Development and Characterization of an Immunologically Humanized And

Iowa State University Capstones, Theses and Graduate Theses and Dissertations Dissertations

2019 Development and characterization of an immunologically humanized and cancer xenograft model in pigs with severe combined immunodeficiency (SCID) Adeline Nicole Boettcher Iowa State University

Follow this and additional works at: https://lib.dr.iastate.edu/etd Part of the Cell Biology Commons, Developmental Biology Commons, and the Molecular Biology Commons

Recommended Citation Boettcher, Adeline Nicole, "Development and characterization of an immunologically humanized and cancer xenograft model in pigs with severe combined immunodeficiency (SCID)" (2019). Graduate Theses and Dissertations. 16975. https://lib.dr.iastate.edu/etd/16975

This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected].

Development and characterization of an immunologically humanized and cancer xenograft model in pigs with severe combined immunodeficiency (SCID)

Adeline N. Boettcher

A dissertation submitted to the graduate faculty

in partial fulfillment of the requirements for the degree of

DOCTOR OF PHILOSOPHY

Major: Molecular, Cellular, and Developmental Biology

Program of Study Committee: Christopher K. Tuggle; Major Professor Joan E. Cunnick Crystal L. Loving Jason W. Ross Randy E. Sacco

The student author, whose presentation of the scholarship herein was approved by the program of study committee, is solely responsible for the content of this dissertation. The Graduate College will ensure this dissertation is globally accessible and will not permit alterations after a degree is conferred.

Iowa State University

Ames, Iowa

2019

TABLE OF CONTENTS

Page

LIST OF FIGURES ...... v

LIST OF TABLES ...... viii

NOMENCLATURE ...... ix

ACKNOWLEDGMENTS ...... xii

ABSTRACT………………………………...... xiv

CHAPTER 1 INTRODUCTION AND DISSERTATON STRUCTURE ...... 1

CHAPTER 2 LITERATURE REVIEW ...... 3

Abstract ...... 3 Introduction ...... 5 Existing SCID pig models ...... 7 Leaky T cell development in SCID pigs and Artemis function ...... 11 SCID pig cancer xenotransplantation studies ...... 13 Porcine immunological similarities to human ...... 15 Routes for humanization and applications ...... 16 Future outlooks on the utilization of SCID pigs for cancer therapies and research ...... 24 Concluding remarks ...... 27 References ...... 28 Figures ...... 41 Tables ...... 49 Supplemental Tables ...... 51

CHAPTER 3 PORCINE SIRPA BINDS TO HUMAN CD47 TO INHIBIT PHAGOCYTOSIS: IMPLICATIONS FOR HUMAN HEMATOPOIETIC STEM CELL TRANSPLANTATION INTO SCID PIGS ...... 52 Abstract ...... 52 Introduction ...... 54 Results ...... 56 Discussion ...... 61 Materials and Methods ...... 64 References ...... 67 Figures ...... 73 Supplemental Figures...... 77

iii

CHAPTER 4 A COMPREHENSIVE PROTOCOL FOR LAPAROTOMY IN SWINE TO FACILITATE ULTRASOUND-GUIDED INJECTION INTO THE FETAL INTRAPERITONEAL SPACE ...... 79 Abstract ...... 79 Introduction ...... 80 Results ...... 82 Discussion ...... 85 Materials and Methods ...... 88 References ...... 92 Figures ……………………………………………………………………………………………………...... 96 Tables …………………………………………………………………...... 99

CHAPTER 5 ENGRAFTMENT OF HUMAN IMMUNE CELLS IN CRISPR/CAS9 Art-/- IL2RG-/Y SCID PIGS AFTER IN UTERO INJECTION OF HUMAN CD34+ CELLS ...... 103 Abstract ...... 104 Introduction ...... 104 Results ...... 107 Discussion ...... 113 Materials and Methods ...... 118 References ...... 127 Figures ...... 133 Tables ...... 139 Supplemental Figures...... 140 Supplemental Tables ...... 146

CHAPTER 6 HUMAN OVARIAN CANCER TUMOR FORMATION IN SEVERE COMBINED IMMUNODEFICIENT (SCID) PIGS ...... 153 Abstract ...... 153 Introduction ...... 154 Results ...... 157 Discussion ...... 159 Materials and Methods ...... 161 References ...... 164 Figures ...... 168 Tables ...... 170

CHAPTER 7 MUTATIONS IN ARTEMIS CAN LEAD TO LEAKY CD3ε+ CELL DEVELOPMENT IN SWINE WITH SEVERE COMBINED IMMUNODEFICIENCY (SCID) ...... 171 Abstract ...... 171 Introduction ...... 172 Results ...... 173 Discussion ...... 177

Materials and Methods ...... 178 References ...... 180 Figures ...... 182 Tables ...... 186 Supplemental Figures...... 188

CHAPTER 8 SUMMARY AND GENERAL DISCUSSION ...... 193 Dissertation summary ...... 193 General Discussion ...... 194 References ...... 204 Figures ...... 207 Tables ...... 208

APPENDIX STANDARD OPERATING PROCEDURES FOR SCID PIG CHARACTERIZATION WORK ...... 209 Isolation of peripheral blood mononuclear cells (PBMCs) from blood ...... 209 Isolation of cells from lymphoid organs ...... 210 Counting cells with flow cytometry ...... 212 Flow cytometry of isolated cells and whole blood ...... 213 Anticoagulant for cord blood collection ...... 214 Isolation of human CD34+ cells from cord blood, freezing, thawing, and culturing ...... 215 List of antibodies for studying human and pig cell subsets ...... 218

LIST OF FIGURES

Page

Figure 2.1 Genetic and molecular mechanisms of RAG 1/2, Artemis, and IL2RG in lymphoid development ...... 41

Figure 2.2 Lymphoid development and relevant SCID mutations ...... 43

Figure 2.3 Biocontainment facilities for rearing SCID pigs ...... 44

Figure 2.4 Swine have fewer unique immunological genes compared to humans than do mice ...... 45

Figure 2.5 Amino acid sequence comparisons in hematopoietic cytokines for pig and mouse compared to humans ...... 46

Figure 2.6 Cell types and routes of injection for SCID pig immunological humanization ...... 47

Figure 2.7 In utero injection of fetal intraperitoneal space via laparotomy ...... 48

Figure 3.1 Multi-species alignment of SIRPA and CD47 ...... 73

Figure 3.2 Porcine monocytes bind to recombinant hCD47 in vitro ...... 74

Figure 3.3 Porcine monocytes phagocytose human and pig RBCs at low levels .... 75

Figure 3.4 Porcine monocyte phagocytosis of human red blood cells is inhibited SIRPA-CD47 interaction ...... 76

Figure 3.S1 Anti-Sirpa antibodies decrease hCD47-Fc binding ...... 77

Figure 3.S2 B6H12 and 2D3 binding to human RBC ...... 78

Figure 4.1 Exteriorization of uterine horns for ultrasound guided injection of wire and saline ...... 96

Figure 4.2 Liver x-rays for wire detection ...... 97

Figure 4.3 Titanium wire detection in liver and IP space of piglets ...... 98

Figure 5.1 Use of CRISPR/Cas9 system to generate Art-/- IL2RG-/Y SCID pigs ...... 133

Figure 5.2 Art-/- IL2RG-/- SCID pigs lack T, B, and NK cells in peripheral blood and lymphoid organs and T cells can be reconstituted after pig to pig bone marrow transplantation ...... 134

Figure 5.3 Human leukocytes in Art-/- IL2RG-/Y SCID pig cord and peripheral blood after in utero injection of human cells ...... 135

Figure 5.4 Human leukocyte engraftment in bone marrow, liver, spleen, and thymic tissue of Art-/- IL2RG-/Y SCID pigs ...... 137

Figure 5.5 Human CD3+ and Pax5+ cells in lymphoid organs of in utero injected Art-/- IL2RG-/Y SCID pigs ...... 138

Figure 5.S1 B cells are absent in Art-/- IL2RG-/Y pigs ...... 140

Figure 5.S2 Lymphoid organs from wildtype and Art-/- IL2RG-/Y pigs ...... 141

Figure 5.S3 Decreased engraftment and differentiation of B cells in Art-/- IL2RG-/Y SCID pig 5 months post bone marrow transplant ...... 142

Figure 5.S4 Human CD45 and CD34 expression on in utero injected cells ...... 143

Figure 5.S5 Species specific antibodies utilized to detect human cells in IU injected SCID pigs ...... 144

Figure 5.S6 Gross visualization of mesentery and remnant thymic tissue of Art-/- IL2RG-/Y pigs that underwent IU injection of human cells ...... 145

Figure 6.1 OSPC-ARK1 cells develop into carcinomas after subcutaneous and intramuscular injection in SCID pigs ...... 168

Figure 6.2 OSPC-ARK1 carcinomas in SCID pigs resemble the human ovarian serous papillary carcinoma morphologically and demonstrate the same immunophenotype ...... 169

Figure 7.1 SCID pigs have CD3ε+ cells in circulation, but not CD79α+ cells ...... 182

Figure 7.2 CD3ε+ cells are present in SCID lymph nodes at various ages ...... 184

Figure 7.S1 Thymic and lymph node tissue from an Art16/16 SCID pig (p4) stained positively for CD3ε ...... 188

Figure 7.S2 Sequence alignment of TCRδ V5 and J1 products from carrier and SCID pigs ...... 189

vii

Figure 7.S3 Sequence alignment of TCRβ V20 and J1.2 products from carrier and SCID pigs ...... 191

Figure 7.S4 Chromatograms of V-D-J joins in TCRβ (V20 and J1.2) and TCRδ (V5 And J1) show evidence of single TCR clones ...... 192

Figure 8.1 Hematopoiesis in the swine fetal liver and performed IU injections ... 207

viii

LIST OF TABLES

Table 2.1 Previously described SCID pig models ...... 49

Table 2.2 Previously described human stem cell injection studies in swine and sheep ...... 50

Table 2.S1 Ensembl accession numbers used for amino acid comparisons ...... 51

Table 4.1 Drug, medication, and equipment information ...... 99

Table 4.2 Overview of fetal injection locations during laparotomy procedures on gilts 31-7 and 34-8 by ultrasound viewing ...... 101

Table 4.3 Overview of piglet birth status from gilts 31-7 and 34-8 ...... 102

Table 5.1 Flow cytometry antibodies used for assessing pig and human cell subsets ...... 139

Table 5.S1 Primers used for genotyping fetal fibroblast lines and cloned piglets... 146

Table 5.S2 Primers used to test potential off-target mutagenesis ...... 147

Table 5.S3 Artemis genotype and MHC information for pFF cell lines ...... 148

Table 5.S4 The efficiency of CRISPR/Cas9-mediated IL2RG mutations in Art-/- pFFs ...... 149

Table 5.S5 Somatic cell nuclear transfer results in embryos for transfer to fertile recipients ...... 150

Table 5.S6 Humanization attempts in single mutant Art-/- pigs by intravenous and intraosseous injection ...... 151

Table 5.S7 Somatic cell nuclear transfer embryos for transfer into fertile recipients for in utero injection of human cells ...... 152

Table 6.1 SCID and non-SCID pig descriptions and tumor growth locations ...... 170

Table 7.1 Overview of SCID pigs, genotypes, and description of CD3ε and CD79α cells found in blood or lymph node ...... 186

Table 8.1 Modifications to improve human immune cell engraftment in SCID pigs ...... 208

NOMENCLATURE

ANOVA Analysis of variance

Art Artemis

Art 16 Artemis 16 haplotype

Art12 Artemis 12 haplotype

BCR B cell receptor

BLT Bone marrow, liver, and thymus

CAR Chimeric antigen receptor

CDX Cell derived xenograft

CRISPR clustered regularly interspaced short palindromic repeats

CRS Cytokine release syndrome

CT Computerized tomography

DSB Double stranded break

ET Embryo transfer

FL Fetal liver

FSC Forward scatter

GVDH Graft versus host disease hCD47-Fc Recombinant human CD47

HLA Human leukocyte antigen

HSCs Hematopoietic stem cells

IACUC Institutional Animal Care and Use Committee

IL2RG Interleukin 2 receptor gamma

IO Intraossesous

IP Intraperitoneal

IRB Institutional Review Board

IU In utero

IV Intravenous

MHC Major histocompatibility complex

MNC Mononuclear cell

MRI Magnetic resonance imaging

NOD Non-obese diabetic

NSG NOD-SCID-IL2RG

PBLs Peripheral blood leukocytes

PBMC Peripheral blood leukocytes

PC Percutaneous

PDX Patient derived xenograft

PET Positron emission tomography

RAG recombination activating gene

SCID Severe combined immunodeficiency

SCNT Somatic cell nuclear transfer

SIRPA Signal regulatory protein alpha

SLA Swine leukocyte antigen

SSC Side scatter

TCR T cell receptor

TREC T cell receptor excision circles

US Ultrasound

VDJ Variable, diversity, and joining

xii

ACKNOWLEDGMENTS

It is incredible how fast the last few years have gone. I have learned much during my time at Iowa State and have been involved in such a unique project working with SCID pigs. I would not trade that for anything.

I would like to thank my committee chair, Christopher Tuggle, for his guidance through my work here. He was supportive in the many research projects that I conceived and executed. He helped me become an independent and confident thinker and researcher.

I also am extremely grateful for the other members of my committee. To Joan Cunnick and

Crystal Loving, you both emerged me in the field of immunology. You have both taught me how to improve my techniques and expanded by breadth of knowledge of immunology. Our non-science talks were also fun! To Jason Ross and Randy Sacco, thank you for your guidance, help, and support during the duration of my graduate work.

I also want to thank my family- Mom, Dad, Grandma, and Teta- for all your support throughout the last few years. It was not always so fun being over 300 miles away. But that will change shortly! I am sure you have all heard about pigs enough to last a lifetime. Your ongoing support helped me achieve my goals here.

Tim, thank you for your daily support. You have heard the ins and outs of all my projects and problems through my graduate work. I know it may not have been easy to hear about everything all the time, but you did a wonderful job helping me through the stress.

Sara, thank you for being such a great friend! Working on art projects was always a great way to unwind from the daily grind. I won’t ever forget the long nights of birthing and

xiii feeding piglets. I still remember when one of our sows decided to farrow early and we had to miss Game of Thrones!

There were so many other individuals that helped me through my time at ISU that I am thankful for! Amanda Ahrens, thank you for always being there to help with all the animal work. You were great to work with as we developed laparotomy procedures. And I will always appreciate your help with necropsies, since those were not my favorite thing to do! Ellis Powell, thank you for teaching me all things SCID-pig when I entered the lab! You laid the foundation that I was able to work from during my graduate work. Yash Solanki, thank you for your dedication to finishing the TCR PCR project. I have probably made you never want to do PCR again!

Thanks to my cat, Simba, who liked to distract me by laying on my books and papers while I tried to read.

And to the other small things that helped me through graduate school (when I wasn’t doing science): Adventure Time, Hobby Lobby (to which a lot of my paycheck went towards art supplies…), pasta and pizza, Chipotle, Mario and Zelda, astronomy books, and

Game of Thrones.

It’s kind of fun to do the impossible.

-Walt Disney

xiv

ABSTRACT

Swine with severe combined immunodeficiency (SCID) are an emerging large animal model for biomedical research. There have been several SCID pig models described since our first discovery of naturally occurring SCID with mutations in Artemis (DCLRE1C) in 2012.

SCID animals are particularly useful in biomedical research due to their lack of T, B, and sometimes NK cells. Absence of the adaptive immune system allows for human cell and tissue xenotransplantation into these SCID animals. The works described within this dissertation are categorized under four main goals: (1) further characterization of the immune system of Art-/- SCID pigs, (2) development of a method for in utero injection of human stem cells, (3) in utero injection of human stem cells for the study of human immune cell engraftment within Art-/- IL2RG-/Y SCID pigs, and (4) development of an ovarian carcinoma model in SCID pigs.

Characterization of the SCID pig immune system is important so that researchers can understand how components of the system could impact their research model within the pigs. This dissertation describes the characterization of porcine monocytes and their interaction with human cells, as well as “leaky” T cell development in SCID pigs. Firstly, we show that porcine SIRPA, which is expressed on myeloid cells, binds to the “self” protein,

CD47, on human cells. Binding between porcine SIRPA and human CD47 prevents phagocytosis of human cells by porcine myeloid cells. Binding compatibility of these two proteins suggests that porcine monocyte phagocytosis of human cells would not be a barrier to human immune cell engraftment within SCID pigs. In addition, this dissertation provides an initial investigation into “leaky” CD3ε+ T cells that develop in Art-/- SCID pigs. If

xv functional, these T cells could negatively impact the ability of human cells to engraft within the pigs. I describe that there are small populations of leaky T cells within the blood and lymph nodes of Art-/- SCID pigs.

Another major goal described within this dissertation is the development of in-house laparotomy surgical protocols to be utilized for the in utero injection of SCID pig fetuses with human hematopoietic stem cells. We performed two practice laparotomies on non-

SCID litters and attempted to inject fetuses within the fetal liver or intraperitoneal space with saline and wire. We showed that our procedures were safe and successful, as we did not have incidence of abortion and 5 of 6 wire-injected piglets were liveborn. We were able to radiographically detect injected wire within the intraperitoneal space, and in one case, in the liver.

After developing the laparotomy procedures, we were able to utilize the surgery techniques to introduce human hematopoietic stem cells into fetal SCID pigs. Art-/- IL2RG-/Y pigs were generated from an Art-/- fetal fibroblast cell line via CRISPR/Cas9 mutagenesis.

These Art-/- IL2RG-/Y SCID pigs have a T- B- NK- cellular phenotype, which is optimal for humanization studies, based on previous SCID mouse literature. SCID fetuses were injected with human hematopoietic stem cells utilizing developed laparotomy procedures. We detected human leukocytes cells within the blood, thymus, spleen, liver, and bone marrow of the injected Art-/- IL2RG-/Y pigs. More specifically, we detected human CD3ε+ cells within the blood, spleen, and thymus of these animals. These findings warrant further investigation to improve the reconstitution of human cells within SCID pigs.

xvi

Lastly, I describe the beginning stages of a model of ovarian cancer in SCID pigs.

Human ovarian serous papillary carcinoma (OSPC)-ARK1 cells were injected into the ear and neck muscles to answer if this carcinoma could develop in an ectopic site within the SCID pig. We found that 3 out of 4 injected SCID pigs developed carcinomas in at least one injection site. OSPC-ARK1 tumors from SCID pigs, SCID mice, as well as the OSPC-ARK1 cell line and the original human tumor sample were stained with commonly used diagnostic markers: Claudin 3/4, Cytokeratin 7, p16, and EMA to assess if tumors that developed in

SCID pigs resembled the human tumor. We found that expression of these proteins was highly similar between SCID pig and human carcinomas. The next step of this project is to develop an orthotopic model of ovarian cancer by injection of these cells into the ovary of

SCID pigs. Development of such a model could be used for diagnostic imaging research.

In all, this work describes further characterization and development of biomedical models in SCID pigs with a focus on humanization and cancer modeling. The findings described here can be utilized to improve SCID pig models in future research.

CHAPTER I

DISSERTATION STRUCTURE

A total of six manuscripts were composed for publication and are included as

Chapters in this dissertation. As of the submission of this dissertation, four manuscripts are published, while two are near submission stage. I, Adeline Boettcher, was the major contributor and writer of the manuscripts presented in Chapter 2, 3, 4, 6, and 7. Christopher

Tuggle was the supervisor for the projects presented in these Chapters.

Chapter 2 contains all components of a hypothesis and review article about the use of humanized SCID pigs in oncology research, which was published in Frontiers in Oncology.

A section about Artemis has been added to this chapter to fully describe the work completed in this dissertation.

Chapter 3, 4, and 6 contain manuscripts accepted during 2018 and 2019 to

Xenotransplantation, Comparative Medicine, and Frontiers in Oncology, respectively.

Chapter 5 contains work that was performed by me and Yunsheng Li, a Post-Doctoral

Researcher in the lab of Jason Ross. For this work, Yunsheng Li generated Art-/- IL2RG-/Y piglets from the original Art-/- SCID pig line. Once this line was established, I injected human hematopoietic stem cells the pigs via in utero procedures and analyzed tissues and blood from these animals. Christopher Tuggle and Jason Ross supervised the project presented in

Chapter 5. We are combining these two major projects into one manuscript that is being prepared for submission to Nature Communications as of March 2019. Yunsheng Li and I will be co-first authors on this manuscript. The writing in Chapter 5 describes both of these projects.

Chapter 7 contains work that is being prepared for submission to Frontiers in

Immunology as of March 2019.

Chapter 8 describes conclusions from all work presented throughout this dissertation and I present ideas for future uses of SCID pigs and improvements to the model.

CHAPTER 2

LITERATURE REVIEW

This chapter is derived from a hypothesis and theory review that was published in Frontiers in Oncology. It has been modified in some areas to expand the topics discussed that are relevant to this dissertation.

Development of severe combined immunodeficient (SCID) pig models for translational cancer modeling: future insights on how humanized SCID pigs can improve preclinical cancer research

Accepted for publication in Frontiers in Oncology on November 9, 2018. Published on November 30, 2018

Adeline Boettcher1, Crystal Loving2, Joan Cunnick1, and Christopher Tuggle1 ______

Author Contributions

ANB wrote manuscript and designed figures. JEC and CLL edited and revised manuscript. CKT wrote, edited, and revised manuscript.

Abstract

Within the last decade there have been several severe combined immunodeficient

(SCID) pig models discovered or genetically engineered. The animals have mutations in

Artemis (Art), IL2RG, or RAG1/2 genes, or combinations thereof, providing SCID pigs with NK cells, but deficient in T and B cells, or deficient in NK, T, and B cells for research studies. The immunophenotyping of these new animal models is important, as depending on the genetic background, leaky T or B cells may still develop. Biocontainment facilities and positive pressure isolators are developed to limit pathogen exposure and prolong the life of SCID pigs. Raising SCID pigs in such facilities allows for completion of long-term studies such as

4 xenotransplantation of human cells. Ectopically injected human cancer cell lines develop into tumors in SCID pigs, thus providing a human-sized in vivo model for evaluating imaging methods to improve cancer detection and therapeutic research and development.

Immunocompromised pigs have the potential to be immunologically humanized by xenotransplantation with human hematopoietic stem cells, peripheral blood leukocytes, or fetal tissue. These cells can be introduced through various routes including injection into fetal liver or the intraperitoneal (IP) space, or into piglets by intravenous, IP, and intraosseous administration. The development and maintenance of transplanted human immune cells would be initially (at least) dependent on immune signaling from swine cells.

Compared to mice, swine share higher homology in immune related genes with humans. We hypothesize that the SCID pig may be able to support improved engraftment and differentiation of a wide range of human immune cells as compared to equivalent mouse models. Humanization of SCID pigs would thus provide a valuable model system for researchers to study interactions between human tumor and human immune cells.

Additionally, as the SCID pig model is further developed, it may be possible to develop patient-derived xenograft models for individualized therapy and drug testing. We thus theorize that the individualized therapeutic approach would be significantly improved with a humanized SCID pig due to similarities in size, metabolism, and physiology. In all, porcine

SCID models have significant potential as an excellent preclinical animal model for therapeutic testing.

Introduction

A new field of personalized medicine has been evolving over the last decade, especially with respect to advances in individualized cancer therapies, ranging from T cell and NK cell immunotherapies, targeted monoclonal antibody therapy, and newly developed small molecule drugs. As progress is made towards the development of cancer therapies, it will be critical that preclinical animal models can dependably represent human responses to drugs. Presently, mice are the most commonly used model for preclinical animal drug trials

(1). However, many preclinical cancer drug trials that succeed in mice fail in humans due to vast differences in physiology, metabolic processes, and size (2,3). The drug development process is intensive; on average, 12 years of research and $1-2 billion is required to bring a new drug to market (4,5). To maximize the efficiency of preclinical drug and therapy testing, large animal models that better parallel human physiology are needed.

Mice with severe combined immunodeficiency (SCID) are an extremely versatile animal model for the field of cancer biology, although they pose significant limitations. The ability to engraft SCID mice with a human immune and/or cancer cell lines has made them an invaluable model for research (6,7). Although mice are important for initial studies in different cancer fields, they are often not good models for specific aspects of human oncology (2,8). Limitations of mouse models of cancer include small size, difficulties in modeling human tumor heterogeneity (9) and metabolic differences to humans (10,11).

Large animal models can be more costly than murine studies, thus murine studies remain valuable for first line screens. However, testing in larger animal models is warranted to better predict outcomes in human and should be used in follow-up studies as a secondary

6 animal model. (12). Immunocompetent and SCID pigs are now being developed for human disease research purposes (13–18). Swine are more similar to humans with respect to size, anatomy, genetics, and immunology, therefore immunodeficient pigs may be a superior animal model for preclinical testing of cancer therapeutics (19–21). In addition, pigs are comparable in size to humans, have more similar metabolism to humans than mice (22,23), and can be transplanted with larger human tumors.

Within the last decade there have been numerous SCID pig models created (16–

18,24–30) or discovered (31,32). One of the hurdles to working with SCID pigs is maintaining viability due to susceptibility to disease. The use of positive-pressure biocontainment facilities (33) and standard animal isolators (29) have improved SCID pig health and viability.

The ability to house immunodeficient pigs in a controlled environment increases their lifespan, allowing them to be utilized for long-term biomedical research. In addition, cleaner biocontainment facilities appear to decrease the incidence of leaky T cell development in

Art-/- SCID pigs, which could negatively impact the growth of human cells in the pigs. Raising clean pigs in these facilities increases their utility in biomedical research,

In this literature review we describe the different SCID pig models that have been reported in recent years, as well as published methods established to raise SCID pigs for use in long-term research trials of 6 months or more. We describe leaky T cell development in

Art-/- SCID pigs and how these cells can impact the health of the animal, as well as impacts to xenograft studies. We describe the importance of human tumor and cancer cell xenotransplantation and how researchers can utilize immunodeficient pigs for translational studies relevant to human patients. In addition to tumor xenografts, SCID pigs have the

7 potential to be engrafted with a human immune system, or “humanized”, just as numerous

SCID mouse models have been humanized. While there is currently no published research on the development of a humanized SCID pig, substantial progress is being made towards this endeavor. We describe the different methods of humanization that could be used in SCID pigs, including fetal liver and intraperitoneal (IP) injections, as well as intravenous (IV), IP, and intraosseous (IO) injection in piglets. Despite the early developmental stage for humanized SCID pigs, the SCID pig has vast potential to be utilized for translational oncology.

Our overarching hypothesis in this review is that porcine SCID models will be more translational than mouse models for oncology research in the future.

Existing SCID pig models

Previously described and generated SCID pigs

Within the last decade, numerous SCID pig models have been developed through mutagenesis or discovery of natural mutations. These SCID pig models are outlined in Table

2.1. Figure 2.1 shows the genetic and molecular mechanisms for the mutations described below that cause SCID, and Figure 2.2 shows the differentiation step blocked by each of these mutations.

The first SCID pig was described in 2012 (13) after a serendipitous discovery in an infection study (31). To confirm the lack of a functional immune system, these SCID pigs were transplanted with human cancer cell lines. Injected cells were not rejected and developed into tumors in the SCID pigs (13). After further analysis, it was found that the discovered SCID pigs had two naturally occurring mutations in two separate alleles within

8 the Artemis (DCLRE1C) gene, which leads to SCID either in the homozygous or compound heterozygous state (32).

Artemis is required for DNA repair during T and B cell development. Specifically, during the process of VDJ recombination, after RAG1/2 nucleases cleave DNA at the RSS sequences flanking V, J (and sometimes D) segments (34), a hairpin loop then forms at the end of the double stranded break (DSB). Ku70/80 proteins are recruited to the area of the

DSB along with Artemis protein, which is responsible for cleaving the hairpin loop so it can be ligated by Ligase IV (35). Without functional Artemis, these hairpins are not cleaved, and functional V, D, and J joins cannot be made. Lack of Artemis function leads to a cellular profile in which T and B cells are deficient, but NK cells develop (T- B- NK+) and are functional in vitro (31,32,36). Homozygous (Art12/12 or Art16/16) or compound heterozygous

(Art12/16) pigs can be raised to 6 months of age in biocontainment facilities developed at

Iowa State University (31, unpublished observation).

Another SCID pig was also described in 2012 with an engineered mutation within the

IL2RG gene (16). In humans and mice, the IL2 receptor γ (IL2Rγ) subunit is required for IL-2,

IL-4, IL-7, IL-9, IL-15, and IL-21 signaling (37). The IL2RG gene is on the X chromosome in mammals and the receptor is expressed on lymphoid cells, including lymphoid progenitors.

The cytokines noted are required for proper lymphoid development, and thus deletion of the IL2Rγ subunit disrupts development of T and NK cells, and B cells to a variable extent

(38,39). The cellular phenotype of these IL2RG knockout pigs was T- B+ NK-, similar to humans (38,39). B cells in IL2RG knockout SCID pigs were not able to secrete immunoglobulin nor class switch due to absence of helper T cells (16). Interestingly, cloned

9 heterozygous IL2RG+/- females exhibited SCID-like phenotypes, which was attributed to aberrant X-inactivation. These females were raised to sexual maturity and crossed with WT males; female IL2RG+/- offspring from this cross phenotypically resembled WT animals (16).

This finding emphasizes the importance of monitoring for SCID phenotype status in cloned piglets even if the expected outcome is a carrier animal. Other groups have also introduced mutations in the IL2RG gene by CRISPR/Cas9 (17) and zinc finger nuclease (18) methods, and the resulting pigs also displayed cellular phenotypes of T-B+NK-. Animals in these studies were raised in conventional settings and had lifespans that ranged from 12 days to 7 weeks

(16–18).

The recombination activating genes, RAG1 and RAG2, have previously been mutated to create pig models. They code for subunits of a nuclease (RAG1/2), that is involved in VDJ recombination required for T and B cell receptor (TCR and BCR, respectively) generation (40).

Without functional RAG1/2 nuclease, VDJ recombination does not initiate, and T and B cells do not develop (41,42). Homozygous or biallelic RAG1 or RAG2 SCID pigs lacked IgM+ B cells and CD3+ cells in peripheral blood (24,25,27). NK cells were present in these animals and were classified as either CD3- CD8α+ (24) or CD16+ CD8α+ (27). RAG knockout pigs were generated with either TALENs (24,26), gene targeting vectors (27), or CRISPR/Cas9 (28) mutagenesis methods. Previous RAG1 or RAG2 mutant SCID pigs have been raised to 29 days

(24,26) to 12 weeks (27) of age in conventional housing.

Once single mutant pigs were established, research groups began to introduce mutations in both VDJ recombination pathway genes (RAG1/2 or Artemis) and IL2RG to produce pigs that lacked innate and adaptive immune function, generating T- B- NK-/lo SCID

10 pigs (28,30). Double-mutant pigs are an important animal model to develop, as rodent models of SCID mice lacking NK cells, as well as T and B cells, engraft human cells better than

T-B- NK+ models (43). It is therefore of interest to generate a T- B- NK- SCID pig model for humanization studies. In 2016, RAG2/IL2RG knock out piglets were generated and used in pathogenesis study with human norovirus (28). RAG2/IL2RG SCID pigs lacked T and B cells, and there were decreased numbers of NK cells compared to controls. The presence of some

NK cells was attributed to a hypomorphic mutation within IL2RG (28). Our group has recently engineered a complete IL2RG knockout that was introduced into an Artemis null genetic background resulting in SCID pigs that lack T, B, and NK cells (30) .

Methods for SCID pig rearing

One of the difficulties to overcome when using SCID pigs in research is maintaining animal viability. SCID pigs raised in conventional settings typically succumb to disease between 6-12 weeks of age (unpublished observation, 17). Biocontainment facilities have been specifically designed to limit exposure of Iowa State University’s Art-/- SCID pigs to any micro-organisms (Figure 2.3A). These rooms have positive-pressure HEPA filtered air flow into a containment bubble and all water entering the bubble is UV irradiated and filtered through a 0.5 μm filter. Personnel entering the bubble wear appropriate garments to limit introduction or organisms into the room, including room dedicated protective suits, hair net, surgical mask, gloves and rubber boots (33). Piglets are derived either by snatch farrowing

(caught in a sterile towel as they are delivered vaginally) or by cesarean section and are transferred immediately into a sterilized bubble. Piglets are immediately fed pasteurized colostrum for the transfer of maternal immunoglobulin (44), fed sterile milk replacer for 21

11 days, and then transitioned to irradiated feed, which is continued throughout life (33).

Specific pathogen-free (SPF) Art+/- carrier females have been raised to sexual maturity and are able to naturally farrow Art-/- SCID litters within the ISU bubble facilities (Figure 2.3B).

Artemis mutant SCID pigs can be successfully reared to 6 months of age in these facilities

(unpublished observation).

Survivability of previous IL2RG knock out pigs has varied from 2 to 7 weeks (16) and derivation of animals and available housing likely impacts outcome. Recently Hara et al. (29) used small isolators and developed piglet delivery protocols to help extend the lifespan of

IL2RG knock out SCID pigs. To achieve this goal, excised uteruses were brought into isolators units, piglets were delivered, and reared within these isolators. One SCID piglet housed in the isolators was raised to a planned endpoint of 12 weeks of age without incidence of bacterial or fungal disease (29).

