas mixture.

3.2.2. Isolation and storage of bacteria Mice with different SPF microbiota compositions were sacrificed and the colonic and cecal content were collected in BBL thioglycolate liquid medium. The content was weighed and transferred into the anaerobic chamber. To homogenize the sample, it was first vortexed and then filtered through a 70fµm sterile filter to remove the larger particles and undigested food. Afterwards it was diluted to a concentration of 40fmg of feces per 1fmL of medium. Two techniques were used to isolate the bacteria: spreading the mixture on agar plates or by using the most probable number (MPN) technique.307 Figure 5 describes the culture techniques used in this study. After diluting the mixtures (ten-fold dilution series from 10-2 till 10-5) were spread on the agar plates, and subsequently were incubated for two to four days at 37fºC in the anaerobic chamber. Different bacterial growth media was used during culturing, namely SM, ABB, Mucus medium, MRS medium and BHI medium. After incubation, colonies displaying different phenotypes (size, color, form) were picked, streaked out on a new plate, and incubated again in the anaerobic chamber for two to four days. To verify that the bacterial cultures were not contaminated, the process of picking and streaking out on a new plate was performed three times before culturing in a 5 mL liquid culture. 10fµL from these 5fmL cultures were taken out to use for PCR. The MPN technique works differently. The homogenized content was diluted via a ten- fold dilution series, and the dilutions were cultured in 200fµL per well in a 96-well plate. The media used were SM, ABB, Mucus medium and BHI medium. 96-well plates containing bacterial cultures in 30% of the wells were chosen for the continuation of culturing. The dilutions showing detectable growth were most often found in the plates containing dilutions 10-6 – 10-8. The 96-well plates were incubated for two days at 37fºC and afterwards 10fµL was taken out for PCR. The visible cultures were then transferred onto agar plates, corresponding to the used medium, and incubated for another two-four days. The same technique as mentioned in the section before was used to verify that the bacteria were not contaminated: a bacterial colony was passaged to a new plate three times before culturing in a 5fmL liquid culture. After 3 passages on agar plate, and growth in a liquid culture, the bacteria were 1:1 diluted with a 40% glycerol mixture to store them for a longer period of time. 500 µL of culture were added to a glass vial containing 500fµL of 40% glycerol/100% BHI medium and immediately transferred into the -80fºC freezer.

Figure 5: Schematic layout of the culturing techniques.

(A) After sacrificing a mice and (B) collecting the intestinal content, the samples were transferred into the anaerobic chamber where they were homogenized and (C) diluted. By spreading the dilutions on (D) agar plates or in (E) liquid medium with the MPN technique, different bacteria were able to be isolated.

3.2.3. Identification of the bacteria 10fµL of the growing cultures were taken out of the anaerobic chamber, and used for 16S rRNA gene PCR. 1 µL of the cultures was directly pipetted into the PCR reaction mix (see: table 32). The 16S rRNA gene specific primers 16S_27F and 16S_1492R were used to amplify the 16S rRNA gene region (see: table 3). The duplication part of the PCR program is performed in two steps. The first step has 11 cycles and will decrease the annealing temperature from 61fºC to 55 ºC, while in the second step consists of 26 cycles with an annealing temperature of 55fºC (see: table 33). After performing the 16S rRNA gene PCR, the DNA was purified by using the Spin Colum PCR Product Purification Kit from BioBasic. The kit uses multiple buffers: Buffer B3, Wash Buffer and Elution Buffer. Buffer B3 was diluted in a 4:1 ratio with isopropanol. To the Wash Buffer, EtOH was added in a ratio of 1:4 (buffer:EtOH).

Table 33: PCR reaction mix for 16S rRNA gene amplification Component Volume (µL) Final concentration PCR buffer (10x) 5 1x

MgSO4 5 1x dNTPs 1 200 µM Forward Primer (16S_27F) 1 200 µM Reverse Primer (16S_1492R) 1 200 µM Taq Polymerase 0.2 1U/50 µL Water 35.8 N/A Culture 1 N/A Instead of isolating the DNA before the PCR reaction, 1 µL of culture is added directly to the PCR reaction mix.

Table 34: PCR program used for 16S rRNA gene replication Step Temperature (ºC) Time (s) Number of cycles Initial denaturation 95 120 1 Denaturation 95 20 Annealing 61 – 55 20 11 Extension 72 60 Denaturation 94 20 Annealing 55 20 26 Extension 72 60 Final extension 72 300 1

In the first denaturation – annealing – extension cycle, the annealing temperature decreases from 61fºC

to 55fºC in 11 cycles. In the second cycle, the annealing temperature stays at 55fºC for 26 cycles.

To purify the PCR product, 125 µL of Buffer B3 were added to the PCR reaction mixture. The mixture was transferred to the EZ-10 column and incubated for two minutes at room temperature. Afterwards it was centrifuged at 10,000 rpm for two minutes. 600 µL of Wash

Solution were added to the column afterwards and again centrifuged for two minutes. The flow- through was removed and the washing step was repeated. After removing the flow-through, the column was centrifuged again for one minute so that all residual Wash Solution was removed. The column was then transferred to a 1.5 mL microfuge tube and 30 µL of Elution Buffer were added and the sample was incubated again for two minutes at room temperature. As the last step, the samples were centrifuged a last time for two minutes. The DNA concentration and purity were measured afterwards, and the samples were send for Sanger Sequencing to the in-house sequence facility called the Genome Analytics Group (GMAK). After receiving the sequences, they were reviewed on their quality. If the HQ was above 30%, the bacterial cultures were considered to be consisting of one single bacterial species, below they were marked as contaminated. When this occurred, the cultures needed to be recultured and passaged again for three times to ensure the culture consisted of one single bacterial strain. The sequences above 30% HQ were inserted in the NCBI BLAST tool, to identify the bacterial species and to examine if the bacterial species were a newly found ones or if it was an isolate/strain of an previously isolated bacterial species.

3.2.4. Whole genome sequencing of bacteria Sequencing of bacteria DNA was performed in the Genome Analytics Platform at Helmholtz Center for Infection Research using the NEBNext Ultra DNA library prep kit (New England Biolabs). The library preparation was performed according to the manufacturer's instructions. Read of demultiplexed libraries were assembled with SPAdes to draft genomes and annotated using prokka.308,309

3.3. Microbiota manipulation

3.3.1. Antibiotics treatment The microbiota can be easily manipulated by using antibiotics. Since antibiotics target different specific bacteria and kill or inhibit the growth of these bacteria, the microbiota will be altered after the treatment. In this study, 10fmg/kg clindamycin is injected intraperitoneal (IP) to manipulate the microbiota of mice with an SPF microbiota. Clindamycin increases the risk of C. difficile infections since it targets distinct anaerobic bacteria generating the colonization resistance.

Additionally, clindamycin resistance is commonly found in C. difficile strains.310 Other antibiotics may affect the microbiota differently, by targeting other bacterial species, but all antibiotics have an effect on the microbiota.

3.3.2. Cohousing of mice and fecal transplantation Another technique to manipulate the microbiota is by cohousing mice with different microbiota. In this study, cohousing was performed between female WTBL/6-GF and WTBL/6-OMM mice. By cohousing, mice of the two different origins were added together in the same cage. Since mice are coprophages, they consume each other’s fecal matter and thus obtaining each other’s microbiotal bacteria. Mice were cohoused for three weeks before used for experiments. Male mice are not able to be cohoused, since they become aggressive towards mice that originate from other cages. To manipulate the microbiota from male mice, a fecal transplant was performed from WTBL/6-OMM to WTBL/6-GF mice. To make sure no contaminations would occur, the following protocol was performed completely in a clean bench. A fecal transplant is produced by sacrificing WTBL/6-OMM mice and collecting the intestinal content of the small intestine, cecum and colon. The intestinal content was added together in BBL thioglycolate liquid medium. To homogenize the sample, the sample was first vortexed and then filtered through a 70fµm sterile filter, to remove the larger particles and undigested food. After filtering, the solution was immediately used as FT. By using stainless steel feeding needles, also called gavage needles, WTBL/6-GF mice were gavaged with 200fµL of the fecal transplant. One week later, the process was repeated by providing a second fecal transplant. Three weeks after the first transplant, mice were ready to be used for experiments.

3.3.3. Colonization of single bacteria or consortia For every experiment, fresh cultures were grown anaerobically for twenty-four hours at 37fºC in the anaerobic chamber (70% N2, 20% CO2 and 10% H2) from a frozen glycerol stock in the appropriate media (see: table 2). All mice were colonized at an age of twenty to twenty-two weeks with 200fµL of a single bacterial culture or a mixture of bacterial cultures via oral gavage (see: table 34). The overnight cultures were used directly without measuring for the OD600. One week after colonization, mice were used for infection.

Table 35: The different bacterial groups used during this study

Consortium Consortium + SBAP SBAP group 1 SBAP group 2 Anaerostipes spp. nov. Anaerostipes spp. nov. C. scindens E. muris C. clostridioforme C. clostridioforme D. muris D. muris E. coli E. coli I. butyriciproducens I. butyriciproducens L. muris L. muris E. muris

3.4. DNA isolation

Different sources were used for DNA isolation. Fresh stool samples were collected from mice and directly stored at -20fºC. Intestinal content (cecal and colon content) was collected from the intestines of the mice and added to 5 ml of 1 x PBS. Samples were homogenized and subsequently centrifuged for ten minutes at 12700 rpm to remove liquids. For whole genome sequencing, 5 mL liquid cultures were used. The cultures were centrifuged for 10 minutes at maximum speed to remove the liquid and only keep the bacteria. For DNA based 16S rRNA gene sequencing, DNA was extracted and isolated according to a protocol that uses both mechanical and chemical disruption of the bacterial cell wall and is based on phenol/chloroform purification. Samples were suspended in a solution containing 500 µL DNA extraction Buffer A (see: table 6), 200 µL 20% SDS, 500 µL phenol:chloroform:isoamyl alcohol and 100 µL of 0.1fmm diameter zirconia/silica beads. The samples were homogenized by bead-beating using the Mini-Beadbeater-96. Samples were bead-beated twice for two minutes with a two minutes break in between, where the samples were stored at 4fºC. After bead-beating, the samples were centrifuged for five minutes at 8000 rpm at 4fºC and the aqueous phase was transferred into a new 1.5 mL Eppendorf tube. The extraction was then repeated by adding 600 µL of phenol:chloroform:isoamyl alcohol, mixing by inverting the tubes ten times and centrifugation of 12700 rpm for five minutes at 4fºC. The upper aqueous phase was again transferred into a new

Eppendorf tube and precipitated by adding 600 µL ice-cold isopropanol and 60 µL 3M sodium acetate solution and storing it at -20fºC for a minimum of three hours. After the incubation, the samples were centrifuged at 12700 rpm for twenty minutes at 4fºC and subsequently washed in 1 mL of 70% EtOH. After another centrifugation step at 12700 rpm speed for three minutes, the crude DNA pellets were dried in a vacuum centrifuge for ten minutes and resuspended in 200fµL of 1x TE buffer by incubating the samples for thirty minutes at 50fºC. After resuspension, the DNA samples were treated with 100fmg/mL RNase and column purified. The isolated DNA was stored at -20 ºC until further analysis.

3.5. 16S rRNA gene microbial community sequencing

3.5.1. WTBL/6-SPF1 - SPF4 mice Sequencing of fecal DNA was performed in the Genome Analytics Platform at Helmholtz Center for Infection Research. Amplification of the V4 region with the use of the 16S_V4Seq primers (see: table 3Table 3) of the 16S rRNA gene was performed.311 Samples were sequenced on an Illumina MiSeq platform (PE250). Barcode-based demultiplexing was performed using IDEMP software with default parameters (https://github.com/yhwu/idemp). Obtained reads were assembled, quality controlled and clustered using Usearch8.1 software package (http://www.drive5.com/usearch/). Briefly, reads were merged using -fastq_mergepairs –with fastq_maxdiffs 30 and quality filtering was done with fastq_filter (-fastq_maxee 1), minimum read length 200 bp. The OTU clusters and representative sequences were determined using the UPARSE algorithm312, followed by taxonomy assignment using the Silva database v128313 and the RDP Classifier314 with a bootstrap confidence cutoff of 80% performed by using QIIME v1.8.0.315 OTU absolute abundance table and mapping file were used for statistical analyses and data visualization in the R statistical programming environment package phyloseq.316 To determine bacterial OTUs that explained differences between microbiota settings, the LEfSe method was used.317 OTUs with Kruskal-Wallis test <0.05 and LDA scores >4.0 were considered informative.

3.5.2. WTBL/6-OMM mice For the specific relative abundance estimation of the species of the OMM microbiota the standard 16S rRNA gene amplicon pipeline (3.5.1) was extended to open-reference approach. Briefly, quality filtered reads were first try to assign to the OMM sequences only (QIIME v1.8.0315 command pick_closed_reference_otus). Reads failed to match the references (default sequence similarity threshold 97%) were reused for the determination of OTU clusters and representative sequences were determined using the UPARSE algorithm312 following the standard pipeline (3.5.1). OTU tables were merged and used for statistical analyses and data visualization in the R statistical programming environment package phyloseq.316

3.6. Clostridioides difficile inhibition assays

3.6.1. In vitro To examine the inhibitory effect of specific bacterial cultures on the vegetative cells of C. difficile, two different in vitro methods were used. First, bacteria were anaerobically cultured overnight, including C. difficile, according to the methods and incubation temperatures mentioned before. For the first method, the bacterial cultures were streaked out horizontally in one thin line on agar plates. The plates were dried for as long as it was needed to show no liquid culture visible on the plate anymore. Afterwards, the vegetative cells of the C. difficile culture were streaked on the plate as well, also in one thin line, but vertically, crossing the earlier streaked line, making a cross, as pictured in Figure 6A. Plates were incubated anaerobically at 37f°C for twenty-four hours. For the second method, 100fµL of the bacterial cultures were spread out over the plate, completely covering the surface of the agar. The plates were dried until no liquid culture was visible anymore on the agar plates. Then, 25fµL of the C. difficile culture was added in a drop in the middle of the plate, as shown in figure 6B. When the drop was also dried, the plates were incubated anaerobically at 37f°C for twenty-four hours.

3.6.2. Ex vivo To examine the inhibitory effect of specific bacterial cultures in combination with intestinal content on C. difficile infections, an ex vivo experiment was performed. For this, WTBL/6-SPF1 mice were treated with 10fmg/kg bodyweight clindamycin twenty-four hours before sacrifice. The

60 content of the cecum and colon were collected and diluted 1:1 in PBS. Aliquots of 500fµL were generated. 50fµL of the bacterial cultures were added to these aliquots. At last, 1000 spores of C. difficile were added to these bacterial cultures and vortexed thoroughly to make sure the samples were mixed well. The samples were then incubated anaerobically at 37°C for six hours and afterwards plated on pre-reduced CLO plates. These plates were incubated anaerobically at 37°C for three days. This method is adjusted from Theriot et al.318

Figure 6: In vitro inhibition assays.

Two different methods were used to assess the inhibition of the different bacteria on C. difficile. (A) Method one, where line number 1 represents the bacterial strain which inhibitory effect is tested and line number 2 represents the C. difficile culture. The two cultures cross each other in the middle. (B) Method two, where circle number 1 represents the bacteria which inhibitory effect is tested and spread of the whole plate and circle number 2 represents the C. difficile culture that is dropped in the middle of the plate.

3.7. Clostridioides difficile infection

3.7.1. SPF microbiota Figure 7 describes the timeline for C. difficile infections in mice containing an SPF microbiota. Briefly, one day before infection, mice received an antibiotic treatment with 10fmg/kg clindamycin intraperitoneal and twenty-four hours (D0) later mice were infected via oral gavage of 1000 spores per mice in 200fµL. Feces for DNA isolation and 16S rRNA gene analysis were collected the day before infection (D-1), D0, one day after infection (D1), three days after infection (D3), five days after infection (D5) and seven days after infection (D7). Feces were also collected on D1, D3, D5 and D7 to assess colonization of vegetative cells and spores, and for lipocalin-2 and Toxin A ELISAs. The mice were monitored and the weight was measured daily, unless the protocol indicated to increase the monitoring to two times a day, for example when the mice lost more than 10% of their bodyweight or when they showed signs of diarrhea.

The susceptibility of mice with an SPF microbiota, more specifically WTBL/6-SPF1 to WTBL/6-SPF4 mice, for C. difficile infections was examined by treating half of the mice with 10fmg/kg clindamycin intraperitoneal and half of the mice with sterile PBS intraperitoneal one day before infection.

Figure 7: Timeline for C. difficile infection in WTBL/6-SPF1 – SPF4 mice.

Two different methods were performed during infection of WTBL/6-SPF1 – SPF4 mice. (A) To examine the survival, mice were followed over a time course of eight days. The experiment started with a clindamycin treatment (10fmg/kg bodyweight) on D-1, followed by an infection with 1000 spores of C. difficile twenty-four hours later on D0. On D1, D3, D5 and D7, feces samples were collected for multiple assays. On D7, mice were also euthanized. (B) To examine colonization of C. difficile in the mice, mice were followed for four days, before being euthanized on D3. On D-1 they received antibiotics, on D0 the mice were infected and on D1 and D3 samples were collected. Additionally, on D3 an organ burden experiment was performed after euthanizing the mice.

3.7.2. OMM microbiota Figure 8 describes the timeline for C. difficile infections in mice containing an OMM microbiota. Mice containing an OMM microbiota are susceptible for C. difficile infections without a prior antibiotics treatment. OMM mice used in this study were used directly for infection, or were one week prior to infection (D-7) colonized with 200 µL of single cultures or consortia of bacterial cultures. Mice were infected on D0 via oral gavage of 1000 spores per mice in 200 µL. Feces for DNA isolation and 16s rRNA gene analysis were collected on D0, D1, D3, D5 and D7.

On the same days, feces were collected to assess the colonization of vegetative cells and spores, for lipocalin-2 and Toxin A ELISAs, and for bile acid analysis.

Figure 8: Timeline for C. difficile infections in WTBL/6OMM mice.

Two different methods were performed during infections of WTBL/6-OMM mice. (A) To examine the survival, mice were followed of a time course over fourteen days. The experiment started with the colonization of commensal bacteria seven days before infection (D-7) followed by an infection with 1000 spores of C. difficile one week later (D0). On D1, D3, D5 and D7, feces samples were collected for multiple assays. On D7, mice were euthanized. (B) To examine colonization of C. difficile in the mice, mice were followed for eleven days, and euthanized on D3. On D-7 they received commensal bacteria, on D0 the mice were infected and on D1 and D3 samples were collected. Additionally, on D3 an organ burden experiment was performed after euthanizing the mice.

3.8. Sacrifice and dissection of mice

All procedures were performed according to the animal protection act and animal suffering was kept to an absolute minimum. Mice were euthanized by CO2 inhalation followed by dislocation of the spine in the neck. For previously specified analysis and experimental procedures, colon content and cecal content was collected after sacrificing the mice.

3.9. Examining CFU in infected mice

To examine the colonization of C. difficile in infected mice, feces samples are collected on the appropriate days, which means D1, D3, D5 and D7, when possible. 1fmL of 1x PBS and 100fµL of 1fmm silico beads were added to the samples and samples were bead-beated two times for twenty seconds. Every sample was divided in four different Eppendorf tubes. One tube was for DNA isolation, one for lipocalin-2 and Toxin A ELISAs, one tube was for using directly and one tube was used for heating up the sample at 65fºC for twenty minutes. The samples for DNA isolation and ELISA were stored at -20fºC until they were analyzed. The tube containing the non- heated sample was suitable for culturing and determining colony forming units (CFUs) of vegetative cells. Samples were diluted in a ten-fold dilution series in 1x PBS. 25 µL was then streaked out on CLO plates. Since these plates lack taurocholate, spores will not be able to germinate. The samples that were heated at 65fºC were also diluted in the same way and 25fµL were streaked out on CLO + 0.1% taurocholate plates. Because of the heating, vegetative cells were inactivated and killed, and only spores were able to form CFUs on these plates. The plates were placed into anaerobic jars containing an AnaeroGen 3.5fL sachet and incubated for three days at 37fºC. Afterwards, the CFUs were counted and calculated back to vegetative cells or spores per gram content. In indicated experiments organ burdens were performed. For this, mice were sacrificed as previously described and the cecum and colon content were collected in 50fmL Falcon tubes. All samples were kept on ice during the experiment. The content was weighed and 5 mL of 1 x PBS was added to the tubes. Using a homogenizer, samples were homogenized for thirty seconds. Between each sample, the homogenizer was washed with 70% EtOH for ten seconds followed by ten seconds of 1 x PBS. Between different experimental groups or different organs, the homogenizer was washed two times with 70% EtOH and 1 x PBS. Samples were then collected in four different Eppendorf tubes. The same procedure as described for the feces samples in the prior paragraph will be used for these samples.

3.10. Enzyme-linked immunosorbent assay

Enzyme-linked immunosorbent assays (ELISAs) were performed to determine the concentration of lipocalin-2 and the concentration of C. difficile Toxin A in the fecal, cecal and colon content. Lipocalin-2 is produced by the host. It is an inflammation marker in the intestines which indicates the severity of an infection. Toxin A is produced by C. difficile and the concentration indicates the severity of the infection. In both ELISAs, the higher the concentration of the protein, the more severe the infection. For both lipocalin-2 and Toxin A, the protocol was carried out mostly according to the manufacturer’s instructions, with some modifications. The samples used for the lipocalin-2 ELISA are undiluted in addition to three dilutions, 1:20, 1:400, 1:8000. For the Toxin A ELISA, samples used are undiluted in addition to three dilutions, 1:5, 1:25, 1:125.

3.10.1. Lipocalin-2 ELISA The Lipocalin-2 ELISA was purchased from R&D systems. In short, a 96-well microplate was coated with the capture antibody diluted in 1x PBS and stored overnight at room temperature. The plate was washed three times with wash buffer and blocked for a minimum of one hour by Reagent Diluent (RD) (1x) to each well. Afterwards the plates are washed again for three times with wash buffer. The standard and samples (undiluted and diluted in RD) were added to the samples and incubated overnight at 4fºC. After another washing step, the detection antibody, diluted in RD, was added to each well and incubated for two hours at room temperature. After a washing step, Streptavidin-HRP diluted in RD was added to each well and incubated for twenty minutes at room temperature while being covered from the light, like all following steps. A last washing step was performed before the Substrate Solution was added. After an incubation of ten to twenty minutes, Stop solution was added and the absorbance was measured at 450fnm and the correction at 540 nm with a plate reader. Standards and samples were fitted and the lipocalin-2 values were calculated back to ng of Lipocalin-2 per gram sample.

3.10.2. Toxin A ELISA The Toxin A ELISA was purchased from Antibodies-Online. The ELISAS were performed using the Two Step Protocol. The undiluted samples, diluted samples, or the control samples were added to the wells and incubated for one hour at 37fºC. Afterwards the plate was washed three times with 65 wash buffer and the anti-toxin A-HRP conjugate was added to each well and incubated at 37fºC for thirty minutes while being covered from the light, like all following steps. The plate was washed again and the substrate was added and incubated at room temperature for ten to twenty minutes. The reaction was stopped by adding Stop solution to each well. The absorbance was measured at 450fnm and the correction at 620fnm and toxin values were calculated back to ng of toxin per gram sample.

3.11. Collection of samples for secondary bile acid analysis

Mice were euthanized and the content of the small intestine, cecum or colon was collected, divided in 50 mg aliquots and added to a tube containing beads. Immediately after weighing the content, the tubes were snap frozen in liquid nitrogen and stored at -80°C until further processing. Processing, isolation and analysis was performed by the group of Dr. Meina Neumann-Schaal at the DSMZ.

3.12. Quantitative PCR (qPCR)

Different qPCRs have been performed in this study. Using the 16S_SangerSeq primers in combination with specific bacterial primers, the relative abundance of specific bacteria could be calculated. Using the Bai_CD primers, the abundance of the bacterial secondary bile metabolizing gene in the samples could be measured. First, the bacterial or fecal DNA is isolated as described before. The components for the qPCR are added together and a 96-well plate is filled up with the master mix. Afterwards, the DNA is added to the wells in duplo. The plate is sealed, vortexed, to make sure the DNA is mixed with the DNA mix, and spinned down at 300x g for three minutes. The LightCycler480 was used to measure the samples. To examine the relative abundance of Extibacter muris and Clostridium scindens in the different groups, two separate qPCRs were performed, since the annealing temperature of the 16S_SangerSeq primers and the annealing temperature of E. muris or C. scindens did not coincide. The qPCR reaction mix can be found in table 35Table 36, and the qPCR program in table 36. The

66 annealing temperature of the 16S_SangerSeq primers is 55fºC, for E_muris_SpPr it is 67fºC and for C_scindens_SpPr the annealing temperature is 64fºC. The protocol for the quantification of the Bai_CD gene in samples is different. A standard of seven decreasing concentrations is made by using different amounts of E. muris or C. scindens DNA. The highest amount is 25 ng/µL, and by diluting 1:2, the standard goes from 25 ng/µL till

0.391 ng/µL, with the eighth well containing only H2O as water control. Both the standard and samples are added to the plate in duplo. The Bai_CD primers have an annealing temperature of 60fºC.