Leaky T cell development in SCID and Artemis function

Humans or model animals with mutations in RAG1/2 or Artemis have the potential to develop “leaky” T cells with varying levels of function. These T cells can develop due to hypomorphic mutations within these genes, allowing them to retain residual VDJ recombination activity. There may also be unidentified mechanisms that explain the development of these cells in SCID patients and animals. Leaky T cells can cause problems such as cancer (45,46) and Omenn’s Syndrome (47,48). The Art-/- ISU SCID pig line comprises of two separate mutated Art alleles, termed Art12 and Art16 (32). The Art12 allele contains a nonsense mutation in exon 10 that leads to a premature stop codon. The Art16 allele contains a splice site mutation within intron 8, which causes all transcripts to lack exon 8.

We have previously reported the incidence of host derived T cell lymphoma development in two BMT SCID pigs (both Art16/16) (49). We have additionally documented two other suspected T cell lymphoma cases in non-BMT SCID pigs (in Art12/16 and Art12/12 pigs)

(unpublished results), which led us to hypothesize that our two Art alleles may be hypomorphic.

The Artemis protein contains three domains: β-lactamase, β-CASP, and the C- terminal domain (50). The Artemis protein possesses 5’ to 3’ exonuclease activity and, when complexed with DNA-PK, 5’ to 3’ endonuclease activity to cleave overhangs and open DNA hairpins (35). Mutagenesis experiments show that the catalytic core of Artemis in VDJ recombination is the β-Lact/β-CASP domains, while the C-terminal domain is required for

DNA repair and potentially protein stabilization (50). Both the Art12 and Art16 allele mutations in the ISU SCID pig affect the β-Lact/β-CASP domains. All transcripts from

Art16/16 fibroblasts lack the entire exon 8, while a majority of the transcripts from Art12/12 fibroblasts are missing large portions of the gene transcript within all three domains (32). In humans, hypomorphic mutations in Artemis are reported for alleles in which there are small deletions in exon 14 (c-terminal domain), a missense mutation within the first codon (ATG to

ACG), and G153R mutations (51). Further study of the SCID pig Art transcripts and encoded proteins are required to assess the VDJ recombination activity and their potential for generating functional VDJ TCR rearrangements.

There are currently a few SCID mouse models available to study leaky T cell development. One of these models is a mouse line containing an R229Q mutation within

RAG2. Mice with the RAG2 R229Q mutation share similar symptoms with human patients

13 diagnosed with Omenn’s syndrome (52). T cells in secondary lymphoid organs from these animals showed a similar CD4+ and CD8+ T cells as compared to wildtype mice, however many of these cells had a memory phenotype (52). Another mouse model was created to study hypomorphic Artemis protein activity; this mouse model contains an equivalent mutation as a human patient, termed P70 (named after the original patient), which is a 7 nucleotide deletion at D451 of the human Artemis protein. (45). This mutation leads to increased thymocyte numbers compared to Art null mice. Additionally, mice homozygous for the Art P70 mutation were capable of producing functional VDJ recombination (53) SCID mouse models of hypomorphic activity are useful in studying the negative impacts of these mutations and may help answer questions pertinent to human patients afflicted with these diseases. Additionally, we can use methods developed for leaky T cell analysis within mice in our SCID pigs.

We have detected leaky CD3+ cells in all genotypes of the ISU SCID pig. We have also had one case where a SCID pig also displayed symptoms similar to Omenn’s syndrome. The pig presented with a rash, diarrhea, fever, and enlarged lymph nodes. CD3+ cells in SCID pigs appears to vary based on housing condition, age, and genotype. Researchers working with these animals need to be aware of the other ailments associated with mutations that cause

SCID when working with SCID pigs.

SCID pig cancer xenotransplantation studies

Existing immortal cell lines develop into tumors in SCID pigs

Since the generation of SCID pigs is recent, there are only a few studies that have been published on the ability of SCID pigs to accept human xenografts. The first SCID pig

14 xenograft study involved the transplantation of human melanoma (A375SM) and pancreatic carcinoma cell (PANC-1) into the ear tissue of Art-/- SCID pigs (13). All SCID pigs receiving cancer cells developed tumors at the site of injection, thus establishing an orthotopic model of melanoma that could be studied further (13). Additionally, the ability of ovarian carcinoma cell line OSPC-ARK1 to develop tumors in Art-/- SCID pigs was explored. SCID pigs were injected in the ear and neck muscles with OSPC-ARK1 cells and subsequently monitored for tumor development. In 3 of the 4 SCID pigs injected, tumors developed within

30 days, with a shortest time of 7 days to palpable tumors. Biopsy samples revealed the ovarian tumors in SCID pigs expressed diagnostic markers commonly used in human cancer diagnoses, and tumors in SCID pigs resembled human tumors (54).

Pigs biallelic for RAG2 mutations can engraft human induced pluripotent stem cells

(iPSCs). Injected iPSCs developed teratomas that represented endoderm, mesoderm and ectoderm tissues (26). Teratomas were grossly visible 12 days after cell inoculation for one recipient; and about 7.5 weeks in the other recipient. Histological analysis revealed CD34+ and CD45+ cells developed in the teratoma, (26), indicating that human immune lineage can survive and differentiate in RAG2 knockout pigs. This important finding indicates that SCID pigs can accept various types of human xenografts. In a follow-up study, PERFORIN and RAG2 double knock out (Pfp/RAG2 dKO) mice and RAG2 knock out pigs were compared for their ability to engraft human iPSCs. The RAG2-/- pigs developed teratomas from injected iPSCs at a higher rate than the Pfp/RAG2 dKO mice. Human teratomas that developed in the RAG2 knockout SCID pigs also had a higher prevalence of CD45+ and CD34+ cells in the teratoma

15 than in SCID mice (55). Thus, the in vivo environment in pigs supports the growth and differentiation of human cells, and in some instances, is an improved system over SCID mice.

Porcine immunological similarities to human

Several aspects of the pig immune system are more similar to humans than mice, providing another advantage of swine models for research (39). Humans and pigs have higher sequence orthology for immune-related genes (termed the ‘immunome’) than humans and mice (20). Immunome-specific gene family expansions, a measure of evolutionary divergence, have occurred in pig relative to human at half the rate detected in mouse or cow (20), and pigs have significantly fewer unique genes not found in humans when compared to unique gene abundance in cow or mouse (Figure 2.4). Additional analyses have further expanded human and pig similarities, although absence of two inflammasome gene families have also been found uniquely in the pig genome (57). As well as immunome structural similarities, immune responses are highly comparable between human and pig (reviewed in 41). For example, the transcriptomic response to lipopolysaccharide (LPS) of pig macrophages in vitro is more similar to human responses as compared to mice. Specifically, clusters of genes with IDO1 as hub were detected in human and pig macrophage responses, but not in mice, while a NOS2A-related gene cluster was only found in the mouse macrophage LPS response (59).

Human hematopoietic stem cell (HSC) development in swine for humanizing pigs will be dependent on swine cytokine signaling. Hence, it is important to determine the cross reactivity of porcine cytokines with human cells. Protein sequence analysis shows that swine share more homology in cytokines involved in hematopoiesis with humans than mice (Figure

2.5; Figure 2.S1), which suggests that certain human lineages may differentiate with greater success in SCID pigs than in SCID mouse models.

Routes for humanization and applications

Given the high similarity of swine and human immune genes, we would anticipate that human HSCs transferred into SCID pigs would successfully engraft and differentiate into representative human immune cell types. Current building of swine SCID models relies heavily on translating methods used for mouse humanization to generate new humanized

SCID pig models. To humanize the mouse, three different approaches are utilized (6,7).

These methods include transfer of purified human CD34+ stem cells, peripheral blood leukocytes (PBLs), or transfer of fetal bone marrow, liver, spleen, and lymph node tissues.

Just as in SCID mouse models, these same approaches and cell types can be investigated as methods to humanize SCID pigs. The pig immune signaling molecules that support engraftment are expected to be similar to humans, thus we expect successful development of human immune cells.

Currently the NOD-SCID-IL2Rγ (NSG) knockout mouse is the gold standard model for humanization. The Sirpa allele in the NOD background contains polymorphisms that allow the encoded Sirpa protein to bind to human CD47, which then sends a inhibitory signal that prevents phagocytosis of human cells (60,61). Swine SIRPA also binds to human CD47 (62), so we speculate that porcine SIRPA-dependent phagocytosis of human cells would not be a barrier to SCID pig humanization.

The following sections describe previous humanization methods performed in SCID mice and other large animal models, and how these methods can be utilized to humanize

SCID pigs. Figure 2.6 shows an overview of different human immune cell types and anatomical injection sites for SCID pig humanization. Past studies utilizing injection of human

HSCs or human induced pluripotent stem cells into large animal models are presented in

Table 2.2.

CD34+ cell injection via fetal liver and intraperitoneal space

Successful humanization of SCID pigs will require that human HSC be injected into sites of hematopoiesis in the pig. During gestation the initial location of hematopoiesis is the yolk sac (63). As gestation continues, the fetal liver becomes the site of hematopoiesis, typically around the beginning of the second trimester (64–68). During swine gestation, hematopoiesis begins at day 30 in the fetal liver (67). Intrauterine injection of human hematopoietic cells during the fetal liver phase of hematopoiesis would provide a rich environment for human stem cells to engraft and differentiate (69), as supporting cells in the fetal liver niche express c-Kit, CD34, CXCL12, and NOTCH (64). Additionally cell subsets in the fetal liver can promote hematopoiesis, such as CD34lo CD133lo cells that have been described in human (70). Differentiated human cells that develop in the SCID pig liver may also migrate to the bone marrow around the same time as other developing swine immune cells, which may increase the ability of human immune progenitors to engraft within the SCID pig bone marrow. Fewer human cells would be required for the fetal liver injection strategy when compared to the number of cells required to engraft a fully developed piglet. Taken together, we hypothesize that fetal injection of human hematopoietic stem cells will likely lead to the highest levels of engraftment compared to other methods described in later sections.

The first study involving in utero injection of human cells into a large animal was performed by Zanjani and colleagues (71). Human fetal liver cells were injected into the IP space of fetal sheep at days 48-54 gestation (145-day term) through the uterine wall. The recipient sheep were immunocompetent, but pre-immune at this stage of development.

Two of the derived sheep were raised to 15 months of age, and human CD3+, CD16+, and

CD20+ cells were still in circulation, albeit at very low frequencies (71). Other studies involving the transplantation of human CD34+ cells in the fetal liver of pre-immune sheep have resulted in similarly low levels of human cell engraftment and differentiation (72,73).

In addition to sheep, in utero injection of human CD34+ cells have been performed in pre-immunocompetent conventional pigs. The first was described in 2003 (74) with the injection of cord blood derived CD34+ cells into the IP space of pre-immune fetal piglets at approximately 40 days of gestation (114 day term). Populations of human CD3+ cells were detected in the thymus, CD19+ cells and myeloid cells also developed de novo in the pig, in as short as 40 days post-injection. Additionally, human CD34+ CD45+ cells were isolated from pig bone marrow 120 days after transplantation and were subsequently transplanted into

SCID mice with successful engraftment of human cells observed. This result indicates that the pig bone marrow environment is able to support the development of functional human

HSCs (74).

Humanization of pigs could serve as a source of human T cells for immunotherapeutic use. Ogle et al. (75) depleted CD3+ cells from human bone marrow or cord blood and injected into the IP space of fetal piglets at 40-43 days of gestation. Human T, B, macrophages, and NK cells were detected in peripheral blood of piglets using RT-PCR by

19 amplification of CD3, CD19, CD14, CD16, and CD56 transcripts, respectively. In order to determine if the human T cells had developed de novo, blood was analyzed for the presence of human T cell receptor excision circles (TREC). Human TRECs were observed at a level that suggested new human T cells had developed in the swine thymus (75). Similar studies were performed in which fetal swine were injected with human T cell depleted bone marrow (76) or T cell depleted cord blood (77), in which human cell engraftment was observed. In all, these studies show that human T cells can develop de novo when human HSC are injected into fetal swine.

Successful engraftment of SCID pigs utilizing in utero injections requires consideration of timing and surgical procedures. We hypothesize that a humanized SCID pig could be developed via in utero injection of human CD34+ cells within the fetal liver or IP space at approximately 40 days of gestation. We have described detailed laparotomy protocols that can be followed for procedures involving stem cell injection into fetal IP space and livers (Boettcher et al., submitted 2018) (Figure 2.7). The level of human cell hematopoiesis in a SCID pig model has yet to be determined, however it is expected that engraftment would be comparable to that described for immunocompetent animals. Given the lack of pig immune cell development in pigs with SCID, the available niches for human progenitor cells to develop in the bone marrow and thymus would be increased.

Peripheral blood leukocyte injection via intravenous or intraperitoneal routes

In 1988, the first humanized mouse models were generated in efforts to investigate the AIDS virus interaction with its human host. One of these models described the injection of human PBLs into the IP space of SCID mice (78). Mice were injected by the IP or IV routes

20 with 10-90 million human PBLs (termed hu-PBL SCID mice). IV injection was deemed ineffective in mice, likely due to the difficulty of proper IV administration in a mouse. Human cells injected IP in mice were able to migrate to the spleen, lymph nodes, and were also detected in peripheral blood; four weeks post IP injection, very few human PBL were detected in the peritoneal space. Mice were vaccinated with tetanus toxoid, which PBL donors were known to be immune. Eight of ten animals injected with PBLs produced human immunoglobulin against tetanus toxoid which supported that human helper T cells and B cells were functional in the hu-PBL SCID mice. Human CD14+ monocytes were also present in the spleens of mice 8 weeks post transplantation (78). These hu-PBL SCID mice are utilized in a variety of different fields including HIV (79–81), cancer (82,83), basic immunology (84,85), and atopic dermatitis (86).

Hu-PBL-SCID pigs could be generated by IV or IP injection of human PBLs into SCID pigs. IV injection of human cells have been deemed ineffective for engraftment in mice.

However, tail veins are typically used in mice, which are difficult to properly inject. Piglets have large and visible ear, cephalic, and saphenous veins that are easily accessible. A limitation of human PBL injections in pigs could be the amount of cells required relative to the number of cells injected into mice. Mice are typically 20 grams (0.02 kg), while a typical newborn piglet weighs about 1-2 kg. In previous studies, the minimum amount of human

PBLs injected into mice is about 10 million cells, which scales up to 0.5-1 billion in a piglet.

However, there are strategies to overcome the cell number limitation. One source for human PBLs could be leukoreduction system chambers (LRSCs), which are utilized by blood banks to remove PBLs during plateletpheresis. During a normal collection of platelets from a

21 donor, approximately 2 billion PBLs can be obtained from LRSCs (87). Another approach is matching a human with a SCID pig and performing repeat PBL injections from the same human donor. Also, it is possible that the number of human PBLs required for successful engraftment of SCID pigs would not be as high as calculated from murine studies. Given that methods to obtain large numbers of PBLs are available, the number limitation is not expected to prevent development of a hu-PBL-SCID pig.

One consideration for using a SCID pig injected with human PBLs is that these animals will eventually develop graft versus host disease (GVHD). SCID mice injected with human

PBLs develop GVHD approximately 3-11 weeks after injection (88) while it takes 14-16 weeks in SCID rats (89). It is currently unknown how long it would take SCID pigs to develop GVHD after human PBL cell transplantation, as well as how the cellular dose would impact the

GVHD time frame. This is a question that will need to be addressed as this model is developed. Another important question that will need to be addressed in developing this model is the time period required for human PBL engraftment within the SCID pig.

One benefit of the PBL model is that it could be used for short term studies in SCID pigs. SCID pigs raised in conventional settings can typically survive to 6 weeks of age. If piglets are injected with human PBLs shortly after birth (1-5 days), this would give researchers approximately a 6-week window to perform experiments. It may also be appropriate to administer immunosuppressive drugs during this period of time to reduce the effects of GVHD.

CD34+ cell injection via intraosseous or intravenous routes

Another route for humanization is through the injection of purified human CD34+

HSCs into live-born piglets. We have previously performed bone marrow transplantations

(BMT) on our SCID pigs through IV injection of unfractionated pig bone marrow cells (49).

One hypothesis is that human HSC could be administered in the same way to generate a humanized SCID pig. Typically in pig to pig bone marrow transplants, it takes approximately

10 weeks to observe a moderate increase in the number of circulating porcine lymphocytes

(49). We hypothesize that human engraftment and de novo development of human cells would require at least 10 weeks to observe human cells in circulation based on pig to pig

BMT observations. It may be of value to compare cell dosages and engraftment rates of human and pig HSC in SCID pigs. IV injection of human HSC is much less invasive than fetal injections, however it may take longer to achieve engraftment and differentiation of human cells.

Another method of human HSC administration is through intraosseous (IO) injection.

IO injection of stem cells and mesenchymal stem cells have previously been performed in

SCID mice (90), dogs (91,92), and pigs (93). IO injection is also a method for bone marrow transplantation in humans (94). It is hypothesized that IO injections are preferable over IV injections due to stem cell trapping in pulmonary tissue, which is often observed in IV injections (95,96). In addition, IO administration introduces cells to the site within which they would differentiate. Protocols have also been developed for the delivery of various substances though IO injection in swine (93,97,98). IO injection of human CD34+ cells into

SCID pigs is therefore another potential route for studying engraftment and humanization models.

Implantation of human fetal bone marrow, thymus, and liver tissues

Another potential method for humanization of SCID pigs is through the transplantation of human fetal liver, thymus, lymph node, and spleen tissue, as has been previously performed in mice (99). Such human lymphoid tissues can be transplanted into mice either by implantation under the kidney capsule or IV injection of a cellular suspension.

Mice transplanted with human lymphoid tissues appear to have immunological protection, as the lifespan of transplanted mice can be extended to 17 months, compared to 4 months for non-transplanted mice. Mice injected with both human thymic and fetal liver cells developed human T and IgG secreting B cells (99). The chimeric mice with human bone marrow, liver and thymus (BLT) are used to study interactions between human immune cells and patient derived melanomas (100).

De novo development of human T cells within the pig requires that human T cells can differentiate within the swine thymus. Transplantation studies show that the porcine thymus supports human T cell development, as mature human T cells develop in athymic mice transplanted with porcine thymus and human HSCs (101,102). Human T cell development within the swine thymus is particularly important for long term studies because this would allow newly differentiated human T cells to develop tolerance to pig antigens. Human thymic tissue could also be transplanted into SCID pigs for human HLA restricted T cell development. Development of GVHD is observed in mice humanized with fetal bone marrow, liver, and thymic tissue (103), potentially due to human thymus dependent T cell

24 development. Depending on the experimental question being addressed, transplantation of a human thymus may be a preferred method in humanizing SCID pigs.

One issue with generating BLT humanization models is the limited fetal tissue availability, as well as ethical implications. Smith and colleagues described a way to circumvent these issues by propagating and expanding BLT tissues in one mouse and then transplanting into 4-5 other mice (104). SCID pigs could be useful in this regard as human tissues would have the potential to grow to a large enough size that they could be transplanted again into a second set of animals.

Future outlooks on the utilization of SCID pigs for cancer therapies and research

Humanized SCID pigs for CAR-T and CAR-NK cell therapy research

Chimeric antigen receptor (CAR) T and NK cells have been developed in recent years as a cancer immunotherapy. CAR-T cells targeted against CD19 for patients with B cell lymphomas and leukemias (105) have been approved by the FDA for therapeutic use

(106,107). One of the issues associated with CAR-T cells is that they can persist and be activated for long periods of time in the body, causing cytokine release syndrome (CRS).

Symptoms of CRS manifest as fatigue, fever, nausea, cardiac failure, among other symptoms

(108). CAR-NK therapies are being developed to overcome some of the issues associated with CAR-T cell therapy. Protocols have been developed to isolate NK cells from cord blood and expanded for use in patients. NK cells do not persist for long periods of time in vivo after infusion (109), do not cause GVHD, and can recognize tumor targets through intrinsic receptors (110). If SCID pigs can successfully develop human NK cells de novo, humanized

SCID pig blood could be a source of NK cells. Six month old Art-/- Yorkshire SCID pigs are

25 approximately 85 kg (personal observation), and thus according to IACUC guidelines, up to

1.2 L of blood could be collected for human NK cell isolation and used for CAR therapy research.

We envision several applications for a hu-PBL SCID pig in testing cell-based immunotherapies. As more CAR therapy targets are generated, it may be possible to test their efficacy and safety in a humanized SCID pigs that are xenografted with human tumors.

Other CAR therapies that are currently under development are CAR-T cells targeting CD20

(111), CD30 (112), CD33 (113), CD7 (114) and CAR-NK cells targeting CD33 (115) and CD19

(116). In addition, as the field of precision medicine continues to grow, a patient’s tumor could be xenografted into a SCID pig and a therapy could be tested. Tumors in SCID pigs could be grown to a comparable size to those found in humans and would therefore be a more representative model compared to the limited size of tumors in mouse models. Similar studies have been performed in hu-PBL-mice, in which interactions between human thyroid tumors and PBLs were studied (117).

Improving targeting imaging techniques

Pigs are an excellent animal model for surgical and clinical imaging research. Due to their larger size, techniques that are used for humans in the clinics (PET, MRI, CT, US) can also be readily adapted for use in swine. There are immunocompetent pig models of cancer that exist with inducible mutations in p53 (15,118,119) and KRAS (120). Pigs with inducible tumors have previously been imaged with CT and MRI, which is proof of concept that these imaging techniques can be performed on pigs (119).

There are also practices that involve targeted imaging of tumors using small peptides and molecules. SCID mice have previously been used for such studies for ovarian (121), nasopharyngeal, breast cancer (122), hepatic (123), lung cancer (124), and others. SCID mice are useful animal models for proof of concept studies that certain molecules and peptides can specifically bind to certain tumor types. After preliminary testing has been completed in mice, SCID pig models engrafted with human cells could then be used for testing these targeting techniques with respective imaging equipment that would be used in the clinics. As an example, human ovarian carcinomas expressing high levels of Claudin 3/4 expression will grow in SCID pigs (45; Boettcher et al., Comparative Med, In press). A Clostridium perfringens enterotoxin (CPE) peptide can specifically bind to Claudin 3/4 (121,125), and such a SCID pig ovarian cancer model can be used as an imaging and therapeutic target of the CPE peptide in targeting ovarian carcinomas in such a way that it is translatable to human patients.

Development of Patient Derived Xenograft models in SCID pigs for personalized drug testing

Since SCID pigs have previously been shown to accept xenografts of human cancer cells (13), as well as pluripotent stem cells (26,55), it would be expected that they would also accept solid tumor tissues as well. Patient derived xenograft (PDX) and cell derived xenograft models have previously been utilized in SCID mouse models for patient specific drug testing (126). SCID pig models can also be developed for these purposes. Due to higher similarity in metabolism between humans and pig (22) compared to mice, drug responses in the pig would likely lead to more directly comparable responses to those that would be found in humans (23). Additionally, the size of the pig would also allow representative drug doses to be tested that could be applied to future doses for human patients.

Concluding Remarks

Here we have described many of the novel uses of SCID pigs in oncology research involving the use of xenotransplantation of human tumor tissues, HSCs, and lymphoid tissues. The full potential of these animals will be realized when biocontainment facilities are more readily available and survivability of SCID pigs improved. Additionally, dissemination of handling protocols will be essential to prolonging the lives of these animals for long-term studies.

Research groups generating SCID pigs are at the forefront of creating a new animal model that can be used for translational preclinical research. We have learned an incredible amount of information by use of small animal mouse models for cancer research. However, in order for therapies to be developed and tested thoroughly, they now need to be evaluated in a larger animal model that better represents human disease states and which can provide realistic opportunities for improved modeling of imaging and surgical approaches. As such, we believe that SCID pig models will provide a foundation for researchers to gain valuable and translational results to improve patient outcomes in a clinical setting.

References

1. Vandamme TF. Use of rodents as models of human diseases. J Pharm Bioallied Sci (2014) 6:2–9. doi:10.4103/0975-7406.124301

2. Mak IWY, Evaniew N, Ghert M. Lost in translation: animal models and clinical trials in cancer treatment. Am J Transl Res (2014) 6:114–118. Available at: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3902221/

3. Uhl EW, Warner NJ. Mouse Models as Predictors of Human Responses: Evolutionary Medicine. Curr Pathobiol Rep (2015) 3:219–223. doi:10.1007/s40139-015-0086-y

4. Van Norman GA. Drugs, Devices, and the FDA: Part 1: An Overview of Approval Processes for Drugs. JACC Basic to Transl Sci (2016) 1:170–179. doi:https://doi.org/10.1016/j.jacbts.2016.03.002

5. DiMasi JA, Grabowski HG, Hansen RW. Innovation in the pharmaceutical industry: New estimates of R&D costs. J Health Econ (2016) 47:20–33. doi:10.1016/j.jhealeco.2016.01.012

6. Walsh N, Kenney L, Jangalwe S, Aryee K-E, Greiner DL, Brehm MA, Shultz LD. Humanized mouse models of clinical disease. Annu Rev Pathol (2017) 12:187–215. doi:10.1146/annurev-pathol-052016-100332

7. Brehm MA, Shultz LD, Greiner DL. Humanized Mouse Models to Study Human Diseases. Curr Opin Endocrinol Diabetes Obes (2010) 17:120–125. doi:10.1097/MED.0b013e328337282f

8. Johnson JI, Decker S, Zaharevitz D, Rubinstein L V, Venditti JM, Schepartz S, Kalyandrug S, Christian M, Arbuck S, Hollingshead M, et al. Relationships between drug activity in NCI preclinical in vitro and in vivo models and early clinical trials. Br J Cancer (2001) 84:1424–1431. doi:10.1054/bjoc.2001.1796

9. Hutchinson L, Kirk R. High drug attrition rates--where are we going wrong? Nat Rev Clin Oncol (2011) 8:189–190. doi:10.1038/nrclinonc.2011.34

10. Anderson S, Luffer-Atlas D, Knadler MP. Predicting circulating human metabolites: how good are we? Chem Res Toxicol (2009) 22:243–256. doi:10.1021/tx8004086

11. Martignoni M, Groothuis GMM, de Kanter R. Species differences between mouse, rat, dog, monkey and human CYP-mediated drug metabolism, inhibition and induction. Expert Opin Drug Metab Toxicol (2006) 2:875–894. doi:10.1517/17425255.2.6.875

12. Roth JA, Tuggle CK. Livestock models in translational medicine. ILAR J (2015) 56:1–6. doi:10.1093/ilar/ilv011

13. Basel MT, Balivada S, Beck AP, Kerrigan MA, Pyle MM, Dekkers JCM, Wyatt CR, Rowland RRR, Anderson DE, Bossmann SH, et al. Human Xenografts Are Not Rejected in a Naturally Occurring Immunodeficient Porcine Line: A Human Tumor Model in Pigs. Biores Open Access (2012) 1:63–68. doi:10.1089/biores.2012.9902

14. Powell EJ, Cunnick JE, Tuggle CK. SCID pigs: An emerging large animal NK model. J rare Dis Res Treat (2017) 2:1–6.

15. Schook LB, Collares T V, Hu W, Liang Y, Rodrigues FM, Rund LA, Schachtschneider KM, Seixas FK, Singh K, Wells KD, et al. A Genetic Porcine Model of Cancer. PLoS One (2015) 10:e0128864. doi:10.1371/journal.pone.0128864

16. Suzuki S, Iwamoto M, Saito Y, Fuchimoto D, Sembon S, Suzuki M, Mikawa S, Hashimoto M, Aoki Y, Najima Y, et al. Il2rg gene-targeted severe combined immunodeficiency pigs. Cell Stem Cell (2012) 10:753–758. doi:10.1016/j.stem.2012.04.021

17. Kang J-T, Cho B, Ryu J, Ray C, Lee E-J, Yun Y-J, Ahn S, Lee J, Ji D-Y, Jue N, et al. Biallelic modification of IL2RG leads to severe combined immunodeficiency in pigs. Reprod Biol Endocrinol (2016) 14:74. doi:10.1186/s12958-016-0206-5

18. Watanabe M, Nakano K, Matsunari H, Matsuda T, Maehara M, Kanai T, Kobayashi M, Matsumura Y, Sakai R, Kuramoto M, et al. Generation of interleukin-2 receptor gamma gene knockout pigs from somatic cells genetically modified by zinc finger nuclease-encoding mRNA. PLoS One (2013) 8:e76478. doi:10.1371/journal.pone.0076478

19. Swindle MM, Makin A, Herron AJ, Clubb FJJ, Frazier KS. Swine as models in biomedical research and toxicology testing. Vet Pathol (2012) 49:344–356. doi:10.1177/0300985811402846

20. Dawson HD, Loveland JE, Pascal G, Gilbert JGR, Uenishi H, Mann KM, Sang Y, Zhang J, Carvalho-Silva D, Hunt T, et al. Structural and functional annotation of the porcine immunome. BMC Genomics (2013) 14:332. doi:10.1186/1471-2164-14-332

21. Schachtschneider KM, Madsen O, Park C, Rund LA, Groenen MAM, Schook LB. Adult porcine genome-wide DNA methylation patterns support pigs as a biomedical model. BMC Genomics (2015) 16:743. doi:10.1186/s12864-015-1938-x

22. Skaanild MT. Porcine cytochrome P450 and metabolism. Curr Pharm Des (2006) 12:1421–1427.

23. Dalgaard L. Comparison of minipig, dog, monkey and human drug metabolism and disposition. J Pharmacol Toxicol Methods (2015) 74:80–92. doi:10.1016/j.vascn.2014.12.005

24. Huang J, Guo X, Fan N, Song J, Zhao B, Ouyang Z, Liu Z, Zhao Y, Yan Q, Yi X, et al. RAG1/2 knockout pigs with severe combined immunodeficiency. J Immunol (2014) 193:1496–1503. doi:10.4049/jimmunol.1400915

25. Ito T, Sendai Y, Yamazaki S, Seki-Soma M, Hirose K, Watanabe M, Fukawa K, Nakauchi H. Generation of recombination activating gene-1-deficient neonatal piglets: a model of T and B cell deficient severe combined immune deficiency. PLoS One (2014) 9:e113833. doi:10.1371/journal.pone.0113833

26. Lee K, Kwon D-N, Ezashi T, Choi Y-J, Park C, Ericsson AC, Brown AN, Samuel MS, Park K- W, Walters EM, et al. Engraftment of human iPS cells and allogeneic porcine cells into pigs with inactivated RAG2 and accompanying severe combined immunodeficiency. Proc Natl Acad Sci (2014) 111:7260 LP-7265. Available at: http://www.pnas.org/content/111/20/7260.abstract

27. Suzuki S, Iwamoto M, Hashimoto M, Suzuki M, Nakai M, Fuchimoto D, Sembon S, Eguchi-Ogawa T, Uenishi H, Onishi A. Generation and characterization of RAG2 knockout pigs as animal model for severe combined immunodeficiency. Vet Immunol Immunopathol (2016) 178:37–49. doi:10.1016/j.vetimm.2016.06.011

28. Lei S, Ryu J, Wen K, Twitchell E, Bui T, Ramesh A, Weiss M, Li G, Samuel H, Clark- Deener S, et al. Increased and prolonged human norovirus infection in RAG2/IL2RG deficient gnotobiotic pigs with severe combined immunodeficiency. Sci Rep (2016) 6:25222. doi:10.1038/srep25222

29. Hara H, Shibata H, Nakano K, Abe T, Uosaki H, Ohnuki T, Hishikawa S, Kunita S, Watanabe M, Nureki O, et al. Production and rearing of germ-free X-SCID pigs. Exp Anim (2018) 67:139–146. doi:10.1538/expanim.17-0095

30. Li Y, Adur M, Boettcher A, Shultz B, Kiefer Z, Charley S, Wang W, Loving C, Cino-Ozuna AG, Tuggle C, et al. Generation of IL2RG -/Y ART -/- double mutant piglets using CRISPR/Cas9. Large Anim Genet Eng Summit

31. Ozuna AGC, Rowland RRR, Nietfeld JC, Kerrigan MA, Dekkers JCM, Wyatt CR. Preliminary findings of a previously unrecognized porcine primary immunodeficiency disorder. Vet Pathol (2013) 50:144–146. doi:10.1177/0300985812457790

32. Waide EH, Dekkers JCM, Ross JW, Rowland RRR, Wyatt CR, Ewen CL, Evans AB, Thekkoot DM, Boddicker NJ, Serão NVL, et al. Not All SCID Pigs Are Created Equally: Two Independent Mutations in the Artemis Gene Cause SCID in Pigs. J Immunol (2015) 195:3171 LP-3179. Available at: http://www.jimmunol.org/content/195/7/3171.abstract

33. Powell EJ, Charley S, Boettcher AN, Varley L, Brown J, Schroyen M, Adur MK, Dekkers S, Isaacson D, Sauer M, et al. Creating effective biocontainment facilities and maintenance protocols for raising specific pathogen-free, severe combined immunodeficient (SCID) pigs. Lab Anim (2018)23677217750691. doi:10.1177/0023677217750691

34. Bassing CH, Swat W, Alt FW. The Mechanism and Regulation of Chromosomal V(D)J Recombination. Cell (2002) 109:S45–S55. doi:https://doi.org/10.1016/S0092- 8674(02)00675-X

35. Ma Y, Pannicke U, Schwarz K, Lieber MR. Hairpin opening and overhang processing by an Artemis/DNA-dependent protein kinase complex in nonhomologous end joining and V(D)J recombination. Cell (2002) 108:781–794.

36. Powell EJ, Cunnick JE, Knetter SM, Loving CL, Waide EH, Dekkers JCM, Tuggle CK. NK cells are intrinsically functional in pigs with Severe Combined Immunodeficiency (SCID) caused by spontaneous mutations in the Artemis gene. Vet Immunol Immunopathol (2016) 175:1–6. doi:10.1016/j.vetimm.2016.04.008

37. Sugamura K, Asao H, Kondo M, Tanaka N, Ishii N, Ohbo K, Nakamura M, Takeshita T. The interleukin-2 receptor gamma chain: its role in the multiple cytokine receptor complexes and T cell development in XSCID. Annu Rev Immunol (1996) 14:179–205. doi:10.1146/annurev.immunol.14.1.179

38. Buckley RH, Schiff RI, Schiff SE, Markert ML, Williams LW, Harville TO, Roberts JL, Puck JM. Human severe combined immunodeficiency: genetic, phenotypic, and functional diversity in one hundred eight infants. J Pediatr (1997) 130:378–387.

39. Conley ME. B cells in patients with X-linked agammaglobulinemia. J Immunol (1985) 134:3070 LP-3074. Available at: http://www.jimmunol.org/content/134/5/3070.abstract

40. Oettinger MA, Schatz DG, Gorka C, Baltimore D. RAG-1 and RAG-2, adjacent genes that synergistically activate V(D)J recombination. Science (1990) 248:1517–1523.

41. Schwarz K, Gauss GH, Ludwig L, Pannicke U, Li Z, Lindner D, Friedrich W, Seger RA, Hansen-Hagge TE, Desiderio S, et al. RAG mutations in human B cell-negative SCID. Science (1996) 274:97–99.

42. Mombaerts P, Iacomini J, Johnson RS, Herrup K, Tonegawa S, Papaioannou VE. RAG-1- deficient mice have no mature B and T lymphocytes. Cell (1992) 68:869–877.

43. Christianson SW, Greiner DL, Schweitzer IB, Gott B, Beamer GL, Schweitzer PA, Hesselton RM, Shultz LD. Role of natural killer cells on engraftment of human lymphoid cells and on metastasis of human T-lymphoblastoid leukemia cells in C57BL/6J-scid mice and in C57BL/6J-scid bg mice. Cell Immunol (1996) 171:186–199. doi:10.1006/cimm.1996.0193

44. Markowska-Daniel I, Pomorska-Mol M, Pejsak Z. Dynamic changes of immunoglobulin concentrations in pig colostrum and serum around parturition. Pol J Vet Sci (2010) 13:21–27.

45. Moshous D, Pannetier C, Chasseval Rd R de, Deist Fl F le, Cavazzana-Calvo M, Romana S, Macintyre E, Canioni D, Brousse N, Fischer A, et al. Partial T and B lymphocyte immunodeficiency and predisposition to lymphoma in patients with hypomorphic mutations in Artemis. J Clin Invest (2003) 111:381–387. doi:10.1172/JCI16774

46. Jacobs C, Huang Y, Masud T, Lu W, Westfield G, Giblin W, Sekiguchi JM. A hypomorphic Artemis human disease allele causes aberrant chromosomal rearrangements and tumorigenesis. Hum Mol Genet (2011) 20:806–819. doi:10.1093/hmg/ddq524

47. Ege M, Ma Y, Manfras B, Kalwak K, Lu H, Lieber MR, Schwarz K, Pannicke U. Omenn syndrome due to ARTEMIS mutations. Blood (2005) 105:4179 LP-4186. Available at: http://www.bloodjournal.org/content/105/11/4179.abstract

48. Elnour IB, Ahmed S, Halim K, Nirmala V. Omenn’s Syndrome: A rare primary immunodeficiency disorder. Sultan Qaboos Univ Med J (2007) 7:133–138. Available at: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3074865/

49. Powell EJ, Graham J, Ellinwood NM, Hostetter J, Yaeger M, Ho C-S, Gault L, Norlin V, Snella EN, Jens J, et al. T Cell Lymphoma and Leukemia in Severe Combined Immunodeficiency Pigs following Bone Marrow Transplantation: A Case Report. Front Immunol (2017) 8:813. doi:10.3389/fimmu.2017.00813

50. Poinsignon C, Moshous D, Callebaut I, de Chasseval R, Villey I, de Villartay J-P. The metallo-beta-lactamase/beta-CASP domain of Artemis constitutes the catalytic core for V(D)J recombination. J Exp Med (2004) 199:315–321. doi:10.1084/jem.20031142

51. Pannicke U, Honig M, Schulze I, Rohr J, Heinz GA, Braun S, Janz I, Rump E-M, Seidel MG, Matthes-Martin S, et al. The most frequent DCLRE1C (ARTEMIS) mutations are based on homologous recombination events. Hum Mutat (2010) 31:197–207. doi:10.1002/humu.21168

52. Marrella V, Poliani PL, Casati A, Rucci F, Frascoli L, Gougeon M-L, Lemercier B, Bosticardo M, Ravanini M, Battaglia M, et al. A hypomorphic R229Q Rag2 mouse mutant recapitulates human Omenn syndrome. J Clin Invest (2007) 117:1260–1269. doi:10.1172/JCI30928

53. Huang Y, Giblin W, Kubec M, Westfield G, St. Charles J, Chadde L, Kraftson S, Sekiguchi J. Impact of a hypomorphic Artemis disease allele on lymphocyte development, DNA end processing, and genome stability. J Exp Med (2009) 206:893 LP-908. Available at: http://jem.rupress.org/content/206/4/893.abstract

54. Boettcher AN, Kiupel M, Adur M, Cocco E, Santin A, Charley SE, Risinger J, Tuggle CK, Shapiro E. Successful tumor formation following xenotransplantation of primary human ovarian cancer cells into severe combined immunodeficient (SCID) pigs. Submitt to Front Oncol (under Rev Available at: http://cancerres.aacrjournals.org/content/78/13_Supplement/LB-042

55. Choi Y-J, Kim E, Reza AMMT, Hong K, Song H, Park C, Cho S-K, Lee K, Prather RS, Kim J- H. Recombination activating gene-2(null) severe combined immunodeficient pigs and mice engraft human induced pluripotent stem cells differently. Oncotarget (2017) 8:69398–69407. doi:10.18632/oncotarget.20626

56. Meurens F, Summerfield A, Nauwynck H, Saif L, Gerdts V. The pig: a model for human infectious diseases. Trends Microbiol (2012) 20:50–57. doi:10.1016/j.tim.2011.11.002

57. Dawson HD, Smith AD, Chen C, Urban JFJ. An in-depth comparison of the porcine, murine and human inflammasomes; lessons from the porcine genome and transcriptome. Vet Microbiol (2017) 202:2–15. doi:10.1016/j.vetmic.2016.05.013

58. Schroyen M, Tuggle CK. Current transcriptomics in pig immunity research. Mamm Genome (2015) 26:1–20. doi:10.1007/s00335-014-9549-4

59. Kapetanovic R, Fairbairn L, Downing A, Beraldi D, Sester DP, Freeman TC, Tuggle CK, Archibald AL, Hume DA. The impact of breed and tissue compartment on the response of pig macrophages to lipopolysaccharide. BMC Genomics (2013) 14:581. doi:10.1186/1471-2164-14-581

60. Yamauchi T, Takenaka K, Urata S, Shima T, Kikushige Y, Tokuyama T, Iwamoto C, Nishihara M, Iwasaki H, Miyamoto T, et al. Polymorphic Sirpa is the genetic determinant for NOD-based mouse lines to achieve efficient human cell engraftment. Blood (2013) 121:1316–1325. doi:10.1182/blood-2012-06-440354

61. Kwong LS, Brown MH, Barclay AN, Hatherley D. Signal-regulatory protein α from the NOD mouse binds human CD47 with an exceptionally high affinity – implications for engraftment of human cells. Immunology (2014) 143:61–67. doi:10.1111/imm.12290

62. Boettcher AN, Cunnick JE, Powell EJ, Egner TK, Charley SE, Loving CL, Tuggle CK. Porcine signal regulatory protein alpha binds to human CD47 to inhibit phagocytosis: Implications for human hematopoietic stem cell transplantation into severe combined immunodeficient pigs. Xenotransplantation (2018)e12466. doi:10.1111/xen.12466

63. Samokhvalov IM, Samokhvalova NI, Nishikawa S. Cell tracing shows the contribution of the yolk sac to adult haematopoiesis. Nature (2007) 446:1056–1061. doi:10.1038/nature05725

64. Battista JM, Tallmadge RL, Stokol T, Felippe MJB. Hematopoiesis In The Equine Fetal Liver Suggests Immune Preparedness. Immunogenetics (2014) 66:635–649. doi:10.1007/s00251-014-0799-9

65. Ema H, Nakauchi H. Expansion of hematopoietic stem cells in the developing liver of a mouse embryo. Blood (2000) 95:2284–2288.

66. Tavian M, Peault B. Embryonic development of the human hematopoietic system. Int J Dev Biol (2005) 49:243–250. doi:10.1387/ijdb.041957mt

67. Sinkora M, Sinkorova J, Butler JE. B cell development and VDJ rearrangement in the fetal pig. Vet Immunol Immunopathol (2002) 87:341–346.

68. Sinkora M, Butler JE, Holtmeier W, Sinkorova J. Lymphocyte development in fetal piglets: facts and surprises. Vet Immunol Immunopathol (2005) 108:177–184. doi:10.1016/j.vetimm.2005.08.013

69. Pixley JS, Zanjani ED. In utero transplantation: Disparate ramifications. World J Stem Cells (2013) 5:43–52. doi:10.4252/wjsc.v5.i2.43

70. Yong KSM, Keng CT, Tan SQ, Loh E, Chang KTE, Tan TC, Hong W, Chen Q. Human CD34(lo)CD133(lo) fetal liver cells support the expansion of human CD34(hi)CD133(hi) hematopoietic stem cells. Cell Mol Immunol (2016) 13:605–614. doi:10.1038/cmi.2015.40

71. Zanjani ED, Pallavicini MG, Ascensao JL, Flake AW, Langlois RG, Reitsma M, MacKintosh FR, Stutes D, Harrison MR, Tavassoli M. Engraftment and long-term expression of human fetal hemopoietic stem cells in sheep following transplantation in utero. J Clin Invest (1992) 89:1178–1188. Available at: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC442977/

72. Kim J, Zanjani ED, Jeanblanc CM, Goodrich AD, Hematti P. Generation of CD34+ cells from human embryonic stem cells using a clinically applicable methodology and engraftment in the fetal sheep model. Exp Hematol (2013) 41:749–758.e5. doi:10.1016/j.exphem.2013.04.003

73. Almeida-Porada G, Porada C, Gupta N, Torabi A, Thain D, Zanjani ED. The human- sheep chimeras as a model for human stem cell mobilization and evaluation of hematopoietic grafts' potential. Experimental hematology [Internet]. 2007 October;35:;159. Exp Hematol (2007) 35:1594–1600. doi:10.1016/j.exphem.2007.07.009

74. Fujiki Y, Fukawa K, Kameyama K, Kudo O, Onodera M, Nakamura Y, Yagami K, Shiina Y, Hamada H, Shibuya A, et al. Successful multilineage engraftment of human cord blood cells in pigs after in utero transplantation. Transplantation (2003) 75:916–922. doi:10.1097/01.TP.0000057243.12110.7C

75. Ogle BM, Knudsen BE, Nishitai R, Ogata K, Platt JL. Toward development and production of human T cells in swine for potential use in adoptive T cell immunotherapy. Tissue Eng Part A (2009) 15:1031–1040. doi:10.1089/ten.tea.2008.0117

76. Ogle BM, Butters KA, Plummer TB, Ring KR, Knudsen BE, Litzow MR, Cascalho M, Platt JL. Spontaneous fusion of cells between species yields transdifferentiation and retroviral transfer in vivo. FASEB J Off Publ Fed Am Soc Exp Biol (2004) 18:548–550. doi:10.1096/fj.03-0962fje

77. McConico A, Butters K, Lien K, Knudsen B, Wu X, Platt JL, Ogle BM. In utero cell transfer between porcine littermates. Reprod Fertil Dev (2011) 23:297–302. doi:10.1071/RD10165

78. Mosier DE, Gulizia RJ, Baird SM, Wilson DB. Transfer of a functional human immune system to mice with severe combined immunodeficiency. Nature (1988) 335:256. Available at: http://dx.doi.org/10.1038/335256a0

79. Safrit JT, Fung MS, Andrews CA, Braun DG, Sun WN, Chang TW, Koup RA. hu-PBL-SCID mice can be protected from HIV-1 infection by passive transfer of monoclonal antibody to the principal neutralizing determinant of envelope gp120. AIDS (1993) 7:15–21.

80. Rizza P, Santini SM, Logozzi MA, Lapenta C, Sestili P, Gherardi G, Lande R, Spada M, Parlato S, Belardelli F, et al. T-cell dysfunctions in hu-PBL-SCID mice infected with human immunodeficiency virus (HIV) shortly after reconstitution: in vivo effects of HIV on highly activated human immune cells. J Virol (1996) 70:7958–7964.

81. Okuma K, Tanaka R, Ogura T, Ito M, Kumakura S, Yanaka M, Nishizawa M, Sugiura W, Yamamoto N, Tanaka Y. Interleukin-4-transgenic hu-PBL-SCID mice: a model for the screening of antiviral drugs and immunotherapeutic agents against X4 HIV-1 viruses. J Infect Dis (2008) 197:134–141. doi:10.1086/524303

82. Mosier DE, Picchio GR, Baird SM, Kobayashi R, Kipps TJ. Epstein-Barr virus-induced human B-cell lymphomas in SCID mice reconstituted with human peripheral blood leukocytes. Cancer Res (1992) 52:5552s–5553s.

83. Malkovska V, Cigel F, Storer BE. Human T cells in hu-PBL-SCID mice proliferate in response to Daudi lymphoma and confer anti-tumour immunity. Clin Exp Immunol (1994) 96:158–165. Available at: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1534540/

84. Spiegelberg HL, Beck L, Kocher HP, Fanslow WC, Lucas AH. Role of interleukin-4 in human immunoglobulin E formation in hu-PBL-SCID mice. J Clin Invest (1994) 93:711– 717. doi:10.1172/JCI117024

85. Wagar EJ, Cromwell MA, Shultz LD, Woda BA, Sullivan JL, Hesselton RM, Greiner DL. Regulation of human cell engraftment and development of EBV-related lymphoproliferative disorders in Hu-PBL-scid mice. J Immunol (2000) 165:518–527.

86. Zadeh-Khorasani M, Nolte T, Mueller TD, Pechlivanis M, Rueff F, Wollenberg A, Fricker G, Wolf E, Siebeck M, Gropp R. NOD-scid IL2R γnull mice engrafted with human peripheral blood mononuclear cells as a model to test therapeutics targeting human signaling pathways. J Transl Med (2013) 11:4. doi:10.1186/1479-5876-11-4

87. Dietz AB, Bulur PA, Emery RL, Winters JL, Epps DE, Zubair AC, Vuk-Pavlovic S. A novel source of viable peripheral blood mononuclear cells from leukoreduction system chambers. Transfusion (2006) 46:2083–2089. doi:10.1111/j.1537-2995.2006.01033.x

88. Schroeder MA, DiPersio JF. Mouse models of graft-versus-host disease: advances and limitations. Dis Model Mech (2011) 4:318–333. doi:10.1242/dmm.006668

89. Noto F, Towobola B, Arey A, Narla G, Chengelis C, Yeshi T. The SRG tm rat: A novel SCID rat for humanization studies. (2018) Available at: http://cancerres.aacrjournals.org/content/78/13_Supplement/1155

90. Metheny L, Eid S, Lingas K, Reese J, Meyerson H, Tong A, de Lima M, Huang AY. Intra- osseous Co-transplantation of CD34-selected Umbilical Cord Blood and Mesenchymal Stromal Cells. Hematol Med Oncol (2016) 1:25–29. doi:10.15761/HMO.1000105

91. Liu X, Liao X, Luo E, Chen W, Bao C, Xu HHK. Mesenchymal Stem Cells Systemically Injected into Femoral Marrow of Dogs Home to Mandibular Defects to Enhance New Bone Formation. Tissue Eng Part A (2014) 20:883–892. doi:10.1089/ten.tea.2012.0677

92. Lange S, Steder A, Killian D, Knuebel G, Sekora A, Vogel H, Lindner I, Dunkelmann S, Prall F, Murua Escobar H, et al. Engraftment Efficiency after Intra-Bone Marrow versus Intravenous Transplantation of Bone Marrow Cells in a Canine Nonmyeloablative Dog

Leukocyte Antigen-Identical Transplantation Model. Biol Blood Marrow Transplant (2017) 23:247–254. doi:10.1016/j.bbmt.2016.10.025

93. Lebouvier A, Poignard A, Cavet M, Amiaud J, Leotot J, Hernigou P, Rahmouni A, Bierling P, Layrolle P, Rouard H, et al. Development of a simple procedure for the treatment of femoral head osteonecrosis with intra-osseous injection of bone marrow mesenchymal stromal cells: study of their biodistribution in the early time points after injection. Stem Cell Res Ther (2015) 6:68. doi:10.1186/s13287-015-0036-y

94. Hagglund H, Ringden O, Agren B, Wennberg L, Remberger M, Rundquist L, Svahn BM, Aspelin P. Intraosseous compared to intravenous infusion of allogeneic bone marrow. Bone Marrow Transplant (1998) 21:331–335. doi:10.1038/sj.bmt.1701116

95. Fischer UM, Harting MT, Jimenez F, Monzon-Posadas WO, Xue H, Savitz SI, Laine GA, Cox CS. Pulmonary Passage is a Major Obstacle for Intravenous Stem Cell Delivery: The Pulmonary First-Pass Effect. Stem Cells Dev (2009) 18:683–691. doi:10.1089/scd.2008.0253

96. Bittencourt H, Vachon M-F, Louis I, Chablis E, Cortier M, Villeneuve E, Teira P, Cellot S, Haddad E, Duval M. Intrabone Infusion of Umbilical Cord Blood Stem Cells to Improve Hematopoietic Recovery after Allogeneic Umbilical Cord Blood Transplantation in Children. Blood (2015) 126:4334 LP-4334. Available at: http://www.bloodjournal.org/content/126/23/4334.abstract

97. Pollack CVJ, Pender ES, Woodall BN, Tubbs RC, Iyer R V, Miller HW. Long-term local effects of intraosseous infusion on tibial bone marrow in the weanling pig model. Am J Emerg Med (1992) 10:27–31.

98. Pantin JM, Hoyt RFJ, Aras O, Sato N, Chen MY, Hunt T, Clevenger R, Eclarinal P, Adler S, Choyke P, et al. Optimization of intrabone delivery of hematopoietic progenitor cells in a swine model using cell radiolabeling with [89]zirconium. Am J Transplant (2015) 15:606–617. doi:10.1111/ajt.13007

99. McCune JM, Namikawa R, Kaneshima H, Shultz LD, Lieberman M, Weissman IL. The SCID-hu mouse: murine model for the analysis of human hematolymphoid differentiation and function. Science (1988) 241:1632–1639.

100. Aryee K-E, Brehm MA, Shultz LD, Jurczyk A. Modeling immune system-tumor interactions using humanized mice. J Immunol (2016) 196:212.12 LP-212.12. Available at: http://www.jimmunol.org/content/196/1_Supplement/212.12.abstract

101. Nikolic B, Gardner JP, Scadden DT, Arn JS, Sachs DH, Sykes M. Normal Development in Porcine Thymus Grafts and Specific Tolerance of Human T Cells to Porcine Donor MHC. J Immunol (1999) 162:3402 LP-3407. Available at: http://www.jimmunol.org/content/162/6/3402.abstract

102. Kalscheuer H, Onoe T, Dahmani A, Li H-W, Holzl M, Yamada K, Sykes M. Xenograft tolerance and immune function of human T cells developing in pig thymus xenografts. J Immunol (2014) 192:3442–3450. doi:10.4049/jimmunol.1302886

103. Greenblatt MB, Vrbanac V, Tivey T, Tsang K, Tager AM, Aliprantis AO. Graft versus host disease in the bone marrow, liver and thymus humanized mouse model. PLoS One (2012) 7:e44664. doi:10.1371/journal.pone.0044664

104. Smith DJ, Lin LJ, Moon H, Pham AT, Wang X, Liu S, Ji S, Rezek V, Shimizu S, Ruiz M, et al. Propagating Humanized BLT Mice for the Study of Human Immunology and Immunotherapy. Stem Cells Dev (2016) 25:1863–1873. doi:10.1089/scd.2016.0193

105. Maude SL, Teachey DT, Porter DL, Grupp SA. CD19-targeted chimeric antigen receptor T-cell therapy for acute lymphoblastic leukemia. Blood (2015) 125:4017 LP-4023. Available at: http://www.bloodjournal.org/content/125/26/4017.abstract

106. Novartis. Highlights of prescribing information: Kymriah. (2017) Available at: https://www.pharma.us.novartis.com/sites/www.pharma.us.novartis.com/files/kymri ah.pdf

107. Kite. Highlights of prescribing information: Yescarta. (2017) Available at: https://www.fda.gov/downloads/BiologicsBloodVaccines/CellularGeneTherapyProduc ts/ApprovedProducts/UCM581226.pdf

108. Bonifant CL, Jackson HJ, Brentjens RJ, Curran KJ. Toxicity and management in CAR T- cell therapy. Mol Ther - Oncolytics (2016) 3:16011. doi:https://doi.org/10.1038/mto.2016.11

109. Fujisaki H, Kakuda H, Shimasaki N, Imai C, Ma J, Lockey T, Eldridge P, Leung WH, Campana D. Expansion of Highly Cytotoxic Human Natural Killer Cells for Cancer Cell Therapy. Cancer Res (2009) 69:4010 LP-4017. Available at: http://cancerres.aacrjournals.org/content/69/9/4010.abstract

110. Mehta RS, Rezvani K. Chimeric Antigen Receptor Expressing Natural Killer Cells for the Immunotherapy of Cancer. Front Immunol (2018) 9:283. doi:10.3389/fimmu.2018.00283

111. Zhang W, Wang Y, Guo Y, Dai H, Yang Q, Zhang Y, Zhang Y, Chen M, Wang C, Feng K, et al. Treatment of CD20-directed Chimeric Antigen Receptor-modified T cells in patients

with relapsed or refractory B-cell non-Hodgkin lymphoma: an early phase IIa trial report. Signal Transduct Target Ther (2016) 1:16002. doi:10.1038/sigtrans.2016.2

112. Wang C-M, Wu Z-Q, Wang Y, Guo Y-L, Dai H-R, Wang X-H, Li X, Zhang Y-J, Zhang W-Y, Chen M-X, et al. Autologous T Cells Expressing CD30 Chimeric Antigen Receptors for Relapsed or Refractory Hodgkin Lymphoma: An Open-Label Phase I Trial. Clin Cancer Res (2017) 23:1156–1166. doi:10.1158/1078-0432.CCR-16-1365

113. Wang Q, Wang Y, Lv H, Han Q, Fan H, Guo B, Wang L, Han W. Treatment of CD33- directed chimeric antigen receptor-modified T cells in one patient with relapsed and refractory acute myeloid leukemia. Mol Ther (2015) 23:184–191. doi:10.1038/mt.2014.164

114. Gomes-Silva D, Srinivasan M, Sharma S, Lee CM, Wagner DL, Davis TH, Rouce RH, Bao G, Brenner MK, Mamonkin M. CD7-edited T cells expressing a CD7-specific CAR for the therapy of T-cell malignancies. Blood (2017) 130:285–296. doi:10.1182/blood-2017- 01-761320

115. Rafiq S, Purdon TJ, Schultz L, Klingemann H, Brentjens RJ. NK-92 cells engineered with anti-CD33 chimeric antigen receptors (CAR) for the treatment of Acute Myeloid Leukemia (AML). Cytotherapy (2015) 17:S23. doi:10.1016/j.jcyt.2015.03.384

116. Liu E, Tong Y, Dotti G, Shaim H, Savoldo B, Mukherjee M, Orange J, Wan X, Lu X, Reynolds A, et al. Cord blood NK cells engineered to express IL-15 and a CD19- targeted CAR show long-term persistence and potent antitumor activity. Leukemia (2018) 32:520–531. doi:10.1038/leu.2017.226

117. Gyory F, Mezosi E, Szakall S, Bajnok L, Varga E, Borbely A, Gazdag A, Juhasz I, Lukacs G, Nagy E V. Establishment of the hu-PBL-SCID mouse model for the investigation of thyroid cancer. Exp Clin Endocrinol Diabetes (2005) 113:359–364. doi:10.1055/s-2005- 865740

118. Leuchs S, Saalfrank A, Merkl C, Flisikowska T, Edlinger M, Durkovic M, Rezaei N, Kurome M, Zakhartchenko V, Kessler B, et al. Inactivation and inducible oncogenic mutation of p53 in gene targeted pigs. PLoS One (2012) 7:e43323. doi:10.1371/journal.pone.0043323

119. Sieren JC, Meyerholz DK, Wang X-J, Davis BT, Newell JD, Hammond E, Rohret JA, Rohret FA, Struzynski JT, Goeken JA, et al. Development and translational imaging of a TP53 porcine tumorigenesis model. J Clin Invest (2014) 124:4052–4066. doi:10.1172/JCI75447

120. Li S, Edlinger M, Saalfrank A, Flisikowski K, Tschukes A, Kurome M, Zakhartchenko V, Kessler B, Saur D, Kind A, et al. Viable pigs with a conditionally-activated oncogenic KRAS mutation. Transgenic Res (2015) 24:509–517. doi:10.1007/s11248-015-9866-8

121. Cocco E, Shapiro EM, Gasparrini S, Lopez S, Schwab CL, Bellone S, Bortolomai I, Sumi NJ, Bonazzoli E, Nicoletti R, et al. Clostridium perfringens enterotoxin C-terminal domain labeled to fluorescent dyes for in vivo visualization of micrometastatic chemotherapy-resistant ovarian cancer. Int J cancer (2015) 137:2618–2629. doi:10.1002/ijc.29632

122. Hsiao J-K, Wu H-C, Liu H-M, Yu A, Lin C-T. A multifunctional peptide for targeted imaging and chemotherapy for nasopharyngeal and breast cancers. Nanomedicine (2015) 11:1425–1434. doi:10.1016/j.nano.2015.03.011

123. Anton N, Parlog A, Bou About G, Attia MF, Wattenhofer-Donzé M, Jacobs H, Goncalves I, Robinet E, Sorg T, Vandamme TF. Non-invasive quantitative imaging of hepatocellular carcinoma growth in mice by micro-CT using liver-targeted iodinated nano-emulsions. Sci Rep (2017) 7:13935. doi:10.1038/s41598-017-14270-7

124. Chi Y-H, Hsiao J-K, Lin M-H, Chang C, Lan C-H, Wu H-C. Lung Cancer-Targeting Peptides with Multi-subtype Indication for Combinational Drug Delivery and Molecular Imaging. Theranostics (2017) 7:1612–1632. doi:10.7150/thno.17573

125. Cocco E, Casagrande F, Bellone S, Richter CE, Bellone M, Todeschini P, Holmberg JC, Fu HH, Montagna MK, Mor G, et al. Clostridium perfringens enterotoxin carboxy-terminal fragment is a novel tumor-homing peptide for human ovarian cancer. BMC Cancer (2010) 10:349. doi:10.1186/1471-2407-10-349

126. Day C-P, Merlino G, Van Dyke T. Preclinical Mouse Cancer Models: A Maze of Opportunities and Challenges. Cell (2015) 163:39–53. doi:10.1016/j.cell.2015.08.068

Figures

Figure 2.1. Genetic and molecular mechanisms of RAG1/2, Artemis, and IL2Rγ in lymphoid development

Previous SCID pig models have been generated or described with mutations in Artemis, RAG1, RAG2, or IL2RG. (A) RAG1 and 2 are subunits of an endonuclease that cleave recombination signal sequences (RSS) flanking V, D, and J gene segments. Cleavage of RSS sequences are required for the gene segments to be joined together. Non-functional RAG1 or 2 proteins cannot cleave these sequences, therefore preventing T cell receptors (TCRs)

42 and B cell receptors (BCRs) from forming. T cells and B cells cannot develop due to non- functional TCR and BCR rearrangement. (B) Artemis is an endonuclease that is responsible for the cleavage of hairpin loops that form after RAG1 and 2 cleaves RSS sequences. These hairpin loops must be cleaved in order for Ligase IV to ligate V, D, and J gene segments together. If Artemis is not functional, these hairpin loops cannot be cleaved, which prevents TCR and BCR rearrangement. (C) IL2Rγ is a subunit required in the receptors for IL-2, IL-15, IL-4, IL-7, IL-9, and IL-21. Without functional IL2Rγ, developing cells that require these cytokines for development (mainly T, B, and NK cells) are not receptive to cytokine signaling, which prevents proper differentiation of T, B, and NK cells. (D) Pigs with mutations in both a VDJ recombination gene (RAG1/2 or Artemis) and IL2RG lack T, B, and NK cells.

Figure 2.2. Lymphoid development and relevant SCID pig mutations

Mutations in Artemis, RAG1/2, and IL2RG leads to SCID in pigs. Artemis and RAG1/2 are active in Pro-B and -T cells during differentiation. IL2Rγ is required at an earlier stage of development than RAG1/2 and Artemis. NK cells and T cells both require cytokine signaling through IL2Rγ early in differentiation. Mutations in IL2RG prevent differentiation of T and B cells. Mouse B cells appear to rely on IL2Rγ signaling more than human and pig B cells. B cells can still develop in humans and pigs with mutations in IL2RG, although they are mostly non- functional due to the absence of helper T cells.

Figure 2.3. Biocontainment facilities for rearing SCID pigs

(A) Biocontainment facilities for the rearing of Art-/- SCID pigs. (B) SPF female Art+/- carriers nursing three week old SCID and non-SCID piglets after naturally farrowing in biocontainment facilities.

Figure 2.4. Swine have fewer unique immunological genes compared to humans than do mice

A comparison of the number of unique immunological genes was compared between humans, mice, cows, and pigs. Pigs have 2 times less unique genes, while mice have 4.7 times more unique genes compared to humans. [Reprinted from Dawson et al., 2013 (20); Figure 1]

Figure 2.5. Amino acid sequence comparisons in hematopoietic cytokines for pig and mouse compared to humans

Amino acid sequences for relevant hematopoietic cytokines and other ligands were acquired from Ensembl (https://useast.ensembl.org/index.html). The percentage of matching sequence between humans to pigs and mouse is shown above. Porcine shares higher sequence similarity to humans for a majority of hematopoietic cytokines compared to mice. Table 2.S1 shows the accession numbers from the sequences that were compared.

Figure 2.6: Cell types and routes of injection for SCID pig immunological humanization

Swine can be injected with human cells at two different developmental stages. During gestation, fetal piglets at approximately 40 days of gestation can be injected with human CD34+ stem cells within either the liver or intraperitoneal space via ultrasound guidance. Newborn piglets can also be injected with human CD34+ stem cells through either intravenous or intraosseous routes. PBLs can also be injected via intravenous injection. Fetal tissues including bone marrow, liver, thymus, or spleen can be transplanted within the abdomen, potentially under the kidney capsule as is done with SCID mice.

Figure 2.7: In utero injection of fetal intraperitoneal space via laparotomy

(A) Exteriorized uterus at 40 days gestation being ultra-sounded for fetuses. Water soluble marker can be used for marking fetuses. (B) Ultrasound image of fetal liver with which human CD34+ stem cells would be injected.