Table 36: qPCR reaction mix used in this study

Component Volume (µL) Final concentration 5x HOT FIREPol EvaGreen qPCR Mix Plus 4 1x Primer Forwards (10pmol/µL) 0.5 Primer Reverse (10pmol/µL) 0.5 DNA template 2 1-50 ng/µL

H2O PCR grade Rest Total 20

Table 37: qPCR program used in this study

Cycle Step Temperature (ºC) Time Cycles Analysis Initial 95 15 min 1 Denaturation Denaturation 95 15 s Annealing 55-67 20 s 40 Quantification Elongation 72 20 s Melting curve - Continuous 1 Melting curve Cooling 37 60 s 1

3.13. Metagenomics

Sequencing of fecal DNA was performed in the Genome Analytics Platform at Helmholtz Center for Infection Research using the NEBNext Ultra DNA library prep kit (New England Biolabs). The library preparation was performed according to the manufacturer's instructions. Demultiplexed libraries were filtered to remove host reads using BBMap using the Ensembl masked mouse genome GRCm38.75 and phiX.319 Quality filtered reads were mapped against the OMM genomes using BBMap.320 Unmapped reads were used for an assembly approach with MegaHIT.321 Resulting contigs were binned to MAG (metagenomics assembled genomes) with metaBAT, quality checked with CheckM.322,323 Resulting MAGs were taxonomic classified with GTDBTk and annotated using prokka.309,324 In addition predicted proteins of the MAGs were searched for baiCD with Blastp using all available baiCD from UniProt as references.325,326

3.14. Statistical analysis

Statistical analysis was performed using GraphPad Prism program version 7 and 8 (GraphPad Software, Inc.) and R v3.3.0. Data are expressed as mean ± SEM (Standard error of mean). Differences were analyzed by Student’s t-test and ANOVA. P values indicated represent an unpaired nonparametric Mann-Whitney or two-way ANOVA by Tukey´s multiple comparison analysis. The permutational multivariate ANOVA analysis of variance (ADONIS) was computed with 999 permutations. In addition to p value, for ADONIS tests an R2 > 0.1 (effect size, 10%) was considered as significant. Values ≤ 0.05 were considered as significant: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

4. Results 4.1. The effect of age on Clostridioides difficile infections in mice

As mentioned in the introduction, age is an important factor in contracting the C. difficile and the severity of the infections in humans. However, in mice, few studies describe the effect of the age of mice in combination with C. difficile infections. To be able to establish a mouse model which is comparable to the development of the infection in humans, an experiment was performed with female WTBL/6-SPF1 mice that were followed over time to analyze C. difficile VPI 10463 infections in mice with different ages. Mice as young as nine weeks till mice aged up to thirty-six weeks were used in this experiment. First, the weight of the mice with different ages were measured. Afterwards, on day one before infection, all mice were treated with 10 mg/kg clindamycin and twenty-four hours later infected with 1000 spores of C. difficile VPI 10463. Mice were weighed and scored daily after infection and fecal samples were collected on day one, three, five and seven after infection to be able to detect colonization, inflammation and toxin levels of C. difficile in the fecal matter.

4.1.1. Mice gain body weight until age of twenty-two weeks Female mice were grouped together by age, with a maximum of six days difference in birth date. To examine the differences in starting bodyweight at infection, mice were weighed before giving the clindamycin treatment. All mice contained the same microbiota, were given the same food and water and were housed in identical cages with identical housing conditions. As expected and as shown in Figure 9, similar aged mice were presenting similar weights, and the body weight increases as they grow older. After twenty-two weeks however, the weight gain plateaus around 25 g per mouse.

Figure 9: Bodyweight of mice grouped by age.

Female mice grouped by age from nine weeks old till thirty-six weeks old, with a maximum of six days difference in birth date. Data is pooled from multiple experiments.

4.1.2. The microbiota does not change over time when mice age The microbiota composition is important for the colonization resistance. In humans, the microbiota changes over time, caused by environmental influences like different nutrient intake, medicine and antibiotic treatments. To examine if the microbiota changes when mice grow older, without any influences from outside, feces were taken before antibiotic treatment and DNA was isolated. 16S rRNA gene sequencing was performed to detect differences in the composition of the microbiota during aging. Figure 10A shows the NDMS plot of the 16S rRNA gene profiles of the feces samples taken from mice when they were different ages before and after clindamycin treatment. No significant differences between the composition of mice of different ages in the 16S rRNA gene profiles could be found, which means that the composition did not change when mice grow older while being kept in isolation. Antibiotic treatment however causes a significant shift to the microbiota, but again no significant differences between the ages were found after antibiotic treatment. The bacterial compositions are shown in figure 10B, where the microbiota composition is shown on family level. The most obvious differences are the absence and/or lower abundance of the Lachnospiraceae, Porphyromonadaceae, Rikenellaceae and Ruminococcaceae and a higher abundance of Enterococcaceae and Lactobacillaceae in the antibiotic treated mice. This shows that clindamycin kills numerous bacteria and decreases the diversity of the microbiota. 70

Figure 10: 16s rRNA data sequencing of feces DNA of mice with different ages before and after antibiotics

Analysis of β-diversity (PCoA) using Bray-Curtis distances along with multivariate analysis of variance (ADONIS test) of variables ‘age’, and ‘treatment’ (A) and fecal microbiota composition on the family level using 16S rRNA gene sequencing. (B) α-diversity (Observed and Shannon) in mice of different ages before and after antibiotics (Student t-test).

4.1.3. Older mice lose more weight and have a lower survival Since the microbiota does not change over time, and also the antibiotic treatment does not alter the microbiota differently in the different ages, the question arose if the mice would show differences in severity and mortality during a C. difficile infection. For this, nine- to thirty-six-week-old female

WTBL/6-SPF1 mice, treated with 10 mg/kg bodyweight clindamycin twenty-four hours before infection, were infected with 1000 spores C. difficile VPI 10463. Mice were followed over a time course of seven days and their body weight was measured daily. Figure 11 shows the weight of the mice (A) and the survival curve (B) of the infected mice. Mice older than twenty-two weeks old lost more weight compared to the younger mice. On day three, mice older than twenty-two weeks old lost 20% of their bodyweight which meant that they reached the humane endpoint and thus were euthanized. Additionally, mice of eighteen weeks and younger started gaining weight again after three days of infection. The younger the mice were at the start of the infection, the lower the weight loss was and the faster they recovered after infection. Nine-week-old mice gained all their weight back at day five post infection, eleven- to thirteen-week-old mice regained their weight completely on day six and thirteen- to eighteen-week-old mice were back at their starting bodyweight seven days post infection. In addition, nine- to eleven-week-old mice did not lose more than 10% of their body weight, while thirteen- to eighteen-week-old mice lost around 15% of their starting body weight. All mice of twenty-two weeks old or older died three to four days post infection, while all mice of eighteen weeks of age or below did not die at all.

Figure 11: Bodyweight loss and survival curve of WTBL/6-SPF1 mice of different ages.

Data pooled from two separate experiments. Bodyweight loss of WTBL/6-SPF1 mice with different ages during a C. difficile infection (antibiotics treatment twenty-four hours before infection, infected with 1000 C. difficile VPI 10463 spores per mice). (A) Complete body weight loss over a time span of seven days. (B) Survival curve for WTBL/6-SPF1 mice.

4.1.4. The production of spores is affected by the age of the mice The weight loss and mortality were affected by the age of the mice. To examine if C. difficile can colonize the mice in higher number depending on age, fecal samples of the infected female mice were collected, when possible, on one, five and seven days post infection. Homogenized samples were spread out on selective CLO agar plates (BioMerieux) to determine the amount of vegetative cells. Additionally, samples that were heated at 65fºC for twenty minutes, were spread out on CLO agar plates supplemented with 0.1% TCA to determine the amount of spores. Figure 12 shows the colonization in CFU/g of vegetative cells and spores on one day, five days and seven days post infection. On day one, there is no difference in the colonization shown by similar CFU/g of vegetative cells between the different ages. However, there is a significant difference between the older and younger mice in the amount of spores found. More specifically, mice from thirty-six weeks old have a significant higher amount of spores compared to mice below eighteen weeks old and thirty-two-week-old mice have a significant higher amount of spores compared to mice below eleven weeks old. In general, the older the mouse, the higher the amount of spores that were recovered from the feces samples. In addition, no difference was found in the CFU/g of vegetative cells and spores on day five post infection, however, only mice from the age of nine to eighteen weeks were still alive and thus no comparison can be made to older mice. Between five and seven days, all mice started clearing the infection, since the CFU/g of vegetative cells went from 107-109 on day five to 104- 106 on day seven. No difference was found in the vegetative cells between all age groups. Additionally, in mice below fifteen weeks of age, no spores were found in the fecal matter on day seven after infection, but, although in a low amount, were still found in mice of eighteen weeks old. However, the CFU/g spores found on day seven were significantly lower compared to the CFU/g of spores on day five. To examine if the older mice produce more inflammation markers, like lipocalin-2, or if the strain produced more toxin in older mice compared with younger mice, two ELISAs were performed, namely a lipocalin-2 and Toxin A ELISA. Both of these ELISAs did not show any difference in the different age groups (data not shown). The mechanism behind the higher susceptibility of older mice for C. difficile is not clear, however, it is clear that mice of twenty-two weeks and older show a higher severity and higher mortality after infection with C. difficile. For following experiments, mice between the age of twenty-two and twenty-six were used.

Figure 12: Colonization of C. difficile in mice with different ages.

Nine- to thirty-six-week-old clindamycin treated female mice were infected with 1000 spores of C. difficile VPI 10463. After one day, five days and seven days, fecal matter was collected. Homogenized fecal matter were plated and CFUs were counted. (A) Vegetative cells and spores in CFU/g one day after infection. (B) Vegetative cells and spores in CFU/g five days after infection. (C) Vegetative cells and spores in CFU/g seven days after infection. Significance was performed using an unpaired two-sided Student’s t-test (*p < 0.05).

4.2. Impact of antibiotics in mice on the severity of Clostridioides difficile infections

The microbiota composition is important in conferring colonization resistance against bacterial pathogens. It is known that different compositions can have different effects on specific infections, for example on the severity of the infection and the time it takes to infect and grow out in the host’s intestine. To examine the effect of different microbiota compositions on the severity of C. difficile with and without the use of antibiotics, mice matched by gender and of an age of twenty-two to twenty-six weeks harboring different SPF microbiota (WTBL/6-SPF1, WTBL/6-SPF2A, WTBL/6-SPF3 and WTBL/6-SPF4 mice, see table 1) were infected. The mice were split in two different groups per microbiota composition (in total 8 groups). One group received a clindamycin treatment (10fmg/kg bodyweight) before being infected with 1000 spores of C. difficile VPI 10463 and one group did not receive any antibiotics prior to infection.

4.2.1. The microbiota is altered after the use of clindamycin Mice were split into eight different groups, two groups per microbiota. One of those groups received a clindamycin treatment (10fmg/kg bodyweight), the other one received PBS as control group. Fecal matter was collected before antibiotic treatment and twenty-four hours after antibiotic treatment. Total DNA was isolated from these samples and the 16s rRNA gene profiles were examined. Figure 13A presents the NDMS plot of the samples before and after antibiotics treatment. Mice with the same microbiota background are clustered together. WTBL/6-SPF2A and -SPF3 mice show to have similar microbiota compositions, but they show differences compared with the WTBL/6-SPF1 and -SPF4 mice. After antibiotic treatment, the composition of the microbiota of mice before antibiotics show a significant different microbiota composition after antibiotics. Still, mice with the same microbiota after antibiotics cluster together, where again WTBL/6-SPF2A and -SPF3 mice seem to have similar microbiota compositions, even after antibiotic treatment. Figure 13B presents the differences in the composition on family level. As presented before, the differences in the microbiota between WTBL/6-SPF1 mice before and after antibiotic treatment is characterized by an increase in Enterococcaceae and a decrease in the relative abundance of Lachnospiraceae, Rikenellaceae, Ruminococcaceae and Verrucomicrobiaceae. In addition, the microbiota of WTBL/6-SPF2A, -SPF3 and -SPF4 mice after antibiotics present a decrease in the relative abundance of Muribaculaceae, Prevotellaceae, Rikenellaceae, Ruminococcaceae and Verrucomicrobiaceae after antibiotic treatment and an increase in the relative abundance of Enterobacteriaceae, Enterococcaceae and Lactobacillaceae compared with before antibiotics. In general, the diversity decreases after antibiotics treatment, independently of the starting microbiota composition.

Figure 13: The 16S rRNA data sequences of feces DNA of mice harboring different microbiota compositions before and after antibiotics.

Analysis of β-diversity (PCoA) using Bray-Curtis distances along with multivariate analysis of variance (ADONIS test) of variables ‘microbiota’, and ‘treatment’ (A) and fecal microbiota composition on the family level using 16S rRNA gene sequencing (B). α-diversity (Observed and Shannon) in mice containing different microbiota compositions before and after antibiotics (Student t-test).

4.2.2. Antibiotic-treated mice are susceptible for Clostridioides difficile infections To examine the effect of the different microbiota compositions before and after antibiotics on the ability of C. difficile to infect and colonize the mice, mice were infected with 1000 spores of C. difficile VPI 1046 twenty-four hours after clindamycin treatment. As shown in Figure 14A, WTBL/6-SPF1 mice treated with clindamycin lost around 15% of bodyweight two days after infection, compared to 0% of WTBL/6-SPF1 mice that were untreated. Three days post infection, the WTBL/6SPF1 mice treated with clindamycin died due to the reach of the humane endpoint (20% bodyweight loss), while the untreated mice did not show any signs of disease after seven days (end of experiment). WTBL/6-SPF2 and -SPF4 mice lost around 10% of their bodyweight and WTBL/6-SPF3 mice lost 5% of bodyweight on day three compared to 0% of bodyweight loss of their untreated counterparts. WTBL/6-SPF2A, -SPF3 and –SPF4 mice treated with clindamycin before infection showed a weight loss of 20% on day four, at which they were euthanized while their counterparts that did not receive any antibiotics prior to infection did not show any signs of disease after seven days (end of experiment). The survival curve for all groups is shown in Figure 14B-E, where all mice in the antibiotic-treated groups died due to the infection (either three days or four days after infection), and all mice not treated with antibiotics survived for the duration of the experiment (seven days) causing a significant difference in survival.

4.2.3. Antibiotic-treated mice show colonization of C. difficile after infection To examine if untreated mice and mice treated with clindamycin would have a difference in C. difficile colonization after infection, fecal samples were taken on day one and day three post infection. Figure 15 shows the CFU of C. difficile per gram feces from each mice in log scale. WTBL/6-SPF1 mice treated with clindamycin were showing severe diarrhea on day three, so no samples could be taken from them on this day. From all other mice groups, samples were able to be collected on both day one and day three. Significant differences were shown between the antibiotic treated mice and the untreated counterparts containing the same microbiota before antibiotic treatment on day one and day three after infection. On day five and day seven, the clindamycin treated mice were dead. Additionally, on day five and day seven, no CFU/g vegetative cells or spores were found in the untreated mice, regardless of which microbiota composition they had. Interestingly, spores found in antibiotic treated WTBL/6-SPF4 mice were significantly lower compared to the amount of spores found in antibiotic treated -SPF1 and -SPF3 mice one day after

77 infection, but significantly higher compared to antibiotic treated -SPF2A and -SPF3 mice on day three post infection. The spore counts in antibiotic treated WTBL/6-SPF2A and -SPF3 mice remained similar on day one and day three, however, the CFUs g/feces found in antibiotic treated WTBL/6-SPF4 mice went up from 104 to 108 CFU/g from day one to day three.

Figure 14: Bodyweight loss and survival curve of mice treated or not treated with antibiotics.

(A) Body weight loss of WTBL/6-SPF1, -SPF2A, -SPF3 and –SPF4 mice treated with antibiotics and untreated mice during a C. difficile infection (infected with 1000 spores of C. difficile VPI 10463 per mice). (B) Survival curve for WTBL/6-SPF1 mice. (C) Survival curve for WTBL/6-SPF2A mice. (D) Survival curve for WTBL/6-SPF3 mice. (E) Survival curve for WTBL/6-SPF4 mice. Significance was performed using an unpaired two-sided Student’s t-test (*p < 0.05).

Figure 15: Antibiotic treatment alters the colonization of C. difficile after infection.

CFU per gram feces of C. difficile in WTBL/6-SPF1 to -SPF4 mice treated with antibiotics and untreated mice during a C. difficile infection (infected with 1000 spores C. difficile VPI 10463 per mice). (A) CFU/ gram feces of vegetative cells found in WTBL/6-SPF1 – SPF4 mice one day after infection. (B) CFU/g feces of spores in fecal samples found in WTBL/6-SPF1 – SPF4 mice one day after infection. (C) CFU/g feces of vegetative cells found in fecal samples of WTBL/6-SPF1 – SPF4 mice three days after infection. (D) CFU/g feces of spores found in fecal samples of WTBL/6-SPF1 – SPF4 mice three days after infection. Significance was performed using an unpaired two-sided Student’s t-test (*p < 0.05; **p < 0.01).

4.2.4. Antibiotic treated mice show intestinal inflammation after Clostridioides difficile infections Lipocalin-2 is excreted by the intestinal cells as response against intestinal inflammation. The higher the level of lipocalin-2, the more inflammation is present in the intestines. The same feces samples that were collected in the previous section were also used to measure the lipocalin-2 levels of the different groups. To examine the amount of lipocalin-2 excreted, a lipocalin-2 ELISA was performed. As shown in Figure 16, lipocalin levels of WTBL6-SPF1 mice without antibiotic treatment were absent in their fecal samples, however, untreated WTBL/6-SPF2A, -SPF3 and SPF4 mice did show lipocalin levels as high as 108 to 5*109fpg/g feces. One day after infection, a significantly higher amount of lipocalin was found in WTBL/6-SPF1 mice that were treated with antibiotics compared to non-treated mice. The other groups did not show any significant difference with their untreated counterparts on day one. However, on day three after infection, untreated WTBL/6-SPF2A, SPF3 and SPF4 mice had a significantly lower amount of lipocalin in their feces compared to their antibiotic treated counterparts, showing that the mice with the C. difficile infection produce more lipocalin.

4.2.5. Mice treated with antibiotics show high levels of toxin A in their feces Toxin A is produced by C. difficile, and is the major cause of the pathogenicity of the bacteria. High levels of toxin A can be a sign of a severe infection. Toxin A can be measured by a toxin A ELISA. As shown in Figure 17, toxin A levels are absent in mice that were not treated with antibiotics before infection, while mice that were treated with antibiotics show high amounts of toxin A, around 107 ng/gram feces. On day one, two of the WTBL/6-SPF1 mice and two of the WTBL/6-SPF3 mice did not show any toxin A in their fecal matter. On day three, all mice treated with antibiotics showed high levels of toxin A.

Figure 16: Amount of lipocalin produced in the mouse during infection.

Lipocalin levels in pg/g feces after infection. (A) Lipocalin levels on day one post infection. (B) Lipocalin levels on day three post infection. P values indicated represent an unpaired nonparametric Mann-Whitney test if not indicated differently Significance was performed using an unpaired two-sided Student’s t-test (*p < 0.05).

Figure 17: Amount of toxin A produced by C. difficile during infection.

Toxin A levels in ng/gram feces after infection. (A) Toxin A levels on day one post infection. (B) Toxin A levels on day three post infection. Significance was performed using an unpaired two-sided Student’s t-test. (*p < 0.05). 81

4.2.6. Clostridioides difficile mouse infections and antibiotics Mice that were not treated with antibiotics before infection did not show any signs of disease. They did not lose body weight and did not promote C. difficile growth or the production of spores during the course of a week. Additionally, they produced, depending on the mouse strain used, lower levels of lipocalin produced on day one or day three after infection and they did not contain any toxin levels in their feces. In this study, the exact composition of the healthy microbiota (thus, without the use of antibiotics) is not important, as long as there is a healthy microbiota composition, the mice are protected against C. difficile infections.

4.3. The effect of mutants of Clostridioides difficile 630∆erm on colonization

4.3.1. PPIase PrsA2 is important for colonizing WTBL/6-SPF1 mice Enteric pathogens use a multitude of adaptation strategies to compete with the resident microbiota and to infect the host. In pathogens, PPIases are known to be involved in stress tolerance, protein homeostasis and secretion and they contribute to the virulence and pathogenicity, however, their role in C. difficile is not yet known. Work by our collaboration partner demonstrated that in vitro, mutant strains without the PPIase PrsA2 showed an increased susceptibility towards metronidazole but a lower susceptibility for inhibition by secondary bile acids. To evaluate their relevance in vivo, twenty-two- to twenty-six-week-old mice were treated with 10 mg/kg bodyweight clindamycin twenty-four hours before being infected with 1000 spores of either C. difficile 630Δerm or C. difficile 630ΔprsA2 (ΔprsA2::ClosTron) mutant. Twenty-four hours after infection, mice were sacrificed and the cecum and colon contents, as well as the fecal matter were collected. As presented in Figure 18, mice infected with the wild type spores yielded higher bacterial numbers in both vegetative cells (cecum and colon) as in spores (colon and fecal matter) compared to the mice infected with the prsA2 mutant. In the cecum, 106 CFU/g vegetative cells were recovered of the wild type strain, while a ten-fold lower CFU/g vegetative cells were recovered of the mutant strain. This difference was even clearer in the colon, where 105 CFU/g vegetative cells were recovered in the wild type, compared to only 103 CFU/g in the mutant, causing a hundred-fold decrease in vegetative cells recovered from the mutant. In contrast, there was no difference found in the CFU/g vegetative cells between the strains in the fecal matter, however, there was a ten-fold

82 difference between the wild type and mutant strain in CFU/g spores, with the lowered CFUs in the mutant strain. Additionally, in the colon was a ten-fold difference found in CFUs, with 4.5*104 wild type spores being recovered compared to 3.2*103 of the mutant spores recovered. No significant differences were found in the CFU/g spores in the cecum after twenty-four hours. These in vivo results show that PPIase PrsA2 is important in colonizing the host with C. difficile. The mutant strain showed lower colonization of the host intestines (most specifically in the colon) in both vegetative cells and spores.

Figure 18: Colonization of C. difficile 630 and 630ΔprsA2 twenty-four hours after infection.

Twenty-two- to twenty-six-week-old clindamycin treated mice were infected with the wild type C. difficile 630Δerm strain or the C. difficile 630ΔprsA2 mutant strain. (A). Vegetative cells and spores in CFU/g content of the cecum. (B) Vegetative cells and spores in CFU/g content of the colon. (C) Vegetative cells and spores in CFU/g fecal matter. Significance was performed using an unpaired two-sided Student’s t-test. (*p < 0.05, **p < 0.01, ***p < 0.001).

4.3.2. The protein rnfC is important in early infection Another protein that was examined on its effect on the infection and colonization of C. difficile is rnfC. RnfC is known to be part of the complex for energy production however, their role in the colonization or pathogenicity in C. difficile is not yet known. Work by our collaborators demonstrated that in in vitro experiments the mutant strain without the PPIase rnfC presented growth arrested behaviors. Additionally, scanning microscopy showed that the mutant displayed impaired flagellar formation compared to the wild type strain (data unpublished). To evaluate the relevance of this protein in vivo, twenty-two- to twenty-six-week-old mice were treated with clindamycin twenty-four hours before infection with 1000 spores of either C. difficile 630Δerm or

C. difficile 630ΔrnfC (ΔrnfC::erm^r) mutant. Twenty-four hours after infection, mice were sacrificed and the cecum and colon contents, as well as the fecal matter were collected. Figure 19 shows the results of the colonization twenty-four hours after infection. After twenty-four hours, in the cecum and colon content as well as in the fecal matter, there is no difference between the CFU/g vegetative cells of both the wild type and mutant strain. However, in both the cecal and colon content as well as in the fecal matter, there is a significant difference in the CFU/g spores. In the mutant, no spores were found after twenty-four hours, which were found as high as 104.5- 105 CFU/g in the cecum and colon contents as well as the fecal matter of the wild type. To examine the lasting effect of the mutation on the colonization of C. difficile, twenty- two- to twenty-six-week-old mice were infected with 1000 spores of either C. difficile 630Δerm or C. difficile 630ΔrnfC and their weight was followed for three days. Fecal samples were taken on day one post infection, and the mice were sacrificed three days post infection. The cecum and colon contents, as well as the fecal matter were collected. Figure 20 shows the results of the colonization three days after infection, pooled from three separate experiments. Comparable to the twenty-four hours data, the CFU/g vegetative cells in the cecum and colon content and the fecal matter of the two strains were comparable. However, in contrast to the earlier time-point, the CFU/g spores after three days of both the wild type and mutant strain are similar as well. No significant difference could be found after three days, and CFUs around 106 and 107 were found. Additionally, experiments were performed with the complement strain of the mutant, where the mutant was supplemented with a working rnfC gene. Twenty-two- to twenty-six-week- old mice were infected with 1000 spores of either C. difficile 630Δerm or C. difficile 630ΔrnfC- prnfC and their weight was followed for three days. Fecal samples were taken twenty-four hours post infection, and the mice were sacrificed three days after infection. Figure 21 shows the results of the colonization of the C. difficile wild type and complement strain after one day (fecal matter) and three days (cecum and colon content as well as fecal matter). No differences were found on both one day and three days post infection in the CFU/g vegetative cells or spores between the wild type and complement strain. In this study, RnfC was shown to be important for the production of spores at early infection in vivo. The mutant strain was not able to produce spores in the first twenty-four hours after infection. However, after three days, this early effect was shown to be resolved and the mutant strain produced similar amounts of spores as compared to the wild type strain.

Figure 19: Colonization of C. difficile 630 and 630ΔrnfC twenty-four hours after infection.

Twenty-two- to twenty-six-week-old clindamycin treated mice were infected with the wild type C. difficile 630Δerm strain or the C. difficile 630ΔrnfC mutant strain. (A) Vegetative cells and spores in CFU/g content of the cecum. (B) Vegetative cells and spores in CFU/g content of the colon. (C). Vegetative cells and spores in CFU/g fecal matter. Significance was performed using an unpaired two-sided Student’s t-test. (*p < 0.05, **p < 0.01,).

Figure 20: Colonization of C. difficile 630 and 630ΔrnfC three days after infection.

Twenty-two- to twenty-six-week-old clindamycin treated mice were infected with the wild type C. difficile 630Δerm strain or the C. difficile 630ΔrnfC mutant strain. (A) Vegetative cells and spores in CFU/g content of the cecum. (B) Vegetative cells and spores in CFU/g content of the colon. (C) Vegetative cells and spores in CFU/g fecal matter. Significance was performed using an unpaired two-sided Student’s t-test.

Figure 21: Colonization of C. difficile 630 and 630ΔrnfC + prnfC after infection.

Twenty-two- to twenty-six-week-old clindamycin treated mice were infected with the wild type C. difficile 630Δerm strain or the C. difficile 630ΔrnfC-prnfC complement strain. (A) Vegetative cells and spores in CFU/g content of the fecal matter twenty-four hours after infection (B) Vegetative cells and spores in CFU/g content of the cecum three days after infection. (C) Vegetative cells and spores in CFU/g content of the colon three days after infection. (D) Vegetative cells and spores in CFU/g fecal matter three days after infection. Significance was performed using an unpaired two-sided Student’s t-test.