Tables

Table 2.1. Previously described SCID pig models

Mutagenesis Cellular Oldest age Mutation(s) Breed Rearing method Reference Method phenotype reported

Gene targeting Conventional IL2RG T- B+ NK- Cross bred 54 days 16 vector housing Biocontainment ARTEMIS Natural T- B- NK+ Yorkshire 6 months 31,32 bubble IL2RG Zinc finger nuclease T- B+ NK- Cross bred Did not rear neonatal 18 Conventional RAG 1/2 TALENs T- B- NK+ Bama miniature 29 days 24 housing 49 RAG 1 Gene targeting T- B- Duroc Did not rear neonatal 25 Conventional RAG 2 TALENs T- B- NK+ Minnesota minipig 29 days 26 housing Conventional IL2RG CRISPR/Cas9 T- B+ NK- Cross bred 12 days 17 housing Gene targeting Conventional RAG 2 T- B- NK+ Cross bred 12 weeks 27 vector Housing RAG 2 IL2RG CRISPR/Cas9 T- B- NK- Yorkshire cross breed Gn Isolator 34 days 28 IL2RG Zinc finger nuclease T- B+ NK- Cross bred Isolator 103 days 18,29 Natural & Biocontainment ARTEMIS IL2RG T- B- NK- Yorkshire 18 days 30 CRISPR/Cas9 bubble

Table 2.2. Previously described human stem cell injection studies in swine and sheep

Type of human cells Number of cells Age and injection Human cell type(s) that Large animal Reference injected injected site differentated

Fetal peritoneal T, B, NK, myeloid, PI sheep Fetal liver cells 0.2-1 x 1010/kg 71 cavity erythroid Fetal CD34+ cells from PI pig 0.5-3 x 106 intraperitoneal T, B, NK, Myeloid 74 cord cephalad space T cell depleted bone Fetal peritoneal PI pig 5 x 107 (5 x 109/kg) B 76 marrow cavity CD34+ cells from Fetal peritoneal T, B, myeloid,dendritic PI sheep 3.6 x 106 73 bone marrow cavity cells, erythroid

T cell depleted bone Fetal peritoneal PI pig marrow or cord 5 x 107 (5 x 109/kg) T, B, NK, myeloid 75 cavity blood Fetal peritoneal T, B, NK, Monocytes, PI sheep ESC-derived CD34+ 0.5 x 106 72 cavity neutrophils Piglet ear and SCID pig iPSCs 5-10 x 106 CD34+, CD45+ 26 lateral flank Piglet ear and SCID pig iPSCs 10 x 106 CD34+, CD45+ 55 lateral flank

PI: Pre-immunocompetent; ESC: embyronic stem cells; iPSC: induced pluripotent stem cells

Supplemental Tables

Table 2.S1. Ensembl accession numbers used for amino acid comparisons

Protein Human Pig Mouse

SCF ENSG00000049130 ENSSSCG00000035495 ENSMUSG00000019966 TPO ENSG00000090534 ENSSSCG00000023909 ENSMUSG00000022847 Flt-3 ENSG00000122025 ENSSSCG00000009314 ENSMUSG00000042817 IL-11 ENSG00000095752 ENSSSCG00000040725 ENSMUSG00000004371 CXCL12 ENSG00000107562 ENSSSCG00000034973 ENSMUSG00000061353 EPO ENSG00000130427 ENSSSCG00000007673 ENSMUSG00000029711 IL-15 ENSG00000164136 ENSSSCG00000009051 ENSMUSG00000031712 IL-2 ENSG00000109471 ENSSSCG00000033267 ENSMUSG00000027720 IL-4 ENSG00000113520 ENSSSCG00000014282 ENSMUSG00000000869 IL-5 ENSG00000113525 ENSSSCG00000014278 ENSMUSG00000036117 IL-6 ENSG00000136244 ENSSSCG00000020970 ENSMUSG00000025746 IL-7 ENSG00000104432 ENSSSCG00000006161 ENSMUSG00000040329 M-CSF ENSG00000184371 ENSSSCG00000037449 ENSMUSG00000014599 GM-CSF ENSG00000164400 ENSSSCG00000023737 ENSMUSG00000018916 G-CSF ENSG00000108342 ENSSSCG00000017488 ENSMUSG00000038067

CHAPTER 3

PORCINE SIRPA BINDS TO HUMAN CD47 TO INHIBIT PHAGOCYTOSIS: IMPLICATIONS FOR HUMAN HEMATOPOETIC STEM CELL TRANSPLANTATION INTO SCID PIGS

Accepted for publication in Xenotransplantation on September 18, 2018. Published on October 12, 2018

Adeline N Boettcher1, Joan E Cunnick1, Ellis J Powell1,4, Timothy K Egner 3, Sara E Charley1, Crystal L Loving 2, Christopher K Tuggle1 ______

1Iowa State University, Department of Animal Science, Ames, IA, USA 2 US Department of Agriculture, Agricultural Research Service, National Animal Disease Center, Food Safety and Enteric Pathogens Unit, Ames, IA, USA 3Iowa State University, Department of Chemistry, Ames, IA, USA 4Affiliation at time of submission: US Department of Agriculture, Agricultural Research Service, National Animal Disease Center, Ruminant Diseases and Immunology Unit, Ames, IA, USA

Author Contributions

ANB designed and performed experiments, analyzed data, and wrote the manuscript; JEC, CLL, EJP, TKE designed experiments, reviewed data, and edited manuscript; EJP performed statistical analysis; SEC genotyped piglets, managed SCID pig colony, and helped with sample collection; and CKT designed experiments, reviewed data, and edited manuscript.

Abstract

Background

Severe combined immunodeficient (SCID) pigs are an emerging animal model being developed for biomedical and regenerative medicine research. SCID pigs can successfully engraft human induced pluripotent stem cells and cancer cell lines. The development of a humanized SCID pig through xenotransplantation of human hematopoietic stem cells (HSCs) would be a further demonstration of the value of such a large animal SCID model.

Xenotransplantation success with HSCs into non-obese diabetic (NOD)-derived SCID mice is dependent on the ability of NOD mouse signal regulatory protein alpha (SIRPA) to bind human CD47, inducing higher phagocytic tolerance than other mouse strains.

Therefore, we investigated whether porcine SIRPA binds human CD47 in the context of developing a humanized SCID pig.

Methods

Peripheral blood mononuclear cells (PBMCs) were collected from SCID and non-SCID pigs. Flow cytometry was used to assess if porcine monocytes could bind to human CD47.

Porcine monocytes were isolated from PBMCs and were subjected to phagocytosis assays with pig, human, and mouse red blood cell (RBC) targets. Blocking phagocytosis assays were performed by incubating human RBCs with anti-human CD47 blocking antibody B6H12, non- blocking antibody 2D3, and non-specific IgG1antibody and exposing to human or porcine monocytes.

Results

We found that porcine SIRPA binds to human CD47 in vitro by flow cytometric assays.

Additionally, phagocytosis assays were performed, and we found that porcine monocytes phagocytose human and porcine RBCs at significantly lower levels than mouse RBCs. When human RBCs were pre-incubated with CD47 antibodies B6H12 or 2D3, phagocytosis was induced only after B6H12 incubation, indicating the lower phagocytic activity of porcine monocytes with human cells requires interaction between porcine SIRPA and human CD47.

Conclusions

We have shown the first evidence that porcine monocytes can bind to human CD47 and are phagocytically tolerant to human cells, suggesting that porcine SCID models have the potential to support engraftment of human HSCs.

Introduction

Mice are currently the most common animal model used in biomedical research.

However, it has become apparent that results pertaining to human disease states and drug responses in mice may not be directly translatable to humans [1,2]. Therefore, progress is being made to develop larger animal models to provide a more accurate representation of human health. One such species that is increasing in research versatility is the domestic pig.

Porcine models are advantageous over other rodent models due to their similarities in anatomy, physiology, immunology, and gene expression to humans [3,4,5,6,7]. Although primate models exist, pigs are preferable for biomedical research due to fewer ethical issues.

Pigs also have a shorter gestation period and larger litter sizes than primates, which better facilitate experimental groups. Therefore, further development of porcine models is needed for translational biomedical research.

We have previously characterized naturally occurring T- B- NK+ severe combined immunodeficient (SCID) pigs with mutations within the Artemis gene [8]. Other SCID pig models that were artificially created include IL2RG-/- [9,10], RAG2-/- [11], and RAG2-/- IL2RG-/- double knockouts [12]. One way to utilize and improve the SCID pig as a model is the humanization through efficient engraftment of human hematopoietic stem cells (HSCs).

Currently, the only humanized SCID animal model is the mouse. Humanized mice have

55 allowed researchers to study human immune cell function in the context of HIV, cancer, transplantation, and other important diseases[13,14].

The mouse strain used for the most efficient human cell engraftment is the non- obese diabetic (NOD) SCID IL2RG (NSG) mouse, which has a T- B- NK- cellular phenotype.

One mechanism for success of human cell engraftment within the NSG background is due to polymorphisms within the NOD signal regulatory protein alpha (SIRPA) gene [15], which allows it to intrinsically bind to human CD47 and signaling leads to phagocytic tolerance of human cells. SIRPA is expressed on the surface of monocytes, macrophages, and other immune cells and binds to the “self” protein CD47 [16]. SIRPA binding to CD47 results in an inhibitory “don’t eat me” signal within SIRPA expressing cells, resulting in the inhibition of phagocytosis [17,18]. Upon binding of CD47, intracellular tyrosine based inhibitory motifs on the intracellular domain of SIRPA are phosphorylated, leading to a dephosphorylation cascade mediated by SHP1, leading to phagocytic inhibition [19]. The SIRPA protein in

C57BL/6 and BALB/c both have low affinity to human CD47 that is not sufficient for inhibitory signaling, which explains the lack of successful human cell engraftment in these mouse strains [20], and further demonstrates the importance of SIRPA-CD47 recognition for humanization of these rodent models [21]. Certain rats and mice of mixed 129/BALB/c background are genetically modified to express human SIRPA, making these animals candidates for humanization if crossed onto a SCID genetic background [22,23].

Interestingly, past studies have investigated the interaction between porcine CD47 and human SIRPA, the opposite interaction to that described here, in relation to transplantation of pig organs into human patients. Results found in one study showed that porcine CD47 was

56 able to bind to human SIRPA in vitro [24], while another showed that phagocytic inhibition was not induced between human macrophages and pig cells [25]. Expression of human CD47 on porcine cells was required to inhibit phagocytosis by human macrophages [25,26].

Together, these studies show evidence that human SIRPA and pig CD47 can bind, although binding is not sufficient for phagocytic inhibition. However, the ability of swine SIRPA to bind to human CD47 has not been explored.

Humanized SCID pigs would be an excellent biomedical model for the study of human disease and cancer. To identify potential cellular barriers to humanization of SCID pigs related to SIRPA/CD47 interactions, we investigated if porcine SIRPA binds to human CD47 and if binding is sufficient to inhibit phagocytosis of human cells. Flow cytometry assays with porcine cells and recombinant human CD47 showed that porcine SIRPA can bind to human

CD47. Additionally, porcine monocytes phagocytosed pig and human cells at very low levels, while readily phagocytosing murine cells. Antibody blocking assays showed that the inhibition of phagocytosis of human cells by porcine monocytes was dependent on the

SIRPA-CD47 interaction. The natural ability of porcine SIRPA to bind to human CD47 suggests that SCID pigs have the potential to be used for humanization and serve as a valuable biomedical model.

Results

Porcine SIRPA and CD47 share high degree of amino acid sequence homology with human

The extracellular IgV domain of SIRPA takes part in binding to the IgSF domain of

CD47 [33]. CD47 IgSF amino acids from human, pig, and mouse were aligned (Figure 3.1A). In comparing amino acids of the IgSF domain among the different species, mouse shares less

57 homology with porcine (53-62%) or human (53-63%) than is shared between porcine and human (72%). The higher degree of similarity between human and porcine CD47 suggests that human CD47 may be similar enough to porcine CD47 to be recognized by porcine SIRPA.

To clarify the level of amino acid conservation of SIRPA across human, pig and mouse, SIRPA IgV amino acids were aligned from human, pig, C57BL/6, BALB/C, and NOD mouse backgrounds (Figure 3.1B). Previously, mutagenesis experiments have identified critical residues in human SIRPA that are required for successful binding of human CD47, including Ala/Val 27 and Gln 37 [34,35,36]. Swine SIRPA contains Ala 27, suggesting that it could interact with human CD47 at this position. Additionally, porcine SIRPA contains residues present in NOD SIRPA that are shared with human, but not in C57BL/6 mice, including His 59, Val 63, Thr 64, and Thr 91. Importantly, NOD, pig, and human SIRPA all lack

Ser 102 and Glu 103 present in the C57BL/6 and BALB/c derived protein; the re-insertion of these residues into NOD SIRPA in vitro dramatically decreased human CD47 binding [28]. Ser

102 and Glu 103 are found on the surface of the binding interface of SIRPA and are near residues shown to physically interact with CD47 including Ser 98 and Asp 100 (depicted as

S101 and D106 in Figure 3.1B) [33]. Other critical residues, including Gln 8, Thr 26, Ser 66, and Arg 69 (depicted as R72 in Figure 3.1B) are conserved across human, pig, and mouse, indicating that these residues do not participate in the species-specific differences in the

CD47-SIRPA interaction [34,35,36]. Taken together, porcine SIRPA shares specific amino acid similarities to human and NOD SIRPA that suggested it may bind to human CD47.

Porcine monocytes bind to recombinant hCD47-Fc

Previous studies have utilized flow cytometry and recombinant human CD47 (hCD47-

Fc) to assess binding to mouse SIRPA [20], and thus we used a similar approach to determine if porcine SIRPA was capable of binding human CD47. PBMCs were isolated from human,

SCID, and non-SCID pig blood and analyzed for surface expression of SIRPA and binding capability of hCD47-Fc. When staining with hCD47-Fc and anti-human SIRPA on human monocytes, we found that the anti-human SIRPA antibody we used inhibited binding of the hCD47-Fc protein. The anti-pig SIRPA antibody we used also appeared to block hCD47-Fc binding (Figure 3.S1). Therefore, cells were stained with SIRPA antibodies and hCD47-Fc separately as to avoid the potential for SIRPA antibodies to block SIRPA-hCD47-Fc interactions.

Monocytes from SCID and non-SCID pigs both showed positive binding to hCD47-Fc

(Figure 3.2A). The percent SIRPA+ positive monocytes in SCID and non-SCID pigs did not differ, nor did the percent of hCD47-Fc (Figure 3.2B). However, in cells from both types of pigs, as well as humans, there was variability in binding capability to hCD47-Fc (Figure 3.2B), with some binding at high levels (Figure 3.2A, top row), or low levels (Figure 3.2A, bottom row). Monocytes from all pigs were shown to bind hCD47-Fc at higher levels than fluorophore controls (Figure 3.2B). In summary, we interpreted these results to indicate that porcine SIRPA+ cells bound to human CD47-Fc in vitro.

Porcine blood-derived monocytes phagocytose human RBCs at very low levels

We next investigated if porcine monocytes phagocytose human cells in an in vitro system. The SIRPA/CD47 interaction is critical for RBC clearance from the blood [37,38], and

59 failure to express CD47 on the surface of a RBCs results in immediate phagocytosis [39].

Additionally, RBCs are an easily obtainable and comparable small cell type that can be collected from humans, pigs, and mice. Therefore, in this study, we utilized RBCs as a model to study the interaction between porcine SIRPA and human CD47.

In comparing CD47 amino acid sequences among species, mouse shares less homology with porcine CD47 than human (Figure 3.1A), indicating that mouse CD47 may not be recognized by porcine SIRPA. Based on sequence differences between pig and mouse

CD47, we expected that porcine monocytes would phagocytose mouse RBCs due to lack of pig SIRPA- mouse CD47 binding. SCID and non-SCID pig SIRPA+ monocytes were incubated with fluorescently labeled human, pig, and mouse RBCs, and phagocytosis was assessed by the percentage of fluorescent monocytes, indicating phagocytosis of labeled RBCs. SCID and non-SCID pigs did not differ in their ability to phagocytose the RBC targets. As predicted, porcine monocytes phagocytosed mouse RBC at very high levels (Figure 3.3A), which indicates that the porcine monocytes have the potential to be phagocytic. Due to the high levels of mRBC phagocytosis, a slightly different gating strategy was used for mRBC phagocytosis since the phagocytic population had a higher fluorescence intensity than when incubated with hRBC or pRBC (Figure 3.3B). The brighter monocyte population (to the right of the gate) are indicated as the phagocytic populations. The levels of phagocytosis of human and porcine RBCs by porcine monocytes were very similar, and significantly lower, than mouse RBCs (p < 0.001) (Figure 3.3A, B). Collectively, low levels of human RBC phagocytosis by porcine monocytes suggested that CD47 expressed on human RBCs bound to porcine SIRPA to subsequently inhibit phagocytosis.

Blocking Porcine SIRPA- human CD47 interaction induced phagocytosis

To demonstrate that human RBCs were not phagocytosed by porcine monocytes due to inhibitory effects of porcine SIRPA-human CD47 binding, we utilized an antibody blocking assay used in a variety of cancer therapy studies [40,41,42,43,44]. The B6H12 clone of anti- human CD47 antibody binds to an epitope of human CD47 that prevents it from binding to human SIRPA, while the 2D3 anti-human CD47 clone does not block the interaction. The 2D3 antibody acts as an opsonization control in these experiments to show that it is the blocking activity of the B6H12 anti-CD47 clone, and not the presence of the antibody on the cellular surface, that allows for phagocytosis to be induced (not inhibited). In human studies, cancer cells that express high levels of CD47 that are incubated with B6H12 are phagocytosed at higher levels than those incubated with 2D3 or non-specific antibodies [40,41,42,43,44].

Thus, The B6H12 and 2D3 antibodies were used with human RBCs in an assay with porcine and human monocytes to interrogate if human CD47 binds to porcine SIRPA to inhibit phagocytosis

Since we have previously shown that SCID and non-SCID pigs do not differ in their ability to bind to human CD47 or phagocytose human RBC targets, they were analyzed as a single group. Human RBCs were incubated with B6H12, 2D3, and IgG control antibodies prior to incubation with either human or porcine monocytes. A schematic of cells and antibodies used are shown in Figure 3.4A. Only pretreatment with B6H12 increased RBC phagocytosis for both human and pig monocytes (Figure 3.4B) (p < 0.001). Importantly, B6H12 and 2D3 bound to human RBCs similarly (Figure 3.S2). On average, 80% of human monocytes phagocytosed B6H12 treated hRBCs, compared to 1-2% for controls. We used human

61 monocytes as a proof of concept to show that blocking the interaction between SIRPA/CD47 within the same species increases phagocytosis. Of porcine monocytes, 20% of monocytes phagocytosed B6H12 treated hRBC, compared to 5% for controls. One hypothesis for the difference in B6H12 phagocytosis induction between human and pig monocytes is that the protein interacting surface between human SIRPA-human CD47 and porcine SIRPA-human

CD47 may slightly differ. The B6H12 antibody may not be as efficient at blocking the porcine

SIRPA-human CD47 interaction, which would explain the lower levels of phagocytosis induction. While the increase in phagocytosis was not as high for porcine monocytes as human monocytes, a significant increase in the level of phagocytosis was induced upon blocking pig SIRPA-human CD47 binding. This result indicates that the SIRPA-CD47 interaction between porcine monocytes and human RBCs is critical for limiting phagocytosis of human RBCs.

Discussion

We present the first evidence that porcine SIRPA can bind and recognize human

CD47 to inhibit phagocytosis of human cells by porcine phagocytes in an in vitro system.

Importantly, monocytes specifically from SCID pigs were capable of binding human CD47 to inhibit phagocytosis of human RBCs. Specifically, porcine monocytes uniformly failed to phagocytose hRBC and blocking the porcine SIRPA-human CD47 axis induced phagocytosis of hRBC. Together, these results show that the porcine SIRPA-human CD47 binding interaction was sufficient to inhibit phagocytosis of human cells. Mouse and rat models have previously required genetic modification to express human SIRPA to allow engraftment of human cells

[22,23]. Due to the fact that porcine SIRPA binds to human CD47 intrinsically, we do not

62 believe that pigs would require introduction of the human SIRPA gene to allow for HSC engraftment. In moving forward with the development of a humanized SCID pig model, it is necessary to characterize interactions that are required for successful engraftment.

There are few studies that have investigated how porcine immune cells interact with human cells, particularly phagocytosis of human cells by pig myeloid lineage cells. Porcine liver sinusoidal endothelial cells phagocytose human platelets perfused through the liver

[45]; however, the involvement of porcine SIRPA and human CD47 in the phagocytosis of human platelets was not assessed in this study. A follow-up report suggests that differences in Galβ and βGlcNAc oligosaccharides on human and porcine platelets contributed to the phagocytosis of human platelets [46]. Previous reports in mouse models indicate NOD mouse macrophages phagocytose human RBC despite the ability of NOD SIRPA to bind to human CD47. The phagocytosis of human RBC by NOD macrophages is hypothesized to be attributed to either mouse complement [47] or xenoantigens on the human RBCs [48]. In our study we were able to show low levels of in vitro phagocytosis of human RBC by porcine monocytes; enhanced phagocytosis only occurred when the porcine SIRPA-human CD47 axis was blocked with the anti-human CD47 B6H12 antibody. One method that could be utilized in future studies would be generating a crystal structure of the human CD47- porcine SIRPA complex to study this interaction in more detail. Additionally, it would be insightful to determine if there are unidentified polymorphisms in the IgV domain of swine SIRPA that could contribute to different binding affinities to human CD47.

Porcine SCID models have already been utilized for different facets of biomedical research including cancer [49,50], influenza [51], and norovirus research [12]. In addition,

63 human cancer cells lines [49] and human induced pluripotent stem cells [52] can survive and persist in SCID pigs. The ability of these cell types to survive within SCID pigs suggests that other human cell types, including HSCs could also survive in SCID pigs. Humanized SCID pig models could aid in the development and testing of vaccines, cancer immunotherapies, stem cell therapies, as well as other important biomedical advancements [53]. Development of such a humanized SCID pig requires clean housing and personnel protocols to ensure minimal exposure of these animals to pathogens. There are protocols developed to raise

SCID pigs in clean, positive-pressure bubble environments to limit disease and increase lifespan so these pigs can be used in long term studies [54], including development of methods to introduce and maintain a human immune system in SCID pigs.

As of this writing, very few studies have been conducted in relation to introducing human HSCs into non-murine models. Non-SCID lambs and piglets can support the development of human T, B, NK, and myeloid lineages when HSC cells were injected in the fetal intraperitoneal space via in utero injections with human HSCs [55,56]. Additionally, the pig thymus can support the development of a wide range of human T cells [57,58]. The development of human immune cell subsets suggests that porcine cytokines can support the development of human immune cells. The differentiation of human cells in pig models is consistent with existing literature that state porcine immune genes are highly similar to human [3,59]. In considering past studies, it is expected that human HSCs would engraft and differentiate in SCID pigs at least as well as they have in non-SCID pigs. Showing that porcine phagocytes tolerate human cells in vitro though the SIRPA-CD47 pathway is important evidence that this interaction would not be a barrier to human HSC engraftment in SCID pigs.

Materials and Methods

Generation of piglets and sample collections from pig, mouse and human subjects

Piglets were derived as described [8]. Piglets from all litters were co-housed with their littermates. All animal protocols and procedures were approved by Iowa State

University’s Institutional Animal Care and Use Committee. Informed consent was obtained from human subjects and was approved by the Iowa State University’s Institutional Review

Board. Blood was collected into a heparinized vacutainer tube (BD, Franklin Lanes, NJ, USA).

Peripheral blood mononuclear cells (PBMCs) were isolated as described [27].

Flow cytometry for hCD47 binding to PBMCs

PBMCs from pig and human were washed in Hanks Balanced Salt Solution (HBSS) to remove excess biotin from complete RPMI media (10% FBS, 2 mM glutamine, 50 µg/mL gentamicin, 10 mM HEPES) and incubated with biotinylated human CD47-Fc (hCD47-Fc) (BPS

Biosciences, San Diego, CA, USA) followed by PE-Cy5 Streptavidin (BD Biosciences). Human cells were stained with anti-human SIRPA (R&D, Minneapolis, MN, USA, clone #602411), while porcine cells were stained with anti-pig monocyte/granulocyte (SWC3a/SIRPA) (BD

Biosciences, clone 74-22-15A). A mouse IgG2b isotype control antibody (BD Biosciences) and goat anti-mouse IgG2b FITC (Southern Biotech, Birmingham, AL, USA) were used as controls.

Human and porcine monocytes were singly stained with SIRPA and hCD47-Fc. We stained from the same stock of cells and gated monocytes the same way for each set of stained cells.

In order to prevent non-specific Fc binding, Human TruStain FcX (BioLegend) and heat inactivated swine serum were also added to human and pig cells, respectively. Data was acquired on a BD FACSCanto II flow cytometer and analyzed with FlowJo (Tree Star). Cells

65 from a total of six pigs (3 SCID and 3 non-SCID) and four humans were used in three independent experiments. The three experimental groups contained piglets from two separate litters.

Sequence alignment of SIRPA and CD47

Sequences of SIRPA from human (CAA71403.1, NP_542970), porcine

(NP_001011508.1), BALB/C [20], C57BL/6 [28], and NOD [28] mouse, as well as CD47 from human (NP_001768.1), porcine (ABW24514.1), and mouse (BAA25401.1, XP_006521871.1) were obtained from the NCBI database and aligned with Clustal Omega alignment tool [29].

BLASTP was used to determine percent identity for CD47 amino acid sequences between species [30].

Preparation of labeled red blood cells for phagocytosis assays

To serve as a source of cells in phagocytosis assays, red blood cells (RBCs) were isolated from pigs, humans, and mice. Whole blood was collected into a heparinized vacutainer tube (BD) and was diluted 1:100 into complete RPMI media and was used as a source of RBCs. The RBCs were then counted using BD counting beads and a flow cytometer.

After counting, RBCs were stained with PKH67 fluorescent dye and counted again to verify positive PKH67 staining.

Monocyte preparation for phagocytosis assays

PBMCs were plated into tissue culture treated flasks and monocytes were allowed to adhere overnight at 37°C. Non-adherent PBMCs were removed, and remaining monocytes were washed with HBSS. Monocytes were then trypsinized with 0.25% HyClone trypsin

(Fisher Scientific, Hampton, NH, USA) with 0.02% EDTA and were released, washed,

66 enumerated by flow cytometry with BD counting beads, and seeded at 105 cells per well in a

24 well plate. Monocytes were incubated over night at 37°C in complete RPMI to adhere.

After incubation, additional fresh media was added to each well.

Labeled target RBCs were added to 105 monocytes at ratios of 1:20, 1:40, and 1:60 and incubated at 37° C for 6 hours. Media with RBCs was removed, and remaining RBCs were lysed with ammonium chloride lysing solution; therefore removing any non-phagocytosed

RBCs from the surface of the monocyte. Monocytes were trypsinized, fixed, and fluorescence was acquired on a BD Biosciences FACSCanto II flow cytometer to evaluate internalized RBCs. The percentage of PKH67 positive monocytes was determined for each sample. A total of six pigs (3 SCID and 3 non-SCID) and were used in two independent experiments. The two experimental groups contained piglets from three separate litters.

CD47 blocking assay

PKH67-stained human RBCs were incubated with either 0.5 µg of anti-CD47 clone

B6H12.2 (eBioscience, San Diego, CA, USA), anti-CD47 clone 2D3 (eBioscience), or mouse

IgG1 isotype control antibody (eBioscience) per 106 RBCs for 30 minutes at room temperature. The B6H12 binds to human CD47 on an epitope which blocks its ability to bind to human SIRPA [31], while 2D3 binds to human CD47, but does not block the interaction with human SIRPA. The 2D3 antibody acts as an opsonization control to show that the presence of the antibody on the surface of the cell does not contribute increases in phagocytosis. After the incubation period, washed RBCs were then added to adhered monocytes at an effector to target ratio of 1:10. Similar binding between B6H12 and 2D3 was verified with a goat anti-mouse IgG1 PE secondary (Southern Biotech) (Supplemental

Figure 3.2). A total of seven pigs (2 SCID and 5 non-SCID) and two humans were used in three independent experiments. The three experimental groups contained piglets from two separate litters.

Statistical Analysis

To compare levels of phagocytosis between RBCs from human, pig, and mouse

(Figure 3.3) and to evaluate the ability of different monoclonal antibodies to human CD47 to inhibit phagocytosis of human RBCs (Figure 3.4 A, B), a multiple linear regression model was assessed. P values are reported from a type III analysis of variance (ANOVA) with fixed effects of target RBC species (Figure 3.3) or antibody treatment (Figure 3.4) using R [32].

References

1. SEOK J, WARREN HS, CUENCA AG et al. Genomic responses in mouse models poorly mimic human inflammatory diseases. Proc Natl Acad Sci U S A 2013; 110: 3507–3512.

2. MUSTHER H, OLIVARES-MORALES A, HATLEY OJD, LIU B, ROSTAMI HODJEGAN A. Animal versus human oral drug bioavailability: Do they correlate? Eur J Pharm Sci 2014; 57: 280–291.

3. DAWSON HD, LOVELAND JE, PASCAL G et al. Structural and functional annotation of the porcine immunome. BMC Genomics 2013; 14: 332.

4. WATSON AL, CARLSON DF, LARGAESPADA DA, HACKETT PB, FAHRENKRUG SC. Engineered Swine Models of Cancer. Front Genet 2016; 7: 78.

5. ROTH JA, TUGGLE CK. Livestock models in translational medicine. ILAR journal 56 2015 1–6.

6. FAIRBAIRN L, KAPETANOVIC R, SESTER DP, HUME DA. The mononuclear phagocyte system of the pig as a model for understanding human innate immunity and disease. J Leukoc Biol 2011; 89: 855–871.

7. MEURENS F, SUMMERFIELD A, NAUWYNCK H, SAIF L, GERDTS V. The pig: a model for human infectious diseases. Trends Microbiol 2012; 20: 50–57.

8. WAIDE EH, DEKKERS JCM, ROSS JW et al. Not All SCID Pigs Are Created Equally: Two Independent Mutations in theArtemisGene Cause SCID in Pigs. J Immunol 2015; 195: 3171 LP-3179.

9. SUZUKI S, IWAMOTO M, SAITO Y et al. Il2rg gene-targeted severe combined immunodeficiency pigs. Cell Stem Cell 2012; 10: 753–758.

10. KANG J-T, CHO B, RYU J et al. Biallelic modification of IL2RG leads to severe combined immunodeficiency in pigs. Reprod Biol Endocrinol 2016; 14: 74.

11. SUZUKI S, IWAMOTO M, HASHIMOTO M et al. Generation and characterization of RAG2 knockout pigs as animal model for severe combined immunodeficiency. Vet Immunol Immunopathol 2016; 178: 37–49.

12. LEI S, RYU J, WEN K et al. Increased and prolonged human norovirus infection in RAG2/IL2RG deficient gnotobiotic pigs with severe combined immunodeficiency. Sci Rep 2016; 6: 25222.

13. BREHM MA, SHULTZ LD, GREINER DL. Humanized Mouse Models to Study Human Diseases. Curr Opin Endocrinol Diabetes Obes 2010; 17: 120–125.

14. WALSH N, KENNEY L, JANGALWE S et al. Humanized mouse models of clinical disease. Annu Rev Pathol 2017; 12: 187–215.

15. TAKENAKA K, PRASOLAVA TK, WANG JCY et al. Polymorphism in Sirpa modulates engraftment of human hematopoietic stem cells. Nat Immunol 2007; 8: 1313–1323.

16. JIANG P, LAGENAUR CF, NARAYANAN V. Integrin-associated protein is a ligand for the P84 neural adhesion molecule. J Biol Chem 1999; 274: 559–562.

17. BARCLAY AN. Signal regulatory protein alpha (SIRPalpha)/CD47 interaction and function. Curr Opin Immunol 2009; 21: 47–52.

18. BARCLAY AN, VAN DEN BERG TK. The interaction between signal regulatory protein alpha (SIRPalpha) and CD47: structure, function, and therapeutic target. Annu Rev Immunol 2014; 32: 25–50.

19. TAKIZAWA H, MANZ MG. Macrophage tolerance: CD47-SIRP-alpha-mediated signals matter. Nature immunology 8 2007 1287–1289.

20. IWAMOTO C, TAKENAKA K, URATA S et al. The BALB/c-specific polymorphic SIRPA enhances its affinity for human CD47, inhibiting phagocytosis against human cells to promote xenogeneic engraftment. Exp Hematol 2014; 42: 163–171.e1.

21. YAMAUCHI T, TAKENAKA K, URATA S et al. Polymorphic Sirpa is the genetic determinant for NOD-based mouse lines to achieve efficient human cell engraftment. Blood 2013; 121: 1316–1325.

22. JUNG CJ, MENORET S, BRUSSELLE L et al. Comparative Analysis of piggyBac, CRISPR/Cas9 and TALEN Mediated BAC Transgenesis in the Zygote for the Generation of Humanized SIRPA Rats. Sci Rep 2016; 6: 31455.

23. STROWIG T, RONGVAUX A, RATHINAM C et al. Transgenic expression of human signal regulatory protein alpha in Rag2-/-gamma(c)-/- mice improves engraftment of human hematopoietic cells in humanized mice. Proc Natl Acad Sci U S A 2011; 108: 13218– 13223.

24. SUBRAMANIAN S, PARTHASARATHY R, SEN S, BODER ET, DISCHER DE. Species- and cell type- specific interactions between CD47 and human SIRPalpha. Blood 2006; 107: 2548– 2556.

25. IDE K, WANG H, TAHARA H et al. Role for CD47-SIRPalpha signaling in xenograft rejection by macrophages. Proc Natl Acad Sci U S A 2007; 104: 5062–5066.

26. YAN J-J, KOO TY, LEE H-S et al. Role of Human CD200 Overexpression in Pig-to-Human Xenogeneic Immune Response Compared With Human CD47 Overexpression. Transplantation 2018; 102: 406–416.

27. POWELL EJ, CUNNICK JE, KNETTER SM et al. NK cells are intrinsically functional in pigs with Severe Combined Immunodeficiency (SCID) caused by spontaneous mutations in the Artemis gene. Vet Immunol Immunopathol 2016; 175: 1–6.

28. KWONG LS, BROWN MH, BARCLAY AN, HATHERLEY D. Signal-regulatory protein α from the NOD mouse binds human CD47 with an exceptionally high affinity – implications for engraftment of human cells. Immunology 2014; 143: 61–67.

29. SIEVERS F, WILM A, DINEEN D et al. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol 2011; 7: 539.

30. ALTSCHUL SF, MADDEN TL, SCHAFFER AA et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 1997; 25: 3389– 3402.

31. PIETSCH EC, DONG J, CARDOSO R et al. Anti-leukemic activity and tolerability of anti- human CD47 monoclonal antibodies. Blood Cancer J 2017; 7: e536.

32. TEAM RS. Integrated development for R. 2015.

33. HATHERLEY D, GRAHAM SC, TURNER J et al. Paired receptor specificity explained by structures of signal regulatory proteins alone and complexed with CD47. Mol Cell 2008; 31: 266–277.

34. LEE WY, WEBER DA, LAUR O et al. Novel structural determinants on SIRP alpha that mediate binding to CD47. J Immunol 2007; 179: 7741–7750.

35. LIU Y, TONG Q, ZHOU Y et al. Functional elements on SIRPalpha IgV domain mediate cell surface binding to CD47. J Mol Biol 2007; 365: 680–693.

36. HATHERLEY D, HARLOS K, DUNLOP DC, STUART DI, BARCLAY AN. The structure of the macrophage signal regulatory protein alpha (SIRPalpha) inhibitory receptor reveals a binding face reminiscent of that used by T cell receptors. J Biol Chem 2007; 282: 14567–14575.

37. BURGER P, HILARIUS-STOKMAN P, DE KORTE D, VAN DEN BERG TK, VAN BRUGGEN R. CD47 functions as a molecular switch for erythrocyte phagocytosis. Blood 2012; 119: 5512– 5521.

38. SOSALE NG, ROUHIPARKOUHI T, BRADSHAW AM et al. Cell rigidity and shape override CD47’s “self”-signaling in phagocytosis by hyperactivating myosin-II. Blood 2015; 125: 542– 552.

39. OLDENBORG PA, ZHELEZNYAK A, FANG YF et al. Role of CD47 as a marker of self on red blood cells. Science 2000; 288: 2051–2054.

40. TSENG D, VOLKMER J-P, WILLINGHAM SB et al. Anti-CD47 antibody-mediated phagocytosis of cancer by macrophages primes an effective antitumor T-cell response. Proc Natl Acad Sci U S A 2013; 110: 11103–11108.

41. MAJETI R, CHAO MP, ALIZADEH AA et al. CD47 is an adverse prognostic factor and therapeutic antibody target on human acute myeloid leukemia stem cells. Cell 2009; 138: 286–299.

42. CHAO MP, ALIZADEH AA, TANG C et al. Therapeutic antibody targeting of CD47 eliminates human acute lymphoblastic leukemia. Cancer Res 2011; 71: 1374–1384.

43. CHAO MP, ALIZADEH AA, TANG C et al. Anti-CD47 antibody synergizes with rituximab to promote phagocytosis and eradicate non-Hodgkin lymphoma. Cell 2010; 142: 699– 713.

44. WILLINGHAM SB, VOLKMER J-P, GENTLES AJ et al. The CD47-signal regulatory protein alpha (SIRPa) interaction is a therapeutic target for human solid tumors. Proc Natl Acad Sci U S A 2012; 109: 6662–6667.

45. BURLAK C, PARIS LL, CHIHARA RK et al. The fate of human platelets perfused through the pig liver: implications for xenotransplantation. Xenotransplantation 2010; 17: 350– 361.

46. PARIS LL, CHIHARA RK, SIDNER RA, TECTOR AJ, BURLAK C. Differences in human and porcine platelet oligosaccharides may influence phagocytosis by liver sinusoidal cells in vitro. Xenotransplantation 2012; 19: 31–39.

47. CHEN B, FAN W, ZOU J et al. Complement Depletion Improves Human Red Blood Cell Reconstitution in Immunodeficient Mice. Stem cell reports 2017; 9: 1034–1042.

48. HU Z, VAN ROOIJEN N, YANG Y-G. Macrophages prevent human red blood cell reconstitution in immunodeficient mice. Blood 2011; 118: 5938–5946.

49. BASEL MT, BALIVADA S, BECK AP et al. Human Xenografts Are Not Rejected in a Naturally Occurring Immunodeficient Porcine Line: A Human Tumor Model in Pigs. Biores Open Access 2012; 1: 63–68.

50. POWELL EJ, GRAHAM J, ELLINWOOD NM et al. T Cell Lymphoma and Leukemia in Severe Combined Immunodeficiency Pigs following Bone Marrow Transplantation: A Case Report. Front Immunol 2017; 8: 813.

51. RAJAO DS, LOVING CL, WAIDE EH et al. Pigs with Severe Combined Immunodeficiency Are Impaired in Controlling Influenza A Virus Infection. J Innate Immun 2017; 9: 193–202.

52. LEE K, KWON D-N, EZASHI T et al. Engraftment of human iPS cells and allogeneic porcine cells into pigs with inactivated RAG2& and accompanying severe combined immunodeficiency. Proc Natl Acad Sci 2014; 111: 7260 LP-7265.

53. POWELL EJ, CUNNICK JE, TUGGLE CK. SCID pigs: An emerging large animal NK model. J rare Dis Res Treat 2017; 2: 1–6.

54. POWELL EJ, CHARLEY S, BOETTCHER AN et al. Creating effective biocontainment facilities and maintenance protocols for raising specific pathogen-free, severe combined immunodeficient (SCID) pigs. Lab Anim 2018; 23677217750691.

55. FUJIKI Y, FUKAWA K, KAMEYAMA K et al. Successful multilineage engraftment of human cord blood cells in pigs after in utero transplantation. Transplantation 2003; 75: 916– 922.

56. GOODRICH AD, VARAIN NM, JEANBLANC CM et al. Influence of a dual-injection regimen, plerixafor and CXCR4 on in utero hematopoietic stem cell transplantation and engraftment with use of the sheep model. Cytotherapy 2014; 16: 1280–1293.

57. OGLE BM, KNUDSEN BE, NISHITAI R, OGATA K, PLATT JL. Toward development and production of human T cells in swine for potential use in adoptive T cell immunotherapy. Tissue Eng Part A 2009; 15: 1031–1040.

58. KALSCHEUER H, ONOE T, DAHMANI A et al. Xenograft tolerance and immune function of human T cells developing in pig thymus xenografts. J Immunol 2014; 192: 3442–3450.

59. DAWSON H. Comparative assesment of the pig, mouse, and human genomes: A structural and functional analysis of genes involved in immunity. minipig Biomed Res 2011; 321–341.

Figures

Figure 3.1. Multi-species alignment of SIRPA and CD47

(A) Sequence alignment of human (NP_001768.1), porcine (ABW24514.1), and mouse (BAA25401.1, XP_006521871.1) CD47 IgSF domain. Blue highlighted residues indicate amino acids in human and mouse sequences that are different from pig. Green and red highlighted residues are amino acids that are different from pig in mouse and human sequences, respectively. (B) Sequence alignment of human (CAA71403.1, NP_542970), porcine (NP_001011508.1), BALB/c [20], C57BL/6 [28], and NOD [28] mouse SIRPA IgV domain. Green and yellow highlighted residues indicate amino acids on human SIRPA that are deemed critical for binding human CD47 through mutagenesis experiments [34,35,36] with green highlighted showing conserved and yellow showing species specific amino acids. Residues in blue are those that differ between C57BL/6 and NOD that both human, porcine, BALB/c (only H59 and T91) SIRPA contain. Most importantly the SE residues only present in BALB/c and C57BL/6 are shown to block human CD47 binding [28].

Figure 3.2. Porcine monocytes bind to recombinant hCD47 in vitro

(A) PBMCs from human subjects (H), non-SCID (NS), and SCID (S) pigs were isolated from whole blood and stained for SIRPA expression and hCD47-Fc binding. PBMCs were gated on monocyte populations and analyzed. Grey histograms show isotype or fluorophore controls. The top row shows samples with high binding to hCD47-Fc, and the bottom row shows low binding for each sample type. Three independent experiments were run (n= 3 S pigs, 3 NS pigs, 4 humans). Images were generated in FlowJo. (B) Percentage and MFI values for SIRPA and hCD47-Fc staining are shown for all stained samples.

Figure 3.3. Porcine monocytes phagocytose human and pig RBCs at low levels

(A) Percent phagocytic monocytes from SCID (S) (open symbol) and non-SCID (NS) (filled symbol) pigs incubated with fluorescently labeled human (diamond), pig (square), and mouse (triangle) RBCs at ratios of 1:20, 1:40, and 1:60 are shown. The average phagocytosis for both SCID and non-SCID pigs are shown in grey. Results from two independent experiments are shown (n= 3 S pigs, 3 NS pigs). * p <0.001. (B) Fluorescence intensity within monocytes was assessed by flow cytometry as a measure for phagocytosis. Phagocytic monocytes were characterized by positive fluorescent signal by flow cytometry for each animal. Fluorescence intensity for monocytes not incubated with any RBC is shown as the black outlined histogram; the same control histogram is on all nine plots. Histograms shaded in grey are monocytes after exposure to the different species and amounts of RBC. Images were generated in FlowJo.

Figure 3.4. Porcine monocyte phagocytosis of human red blood cells is inhibited by SIRPA- CD47 interaction

(A) Schematic of cells and antibodies used. Phagocytosis was only induced between human RBC and porcine monocytes when human RBC were incubated with anti-human CD47 blocking antibody B6H12, showing that human CD47 binds to porcine SIRPA to inhibit phagocytosis. (B) Human monocyte phagocytosis of human RBCs incubated with B6H12, 2D3, or mouse IgG control antibodies (n=2). (C) Porcine monocyte phagocytosis of human RBCs (n=2 S pigs, 5 NS pigs) incubated with the same antibodies. Percent phagocytic monocytes are shown for both human and porcine monocytes. Results from four independent experiments shown. Error bars represent standard error. * p < 0.001

Supplemental Figures

Figure 3.S1. Anti-Sirpa antibodies decrease hCD47-Fc binding

Plots and statistics shown are gated on monocytes from either human or pig samples. (A) Human and porcine monocytes were incubate with either IgG2b isotype/fluorophore and PeCy5 fluorophore controls or species specific anti-SIRPA antibodies and hCD47-Fc. Isotype and fluorophore controls were used to gate for both species. For both porcine and human monocytes, the SIRPA+ population is also hCD47-Fc positive. However, when cells were stained with just hCD47-Fc alone, without the anti-SIRPA antibodies, the percentage of hCD47-Fc positive cells was increased. (B) MFI values for hCD47-Fc binding (or PeCy5 controls) are shown. For the two pigs and three human samples tested, the MFI of hCD47-Fc was decreased when anti-SIRPA antibodies were present, indicating that the anti-SIRPA antibodies were blocking the ability of hCD47-Fc to bind to the monocytes.

Figure 3.S2. B6H12 and 2D3 binding to human RBC.

In order to verify that the same amount of B6H12 and 2D3 antibodies were bound on the surface of human RBC, 106 hRBCs were stained with 0.5 μg of each antibody. An IgG1 isotype control was also used, and is shown as a light grey histogram. The fluorescence intensity for B6H12 and 2D3 staining was highly similar, indicating similar levels of antibody on the surface of the cell.

CHAPTER 4

A COMPREHENSIVE PROTOCOL FOR LAPAROTOMY IN SWINE TO FACILITATE ULTRASOUND-GUIDED INJECTION INTO THE FETAL INTRAPERITONEAL SPACE

Accepted for publication Comparative Medicine on November 8, 2018. Slated to be published in April, 2019.

Adeline Boettcher1 BS., Amanda Ahrens2 DVM., Sara Charley1 BS., and Christopher Tuggle1 PhD. ______

1Iowa State University, Department of Animal Science, Ames, Iowa 2Iowa State University, Laboratory Animal Research, Ames, Iowa

Author Contributions

AB designed study and wrote manuscript. AA designed and performed surgeries, wrote section describing surgery protocol, and edited manuscript. SC helped design study. CT designed study and edited manuscript.

Abstract

Swine are a commonly used animal model for biomedical research. One such research application for swine models is the study of human or pig cells injected in utero into the fetal liver (FL) or intraperitoneal space (IP). In utero injections can be accomplished via laparotomy procedures in pregnant swine. In this study we aimed to establish comprehensive laparotomy protocols for ultrasound guided injections into fetuses. Two pregnant gilts, with a total of sixteen fetuses, underwent laparotomy procedures at 41 and

42 days of gestation. Half of the fetuses were injected in either the FL or IP space with saline and titanium wire for radiographic imaging after birth. After the laparotomy and fetal injections, both gilts maintained pregnancy through gestation and initiated labor at full term.

Of the sixteen initial fetuses, twelve were liveborn, two were stillborn, and two were mummies. A total of seven fetuses were known to have been injected with wire during the

80 surgery between the two litters. After farrowing, piglets were radiographed, and six piglets were identified to have wire within the abdominal space. Livers were dissected, and additional radiographs were obtained, and it was determined that one piglet had wire within the liver, while the other five had wire within the IP space. In all, we describe in-depth laparotomy surgery protocols, ultrasound guided injection of saline and titanium wire into the FL or IP space, post-operative monitoring protocols, and information on radiographic detection of titanium wire after piglet birth. These protocols can be followed by other research groups intending to inject fetal piglets in either the IP space or FL with cells of interest.

Introduction

Swine are a popular animal model for biomedical research. Many research groups use pigs for cancer 16,17, cardiovascular 21, infectious disease research 10, and other areas. An application of swine models that is gaining interest is the ability to study human immune cell function and de novo development of human cells, also known as “humanization”, in pigs.

Previous humanization studies in swine have been performed via in utero injection of human hematopoietic stem cells (HSC) into the fetal intraperitoneal space (IP) 4,9,12,13. Injections typically occur around 40 days of gestation, as this is the time period when hematopoiesis is occurring in the swine fetal liver 18.

Fetal piglets can be injected in the IP space either through percutaneous (PC) injection through the dam’s abdomen into the uterus, or by laparotomy and injected through the uterine wall. Fujiki et al (2003) injected human HSC via ultrasound guided PC injection, as laparotomy procedures resulted in high instances of abortion in their study.

Fetuses from this study were also injected with small titanium wires so that injection site could be determined later by radiographic analysis 4. More recent human HSC injections in swine have utilized laparotomy procedures for ultrasound guided fetal IP injections 9,12,13. In addition, laparotomy techniques are utilized for the injection of human liver cells into swine fetal livers 3. Laparotomy procedures allow for more precise aiming into the fetuses due to closer contact to the injection site.

Recently, pigs with severe combined immunodeficiency (SCID) are an emerging animal model 6,7,14,19,20,23,24. SCID pigs are a particularly important biomedical model to develop due to their ability to accept human xenografts, including pluripotent stem cells 8 and cancer cells 2. It is of interest to the biomedical field to generate humanized SCID pig models, as well as to produce SCID pig breeders by porcine HSC transplantation for the propagation of such animals. HSC transplantation can be performed by ultrasound guided injection into the fetal IP space or fetal liver (FL) for the engraftment of human or porcine

HSC. In addition, an interesting question to address is if HSC engraftment levels differ if cells are injected into the fetal IP space or liver. Titanium wire injection into these locations can be utilized for radiographic identification after piglet birth as analysis of cell engraftment takes place.

There are research studies that outline brief descriptions of swine laparotomies, however there are no publications dedicated solely to protocols for ultrasound guided fetal injections via midline laparotomies in mid-gestation swine. Here we detail safe and successful surgical procedures, post-operative monitoring protocols, attempted differential

IP and FL aiming, and radiograph results from farrowed piglets. We utilized injection of saline

82 as a model for a cellular suspension, as well as titanium wire for radiographic analysis. These protocols will be of value for veterinary surgeons working with swine in biomedical settings to help minimize losses, morbidity, and animal numbers. With this work we aim to provide protocols that can be referenced for consistency across different groups performing swine laparotomies for the injection of cells of interest into fetal piglets.

Results

Ultrasound guided injection into intraperitoneal space and fetal liver

One goal we aimed to accomplish with injecting the fetuses was to determine the feasibility of specifically aiming in the fetal intraperitoneal space or liver. To achieve this goal, fetuses were injected with a titanium wire at the site of saline injection such that x-ray analysis could be performed later to determine injection location. We aimed for fetal IP space injections in gilt 31-7 and FL injections in 34-8. We decided to only inject half of each litter, as in case there was fetal death caused by injections, the pregnancy would likely be maintained by surviving (non-injected) piglets. All fetuses are listed in Table 4.2.

Gilt 31-7 had a total of ten fetuses, with four in the left horn and six in the right horn.

A total of five piglets were attempted to be injected with wire and saline. Saline and wire were injected into fetuses A, C, E, G, and I. However, we observed the wire came out of fetus

A externally from the uterus immediately after the injection, thus fetus A is reported as saline injected only. We did not attempt to inject another wire into fetus A. Of the other four fetuses, based on observations from ultrasound viewing at the time of injection, we anticipated that we injected wire within the IP space of three fetuses (C, G, and I), and one within the FL (E). Gilt 34-8 had a total of six fetuses, with three in each horn. A total of three

83 fetuses were injected with wire and saline. Of the three fetuses, we anticipated that we injected wire within the FL for two fetuses (L and N) and one in the IP space (P) (Table 4.2).

Post-operative monitoring

Another important aspect to this surgery was to ensure that gilts did not succumb to infection or abort fetuses after the surgery was performed. Gilts were closely monitored for the 14 days following the surgery. Neither animal presented with a fever or vaginal discharge during this time period, nor for the rest of gestation. One gilt (34-8) showed moderate hind leg stiffness 2 days post-surgery. Meloxicam was continued an additional 2 days; no pain was observed following the additional meloxicam administration or the discontinuation of meloxicam. We observed no other signs of pain in the gilts; they presented with normal appetites, good locomotion, and attitudes. Bandages were replaced if coming loose or if incisional drainage was noted. Bandages were removed from both gilts one week after surgery. Minimal redness and swelling were observed around the incision sites. Matrix was administered daily, in the morning, to help prevent abortions from occurring. Both animals were moved to a farrowing crate at gestational day 109 before going into labor at full term.

Farrowing and radiographic identification of wire location post birth

It was also imperative to determine if injected fetuses could develop normally and to gestate to term after laparotomy procedures. Piglets IDs, as well as birthweights are listed in

Table 4.3. The order of the piglets does not correspond to the order of the fetuses in Table

4.2. As the piglets were farrowed, we did not have a way to determine piglet location in the uterus as they were born.

Gilt 31-7 (litter 317) farrowed nine live and one fully developed stillborn piglet with no complications. Gilt 34-8 (litter 348) required a Cesarean section (C-section) after the first three piglets were manually assisted with delivery due to uterine inertia causing dystocia.

The C-section took place approximately 5 hours after the previous piglet was delivered (24 hours after first milk streaming was observed). The C-section was performed by euthanizing the gilt and exposing the uterus to retrieve any other piglets that were present. One fully developed stillborn (348-04) and one mummy (348-06) were found. The sixth known piglet

(348-05) was not found within the uterus; mummy was designated for this pig. We do not suspect the uterine inertia was due to the laparotomy procedures, but rather due to piglet malposition in the birth canal and resultant unproductive contractions. Piglets from the 348 litter were cross fostered on sow 31-7 for the duration of the study.

Piglets were euthanized at 2 (litter 317) or 3 (litter 348) days of age at which point they were radiographed for the detection of wires. From the surgeries, we expected that seven of the total sixteen piglets (Table 4.2) would have wires in either the liver or IP space.

From initial lateral and abdominal x-rays, we found a total of six piglets with wires (Table

4.3). It is likely that the wire from the seventh piglet was lost in the uterine wall during injections; we do not know specifically which fetus from gilt 31-7 wire was lost from. All wires appeared to be in the abdominal cavity of the piglets. Mummy 348-06 was also found to have a wire; although due to the small size it was difficult to distinguish where the wire was located, so the wire location was undetermined. Additionally, because we identified all three injected animals in the 348 litter by finding the three contained wires, mummy 348-05 was not directly due to injection trauma.

After initial x-rays, livers were removed from all piglets and were x-rayed separately for wire detection. We found that one piglet (317-01) had a wire within the liver (Figure 4.2).

All other piglets with a wire did not have a wire in the liver, which suggested that they contained wire within the intraperitoneal space. Examples of piglets with wire in liver (317-

01) and IP (317-08 and 348-03) are shown in Figure 4.3. Of the seven fetuses that were injected with wire, based on observations during surgery, we anticipated that three of these fetuses were injected in the liver. After radiographing, only one piglet was found to successfully have been injected in the liver, while all others with wire were injected IP.

Discussion

Previous work is reported on the use of laparotomies for injection of human stem cells and human liver cells into fetal piglets 3,4,9,12,13. However, a comprehensive and detailed account of surgical procedures, post-operative care, as well as FL and IP aiming has not been previously published. Here we report the successful injection of piglets within the IP space after laparotomy procedures on two pregnant gilts.

Laparotomies as alternative to abdominal injections

There are two primary methods for the delivery of cells into fetal piglets. One method involves the insertion of a needle through the abdominal wall and uterus 1, while the other involves laparotomy procedures to directly inject through the uterine wall 3,9,12,13.

Although injection through the skin is less invasive to the sow, manipulation of the uterus aids in aiming for specific locations within the fetus. Additionally, with such proximity when injecting through the uterine wall, vital fetal organs can be avoided during injection.

Furthermore, injection through the dam’s skin would require the use of a larger gauge

86 needle, which may cause more trauma to the fetuses; a smaller gauge needle can be used in laparotomies.

These laparotomy procedures can also be approached by making a paramammary incision. We chose to perform our laparotomies with a ventral midline incision for a variety of reasons. Such incision location allows for better exposure to both horns of the uterus, as opposed to the paramammary approach, in which incision would be closer to one horn than the other. Also, the midline incision goes through the linea alba, which can promote better healing as opposed to going through muscle tissue. By covering the incision with the Ioban bandage and housing the animals on solid flooring without bedding, the increased risk of contamination with a midline incision is mitigated. As gilts were used for the surgery, the mammary tissue that may present a problem for midline incisions in sows was not encountered.

Methods for wire detection in the abdominal cavity

In these procedures, it was important to establish methods for wire injections so that injection site could be determined. We designed a copper wire plunger system for our fetal injections that was used in a 22G needle with a 0.25 mm diameter titanium wire. A 22G spinal needle with a stylet could also be used for titanium wire injections.

In our study, we radiographed piglets after they were born as opposed to radiographing the pregnant gilts immediately after surgery. There may be limitations in radiographing gilts or sows after surgery depending on equipment available at different facilities. We additionally decided to radiograph piglets after birth, as this would mimic the procedure that would be followed if piglets were actually injected with cells. Between

87 surgery and the end of gestation, a total of approximately 75 days elapsed, so it is possible that wires could move in the fetus to a different site. Radiographs or a computerized tomography image could be performed on the gilt or sow after surgery, but matching fetuses seen in utero with farrowed piglets may be difficult. If C-sections are performed, the position of piglets could be matched with the location of which fetuses were injected.

Abortion and fetal death prevention

Matrix (Altrenogest) has historically been used to synchronize estrous in swine.

During pregnancy, the body naturally produces progesterone. Altrenogest is a synthetic progestin and can therefore be used to help maintain pregnancies that may otherwise have been aborted due to stress of the procedure. Altrenogest has been used as a treatment in dolphins 15 and mares 11 to prevent abortions.

During surgery it is important to limit manipulation of the fetuses and uterus.

Additionally, numerous needle punctures should be avoided on a single fetus as to reduce the likelihood of blunt trauma to any internal organs. Together, these practices can help reduce fetal and uterine stress. We demonstrated herein that a single injection using a 22G needle caused minimal trauma to the fetuses, as 5/6 titanium wire-injected identified piglets were fully developed at gestational end.

Biomedical model development in swine

In all, we aimed to develop procedures that could be utilized for cell injections into fetal piglets. As swine models develop, whether immunocompetent or immunocompromised, they will continue to be used for translational research relevant to human health. One such application for the procedures described here is for the injection of

88 human HSCs into SCID pigs for the development of a humanized model. In order to accomplish this task, it is critical to develop protocols that would ensure for viability of all pregnant females and piglets during and after surgical procedures. The descriptions outlined here can be used as a guideline for future research requiring laparotomies and fetal injections in swine.

Materials and Methods

All protocols and methods were approved by Iowa State University’s (ISU)

Institutional Animal Care and Use Committee. All protocols and procedures performed were in accordance with The Guide for the Care and Use of Laboratory Animals.

Animals

Two commercial crossbred (Yorkshire and Duroc) gilts (referred to as 31-7 and 34-8 herein) of approximately 1 year of age were bred at a university associated facility. Gilt 31-7 weighed 167 kg and 34-8 weighed 182 kg at the time of surgery. Gilts were pregnancy checked 28 days after breeding and were tested for porcine reproductive and respiratory syndrome virus (PRRSv) and porcine circovirus type 2 (PCV2) before being transferred to the

ISU Laboratory Animal Research (LAR) center at gestational day 40. Both gilts were negative for PRRSv and PCV2 by PCR. Gilt 31-7 underwent surgery at gestational day 41, while gilt 34-

8 underwent surgery at gestational day 42.

Gilts were housed in clean conventional housing rooms at ISU LAR after surgery and through the rest of gestation. Specifically, the gilts were singly housed with nose-to-nose contact with each other on epoxy coated flooring and mats covering part of the floor.

Animals were given continual access to water, limit fed a custom swine gestation diet free of

89 dried distiller’s grains (Heartland Co-op, Prairie City, IA) with chopped straw and timothy hay cubes added. Rooms were maintained between 68 and 72 F. At gestational day 109 gilts were moved to farrowing decks, with plastisol-coated metal grate flooring; room temperature was increased to 73-75 F. Diet was changed from gestation to lactation following farrowing. Heat lamps were placed on the sides of the farrowing crates to provide additional warmth for the piglets. All animals were checked every 12 hours.

Laparotomy surgery protocol

Pregnant gilts undergoing laparotomy procedures were started on 15 mg of Matrix

(Altrenogest) (Merck Animal Health, Madison, NJ) in morning feed starting 1 day before surgery (dosage independent of weight). Both gilts were maintained on Matrix through gestational day 113, which was given at approximately the same time every morning. Feed was withheld from both animals 12 hours prior to surgery. On the morning of surgery,

Matrix was given orally, instead of in feed.

Prior to anesthesia, gilts were given 0.01 mg/kg Glycopyrrolate (West-Ward

Pharmaceuticals, Eatontown, NJ) by intramuscular injection. Gilts were then anesthetized with 5 mg/kg Telazol (Zoetis, Parsippany, NJ) and 2mg/kg Xylazine (Akorn, Lake Forest, IL) by intramuscular injection. After gilts were anesthetized, hair was clipped from the lower abdomen, surgical site was washed, and the gilts were moved to a surgical table and placed in dorsal recumbency. Gilts were then intubated and started on isofluorane (2-5%) and oxygen (2.5 L/min). A 20G IV catheter was placed in the ear vein. Lactated Ringer’s Solution

(Hospira, Lake Forest, IL) was administered intravenously at a constant rate infusion for a total of 0.83-1.25 L/hour. Cefazolin (West-Ward Pharmaceuticals, Eatontown, NJ, USA) was

90 administered intravenously via the catheter starting within 10 minutes of the initial incision.

A pre-surgical scrub was performed with chlorohexidine (Phoenix, St. Joseph, MO, USA).

Sterile material drapes and Ioban (3M, Maplewood, MN) were used to cover the surgical field.

A ventral midline incision from the caudal most nipple extending cranially to the caudal aspect of the umbilicus through the linea alba into the peritoneal cavity was made by sharp dissection. The left horn was exteriorized first, fetuses were visualized by ultrasound and a sterile gentian violet ink marker (Medline Industries, Dubuque, IA) was used to physically mark the outside of the uterus for each fetus (Figure 4.1A). Every other fetus in the horn was injected (See following section Ultrasound guidance of injection of saline and wire into intraperitoneal space or fetal liver for injection specifics). The left horn was then replaced into the abdominal cavity. The same procedure was then performed on the right horn.

Both uterine horns and abdominal cavity were lavaged with a total of 500 mL of

Lactated Ringer’s Solution. The abdominal cavity was closed at the linea alba in a simple continuous pattern (1 Polydioxanone) with an additional overlying cruciate pattern (1

Polydioxanone). The subcutaneous tissue was closed with a simple continuous pattern (0

Polyglycolic Acid). The skin was closed in a buried subcuticular pattern (0 Polyglycolic Acid).

The incision was then covered with sterile gauze and was held in place with an Ioban drape.

A list of all drugs, medications, and dosages are found in Table 4.1.

Ultrasound guidance of injection of saline and wire into intraperitoneal space or fetal liver

A ZONARE ultrasound system with a L14-5sp intraoperative linear array transducer

(10 MHz) was used to identify fetuses and guide injections. A 2 mm long titanium wire (0.25 mm diameter) was injected into the IP or FL space by use of 22G needle and a copper wire plunger made from multiple copper speaker wires. Copper wire plungers were preloaded into 22G needles and autoclaved in sterilized pouches along pre-cut titanium wires.

As described above, the uterine horns were imaged using ultrasound to identify the number of fetuses present and were marked. Every other fetus was injected in each horn

(Figure 4.1B). Ultrasound guidance was used to identify either the fetal liver (Figure 4.1C) or intraperitoneal space. Once these areas were identified, titanium wire was loaded into the

22G needle (Figure 4.1D) with sterilized needle nosed forceps. The needle was then aimed for either FL or IP by keeping the needle parallel to the ultrasound transducer to allow for visualization. Once the needle was inserted in the proper location, the copper wire plunger was moved forward to push the titanium wire out and into the fetus. The copper wire was then removed from the needle, while keeping the needle in the same place in the fetus. A 1 mL syringe with 0.1 mL saline was inserted into the needle and this solution was injected into the fetus (Figure 4.1B).

Post-operative care of pregnant females

After the Ioban bandage was placed over the incision, animals received 0.18 mg/kg

Buprenophine- Sustained Release (ZooPharm, Windsor, CO) subcutaneously (SQ).

Buprenophine is shown to reach therapeutic levels in the serum 30 minutes after administration5,22. Then 5 mg/kg Ceftiofur Crystalline Free Acid (Excede) (Zoetis, Parsippany,

NJ) was administered through intramuscular injection. A dose of 0.3 mg/kg of meloxicam

(Norbrook, Overland Park, KS) was given SQ. Gilts were then removed from the surgery table and placed in a recovery pen with warming blankets. Rectal temperatures were taken approximately every 30 minutes. A total of 2.5 L of Lactated Ringer’s Solution was given via

IV until gilts began to wake.

Gilts were checked every 12 hours for the 14 days following the surgery. Animals were monitored for evidence of adequate pain control based on attitude, appetite, vocalization, and locomotion. Additionally, rectal temperatures, vaginal discharge, urination, and defecation were recorded over this time period. For the first three days following the surgery, gilts were given 0.25- 0.3 mg/kg Meloxicam (rounded to the nearest half 15 mg tablet; 45 mg) orally in the morning. Gilts were also given 15 mg of Matrix which was dressed over morning feed daily until gestational day 113. The Ioban bandage was removed one week after surgery.

X-ray detection of injected wires

Piglets from both litters were delivered at full term. Piglets nursed until 2 or 3 days of age and were then euthanized humanely by intravenous pentobarbital sodium (Fatal-Plus;

Vortech Pharmaceuticals, Dearborn, MI) injection (2-4 mL per piglet). Sows were also euthanized with 60 mL of pentobarbital sodium administered intravenously. Piglets were then brought to the ISU Small Animal Clinic where lateral and dorsoventral radiographs were acquired for both intact piglets as well as dissected livers.

References

1. Abellaneda JM, Ramis G, Martinez-Alarcon L, Majado MJ, Quereda JJ, Herrero- Medrano JM, Mendonca L, Garcia-Nicolas O, Reus M, Insausti C, et al. Generation of

human-to-pig chimerism to induce tolerance through transcutaneous in utero injection of cord blood-derived mononuclear cells or human bone marrow mesenchymals cells in a preclinical program of liver xenotransplantation: preliminary results. Transplantation proceedings. 2012;44:;1574–1578.

2. Basel MT, Balivada S, Beck AP, Kerrigan MA, Pyle MM, Dekkers JCM, Wyatt CR, Rowland RRR, Anderson DE, Bossmann SH, et al. Human Xenografts Are Not Rejected in a Naturally Occurring Immunodeficient Porcine Line: A Human Tumor Model in Pigs. BioResearch Open Access [Internet]. 2012 April;1:;63–68. Available from: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3559234/

3. Fisher JE, Lillegard JB, McKenzie TJ, Rodysill BR, Wettstein PJ, Nyberg SL. In utero transplanted human hepatocytes allow postnatal engraftment of human hepatocytes in pigs. Liver transplantation : official publication of the American Association for the Study of Liver Diseases and the International Liver Transplantation Society. 2013 March;19:;328–335.

4. Fujiki Y, Fukawa K, Kameyama K, Kudo O, Onodera M, Nakamura Y, Yagami K, Shiina Y, Hamada H, Shibuya A, et al. Successful multilineage engraftment of human cord blood cells in pigs after in utero transplantation. Transplantation. 2003 April;75:;916–922.

5. Hanks B, Schlink S, Brown L, Luna M, Liu Y, Liu J, Stricker-Krongrad A, Bouchard G. Short-acting and long-acting Buprenorphine therapeutic drug levels following single subcutanesous administration in diabetic yucatan miniswine. Sinclair Preclinical Services [Internet]. 2016. Available from: http://kcasbio.com/wp- content/uploads/2014/04/BuprenorphinePharmacokineticPoster.pdf

6. Ito T, Sendai Y, Yamazaki S, Seki-Soma M, Hirose K, Watanabe M, Fukawa K, Nakauchi H. Generation of recombination activating gene-1-deficient neonatal piglets: a model of T and B cell deficient severe combined immune deficiency. PloS one. 2014;9:;e113833.

7. Kang J-T, Cho B, Ryu J, Ray C, Lee E-J, Yun Y-J, Ahn S, Lee J, Ji D-Y, Jue N, et al. Biallelic modification of IL2RG leads to severe combined immunodeficiency in pigs. Reproductive biology and endocrinology : RB&E. 2016 November;14:;74.