4.4. Mouse-specific SBAP bacteria compared to human-specific SBAP bacteria

4.4.1. Secondary bile acid colonization did not confer full protection against Clostridioides difficile infections C. difficile is known to be inhibited in both growth and germination by secondary bile acids (SBAs). Using the WTBL/6-OMM mice, which contain only twelve bacteria which do not possess 7α-dehydroxylating genes, the effect of SBA producing bacteria on C. difficile infections can be thoroughly examined. OMM mice themselves are highly susceptible for C. difficile infections causing the mice to reach the humane end point three days after infection. In this study, Clostridium scindens, which is a human SBAP bacteria and already used in a similar study performed by Studer et al. 289 and the mouse-specific SBAP Extibacter muris are used to compare the difference between the effect of human- and mouse-specific SBA producers on the resistance against C. difficile. Twenty-two- to twenty-six-week-old female WTBL/6-OMM mice were colonized with C. scindens or E. muris one week before infection. The control group did not receive any additional bacteria. After seven days, all mice were infected with 1000 spores C. difficile VPI 10463. Mice were followed over a time course of three days and their body weight was measured daily. As shown in Figure 22, WTBL/6-OMM mice that were not colonized by any SBAP bacteria lose 20% of weight in the first three days and thus died of the consequences of the C. difficile infection. Surprisingly, and in contrast to the results found by Struder et al., WTBL/6-OMM mice colonized by C. scindens did not show a better survival or decreased bodyweight loss compared to the non-colonized mice. These mice also lost 20% of body weight and died on day three after infection. Interestingly, mice colonized with E. muris actually presented a better survival and lower weight loss three days after infection. They started losing around 5% of their bodyweight after three days of infection. In conclusion, in this study, C. scindens colonization of WTBL/6-OMM mice did not confer additional protection against C. difficile in contrast with E. muris colonization, which did confer additional protection. However, E. muris did not confer complete protection against C. difficile, showing that they start losing weight three days after infection.

Figure 22: Bodyweight and survival of mice colonized with SBA producing bacteria.

Bodyweight loss of WTBL/6-OMM mice with different ages during a C. difficile infection (1000 C. difficile VPI 10463 spores per mice). (A) Complete body weight loss over a time span of three days. (B) Survival curve for WTBL/6-OMM mice. Significance was performed using an unpaired two-sided Student’s t-test (*p < 0.05).

4.4.2. Secondary bile acid producers do not completely inhibit the colonization of Clostridioides difficile To compare the ability of C. difficile to infect the differently colonized WTBL/6-OMM mice, an infection and subsequently an organ burden was performed three days after infection. Infected WTBL/6-OMM mice colonized or not colonized with SBAP bacteria were sacrificed three days post infection and the cecum and colon content were collected. Figure 23 shows the CFU/g vegetative cells or spores in the cecum and colon content three days after infection. No significant differences were found between the CFU/g vegetative cells in the cecum content although there was a significant difference in the CFU/g spores found in the mice colonized with E. muris compared with the non-colonized mice or mice colonized with C. scindens in both the cecum and colon samples as well as in the CFU/gram vegetative cells in the colon samples. These results indicate that E. muris is able to confer partial resistance against C. difficile, however, is not sufficient to completely protect the WTBL/6-OMM mice against the infection.

Figure 23. Colonization of C. difficile in WTBL/6-OMM mice colonized with SBAP bacteria.

Twenty-two- to twenty-six-week-old WTBL/6-OMM mice were infected with 1000 spores of C. difficile VPI 10463. Three days after infection cecum and colon content was collected. (A) Vegetative cells and spores in CFU/g cecum content three days after infection. (B) Vegetative cells and spores in CFU/g colon content three days after infection. Significance was performed using an unpaired two-sided Student’s t-test (*p < 0.05, **p < 0.01).

4.5. Isolation of bacteria from Clostridioides difficile infection- resistant mice

4.5.1. Using the MPN technique previously uncultured bacteria were isolated As shown in this study and a multitude of other studies: the microbiota is important for the protection against C. difficile infections. It is hypothesized that this protection arises from the ability of the microbiota to produce secondary bile acids. However, in the experiment performed by Studer et al., and the experiment described in the previous section, the effect of adding a secondary bile acid producer (human or mouse origin) to WTBL/6-OMM mice containing no secondary bile acid producers did not confer complete resistance against C. difficile. This resulted in the hypothesis, that other bacteria are needed to confer complete colonization resistance.

Commensal mouse microbiota bacteria were isolated from the cecum and colon content from WTBL/6-SPF1 to WTBL/6-SPF4 and N6BL/6-SPF1 mice (see: table 1). These mice showed that, without an antibiotic treatment, they were completely resistant against C. difficile infections. Bacteria were isolated from of the cecum and colon content of resistant mouse models. The content was transferred into the anaerobic chamber to ensure that the anaerobic bacteria would survive. The content was diluted in different types of media, namely Anaerobic Basal Broth medium (see: table 10 and table 11), LB medium (see: table 19 and table 20), Mucin medium (see: table 21 and table 22), MRS medium (see: table 18) or Super Medium (see table 23 and table 24). Diluted content was spread out on agar plates or distributed in 96-well plates containing 200fµL medium per well and were incubated in the anaerobic chamber at 37fºC for two-four days. For the agar plates, the dilution chosen was the plate containing colonies which were able to be picked without touching other bacterial colonies as well. The 96-well plates that were chosen contained a maximum of 30% of wells containing a growing culture. These colonies and liquid cultures were used for further culturing and 16s rRNA gene analysis. In total, sixty-five bacterial species were isolated from the different mouse intestinal contents as short-term or long-term isolates from which fifty were newly found species. All the fifty new species were isolated using the MPN technique. New species were marked “new” when they had lower than 98% similarity with the closest relative compared to the 16S rRNA gene sequences in the NCBI blast database, analysis performed in December 2017. Using the plating and picking technique, no new species were isolated, and often Enterococcus feacalis or Enterococcus feacium were identified. Additionally, some Lactobacillus spp. were found by picking, however all picked colonies were already known species, meaning that they had a higher than 98% similarity with genes found in the NCBI blast database. Figure 24 shows the phylogenetic tree based on the full 16S rRNA gene sequences of all bacteria found by the MNP technique. Most bacteria isolated are belonging to the Bacteroidetes and Firmicutes, however, also species from Actinobacteria, Verrucomicrobia and Proteobacteria were isolated.

Figure 24: Phylogenetic characterization of all found bacterial species.

The evolutionary history was inferred using the Neighbor-Joining method. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches. The evolutionary distances were computed using the Maximum Composite Likelihood method and are in the units of the number of base substitutions per site. Evolutionary analyses were conducted in MEGA7.327 Coloring group different taxonomic clusters. Bacteria marked with an * behind their name are previous uncultured bacterial species. The colors group together the different phyla. Green: Firmicutes, Yellow: Actinobacteria, Blue: Verrucomicrobia, Pink: Proteobacteria, Red: Bacteroidetes. Muribaculaceae bacterial species were identified as S24-7 before 2019.

4.5.2. Isolation of bacteria of the Muribaculaceae family While isolating the bacteria, a total of twenty-five strains, which is half of all new bacteria found, were identified as species of the Muribaculaceae family, previously known as the S24-7 family. This family is a highly abundant bacterial family of the mouse microbiota. Most of these species isolated were not viable after one passage in culture medium or after freezing the samples in glycerol. However, eight different strains were able to be cultured to at least one mL cultures, which was enough to isolate the DNA for whole genome sequencing. Additionally, one species was able to be frozen in glycerol and afterwards to be revived again, making it a long-term isolate. The bacterial growth media used to culture the isolates that were able to be passaged was Mucin medium. All of the species isolated in the SM or the AAB medium could not be passaged. With a collaborating partner, a study was performed on these Muribaculaceae bacteria, including the Muribaculaceae isolated in our laboratory.328 The long term isolate was named Duncaniella muris.

4.5.3. The selection of the limited consortium The aim to isolate bacteria was to collect species from the microbiota of mice that are resistant against C. difficile infections so they could accompany the secondary bile acid producing bacteria in colonization experiments. Fifty different bacteria were isolated during this particular study, from which four different isolates were chosen to become part of the limited consortium (LC). Another bacterial strain was ordered from the DSMZ and added because of its specific function. A sixth bacteria was an E. coli strain isolated in previous experiments. Important was that the LC was constructed to not contain any secondary bile acid producing bacteria. The LC consists of an Anaerostipes spp. nov., Clostridium clostridioforme., Duncaniella muris, Escherichia coli, Intestinimonas butyriciproducens and Lactobacillus murinus (Table 2). Of all of the bacteria, the whole genome was acquired, by performing whole genome sequencing if not already available. The A. spp. nov. and C. clostridioforme were isolated of the WTBL/6-SPF4 mice, the E. coli is previously isolated out of the microbiota of the WTBL/6-SPF2A mice and L. murinus originates from the microbiota of the WTBL/6-SPF3 mice, which are all isolated from mice that are resistant against C. difficile infections. A. spp. nov. was chosen to represent the Firmicutes bacteria that originate from the cecum and colon and L. murinus to represent the Firmicutes bacteria that originate from the small intestine. E. coli was selected because it is a

92 facultative anaerobic bacterium and belongs to the Proteobacteria. C. clostridioforme was selected in order to represent a Clostridium species that does not produce secondary bile acids in contrast to C. scindens. D. muris is isolated from N6BL/6-SPF1. This specific mouse microbiota composition was not tested against C. difficile infections. However, this strain, that is part of the family Muribaculaceae, was able to be frozen and revived again and thus is used in this LC as representative for the Muribaculaceae family and the Bacteroidetes phylum. The Intestinimonas butyriciproducens was bought from the DSMZ and was chosen because of its function to produce butyrate. A BaiCD gene qPCR has been performed to make sure these bacteria do not possess the ability to produce secondary bile acids (data not shown).

4.6. The effect of the bacteria of the limited consortium on Clostridioides difficile

To determine the effect of the bacteria of the LC on C. difficile infections, first an in vivo and an ex vivo experiment was performed to examine the outgrowth of C. difficile vegetative cells and spores. In vitro means that everything was performed in laboratory settings, with media and cultures. Ex vivo means that mice were used, but not received the infection in vivo.

4.6.1. In vitro effect of the bacteria of the LC on Clostridioides difficile In order to perform the in vitro experiment, three different agar media were used: BHIS, which supports C. difficile growth, and Mucus medium and ABB medium, both supporting the growth of the specific bacteria from the LC. From all bacteria, including the C. difficile, an overnight culture was made prior to the experiment. Two different methods were used to determine the inhibiting effect of the bacteria of the LC on C. difficile growth. The first method to examine the inhibitory effect was by adding two thin lines of bacterial culture as shown in Figure 6A. Using this method, none of the bacteria of the LC, nor the SBA producing bacteria, nor the combination of all the bacterial cultures of the LC, nor the combination of the LC and a SBA producing bacteria provided an inhibitory effect on the growth of C. difficile. The experiment has been performed two times, and in both cases, no difference was found (data not shown).

The second method was by covering the complete plate with the culture of one of the bacteria of the LC, one of the SBA producing bacteria, all the bacteria of the LC, or all the bacteria of the LC together with E. muris. After this had dried, one drop of C. difficile culture was added in the middle of the plates as shown in Figure 6B. Similar as with the previously described experiment, none of the plates showed any inhibition towards the growth of C. difficile (data not shown).

4.6.2. Ex vivo effect of the bacteria of the LC on Clostridioides difficile During the in vivo experiments, there was no evidence of the inhibition from bacteria of the LC, or from the SBA producing bacteria on C. difficile growth. However, in these experiments vegetative cells were used instead of spores. The plates used in the experiment did not contain taurocholate, since taurocholate can inhibit the growth of other bacteria. Without taurocholate, C. difficile spores will not be able germinate and subsequently grow out. For the following experiment, we treated WTBL/6-SPF1 mice with 10fmg/kg bodyweight clindamycin and euthanized the mice twenty-four hours later. The cecum and colon content was collected and 1:1 diluted in PBS. This mixture was divided and to each assigned tube one of the bacteria of the LC, one of the SBA producing bacteria, the complete LC or the complete LC in combination with the SBA producing bacteria was added. Afterwards, 1000 spores were added to each tube and incubated anaerobically for six hours. Samples were then plated on CLO plates. As shown in Figure 25, the antibiotic-treated control group, who received no bacteria at all, shows germination and outgrowth of C. difficile after six hours of incubation. The control group, consisting of the content of mice that did not receive antibiotics, showed no germination and growth at all. Additionally, none of the bacteria of the LC, except for D. muris was able to significantly inhibit the germination and growth of C. difficile. The combination of all bacteria of the LC were not able to inhibit C. difficile. Interestingly, both SBA producing bacteria, C. scindens and E. muris were able to significantly inhibit the germination of C. difficile, in addition to the combination of the LC with E. muris. This concludes that ex vivo, C. scindens and E. muris are able to significantly inhibit the germination and/or growth of C. difficile but are not able to protect the host in vivo against the infection. However, E. muris did show to cause a delay in the infection in vivo. To be able to determine the effect of the LC together with the SBA producing bacteria, since this combination

94 proved to be successful as well in inhibiting the germination and/or outgrowth of C. difficile ex vivo, in vivo experiments are the next step. Outgrowth of C. difficile

**** 8 **** **** * ** ****

m 6 ****

e t

U 4

F o

C detection

g limit

o 2 l

0 s s . e s i s s s s s c c v n l u i i n C ri ti ti o rm e co n r r e L u o o n o c . ri u u d i i . f u u m m n m ib ib p io d E . . ci . t t p d ro m D E s E n n s i p . . + A a . tr i L C C o A s ic N lo r L c ty . u C b I. Controls Bacteria of SBA Consortia the LC producing bacteria

Figure 25: Outgrowth of C. difficile in antibiotic-treated cecum and colon content.

Outgrowth of C. difficile measured by log CFU/g content. The controls consist of samples that originated from mice that received antibiotics twenty-four hours before infection and samples that originated from untreated mice. The six bacteria of the LC and both SBA producers C. scindens and E. muris were examined separately, but also as consortia (LC and LC + E. muris). Significance was performed using an unpaired two-sided Student’s t-test (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001).

4.7. The effect of colonization of the LC and E. muris on Clostridioides difficile

To examine the possibly inhibitory effect of the limited consortium in combination with E. muris on C. difficile infections in vivo, twenty-two- to twenty-six-week-old WTBL/6-OMM mice were

95 colonized with either E. muris, the LC or E. muris combined with the LC one week prior to infection with 1000 spores of C. difficile VPI 10463. The bodyweight was measured for the length of the experiment, which was three or six days after infection. Fecal samples were collected before colonization and before infection and in case of the three-day experiment, the cecum and colon content were collected after sacrificing the mice.

4.7.1. 16s rRNA gene analysis shows colonization of the E. muris and LC in WTBL/6-OMM mice one week after colonization To examine if the bacteria of the LC and the SBAP bacteria were able to colonize the WTBL/6- OMM mice, fecal matter before and one week after colonization were collected and send for 16S rRNA gene sequencing. Using the pipeline mentioned in the methods, which was specifically made for the WTBL/6-OMM mice, the 16S rRNA gene profile was established. Figure 26 shows the 16S rRNA gene levels of the microbiota of WTBL/6-OMM mice one week after colonization. The non-colonized WTBL/6-OMM mice showed to be clean and not contain additional bacteria. Adding the LC to the WTBL/6-OMM mice, it is clear that the bacteria from the LC can colonize the mice, with D. muris in high relative abundances. When E. muris is added to the mice, they are also able to colonize, but in lower relative abundances compared to when E. muris is colonized together with the LC. Both Anaerostipes spp. nov. and I. butyriciproducens, part of the LC, were not detected in the 16S rRNA gene analysis, while four bacteria from the OMM-microbiota were not detected.

4.7.2. Colonization with the LC and E. muris combined were able to confer complete resistance To examine the effect of the LC combined with E. muris on C. difficile infections, an infection experiment was performed. WTBL/6-OMM mice were colonized with the appropriate groups one week prior to infection. No antibiotics were used in these experiments. During the time course of the infection, the mice were weighed daily. Figure 27 shows the weight loss curve and survival curve of the mice colonized with E. muris, the LC or the LC and E. muris combined. WTBL/6- OMM mice not colonized with any additional bacteria lost 20% of body weight in the first three days of infection. When the LC is added to the twelve bacteria of the WTBL/6-OMM mice, the mice lose around 10% in the first three days, but lose an additional 10% on day four, so extending

96 their survival for one day compared to the non-colonized mice. When E. muris was added, mice started losing weight around three days after infection, and this continued until the mice reached 20% body weight loss on day six. Mice colonized with both the E. muris and the LC did not lose any weight in this six-day experiment. The survival curve shows the same, the non-colonized WTBL/6-OMM mice did not survive longer than three days, the mice colonized with the LC died all on day four and the mice colonized with only the E. muris survived until day five but started to reach the humane end point on day six after infection. None of the WTBL/6-OMM mice colonized with the combination of the LC and E. muris died within the six-day span of the experiment.

Figure 26: 16s rRNA data sequencing of feces DNA of (non-)colonized WTBL/6-OMM mice.

α-diversity (Observed and Shannon) in (non-)colonized WTBL/6-OMM mice (Student t-test) one week after colonization. Bacteria containing marked with a * in front of their name are bacteria originating from the LC. The bacteria with $ in front of its name is the secondary bile acid producer. C. clostridioforme contains of two strains, one originating from the OMM microbiota, one originating from the LC, but are undistinguishable in the 16S rRNA gene analysis.

Figure 27: Bodyweight loss and survival of differently colonized WTBL/6-OMM mice.

Bodyweight loss of non-colonized twenty-two- to twenty-six-week-old WTBL/6-OMM mice and mice colonized with E. muris, the LC or the LC and E. muris combined during C. difficile infection (1000 C. difficile VPI 10463 spores per mice). (A) Body weight loss over a time span of 6 days. (B) Survival curve for WTBL/6-SPF1 mice.

4.7.3. Colonization with LC and E. muris combined caused a decreased Clostridioides difficile colonization WTBL/6-OMM mice colonized with the LC and E. muris did not show any signs of disease presented by the lack of bodyweight loss. To examine if this effect arises because C. difficile was not able to colonize the mice, twenty-four to twenty-six-week old WTBL/6-OMM mice were colonized with the appropriate groups one week prior to infection. The mice were weighed daily and sacrificed three days after infection. Cecum and colon samples were collected. In Figure 28 colonization of C. difficile in the cecum and colon are shown in the different groups for both the vegetative cells as the spores. No significant differences were found in the CFU/g of the vegetative cells in the cecum between any groups. Interestingly, comparing the amount of spores of the non- colonized mice and the mice colonized with a combination of LC and E. muris, the non-colonized mice feature significantly higher spore levels. Additionally, in the colon, both the CFU/g vegetative cells and the spores were significantly higher in the non-colonized mice compared to the mice colonized with the combination of the LC and E. muris. The CFU/g vegetative cells in the colon content was also significantly lower in the mice colonized with the LC and E. muris compared to the non-colonized mice and the mice only colonized with the LC. In conclusion, there is a lower colonization of C. difficile in mice colonized with both the LC combined with E. muris.

Figure 28: Colonization of C. difficile in differently colonized WTBL/6-OMM mice.

Twenty-two- to twenty-six-week-old WTBL/6-OMM mice were infected with 1000 spores of C. difficile VPI 10463 one week after colonization with the different groups. (A) Vegetative cells and spores in CFU/g cecum content three days after infection. (B) Vegetative cells and spores in CFU/g colon content three days after infection. Significance was performed using an unpaired two-sided Student’s t-test (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001).

4.7.4. Colonization of the LC and E. muris combined causes a decrease of intestinal inflammation after Clostridioides difficile infection Since C. difficile was able to colonize the WTBL/6-OMM mice colonized with the LC combined with E. muris, but did not show signs of disease, it was hypothesized that there was a decreased inflammation in these mice. Lipocalin-2 is excreted by the intestinal cells as response against intestinal inflammation. The higher the level of lipocalin-2, the more inflammation is present in the intestines. The same cecum and colon samples that were collected in the previous section were also used to measure the lipocalin-2 levels of the different groups. As shown in Figure 29, lipocalin-2 levels in the WTBL/6-OMM mice colonized with only the SCAP bacteria or with both the SBAP bacteria and the LC shows a significantly lower inflammation compared to the non- colonized mice in the cecum content. In the colon content a similar picture is shown: both the mice colonized with only the SBAP bacteria or with both the SBAP and LC show a significant difference with the non-colonized mice or the mice colonized with the LC. However, there was also found a

99 significant lower amount of lipocalin-2 in the mice colonized with both the LC and SBAP bacteria compared to the mice only colonized with the SBAP bacteria. Thus, the addition of the SBAP bacteria significantly reduces the inflammation on day three after infection and, in addition with the LC, it reduces the inflammation even more.

Figure 29: Intestinal inflammation levels measured by lipocalin-2 in the intestinal content.

Lipocalin-2 levels in ng/g cecum or colon content in the non-colonized WTBL/6-OMM mice and the differently colonized mice three days after infection. (A) Lipocalin-2 levels in the cecum. (B) Lipocalin-2 levels in the colon. Data was pooled from two separate experiments. Significance was performed using an unpaired two-sided Student’s t-test (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001).

4.7.5. Colonization of the LC and E. muris combined causes a decrease in toxin A production after Clostridioides difficile infection WTBL/6-OMM mice colonized with the LC and E. muris combined showed to have a decreased production of lipocalin-2, which indicates a lowered inflammation of the intestines. To examine if C. difficile produces toxin, a Toxin A ELISA was performed. As shown in Figure 30, non- colonized WTBL/6-OMM mice have a significant higher amount of toxin A in the cecum and colon compared to mice colonized with the LC, E. muris or both the LC and E. muris. In mice colonized with both the LC and E. muris, C. difficile did not produce toxin in the cecum of three out of six mice and not in the colon for five out of six mice. In addition, in the colon it was found that C. difficile in mice colonized with the LC also show a increased amount of Toxin A production compared with the mice colonized with the LC combined with E. muris.

100

Figure 30: Toxin A production in (non-)colonized WTBL/6-OMM mice after infection.

Toxin A levels in ng/g cecum or colon content in the non-colonized WTBL/6-OMM mice and the differently colonized mice three days after infection. (A) Toxin A levels in the cecum. (B) Toxin A levels in the colon. Significance was performed using an unpaired two-sided Student’s t-test (*p < 0.05).

4.7.6. Primary and secondary bile acids are significantly higher after colonization of the combination of LC and E. muris To substantiate the hypothesis that SBA producing bacteria are influencing the severity of the C. difficile infection by the production of SBAs, the next step was to examine the amount of secondary bile acids in the cecum and colon of the mice that were colonized with the different groups. Cecum and colon samples were collected from mice colonized with the appropriate groups and analyzed by liquid chromatography-mass spectrometry (LCMS). Figure 31 shows the results of the secondary bile acids deoxycholic acid (DCA), lithocholic acid (LCA), taurodeoxycholic acid (TDCA) and 7-oxo-deoxycholic acid (7-oxo-DCA). WTBL/6-OMM mice colonized with both the LC and E. muris showed to have a significantly higher amount in both the cecum and colon of DCA (Figure 31A), LCA (Figure 31B) and TDCA (Figure 31C) compared to any of the other groups. 7-oxo-DCA (Figure 31D) is significantly higher in WTBL/6-OMM mice colonized with the LC and E. muris in the cecum compared to mice colonized with only E. muris and in the colon compared to mice colonized with E. muris or the LC. Most interestingly to see is that the

101 secondary bile acids highly increase when mice receive the LC and E. muris together, but that this effect is not seen in mice who only receive E. muris, even though these bacteria are able to produce SBA. Surprisingly, the primary bile acids (Figure 32) present a similar trend. Taurocholic acid (TCA) (Figure 32A) and α-muricholic acid (α-MCA) (Figure 32B) in mice colonized with both the LC and E. muris show in the cecum samples a significantly higher amount of PBAs compared to any of the other groups. α-MCA was also in the colon significantly increased compared to the other groups. In addition, β-muricholic acid (β-MCA) (Figure 32C) and cholic acid (CA) (Figure 32D) show the same trend.

4.7.7. In combination with the LC, E. muris colonizes in higher numbers compared to colonization of E. muris by itself E. muris, in combination with the LC, produces significantly more secondary bile acids compared to mice that are only colonized with E. muris alone. This led to the hypothesis that the LC somehow supports or stabilizes the growth of E. muris within the microbiota. To quantify the amount of E. muris, multiple methods were used to assess the number of E. muris within both groups. Counting CFU/g feces or content was preferred, however, E. muris does not contain a workable natural resistance against distinct antibiotics. Thirty-two different antibiotics were used, and two antibiotics were found to not negatively affect the growth of E. muris: pipemidic acid and polymyxin B. However, E. muris grows limited on agar plates and the two antibiotics were not able to kill all other bacterial species from the microbiota of WTBL/6-OMM mice or the LC. Instead of culturing and being able to count the exact number of CFU, it was decided to examine the relative amount of E. muris within the groups. Two methods were used for this: qPCR and 16S rRNA gene analysis. To find the relative abundance of E. muris by qPCR, samples were diluted to 25 ng/µL DNA. Both a specific E. muris qPCR was performed as well as a total 16S rRNA gene qPCR, to be able to normalize the abundances found. Figure 33A shows the relative abundance of E. muris in the different groups quantified by qPCR. As shown, both WTBL/6-OMM mice colonized with E. muris as well as mice colonized with the LC and E. muris combined show a significantly higher amount of E. muris compared to the non-colonized mice or mice colonized with the LC. Interestingly however is that, when mice are colonized with the combination of E. muris and the

102

LC, they have a significantly higher relative abundance of E. muris compared to mice only colonized with E. muris. To confirm the data found in the qPCR, 16S rRNA gene analysis was performed. Figure 33B shows the results of the analysis. In this analysis, also the samples before colonization were added, which shows a significant difference between the before and after colonization relative abundances of E. muris in the mice colonized with E. muris or with the combination of the LC and E. muris. Comparing the samples acquired after colonization between the groups, the results are similar to the ones found in the qPCR. This substantiated the hypothesis that the amount of E. muris is higher in the mice colonized with the LC and E. muris compared to mice only colonized with E. muris.

4.7.8. The LC and E. muris together are able to protect mice from Clostridioides difficile infections As shown in the experiments performed in this chapter, E. muris is only able to protect the host against C. difficile infections in combination with the LC. Mice that are colonized with both E. muris and the LC show no bodyweight loss or death caused by the infection, nor any other symptoms like diarrhea. Additionally, the WTBL/6-OMM mice colonized with the LC and E. muris presented lower colonization rates, lower lipocalin levels and lower toxin levels compared to the other groups. Additionally, the mice have higher amounts of primary and secondary bile acids which is probably caused by higher numbers of E. muris colonization. The LC must thus consist of a bacterium (or multiple) that is (or are) able to enhance the growth by for example producing the correct nutrition, or stabilizing the niche for E. muris within the microbiota.

103

Figure 31: Secondary bile acid production in the (non-)colonized WTBL/6-OMM mice.

Amount of secondary bile acids measured as area under curve to compare between relative amounts of bile acids found in the cecum and colon. (A) Amount of deoxycholic acid (DCA) found in the cecum and colon content. (B) Amount of lithocholic acid (LCA) found in the cecum and colon content. (C) Amount of taurodeoxycholic acid (TDCA) found in the cecum and colon content. (D) Amount of 7-oxodeoxycholic acid (7-oxo-DCA) found in the cecum and colon content. Significance was performed using an unpaired two-sided Student’s t-test (*p < 0.05, **p < 0.01, ***p < 0.001).

104

Figure 32: Primary bile acid production in the (non-)colonized WTBL/6-OMM mice.

Amount of primary bile acids measured as area under the curve to compare between relative amounts of bile acids found in the cecum and colon. (A) Amount of taurocholic acid (TCA) found in the cecum and colon content. (B) Amount of α-muricholic acid (α-MCA) found in the cecum and colon content. (C) Amount of β-muricholic acid (β-MCA) found in the cecum and colon content. (D) Amount of cholic acid (CA) found in the cecum and colon content. Significance was performed using an unpaired two-sided Student’s t-test (*p < 0.05, **p < 0.01, ***p < 0.001).

105

Figure 33: Quantification of colonization of E. muris.

(A) Quantification of relative abundance of E. muris by qPCR. (B) Quantification of relative abundance of E. muris by 16S rRNA gene data Significance was performed using an unpaired two-sided Student’s t-test (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001).

4.8. Contamination of SBAP bacteria in WTBL/6-OMM mice

4.8.1. Contaminated WTBL/6-OMM mice did not show significant weight loss and death rates after C. difficile infection Trying to repeat the previous experiment, a problem occurred with the WTBL/6-OMM mice. Mice that were previously highly susceptible did not show any weight loss or death anymore after C. difficile infections. There was no difference in age compared to earlier experiments. Non- colonized WTBL/6-OMM mice or mice that were colonized with the appropriate groups were infected with 1000 spores of C. difficile VPI 10463. However, as opposed to earlier experiments and shown in Figure 34, mice did not lose weight after infection. Compared to the experiments performed in the chapter before, where mice were euthanized after three days because they reached a bodyweight loss of 20%, in this experiment mice did not lose any significant amount of weight. This experiment was repeated three times. It was hypothesized that these mice were contaminated

106 with bacteria that confer complete resistance against weight loss and death by C. difficile infections.

Figure 34: Weight loss of WTBL/6-OMM mice after infection.

Combined data (three separate experiments) of WTBL/6-OMM mice infected with C. difficile after contamination. WTBL/6-OMM mice infected with 1000 spores of C. difficile VPI 10463. Mice were not treated with antibiotics before infection. Significance was performed using an unpaired two-sided Student’s t-test.

4.8.2. Contaminated WTBL/6-OMM mice show a significant lower colonization of Clostridioides difficile To examine if these mice were able to completely resist the growth of C. difficile in the intestines, three days after infection mice were euthanized and the cecum and colon content along with the feces samples were taken. Figure 35 shows the results of the colonization of C. difficile. Mice were still colonized with vegetative cells, even though they did not lose any weight. However, C. difficile did not seem to produce any spores, since no spores were found three days after infection.

4.8.3. Contaminated WTBL/6-OMM mice carry the baiCD gene in their feces To examine if the mice were contaminated with a bacteria that was able to produce secondary bile acids, a qPCR was performed on one of the genes that is essential for SBA production, called the baiCD gene. Bacteria that are able to perform 7α-dehydroxylation possess this gene. The samples were put on gel after the qPCR to show that the product was the correct size and indeed contained the baiCD gene. All of the contaminated samples showed the presence

107 of the baiCD gene, while the non-contaminated samples did not contain any baiCD gene (data not shown). This points out that the bacteria that contaminates the mice is, at least, one bacterium with the ability to produce secondary bile acids, making the mice resistant against C. difficile infections.

Figure 35: Colonization after C. difficile infection in WTBL/6-OMM mice after infection.

WTBL/6-OMM mice infected with C. difficile after contamination. WTBL/6-OMM mice were infected with 1000 spores of C. difficile VPI 10463. Mice were not treated with antibiotics before infection. (A) Colonization of vegetative cells in cecum content. (B) Colonization of vegetative cells in colon content. (C) Colonization of vegetative cells in feces. Significance was performed using an unpaired two-sided Student’s t-test.

4.8.4. Metagenomics show the presence of two additional bacteria, including a secondary bile acid producer Feces from supposedly contaminated mice were send for 16s rRNA gene sequencing, together with feces from mice that were not contaminated. After analysis, no differences were found. This led two different hypotheses. Or the contamination exists in such a low abundance or the primers are not a good match for this bacterium, both causing it to not be visible in 16S rRNA gene analysis. To be able to get a more complete image of the bacteria that are present, metagenomics of all bacteria in the fecal matter were performed. After analysis, two additional bacteria were found: Dorea spp. and Anaerostipes spp. Comparing the genome, the Anaerostipes spp. appeared to be the same species as the one isolated and named in table 2. The Dorea spp. was found (in the NCBI blast database in December 2018) to be an unknown and uncultured bacterial species and additionally to contain the baiCD gene. This means that the bacterium thus must have the ability to produce secondary bile acids. The relative abundance of the Dorea spp. nov. 0.6%.

108

These findings led to the conclusion that these mice are indeed protected against C. difficile infections because of the acquired secondary bile acid producer Dorea spp. nov. in combination with Anaerostipes spp. nov.

5. Discussion 5.1. The importance of Clostridioides difficile research

C. difficile is a growing problem in health care facilities where there is a high usage of antibiotics. Antibiotics are used to treat bacterial infections, but additionally kills numerous beneficial commensal bacteria. By losing these bacteria, the colonization resistance also gets lost, making the host susceptible for other bacterial infections, like the gastrointestinal pathogen C. difficile.329 C. difficile mostly occurs in already weak patients: since most of them used antibiotics, these patients often have an underlying disease. Additionally, these patients are mostly older individuals, which are in general already weaker than younger people.134,154,330 The therapy used to treat C. difficile infections are antibiotics, which again not only target C. difficile but also the commensal bacteria. Around 30% of the patients will not recover and acquire a recurrent infection. A newer treatment is the fecal transplant, transferring the fecal matter of a healthy individual to the patient.331–333 However, recently, one patient who received a fecal transplant in the USA died afterwards because of it.284 More insight and studies are needed to examine which commensal bacteria are important for making a transplant successful, and if we can use this knowledge to discover better and more save treatments than antibiotics or fecal transplants.

5.2. Aging is a risk factor for Clostridioides difficile infections

Patients aged above 65 years have a five- to ten-fold higher risk of developing a C. difficile infection compared to patients below 65 years old. Not only is age a risk factor for infection, it also has worse clinical outcomes with higher chances on severity and mortality.334–336 More than 90% of the deaths caused by C. difficile occur in patients older than 65 years old.337–339 Examining the underlying mechanisms of this susceptibility of the aged host is thus important, since aging is a multifactorial occurrence. It has disruptive effects on many host defense systems, including the microbiota and immune responses.340–342 Added to that, elderly often use more medication,

109 antibiotics and in general spend more time in health-care facilities.330 From this perspective, we can see aging as the cumulative effects of a life-time exposure of disturbances combined with the degradation of the hosts tissue integrity and cellular functions. This results in an altered and possibly less stable microbiota landscape causing the heightened vulnerability to pathogenic invasion and bacterial translocation. Not only in humans we see this age difference in susceptibility for C. difficile, but also in mice this has been described. Shin et al. found a higher mortality in mice above eighteen months compared to eight week old mice when treated with antibiotics before infection.290 More interestingly, in early infection there was a weaker neutrophilic mobilization in blood and intestinal tissue and a lower amount of proinflammatory cytokines in the older mice. However, the colonization and toxin levels did not vary much between young and old mice. The major discovery of the study was that the microbiota of the eighteen month old mice showed significant deficiencies in the Bacteroides phylum, more specifically in the Bacteroides and Alistipes species. This is different from data in the experiments described in this study, where mice of all ages had the same microbiota composition. However, the old mice in this study were of a younger age compared to the old mice used by Shin et al. Of note, it was also reported that the mice in the study of Shin et al. did not originate from the same facility and thus there is a likely possibility that the starting microbiota already was different because of the origin of the mice and not because of aging. In order to verify their results, they would need to repeat the experiment with mice with the same origin as differences in neutrophil recruitment and cytokine production may also be an effect of the different microbiota compositions.290 Another study in 2018 by Peniche et al. stated that the aging impairs the host defenses by suppressing neutrophil and IL-22 mediated immunity.343 It was described that, comparable with Shin et al., middle-aged mice (twelve-fourteen months old) and young mice (two-four months old) showed a higher susceptibility for C. difficile infections and a worse outcome compared to young mice. A significant decrease in neutrophil recruitment to the colon was described, in addition to lower levels of cytokines IL-6, IL-23 and IL-22. Especially IL-22 was found to be important, since IL-22 administration to middle-aged mice reduced the severity of infection and prevented death of the mice. As opposed to Shin et al., Peniche et al. studied mice containing the same microbiota. The microbiota did not show age-related differences, which is in concordance with the data provided in this thesis. Together these experiments show that middle-aged and old mice are higher

110 susceptible towards C. difficile infections, after antibiotics treatment. However, in our experiments we found even in the age-range of nine to thirty-six weeks a difference in severity of disease. Older mice (above twenty-two weeks old) present a decreased survival rate, increased lipocalin levels and increased toxin levels compared to mice below eighteen weeks old. For future projects, investigating the exact mechanisms that increase the susceptibility for C. difficile infections would be a field of interest. Additionally, it would be interesting to identify at which age the decrease in neutrophil recruitment starts. The “young mice” used in the study by Peniche were eight to sixteen weeks old, which is, compared to the experiments in this study, in the age range of mice that did not die after a C. difficile infection. Hence as a follow-up experiment, it would be valuable to examine the neutrophil recruitment by histological scoring of infiltrated neutrophils into the lamina propria and ELISAs to measure cytokine production (IL-6, IL-23 and IL-22) as described by Peniche et al.343 In order to use this information to treat patients infected with C. difficile, it is important to know what affects the changes in cytokine production, which factors are important for these changes and how to reverse the aging effects on the immune function of the microbiota and the host combined.

5.3. Colonization resistance and antibiotics react similar in different microbiota settings

Colonization resistance contains the resistance of the entirety of the microbiota against different gastrointestinal infections, for example C. difficile infections.251 Most bacterial species in the intestine belong to the Firmicutes, Bacteroidetes, Actinobacteria and Proteobacteria phyla and it harbors a highly diverse collection of bacterial species and even strains.41,344 As long as the microbiota is not disturbed, the risk of getting infected with C. difficile is very low. However, antibiotics also affect the commensal bacteria of the microbiota which are then inhibited or killed by this treatment, causing a reduced diversity of the total microbiota. Specifically, antibiotic treatments with clindamycin, cephalosporins, penicillins and fluoroquinolones increase the risk towards C. difficile infections.345–347 The reduced microbiota show a disturbed production of short chain fatty acids (SCFA) and secondary bile acids.348–350 The overall metabolic activity, including lipid metabolism, amino acid metabolism and carbohydrate metabolism is altered.262,351–353

111

Not all antibiotics influence infection susceptibility in the same way. In a study performed by Schubert et al., several antibiotics were tested for their ability to disturb the microbiota in such a way that C. difficile was able to infect the mice. C. difficile was not found in mice that were not treated with antibiotics. Additionally, C. difficile was also not able to infect mice that were treated with ciprofloxacin or vancomycin. In contrast, after ampicillin, clindamycin, streptomycin, metronidazole or cefoperazone (belongs to the cephalosporins) treatment, mice were highly colonized (up to 108 CFU/g feces) with C. difficile.354 In another study, performed by Theriot et al., mice received different antibiotics, including clindamycin, vancomycin and metronidazole. In contrast to Schubert et al., they collected the content after antibiotic treatment and added spores directly in the content rather than performing in vivo infections. They examined the outgrowth of C. difficile after six hours of incubation and found, in concordance with the study described in this study and Schubert’s study, that mice that did not receive antibiotics showed no germination and outgrowth of C. difficile. They also show that mice treated with the antibiotics clindamycin and vancomycin did show germination and outgrowth of C. difficile. Mice treated with metronidazole however did not show any germination or outgrowth of C. difficile ex vivo. They associated the colonization resistance to be associated with secondary bile acids.287 In conflict with the results found by Schubert et al., they did find a higher susceptibility when the mice were treated with vancomycin. It could be argued that, since the starting microbiota is different, the effect of the vancomycin treatment could also show differences. To examine if mice with different starting microbiota compositions would all react the same to C. difficile infections with or without antibiotics, mice acquired from different vendors or originating from our in-house facility were used in this work. Half of the group received antibiotics. As expected, the mice that did not receive any antibiotics, did not get infected by C. difficile, no matter which microbiota composition they had. In contrast, all mice that were treated with clindamycin prior to infection did get infected by C. difficile. The only difference was that mice that were bought at a vendor died four days post infection while mice originating from the in-house facility died three days post infection. This points to the hypothesis that the microbiota composition itself is not important, but the colonization resistance that the microbiota produces confers protection from C. difficile infections. Antibiotics disturbs the microbiota and thus the colonization resistance. In this study, the use of clindamycin showed that the starting microbiota

112 was not important and that the antibiotics disturb the microbiota in such a way that mice will not have colonization resistance anymore. In summary, the microbiota itself, when it is undisturbed and contains a high diversity and complexity, in both mice and humans, confers colonization resistance against C. difficile, independent of the composition of the microbiota. Different antibiotics cause different disturbances, which all lower the diversity of the microbiota. However, not all antibiotics result in a lowered or weakened colonization resistance against C. difficile. When a specific kind of antibiotic does diminish the colonization resistance, it will do so in most microbiota compositions. Mice treated with clindamycin, which decreases the relative abundance of Lachnospiraceae, Rikenellaceae, Ruminococcacea, Muribaculaceae and Verrucomicrobiaceae, present an increased susceptibility for C. difficile colonization.

5.4. CDprsA2 is involved in the colonization of Clostridioides difficile

As mentioned in the introduction, prsA2 is part of the parvulin class of the PPIases. PPIases are involved in stress tolerance, protein homeostasis and secretion. It has been shown that PPIases are contributing to the virulence and pathogenicity. Since C. difficile 630 contains prsA2 homologs of the L. monocytogenes, and it was found to be an active parvulin, the closest homolog was chosen to be mutated. The effect of a mutation of the prsA2 gene in C. difficile has been initially examined in vitro.244 In vitro growth curves showed no differences between the mutant and the wild type strain, however, it was shown that the C. difficile prsA2 (CDprsA2) is involved in the stress response. For example, there was found to be a significant reduction in the resistance against metronidazole for the mutant strain, however, the strain was less susceptible toward the secondary bile acids LCA and DCA compared to the wild type strain. This is quite interesting since secondary bile acids are known to inhibit the growth of C. difficile. By having a lower antibiotic effect of secondary bile acids in the mutant strain, it is highly likely that prsA2 is involved in this process. It might be possible that the outer membrane contains fewer (unknown for now) receptors for bile acids, caused by the mutation, since prsA2 is involved in both protein homeostasis and secretion of proteins. In addition, the mutant strain had an impaired germination in medium containing primary bile acids. This, together with the information that secondary bile acids LCA and DCA show a lower antibiotic effect, shows that prsA2 is important in responding to the different bile

113 acids. How exactly prsA2 affects the bile acid uptake or response is not known yet. However, aside from these in vitro results, our in vivo experiments found that the C. difficile mutant strain caused a lower colonization of vegetative cells in cecum and colon and of spores in colon and fecal matter. Multiple studies have shown that homologs of the CDprsA2 often contribute to pathogenicity by secreting extracellular virulence factors.225,242,243 The reduced response to bile acids might have an influence also on the in vivo infection and may explain why the mutant has reduced colonization in mice. Additionally to these results, it also has been found that, in a transcriptomics experiment performed by Fletcher et al., during the first thirty hours of infection, CDprsA2 production significantly was upregulated.355 Together with the data described in this work, it shows that CDprsA2 contributes to the severity of the infection and the response towards primary and secondary bile acids.

5.5. The Rnf-complex is involved in the production of spores in early infection

As described in the introduction, the Rnf-complex is important in the energy production of Clostridia species. The Rnf-complex is hypothesized to generate a proton gradient and thus enable synthesis of ATP by an H+-translocating ATPase. In C. ljungdahlii, the Rnf-complex is the only proton pump responsible for a proton motive force that is necessary for ATP synthesis during in vivo growth. Additionally, the Rnf-complex participates in energy conservation.245 The Rnf- complex is located on the membrane and consists of multiple parts, including rnfC. The rnfC gene is mutated in the study performed in this thesis.246 In in vitro data, performed by collaborating partners and not yet published, the rnfC mutant presents a growth arrested behavior in comparison to the wild type and displayed impaired flagellar formation. For this reason, mouse experiments were performed to examine the effect of the mutation in infection. The in vivo data showed that there is no difference in vegetative growth of a C. difficile strain with the rnfC gene or a strain where this gene is mutated. However, after twenty- four hours, the mutant was not able to produce any spores in the intestine while the wild-type did produce spores. This effect disappeared in late infection: on day three, the mutant strain produced the same amount of spores as the wild-type strain. It was hypothesized that, since the Rnf-complex is important for the energy production, the mutant does not synthesize enough ATP to both grow

114 in vegetative cells and produce spores at the same time. After the early infection, the C. difficile is colonized within the intestines and the microbiota and therefore only needs to maintain the colonization. The energy that was spend on vegetative cell replication could then be focused on spore production. Alternatively, other Rnf-complex-independent energy generation is utilized at this time point. By targeting the Rnf-complex, it might be possible to slow down the infection by creating an energy-deficiency. By using this at the same time as antibiotics, the vegetative cells would not be able to produce enough energy to both replicate and produce spores at the same time. More research is needed to find the exact mechanisms of how the Rnf-complex is influencing spore production and pathogenicity.

5.6. Dangers of fecal transplants and the advantage of limited consortia

Fecal transplants have been proven highly effective against C. difficile infections and especially recurrent infections.331,332,356–359 It is generally believed that fecal transplants recover the colonization resistance against C. difficile infections. When a patient receives a fecal transplant, the whole fecal matter is being transferred from the donor to the recipient. The danger of FTs lies in the fact that it is not known exactly what a fecal transplant consists of, since a lot of factors play a role. The microbiota does not only consist of bacteria either, there are, for example, also bacterial phages present, and numerous metabolites made by either the host or the microbiota, which are being transferred as well. In normal circumstances, drugs are produced under controlled conditions, where the ingredients and contents of the drugs are completely known and examined. For fecal transplants, this is not the yet case. With 16S rRNA gene amplicon sequencing, there is a rough idea of which bacteria are being transferred, and selective analyses can test for specific intestinal pathogens (bacterial, viral or parasitical), antibiotic resistant bacteria and other intestinal and non-intestinal donor derived diseases like inflammatory bowel disease (IBD), Human immunodeficiency virus (HIV) and Hepatitis.333 There are also theoretical hazards of transplanting bacteria that could make the recipients more susceptible to chronic conditions like obesity or autoimmune disorders.360 The selection of donors include diverse screenings, together with a questionnaire similar to those who are potential blood donors. Exclusion data includes, but is not

115 limited to, HIV or Hepatitis B or C infection, high-risk sexual behavior, recreational drug usage, gastrointestinal diseases like IBD or history of chronic constipation and diarrhea, as well as medical drug usage that can influence the microbiota.361 However, a lot of uncertainties remain. Even if it would be possible to identify every single bacterium or virus in the fecal matter, the genomes from similar species can differ greatly, caused by acquired plasmids and mutations in the genome. However, with the current technologies it is not even possible to identify every single bacteria in the fecal sample. In June 2019, two patients fell ill, and one of them died, after receiving a fecal transplant containing an antibiotic resistant E. coli strain, which was announced by the Food and Drug Administration (FDA).284 Despite throughout screening for all known pathogens and all known antibiotic resistances, there is a remaining chance that unknown pathogens or resistances can be transferred to a patient. Another possibility is that bacteria, which currently are classified as commensals, could be attributing to diseases in specific microbiota states or in immunocompromised states of the host. There are suspicions and preliminary data of pathobionts that are attributing to specific non-intestinal diseases, like atherosclerosis, insulin sensitivity and Crohn’s disease.362–364 Other uncertainties are the potential donor metabolites, cells and potential immune regulators like IgA.365–367 Long-term effects of fecal transplants are also still unknown.368 Overall, it is better to reduce the risk of introducing pathobionts, antibiotic resistant bacteria and possible other pathogenic organisms like viruses. Using a small consortium of bacteria, from which all of them are genomically sequenced, the problem of transferring unknown material into the patient is avoided. Additionally, these single bacterial strains can be tested for antibiotic resistance genes and other possible pathogenic genes. A number of laboratories are trying to isolate specific bacterial species that provide resistance to C. difficile infections. Some groups are testing a consortium of bacteria, for example Tvede et al., who demonstrated that a consortium of ten different bacterial species can treat a C. difficile infection.369 But single bacterial strains are topics of research as well. For example, one bacterial species belonging to the Lachnospiraceae family has shown to be involved in the reduction of C. difficile in germ-free mice.260

5.7. The difference between C. scindens and E. muris

In a study by Studer et al, it was shown that C. scindens can inhibit C. difficile in the early infection, however, it does not confer complete protection to save the mice from dying of the infection in the

116 later phase of the infection. This experiment was performed in OMM mice, which contain the same microbiota composition as the mice used in this study.289 C. scindens is a SBA producer, and converts primary bile acids into secondary bile acids, similar to E. muris. The production of SBAs in both bacterial strains was confirmed both by secondary bile acid mass spectrometry and a qPCR of the baiCD gen. However, C. scindens is a bacteria originating from the human gut microbiota while E. muris originates from the mouse microbiota.294,370 As shown in Figure 22, C. scindens did not confer an improvement in survival, while E. muris did cause a significant improvement. It is possible that the human-associated secondary bile acid producer was not able to completely colonize the mice. It was also confirmed in plating assays that not all WTBL/6-OMM mice were colonized with C. scindens after colonization. Addressing these concerns with the authors of the paper, Studer et al. confirmed that their mice were not always colonized and when not colonized, subsequently excluded from the experiments. There have been discussions about the effect of transferring human microbiota into mice, producing so called human microbiota associated (HMA) mice. The microbiota and the host have both been shaped by coevolution. This means that many of the bacteria are host-specific and that the human microbiota contains different bacterial strains compared to the mice microbiota or even other animals. Certain gut microbes have evolved specific genetic traits that facilitates host adaptation and thus are beneficial for survival in that specific host, and both host and microbial factors have an influence on the colonization and interactions between one another.371,372 Additionally, only 15% of gut bacteria lineages are shared between mice and humans.373 In a study performed by Seedorf et al., it was found that mouse-adapted bacterial species outcompete colonization of human gut bacteria within a period of fourteen days.374 Additionally, HMA mice have an altered immune response, as it was shown by Chung et al. HMA mice develop reduced numbers of innate and adaptive intestinal immune cells and show a lower expression of antimicrobial peptides within the intestines compared to mice harboring a mouse microbiota. In addition, these mice have a lower efficiency in clearing infections like Salmonella enterica serovar Typhimurium.375 The data in this thesis confirms these results: mice containing the human SBA producing microbe have a higher susceptibility towards C. difficile infections compared to mice containing the mouse specific microbe. It might be possible that there are other mechanisms behind the lowered colonization, for example that C. scindens needs a different niche or different nutrition which is not available in the WTBL/6-OMM mice.

117

To examine if it is indeed connected to the coevolution of the microbiota with the host or if it is something specific for C. scindens in this particular setting, two types of experiments could be conducted. The first experiment is to isolate and test more than one human and one mouse- derived SBA producer. By using different SBA producing bacteria, both originating from human and mice, and possibly also other hosts, the effect of the coevolution on the susceptibility towards C. difficile in the OMM mouse model could be examined. Another experiment would be to use different microbiota settings. Perhaps this particular microbiota does not support the colonization and outgrowth of C. scindens within the mice, while other microbiota compositions might be able to do so. By using different microbiota settings, it would become clear if this effect is connected to the microbiota itself or with issue of the host issue.

5.8. Muribaculaceae species and its functions within the microbiota

The family Muribaculaceae, previously known as the S-24/7 family and part of the Bacteroidetes phylum, is dominantly abundant in the mouse intestinal microbiota and can also be found in the intestines of multiple other animal species. The functions and interactions of these bacteria with the host were still unknown. During the isolation of bacterial species of the microbiota, twenty- five isolates of this family were cultivated. Most of them were short-term isolates, which shows that they need some nutrition sources which were not available in the bacterial growth media used or perhaps it needs other bacterial species or the metabolites of other bacterial species to be able to replicate and survive. However, multiple strains were able to at least grow to 1 mL cultures, which was enough for whole genome sequencing, and one species was not only stable during passaging, but could also be revived after storage in glycerol at -80˚C. In collaboration with the group of Prof. Dr. Thomas Clavel, numerous species were cultivated. The DNA was used for whole genome sequencing and subsequently the S24-7 family was renamed to “Muribaculaceae”.328 In total, five different strains could be maintained in culture. Muribaculaceae belong to the Bacteroidales. The first time this bacterial family was mentioned was by Salzman et al. in 2002 where they described a bacterial species with an abundance of 20% to 30% of total bacteria residing in the mouse gut microbiota.376 In 2018, Ormerod et al. performed a study with Muribaculaceae based on thirty genomes of members of the, as they were previously known, S24-7 family. Although they did not have isolates, genomes

118 were assembled from shotgun metagenomic sequence datasets. It was reported that the species live in homeothermic animals, dominantly in the gut of rodent species, and they have a versatile number of gene sets encoding carbohydrate-active enzymes.377 In the literature, there is no common name to call these bacterial species. Some databases call the species “Porphyromonadaceae” (in RDP) or just “S24-7-group” (in SILVA), or “Homeothermaceae” as proposed by Ormerod et al.313,314,377 Determining the functions of the Muribaculaceae, it was found that the species itself formed a cluster well-separated from the neighboring families, with specific functional features that were shared between the Muribaculaceae species but not with other Bacteroidales families. Specific to the Muribaculaceae genomes are benzoate resistance and nitrogen utilization. Muribaculaceae species are predicted to degrade complex carbohydrates, separated into three different categories: α-glucans, plant glycans and host glycans, which was also mentioned in Ormerod et al.377 This could explain the fact that there are multiple Muribaculaceae species present in one single mouse microbiota since different strains utilize different nutrient sources. Up to eight different species were found to co-occur in one gut microbiota. Furthermore, phylogenomic analysis revealed that there were four distinct clades within the Muribaculaceae, in which clade four was represented with the five strains that were able to be cultured and maintained over time. The name proposed to the genus of the strain isolated in this study is called Duncaniella gen. nov., in honor of Dr. Sylvia Duncan for her contribution to research on gut bacteria. Duncaniella spp. nov. had a 90.1% identity with its closest relative M. intestinale based on 16S rRNA gene sequencing. It is one of the most dominant and prevalent species studied and has a relative abundance of up to 6.6% found in 18% of the over 10.000 mouse microbiota samples. The species is called Duncaniella muris.328 The precise functions of the bacteria belonging to the Muribaculaceae family within the mice still remain unclear. A way to examine the functions is to perform a colonization in either germ-free mice or gnotobiotic mice to see the effect of this one particular bacterial species on the metabolites made and also the effect of the colonization on the mouse immune system can be established. For this, species of the other clades, not only clade four, should be isolated and be able to be cultured to find out if there is a difference between the different clades. The problem of the inability to maintain the cultures of the other clades would need to be solved for this experiment to be possible. Using rich media containing complex carbohydrate sources, it might be possible to

119 keep the bacteria in culture, since the inability to grow them probably originates because of the absence of specific essential nutrient sources or other favorable aspects of their natural habitat, like pH or osmotic conditions.378 Perhaps it would be possible to use a filtrate of the gastrointestinal contents of the mouse microbiota to be able to grow them, however, this would mean we would need a large amount of intestinal content of the mice. A better solution would be to find the nutrients that are necessary for the growth of the bacteria.