8. Lee K, Kwon D-N, Ezashi T, Choi Y-J, Park C, Ericsson AC, Brown AN, Samuel MS, Park K- W, Walters EM, et al. Engraftment of human iPS cells and allogeneic porcine cells into pigs with inactivated RAG2 and accompanying severe combined immunodeficiency. Proceedings of the National Academy of Sciences [Internet]. 2014 May 20;111:;7260 LP-7265. Available from: http://www.pnas.org/content/111/20/7260.abstract

9. McConico A, Butters K, Lien K, Knudsen B, Wu X, Platt JL, Ogle BM. In utero cell transfer between porcine littermates. Reproduction, fertility, and development. 2011;23:;297–302.

10. Meurens F, Summerfield A, Nauwynck H, Saif L, Gerdts V. The pig: a model for human infectious diseases. Trends in microbiology. 2012 January;20:;50–57.

11. Neuhauser S, Palm F, Ambuehl F, Mostl E, Schwendenwein I, Aurich C. Effect of altrenogest-treatment of mares in late gestation on adrenocortical function, blood count and plasma electrolytes in their foals. Equine veterinary journal. 2009 July;41:;572–577.

12. Ogle BM, Butters KA, Plummer TB, Ring KR, Knudsen BE, Litzow MR, Cascalho M, Platt JL. Spontaneous fusion of cells between species yields transdifferentiation and retroviral transfer in vivo. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 2004 March;18:;548–550.

13. Ogle BM, Knudsen BE, Nishitai R, Ogata K, Platt JL. Toward development and production of human T cells in swine for potential use in adoptive T cell immunotherapy. Tissue engineering. Part A. 2009 May;15:;1031–1040.

14. Powell EJ, Cunnick JE, Tuggle CK. SCID pigs: An emerging large animal NK model. Journal of rare diseases research & treatment. 2017;2:;1–6.

15. Robeck TR, Gill C, Doescher BM, Sweeney J, Laender P De, Elk CE Van, O’Brien JK. Altrenogest and progesterone therapy during pregnancy in bottlenose dolphins (Tursiops truncatus) with progesterone insufficiency. Journal of zoo and wildlife medicine : official publication of the American Association of Zoo Veterinarians. 2012 June;43:;296–308.

16. Schook LB, Collares T V, Hu W, Liang Y, Rodrigues FM, Rund LA, Schachtschneider KM, Seixas FK, Singh K, Wells KD, et al. A Genetic Porcine Model of Cancer. PloS one. 2015;10:;e0128864.

17. Sieren JC, Meyerholz DK, Wang X-J, Davis BT, Newell JD, Hammond E, Rohret JA, Rohret FA, Struzynski JT, Goeken JA, et al. Development and translational imaging of a TP53 porcine tumorigenesis model. The Journal of Clinical Investigation [Internet]. 2014 September 2;124:;4052–4066. Available from: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4151205/

18. Sinkora M, Sinkorova J, Butler JE. B cell development and VDJ rearrangement in the fetal pig. Veterinary immunology and immunopathology. 2002 September;87:;341– 346.

19. Suzuki S, Iwamoto M, Hashimoto M, Suzuki M, Nakai M, Fuchimoto D, Sembon S, Eguchi-Ogawa T, Uenishi H, Onishi A. Generation and characterization of RAG2 knockout pigs as animal model for severe combined immunodeficiency. Veterinary immunology and immunopathology. 2016 October;178:;37–49.

20. Suzuki S, Iwamoto M, Saito Y, Fuchimoto D, Sembon S, Suzuki M, Mikawa S, Hashimoto M, Aoki Y, Najima Y, et al. Il2rg gene-targeted severe combined immunodeficiency pigs. Cell stem cell. 2012 June;10:;753–758.

21. Suzuki Y, Yeung AC, Ikeno F. The representative porcine model for human cardiovascular disease. Journal of biomedicine & biotechnology. 2011;2011:;195483.

22. Thiede AJ, Garcia KD, Stolarik DF, Ma J, Jenkins GJ, Nunamaker EA. Pharmacokinetics of sustained-release and transdermal buprenorphine in Göttingen minipigs (Sus scrofa domestica). Journal of the American Association for Laboratory Animal Science : JAALAS [Internet]. 2014 November;53:;692–699. Available from: https://www.ncbi.nlm.nih.gov/pubmed/25650977

23. Waide EH, Dekkers JCM, Ross JW, Rowland RRR, Wyatt CR, Ewen CL, Evans AB, Thekkoot DM, Boddicker NJ, Serão NVL, et al. Not All SCID Pigs Are Created Equally: Two Independent Mutations in the Artemis Gene Cause SCID in Pigs. The Journal of Immunology [Internet]. 2015 October 1;195:;3171 LP-3179. Available from: http://www.jimmunol.org/content/195/7/3171.abstract

24. Watanabe M, Nakano K, Matsunari H, Matsuda T, Maehara M, Kanai T, Kobayashi M, Matsumura Y, Sakai R, Kuramoto M, et al. Generation of interleukin-2 receptor gamma gene knockout pigs from somatic cells genetically modified by zinc finger nuclease-encoding mRNA. PloS one. 2013;8:;e76478.

Figures

Figure 4.1. Exteriorization of uterine horns for ultrasound guided injection of wire and saline

(A) During laparotomy procedures, each horn was exteriorized to ultrasound for fetuses. Fetuses were marked with a water-soluble marker. (B) Ultrasound was utilized to guide injection of wire and saline into fetuses. (C) An ultrasound image of fetal liver. (D) A 22G needle was preloaded with a long copper wire plunger. A 2 mm titanium wire was placed at the tip of the needle. The copper wire was then used as a plunger to push the titanium wire into fetal tissues

Figure 4.2. Liver x-rays for wire detection.

After initial body x-rays were acquired, livers were removed and x-rayed separately for detection of wire. The top two rows (labeled 1-10) are from litter 317. The bottom row (labeled 1-4) are from litter 348. Only animal 317-01, shown on the top left, contained wire within the liver.

Figure 4.3. Titanium wire detection in liver and IP space of piglets.

Radiographs were acquired from farrowed piglets. Examples of piglets with wires are shown. Piglet 317-01 had a wire within the liver, while piglet 317-08 and 348-03 had wires within the IP space.

Tables

Table 4.1. Drug, medication, and equipment information

Product Dose Route Purpose Company

0 Polyglactin 910 with Suture Ethicon, Sommerville, NJ Irgacare MP 1 Polydioxanone Suture Ethicon, Sommerville, NJ Buprenophine, sustained 0.18 mg/kg SQ Pain relief ZooPharm, Windsor, CO release Intraoperative West-Ward Pharmaceuticals, Cefazolin 25 mg/kg IV antibiotic Eatontown, NJ Clean surgical 2% Chlorohexidine scrub Phoenix, St Joseph, MO 99 site

Copper wire (16-gauge RCA, New York, NY speaker wire) Ceftifur, crystalline free 5 mg/kg IM Antibiotic Zoetis, Parsippany, NJ acid (Excede) 380 mg/mL Fatal Plus (sodium Vortech Phamaceuticals, 60 mL per sow Euthanasia pentobarbital) Dearborn, MI 2-4 mL per piglet Prevent bradycardia, West-Ward Pharmaceuticals, Glycopyrrolate 0.01 mg/kg IM decrease Eatontown, NJ salivation Ioban 2 3M, Maplewood, MN Isofluorane To effect (3% to 5%) Inhalation Anesthetic Phoenix, St. Joseph, MO

Table 4.1 Cont. Drug, medication, and equipment information

Product Dose Route Purpose Company

10 mL/kg during Lactated Ringers solution IV Hydration Hospira, Lake Forest, IL surgery and recovery 15 mg daily until Pregnancy Matrix (altrenogest) Oral Merck Animal Health, Madison, NJ gestational day 113 maintenance Meloxicam (injectable) 0.3 mg/kg SQ Pain relief Norbrook, Overland Park, KS 45 mg/gilt daily Unichem Laboratories, Mumbai, Meloxicam (oral) Oral Pain relief for 3 d India

postoperatively 100 Skin marker (gentian Medline Industries, Dubuque, IA violet ink) 0.9% Sodium chloride 0.1 mL per injection FL, IP Hospira, Lake Forest, IL (saline) Tiletamine–zolazepam 5 mg/kg IM Anesthetic Zoetis, Parsippany, NJ (Telazol) Titanium wire (diameter, FL, IP Sigma Aldrich, St Louis, MO 0.25 mm) Xylazine 2mg/kg IM Anesthetic Akorn, Lake Forest, IL ZONARE ultrasonography Mindray, Mahwah, NJ system

SQ: subcutanesous, IV:intravenous, IM: intramuscular, FL: Fetal liver, IP: intraperitoneal

Table 4.2 Ultrasonographic overview of anticipated fetal injection locations during laparotomy procedures on gilts 31-7 and 34-8

31-7 34-8 Uterine Horn Fetus Injection location notes Uterine Horn Fetus Injection location notes

0.1 mL saline, IP. Wire Right 1 Right 1 Not injected came out 2 Not injected 2 0.1 mL saline and wire, FL

3 0.1 mL saline and wire, IP 3 Not injected

101

4 Not injected Left 4 0.1 mL saline and wire, FL 0.1 mL saline and wire, Left 5 5 Not injected potentially FL 0.1 mL saline and wire, 6 Not injected 6 potentially IP 7 0.1 mL saline and wire, IP

8 Not injected

9 0.1 mL saline and wire, IP

10 Not injected

Table 4.3 Overview of piglet birth status from gilts 31-7 and 34-8

31-7 34-8 Piglet ID Status Birth Weight (kg) Wire location Piglet ID Status Birth Weight (kg) Wire location

317-01 Live 1.3 Liver 348-01 Live 1.0 - 317-02 Live 1.4 - 348-02 Live 1.5 IP 317-03 Live 1.3 - 348-03 Live 1.5 IP 317-04 Live 1.1 - 348-04 Stillborn 1.2 - 317-05 Live 1.3 - 348-05 Mummy - - 317-06 Live 1.3 - 348-06 Mummy - Undetermined 317-07 Live 1.0 IP

102 317-08 Live 1.2 IP

317-09 Live 1.4 - 317-10 Stillborn 1.1 -

103

CHAPTER 5

ENGRAFTMENT OF HUMAN IMMUNE CELLS IN CRISPR/CAS9 GENERATED Art-/- IL2RG -/Y SCID PIGS AFTER IN UTERO INJECTION OF HUMAN CD34+ CELLS

Prepared for submission to Nature Communications.

Adeline N Boettcher1*, Yunsheng Li1*, Amanda Ahrens2, Matti Kiupel3, Kristen Byrne4, Crystal Loving4, A. Giselle Cino-Ozuna5, Jayne Wiarda4, Malavika Adur1, Jay Swanson6, Elizabeth Snella1, Chak-Sum (Sam) Ho7, Sara Charley1, Zoe Kiefer1, Joan Cunnick1, Ellis Powell1, Giuseppe Dell’Anna2, Jackie Jens1, Frederick Goldman8, Erik Westin8, Jason Ross1, Christopher Tuggle1

*Authors contributed equally to this work 1Iowa State University, Department of Animal Science, Ames, Iowa 2Iowa State University, Laboratory Animal Resources, Ames, Iowa 3Michigan State University, Department of Pathobiology and Diagnostic Investigation, College of Veterinary Medicine, East Lansing, Michigan 4National Animal Disease Center, Food Safety and Enteric Pathogen Unit, US Department of Agriculture, Agricultural Research Service, Ames, Iowa 5Kansas State University, Veterinary Diagnostic Laboratory, Manhattan, Kansas 6Mary Greeley Hospital, Ames, Iowa 7Gift of Life Michigan, Ann Arbor, Michigan 8Children’s of Alabama, Birmingham, Alabama

Author Contributions ANB designed humanization experiments, isolated human stem cells, performed fetal injections, human immune cell flow cytometry, and wrote the draft of the manuscript. YL isolated fetal fibroblasts, performed CRISPR/Cas9 mutagenesis, performed embryo transfers to generate double mutant piglets, and wrote draft of the manuscript. AA performed fetal injection laparotomy procedures on pregnant gilt. MK performed immunohistochemistry for human immune cells in lymphoid tissues. KB and CL performed flow cytometry for Art-/- IL2RG-/Y immunophenotyping and bone marrow transplantation monitoring. GC and JW performed immunohistochemistry for porcine immune cells in lymphoid tissues. EP performed IV injections of human stem cells in Art-/- pigs. JS collected cord blood for stem cell isolations that were used in fetal injections of Art-/- IL2RG-/Y fetuses. ES performed pig bone marrow isolation for bone marrow transplantation. CSH performed MHC PCR analysis for bone marrow donors. JWR performed bone marrow transplantation. SC genotyped fetal fibroblast cell lines for Art status. SC, ZK, and MA were involved in experimental planning for all facets of this project. JC was involved in experimental flow cytometry planning. GD and JJ assisted with fetal injection procedures. FG and EW provided human stem cells for IV

104 injection procedures in Art-/- pigs. JWR and CKT were involved in all aspects of procedures and experiments performed in this study and edited the manuscript.

Abstract

Pigs with severe combined immunodeficiency (SCID) are an emerging biomedical animal model. In this work we have generated T- B- NK- SCID pigs through site directed

CRISPR/Cas9 mutagenesis of IL2RG within a naturally occurring DCLRE1C (Artemis)-/- genetic background. We confirmed that Art-/- IL2RG-/Y pigs lacked T, B, and NK cells in both blood and lymphoid tissues. We performed a bone marrow transplant on one Art-/- IL2RG-/Y SCID pig and were successful in reconstitution of porcine T and NK cells. Next, we performed in utero

(IU) injections of cultured human CD34+ cord blood cells as a route to engraft cells within the fetal Art-/- IL2RG-/Y SCID pigs. At birth, human CD45+ CD3+ cells were in circulation of IU injected piglets. Human leukocytes were engrafted within the bone marrow, spleen, liver, thymus, and mesenteric lymph nodes of these animals. Together, we describe the first publication of initial development of an immunologically humanized SCID pig model.

Introduction

Animals with severe combined immunodeficiency (SCID) are invaluable to human biomedical researchers because they allow the engraftment and study of human cells in an in vivo environment. In 2012, we discovered the first SCID pigs with natural mutations1,2 within the Artemis gene causing T- B- NK+ SCID3,4. Since then, pigs with mutations in RAG15,6,

RAG27,8, IL2RG9–11, and RAG2/IL2RG 12 have also been generated through different mutagenesis approaches. Within the past few years, such SCID pigs are now being utilized by cancer 13 ,disease model12 , and stem cell therapy7 researchers. Biocontainment

105 facilities14, isolators 12 , and c-section15 techniques have been developed to deliver and raise

SCID pigs in clean environments for longer term studies. An important progressive step in developing the SCID pig model is to immunologically humanize these animals through the introduction of human CD34+ stem cells. Similarities between human and porcine immune genes16 suggests that human immune development would be supported in vivo within the pig17. Development of such a model could provide researchers with a larger humanized animal for use in a variety of different biomedical fields including cancer13,17, HIV, and vaccine development research.

The first SCID mouse was described in 198318, and was shortly thereafter humanized by either injection of human peripheral blood leukocytes19 or implantation of human fetal liver, thymus and lymph node tissue20. Humanized mouse models are still being optimized and improved since their conception 35 years ago. Reconstitution of human immune cell subsets in SCID mice often requires addition of human cytokine genes, humanization of resident mouse immune genes, or administration of developmental cytokines to the mice 21–

24. Humanized mice have been utilized in a variety of different biomedical fields including cancer, infectious disease, transplantation, and drug testing25–27. However, there are limitations to mouse models such as size, differences in drug metabolism, and differences in disease pathology compared to humans 28,29. Thus, one major goal of the SCID pig community is to create an immunologically humanized SCID pig model, which could be used in conjunction with humanized SCID mouse models to test preclinical therapeutics.

The most commonly used strain for humanization is the non-obese diabetic (NOD)-

SCID- IL2RG (NSG) mouse30. The NOD mouse background contains polymorphisms within the

106

SIRPA gene which allows it to bind to human CD47 to transduce a “don’t eat me” signal in mouse myeloid cells to inhibit phagocytosis31–33. We have demonstrated that porcine SIRPA also binds to human CD47 to inhibit phagocytosis of human cells34, indicating that pigs may be as permissive to human xenografts as NOD mice. In addition to the SIRPA polymorphism

NSG mice also have a T- B- NK- cellular phenotype. This cellular phenotype can be generated through mutagenesis of required genes for VDJ recombination (Artemis or RAG1/2) as well as IL2RG. Previous reports show that mouse NK cells negatively impact the ability of human cell engraftment in SCID mice30. NK cells in Art-/- SCID pigs are functional in vitro 4, and thus we anticipate that swine NK cells could also negatively impact human cell engraftment. In order to deplete NK cells in our current Art-/- SCID pig model, we mutagenized IL2RG in an

Art-/- mutant cell line. Together, the generated pigs are similar to NSG mice in cellular phenotype as well as in SIRPA/CD47 dependent phagocytic tolerance34.

Here we describe the generation of Art-/- IL2RG-/Y SCID pigs that were derived by site- directed CRISPR/Cas9 mutagenesis of an Art-/- fetal fibroblast cell line. Modified Art-/- IL2RG-/Y embryos were implanted in gilts via surgical embryo transfer. Piglets were born at full term and were confirmed to have the expected T- B- NK- cellular phenotype based on flow cytometry and immunohistochemical (IHC) analysis of blood and lymphoid organs. We next asked if these double mutant pigs could be humanized via the introduction of human CD34+ stem cells. Gestational day 41 Art-/- IL2RG-/Y fetuses were injected with human CD34+ cells within the intraperitoneal space via ultrasound guidance. Piglets were born via Cesarean section delivery at gestational day 119. Blood and lymphoid organs from delivered piglets were analyzed at day 0 or 7 for the presence of human cells. Human cells, primarily

107 consisting of CD3+ cells, were present in blood, spleen, bone marrow, liver, and thymic tissue. Thus, we describe here the first steps towards the generation of humanized SCID pigs.

Results

Generation of Art-/- IL2RG-/Y SCID pigs by site directed CRISPR/Cas9 mutagenesis of Art-/- fetal fibroblasts

We previously described the discovery of naturally occurring Art-/- SCID pigs3, which we have been able to raise and breed14,35 for research purposes. We started with this genetic background for IL2RG site-directed mutagenesis. One goal we have with producing

Art-/- IL2RG-/Y SCID pigs is to generate a breeding colony such that IL2RG knockout piglets could be derived through natural birth rather than cloning procedures. In our breeding protocol, this would require bone marrow transplantation of a SCID boar such that he could be raised to sexual maturity and bred to an Art-/+ carrier female. Mutagenizing our existing

Art-/- line would facilitate producing SCID pigs with matching SLA (swine leukocyte antigen) to carrier animals within our colony. Therefore, we decided to utilize cloned Art-/- fibroblasts for IL2RG mutagenesis for somatic cell nuclear transfer (SCNT) to generate pigs with these desired genetics. Figure 5.1A shows a schematic for the process of generating Art-/- IL2RG-/Y piglets.

Art-/- pFFs that would be mutagenized were derived from an Art-/- male and Art-/+ mating (see Materials and Methods for information on Artemis genotypes). Gestational day

35 fibroblasts were collected and underwent SLA testing, as well as were genotyped for Art status. Genotyping revealed that two male and two female cell lines were Art-/- mutants, whereas the other six male and three female cell lines were Art-/+ carriers (Table 5.S3)

108

To mutagenize IL2RG, a single guide RNA (sgRNA) was designed to target exon 5 of

IL2RG (Figure 5.1B). We selected a male Art-/- cell line (7707-FB1) with a matching SLA haplotype (26.6/68.19a) to a carrier fibroblast line (7709-FB6) to transfect with the sgRNA

Table 5.S3). After transfection, a total of 202 individual clonal colonies from the 7707-FB1 cell line were screened using PCR and Sanger sequencing. Five (2.5 %) clonal colonies were confirmed to be IL2RG-/Y (hemizygous) (Table 5.S4) with a 120 bp deletion in intron 4 and exon 5 of the IL2RG locus, which is expected to cause a frameshift leading to an early stop codon. (Figure 5.1C). A total of 920 IL2RG-/Y Art-/- and 512 non-modified SCNT (carrier) derived embryos (7709-FB6) were transferred surgically into seven different recipient gilts.

Both cell lines shared the same SLA haplotype of 26.6/68.19a. Among those transferred, four gilts were confirmed pregnant and two carried the piglets to full term. These two surrogates produced five live male piglets via cesarean section that were reared in the SCID pig bubble14

(Table 5.S5). All five piglets were confirmed to have the 120 bp loss in IL2RG and the established mutation in exon 10 of Artemis3 (Art12 allele information found in Materials and

Methods). None of the live born piglets were derived from non-modified, carrier embryos

(7709-FB6) that would have been used as a bone marrow donor.

Art-/- IL2RG-/Y SCID pigs lack T, B, and NK cells in blood and lymphoid organs

Once Art-/- IL2RG-/Y piglets were delivered, blood was collected and analyzed by flow cytometry to confirm the expected T- B- NK- cellular phenotype of these animals. Forward and side scatter plots (FSC/SSC) show the lack of a lymphocyte population in Art-/- IL2RG-/Y pigs compared to Art-/- and wild type pigs (Figure 5.2A). Peripheral blood was stained for

CD172, CD8α, and CD3 in wildtype, Art-/-, and Art-/- IL2RG-/Y pigs. T cells (CD172- CD3+) and NK

109 cells (CD172- CD3- CD8a+) were not in circulation of Art-/- IL2RG-/Y piglets (Figure 5.2B). We additionally stained for CD21 to confirm there were no B cells in circulation of the Art-/-

IL2RG-/Y pigs (Figure 5.S1). Furthermore, Art-/- IL2RG-/Y lacked a thymus and lymphoid tissue in the intestines, as well as had a smaller spleen than wildtype pigs (Figure 5.S2).

We additionally confirmed that T and B cells were absent from lymphoid tissues.

Lymph nodes and spleens were collected from wild type (18d), Art-/-(0d), Art-/- IL2RG-/Y(18d) pigs for IHC analysis. Lymph node tissue was stained for CD3 and CD79α to assess for the presence of T, and B cells, respectively. Both Art-/- and Art-/- IL2RG-/Y pigs lacked normal T and

B cells in lymph nodes (Figure 5.2C).

T and NK cell reconstitution in an Art-/- IL2RG-/Y SCID pig after pig bone marrow transplantation

An additional goal with the generation of Art-/- IL2RG-/Y SCID pigs was to establish a male breeding line. Carrier Art-/+ females bred with an Art-/- IL2RG-/Y BMT SCID rescued boar could generate litters with a mix of males and females with different Art and IL2RG genotypes for future studies and breeding. The original intent with performing embryo transfers with non-modified carrier embryos was to act as a source of bone marrow for the

Art-/- IL2RG-/Y pigs. In our full-term pregnancies, only Art-/- IL2RG-/Y piglets were born despite the fact that both Art-/- IL2RG-/Y and Art-/+ embryos were transferred into the surrogate female, and thus we needed an alternative source of bone marrow for a BMT.

We therefore performed a bone marrow transplantation on one Art-/- IL2RG-/Y male piglet with 100% SLA bone marrow match (haplotype 26.6/68.19a) from a 4 year old sow raised on a conventional farm. A total of 227.5 million unfractionated bone marrow cells

110 from the ribs and sternum were collected and administered to one Art-/- IL2RG-/Y SCID pig.

The piglet was not conditioned prior to the BMT, as we have had success with porcine T and

B cell reconstitution without conditioning in Art-/- SCID pigs35.

Blood was collected approximately once a month after the transplant and analyzed by either a complete blood count (CBC) or by flow cytometric analysis. Counts from CBC analysis showed that white blood cells and lymphocytes increased in number every month after the transplant, to near normal levels by 4 months after BMT (Figure 5.2D). PBMCs were stained for CD3, CD8α, and CD172 to assess cell populations. Circulating T and NK cells were detected in circulation at 4 months of age (Figure 5.2D). We assessed if B cells had developed in the transplanted boar by staining with CD21 and CD79α, and we observed very few circulating B cells (Figure 5.S3) within 6 months after the transplant. Similar B cell reconstitution issues have been reported in human BMT cases with mutations in Artemis 36–

38. This BMT Art-/- IL2RG-/Y boar is sexually mature and healthy as of 9 months of age.

Circulating human T cells in neonatal Art-/- IL2RG-/Y piglets after in utero injection of human hematopoietic stem cells

Once we confirmed the cellular phenotype of Art-/- IL2RG-/Y pigs, we next asked if these pigs were capable of engrafting human CD34+. We previously attempted intravenous and intraosseous injection of human CD34+ cells into single mutant Art-/- piglets (T- B- NK+) with various cell doses and busulfan conditioning (Table 5.S6) and we saw no evidence of engraftment within blood or lymphoid organs after a maximum of 15 weeks post cell inoculation. We thus utilized an alternative approach of in utero (IU) injection of human stem cells into the intraperitoneal space of Art-/- IL2RG-/Y SCID pig fetuses.

111

During mid-gestation, the fetal liver is a site for hematopoiesis39–42. Specifically, between 30-45 days of gestation, the hematopoiesis occurs within the liver of fetal swine43.

Previous reports show that injection of human CD34+ cells into the intraperitoneal space of pre-immunocompetent piglets and sheep leads to the differentiation and engraftment of human immune cells44–47. However, such injections have not been reported in pigs with

SCID. Approaches to inject fetal piglets require laparotomy procedures to expose the uterus to visualize fetuses via ultrasound imaging. Thus, we utilized laparotomy surgery with ultrasound guided injections of human CD34+ cells into the intraperitoneal space of Art-/-

IL2RG-/Y fetuses (Figure 5.3A) (Boettcher et al. Comparative Medicine, in press). Human

CD34+ cells derived from cord blood were cultured with thrombopoietin, FLT-3L, and stem cell factor for the seven days prior to injection to expand the cell populations for the appropriate cellular dose. After culturing, cells were either CD45+CD34+ (72-76%) or CD45+

CD34- (24-28%) (Figure 5.S4).

To perform fetal injections, one surrogate gilt was transplanted with 320 Art-/-

IL2RG-/Y mutant embryos (Table 5.S7). Pregnancy was confirmed at 28 days of gestation and laparotomy surgery for IU injection was performed on gestational day 41. We injected half of the fetuses (n=6 total; 3 injected) with 2 or 4 million cultured human CD34+ stem cells. The gilt fully recovered from the laparotomy surgery and piglets were delivered via Cesarean section at gestational day 119 and a total of three piglets were born (6901, 6902, and 6903).

Cord blood was immediately collected from the three piglets to assess if human immune cells were in circulation. We have tested and created panels of anti-human antibodies that are not cross reactive to swine leukocytes (Figure 5.S5). Whole cord blood was stained for

112 pig and human CD45, as well as human CD47. Two of the three pigs (6901 and 6903) were found to have human CD45+ (Figure 5.3B), as well as human CD47+ cells in cord blood (Figure

5.3C).

One piglet (6901) was euthanized on day 0 due to severe cleft palate. Peripheral blood was collected from 6901 at day 0, while peripheral blood was collected from 6902 and

6903 at 1 day of age and stained for human T cells (CD3, CD4, and CD8) (Figure 5.3D), B cells

(CD20) and (Figure 5.3E), and myeloid cells (CD33) (Figure 5.3F). Red blood cells were also stained for human CD47 (Figure 5.3G). Nearly all of the human CD45+ cells in 6901 and 6903 consisted of human CD3+ cells. We then stained for human CD4 and CD8α to assess if human

T helper and cytotoxic cells developed within these pigs. Both pigs had single positive CD4 and CD8α populations of T cells in peripheral blood (Figure 5.3D).

Human CD45+ cell engraftment in Art-/- IL2RG-/Y bone marrow, liver, spleen, and thymic tissue

Since we observed that human cells were in circulation, we next assessed if human immune cells engrafted within lymphoid organs. Interestingly, during necropsy, we observed grossly visible mesenteric lymph nodes in 6901 and 6903, but not 6902. Additionally, all three pigs had some remnant, immature thymic tissue present over the heart (Figure 5.S6), which was collected for analysis. Of the tissues collected, cells were isolated from bone marrow, liver, spleen, and thymic tissue for flow cytometric analysis. Whole cell suspensions were stained from bone marrow and thymus, while mononuclear cells were stained from liver and spleen. Human CD45+ cells were found in all four tissue types in 6901 and 6903, which both had human CD45+ cells in circulation (Figure 5.4A). At least half of the isolated

113 thymic tissue cells from these two animals were human cells. Animal 6902 did not have any human cells in any lymphoid organs.

Since a majority of the human cells we observed in these pigs were CD3+, we were interested in assessing the expression of CD4 and CD8α within the thymic tissue cells. T cells that are early in their stage of development express both CD4 and CD8. In animal 6901, we observed that thymic hCD45+ hCD3+ cells were either CD4+ CD8α- or CD4- CD8α-, while in

6903 they appeared to be CD4- CD8α- (Figure 5.4B).

In addition to flow cytometric analysis of cells within lymphoid tissues, we also analyzed tissues via IHC analysis. We collected lymphoid tissues and assessed for the presence of human T and B cells in the in utero injected piglets. Thymic tissue, spleen, ileum, and mesenteric lymph nodes from both 6901 and 6903 had CD3+ cells (Figure 5.5A). Spleens from both 6901 and 6903 also had punctate Pax5+ cells present. A mesenteric lymph node from 6901 also had Pax5+ cells (Figure 5.5B). Tissues from 6902 did not stain positively for either CD3 or Pax5. These histology results are consistent with the flow cytometric analyses in showing that human leukocytes engrafted within the Art-/- IL2RG-/Y SCID pig lymphoid tissues.

Discussion

Herein we have described the first steps towards the development of immunologically humanized large animal SCID model. To create this model, we introduced a mutation into the IL2RG gene by CRISPR/Cas9 site directed mutagenesis into a naturally occurring Art-/- SCID background to generate Art-/- IL2RG-/Y pigs that lacked T, B, and NK cells.

We performed a pig to pig BMT procedure on one male Art-/- IL2RG-/Y pig, which led to

114 successful reconstitution of graft T and NK cells, but very few B cells. Next, we utilized IU injection procedures to introduce human hematopoietic stem cells into the IP space of SCID pig fetuses. We observed that human CD3+ cells were present in bone marrow, spleen, liver, and thymic tissue in injected pigs after birth. Human Pax5+ cells were also present within the spleen and mesenteric lymph nodes of injected pigs. Protocols described here can be utilized to improve engraftment efficiency within SCID pig models in the future.

Further human immune cell characterization of SCID pigs

Presently, there have been few studies that have probed for engraftment potential of human cells within pigs. Previous studies primarily utilized PCR to detect human cell types in circulation44,47. To probe for these human cell types by other methods (flow cytometry and immunohistochemistry), antibody-based tools need to be developed and validated to confirm the host species of cell type that is being detected. In developing this initial human immune engraftment model in SCID pigs, we have described a set of non-cross reactive antibodies that are specific for human antigens in flow cytometry (Table 5.1 and Figure

5.S5).

An additional method for detecting human cells within the SCID pig lymphoid organs is immunohistochemistry. This method would allow us to have a secondary method for the detection of human cells, as well as give additional information on how the human cells are localized within the tissues. One of the issues that arises during IHC analysis is that during sample preparation of formalin fixed paraffin embedded tissues is that the antigen retrieval process can make antigens less specific when trying to stain for species specific antigens.

When staining porcine tissues that contain human cells, the antibody of choice (depending

115 on the specific marker) may recognize antigens that are present in both human and pig proteins, and thus results are not informative on human engraftment. For example, human and pig share 62% identical amino acids in their CD3ε subunit. Therefore, a single antibody clone may bind to epitopes on both human and pig CD3ε after protein denaturation.

Because we are working with SCID pigs, which lack porcine CD3+ cells, utilizing an antibody that cross reacts with human and porcine CD3+ lymphocytes may still be an option to use for interrogating the presence of human cells in SCID pigs. Hence, it is important to have both flow cytometry, as well as IHC data to show species specificity of the antigen being stained.

Outlooks on B cell reconstitution in Art-/- ILR2G-/Y SCID pigs

One issue that arose in both the pig to pig BMT, as well as IU injection of human

HSCs, was the failure of pig and human B cells to robustly develop. Historically, some human

SCID patients that have undergone BMT have also failed to develop graft derived B cells36. In some cases, significant B cell reconstitution in human BMT can take up to two years 48,49.

One leading hypothesis as to why there are B cell development issues is due to lack of physical space in the B cell niche in the bone marrow. Single mutant IL2RG pigs develop B cells that are detected in circulation9,10, although they are non-functional due to the absence of T helper cells. Mutations in Artemis lead to a B cell block of differentiation at the pre-B cell phase 50. Together, an Art-/- Il2RG-/Y pig likely still has these premature B cells present in the bone marrow, which would prevent further engraftment and differentiation of graft stem cells in this niche. Conditioning before stem cell transplantation has helped improve B cell reconstitution in some cases51, although such conditioning procedures would be difficult for

IU injections.