5.9. The in vitro and ex vivo inhibitory effect of the bacteria of the limited consortium

Bacteria that can produce secondary bile acids are able to at least partially inhibit the growth of C. difficile, but not confer complete resistance in our mouse model. To get a better understanding of the functionality of other species of the microbiota, the bacteria from the limited consortium were chosen because they are not able to produce secondary bile acids. To assess if these bacteria have inhibitory effects on C. difficile, two different in vitro assays and one ex vivo assay were performed. The two in vitro assays did not show any inhibitory effect, not from the bacteria from the LC, not from the secondary bile acid producing bacteria and also not from the combination of all LC bacteria or all LC bacteria combined with a secondary bile acid producer. This was unexpected, since both C. scindens and E. muris are able to produce secondary bile acids. However, since these assays were in vitro, two things might have occurred. 1). In the in vitro assays, C. difficile was used in its vegetative form, not in the spore form. This could be problematic when the inhibition would occur by inhibiting spores to germinate. However, since C. difficile spores need the primary bile acids taurocholate to germinate, and it is known that bile acids are able to inhibit the growth of bacteria, it was not possible to start with spores. 2). The medium used was not able to support E. muris and C. scindens in a way that they were able to produce secondary bile acids, for example since there were no primary bile acids in the media that could be converted into secondary bile acids. Both hypotheses could explain why there was no inhibition of C. difficile in these assays. During the ex vivo experiment, where the intestinal content of antibiotic treated mice was used, C. difficile was used in its spore form. Interestingly, the ex vivo assay did show the inhibitory effect of the secondary bile acids, however, all but one bacteria of the LC did not show any

120 inhibition of the growth of C. difficile. Also, the LC combined with E. muris was able to inhibit C. difficile, but the LC by itself was not. Since the intestinal content of mice treated with antibiotics contains primary bile acids, but not secondary bile acids, C. difficile spores were able to germinate. However, also E. muris and C. scindens were able to use these primary bile acids and convert them into secondary bile acids.

5.10. The protective effect of the LC and SBAP bacteria

The increased survival of WTBL/6-OMM mice colonized with the combination of LC and E. muris that are infected with C. difficile shows that these seven bacteria together are sufficient to protect the mice against C. difficile in this specific gnotobiotic mouse model. This is further supported by the colonization levels and lipocalin-2 levels, from which the latter is a marker for intestinal inflammation. In addition with the increased levels of SBAs in the intestinal content and the increased relative abundance of E. muris, a possible mechanisms is that the bacteria of the LC support or stabilize the growth of E. muris in mice. Higher relative abundance of E. muris leads to higher levels of secondary bile acids that confer an increased inhibition of C. difficile compared to the other groups. Other studies have shown that secondary bile acids are inhibiting C. difficile infections, and thus this is a reasonable hypothesis of how the E. muris and the consortium are conferring complete resistance against the infection.253,265,289 The mechanisms behind the effect of the LC on the increased relative abundance of E. muris is still unknown. It is possible that there is a supporting effect of the LC that stabilized E. muris colonization and/or the growth. In order to understand the mechanisms of protection, the protective bacterial species of the LC has to be identified. This would allow for the measurement of metabolites and gene expression of E. muris and the additional colonizing bacterial species. By comparing the gene expression of E. muris with this strain and without, the differences in gene expression could give a hint of what metabolites are important for stabilization. One of the hypotheses is that there are bacteria in the LC that are able to initiate the bile acid metabolism via bile salt hydrolases (BSHs).379,380 These enzymes are important for deconjugation of the glycine and taurine that bind to the primary bile acids, for example TCA would need to be deconjugated to CA before it can be subsequently undergo 7α-dehydroxylation, which is performed by the SBA producing bacteria to generate secondary bile acids.381 The amount of TCA and CA in WTBL/6-OMM mice are similar, however, after adding the LC and E. muris, 121 both significantly increase. There is a trend that CA has a higher increase compared with TCA, looking at the area under the curve. Furthermore, both I. butyriciproducens and Anaerostipes spp. nov. are butyrate producing bacteria. Studies have found that butyrogenic bacteria are depleted in C. difficile patients.248 In mice similar findings have been found.258 Additionally, SCFAs, which are made by the commensals of the microbiota, have immunomodulatory effects and improves host response against inflammatory and infectious stimuli.382–384 There is evidence that the SCFA butyrate protects the host from C. difficile induced colitis.385,386 Butyrate itself does not inhibit C. difficile growth or toxin production. However, butyrate increases the expression of tight junctions in the epithelial cells and reduces intestinal inflammation and bacterial translocation. This way it attenuates the intestinal inflammation and improves the intestinal barrier, and thus reduces intestinal epithelial permeability. Fachi et al. found that oral administration of butyrate protects against C. difficile infections, in addition to butyrate activation of the hypoxia inducible factor-1 (HIF-1) in intestinal epithelial cells. Because the activation of HIF-1, expression of genes related to the paracellular junctions were higher, the tight junctions were tightened and the permeability decreased.387 To test the hypothesis that butyrate-producing bacteria, in combination with the SBA producing bacteria are able to protect the host from C. difficile infections, an experiment could be performed where E. muris is added together with a supplement of butyrate, which can be given orally. Mice receiving the combination of butyrate plus E. muris would then present an increased resistance against the infection.

5.11. The protective effect of the contamination on Clostridioides difficile infections

As mentioned in the results, a new mouse model was (accidentally) created after contamination of the WTBL/6-OMM mice. The first evidence of the presence of a contamination were the absence of weight loss and death of the mice which usually occurs during C. difficile infection in this mouse model. Multiple techniques have been used to confirm the contamination of these C. difficile- infection-resistant mice. Of note, using 16S rRNA gene sequencing, the contamination was not found, which might be caused by the low abundance of the bacteria that contaminated the mice. However, the baiCD-gene qPCR revealed that at least one secondary bile acid producing bacteria

122 was present in the microbiota. The production of secondary bile acids was shown by mass spectrometry, which proved the presence of a contamination in the mice. After metagenomic sequencing of the microbes of the intestinal content, two unknown bacterial species were found in the mice. After genome comparisons, one of the new bacteria was identified as Anaerostipes spp. nov., which is identical to the one found in the LC. The second bacterial species was identified as Dorea spp. nov. and genome sequencing confirmed that the bacterium contains the baiCD-gene and thus is able to perform 7α-dehydroxylation. Dorea is a genus of strict anaerobic, gram-positive and non-spore-forming bacteria in the Lachnospiraceae family.388 Since the contamination happened in a sterile and antiseptic environment, it seems unlikely that non-spore-forming and strictly anaerobic bacteria were able to contaminate. Spores are much more robust and thus more likely to survive treatments to kill bacteria compared to vegetative cells. However, in order to examine the newly identified Dorea species, the strain would need to be isolated. Numerous attempts have been performed to isolate the new bacterial species; however, the attempts were unsuccessful. Different bacterial growth media were used in the effort to isolate the bacterial species, which were carefully chosen from studies that have been successful in isolating secondary bile acid producing bacteria, like Gifu Anaerobic Broth, Liquid Casein Yeast medium and Peptone-Yeast extract broth.389 Interestingly, the second additional bacteria found in the contaminated WTBL/6-OMM mice was the same Anaerostipes spp. nov. found in the LC. This species, together with the Dorea spp. nov. and the bacteria of the microbiota of WTBL/6-OMM mice conferred complete resistance against C. difficile infection, however, not against colonization. It would be very interesting to examine the effect of Anaerostipes spp. nov. together with the SBAP bacteria E. muris in WTBL/6- OMM mice, to be able to confirm the protective effect of the Anaerostipes spp. nov. added with a SBAP bacteria. However, in order to verify the protective effects, a non-contaminated WTBL/6- OMM mouse model is needed, and all efforts to recreate the non-contaminated WTBL/6-OMM mice were unsuccessful. Since the origin of the contamination is unknown, the contamination problem could not be solved. Despite replacing the breeding pairs in our facility, the second and third breeding pair received from the MHH showed the similar problems. Water and food sources were tested for contaminations, as well as the bedding materials but these proved to be negative for the contamination. 16S rRNA gene analysis performed on fecal samples originating from the MHH

123

WTBL/6-OMM isolators was also negative for the contamination. Nevertheless, some mice we received from the MHH showed signs of disease after C. difficile infection while other mice were not affected at all. Mice received from the MHH were housed in isocages at the HZI a couple of days prior to be used for experiments, which makes originating the source of the contamination problematic. Two potential solutions to the contamination problem could be: 1) Culturing all twelve bacterial strains originating in the WTBL/6-OMM microbiota separately and colonizing germ-free mice with these strains. The bacterial strains can be sequenced before colonizing as confirmation to prevent contaminations. The bacteria would only need to be bought once, and by freezing them in glycerol stocks, the bacterial stocks would be able to be used for a long time, which makes it a cheap method. The disadvantage of using separate cultures is that there is always a chance to contaminate the cultures or the chance that some cultures do not grow at similar rates. 2) Purchasing the specific “OMM-bacterial mix” at the DSMZ. By colonizing germ-free mice with this already premade OMM bacterial mix, mice would be colonized with the correct mix and there would be no need to culture the bacterial strains beforehand. The advantage of using a premade mixture is the decreased chance on contamination caused by culturing. The disadvantage of this model is that these premade mixtures have to be purchased for every experiment, and thus is it more expensive.

5.12. Future experiments

5.12.1. Confirmation that the protection originates from the 7α-dehydroxylation gene in SBA producing bacteria One of the ways of confirming that the 7α-dehydroxylation gene of these specific SBA producing bacteria is the cause of the protection is by replacing the SBA producing bacteria Extibacter muris with another SBA producing bacteria. As described in the previous chapter of the discussion, another SBA producing bacteria was found to confer protection, in combination with the Anaerostipes spp. nov., towards C. difficile infections in our contaminated WTBL/6-OMM mice. Isolating this Dorea spp. nov. would be helpful in examining the effect of SBA producing bacteria in the limited consortium of bacteria. Other SBA producing bacteria would also be helpful in confirming that the protection originates from these 7α-dehydroxylating bacteria. However, this

124 would never completely confirm that it is this exact gene that causes the protection. It might be possible that all of these bacterial species have another gene which is independent to the 7α- dehydroxylation gene, but the more 7α-dehydroxylating bacteria are tested, the more it is substantiated that this is the mechanisms behind the protection. Mutating and disabling the 7α-dehydroxylation gene is a second way of confirming that this is the gene responsible for the protection. By constructing a mutated bacterial strain like Extibacter muris, that previously was able to produce SBA but after mutation unable to convert PBA into SBA, mice can be colonized with these mutated bacteria combined with the limited consortium and conduct a C. difficile infection. When the mice are not present protection against C. difficile anymore after mutating the 7α-dehydroxylation gene, then it is certain that this is the mechanism behind the protective behavior against C. difficile. There are multiple ways of confirming that the bacteria indeed lost the baiCD gene, for example, using the qPCR primers and performing a qPCR of the baiCD gene should result in a negative qPCR compared to the non- mutated strain. Also measuring the amount of SBA in the fecal samples after colonizing the mice with the mutated SBA producing bacteria and the limited consortium should results in an absence of SBA.

5.12.2. Elimination of bacteria in the limited consortium The limited consortium of bacteria consists of six bacteria, which is already a low number of different bacteria. However, it is preferable to use the lowest amount of bacterial strains possible. Additionally, this would also help in understanding which bacterial strain is supporting the SBA producing bacteria, how it is supporting and what metabolites it produces. To start with eliminating, we can split the bacteria by phylum and colonize mice accordingly with the different groups, which would make it possible to eliminate a whole phylum. In the case of the elimination of Firmicutes and one of the other two phyla (Bacteroidetes or Proteobacteria), it would be immediately clear which bacterial strain aids in the protection against C. difficile. When this is not the case, and the bacteria is part of the Firmicutes, this group has to be divided into individual bacteria, which then would be transferred into the WTBL/6-OMM mice in combination with the SBA producer. One hint to which bacterial strain might be the one that protects against C. difficile, lies in the contaminated mice. During our examinations of the contamination, we found via metagenomic

125 sequencing that the Anaerostipes spp. nov. was able to protect completely against C. difficile infections, in combination with the SBA producer Dorea spp. nov. Species of the Anaerostipes genus are known to produce butyrate, which is a SCFA. SCFAs are also negatively correlated with C. difficile infections, not by C. difficile colonization or toxin production, but by attenuating intestinal inflammation and improving the intestinal wall permeability, thus protecting the intestinal epithelial cells.387

5.12.3. Testing the effect of the limited consortium and the secondary bile acid producer in different microbiota settings During the experiments, WTBL/6-OMM mice have been used as mouse model for Clostridioides difficile infections, since they are highly susceptible for C. difficile infections. The commensal bacteria from these mice are not able to produce any SBAs. The limited consortium plus the added SBAP Extibacter muris are able to protect these mice against a C. difficile infection. However, we do not know if this mixture will work in different microbiota settings. To test this, mice containing different microbiota compositions would need to be treated with antibiotics, before receiving the limited consortium, SBAP bacteria and the C. difficile infection. By using multiple microbiota compositions, it should be easier to confirm and prove that the mixture indeed protects against C. difficile, not only in the WTBL/6-OMM mice but in a more general sense. Importantly, in a normal human situation, the patient has been treated with antibiotics before infection, so this would also imitate more the development of the human infection, and thus how the treatment would work in future plans.

5.13. Limitations of the study

5.13.1. Good as protective measure, but how good is the mixture of bacteria as treatment of Clostridioides difficile infections? In all these experiments the mice were colonized with the limited consortium, added or not with the SBA producing bacteria, one week before the C. difficile infection. In normal human circumstances, it would be possible to give this cocktail of probiotic bacteria directly after an antibiotic treatment, taking into account the wash-out of the antibiotics. This way, C. difficile would not have a chance to colonize and infect the host. However, there will always be cases where

126 a patient already is colonized with C. difficile or gets infected with C. difficile during or directly after the antibiotic treatment. It is thus of importance to examine the effect of giving the probiotic cocktail after a C. difficile infection, to examine if the consortium can not only prevent, but also cure the infection. Performing a study where the LC plus SBA producing bacteria are given after infection would be interesting, to see the effect of the mixture after infection. However, WTBL/6- OMM mice or WTBL/6-SPF1 mice already die of the consequences of C. difficile three days after infection. Choosing the right day to give the mixture could be difficult as the mice do not show any signs of disease on day one, while day two could already be too late. Therefore, WTBL/6- SPF2, -SPF3 or SPF-4 mice could prove to be more suitable, as they all survived the third day but died four days after infection. In this case the mice could be colonized with the mixture of bacteria two days after infection, and survive two more days to see improvements. This way, the six bacterial species would not only be able to serve as probiotic, but also as treatment.

5.13.2. From mice to human: how useful are mouse studies? As already discussed earlier in the discussion, in the end it is important to translate the data received from the animal experiments to the human situation. It is of course important to acknowledge that all the bacteria used in this study, with the exception of Clostridium scindens, are mouse specific bacteria. Thus, there might be a possibility that in a human case, this specific consortium of bacteria will not be able to colonize and protect in a human C. difficile infection. Both the macroscopic anatomy as the microscopic anatomy of the intestines differ from human and mice. Mice have, compared to humans, a significant larger cecum. Additionally, the distribution of specific cells, like Paneth cells or mucin-producing goblet cells is different in mice compared to humans. But most importantly, the bacteria from the microbiota co-evolved with the host. 85% of the bacterial genera found in the mouse intestines is not found in human intestines373,390. To translate the data from mice to humans, a couple of experiments are necessary. The first one would be to repeat the mice experiments with mice models containing a humanized microbiota, the HMA mice. By using WTBL/6-GF mice, a fecal transplant with human fecal matter can be performed. First using healthy individuals, mice would receive antibiotics before they receive the limited consortium added with the SBA producing bacteria Extibacter muris, followed by a C. difficile infection. On condition that the limited consortium with the SBA

127 producer can protect the mice from C. difficile infections, the next step would be to transfer the fecal matter from patients suffering from C. difficile infections into the WTBL/6-GF mice and treat them with the mixture. Problematic is that HMA mice have a diminished immune system and immune response and thus might be giving false results when mice do not show any increase in survival has to be acknowledged. A next step would be to start a human trial. There is a chance that, since all bacteria are mouse specific bacteria, colonization of the human gut will be problematic. Therefore it is important to find bacteria with similar functions from similar genera, that possibly have the same effect in humans as the LC has in mice. This would also mean that, instead of using Extibacter muris, Clostridium scindens might be a better candidate, since this is a human secondary bile acid producing bacteria. It might be wise to first perform in vitro experiment with fecal matter of humans treated with antibiotics, of mice treated with antibiotics, the mouse bacterial LC and a similar human bacterial LC, which would predict if the LC is able to inhibit outgrowth of C. difficile in these samples.

128

Abbreviations bp Base pair 16S rRNA 16S ribosomal RNA 7-oxo-DCA 7-oxo-deoxycholic acid ABB Anaerobic basal broth BHI Brain heart infusion BHIS Brain heart infusion + yeast extract BHIST Brain heart infusion + yeast extract + taurocholate BLAST Basic Local Alignment Search Tool CA Cholic acid Ca-DPA Calcium-dipicolinic acid CcpA Catabolite control protein A CDC Center for Disease Control and Prevention CDI Clostridium difficile infection CDT C. difficile transferase CFU Colony forming units CR Colonization resistance D0 Day of infection D1 1 day after infection D-1 1 day before infection D2 2 days after infection D3 3 days after infection D4 4 days after infection D5 5 days after infection D6 6 days after infection D7 7 days after infection D-7 7 days before infection DCA Deoxycholic acid DCs Dendritic cells

129

ECDC European Centre for Disease Prevention and Control EEA European Economic Area EECs Enteroendocrine cells EHEC Enterohaemorrhagic E. coli ELISA Enzyme-linked immunosorbent assay EPEC Enteropathogenic E. coli EU European Union FDA Food and Drug Administration FT Fecal transplant FUT2 2-α-ʟ-fucosyltransferase 2 GF Germ-free GI tract Gastrointestinal tract HDCA Hyodeoxycholic acid HIF-1 Hypoxia inducible factor-1 HIV Human immunodeficiency virus HMA Human microbiota associated HRP Horseradish peroxidase IBD Inflammatory bowel disease IFNγ Interferon gamma IgA/M/G Immunoglobulin A/M/G IL Interleukin ILCs Innate lymphoid cells IVC Individually ventilated cages IP Intraperitoneal LB Lennox and Miller Bacterial Culture LC Limited consortium LCA Lithocholic acid LCGT Large clostridial glucosylating toxin LCMS Liquid chromatography-mass spectrometry LPS Lipopolysaccharide

130

MHH Medical School Hannover MIC Minimal inhibitory concentration Mip Macrophage infectivity potentiator MIP-2 Macrophage inflammatory protein 2 MLVA Multilocus variable-number tandem repeat MM Mucus Medium MPN Most probable number MRS De Man, Rogosa and Sharpe MyD88 Myeloid differentiation primary response 88 NCI National Cancer Institute NMDS Non-metric Multi-dimensional Scaling NOD1 Nucleotide-binding oligomerization domain-containing protein 1 OMM Oligo-mouse-microbiota PaLoc Pathogenicity locus PBA Primary bile acids PBS Phosphate buffered Saline PCR Polymerase chain reaction PFGE Pulsed-field gel electrophoresis PPIase Peptidyl-prolyl-cis/trans-isomerases QIIME Quantitative insights into microbial Ecology qPCR Quantitative PCR RD Reagent diluent RDP Ribosomal Database Project REGIIIγ Regenerating islet-derived protein 3 gamma Rnf Rhodobacter nitrogen fixation RPM Revolutions per minute RT Ribotype SAA Serum amyloid A SBA Secondary bile acids SBAP Secondary bile acid producer

131

SCFAs Short-chain fatty acids SFB Segmented filamentous bacteria SM Super Medium SPF Specific pathogen free Spo0A Transcription factor stage 0 sporulation protein TCA Taurocholic acid TDCA Taurodeoxycholic acid

TH17 T helper 17 TLR5 Toll-like receptor 5 UDCA Ursodeoxycholic acid WCAB Wilkins-Chalgren anaerobe broth WCABG Wilkins-Chalgren anaerobe broth + glucose WGS Whole genome sequencing WTBL/6 Wild-type C57BL/6N mice α-MCA Alpha-muricholic acid β-MCA Beta-muricholic acid ωMCA Omega-muricholic acid

132

List of figures

Figure 1: The 16S rRNA gene...... 3 Figure 2: Direct and indirect colonization resistance against pathogenic bacteria...... 9 Figure 3: Clostridioides difficile infection cycle...... 12 Figure 4: Production of bile acids and the effect on the lifecycle of C. difficile...... 23 Figure 5: Schematic layout of the culturing techniques...... 54 Figure 6: In vitro inhibition assays...... 61 Figure 7: Timeline for C. difficile infection in WTBL/6-SPF1 – SPF4 mice...... 62 Figure 8: Timeline for C. difficile infections in WTBL/6OMM mice...... 63 Figure 9: Bodyweight of mice grouped by age...... 70 Figure 10: 16s rRNA data sequencing of feces DNA of mice with different ages before and after antibiotics ...... 71 Figure 11: Bodyweight loss and survival curve of WTBL/6-SPF1 mice of different ages...... 72 Figure 12: Colonization of C. difficile in mice with different ages...... 74 Figure 13: The 16S rRNA data sequences of feces DNA of mice harboring different microbiota compositions before and after antibiotics...... 76 Figure 14: Bodyweight loss and survival curve of mice treated or not treated with antibiotics... 78 Figure 15: Antibiotic treatment alters the colonization of C. difficile after infection...... 79 Figure 16: Amount of lipocalin produced in the mouse during infection...... 81 Figure 17: Amount of Toxin A produced by C. difficile during infection...... 81 Figure 18: Colonization of C. difficile 630 and 630ΔprsA2 twenty-four hours after infection. ... 83 Figure 19: Colonization of C. difficile 630 and 630ΔrnfC twenty-four hours after infection...... 85 Figure 20: Colonization of C. difficile 630 and 630ΔrnfC three days after infection...... 85 Figure 21: Colonization of C. difficile 630 and 630ΔrnfC + prnfC after infection...... 86 Figure 22: Bodyweight and survival of mice colonized with SBA producing bacteria...... 88 Figure 23. Colonization of C. difficile in WTBL/6-OMM mice colonized with SBAP bacteria. 89 Figure 24: Phylogenetic characterization of all found bacterial species...... 91 Figure 25: Outgrowth of C. difficile in antibiotic-treated cecum and colon content...... 95 Figure 26: 16s rRNA data sequencing of feces DNA of (non-)colonized WTBL/6-OMM mice. 97 Figure 27: Bodyweight loss and survival of differently colonized WTBL/6-OMM mice...... 98

133

Figure 28: Colonization of C. difficile in differently colonized WTBL/6-OMM mice...... 99 Figure 29: Intestinal inflammation levels measured by lipocalin-2 in the intestinal content. .... 100 Figure 30: Toxin A production in (non-)colonized WTBL/6-OMM mice after infection...... 101 Figure 31: Secondary bile acid production in the (non-)colonized WTBL/6-OMM mice...... 104 Figure 32: Primary bile acid production in the (non-)colonized WTBL/6-OMM mice...... 105 Figure 33: Quantification of colonization of E. muris...... 106 Figure 34: Weight loss of WTBL/6-OMM mice after infection...... 107 Figure 35: Colonization after C. difficile infection in WTBL/6-OMM mice after infection...... 108

134

List of tables

Table 1: Origin and housing of the different mouse lines and different microbiota ...... 30 Table 2: Bacterial strains used during mice microbiota colonization and infection ...... 32 Table 3: List of PCR and qPCR primers used in this study ...... 34 Table 4: List of chemicals used in this study ...... 35 Table 5: Commercial assays used in this study ...... 37 Table 6: Recipe for Buffer A (for DNA isolation) ...... 37 Table 7: Recipe for 10 x phosphate buffered saline (PBS) ...... 38 Table 8: Trace Mineral Supplement Mixture ...... 38 Table 9: Wolves Vitamin solution mixture ...... 39 Table 10: Recipe for ELISA washing buffer ...... 39 Table 11: Recipe for Anaerobe basal broth (liquid) ...... 40 Table 12: Recipe for Anaerobe basal broth (agar) ...... 40 Table 13: Recipe for BHI medium (liquid) ...... 40 Table 14: Recipe for BHI medium (agar) ...... 40 Table 15: Recipe for BHIS medium (liquid)...... 41 Table 16: Recipe for BHIS medium (agar) ...... 41 Table 17: Recipe for BHIST medium (liquid) ...... 41 Table 18: Recipe for BHIST medium (agar) ...... 42 Table 19: Recipe for de Man, Rogosa and Sharpe (agar) ...... 42 Table 20: Recipe for LB broth (Lennox) medium (liquid) ...... 42 Table 21: Recipe for LB broth with agar (Miller) medium (agar) ...... 43 Table 22: Recipe for Mucus medium (liquid)...... 43 Table 23: Recipe for Mucus medium (agar) ...... 44 Table 24: Recipe for Super Medium (liquid) ...... 45 Table 25: Recipe for Super Medium (agar) ...... 45 Table 26: Recipe for WCAB medium (liquid) ...... 46 Table 27: Recipe for WCAB medium (agar) ...... 46 Table 28: Recipe for WCAB medium with glucose (liquid) ...... 46 Table 29: Recipe for WCAB medium with glucose (agar) ...... 47

135

Table 30: List of equipment used in this study ...... 47 Table 31: List of materials used in this study ...... 48 Table 32: List of software and algorithms used in this study ...... 49 Table 33: PCR reaction mix for 16S rRNA gene amplification ...... 55 Table 34: PCR program used for 16S rRNA gene replication ...... 55 Table 35: The different bacterial groups used during this study ...... 58 Table 36: qPCR reaction mix used in this study ...... 67 Table 37: qPCR program used in this study ...... 67

136

References

1. Bengmark, S. Ecological control of the gastrointestinal tract. The role of probiotic flora. Gut 42, 2–7 (1998). 2. Greenwood-Van Meerveld, B., Johnson, A. C. & Grundy, D. Gastrointestinal Physiology and Function BT - Gastrointestinal Pharmacology. in (ed. Greenwood-Van Meerveld, B.) 1–16 (Springer International Publishing, 2017). doi:10.1007/164_2016_118 3. Latorre, R., Sternini, C., De Giorgio, R. & Greenwood-Van Meerveld, B. Enteroendocrine cells: a review of their role in brain–gut communication. Neurogastroenterol. Motil. 28, 620–630 (2016). 4. Ward, S. M. & Sanders, K. M. Interstitial cells of Cajal: primary targets of enteric motor innervation. Anat. Rec. 262, 125– 135 (2001). 5. Sanders, K. M., Ward, S. M. & Koh, S. D. Interstitial cells: regulators of smooth muscle function. Physiol. Rev. 94, 859– 907 (2014). 6. Ohman, L., Tornblom, H. & Simren, M. Crosstalk at the mucosal border: importance of the gut microenvironment in IBS. Nat. Rev. Gastroenterol. Hepatol. 12, 36–49 (2015). 7. Camilleri, M., Madsen, K., Spiller, R., Greenwood-Van Meerveld, B. & Verne, G. N. Intestinal barrier function in health and gastrointestinal disease. Neurogastroenterol. Motil. 24, 503–512 (2012). 8. Moore, W. E. & Holdeman, L. V. Human fecal flora: the normal flora of 20 Japanese-Hawaiians. Appl. Microbiol. 27, 961–979 (1974). 9. Salanitro, J. P., Fairchilds, I. G. & Zgornicki, Y. D. Isolation, Culture Characteristics, and Identification of Anaerobic Bacteria from the Chicken Cecum. Appl. Microbiol. 27, 678 LP – 687 (1974). 10. Salanitro, J. P., Blake, I. G. & Muirhead, P. A. Isolation and identification of fecal bacteria from adult swine. Appl. Environ. Microbiol. 33, 79 LP – 84 (1977). 11. Poretsky, R., Rodriguez-R, L. M., Luo, C., Tsementzi, D. & Konstantinidis, K. T. Strengths and limitations of 16S rRNA gene amplicon sequencing in revealing temporal microbial community dynamics. PLoS One 9, e93827 (2014). 12. Mizrahi-Man, O., Davenport, E. R. & Gilad, Y. Taxonomic classification of bacterial 16S rRNA genes using short sequencing reads: evaluation of effective study designs. PLoS One 8, e53608 (2013). 13. Suau, a et al. Direct analysis of genes encoding 16S rRNA from complex communities reveals many novel molecular species within the human gut. Appl. Environ. Microbiol. 65, 4799–4807 (1999). 14. Li, J. et al. An integrated catalog of reference genes in the human gut microbiome. Nat. Biotechnol. 32, 834–841 (2014). 15. McGuire, A. L. et al. Ethical, legal, and social considerations in conducting the Human Microbiome Project. Genome Res. 18, 1861–1864 (2008). 16. Hugon, P. et al. A comprehensive repertoire of prokaryotic species identified in human beings. Lancet. Infect. Dis. 15, 1211–1219 (2015). 17. Bukin, Y. S. et al. The effect of 16S rRNA region choice on bacterial community metabarcoding results. Sci. Data 6, 190007 (2019). 18. Zhang, J. et al. Evaluation of different 16S rRNA gene V regions for exploring bacterial diversity in a eutrophic freshwater lake. Sci. Total Environ. 618, 1254–1267 (2018). 19. Bäckhed, F., Ley, R. E., Sonnenburg, J. L., Peterson, D. a & Gordon, J. I. Host-bacterial mutualism in the human intestine. Science 307, 1915–20 (2005). 20. Neish, A. S. Microbes in gastrointestinal health and disease. Gastroenterology 136, 65–80 (2009).

137

21. Gill, S. R. et al. Metagenomic analysis of the human distal gut microbiome. Science 312, 1355–1359 (2006). 22. Sender, R., Fuchs, S. & Milo, R. Are We Really Vastly Outnumbered? Revisiting the Ratio of Bacterial to Host Cells in Humans. Cell 164, 337–340 (2016). 23. Chang, C. & Lin, H. Dysbiosis in gastrointestinal disorders. Best Pract. Res. Clin. Gastroenterol. 30, 3–15 (2016). 24. Schroeder, B. O. & Backhed, F. Signals from the gut microbiota to distant organs in physiology and disease. Nat. Med. 22, 1079–1089 (2016). 25. Aagaard, K. et al. The placenta harbors a unique microbiome. Sci. Transl. Med. 6, 237ra65 (2014). 26. Rodriguez, J. M. et al. The composition of the gut microbiota throughout life, with an emphasis on early life. Microb. Ecol. Health Dis. 26, 26050 (2015). 27. Perez-Muñoz, M. E., Arrieta, M.-C., Ramer-Tait, A. E. & Walter, J. A critical assessment of the “sterile womb” and “in utero colonization” hypotheses: implications for research on the pioneer infant microbiome. Microbiome 5, 48 (2017). 28. Leiby, J. S. et al. Lack of detection of a human placenta microbiome in samples from preterm and term deliveries. 1–11 (2018). 29. Theis, K. R. et al. Does the human placenta delivered at term have a microbiota? Results of cultivation, quantitative real- time PCR, 16S rRNA gene sequencing, and metagenomics. Am. J. Obstet. Gynecol. 220, 267.e1-267.e39 (2019). 30. Koenig, J. E. et al. Succession of microbial consortia in the developing infant gut microbiome. Proc. Natl. Acad. Sci. U. S. A. 108 Suppl 1, 4578–4585 (2011). 31. Avershina, E. et al. Major faecal microbiota shifts in composition and diversity with age in a geographically restricted cohort of mothers and their children. FEMS Microbiol. Ecol. 87, 280–290 (2014). 32. Aagaard, K. et al. A Metagenomic Approach to Characterization of the Vaginal Microbiome Signature in Pregnancy. PLoS One 7, 1–15 (2012). 33. Jakobsson, H. E. et al. Decreased gut microbiota diversity, delayed Bacteroidetes colonisation and reduced Th1 responses in infants delivered by caesarean section. Gut 63, 559–566 (2014). 34. Salminen, S., Gibson, G. R., McCartney, A. L. & Isolauri, E. Influence of mode of delivery on gut microbiota composition in seven year old children. Gut 53, 1388–1389 (2004). 35. Palmer, C., Bik, E. M., DiGiulio, D. B., Relman, D. A. & Brown, P. O. Development of the Human Infant Intestinal Microbiota. PLOS Biol. 5, 1–18 (2007). 36. Dethlefsen, L. & Relman, D. A. Incomplete recovery and individualized responses of the human distal gut microbiota to repeated antibiotic perturbation. Proc. Natl. Acad. Sci. U. S. A. 108 Suppl, 4554–4561 (2011). 37. Claesson, M. J. et al. Composition, variability, and temporal stability of the intestinal microbiota of the elderly. Proc. Natl. Acad. Sci. U. S. A. 108 Suppl 1, 4586–4591 (2011). 38. Woodmansey, E. J., McMurdo, M. E. T., Macfarlane, G. T. & Macfarlane, S. Comparison of compositions and metabolic activities of fecal microbiotas in young adults and in antibiotic-treated and non-antibiotic-treated elderly subjects. Appl. Environ. Microbiol. 70, 6113–6122 (2004). 39. He, J. et al. Characterizing the bacterial microbiota in different gastrointestinal tract segments of the Bactrian camel. 1–9 (2018). doi:10.1038/s41598-017-18298-7 40. Donaldson, G. P., Lee, S. M. & Mazmanian, S. K. Gut biogeography of the bacterial microbiota. Nat. Rev. Microbiol. 14, 20–32 (2016). 41. Eckburg, P. B. et al. Diversity of the human intestinal microbial flora. Science (80-. ). 308, 1635–1638 (2005). 42. Lavelle, A. et al. Spatial variation of the colonic microbiota in patients with ulcerative colitis and control volunteers. Gut 64, 1553–1561 (2015). 43. Van den Abbeele, P. et al. Butyrate-producing Clostridium cluster XIVa species specifically colonize mucins in an in 138

vitro gut model. ISME J. 7, 949–961 (2013). 44. Zoetendal, E. G. et al. The human small intestinal microbiota is driven by rapid uptake and conversion of simple carbohydrates. ISME J. 6, 1415–1426 (2012). 45. David, L. A. et al. Diet rapidly and reproducibly alters the human gut microbiome. Nature 505, 559–563 (2014). 46. Walker, A. W. et al. Dominant and diet-responsive groups of bacteria within the human colonic microbiota. ISME J. 5, 220–230 (2011). 47. De Filippo, C. et al. Impact of diet in shaping gut microbiota revealed by a comparative study in children from Europe and rural Africa. Proc. Natl. Acad. Sci. 107, 14691 LP – 14696 (2010). 48. Wu, G. D. et al. Linking long-term dietary patterns with gut microbial enterotypes. Science 334, 105–108 (2011). 49. Sonnenburg, E. D. et al. Diet-induced extinctions in the gut microbiota compound over generations. Nature 529, 212 (2016). 50. Biedermann, L. et al. Smoking Cessation Induces Profound Changes in the Composition of the Intestinal Microbiota in Humans. PLoS One 8, 1–8 (2013). 51. Jiang, H. et al. Altered fecal microbiota composition in patients with major depressive disorder. Brain. Behav. Immun. 48, 186–194 (2015). 52. Tyakht, A. V et al. Human gut microbiota community structures in urban and rural populations in Russia. Nat. Commun. 4, 2469 (2013). 53. Maurice, C. F., Haiser, H. J. & Turnbaugh, P. J. Xenobiotics shape the physiology and gene expression of the active human gut microbiome. Cell 152, 39–50 (2013). 54. Jernberg, C., Lofmark, S., Edlund, C. & Jansson, J. K. Long-term ecological impacts of antibiotic administration on the human intestinal microbiota. ISME J. 1, 56–66 (2007). 55. Louis, P. & Flint, H. J. Formation of propionate and butyrate by the human colonic microbiota. Environ. Microbiol. 19, 29–41 (2017). 56. Ze, X., Duncan, S. H., Louis, P. & Flint, H. J. Ruminococcus bromii is a keystone species for the degradation of resistant starch in the human colon. ISME J. 6, 1535–1543 (2012). 57. Louis, P., Scott, K. P., Duncan, S. H. & Flint, H. J. Understanding the effects of diet on bacterial metabolism in the large intestine. J. Appl. Microbiol. 102, 1197–1208 (2007). 58. Duncan, S. H., Louis, P. & Flint, H. J. Lactate-utilizing bacteria, isolated from human feces, that produce butyrate as a major fermentation product. Appl. Environ. Microbiol. 70, 5810–5817 (2004). 59. Juge, N., Tailford, L. & Owen, C. D. Sialidases from gut bacteria: a mini-review. Biochem. Soc. Trans. 44, 166–175 (2016). 60. McGuckin, M. A., Linden, S. K., Sutton, P. & Florin, T. H. Mucin dynamics and enteric pathogens. Nat. Rev. Microbiol. 9, 265–278 (2011). 61. Dharmani, P., Srivastava, V., Kissoon-Singh, V. & Chadee, K. Role of intestinal mucins in innate host defense mechanisms against pathogens. J. Innate Immun. 1, 123–135 (2009). 62. Hooper, L. V, Midtvedt, T. & Gordon, J. I. How host-microbial interactions shape the nutrient environment of the mammalian intestine. Annu. Rev. Nutr. 22, 283–307 (2002). 63. Sekirov, I., Russell, S. L., Antunes, L. C. M. & Finlay, B. B. Gut microbiota in health and disease. Physiol. Rev. 90, 859– 904 (2010). 64. Hill, M. J. Intestinal flora and endogenous vitamin synthesis. S43–S45 (1997). 65. Ramakrishna, B. S. Role of the gut microbiota in human nutrition and metabolism. J. Gastroenterol. Hepatol. 28 Suppl 4, 9–17 (2013). 139

66. Pompei, A. et al. Folate production by bifidobacteria as a potential probiotic property. Appl. Environ. Microbiol. 73, 179– 85 (2007). 67. LeBlanc, J. G. et al. Bacteria as vitamin suppliers to their host: a gut microbiota perspective. Curr. Opin. Biotechnol. 24, 160–8 (2013). 68. Martens, J. H., Barg, H., Warren, M. J. & Jahn, D. Microbial production of vitamin B12. Appl. Microbiol. Biotechnol. 58, 275–285 (2002). 69. Sartor, R. B. Microbial influences in inflammatory bowel diseases. Gastroenterology 134, 577–594 (2008). 70. Macfarlane, S. & Macfarlane, G. T. Regulation of short-chain fatty acid production. Proc. Nutr. Soc. 62, 67–72 (2003). 71. Sonnenburg, E. D. & Sonnenburg, J. L. Starving our microbial self: the deleterious consequences of a diet deficient in microbiota-accessible carbohydrates. Cell Metab. 20, 779–786 (2014). 72. De Vadder, F. et al. Microbiota-generated metabolites promote metabolic benefits via gut-brain neural circuits. Cell 156, 84–96 (2014). 73. Frost, G. et al. The short-chain fatty acid acetate reduces appetite via a central homeostatic mechanism. Nat. Commun. 5, 3611 (2014). 74. Zhao, L. et al. Gut bacteria selectively promoted by dietary fibers alleviate type 2 diabetes. Science 359, 1151–1156 (2018). 75. Lin, H. V et al. Butyrate and propionate protect against diet-induced obesity and regulate gut hormones via free fatty acid receptor 3-independent mechanisms. PLoS One 7, e35240 (2012). 76. Metges, C. C. Contribution of microbial amino acids to amino acid homeostasis of the host. J. Nutr. 130, 1857S–64S (2000). 77. Metges, C. C. & Petzke, K. J. Utilization of essential amino acids synthesized in the intestinal microbiota of monogastric mammals. Br. J. Nutr. 94, 621–622 (2005). 78. Raj, T., Dileep, U., Vaz, M., Fuller, M. F. & Kurpad, A. V. Intestinal microbial contribution to metabolic leucine input in adult men. J. Nutr. 138, 2217–2221 (2008). 79. Torrallardona, D., Harris, C. I. & Fuller, M. F. Pigs’ gastrointestinal microflora provide them with essential amino acids. J. Nutr. 133, 1127–1131 (2003). 80. Bergen, W. G. & Wu, G. Intestinal nitrogen recycling and utilization in health and disease. J. Nutr. 139, 821–825 (2009). 81. Stewart, G. S. & Smith, C. P. Urea nitrogen salvage mechanisms and their relevance to ruminants, non-ruminants and man. Nutr. Res. Rev. 18, 49–62 (2005). 82. Velagapudi, V. R. et al. The gut microbiota modulates host energy and lipid metabolism in mice. J. Lipid Res. 51, 1101– 1112 (2010). 83. Backhed, F. et al. The gut microbiota as an environmental factor that regulates fat storage. Proc. Natl. Acad. Sci. U. S. A. 101, 15718–15723 (2004). 84. Turnbaugh, P. J., Bäckhed, F., Fulton, L. & Gordon, J. I. Diet-Induced Obesity Is Linked to Marked but Reversible Alterations in the Mouse Distal Gut Microbiome. Cell Host Microbe 3, 213–223 (2008). 85. Buffie, C. & Pamer, E. Microbiota-mediated colonization resistance against intestinal pathogens. Nat. Immunol Rev. 13, 790–801 (2013). 86. Le Lay, C., Dridi, L., Bergeron, M. G., Ouellette, M. & Fliss, I. L. Nisin is an effective inhibitor of Clostridium difficile vegetative cells and spore germination. J. Med. Microbiol. 65, 169–175 (2016). 87. Searle, L. E. J. et al. A mixture containing galactooligosaccharide, produced by the enzymic activity of Bifidobacterium bifidum, reduces Salmonella enterica serovar Typhimurium infection in mice. J. Med. Microbiol. 58, 37–48 (2009). 88. Ivanov, I. I. et al. Induction of intestinal Th17 cells by segmented filamentous bacteria. Cell 139, 485–98 (2009). 140

89. Cua, D. J. & Tato, C. M. Innate IL-17-producing cells: the sentinels of the immune system. Nat. Rev. Immunol. 10, 479– 489 (2010). 90. Johansson, M. E. V et al. The inner of the two Muc2 mucin-dependent mucus layers in colon is devoid of bacteria. Proc. Natl. Acad. Sci. U. S. A. 105, 15064–15069 (2008). 91. Johansson, M. E. V, Larsson, J. M. H. & Hansson, G. C. The two mucus layers of colon are organized by the MUC2 mucin, whereas the outer layer is a legislator of host-microbial interactions. Proc. Natl. Acad. Sci. U. S. A. 108 Suppl 1, 4659–4665 (2011). 92. Li, H. et al. The outer mucus layer hosts a distinct intestinal microbial niche. Nat. Commun. 6, 8292 (2015). 93. Hurd, E. A., Holmén, J. M., Hansson, G. C. & Domino, S. E. Gastrointestinal mucins of Fut2-null mice lack terminal fucosylation without affecting colonization by Candida albicans. Glycobiology 15, 1002–1007 (2005). 94. Pickard, J. M. et al. Rapid fucosylation of intestinal epithelium sustains host–commensal symbiosis in sickness. Nature 514, 638 (2014). 95. Goto, Y. et al. Innate lymphoid cells regulate intestinal epithelial cell glycosylation. Science 345, 1254009 (2014). 96. Johansson, M. E. V et al. Normalization of Host Intestinal Mucus Layers Requires Long-Term Microbial Colonization. Cell Host Microbe 18, 582–592 (2015). 97. Petersson, J. et al. Importance and regulation of the colonic mucus barrier in a mouse model of colitis. Am. J. Physiol. Gastrointest. Liver Physiol. 300, G327-33 (2011). 98. Jesudason, M. V, Hentges, D. J. & Pongpech, P. Colonization of mice by Campylobacter jejuni. Infect. Immun. 57, 2279 LP – 2282 (1989). 99. Lee, A., O'Rourke, J. L., Barrington, P. J. & Trust, T. J. Mucus colonization as a determinant of pathogenicity in intestinal infection by Campylobacter jejuni: a mouse cecal model. Infect. Immun. 51, 536 LP – 546 (1986). 100. Wine, E., Gareau, M. G., Johnson-Henry, K. & Sherman, P. M. Strain-specific probiotic (Lactobacillus helveticus) inhibition of Campylobacter jejuni invasion of human intestinal epithelial cells. FEMS Microbiol. Lett. 300, 146–152 (2009). 101. Ubeda, C. et al. Intestinal microbiota containing Barnesiella species cures vancomycin-resistant Enterococcus faecium colonization. Infect. Immun. 81, 965–973 (2013). 102. Doron, S. et al. Effect of Lactobacillus rhamnosus GG Administration on Vancomycin-Resistant Enterococcus Colonization in Adults with Comorbidities. Antimicrob. Agents Chemother. 59, 4593–4599 (2015). 103. Bohnhoff, M. & Miller, C. P. Enhanced susceptibility to Salmonella infection in streptomycin-treated mice. J. Infect. Dis. 111, 117–127 (1962). 104. Sekirov, I. et al. Antibiotic-induced perturbations of the intestinal microbiota alter host susceptibility to enteric infection. Infect. Immun. 76, 4726–4736 (2008). 105. Ferreira, R. B. R. et al. The intestinal microbiota plays a role in Salmonella-induced colitis independent of pathogen colonization. PLoS One 6, e20338 (2011). 106. Thiemann, S. et al. Enhancement of IFNγ Production by Distinct Commensals Ameliorates Salmonella-Induced Disease. Cell Host Microbe 21, (2017). 107. Lessa, F. C., Winston, L. G. & McDonald, L. C. Burden of Clostridium difficile infection in the United States. The New England journal of medicine 372, 2369–2370 (2015). 108. Berdy, J. Bioactive microbial metabolites. J. Antibiot. (Tokyo). 58, 1–26 (2005). 109. von Nussbaum, F., Brands, M., Hinzen, B., Weigand, S. & Habich, D. Antibacterial natural products in medicinal chemistry--exodus or revival? Angew. Chem. Int. Ed. Engl. 45, 5072–5129 (2006). 110. Kong, K.-F., Schneper, L. & Mathee, K. Beta-lactam antibiotics: from antibiosis to resistance and bacteriology. APMIS 141

118, 1–36 (2010). 111. Andrews, J. M. Determination of minimum inhibitory concentrations. J. Antimicrob. Chemother. 48, 5–16 (2001). 112. Kim, D.-H. Gut Microbiota-Mediated Drug-Antibiotic Interactions. Drug Metab. Dispos. 43, 1581–1589 (2015). 113. Dethlefsen, L., Huse, S., Sogin, M. L. & Relman, D. A. The Pervasive Effects of an Antibiotic on the Human Gut Microbiota, as Revealed by Deep 16S rRNA Sequencing. PLoS Biol 6, e280 (2008). 114. Morgan, X. C. et al. Dysfunction of the intestinal microbiome in inflammatory bowel disease and treatment. Genome Biol. 13, R79 (2012). 115. Stewardson, A. J. et al. Collateral damage from oral ciprofloxacin versus nitrofurantoin in outpatients with urinary tract infections: a culture-free analysis of gut microbiota. Clin. Microbiol. Infect. 21, 344.e1–11 (2015). 116. Iapichino, G. et al. Impact of antibiotics on the gut microbiota of critically ill patients. J. Med. Microbiol. 57, 1007–1014 (2008). 117. O’Sullivan, O. et al. Alterations in intestinal microbiota of elderly Irish subjects post-antibiotic therapy. J. Antimicrob. Chemother. 68, 214–221 (2013). 118. Jeong, S.-H., Song, Y.-K. & Cho, J.-H. Risk assessment of ciprofloxacin, flavomycin, olaquindox and colistin sulfate based on microbiological impact on human gut biota. Regul. Toxicol. Pharmacol. 53, 209–216 (2009). 119. Panda, S. et al. Short-term effect of antibiotics on human gut microbiota. PLoS One 9, e95476 (2014). 120. Zaura, E. et al. Same Exposure but Two Radically Different Responses to Antibiotics: Resilience of the Salivary Microbiome versus Long-Term Microbial Shifts in Feces. MBio 6, e01693-15 (2015). 121. Wlodarska, M. et al. Antibiotic treatment alters the colonic mucus layer and predisposes the host to exacerbated Citrobacter rodentium-induced colitis. Infect. Immun. 79, 1536–1545 (2011). 122. Lozupone, C. a., Stombaugh, J. I., Gordon, J. I., Jansson, J. K. & Knight, R. Diversity, stability and resilience of the human gut microbiota. Nature 489, 220–230 (2012). 123. Cox, L. M. & Blaser, M. J. Antibiotics in early life and obesity. Nat. Rev. Endocrinol. 11, 182–190 (2015). 124. Saari, A., Virta, L. J., Sankilampi, U., Dunkel, L. & Saxen, H. Antibiotic exposure in infancy and risk of being overweight in the first 24 months of life. Pediatrics 135, 617–626 (2015). 125. Korpela, K. et al. Intestinal microbiome is related to lifetime antibiotic use in Finnish pre-school children. Nat. Commun. 7, 10410 (2016). 126. Fouhy, F. et al. High-throughput sequencing reveals the incomplete, short-term recovery of infant gut microbiota following parenteral antibiotic treatment with ampicillin and gentamicin. Antimicrob. Agents Chemother. 56, 5811–5820 (2012). 127. Tanaka, S. et al. Influence of antibiotic exposure in the early postnatal period on the development of intestinal microbiota. FEMS Immunol. Med. Microbiol. 56, 80–87 (2009). 128. Hall, I. & O’Toole, E. Intestinal flora in new-born infants: a description of a new pathogenic anaerobe, Bacillus Difficilis. Am. J. Dis. Child. 49, 390–402 (1935). 129. George, R. H. et al. Identification of Clostridium difficile as a cause of pseudomembranous colitis. Br. Med. J. 1, 695 (1978). 130. Larentis, D. Z., Rosa, R. G., Dos Santos, R. P. & Goldani, L. Z. Outcomes and Risk Factors Associated with Clostridium difficile Diarrhea in Hospitalized Adult Patients. Gastroenterol. Res. Pract. 2015, 346341 (2015). 131. Khanna, S., Gupta, A., Baddour, L. M. & Pardi, D. S. Epidemiology, outcomes, and predictors of mortality in hospitalized adults with Clostridium difficile infection. Intern. Emerg. Med. 11, 657–665 (2016). 132. Britton, R. A. & Young, V. B. Role of the intestinal microbiota in resistance to colonization by Clostridium difficile. Gastroenterology 146, 1547–1553 (2014). 142