116

Another important factor for B cell development is the microflora of the host organism. Recent research shows that the gut microflora contributes to the last phases of B cell development52. Our current SCID pig housing protocols require that pigs are raised in biocontainment facilities to reduce the incidence of pathogen exposure and disease. Such rearing conditions prevents the colonization of normal flora in these animals that may be required for B cell development. Further studies are needed to determine the specific microflora that Art-/- IL2RG-/Y SCID pigs may need for B cell development after either pig to pig BMT or transplantation of human stem cells.

Improving human cell engraftment in SCID pigs

One surprising finding was that we did not find human myeloid cells, as has previously been reported in past IU injections in immunocompetent pig fetuses47. In this initial model, we only probed for myeloid cells during the first 7 days of life. In earlier studies

44, myeloid lineage had been assessed at 40 days post injection (80 days of gestation). It may be possible that human myeloid cells are transient during gestation in this fetal injection model. Further investigation will be needed to improve human myeloid reconstitution in neonatal Art-/- IL2RG-/Y SCID pigs.

In the process of in vitro CD34+ cell culturing with SCF, TPO, and FLT-3L, some cells may lose their stemness, which could contribute to the lack of a variety of cells that differentiated within our SCID pig model. In mouse models, genetic modifications of CSF-1,

IL-15, GM-CSF, Flt-3L, IL-3, and TPO and others have been required to attain human myeloid and NK cell engraftment21,23,53–56. Humanization of certain cytokine genes may be required in the future in the pig model. In vitro culturing assays with human hematopoietic stem cells

117 and porcine cytokines can be a first-line screen for assessing porcine cytokine cross reactivity.

Another potential method to increase engraftment is to condition the fetuses prior to human cell injection. Plerixafor, a drug that mobilizes stem cells out of the bone marrow57, has previously been utilized in IU injections of human cells into sheep fetuses to improve engraftment of human cells58. Plerixafor is an agonist for CXCL12 on stromal cells, which binds to CXCR4 on HSC57. Administration of plerixafor mobilizes sheep HSC out of the bone marrow such that there are more available niches to human HSC to engraft. Goodrich et al.

(2014) described that the administration of plerixafor along with administering a CD34+

CXCR4+ human stem cells and mesenchymal stem cells improved from 2.80% chimerism (in peripheral blood) to 8.77% chimerism 5 weeks after transplantation. Now that T- B- NK- SCID pigs and biocontainment facilities are available, a similar regimen could be administered to

SCID pig fetuses prior to IU injection with human stem cells. In addition, the same human stem cell line could be re-injected into piglets after birth.

Concluding remarks

As the field of biomedical SCID pig research expands, new techniques will arise to optimize human cell engraftment within this model. We can draw from previous large animal IU injection protocols44–47,58,59, as well as humanization techniques performed in immunocompromised mice 60,61. In this model we show that human T and B cells develop. If we can improve reconstitution of human cell subsets, the humanized SCID pig can be an alternative large animal model for researchers in a variety of biomedical models to use.

118

Materials and Methods

Ethics statement

All animal protocols were approved by Iowa State University’s Institutional Animal

Care and Use Committee. All animals were utilized in accordance with the USDA guide to large animal requirements in the Animal Welfare Act. All human sample collection protocols were approved by Iowa State University’s Institutional Review Board.

Establishment of porcine fetal fibroblast cell lines with Art-/- genetic background

Our population of SCID pigs have two natural mutations in two separate Artemis alleles, termed Art12 and Art16. The Art12 allele contains a nonsense mutation in exon 10, and the Art16 allele contains a splice site mutation in intron 83. Frozen semen from a bone marrow transplanted (BMT) rescued Art12/16 35 boar was utilized to artificially inseminate two Art carrier sows. The sows were sacrificed at day 35 of gestation and fetuses were collected in a sterile manner to obtain fetal fibroblasts (pFF) as described previously62.

Briefly, minced tissue from each fetus was digested in 20 ml of digestion media (Dulbecco- modified Eagle medium [DMEM] containing L-glutamine and 1 g/L D-glucose [Cellgro] supplemented with 200 units/ml collagenase and 25 Kunitz units/ml DNaseI) for 5 h at

38.5℃. After digestion, pFF cells were washed in sterile PBS and cultured in DMEM supplemented with 15% fetal bovine serum (FBS) and 40 μg/ml gentamicin. Upon reaching

100% confluence, the pFF cells were trypsinized, frozen in FBS with 10% dimethyl sulfoxide

(DMSO) and stored long-term in liquid nitrogen. Simultaneously, cellular DNA was sent to

Gift of Life Michigan for swine leukocyte antigen (SLA) typing as described in Powell et al35.

119

SRY and Artemis primers (Table 5.S1) were utilized to identify pFF sex and Artemis genotype3.

CRISPR/Cas plasmid and sgRNA product

Guide RNAs targeting exon 5 of IL2RG were designed utilizing software available from

Zhang Lab (https://zlab.bio/guide-design-resources). The sequence of the designed sgRNA is:

5’-GGCCACTATCTATTCTCTGAAGG-3’; the bold font identifies the PAM site. The sgRNA oligos were annealed and ligated into the human codon-optimized SpCas9 expression plasmid

(pX330; Addgene plasmid # 42230) as described previously63. We only transfected male

Art12/12 cell lines (herein referred to as Art-/-).

Identification of off-target sequences

To identify putative off-target sequences for the CRISPR/Cas9 mutagenesis used in

Art-/- IL2RG-/Y piglets, bioinformatics tools (http://www.rgenome.net/cas-offinder/) were used to identify potential off-target sequences. Ten potential off-target sites were identified, and primers for the off-target positions were designed. Genomic DNA was obtained from ear notches of Art-/- IL2RG-/Y pigs were used as template in a PCR amplifying the potential off- target regions. Primers and gene information for this purpose are shown in Table 5.S2. DNA sequencing results revealed that no mutations occurred in any of the potential off-target positions.

Establishment of transfected clonal colonies and identification of IL2RG mutagenesis

Male Art-/- pFFs were used for cell transfection in this study as described in Whitworth et al64. Briefly, pFFs were cultured in 75cm2 flasks to reach 90% confluency, trypsinized, and resuspended at a concentration of 1.0 x 106 cells/mL in Electroporation Buffer medium (25%

120

Opti-MEM and 75% cytosalts [120 mM KCl, 0.15 mM CaCl2, 10 mM K2HPO4; pH 7.6, 5 mM

MgCl2]) and were prepared for transfection. A mixture of 1μg sgRNA ligated vector and 200

μL of cell suspension in electroporation buffer was then transferred into 2 mm gap cuvettes

(Fisher Sci, 9104-6050), and exposed to three- 1 msec square-wave pulses at 250 V, using the

BTX Electro Cell Manipulator (Harvard Apparatus). Transfected cells were then diluted, and

80-200 cells were plated in 100 mm culture dishes to obtain distinct clonal cell colonies and

o maintained at 38.5 C in 5% CO2. After 10-12 days in culture, cell colonies were delineated using cloning cylinders and picked for clonal colony propagation and DNA sequencing.

Primers (Table 5.S1) flanking the IL2RG exon 5 target region were utilized to test clonal colonies and PCR products thus obtained were purified by ExoSAP-IT PCR product Cleanup kit

(Affymetrix Inc, Thermo Fisher Scientific). Mutant PCR products were cloned into PCR2.1 vectors (Life Technologies) and transformed into E.coli DH5-α maximum competent cells (Life

Technologies). Ten colonies were chosen and DNA from these samples were sent to the Iowa

State University DNA Facility for sequencing. Sequences were aligned by Bio-Edit software

(Ibis Biosciences, Carlsbad, CA, USA) for comparison with wild-type alleles, to identify cell lines with the appropriate mutations in IL2RG on the Art-/- background.

Double mutant embryo production and surgical embryo transfer

Oocytes from sow source (DeSoto Biosciences, Inc.) or from gilt ovaries (Pineridge abattoir) were utilized for in vitro maturation (IVM) as previously described 65,66. Briefly, sow- derived oocytes were shipped overnight in maturation medium (TCM-199 with 2.9 mM

HEPES, 5μg/mL insulin, 10 ng/mL epidermal growth factor, 0.5μg/mL porcine follicle stimulating hormone, 0.91 mM pyruvate, 0.5 mM cysteine, 10% porcine follicular fluid, and

121

25 ng/mL gentamicin) and transferred into fresh medium after 22 h. Following IVM, cumulus- oocyte-complexes (COC) were vortexed for 3 minutes in 0.1% hyaluronidase in TCM199 with

HEPES to obtain denuded oocytes. Metaphase II (MII) oocytes, identified by the presence of an extruded polar body, were placed in manipulation medium (TCM199 with HEPES supplemented with 7 μg/mL cytochalasin B) and used thereafter for somatic cell nuclear transfer (SCNT). The extruded polar body along with a portion of the adjacent cytoplasm, presumably containing the MⅡ plate, was removed, and a donor nucleus of the appropriate

Art-/- IL2RG-/Y genotype was placed in the perivitelline space by using a thin glass capillary.

The reconstructed embryos were then placed in a fusion medium (0.3 M mannitol, 0.1 mM

CaCl2, 0.1 mM MgCl2, and 0.5 mM HEPES) and exposed to two DC pulses (1-sec interval) at

1.2 kV/cm for 30 μsec using a BTX Electro Cell Manipulator (Harvard Apparatus). After fusion, these embryos were activated in embryo activation medium (10 μg/mL cytochalasin B) for 4 h. After chemical activation, cloned zygotes were treated with 500 mM Scriptaid for 12-14 h and then cultured in porcine zygote medium 3 (PZM-3) until embryo transfer. Embryos thus produced over two days were then surgically transferred into the ampullary-isthmic junction of the oviduct of the surrogate on day 1-2 post estrus. Pregnancies were confirmed by ultrasound 28-30 days following embryo transfer.

C-section and rearing of Art-/-IL2RG-/Y SCID pigs

At gestational day 119, pregnant gilts underwent Cesarean sections. Briefly, lidocaine patches were placed on both ears and the epidural site. Initial anesthesia was induced with either an epidural of propofol (0.83-1.66 mg/kg) or intramuscular injection of Ketamine (1-2 mg/kg) and Xylazine (1-2 mg/kg). The gilts were then intubated, and isoflurane was started.

122

An abdominal incision was made to expose and remove the uterus. After removal, the uterus was immediately rinsed in chlorohexidine and then surgically opened to remove the piglets. All piglets had their cords clamped before being immediately placed into sterile polystyrene boxes and delivered into biocontainment facilities14. All piglets were fed 250 mL of pasteurized porcine colostrum within the first 24 hours of life. Piglets derived from the gilt that underwent laparotomy procedures for human stem cell injection (see below) did not receive colostrum.

Genotyping of neonatal Art-/- IL2RG-/Y pigs

After birth, DNA was isolated from ear notch tissues and was subjected to genotyping for Art and IL2RG status using primers and protocols described in Table 5.S1.

Flow cytometry staining for Art-/- IL2RG-/Y pig characterization and bone marrow engraftment monitoring

Whole blood or cord blood from newborn Art-/- IL2RG-/Y was collected into an EDTA blood collection tube. Whole blood was stained for porcine CD3, CD8α, and CD172 to assess the presence of porcine T and NK cells. Cells were additionally stained for CD21 to assess the presence of B cells (Figure 5.S1). Blood from the Art-/- IL2RG-/Y BMT was also stained for CD79 to assess B cell reconstitution (Figure 5.S3). Additional information about antibodies used can be found in Table 5.1.

Blood was collected from the bone marrow transplanted boar approximately once a month after the BMT. Blood was subjected to either a complete blood count (CBC) at Iowa

State University’s Veterinary Diagnostic lab or by flow cytometry analysis with the same

123 antibodies as listed above. All samples were run on a custom BD LSR II and data was analyzed using Flowjo (Tree Star).

Pig bone marrow isolation and bone marrow transplantation

A 100% SLA matched female sow of approximately 4 years of age was euthanized as a bone marrow donor for one Art-/- IL2RG-/Y piglet. Briefly, the sternum and ribs were collected from the animal and dipped in 70% ethanol. A sterilized Dremel tool was used to make holes halfway through the bone to loosen bone marrow. Sterilized Spratt Brun bone curettes were used to scrape marrow from the bone. HBSS (without phenol red) was used to flush the bone marrow to collect cells; any other loosened marrow was also placed in HBSS.

After marrow isolation, the suspension was washed in HBSS. The cells were resuspended in

ACK lysing solution (Lonza) for ten minutes at room temperature. The suspension was washed in HBSS and filtered through a 70 μm cell strainer. A total of 227.5 million unfractionated cells were isolated and resuspended in approximately 3 mL of HBSS for infusion.

To infuse marrow into the Art-/- IL2RG-/Y donor, the five-day old SCID piglet was anesthetized and maintained on isoflurane gas through the procedure. A catheter was placed in an ear vein and the cell suspension was infused. After infusion, personnel monitored the piglet until awake.

Immunohistochemistry of human and porcine immune markers

Lymphoid organs were collected into 3.7% formaldehyde in 1X PBS for 24 hours.

Tissues were then moved to 70% ethanol until processing. Immunohistochemical (IHC) staining for T and B lymphocyte markers (for Art-/- IL2RG-/Y immune characterization) was

124 performed in paraffin-embedded tissue thin sections at Kansas State Veterinary Diagnostic

Laboratory (KSVDL). Briefly, deparaffinized slide-mounted thin sections were pre-treated for

5 minutes with a peroxide block, followed by incubation with primary antibody. A mouse monoclonal anti-CD3 (clone LN10, Leica Biosystems) was used to stain for pig T cells, while a mouse monoclonal anti-CD79α (clone HM57, Abcam) was used to stain for B cells. Primary antibodies were incubated with PowerVision Poly-HRP anti-mouse IgG at room temperature for 25 minutes with DAB chromagen, and then counterstained with hematoxylin.

Lymphoid tissues from SCID pigs engrafted with human cells were treated similarly as above. Staining was performed at Michigan State University’s Department of Pathobiology and Diagnostic Investigation. Tissues were stained for anti-CD3 (Dako #A0452) and anti-Pax5

(Ventana clone 24) to assess for the presence of human T and B cells, respectively. Briefly,

CD3 staining was performed by antigen retrieval with standard ER1 retrieval for 20 minutes, and tissues were analyzed on a BondMax for the detection of DAB chromagen. For Pax5 staining, antigen retrieval was performed with standard CC1 retrieval for 64 minutes, and tissues were analyzed on a Discovery Ultra AP for ultrared detection.

Human hematopoietic stem cell isolation from cord blood

Human cord blood was collected at Mary Greeley Hospital into 50 mL conical tubes containing 8 mL of anticoagulant citrate dextrose solution (38 mM citric acid, 85.25 mM sodium citrate, 136 mM dextrose). Mononuclear cells (MNCs) were isolated from cord blood by diluting blood 1:2 in HBSS and then layering over Ficoll-Paque. Buffy coats were collected and washed in HBSS. Prior to stem cell isolation, MNCs were resuspended in an isolation

HBSS (iHBSS) consisting of 0.5% FBS and 2 mM EDTA in HBSS.

125

To isolate human CD34+ cells, we used a CD34 MicroBead kit from Miltenyi Biotech.

Briefly, MNCs were incubated in iHBSS with CD34 microbeads and FcR blocking reagent for

30 minutes at 4˚ C on a rocker. After incubation period, cells were washed in iHBSS. Cells were then passed through an LS column in a Miltenyi magnet to capture human CD34+ cells.

The column was then removed from the magnet and cells were flushed. Cells were washed once more in HBSS. Cells were frozen in 10% DMSO and 90% FBS at -80˚ C until use.

Human HSC thawing, culturing, and preparation for fetal injection

Human CD34+ cells were thawed by diluting into complete RPMI media (10% FBS, 2 mM glutamine, 50μg/mL gentamicin, and 10 mM HEPES). Cells were cultured in Miltenyi

StemMACS media containing Thrombopoietin (TPO), Stem Cell Factor (SCF), and Flt3-Ligand

(FLT-3L) at starting concentrations of 38-42 x 103 cells/mL. Cells were left in culture for 7 days to expand. After culturing, cells were prepared for injection by washing three times in phosphate buffered saline. After washing, stem cells were resuspended at a concentration of

26.6 x 106 cells/mL. A total of 150 μl of cell suspension with either 2 or 4 x 106 cells were administered to the fetuses in 0.9% saline.

Laparotomy procedure for fetal injection of human stem cells

Laparotomy procedures were performed as described in Boettcher et al. (2019,

Comparative Med, In press). Briefly, the gilt was started on 15 mg of Matrix orally one day before surgery; she was maintained on Matrix until gestational day 118. Immediately prior to sedation, the gilt was given 0.01 mg/kg Glycopyrrolate by intramuscular injection. The gilt was anesthetized with 2 mg/kg Xylazine and 5 mg/kg Telazol by intramuscular injection. The gilt was then placed in dorsal recumbency, intubated, and started on isoflurane (3-5%) and

126 oxygen (2.5 L/min). Lactated Ringer’s solution was given in an ear catheter at a constant rate infusion within 10 minutes of the first incision. The abdominal area was scrubbed with chlorohexidine and the surgical field was covered with sterile drapes and Ioban drapes.

A ventral midline incision was made from the caudal most nipple extending to the caudal aspect of the umbilicus through the linea alba into the peritoneal cavity. The left uterine horn was removed and was visualized with a ZONARE ultrasound with an L14-5sp intraoperative linear array transducer (10 MHz). Two live and one nonviable fetus were visualized in the left horn; one was injected with 4 million cultured human stem cells in a volume of 0.15 mL within the intraperitoneal space. The left horn was placed back into the abdominal cavity, and the right horn was removed. The right horn was visualized, and three fetuses were observed. One was injected with 2 million human stem cells, while one other was injected with 4 million human cells within the intraperitoneal space. In total, three out of the five viable fetuses were injected. The abdominal cavity was lavaged with 500 mL of

Lactated Ringer’s solution prior to being sutured closed. The gilt then received 0.18 mg/kg

Buprenophine- Sustained Release subcutaneously, 5 mg/kg Ceftiofur Crystalline Free Acid

(Excede), and 0.3 mg/kg of meloxicam. The gilt was monitored by personnel until recovered from anesthesia. The gilt recovered from the laparotomy surgery with no issues. The gilt underwent a Cesarean section at day 119 of gestation (see above).

At the time of Cesarean section, we observed that there were two live piglets within the left horn and one live piglet in the right horn of the uterus. During the laparotomy, we observed two viable fetuses in the left horn; one was injected, and one was not, and relative position was recorded. After Cesarean delivery, by position in the uterus we were able to

127 identify the two developed piglets in the left horn as injected (6901) and non-injected

(6902). In the right horn, there were originally three viable fetuses, but only one piglet survived to term. After flow cytometric analysis, we confirmed that there were human cells present and that this piglet was injected (6903).

Flow cytometry analysis for human cells in Art-/- IL2RG-/Y pig blood

Peripheral or cord blood was collected from piglets into EDTA blood containers.

Whole blood was stained with antibodies against human and pig cell subset markers (Table

5.1). Each staining step was incubated for 15 minutes at 4˚C and washed with 1X PBS with

0.1% sodium azide. Red blood cells were lysed with ammonium chloride lysing solution. Cells were fixed in 2% formaldehyde in 1X PBS and data was acquired on a FACs Canto II flow cytometer and data was analyzed using FlowJo (Treestar).

References

1. Ozuna, A. G. C. et al. Preliminary findings of a previously unrecognized porcine primary immunodeficiency disorder. Vet. Pathol. 50, 144–146 (2013).

2. Basel, M. T. et al. Human Xenografts Are Not Rejected in a Naturally Occurring Immunodeficient Porcine Line: A Human Tumor Model in Pigs. Biores. Open Access 1, 63–68 (2012).

3. Waide, E. H. et al. Not All SCID Pigs Are Created Equally: Two Independent Mutations in the Artemis Gene Cause SCID in Pigs. J. Immunol. 195, 3171 LP-3179 (2015).

4. Powell, E. J. et al. NK cells are intrinsically functional in pigs with Severe Combined Immunodeficiency (SCID) caused by spontaneous mutations in the Artemis gene. Vet. Immunol. Immunopathol. 175, 1–6 (2016).

5. Huang, J. et al. RAG1/2 knockout pigs with severe combined immunodeficiency. J. Immunol. 193, 1496–1503 (2014).

6. Ito, T. et al. Generation of recombination activating gene-1-deficient neonatal piglets: a model of T and B cell deficient severe combined immune deficiency. PLoS One 9, e113833 (2014).

128

7. Lee, K. et al. Engraftment of human iPS cells and allogeneic porcine cells into pigs with inactivated RAG2 and accompanying severe combined immunodeficiency. Proc. Natl. Acad. Sci. 111, 7260 LP-7265 (2014).

8. Suzuki, S. et al. Generation and characterization of RAG2 knockout pigs as animal model for severe combined immunodeficiency. Vet. Immunol. Immunopathol. 178, 37–49 (2016).

9. Suzuki, S. et al. Il2rg gene-targeted severe combined immunodeficiency pigs. Cell Stem Cell 10, 753–758 (2012).

10. Kang, J.T. et al. Biallelic modification of IL2RG leads to severe combined immunodeficiency in pigs. Reprod. Biol. Endocrinol. 14, 74 (2016).

11. Watanabe, M. et al. Generation of interleukin-2 receptor gamma gene knockout pigs from somatic cells genetically modified by zinc finger nuclease-encoding mRNA. PLoS One 8, e76478 (2013).

12. Lei, S. et al. Increased and prolonged human norovirus infection in RAG2/IL2RG deficient gnotobiotic pigs with severe combined immunodeficiency. Sci. Rep. 6, 25222 (2016).

13. Boettcher, A. N. et al. Human Ovarian Cancer Tumor Formation in Severe Combined Immunodeficient (SCID) Pigs . Frontiers in Oncology 9, 9 (2019).

14. Powell, E. J. et al. Creating effective biocontainment facilities and maintenance protocols for raising specific pathogen-free, severe combined immunodeficient (SCID) pigs. Lab. Anim. 23677217750691 (2018). doi:10.1177/0023677217750691

15. Hara, H. et al. Production and rearing of germ-free X-SCID pigs. Exp. Anim. 67, 139– 146 (2018).

16. Dawson, H. D. et al. Structural and functional annotation of the porcine immunome. BMC Genomics 14, 332 (2013).

17. Boettcher, A. N., et al. Development of severe combined immunodeficient (SCID) pig models for translational cancer modeling: future insights on how humanized SCID pigs can improve preclinical cancer research. Front. Oncol. 8: 559 (2018).

18. Bosma, G. C., et al. A severe combined immunodeficiency mutation in the mouse. Nature 301, 527 (1983).

19. Mosier, D. E., et al. Transfer of a functional human immune system to mice with severe combined immunodeficiency. Nature 335, 256 (1988).

129

20. McCune, J. M. et al. The SCID-hu mouse: murine model for the analysis of human hematolymphoid differentiation and function. Science 241, 1632–1639 (1988).

21. Rongvaux, A. et al. Development and function of human innate immune cells in a humanized mouse model. Nat. Biotechnol. 32, 364–372 (2014).

22. Brehm, M. A. et al. Transgenic expression of human IL15 in NOD-scid IL2rg null (NSG) mice enhances the development and survival of functional human NK cells. J. Immunol. 200, 103.20 LP-103.20 (2018).

23. Iwabuchi, R. et al. Introduction of Human Flt3-L and GM-CSF into Humanized Mice Enhances the Reconstitution and Maturation of Myeloid Dendritic Cells and the Development of Foxp3(+)CD4(+) T Cells. Front. Immunol. 9, 1042 (2018).

24. Strowig, T. et al. Transgenic expression of human signal regulatory protein alpha in Rag2-/-gamma(c)-/- mice improves engraftment of human hematopoietic cells in humanized mice. Proc. Natl. Acad. Sci. U. S. A. 108, 13218–13223 (2011).

25. Brehm, M. A., et al. Humanized Mouse Models to Study Human Diseases. Curr. Opin. Endocrinol. Diabetes. Obes. 17, 120–125 (2010).

26. Walsh, N. et al. Humanized mouse models of clinical disease. Annu. Rev. Pathol. 12, 187–215 (2017).

27. Van Duyne, R. et al. The utilization of humanized mouse models for the study of human retroviral infections. Retrovirology 6, 76 (2009).

28. Perlman, R. L. Mouse models of human disease: An evolutionary perspective. Evol. Med. public Heal. 2016, 170–176 (2016).

29. Elsea, S. H. & Lucas, R. E. The Mousetrap: What We Can Learn When the Mouse Model Does Not Mimic the Human Disease. ILAR J. 43, 66–79 (2002).

30. McDermott, S. P., et al. Comparison of human cord blood engraftment between immunocompromised mouse strains. Blood 116, 193–200 (2010).

31. Takenaka, K. et al. Polymorphism in Sirpa modulates engraftment of human hematopoietic stem cells. Nat. Immunol. 8, 1313–1323 (2007).

32. Yamauchi, T. et al. Polymorphic Sirpa is the genetic determinant for NOD-based mouse lines to achieve efficient human cell engraftment. Blood 121, 1316–1325 (2013).

130

33. Kwong, L. S., et al. Signal-regulatory protein alpha from the NOD mouse binds human CD47 with an exceptionally high affinity-- implications for engraftment of human cells. Immunology 143, 61–67 (2014).

34. Boettcher, A. N. et al. Porcine signal regulatory protein alpha binds to human CD47 to inhibit phagocytosis: Implications for human hematopoietic stem cell transplantation into severe combined immunodeficient pigs. Xenotransplantation e12466 (2018). doi:10.1111/xen.12466

35. Powell, E. J. et al. T Cell Lymphoma and Leukemia in Severe Combined Immunodeficiency Pigs following Bone Marrow Transplantation: A Case Report. Front. Immunol. 8, 813 (2017).

36. Buckley, R. H. et al. Post-transplantation B cell function in different molecular types of SCID. J. Clin. Immunol. 33, 96–110 (2013).

37. Pannicke, U. et al. The most frequent DCLRE1C (ARTEMIS) mutations are based on homologous recombination events. Hum. Mutat. 31, 197–207 (2010).

38. Schuetz, C. et al. SCID patients with ARTEMIS vs RAG deficiencies following HCT: increased risk of late toxicity in ARTEMIS-deficient SCID. Blood 123, 281–289 (2014).

39. Yong, K. S. M. et al. Human CD34(lo)CD133(lo) fetal liver cells support the expansion of human CD34(hi)CD133(hi) hematopoietic stem cells. Cell. Mol. Immunol. 13, 605– 614 (2016).

40. Battista, J. M., et al. Hematopoiesis In The Equine Fetal Liver Suggests Immune Preparedness. Immunogenetics 66, 635–649 (2014).

41. Sinkora, M., et al. Lymphocyte development in fetal piglets: facts and surprises. Vet. Immunol. Immunopathol. 108, 177–184 (2005).

42. Sinkora, M. & Butler, J. E. The ontogeny of the porcine immune system. Dev. Comp. Immunol. 33, 273–283 (2009).

43. Sinkora, M., et al. B cell development and VDJ rearrangement in the fetal pig. Vet. Immunol. Immunopathol. 87, 341–346 (2002).

44. Fujiki, Y. et al. Successful multilineage engraftment of human cord blood cells in pigs after in utero transplantation. Transplantation 75, 916–922 (2003).

45. Ogle, B. M., et al. Toward development and production of human T cells in swine for potential use in adoptive T cell immunotherapy. Tissue Eng. Part A 15, 1031–1040 (2009).

131

46. Ogle, B. M. et al. Spontaneous fusion of cells between species yields transdifferentiation and retroviral transfer in vivo. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 18, 548–550 (2004).

47. McConico, A. et al. In utero cell transfer between porcine littermates. Reprod. Fertil. Dev. 23, 297–302 (2011).

48. Marie-Cardine, A. et al. Transitional B cells in humans: characterization and insight from B lymphocyte reconstitution after hematopoietic stem cell transplantation. Clin. Immunol. 127, 14–25 (2008).

49. Ogonek, J. et al. Immune Reconstitution after Allogeneic Hematopoietic Stem Cell Transplantation. Front. Immunol. 7, 507 (2016).

50. Noordzij, J. G. et al. Radiosensitive SCID patients with Artemis gene mutations show a complete B-cell differentiation arrest at the pre–B-cell receptor checkpoint in bone marrow. Blood 101, 1446 LP-1452 (2003).

51. van der Burg, M. et al. B-cell recovery after stem cell transplantation of Artemis- deficient SCID requires elimination of autologous bone marrow precursor-B-cells. Haematologica 91, 1705–1709 (2006).

52. Wesemann, D. R. Microbes and B cell development. Adv. Immunol. 125, 155–178 (2015).

53. Rathinam, C. et al. Efficient differentiation and function of human macrophages in humanized CSF-1 mice. Blood 118, 3119–3128 (2011).

54. Willinger, T. et al. Human IL-3/GM-CSF knock-in mice support human alveolar macrophage development and human immune responses in the lung. Proc. Natl. Acad. Sci. U. S. A. 108, 2390–2395 (2011).

55. Rongvaux, A. et al. Human thrombopoietin knockin mice efficiently support human hematopoiesis in vivo. Proc. Natl. Acad. Sci. U. S. A. 108, 2378–2383 (2011).

56. Chen, Q., et al. Expression of human cytokines dramatically improves reconstitution of specific human-blood lineage cells in humanized mice. Proc. Natl. Acad. Sci. U. S. A. 106, 21783–21788 (2009).

57. Uy, G. L., et al. Plerixafor, a CXCR4 antagonist for the mobilization of hematopoietic stem cells. Expert Opin. Biol. Ther. 8, 1797–1804 (2008).

132

58. Goodrich, A. D. et al. Influence of a dual-injection regimen, plerixafor and CXCR4 on in utero hematopoietic stem cell transplantation and engraftment with use of the sheep model. Cytotherapy 16, 1280–1293 (2014).

59. Kim, J., Zanjani, et al. Generation of CD34+ cells from human embryonic stem cells using a clinically applicable methodology and engraftment in the fetal sheep model. Exp. Hematol. 41, 749–758.e5 (2013).

60. Shultz, L. D., et al. Humanized mice for immune system investigation: progress, promise and challenges. Nat. Rev. Immunol. 12, 786–798 (2012).

61. Lepus, C. M. et al. Comparison of human fetal liver, umbilical cord blood, and adult blood hematopoietic stem cell engraftment in NOD-scid/gammac-/-, Balb/c-Rag1-/- gammac-/-, and C.B-17-scid/bg immunodeficient mice. Hum. Immunol. 70, 790–802 (2009).

62. Ross, J. W. et al. Optimization of square-wave electroporation for transfection of porcine fetal fibroblasts. Transgenic Res. 19, 611–620 (2010).

63. Cong, L. et al. Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819–823 (2013).

64. Whitworth, K. M. et al. Use of the CRISPR/Cas9 system to produce genetically engineered pigs from in vitro-derived oocytes and embryos. Biol. Reprod. 91, 78 (2014).

65. Yang, C.-X. et al. Small RNA profile of the cumulus-oocyte complex and early embryos in the pig. Biol. Reprod. 87, 117 (2012).

66. Wright, E. C., et al. MicroRNA-21 and PDCD4 expression during in vitro oocyte maturation in pigs. Reprod. Biol. Endocrinol. 14, 21 (2016).

133

Figures

Figure 5.1. Use of CRISPR/Cas9 system to generate Art-/- IL2RG-/Y SCID pigs.

(A) Semen from an Art-/- boar was used to inseminate Art-/+ carrier sows. Two pregnant sows were euthanized at 35 days of gestation and fetal fibroblasts were collected. Collected Art-/- fetal fibroblasts were electroporated with PX330 plasmid with sgRNA against IL2RG target site, generating Art-/-IL2RG-/Y mutant fetal fibroblasts (pFF). Once the mutant pFFs lines were established, somatic cell nuclear transfer was performed, and embryos were transferred into surrogate gilts. Piglets born from these litters were delivered via Cesarean section at gestational day 119 and were delivered into biocontainment facilities. (B) SgRNA design to target IL2RG exon 3. Sequence in blue indicates designed gRNA, letters in red reflect PAM sequence (NGG), and arrows indicate the location of primers used to genotype embryos and piglets. (C) Genotype of IL2RG mutation in pFF and cloned pig. Blue letters indicate deleted nucleotide sequence in pFF and cloned pig. Red dashes indicate deletion of nucleotides. PAM sequences are highlighted in red.

134

Figure 5.2. Art-/- IL2RG-/Y SCID pigs lack T, B, and NK cells in peripheral blood and lymphoid organs and T cells can be reconstituted after pig to pig bone marrow transplantation (A) Flow cytometric analysis of major leukocyte populations in wildtype, Art-/-, and Art-/- IL2RG-/Y pigs. Percentages for granulocytes (G), monocytes (M), and lymphocytes (L) are shown for each type of pig. (B) Mononuclear populations were gated from each sample and assessed for presence of monocytes (CD172+ CD3- CD8-), T cells (CD172- CD3+ CD8-/+), and NK cells (CD172-CD3- CD8+). CD172 expression was assessed first, then CD172- populations were assessed for expression of CD3 and CD8. Art-/- IL2RG -/Y pigs lack T and NK cells. (C) Lymph nodes were collected and assessed for T cells (CD3) and B cells (CD79α). (D) One Art-/- IL2RG- /Y SCID piglet underwent a bone marrow transplant. At 4 months post transplantation, MNC were stained for CD172, CD3, and CD8 to assess for donor T and NK cells (left). Complete blood counts were also performed throughout a four month period (right). White blood cell and lymphocyte concentrations increased at every collection point.