133. Pepin, J. et al. Clostridium difficile-associated diarrhea in a region of Quebec from 1991 to 2003: a changing pattern of disease severity. CMAJ 171, 466–472 (2004). 134. Alyousef, A. A. Clostridium difficile: Epidemiology, Pathogenicity, and an Update on the Limitations of and Challenges in Its Diagnosis. J. AOAC Int. 101, 1119–1126 (2018). 135. European Centre for Disease Prevention and Control. Healthcare-associated infections: Clostridium difficile infections. ECDC. Annu. Epidemiol. Rep. 2016. Stock. (2018). 136. Robert Koch-Institut. Infektionsepidemiologisches Jahrbuch meldepflichtiger Krankheiten für 2017. Berlin (2018). 137. Davies, K. A. et al. Underdiagnosis of Clostridium diffi cile across Europe : the European , multicentre , prospective , biannual , point-prevalence study of Clostridium diffi cile infection in hospitalised patients with diarrhoea ( EUCLID ). 14, (2014). 138. Loo, V. G. et al. A predominantly clonal multi-institutional outbreak of Clostridium difficile-associated diarrhea with high morbidity and mortality. N. Engl. J. Med. 353, 2442–2449 (2005). 139. Redelings, M. D., Sorvillo, F. & Mascola, L. Increase in Clostridium difficile-related mortality rates, United States, 1999- 2004. Emerg. Infect. Dis. 13, 1417–1419 (2007). 140. O’Connor, J. R., Johnson, S. & Gerding, D. N. Clostridium difficile infection caused by the epidemic BI/NAP1/027 strain. Gastroenterology 136, 1913–1924 (2009). 141. Archbald-Pannone, L. R., Boone, J. H., Carman, R. J., Lyerly, D. M. & Guerrant, R. L. Clostridium difficile ribotype 027 is most prevalent among inpatients admitted from long-term care facilities. J. Hosp. Infect. 88, 218–221 (2014). 142. Couturier, J., Davies, K., Gateau, C. & Barbut, F. Ribotypes and New Virulent Strains Across Europe BT - Updates on Clostridium difficile in Europe: Advances in Microbiology, Infectious Diseases and Public Health Volume 8. in (eds. Mastrantonio, P. & Rupnik, M.) 45–58 (Springer International Publishing, 2018). doi:10.1007/978-3-319-72799-8_4 143. Rupnik, M. & Janezic, S. An Update on Clostridium difficile Toxinotyping. J. Clin. Microbiol. 54, 13–18 (2016). 144. Braun, V., Hundsberger, T., Leukel, P., Sauerborn, M. & von Eichel-Streiber, C. Definition of the single integration site of the pathogenicity locus in Clostridium difficile. Gene 181, 29–38 (1996). 145. Rupnik, M., Brazier, J. S., Duerden, B. I., Grabnar, M. & Stubbs, S. L. J. Comparison of toxinotyping and PCR ribotyping of Clostridium difficile strains and description of novel toxinotypes. Microbiology 147, 439–447 (2001). 146. Bidet, P., Barbut, F., Lalande, V., Burghoffer, B. & Petit, J. C. Development of a new PCR-ribotyping method for Clostridium difficile based on ribosomal RNA gene sequencing. FEMS Microbiol Lett 175, (1999). 147. Killgore, G. et al. Comparison of Seven Techniques for Typing International Epidemic Strains of Clostridium difficile: Restriction Endonuclease Analysis, Pulsed-Field Gel Electrophoresis, PCR-Ribotyping, Multilocus Sequence Typing, Multilocus Variable-Number Tandem-Repeat A{\textellipsis}. J. Clin. Microbiol. 46, 431–437 (2008). 148. Kristjánsson, M. et al. Comparison of restriction endonuclease analysis, ribotyping, and pulsed-field gel electrophoresis for molecular differentiation of Clostridium difficile strains. J. Clin. Microbiol. 32, 1963–1969 (1994). 149. Marsh, J. W. et al. Multilocus variable-number tandem-repeat analysis for investigation of Clostridium difficile transmission in Hospitals. J. Clin. Microbiol. 44, 2558–2566 (2006). 150. Knetsch, C. W. et al. Current application and future perspectives of molecular typing methods to study Clostridium difficile infections. Eurosurveillance 18, (2013). 151. Eyre, D. W. et al. A pilot study of rapid benchtop sequencing of Staphylococcus aureus and Clostridium difficile for outbreak detection and surveillance. BMJ Open 2, (2012). 152. Bauer, M. P. et al. Clostridium difficile infection in Europe: a hospital-based survey. Lancet 377, 63–73 (2011). 153. Davies, K. A. et al. Diversity of Clostridium difficile PCR ribotypes in Europe: results from the European, multicentre, 143

prospective, biannual, point-prevalence study of Clostridium difficile infection in hospitalised patients with diarrhoea (EUCLID), 2012 and 2013. Eurosurveillance 21, (2016). 154. von Müller, L. et al. Epidemiology of Clostridium difficile in Germany based on a single center long-term surveillance and German-wide genotyping of recent isolates provided to the advisory laboratory for diagnostic reasons. Int. J. Med. Microbiol. 305, 807–813 (2015). 155. Smith, A. Outbreak of Clostridium difficile infection in an English hospital linked to hypertoxin-producing strains in Canada and the US. Euro Surveill. Bull. Eur. sur les Mal. Transm. = Eur. Commun. Dis. Bull. 10, E050630.2 (2005). 156. Warny, M. et al. Toxin production by an emerging strain of Clostridium difficile associated with outbreaks of severe disease in North America and Europe. Lancet (London, England) 366, 1079–1084 (2005). 157. Neely, F., Lambert, M.-L., Van Broeck, J. & Delmée, M. Clinical and laboratory features of the most common Clostridium difficile ribotypes isolated in Belgium. J. Hosp. Infect. 95, 394–399 (2017). 158. Stabler, R. A. et al. Comparative Phylogenomics of Clostridium difficile Reveals Clade Specificity and Microevolution of Hypervirulent Strains. J. Bacteriol. 188, 7297–7305 (2006). 159. Valiente, E., Dawson, L. F., Cairns, M. D., Stabler, R. A. & Wren, B. W. Emergence of new PCR ribotypes from the hypervirulent Clostridium difficile 027 lineage. J. Med. Microbiol. 61, 49–56 (2012). 160. Krutova, M., Matejkova, J., Tkadlec, J. & Nyc, O. Antibiotic profiling of Clostridium difficile ribotype 176 – A multidrug resistant relative to C. difficile ribotype 027. Anaerobe 36, 88–90 (2015). 161. Cassir, N. et al. Emergence of Clostridium difficile tcdC variant 078 in Marseille, France. Eur. J. Clin. Microbiol. Infect. Dis. 36, 1971–1974 (2017). 162. Fawley, W. N. et al. Enhanced surveillance of Clostridium difficile infection occurring outside hospital, England, 2011 to 2013. Eurosurveillance 21, (2016). 163. Baldan, R. et al. Clostridium difficile PCR Ribotype 018, a Successful Epidemic Genotype. J. Clin. Microbiol. 53, 2575– 2580 (2015). 164. Roberts, A. P. & Klaas, W. Anaerobe The evolving epidemic of Clostridium dif fi cile 630. 10–12 (2018). doi:10.1016/j.anaerobe.2018.04.015 165. van Eijk, E. et al. Complete genome sequence of the Clostridium difficile laboratory strain 630Δerm reveals differences from strain 630, including translocation of the mobile element CTn5. BMC Genomics 16, 31 (2015). 166. Heap, J. T., Pennington, O. J., Cartman, S. T., Carter, G. P. & Minton, N. P. The ClosTron: a universal gene knock-out system for the genus Clostridium. J. Microbiol. Methods 70, 452–464 (2007). 167. Paredes-Sabja, D., Torres, J. A., Setlow, P. & Sarker, M. R. Clostridium perfringens Spore Germination: Characterization of Germinants and Their Receptors. J. Bacteriol. 190, 1190 LP – 1201 (2008). 168. Donnelly, M. L., Fimlaid, K. A. & Shen, A. Characterization of Clostridium difficile Spores Lacking Either SpoVAC or Dipicolinic Acid Synthetase. J. Bacteriol. 198, 1694–1707 (2016). 169. Mason, J. M. & Setlow, P. Essential role of small, acid-soluble spore proteins in resistance of Bacillus subtilis spores to UV light. J. Bacteriol. 167, 174–178 (1986). 170. Setlow, P. I will survive: DNA protection in bacterial spores. Trends Microbiol. 15, 172–180 (2007). 171. Meador-Parton, J. & Popham, D. L. Structural Analysis of Bacillus subtilisSpore Peptidoglycan during Sporulation. J. Bacteriol. 182, 4491–4499 (2000). 172. Paredes-Sabja, D., Setlow, P. & Sarker, M. R. Germination of spores of Bacillales and Clostridiales species: mechanisms and proteins involved. Trends Microbiol. 19, 85–94 (2011). 173. Chirakkal, H., O’Rourke, M., Atrih, A., Foster, S. J. & Moir, A. Analysis of spore cortex lytic enzymes and related proteins in Bacillus subtilis endospore germination. Microbiology 148, 2383–2392 (2002). 144

174. Bagyan, I. & Setlow, P. Localization of the Cortex Lytic Enzyme CwlJ in Spores of Bacillus subtilis. J. Bacteriol. 184, 1219–1224 (2002). 175. Ragkousi, K. & Setlow, P. Transglutaminase-Mediated Cross-Linking of GerQ in the Coats of Bacillus subtilis Spores. J. Bacteriol. 186, 5567–5575 (2004). 176. Bozue, J. A., Welkos, S. & Cote, C. K. The Bacillus anthracis Exosporium: What’s the Big “Hairy” Deal? in The Bacterial Spore: from Molecules to Systems 253–268 (American Society of Microbiology, 2016). 177. Stewart, G. C. The Exosporium Layer of Bacterial Spores: a Connection to the Environment and the Infected Host. Microbiol. Mol. Biol. Rev. 79, 437–457 (2015). 178. Diaz-Gonzalez, F. et al. Protein composition of the outermost exosporium-like layer of Clostridium difficile 630 spores. J. Proteomics 123, 1–13 (2015). 179. Gerding, D. N., Muto, C. A. & Owens, R. C. J. Measures to control and prevent Clostridium difficile infection. Clin. Infect. Dis. 46 Suppl 1, S43-9 (2008). 180. Setlow, P. Spore germination. Curr. Opin. Microbiol. 6, 550–556 (2003). 181. Fimlaid, K. A. & Shen, A. Diverse mechanisms regulate sporulation sigma factor activity in the Firmicutes. Curr. Opin. Microbiol. 24, 88–95 (2015). 182. Haraldsen, J. D. & Sonenshein, A. L. Efficient sporulation in Clostridium difficile requires disruption of the sigmaK gene. Mol. Microbiol. 48, 811–821 (2003). 183. Fimlaid, K. A. et al. Global Analysis of the Sporulation Pathway of Clostridium difficile. PLOS Genet. 9, e1003660 (2013). 184. Pereira, F. C. et al. The Spore Differentiation Pathway in the Enteric Pathogen Clostridium difficile. PLOS Genet. 9, e1003782 (2013). 185. Poutanen, S. M. & Simor, A. E. Clostridium difficile-associated diarrhea in adults. CMAJ 171, 51–58 (2004). 186. Moir, A. How do spores germinate? J. Appl. Microbiol. 101, 526–530 (2006). 187. Sorg, J. A. & Sonenshein, A. L. Bile salts and glycine as cogerminants for Clostridium difficile spores. J. Bacteriol. 190, 2505–2512 (2008). 188. Howerton, A., Ramirez, N. & Abel-Santos, E. Mapping Interactions between Germinants and Clostridium difficile Spores. J. Bacteriol. 193, 274–282 (2011). 189. Shrestha, R., Lockless, S. W. & Sorg, J. A. A Clostridium difficile alanine racemase affects spore germination and accommodates serine as a substrate. J. Biol. Chem. 292, 10735–10742 (2017). 190. Shrestha, R. & Sorg, J. A. Hierarchical recognition of amino acid co-germinants during Clostridioides difficile spore germination. Anaerobe 49, 41–47 (2018). 191. Kochan, T. J. et al. Intestinal calcium and bile salts facilitate germination of Clostridium difficile spores. PLoS Pathog. 13, e1006443 (2017). 192. Francis, M. B., Allen, C. A., Shrestha, R. & Sorg, J. A. Bile acid recognition by the Clostridium difficile germinant receptor, CspC, is important for establishing infection. PLoS Pathog. 9, e1003356 (2013). 193. Wang, S., Shen, A., Setlow, P. & Li, Y. Characterization of the Dynamic Germination of Individual Clostridium difficile Spores Using Raman Spectroscopy and Differential Interference Contrast Microscopy. J. Bacteriol. 197, 2361–2373 (2015). 194. Bhattacharjee, D., McAllister, K. N. & Sorg, J. A. Germinants and Their Receptors in Clostridia. J. Bacteriol. 198, 2767– 2775 (2016). 195. Francis, M. B. & Sorg, J. A. Dipicolinic Acid Release by Germinating Clostridium difficile Spores Occurs through a Mechanosensing Mechanism. mSphere 1, (2016). 145

196. Donnelly, M. L. et al. A Clostridium difficile-Specific, Gel-Forming Protein Required for Optimal Spore Germination. MBio 8, (2017). 197. Carman, R. J. et al. Clostridium difficile binary toxin (CDT) and diarrhea. Anaerobe 17, 161–165 (2011). 198. Jank, T., Belyi, Y. & Aktories, K. Bacterial glycosyltransferase toxins. Cell. Microbiol. 17, 1752–1765 (2015). 199. Jank, T., Giesemann, T. & Aktories, K. Rho-glucosylating Clostridium difficile toxins A and B: new insights into structure and function. Glycobiology 17, 15R-22R (2007). 200. Di Bella, S., Ascenzi, P., Siarakas, S., Petrosillo, N. & di Masi, A. Clostridium difficile Toxins A and B: Insights into Pathogenic Properties and Extraintestinal Effects. Toxins (Basel). 8, 134 (2016). 201. Yamakawa, K., Karasawa, T., Ikoma, S. & Nakamura, S. Enhancement of Clostridium difficile toxin production in biotin- limited conditions. J. Med. Microbiol. 44, 111–114 (1996). 202. Karlsson, S. et al. Expression of Clostridium difficile toxins A and B and their sigma factor TcdD is controlled by temperature. Infect. Immun. 71, 1784–1793 (2003). 203. Bouillaut, L., Dubois, T., Sonenshein, A. L. & Dupuy, B. Integration of metabolism and virulence in Clostridium difficile. Res. Microbiol. 166, 375–383 (2015). 204. Hundsberger, T. et al. Transcription analysis of the genes tcdA-E of the pathogenicity locus of Clostridium difficile. Eur. J. Biochem. 244, 735–742 (1997). 205. Dupuy, B. & Sonenshein, A. L. Regulated transcription of Clostridium difficile toxin genes. Mol. Microbiol. 27, 107–120 (1998). 206. Karlsson, S., Lindberg, A., Norin, E., Burman, L. G. & Akerlund, T. Toxins, butyric acid, and other short-chain fatty acids are coordinately expressed and down-regulated by cysteine in Clostridium difficile. Infect. Immun. 68, 5881–5888 (2000). 207. Karlsson, S., Burman, L. G. & Akerlund, T. Suppression of toxin production in Clostridium difficile VPI 10463 by amino acids. Microbiology 145 ( Pt 7), 1683–1693 (1999). 208. Chen, S., Sun, C., Wang, H. & Wang, J. The Role of Rho GTPases in Toxicity of Clostridium difficile Toxins. Toxins (Basel). 7, 5254–5267 (2015). 209. Just, I., Richter, H. P., Prepens, U., von Eichel-Streiber, C. & Aktories, K. Probing the action of Clostridium difficile toxin B in Xenopus laevis oocytes. J. Cell Sci. 107, 1653 LP – 1659 (1994). 210. Hecht, G., Pothoulakis, C., LaMont, J. T. & Madara, J. L. Clostridium difficile toxin A perturbs cytoskeletal structure and tight junction permeability of cultured human intestinal epithelial monolayers. J. Clin. Invest. 82, 1516–1524 (1988). 211. Carter, G. P. et al. Defining the Roles of TcdA and TcdB in Localized Gastrointestinal Disease, Systemic Organ Damage, and the Host Response during Clostridium difficile Infections. MBio 6, e00551 (2015). 212. Samra, Z., Talmor, S. & Bahar, J. High prevalence of toxin A-negative toxin B-positive Clostridium difficile in hospitalized patients with gastrointestinal disease. Diagn. Microbiol. Infect. Dis. 43, 189–192 (2002). 213. Gerding, D. N., Johnson, S., Rupnik, M. & Aktories, K. Clostridium difficile binary toxin CDT: mechanism, epidemiology, and potential clinical importance. Gut Microbes 5, 15–27 (2014). 214. Knapp, O., Benz, R. & Popoff, M. R. Pore-forming activity of clostridial binary toxins. Biochim. Biophys. Acta 1858, 512–525 (2016). 215. Papatheodorou, P. et al. Lipolysis-stimulated lipoprotein receptor (LSR) is the host receptor for the binary toxin Clostridium difficile transferase (CDT). Proc. Natl. Acad. Sci. U. S. A. 108, 16422–16427 (2011). 216. Wegner, A. & Aktories, K. ADP-ribosylated actin caps the barbed ends of actin filaments. J. Biol. Chem. 263, 13739– 13742 (1988). 217. Aktories, K. et al. Botulinum C2 toxin ADP-ribosylates actin. Nature 322, 390–392 (1986). 218. Schiene-Fischer, C., Aumuller, T. & Fischer, G. Peptide bond cis/trans isomerases: a biocatalysis perspective of 146

conformational dynamics in proteins. Top. Curr. Chem. 328, 35–67 (2013). 219. Dunyak, B. M. & Gestwicki, J. E. Peptidyl-Proline Isomerases (PPIases): Targets for Natural Products and Natural Product-Inspired Compounds. J. Med. Chem. 59, 9622–9644 (2016). 220. Siekierka, J. J., Hung, S. H., Poe, M., Lin, C. S. & Sigal, N. H. A cytosolic binding protein for the immunosuppressant FK506 has peptidyl-prolyl isomerase activity but is distinct from cyclophilin. Nature 341, 755–757 (1989). 221. Fischer, G., Bang, H. & Mech, C. [Determination of enzymatic catalysis for the cis-trans-isomerization of peptide binding in proline-containing peptides]. Biomed. Biochim. Acta 43, 1101–1111 (1984). 222. Rahfeld, J. U. et al. Confirmation of the existence of a third family among peptidyl-prolyl cis/trans isomerases. Amino acid sequence and recombinant production of parvulin. FEBS Lett. 352, 180–184 (1994). 223. Behrens-Kneip, S. The role of SurA factor in outer membrane protein transport and virulence. Int. J. Med. Microbiol. 300, 421–428 (2010). 224. Lyu, Z. X. & Zhao, X. S. Periplasmic quality control in biogenesis of outer membrane proteins. Biochem. Soc. Trans. 43, 133–138 (2015). 225. Unal, C. M. & Steinert, M. Microbial peptidyl-prolyl cis/trans isomerases (PPIases): virulence factors and potential alternative drug targets. Microbiol. Mol. Biol. Rev. 78, 544–571 (2014). 226. Cahoon, L. A. & Freitag, N. E. Listeria monocytogenes virulence factor secretion: don’t leave the cell without a chaperone. Front. Cell. Infect. Microbiol. 4, 13 (2014). 227. Rasch, J., Unal, C. M. & Steinert, M. Peptidylprolyl cis-trans isomerases of Legionella pneumophila: virulence, moonlighting and novel therapeutic targets. Biochem. Soc. Trans. 42, 1728–1733 (2014). 228. Gioti, A. et al. Expression profiling of Botrytis cinerea genes identifies three patterns of up-regulation in planta and an FKBP12 protein affecting pathogenicity. J. Mol. Biol. 358, 372–386 (2006). 229. Port, G. C. & Freitag, N. E. Identification of novel Listeria monocytogenes secreted virulence factors following mutational activation of the central virulence regulator, PrfA. Infect. Immun. 75, 5886–5897 (2007). 230. Gothel, S. F., Scholz, C., Schmid, F. X. & Marahiel, M. A. Cyclophilin and trigger factor from Bacillus subtilis catalyze in vitro protein folding and are necessary for viability under starvation conditions. Biochemistry 37, 13392–13399 (1998). 231. Justice, S. S. et al. Periplasmic peptidyl prolyl cis-trans isomerases are not essential for viability, but SurA is required for pilus biogenesis in Escherichia coli. J. Bacteriol. 187, 7680–7686 (2005). 232. Dolinski, K., Muir, S., Cardenas, M. & Heitman, J. All cyclophilins and FK506 binding proteins are, individually and collectively, dispensable for viability in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. U. S. A. 94, 13093–13098 (1997). 233. Obi, I. R., Nordfelth, R. & Francis, M. S. Varying dependency of periplasmic peptidylprolyl cis-trans isomerases in promoting Yersinia pseudotuberculosis stress tolerance and pathogenicity. Biochem. J. 439, 321–332 (2011). 234. Kontinen, V. P., Saris, P. & Sarvas, M. A gene (prsA) of Bacillus subtilis involved in a novel, late stage of protein export. Mol. Microbiol. 5, 1273–1283 (1991). 235. Vitikainen, M. et al. Structure-function analysis of PrsA reveals roles for the parvulin-like and flanking N- and C-terminal domains in protein folding and secretion in Bacillus subtilis. J. Biol. Chem. 279, 19302–19314 (2004). 236. Zemansky, J. et al. Development of a mariner-based transposon and identification of Listeria monocytogenes determinants, including the peptidyl-prolyl isomerase PrsA2, that contribute to its hemolytic phenotype. J. Bacteriol. 191, 3950–3964 (2009). 237. Alonzo, F. 3rd & Freitag, N. E. Listeria monocytogenes PrsA2 is required for virulence factor secretion and bacterial viability within the host cell cytosol. Infect. Immun. 78, 4944–4957 (2010). 238. Alonzo 3rd, F., Xayarath, B., Whisstock, J. C. & Freitag, N. E. Functional analysis of the Listeria monocytogenes secretion 147

chaperone PrsA2 and its multiple contributions to bacterial virulence. Mol. Microbiol. 80, 1530–1548 (2011). 239. Forster, B. M., Zemansky, J., Portnoy, D. A. & Marquis, H. Posttranslocation chaperone PrsA2 regulates the maturation and secretion of Listeria monocytogenes proprotein virulence factors. J. Bacteriol. 193, 5961–5970 (2011). 240. Ikolo, F. et al. Characterisation of SEQ0694 (PrsA/PrtM) of Streptococcus equi as a functional peptidyl-prolyl isomerase affecting multiple secreted protein substrates. Mol. Biosyst. 11, 3279–3286 (2015). 241. Cincarova, L., Polansky, O., Babak, V., Kulich, P. & Kralik, P. Changes in the Expression of Biofilm-Associated Surface Proteins in Staphylococcus aureus Food-Environmental Isolates Subjected to Sublethal Concentrations of Disinfectants. Biomed Res. Int. 2016, 4034517 (2016). 242. Jiang, X. et al. Roles of the Putative Type IV-like Secretion System Key Component VirD4 and PrsA in Pathogenesis of Streptococcus suis Type 2. Front. Cell. Infect. Microbiol. 6, 172 (2016). 243. Wiemels, R. E. et al. An Intracellular Peptidyl-Prolyl cis/trans Isomerase Is Required for Folding and Activity of the Staphylococcus aureus Secreted Virulence Factor Nuclease. J. Bacteriol. 199, (2017). 244. Ünal, C. M. et al. PrsA2 (CD630_35000) of Clostridioides difficile Is an Active Parvulin-Type PPIase and a Virulence Modulator. Front. Microbiol. 9, 2913 (2018). 245. Tremblay, P., Zhang, T., Dar, S. A., Leang, C. & Lovley, D. R. The Rnf Complex of Clostridium ljungdahlii Is a Proton- .(Translocating Ferredoxin : NAD ؉ Oxidoreductase Essential for Autotrophic Growth. 4, 1–8 (2013 246. Suharti, S., Wang, M., Vries, S. De & Ferry, J. G. Characterization of the RnfB and RnfG Subunits of the Rnf Complex from the Archaeon Methanosarcina acetivorans. 9, 1–10 (2014). 247. Fonknechten, N. et al. Clostridium sticklandii , a specialist in amino acid degradation : revisiting its metabolism through its genome sequence. (2010). 248. Antharam, V. C. et al. Intestinal dysbiosis and depletion of butyrogenic bacteria in Clostridium difficile infection and nosocomial diarrhea. J. Clin. Microbiol. 51, 2884–2892 (2013). 249. Chang, J. Y. et al. Decreased diversity of the fecal Microbiome in recurrent Clostridium difficile-associated diarrhea. J. Infect. Dis. 197, 435–438 (2008). 250. Hopkins, M. J. & Macfarlane, G. T. Changes in predominant bacterial populations in human faeces with age and with Clostridium difficile infection. J. Med. Microbiol. 51, 448–454 (2002). 251. Perez-Cobas, A. E. et al. Gut microbiota disturbance during antibiotic therapy: a multi-omic approach. Gut 62, 1591–1601 (2013). 252. Vincent, C. et al. Reductions in intestinal Clostridiales precede the development of nosocomial Clostridium difficile infection. Microbiome 1, 18 (2013). 253. Buffie, C. G. et al. Precision microbiome restoration of bile acid-mediated resistance to Clostridium difficile. Nature 517, 205–208 (2015). 254. Howerton, A., Patra, M. & Abel-Santos, E. A new strategy for the prevention of Clostridium difficile infection. J. Infect. Dis. 207, 1498–1504 (2013). 255. Sorg, J. A. & Sonenshein, A. L. Inhibiting the initiation of Clostridium difficile spore germination using analogs of chenodeoxycholic acid, a bile acid. J. Bacteriol. 192, 4983–4990 (2010). 256. Giel, J. L., Sorg, J. A., Sonenshein, A. L. & Zhu, J. Metabolism of bile salts in mice influences spore germination in clostridium difficile. PLoS One 5, e8740 (2010). 257. Antunes, L. C. M. et al. Effect of antibiotic treatment on the intestinal metabolome. Antimicrob. Agents Chemother. 55, 1494–1503 (2011). 258. Theriot, C. M. et al. Antibiotic-induced shifts in the mouse gut microbiome and metabolome increase susceptibility to Clostridium difficile infection. Nat. Commun. 5, 3114 (2014). 148

259. Lawley, T. D. & Walker, A. W. Intestinal colonization resistance. Immunology 138, 1–11 (2013). 260. Reeves, A. E., Koenigsknecht, M. J., Bergin, I. L. & Young, V. B. Suppression of Clostridium difficile in the gastrointestinal tracts of germfree mice inoculated with a murine isolate from the family Lachnospiraceae. Infect. Immun. 80, 3786–3794 (2012). 261. Su, W. J. et al. Role of volatile fatty acids in colonization resistance to Clostridium difficile in gnotobiotic mice. Infect. Immun. 55, 1686–1691 (1987). 262. Ng, K. M. et al. Microbiota-liberated host sugars facilitate post-antibiotic expansion of enteric pathogens. Nature 502, 96–99 (2013). 263. Perez-Cobas, A. E. et al. Structural and functional changes in the gut microbiota associated to Clostridium difficile infection. Front. Microbiol. 5, 335 (2014). 264. Rea, M. C. et al. Thuricin CD, a posttranslationally modified bacteriocin with a narrow spectrum of activity against Clostridium difficile. Proc. Natl. Acad. Sci. U. S. A. 107, 9352–9357 (2010). 265. Winston, J. A. & Theriot, C. M. Impact of microbial derived secondary bile acids on colonization resistance against Clostridium difficile in the gastrointestinal tract. Anaerobe 41, 44–50 (2016). 266. Jarchum, I., Liu, M., Shi, C., Equinda, M. & Pamer, E. G. Critical role for MyD88-mediated neutrophil recruitment during Clostridium difficile colitis. Infect. Immun. 80, 2989–2996 (2012). 267. Hasegawa, M. et al. Protective role of commensals against Clostridium difficile infection via an IL-1beta-mediated positive-feedback loop. J. Immunol. 189, 3085–3091 (2012). 268. Hasegawa, M. et al. Nucleotide-binding oligomerization domain 1 mediates recognition of Clostridium difficile and induces neutrophil recruitment and protection against the pathogen. J. Immunol. 186, 4872–4880 (2011). 269. Jarchum, I., Liu, M., Lipuma, L. & Pamer, E. G. Toll-like receptor 5 stimulation protects mice from acute Clostridium difficile colitis. Infect. Immun. 79, 1498–1503 (2011). 270. Branka, J. E. et al. Early functional effects of Clostridium difficile toxin A on human colonocytes. Gastroenterology 112, 1887–1894 (1997). 271. Corfield, A. P. et al. Mucins and mucosal protection in the gastrointestinal tract: new prospects for mucins in the pathology of gastrointestinal disease. Gut 47, 589–594 (2000). 272. Bevins, C. L., Martin-Porter, E. & Ganz, T. Defensins and innate host defence of the gastrointestinal tract. Gut 45, 911– 915 (1999). 273. Hing, T. C. et al. The antimicrobial peptide cathelicidin modulates Clostridium difficile-associated colitis and toxin A- mediated enteritis in mice. Gut 62, 1295–1305 (2013). 274. Mahida, Y. R., Makh, S., Hyde, S., Gray, T. & Borriello, S. P. Effect of Clostridium difficile toxin A on human intestinal epithelial cells: induction of interleukin 8 production and apoptosis after cell detachment. Gut 38, 337–347 (1996). 275. Vohra, P. & Poxton, I. R. Induction of cytokines in a macrophage cell line by proteins of Clostridium difficile. FEMS Immunol. Med. Microbiol. 65, 96–104 (2012). 276. Sunenshine, R. H. & McDonald, L. C. Clostridium difficile-associated disease: new challenges from an established pathogen. Cleve. Clin. J. Med. 73, 187–197 (2006). 277. Ryan, A. et al. A role for TLR4 in Clostridium difficile infection and the recognition of surface layer proteins. PLoS Pathog. 7, e1002076 (2011). 278. Kyne, L., Sougioultzis, S., McFarland, L. V & Kelly, C. P. Underlying disease severity as a major risk factor for nosocomial Clostridium difficile diarrhea. Infect. Control Hosp. Epidemiol. 23, 653–659 (2002). 279. Johal, S. S. et al. Colonic IgA producing cells and macrophages are reduced in recurrent and non-recurrent Clostridium difficile associated diarrhoea. J. Clin. Pathol. 57, 973–979 (2004). 149

280. Drudy, D. et al. Human antibody response to surface layer proteins in Clostridium difficile infection. FEMS Immunol. Med. Microbiol. 41, 237–242 (2004). 281. McDonald, L. C. et al. Clinical Practice Guidelines for Clostridium difficile Infection in Adults and Children: 2017 Update by the Infectious Diseases Society of America (IDSA) and Society for Healthcare Epidemiology of America (SHEA). Clin. Infect. Dis. 66, 987–994 (2018). 282. Brandt, L. J. et al. Long-term follow-up of colonoscopic fecal microbiota transplant for recurrent Clostridium difficile infection. Am. J. Gastroenterol. 107, 1079–1087 (2012). 283. Kelly, C. R., de Leon, L. & Jasutkar, N. Fecal microbiota transplantation for relapsing Clostridium difficile infection in 26 patients: methodology and results. J. Clin. Gastroenterol. 46, 145–149 (2012). 284. McSeveney, M. FDA In Brief: FDA warns about potential risk of serious infections caused by multi-drug resistant organisms related to the investigational use of Fecal Microbiota for Transplantation. https://www.fda.gov/news-events/fda- brief/fda-brief-fda-warns-about-potential-risk-serious-infections-caused-multi-drug-resistant-organisms 285. Best, E. L., Freeman, J. & Wilcox, M. H. Models for the study of Clostridium difficile infection. Gut Microbes 3, 145– 167 (2012). 286. Chen, X. et al. A Mouse Model of Clostridium difficile-Associated Disease. Gastroenterology 135, 1984–1992 (2008). 287. Theriot, C. M., Bowman, A. A. & Young, V. B. Antibiotic-Induced Alterations of the Gut Microbiota Alter Secondary Bile Acid Production and Allow for Clostridium difficile Spore Germination and Outgrowth in the Large Intestine. mSphere 1, (2016). 288. Reeves, A. E. et al. The interplay between microbiome dynamics and pathogen dynamics in a murine model of Clostridium difficile Infection. Gut Microbes 2, 145–158 (2011). 289. Studer, N. et al. Functional Intestinal Bile Acid 7α-Dehydroxylation by Clostridium scindens Associated with Protection from Clostridium difficile Infection in a Gnotobiotic Mouse Model. Front. Cell. Infect. Microbiol. 6, 191 (2016). 290. Shin, J. H. et al. Innate Immune Response and Outcome of Clostridium difficile Infection Are Dependent on Fecal Bacterial Composition in the Aged Host. J. Infect. Dis. 217, 188–197 (2018). 291. Bernui, M. E. & Kutzler, M. A. Age-associated defects impair the optimal development of a protective immune response to Clostridium difficile in the context of infection in a novel aged murine model. J. Immunol. 196, 65.21 LP-65.21 (2016). 292. Brugiroux, S. et al. Genome-guided design of a defined mouse microbiota that confers colonization resistance against Salmonella enterica serovar Typhimurium. Nat. Microbiol. 2, 16215 (2016). 293. Derrien, M., Vaughan, E. E., Plugge, C. M. & de Vos, W. M. Akkermansia muciniphila gen. nov., sp. nov., a human intestinal mucin-degrading bacterium. Int. J. Syst. Evol. Microbiol. 54, 1469–1476 (2004). 294. Lagkouvardos, I. et al. The Mouse Intestinal Bacterial Collection (miBC) provides host-specific insight into cultured diversity and functional potential of the gut microbiota. Nat. Microbiol. 1, 16131 (2016). 295. Masco, L., Ventura, M., Zink, R., Huys, G. & Swings, J. Polyphasic taxonomic analysis of Bifidobacterium animalis and Bifidobacterium lactis reveals relatedness at the subspecies level: reclassification of Bifidobacterium animalis as Bifidobacterium animalis subsp. animalis subsp. nov. and Bifidobacterium lact. Int. J. Syst. Evol. Microbiol. 54, 1137– 1143 (2004). 296. Mitsuoka, T. [Comparative studies on bifidobacteria isolated from the alimentary tract of man and animals (including descriptions of bifidobacterium thermophilum nov. spec. and bifidobacterium pseudolongum nov. spec)]. Zentralbl. Bakteriol. Orig. 210, 52–64 (1969). 297. Andrewes, F. W. & Foulerton, A. G. Report on the Sections Submitted from the Two Cases (Nos. 11 and 42). Med. Chir. Trans. 89, 156a-d (1906). 150

298. Schleifer, K. H. & Kilpper-Bälz, R. Transfer of Streptococcus faecalis and Streptococcus faecium to the Genus Enterococcus nom. rev. as Enterococcus faecalis comb. nov. and Enterococcus faecium comb. nov. Int. J. Syst. Evol. Microbiol. 34, 31–34 (1984). 299. Burri, R. & Ankersmit., 0. Bacterium clostridiiforme. P. Ankersmit (ed.), Untersuchunger uber tralbl. Bacteriol. Parasitenkd. Infekt. Hyg. Abt. I Orig. lOO-118. (1906). 300. KANEUCHI, C., WATANABE, K., TERADA, A., BENNO, Y. & MITSUOKA, T. Taxonomic Study of Bacteroides clostridiiformis subsp. clostridiiformis (Burri and Ankersmit) Holdeman and Moore and of Related Organisms: Proposal of Clostridium clostridiiformis (Burri and Ankersmit) comb. nov. and Clostridium symbiosum (Stevens) comb. . Int. J. Syst. Evol. Microbiol. 26, 195–204 (1976). 301. Séguin, P. Culture du Fusobacterium plauti forme mobile du bacille fusiforme. C. R. Soc. Biol. 439–442 (1928). 302. Carlier, J.-P., Bedora-Faure, M., K’ouas, G., Alauzet, C. & Mory, F. Proposal to unify Clostridium orbiscindens Winter et al. 1991 and Eubacterium plautii (Seguin 1928) Hofstad and Aasjord 1982, with description of Flavonifractor plautii gen. nov., comb. nov., and reassignment of Bacteroides capillosus to Pseudoflavonifrac. Int. J. Syst. Evol. Microbiol. 60, 585–590 (2010). 303. Kaneuchi, C., Benno, Y. & Mitsuoka, T. Clostridium coccoides , a New Species from the Feces of Mice. 26, 482–486 (1976). 304. Liu, C., Finegold, S. M., Song, Y. & Lawson, P. A. Reclassification of Clostridium coccoides, Ruminococcus hansenii, Ruminococcus hydrogenotrophicus, Ruminococcus luti, Ruminococcus productus and Ruminococcus schinkii as Blautia coccoides gen. nov., comb. nov., Blautia hansenii comb. nov., Blautia hydroge. Int. J. Syst. Evol. Microbiol. 58, 1896– 1902 (2008). 305. Smith, L. D. & King, E. Clostridium innocuum, sp. n., a sporeforming anaerobe isolated from human infections. J. Bacteriol. 83, 938–939 (1962). 306. Edwards, A. N., Suarez, J. M. & McBride, S. M. Culturing and maintaining Clostridium difficile in an anaerobic environment. J. Vis. Exp. e50787 (2013). doi:10.3791/50787 307. Goodman, A. L. et al. Extensive personal human gut microbiota culture collections characterized and manipulated in gnotobiotic mice. Proc. Natl. Acad. Sci. 108, 6252 LP – 6257 (2011). 308. Bankevich, A. et al. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. 19, 455–477 (2012). 309. Seemann, T. Prokka: rapid prokaryotic genome annotation. Bioinformatics 30, 2068–2069 (2014). 310. Peng, Z. et al. Update on Antimicrobial Resistance in Clostridium difficile: Resistance Mechanisms and Antimicrobial Susceptibility Testing. J. Clin. Microbiol. 55, 1998–2008 (2017). 311. Caporaso, J. G. et al. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. Proc. Natl. Acad. Sci. 108, 4516–4522 (2011). 312. Edgar, R. C. UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nat. Methods 10, 996–998 (2013). 313. Quast, C. et al. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Res. 41, D590-6 (2013). 314. Wang, Q., Garrity, G. M., Tiedje, J. M. & Cole, J. R. Naïve Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Appl. Environ. Microbiol. 73, 5261–5267 (2007). 315. Caporaso, J. G. et al. QIIME allows analysis of high-throughput community sequencing data. 7, 335–336 (2011). 316. McMurdie, P. J. & Holmes, S. Phyloseq: An R Package for Reproducible Interactive Analysis and Graphics of Microbiome Census Data. PLoS One 8, (2013). 317. Segata, N. et al. Metagenomic biomarker discovery and explanation. Genome Biol. 12, R60 (2011). 151

318. Theriot, C. M., Bowman, A. A. & Young, V. B. Antibiotic-Induced Alterations of the Gut Microbiota Alter Secondary Bile Acid Production and Allow for Clostridium difficile Spore Germination and Outgrowth in the Large Intestine. mSphere 1, e00045-15 (2016). 319. Bushnell, B. BBMap: A Fast, Accurate, Splice-Aware Aligner. 320. Garzetti, D. et al. High-Quality Whole-Genome Sequences of the Oligo-Mouse-Microbiota Bacterial Community. Genome Announc. 5, (2017). 321. Li, D., Liu, C.-M., Luo, R., Sadakane, K. & Lam, T.-W. MEGAHIT: an ultra-fast single-node solution for large and complex metagenomics assembly via succinct de Bruijn graph. Bioinformatics 31, 1674–1676 (2015). 322. Kang, D. et al. MetaBAT 2: an adaptive binning algorithm for robust and efficient genome reconstruction from metagenome assemblies. PeerJ Prepr. 7, e27522v1 (2019). 323. Parks, D. H., Imelfort, M., Skennerton, C. T., Hugenholtz, P. & Tyson, G. W. CheckM: assessing the quality of microbial genomes recovered from isolates, single cells, and metagenomes. Genome Res. 25, 1043–1055 (2015). 324. Chaumeil, P.-A., Mussig, A. J., Hugenholtz, P. & Parks, D. H. GTDB-Tk: a toolkit to classify genomes with the Genome Taxonomy Database. Bioinformatics (2019). doi:10.1093/bioinformatics/btz848 325. Altschul, S. F., Gish, W., Miller, W., Myers, E. W. & Lipman, D. J. Basic local alignment search tool. J. Mol. Biol. 215, 403–410 (1990). 326. The UniProt Consortium. UniProt: the universal protein knowledgebase. Nucleic Acids Res. 45, D158–D169 (2017). 327. Kumar, S., Stecher, G. & Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 33, 1870–1874 (2016). 328. Lagkouvardos, I. et al. Sequence and cultivation study of Muribaculaceae reveals novel species, host preference, and functional potential of this yet undescribed family. Microbiome 7, 28 (2019). 329. Theriot, C. M., Bowman, A. A. & Young, V. B. Antibiotic-Induced Alterations of the Gut Microbiota Alter Secondary Bile Acid Production and Allow for Clostridium difficile Spore Germination and Outgrowth in the Large Intestine. mSphere 1, e00045-15 (2016). 330. Shin, J. H., High, K. P. & Warren, C. A. Older Is Not Wiser, Immunologically Speaking: Effect of Aging on Host Response to Clostridium difficile Infections. J. Gerontol. A. Biol. Sci. Med. Sci. 71, 916–922 (2016). 331. Petrof, E. O. et al. Stool substitute transplant therapy for the eradication of Clostridium difficile infection: ‘RePOOPulating’ the gut. Microbiome 1, 3 (2013). 332. Zanella Terrier, M. C., Simonet, M. L., Bichard, P. & Frossard, J. L. Recurrent Clostridium difficile infections: The importance of the intestinal microbiota. World J. Gastroenterol. 20, 7416–7423 (2014). 333. Woodworth, M. H. et al. Laboratory Testing of Donors and Stool Samples for Fecal Microbiota Transplantation for Recurrent Clostridium difficile Infection. J. Clin. Microbiol. 55, 1002 LP – 1010 (2017). 334. Leffler, D. A. & Lamont, J. T. Clostridium difficile Infection. The New England journal of medicine 373, 287–288 (2015). 335. CZEPIEL, J. et al. Epidemiology of Clostridium difficile infection: results of a hospital-based study in Krakow, Poland. Epidemiol. Infect. 143, 3235–3243 (2015). 336. Czepiel, J. et al. Clostridium difficile infection: review. Eur. J. Clin. Microbiol. Infect. Dis. 38, 1211–1221 (2019). 337. Cohen, S. H. et al. Clinical practice guidelines for Clostridium difficile infection in adults: 2010 update by the society for healthcare epidemiology of America (SHEA) and the infectious diseases society of America (IDSA). Infect. Control Hosp. Epidemiol. 31, 431–455 (2010). 338. Henrich, T. J., Krakower, D., Bitton, A. & Yokoe, D. S. Clinical risk factors for severe Clostridium difficile-associated 152

disease. Emerg. Infect. Dis. 15, 415–422 (2009). 339. Pepin, J., Valiquette, L. & Cossette, B. Mortality attributable to nosocomial Clostridium difficile-associated disease during an epidemic caused by a hypervirulent strain in Quebec. CMAJ 173, 1037–1042 (2005). 340. El Chakhtoura, N. G., Bonomo, R. A. & Jump, R. L. P. Influence of Aging and Environment on Presentation of Infection in Older Adults. Infect. Dis. Clin. North Am. 31, 593–608 (2017). 341. Bandaranayake, T. & Shaw, A. C. Host Resistance and Immune Aging. Clin. Geriatr. Med. 32, 415–432 (2016). 342. Odamaki, T. et al. Age-related changes in gut microbiota composition from newborn to centenarian: a cross-sectional study. BMC Microbiol. 16, 90 (2016). 343. Peniche, A. G., Spinler, J. K., Boonma, P., Savidge, T. C. & Dann, S. M. Aging impairs protective host defenses against Clostridioides (Clostridium) difficile infection in mice by suppressing neutrophil and IL-22 mediated immunity. Anaerobe 54, 83–91 (2018). 344. Ley, R. E., Lozupone, C. A., Hamady, M., Knight, R. & Gordon, J. I. Worlds within worlds: evolution of the vertebrate gut microbiota. Nature reviews. Microbiology 6, 776–788 (2008). 345. Bartlett, J. G. Clostridium difficile: progress and challenges. Ann. N. Y. Acad. Sci. 1213, 62–69 (2010). 346. Britton, R. A. & Young, V. B. Interaction between the intestinal microbiota and host in Clostridium difficile colonization resistance. Trends Microbiol. 20, 313–319 (2012). 347. Mullish, B. H. & Williams, H. R. Clostridium difficile infection and antibiotic-associated diarrhoea. Clin. Med. 18, 237– 241 (2018). 348. Stecher, B. & Hardt, W.-D. Mechanisms controlling pathogen colonization of the gut. Curr. Opin. Microbiol. 14, 82–91 (2011). 349. Swann, J. R. et al. Systemic gut microbial modulation of bile acid metabolism in host tissue compartments. Proc. Natl. Acad. Sci. U. S. A. 108 Suppl 1, 4523–4530 (2011). 350. Cho, I. et al. Antibiotics in early life alter the murine colonic microbiome and adiposity. Nature 488, 621–626 (2012). 351. Dai, Z.-L., Wu, G. & Zhu, W.-Y. Amino acid metabolism in intestinal bacteria: links between gut ecology and host health. Front. Biosci. (Landmark Ed. 16, 1768–1786 (2011). 352. Hashimoto, T. et al. ACE2 links amino acid malnutrition to microbial ecology and intestinal inflammation. Nature 487, 477–481 (2012). 353. Macfarlane, G. T., Cummings, J. H. & Allison, C. Protein degradation by human intestinal bacteria. J. Gen. Microbiol. 132, 1647–1656 (1986). 354. Schubert, A. M., Sinani, H. & Schloss, P. D. Antibiotic-Induced Alterations of the Murine Gut Microbiota and Subsequent Effects on Colonization Resistance against Clostridium difficile MBio 6, e00974-15 (2015). 355. Fletcher, J. R., Erwin, S., Lanzas, C. & Theriot, C. M. Shifts in the Gut Metabolome and Clostridium difficile Transcriptome throughout Colonization and Infection in a Mouse Model. mSphere 3, e00089-18 (2018). 356. Rao, K. & Safdar, N. Fecal microbiota transplantation for the treatment of Clostridium difficile infection. J. Hosp. Med. 11, 56–61 (2016). 357. Yoon, S. S. & Brandt, L. J. Treatment of refractory/recurrent C. difficile-associated disease by donated stool transplanted via colonoscopy: a case series of 12 patients. J. Clin. Gastroenterol. 44, 562–566 (2010). 358. Owens, C., Broussard, E. & Surawicz, C. Fecal microbiota transplantation and donor standardization. Trends Microbiol. 21, 443–445 (2013). 359. Gathe, J. C., Diejomaoh, E. M., Mayberry, C. C. & Clemmons, J. B. Fecal Transplantation for Clostridium Difficile ‘All Stool May Not Be Created Equal’. J. Int. Assoc. Provid. AIDS Care 1–2 (2016). doi:10.1177/2325957415627695 153

360. Kelly, C. & Alm, E. J. How to regulate faecal transplants. 5–6 361. Bakken, J. S. et al. Treating Clostridium difficile Infection With Fecal Microbiota Transplantation. YJCGH 9, 1044–1049 (2011). 362. Gregory, J. C. et al. Transmission of Atherosclerosis Susceptibility with Gut Microbial Transplantation *. J. Biol. Chem. 290, 5647–5660 (2015). 363. Vrieze, A. et al. Transfer of Intestinal Microbiota From Lean Donors Increases Insulin Sensitivity in Individuals With Metabolic Syndrome. Gastroenterology 143, 913-916.e7 (2012). 364. Suskind, D. L. et al. Fecal microbial transplant effect on clinical outcomes and fecal microbiome in active Crohn’s disease. Inflamm. Bowel Dis. 21, 556–563 (2015). 365. Chandel, D. S., Braileanu, G. T., Chen, J.-H. J., Chen, H. H. & Panigrahi, P. Live colonocytes in newborn stool: surrogates for evaluation of gut physiology and disease pathogenesis. Pediatr. Res. 70, 153–158 (2011). 366. Mantis, N. J., Rol, N. & Corthesy, B. Secretory IgA’s complex roles in immunity and mucosal homeostasis in the gut. Mucosal Immunol. 4, 603–611 (2011). 367. Bojanova, D. P. & Bordenstein, S. R. Fecal Transplants : What Is Being Transferred ? 1–12 (2016). doi:10.1371/journal.pbio.1002503 368. Borody, T. J. & Khoruts, A. Fecal microbiota transplantation and emerging applications. Nat. Rev. Gastroenterol. Hepatol. 9, 88–96 (2011). 369. Tvede, M. & Rask-Madsen, J. Bacteriotherapy for chronic relapsing Clostridium difficile diarrhoea in six patients. Lancet 1, (1989). 370. Ridlon, J. M. et al. Clostridium scindens: a human gut microbe with a high potential to convert glucocorticoids into androgens. J. Lipid Res. 54, 2437–2449 (2013). 371. Frese, S. A. et al. Molecular Characterization of Host-Specific Biofilm Formation in a Vertebrate Gut Symbiont. PLOS Genet. 9, e1004057 (2013). 372. Arrieta, M., Walter, J. & Finlay, B. B. Forum Human Microbiota-Associated Mice : A Model with Challenges. Cell Host Microbe 19, 575–578 (2016). 373. Ley, R. E. et al. Obesity alters gut microbial ecology. Proc. Natl. Acad. Sci. 102, 11070–11075 (2005). 374. Seedorf, H. et al. Bacteria from diverse habitats colonize and compete in the mouse gut. Cell 159, 253–266 (2014). 375. Chung, H. et al. Gut Immune Maturation Depends on Colonization with a Host-Specific Microbiota. 2, (2012). 376. Salzman, N. H. et al. Analysis of 16S libraries of mouse gastrointestinal microflora reveals a large new group of mouse intestinal bacteria. Microbiology 148, 3651–3660 (2002). 377. Ormerod, K. L. et al. Genomic characterization of the uncultured Bacteroidales family S24-7 inhabiting the guts of homeothermic animals. Microbiome 4, 36 (2016). 378. Stewart, E. J. Growing Unculturable Bacteria. J. Bacteriol. 194, 4151 LP – 4160 (2012). 379. Ridlon, J. M., Kang, D.-J. & Hylemon, P. B. Bile salt biotransformations by human intestinal bacteria. J. Lipid Res. 47, 241–259 (2006). 380. Foley, M. H., O’Flaherty, S., Barrangou, R. & Theriot, C. M. Bile salt hydrolases: Gatekeepers of bile acid metabolism and host-microbiome crosstalk in the gastrointestinal tract. PLoS Pathog. 15, e1007581–e1007581 (2019). 381. Fiorucci, S. & Distrutti, E. Bile Acid-Activated Receptors, Intestinal Microbiota, and the Treatment of Metabolic Disorders. Trends Mol. Med. 21, 702–714 (2015). 382. Corrêa-Oliveira, R., Fachi, J. L., Vieira, A., Sato, F. T. & Vinolo, M. A. R. Regulation of immune cell function by short- chain fatty acids. Clin. Transl. Immunol. 5, e73–e73 (2016). 383. Galvão, I. et al. The Metabolic Sensor GPR43 Receptor Plays a Role in the Control of Klebsiella pneumoniae Infection 154

in the Lung . Frontiers in Immunology 9, 142 (2018). 384. Koh, A., De Vadder, F., Kovatcheva-Datchary, P. & Backhed, F. From Dietary Fiber to Host Physiology: Short-Chain Fatty Acids as Key Bacterial Metabolites. Cell 165, 1332–1345 (2016). 385. Hryckowian, A. J. et al. Microbiota-accessible carbohydrates suppress Clostridium difficile infection in a murine model. Nat. Microbiol. 3, 662–669 (2018). 386. Valdes-Varela, L., Hernandez-Barranco, A. M., Ruas-Madiedo, P. & Gueimonde, M. Effect of Bifidobacterium upon Clostridium difficile Growth and Toxicity When Co-cultured in Different Prebiotic Substrates. Front. Microbiol. 7, 738 (2016). 387. Fachi, J. L., Felipe, J. D. S., Farias, S., Varga-weisz, P. & Vinolo, M. A. R. Butyrate Protects Mice from Clostridium difficile - Induced Colitis through an HIF-1-Dependent Article Butyrate Protects Mice from Clostridium difficile -Induced Colitis through an HIF-1-Dependent Mechanism. Cell Rep. 27, 750–761 (2019). 388. Taras, D., Simmering, R., Collins, M. D., Lawson, P. A. & Blaut, M. Reclassification of Eubacterium formicigenerans Holdeman and Moore 1974 as Dorea formicigenerans gen. nov., comb. nov., and description of Dorea longicatena sp. nov., isolated from human faeces. Int. J. Syst. Evol. Microbiol. 52, 423–428 (2002). 389. Fukiya, S. et al. Conversion of cholic acid and chenodeoxycholic acid into their 7-oxo derivatives by Bacteroides intestinalis AM-1 isolated from human feces. FEMS Microbiol. Lett. 293, 263–270 (2009). 390. Nguyen, T. L. A., Vieira-Silva, S., Liston, A. & Raes, J. How informative is the mouse for human gut microbiota research? Dis. Model. & Mech. 8, 1 LP – 16 (2015).

155