135

136

Figure 5.3. Human leukocytes in Art-/- IL2RG-/Y SCID pig cord and peripheral blood after in utero injection of human cells. (A) Art-/- IL2RG-/Y embryos were surgically transferred into a surrogate gilt. At gestational day 41, the pregnant gilt underwent a laparotomy procedure to expose the uterus. Ultrasound guidance was utilized to inject human CD34+ stem cells into the intraperitoneal space of fetal piglets. After surgery, gilts underwent C-section at gestational day 119 and piglets were delivered into biocontainment facilities. (B) Blood was collected from a human and three neonatal (6901, 6902, and 6903) SCID pigs and stained for human and pig CD45, as well as human CD47. All cells in circulation were gated from SCID pigs. Pigs 6901 and 6903 both had human cells in cord blood, as shown by presence of hCD45+ and hCD47+ cells. (C, D, E, F) Peripheral blood was collected from 6901 (day 0), 6902, and 6903 (Day 1) and stained for various human immune cell markers. Whole human blood was stained as a control to show gating strategy. All cells in circulation were gated from SCID pigs, while only lymphocytes and monocytes were gated from the human sample, for the analysis of T, B, and myeloid cells. RBC were also stained separately for human CD47. (C) Presence of human T cells were assessed by staining for human CD45, CD3, CD4, and CD8. CD3+ cells (left) were then assessed for CD4 and CD8α expression (right). Human T cells were present in both 6901 and 6903. Single positive CD4+ and CD8+ cells were also present. (D) Human B cells were assessed by staining for hCD45 and CD20. B cells were not present in any pigs (E) Human myeloid cells were assessed by staining for hCD45 and hCD33. Myeloid cells were not present in any pigs. (F) RBCs were stained for CD47 expression to determine if human erythroid lineage differentiated in SCID pigs. No RBCs from SCID pigs expressed hCD47.

137

Figure 5.4. Human leukocyte engraftment in bone marrow, liver, spleen, and thymic tissue of in utero injected Art -/- IL2RG -/Y SCID pigs. (A) Lymphoid organs from 0 day old (6901) or 7 day old (6902 and 6903) SCID pigs were analyzed for the presence of human leukocytes by staining with human and pig CD45. Bone marrow liver, spleen, and thymic tissue from 6901 and 6903 both contained human CD45+ cells. All cells from isolated bone marrow and thymic tissue were stained, while mononuclear cells from spleen and liver were stained. (B) Human CD45+ cells in isolated cells from thymic tissue expressed human CD3. Black histogram is gated on hCD45+ cells, while grey is hCD45- cells. Human CD4 and CD8α expression was assessed on human CD3+ cells within the thymus.

138

Figure 5.5. Human CD3+ and Pax5+ cells in lymphoid organs of in utero injected Art -/- IL2RG -/Y SCID pigs Lymphoid tissues were collected and stained for (A) CD3 and (B) Pax5. (A) Thymic tissues from 6901 and 6903 were robustly populated with CD3+ cells, and CD3+ cells were also present in periarteriolar sheaths within the spleen. The ileum tissue from both animals had punctate CD3+ cells (black arrows); CD3+ cells were also present within mesenteric lymph nodes (LN). Lymphoid tissues from 6902 did not contain CD3+ cells. (B) Spleen from both 6901 and 6903 had punctate Pax5+ cells. Only the mesenteric LN in 6901 had Pax5+ cells. No Pax5+ cells were found in tissues from 6902.

139

Tables

Table 5.1. Flow cytometry antibodies used for assesing pig and human cell subsets

Purpose Marker Clone Fluorophore Company

pCD3 BB23-8E6-8C8 PE-Cy7 BD Bioscience pCD8α 76-2-11 PE BD Bioscience pCD172 72-22-15A FITC BioRad pCD16 G7 x BioRad

Porcine anti ms IgG1 RMG-1-1 BV421 BioLegend pCD21 BB6-11C9.6 Alexa Fluor 647 Southern Biotech

Immunophenotyping hCD79α HM47 PE Invitrogen pCD45 LS-C127705 FITC LSBio hCD45-biotin HI30 x eBioscience SA-PeCy5 x PE-Cy5 BD Bioscience hCD20 2H7 PE BioLegend hCD3 UCHT1 X BioLegend Anti ms IgG1/IgG2a BV421 BD Bioscience hCD56 B159 PE-Cy7 BD Bioscience hCD33 WM53 PE BioLegend hCD11b ICRF44 PE-Cy7 BioLegend hCD4 RPA-T4 PE-Cy7 BioLegend hCD8a HIT8a PE BioLegend

Human immunophenotyping hCD15 H198 PE Invitrogen hCD34 AC136 APC Miltenyi hCD47 B6H12 x eBioscience Anti ms IgG1 Cat #1072-09 PE Southern Biotech

140

Supplemental Figures

Figure 5.S1. B cells are absent in Art-/- IL2RG-/Y pigs.

Whole blood was stained for CD3 and CD21 from a wildtype, Art-/- and Art-/- IL2RG-/Y pigs. Art-/- pigs lack B cells, although they have a “leaky” T cell phenotype. Art-/- IL2RG-/Y pigs do not have T or B cells in circulation.

141

Figure 5.S2. Lymphoid organs from wildtype and Art-/- IL2RG-/Y pigs.

Art-/- IL2RG-/Y pigs lack a thymus, have an atrophied spleen, as well as lack mesenteric lymph nodes. Blue arrows indicate thymus. Yellow arrow indicates mesenteric lymph nodes.

142

Figure 5.S3. Decreased engraftment and differentiation of B cells in an Art-/- IL2RG-/Y SCID pig 5 months post bone marrow transplant.

Whole blood was collected from a wildtype and BMT Art-/- IL2RG-/Y SCID pig and stained for CD3, CD79α, and CD21. Lymphocytes were gated and first assessed for expression of CD3. The CD3 negative population was then assessed for expression of CD21 and CD79α. The BMT SCID pig has normal proportions of T cells, while lacking a B cell population.

143

Figure 5.S4. Human CD45 and CD34 expression on IU injected stem cells.

Human CD34+ stem cells were isolated from cord blood and cultured for 7 days prior to in utero injections with FLT-3L, stem cell factor, and thrombopoietin. Piglet 6901 was injected with cultured stem cells from Cord 1, while piglet 6903 was injected with stem cells from either Cord 1 or Cord 2.

144

Figure 5.S5. Species specific antibodies utilized to detect human cells in IU injected SCID pigs.

Whole blood was collected from a human and a wild type pig and stained for a variety of markers found in lymphoid, myeloid, and granulocytes. Markers and clones are labeled above; specific antibody information can be found in Table 5.1. All cells were gated for the analysis of pCD45, hCD45, and hCD47. Only monocytes were gated for the analysis of hCD33 and hCD11b. Only granulocytes were gated for the analysis of hCD15. Only lymphocytes were gated for the analysis of hCD3, hCD20, hCD4, hCD8.

145

Figure 5.S6. Gross visualization of mesentery and remnant thymic tissue of Art-/- IL2RG-/Y pigs that underwent IU injection of human cells.

Pigs 6901 and 6903 were found to have circulating human leukocytes, while 6902 did not. Some remnant thymic tissue is present on all pigs; 6903 appears to have slightly more. Pigs 6901 and 6903 have lymph node structures present in the mesentery, while 6902 does not. White arrows indicate presence of thymic tissue or mesenteric lymph nodes.

146

Supplemental Tables

Figure 5.S1 Primers used for genotyping fetal fibroblast lines and cloned piglets

Primer Sequence (5’- 3’) PCR protocol

SRY-F ATGGACGTGAAACTAGAGGAAG 94˚C for 5 min, 30 cycles of 94˚ for 30s, 60˚C for 30 s, and 72˚C for 35 s, followed SRY-R TGTGAGTGACTTAACTGGCTTT by 72˚C for 5 minutes

IL2RG F1 GGACCAAGAAAGAGGTTAGCCAG 95˚C for 5 min, 38 cycles of 94˚ for 30s, 58˚C for 30 s, and 72˚C for 30 s, followed IL2RG R1 CGGCTTTTGTTTACTTGTCTGTC by 72˚C for 5 minutes

ART16 F CTCAGTGGGTTAGGGACCTG 95˚C for 2 min, 38 cycles of 94˚ for 30s, 54˚C for 30 s, and 72˚C for 30 s, followed ART16 R GCCATCTGATAGGGTTTCCA by 72˚C for 5 minutes

ART12 F GCTAAAGTCCAGGCCAGTTG 95˚C for 2 min, 38 cycles of 94˚ for 30s, 54˚C for 30 s, and 72˚C for 30 s, followed ART12 R CAAGAGTCCCCACCAGTCTT by 72˚C for 5 minutes

147

Table 5.S2. Primers used to test potential off-target mutagenesis

Potential target Product Off target gene Accession Location Target (crRNA, DNA) Primers (F, R) (5'-3') length mutagenesis

Chr. 3: ENSSSCG00 GGCCACTATCTATTCTCTG-ANGG TGTGGTCCAACAATCCACAAC VPS54 81,716,210- 382 no 000027509 81,779,070 GGCCAaTcTCTATTCTCTGTgTGG AAAGAGGTTTCCTGAGTGCCAT Chr. 7: ENSSSCG00 GGCCACTATCT--ATTCTCTGANGG CAAAAACCACAGTCCAGCCC POLH 44,152,193- 261 no 000001683 44,184,675 GGCCACcATCTGGATaCTCTGtTGG ATAGTCCGAGTGTTCTGGCG Chr. 4: ENSSSCG00 G--GCCACTATCTATTCTCTGANGG CGGGAACCAACGGACGTATAG JPH1 67,243,406- 214 no 000006174 67,423,310 GAGGCCACTgTCTgTgCTCTGAAGG ACTCTCCTCTGTCTTTGGGATAA Chr. 5: ENSSSCG00 GGCCACTAT-CTATTCTCTGANGG GCTAGTACTTGGTCAGAGATTGGA GRIN2B 62,070,371- 212 no 000000614 62,272,186 GGCCAaTATTaTATTCaCTGATGG ATGTAGGGTGTGTGTGGTCTG Chr. 13: ENSSSCG00 GGCCACTAT-CTATTCTCTGANGG GAAGAGTACTAGCTGTTCAAATTGT VEPH1 105,238,633- 220 no 000011726 105,486,983 GGCtgCTATTCTgTTCTCTGAGGG ACCTGTTCAGCTTTCCCTGG Chr. 13: ENSSSCG00 GGCCACTATC--TATTCTCTGANGG GGCAGAAACTGTAGTCTGCTTT HHLA2 160,195,017- 152 no 000027275 160,239,674 caCCACTATaCTTATTCTCTGATGG GCTCTTGTCATCGCATACTGTTC Chr. 2: ENSSSCG00 GGCCACTATCT--ATTCTCTGANGG ATTTGGGTGGAGATTGCTCAGT RASA1 97,400,410- 214 no 000014146 97,515,957 ttCCACTATCTTAATTCTCaGATGG TCACAAAGCATCCAGAGAAAGATG Chr. 15: ENSSSCG00 GGCCACT--ATCTATTCTCTGANGG CAGCATCACTTTGTTCCCCA ASB5 44,410,073- 279 no 000030395 44,464,546 GGCCACTGCAaCgATTaTCTGAAGG AGCAGACTCTATGTGGGTAAAGC Chr. 14: ENSSSCG00 GGCCACTATCTAT--TCTCTGANGG AGAGAGTTGGCATAACACCCTG PLPP4 141,831,969- 385 no 000010691 141,983,156 GGCCACTATaTAaCCTCTCaGATGG ACGCTGGCCTTTTCTCTTTTTC Chr. 14: ENSSSCG00 GGCCACTATC--TATTCTCTGANGG CTGAACCAGAACTTCCTACCTCG SLC353 60,839,431- 200 no 000010162 60,934,051 aGCCACTAgCTTcATTCTCTGAAGG GGGAAGGTGGACGAGATGAC

148

Table 5.S3. Artemis genotype and MHC information for pFF cell lines

Fibroblast ID Sex Genotype MHC Additional Information

7709-FB1 M 16/+ 26.6/68.19a 7709-FB2 M 12/+ 35.12a/68.19a 7709-FB3 F 12/+ 26.6/68.19a 7709-FB4 F 12/12 26.6/35.12a 7709-FB5 F 12/12 26.6/35.12a 7709-FB6 M 16/+ 26.6/68.19a Anticipated SLA donor 7709-FB7 F 12/+ 26.6/68.19a 7707-FB1 M 12/12 26.6/68.19a Mutagenized line 7707-FB2 M 12/16 26.6/68.19a 7707-FB3 F 12/+ 35.12a/68.19a 7707-FB4 M 12/+ 35.12a/68.19a 7707-FB5 M 12/+ 35.12a/35.12a 7707-FB6 M 12/+ 26.6/35.12a

149

Table 5.S4. The efficiency of CRISPR/Cas9-mediated IL2RG mutations in Art -/ - pFFs

Mutant alleles Cell Genotype Sex (Mutated colony/tested colonies)

Art -/- Male 5/202 (2.5%)

150

Table 5.S5. Somatic cell nuclear transfer results in embryos for transfer to fertile recipients

No. of No. (%)of No. (%) of No. of ET No. (%) of pigs Donor cell type embryos pregnancies term recipients born transferred at day 30 pregnancies

-/- -/Y 920 5(0.5%) Art IL2RG 7 4 (57) 2 (30) Art-/+ 512 0

151

Table 5.S6. Humanization attempts in single mutant Art -/- pigs by intravenous and intraosseous injection

Injection Cell dosage Busulfan Animal ID route (cells/kg) conditioning Time on trial

2 doses of 2mg 202-05 IV 217,000 10 weeks Busulfan (2.3 kg) 202-06 IV 271,000 x 10 weeks 202-07 IV 304,000 x 14 weeks 203-01 IV 105,000 x 10 weeks 2 doses of 4 mg 203-02 IV 105,000 15 weeks Busulfan (4.7 kg) 203-05 IV 216,000 x 15 weeks 202-09 IV 111,111 x 14 weeks 226-07 IO 9,180,000 x 7 weeks 227-05 IV 17,870,000 x 9 weeks 227-07 IO 5,900,000 x 9 weeks

152

Table 5.S7. Somatic cell nuclear transfer embryos for transfer into fertile recipients for in utero injection of human cells

No. of No. of No. of No. of No. of Donor cell No. of ET No. of term pigs embryos pigs in pigs humanized type recipients pregnancies injected transferred utero born pigs in utero

Art-/- IL2RG-/Y 320 1 1 (100%) 6 3 3 2

153

CHAPTER 6

HUMAN OVARIAN CANCER TUMOR FORMATION IN SEVERE COMBINED IMMUNODEFICIENT (SCID) PIGS

Accepted for publication in Frontiers in Oncology on January 3, 2019. Published on January 22, 2019.

Adeline N. Boettcher1, Matti Kiupel2, Malavika Adur,1 Emiliano Cocco3, Alessandro D. Santin3, Stefania Bellone3, Sara E. Charley1, Barbara Blanco-Fernandez5, John Risinger4, Christopher K. Tuggle1, and Erik M. Shapiro5

1 Iowa State University, Department of Animal Science, Ames, IA, USA 2Diagnostic Center for Population and Animal Health, Michigan State University, East Lansing, Michigan 3 Department of Obstetrics, Gynecology and Reproductive Sciences, Yale University School of Medicine, New Haven, Connecticut 4 Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapid, Michigan 5 Department of Radiology, Michigan State University, East Lansing, Michigan.

Author Contributions

AB was involved in SCID pig cell injections, compiling data, and writing manuscript. MK performed histological analyses and provided histological descriptions. MA was involved in SCID pig cell injections. EC, AS, SB, and BBF were involved with SCID mouse cell injections and human sample collection. JR was involved in experimental design. CT injected cells into pigs and performed dissections. CT and ES designed experiment and reviewed data. All authors were involved in editing the manuscript.

Abstract

Ovarian cancer (OvCa) is the most lethal gynecologic malignancy, with two-thirds of patients having late-stage disease (II-IV) at diagnosis. Improved diagnosis and therapies are needed, yet preclinical animal models for ovarian cancer research have primarily been restricted to rodents, for data on which can fail to translate to the clinic. Thus, there is currently a need for a large animal OvCa model. Therefore, we sought to determine if pigs,

154 being more similar to humans in terms of anatomy and physiology, would be a viable preclinical animal model for OvCa. We injected human OSPC-ARK1 cells, a chemotherapy- resistant primary ovarian serous papillary carcinoma cell line, into the neck muscle and ear tissue of four severe combined immune deficient (SCID) and two non-SCID pigs housed in novel biocontainment facilities to study the ability of human OvCa cells to form tumors in a xenotransplantation model. Tumors developed in ear tissue of three SCID pigs, while two

SCID pigs developed tumors in neck tissue; no tumors were detected in non-SCID control pigs. All tumor masses were confirmed microscopically as ovarian carcinomas. The carcinomas in SCID pigs were morphologically similar to the original human ovarian carcinoma and had the same immunohistochemical phenotype based on expression of

Claudin 3, Claudin 4, Cytokeratin 7, p16, and EMA. Confirmation that OSPC-ARK1 cells form carcinomas in SCID pigs substantiates further development of orthotopic models of OvCa in pigs.

Introduction

Ovarian cancer (OvCa) is the most lethal among gynecologic malignancies, taking an estimated 14,000 lives in the United States in 2018 (1). OvCa often goes undetected until late stages due to non-specificity of its early symptoms, hence 2/3 of patients have late-state disease (stage III- IV) at diagnosis. The current standard of care is debulking surgery to remove tumor masses followed by first-line platinum and Taxol chemotherapy (2). Debulking is critical to successful chemotherapy, and so prior identification of tumor masses by diagnostic imaging often plays a key role in pre-surgical planning. X-ray computer tomography (CT) (3) is the most widely used imaging modality for evaluating peritoneal

155 spread in OvCa for presurgical planning, yet there are well acknowledged “blind-spots” where tumor spread simply cannot be seen as the contrast between normal tissue and tumors is insufficient to discriminate one tissue type from another. Thus, tumors can be missed, leading to incomplete tumor resection. Methods to enhance tumor detection are being developed for a variety of imaging modalities, including magnetic resonance imaging

(MRI) and positron emission tomography (PET), making use of various targeting mechanisms to specifically target ovarian cancers. For example, small peptides and molecules including

OTL38 (4), GE11 (5), and CPE (6–9), which bind to folate receptor, EGFR, and claudins, respectively, have been successfully tested in preclinical mouse trials. Clinical trials for use of

OTL38 are already beginning to recruit patients with folate receptor positive ovarian cancer for the use of this fluorescent molecule during cytoreduction or debulking surgeries (10).

Current research to improve imaging technologies and methodologies uses either human volunteers or rodent models. Imaging research involving human OvCa patients is challenging for a variety of reasons. For imaging modalities which involve significant radiation, such as CT, extensive research cannot be performed due to radiation dose.

Second, it is challenging to perform serial imaging research on OvCa patients due to ongoing treatment regimens and patient morbidity. Such serial scans could be useful in developing predictive imaging capability derived from a multiparametric data set (11). Development of imaging strategies on rodents poorly informs how one approaches the clinical scenario. This is due to the size of the animal and the tumors, as well as the equipment that are used in animal imaging experiments. Small tumors exhibit different perfusion (12) and water diffusion (13) from large tumors. Small animals have different metabolism than large animals

156 and exhibit vastly different pharmacology of administered drugs (14), while humans and pigs have similar liver content of cytochrome proteins (15,16). All of these characteristics, and many more, influence imaging results.

It is not always practical to use human OvCa patients for developing or validating new imaging techniques, and rodents are inadequate for developing clinically relevant imaging protocols. Recently there is a new hybrid field of molecular imaging and surgery called optical surgical navigation (17). This field couples fluorescence imaging with surgery to enhance surgical removal of tumors by way of fluorescent marker uptake. The translational value of new fluorescent tracers, either targeted or untargeted, can only be meaningfully evaluated in the context of a research subject that has appropriate size and physiology to

OvCa patients. A pig model of OvCa could fill this crucial gap.

Human cancer xenotransplantation studies have not been possible in pigs until the recent identification (18) or creation (19–22) of severe combined immunodeficient (SCID) pigs (23) . SCID pigs have previously been reported to accept grafts of human melanoma

(A375SM) and pancreatic carcinoma (PANC-1) cancer cell lines (24), as well as human induced pluripotent stem cells (25). In addition to xenotransplantation methods of studying cancer, genetic models of porcine cancer have also been developed. Inducible and germline mutations of TP53R167H (26,27) and KRASG12D (28,29) have been introduced into pigs, which are useful in studying lymphomas, osteogenic tumors, renal tumors, and others. These neoplasms were detected with computed tomography (CT), magnetic resonance imaging

(MRI), and ultrasound imaging systems (27), exemplifying the pig’s utility as an imaging animal model system.

157

To initiate the development of a large animal model of ovarian cancer, we tested whether human ovarian cancer cells could survive and develop ectopic tumors in SCID pigs.

OSPC-ARK1 cells, derived from an ovarian serous papillary carcinoma (OSPC), were injected into male and female SCID pigs and were monitored for tumor development for this first stage screen. We demonstrate that OSPC-ARK1 derived carcinomas developed in three of four SCID pigs tested. Additionally, we verified an immunophenotype comparable to human patient OSPC samples based on the expression of Claudin 3, Claudin 4, Cytokeratin 7, p16, and EMA in SCID pig carcinomas. In summary, we demonstrate that SCID pigs can successfully develop OSPC-ARK1 carcinomas, which warrants further development of an orthotopic SCID pig model of ovarian cancer.

Results

OSPC-ARK1 cells injected into SCID pigs develop carcinomas

To assess if human ovarian carcinomas could develop in SCID pigs, a total of four SCID

(S1, S2, S3, and S4) and two non-SCID (NS1 and NS2) pigs were injected with OSPC-ARK1 cells. Due to limited female SCID availability, we injected two female and two male SCID pigs in this initial study to answer our question of if OSPC-ARK1 cells were capable of developing tumors ectopically in immunocompromised pigs. Four sites were injected in each pig; one subcutaneous on each ear, and one intramuscular on each side of the neck. We decided to inject in these superficial sites such that we could easily and noninvasively monitor tumor growth over time. Evidence of growth in these sites would warrant injection into a more physiologically relevant area, such as the peritoneum or ovary of female SCID pigs.

158

Palpable tumors were observed on the ears of three SCID pigs prior to euthanasia. S1 and S2 were euthanized at 13 and 30 days after neoplastic cell inoculation and no grossly visible tumors were observed on the neck sites of injection. S3 was euthanized 11 days after injection and tumors were observed on the left and right ears. S4 was euthanized 7 days after injection, at which point a tumor was detected on the right ear (Figure 6.1). Wild-type animals, NS1 and NS2, did not have visible tumors at 30 days post injection. Table 6.1 shows an overview of locations of carcinoma development in the six pigs.

At euthanasia, samples from each injection site were collected and fixed, and H&E staining and analysis was used to determine if tumor architecture was present. Of the four

SCID pigs injected, ovarian carcinomas were present in three animals in at least one injection site. S1 and S3 (Figure 6.1) developed carcinomas in the neck. S1, S3, and S4 all developed carcinomas within the ear tissue. S3 had carcinoma present in all four injection locations. In all cases neoplastic cells incited and were surrounded by an extensive scirrhous response.

Most commonly, neoplastic cells formed small nests, solid cords or elongated cleft like glandular structures that were lined by anaplastic neoplastic cells. There was marked anisocytosis and anisokaryosis and the degree of cellular pleomorphism and the remarkable scirrhous response are characteristic findings of high grade serous ovarian carcinomas. In summary, we were able to demonstrate that OSPC-ARK1 cells were able to successfully form ovarian carcinomas in SCID pigs.

159

OSPC-ARK1 carcinomas in SCID pigs maintain expression of common ovarian carcinoma diagnostic markers

We next wanted to determine if ovarian carcinoma protein marker expression were retained in the pig xenotransplants. OSPC-ARK1 cells, the original human carcinoma

(neoplasm from which the OSPC-ARK1 cell line was derived), and OSPC-ARK1 derived carcinomas in SCID pigs and SCID mice were subjected to immunohistochemical analysis

(Figure 6.2). S1 (female) is shown in Figure 6.2. We assessed the expression of p16, epithelial membrane antigen (EMA), cytokeratin 7 (CK7), which have previously been used in diagnostic panels (31); we also assessed expression of Claudin 3 and 4 in all samples.

Expression of CK7, p16, and EMA were all highly similar in tissue samples from all three species, as well as in the pellets generated from the OSPC-ARK1 cell line. Importantly,

Claudin 3 and 4 expression in SCID pig carcinomas was also highly similar to the observed expression pattern in the original human carcinoma. In summary, OSPC-ARK1 carcinomas in

SCID pigs have the same immunophenotype as the original ovarian carcinoma from a human patient.

Discussion

We have described the successful development of human OSPC-ARK1 carcinomas in

SCID pigs. Injected sites were verified histopathologically as true carcinomas. We additionally showed that tumors in SCID pigs phenotypically resembled human ovarian carcinomas through assessing the expression of OvCa protein markers CK7, p16, and EMA (31).

Furthermore, we showed that tumors in SCID pigs retained expression of Claudin 3 and

160

Claudin 4, which we have previously used as an imaging and therapeutic target in mouse models (6–8).

The ability of human ovarian tumors to grow in SCID pigs warrants further development of an orthotopic model of this cancer. The capability to study a human tumor in a non-rodent species is critically important as it would allow researchers and medical practitioners to utilize imaging modalities that are used in clinical settings. Additionally, there are many cases where progression from early-stage to late-stage occurs rapidly and can often happen within the span of a few months. We have raised SCID pigs for up to 6 months (unpublished results) in biocontainment facilities (30), which would allow long term trials that are required for studying spread and metastasis to be performed. The SCID pigs used in this study have natural mutations in Artemis (18), which is a critical component of the VDJ recombination pathway required for TCR and BCR development, and thus have a T-

B- NK+ cellular phenotype. NK cells are functional in our SCID model in in vitro assays (32), which could have anti-tumor activity on human cancer cells as evidenced by the absence of tumor development in S2. Thus, use of a T- B- NK- SCID pig may better facilitate human ovarian tumor growth.

Pigs and humans share more similar reproductive tract sizes and structures than mice. In this initial trial, tumor growth from the OSPC-ARK1 cell line was not dependent on the sex of the animal. However, as we develop this model further, we would inject OSPC-

ARK1 cells into the peritoneum or ovarian bursa in female SCID pigs. Such orthotopic tumor sites would allow for new imaging research to be initiated in SCID pigs. Studies involving surgical practices cannot be efficiently performed in mice because tumors are too small.

161

Moving forward, it will be an important step to test human specific imaging targets (CPE, folate, GE11) and systems (PET, MRI) in SCID pigs xenografted with human tumors.

We have previously utilized the CPE peptide to either label tumors with a fluorescent marker (8) or deliver a suicide gene (9) to the site of ovarian tumors mice. Inoculation of

OSPC-ARK1 cells into SCID pigs would allow for methods, dosages, efficacy, and safety of the

CPE peptide to be established. Additionally, injection of fluorescently labeled CPE would allow for surgical practices to be performed for use of this peptide in marking smaller tumors that are difficult to detect by commonly used imaging practices. The pigs would be of comparable size to humans, so dosages of the peptide would be relevant as well. In all, confirming that human ovarian carcinomas can successfully develop in SCID pigs provides a basis for further development of an orthotopic OvCa model in pigs.

Materials and Methods

Generation and care of piglets

Wildtype and Art-/- piglets were generated as described (18) and were housed in positive pressure biocontainment bubble facilities (30). All animal protocols and procedures were approved by Iowa State University’s Institutional Animal Care and Use Committee

(IACUC).

Human tissue collection

Informed consent was obtained from human subjects and was approved by the Yale

Institutional Review Board. The OSPC-ARK1 primary ovarian cell line used in this study was established from samples collected at the time of tumor recurrence from a patient harboring stage IV ovarian serous papillary carcinoma.

162

Cell preparation and injections

SCID pigs: OSPC-ARK1 cells were grown in complete RPMI media (10% FBS, 50μg/mL gentamycin, 10 mM HEPES) until 80-100% confluent. Cells were trypsinized and washed five times in sterile phosphate buffered saline (PBS). Cells were then counted with a hemocytometer and were brought to a concentration of 50 x 106 cells/mL.

Animals were anesthetized with isoflurane. A total of six pigs were used in two independent experiments. Injection sites were marked, and all animals were injected subcutaneously in the right and left ear and intramuscularly into the right and left side of the neck. In the first trial, four 43 day old pigs (S1, S2, NS1, and NS2) were injected with 5 million cells in a 100 μL PBS cell suspension. In the second trial, two 18 day old SCID pigs (S3 and S4) were injected with the same number and volume of cells in the same locations. The SCIDs in trial 1 were female, while the SCIDs in trial 2 were male. Table 7.1 shows an overview of piglet ID, sex, trial, genotype, age at trial end, and locations of carcinoma formation.

SCID mice: C.B-17/SCID female mice 5–7 weeks old were purchased from Harlan

Sprague-Dawley (Indianapolis, IN) and housed in a pathogen-free environment. They were given basal diet and water ad libitum. All animal protocols and procedures were approved by

Yale University’s IACUC. OPSC-ARK1, a chemotherapy-resistant primary ovarian serous papillary carcinoma cell line, was used to develop a xenograft model. OPSC-ARK1 cancer cell line was injected IP at a dose of 7 million cells.

Tissue collection and processing

Tissues were collected at the marked injection sites and fixed in 10% neutral buffered formalin for 24 hours, at which point they were transferred to 70% ethanol. Following

163 routine processing, tissues were embedded into paraffin and serial sections were cut at 5 µm thickness. Slides were either stained with hematoxylin and eosin or used for immunohistochemical labeling. In addition, OPSC-ARK1 cells were harvested and fixed in

10% neutral buffered formalin for 24 hours and transferred to 60% alcohol. Following centrifugation, cell pellets were harvested and suspended in liquid histogel (Thermo Fisher

Scientific, Ann Arbor, MI, USA). After the histogel had solidified, samples were transferred to

60% alcohol followed by routine tissue processing and embedding into paraffin. Serial sections were cut at 5 µm thickness and processed in parallel to the tissue samples.

Immunohistochemistry

Serial sections of the pig tumors and the cell line were routinely labeled with immunohistochemistry for Claudin 3, Claudin 4 (both Thermo Fisher Scientific, Ann Arbor,

MI, USA), Cytokeratin 7 (Agilent, Santa Clara, CA, USA), p16 (BD Biosciences, Franklin lakes,

NJ, USA), and EMA (LifeSpan BioSciences, Seattle, WA, USA). In addition, OPSC-ARK1 xenotransplant tumors from mice and sections of the original biopsy of this neoplasm that had been processed in a similar manner as the pig tissues were run as controls.

Immunohistochemistry was performed on the Dako link 48 Automated Staining System

(Agilent Technologies, Santa Clara, CA, USA) using the peroxidase conjugated EnVision

Polymer Detection System (Agilent Technologies, Santa Clara, CA, USA) for all antibodies.

Briefly, endogenous peroxidases were neutralized with 3% hydrogen peroxide for 5 minutes.

Antigen retrieval was achieved by incubating slides in either low pH (Claudin 3, Claudin 4 and

EMA) or a high pH (EMA) retrieval solution for 20 mins on the Dako PT link (Agilent

Technologies, Santa Clara, CA, USA) or through 20 minutes of protein digestion with

164 proteinase K (Cytokeratin 7). Non-specific immunoglobulin binding was blocked by incubation of slides for 10 min with a protein-blocking agent (Agilent Technologies, Santa

Clara, CA, USA). Using the Dako autostainer, slides were incubated for 30 minutes with a rabbit polyclonal anti-human Claudin 3 antibody (#34-1700), a mouse monoclonal anti- human Claudin 4 antibody (clone 3E2C1), a mouse monoclonal anti-human Cytokeratin 7 antibody (clone OV-TL 12/30), a rabbit polyclonal anti-human EMA antibody (#LS-C30532) and a mouse monoclonal anti-human p16 antibody (clone G175-405) at dilutions of 1:100,

1:250, 1:75, 1:500 and 1:100, respectively. The immunoreactions were visualized with 3,3- diaminobenzidine substrate (Dako, Carpinteria, CA). Sections were counterstained with

Mayer’s haematoxylin.

References

1. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2018. CA Cancer J Clin (2018) 68:7–30. doi:10.3322/caac.21442

2. Raja FA, Chopra N, Ledermann JA. Optimal first-line treatment in ovarian cancer. Ann Oncol Off J Eur Soc Med Oncol (2012) 23 Suppl 1:x118-27. doi:10.1093/annonc/mds315

3. Chandrashekhara SH, Triveni GS, Kumar R. Imaging of peritoneal deposits in ovarian cancer: A pictorial review. World J Radiol (2016) 8:513–517. doi:10.4329/wjr.v8.i5.513

4. Hoogstins CES, Tummers QRJG, Gaarenstroom KN, de Kroon CD, Trimbos JBMZ, Bosse T, Smit VTHBM, Vuyk J, van de Velde CJH, Cohen AF, et al. A Novel Tumor-Specific Agent for Intraoperative Near-Infrared Fluorescence Imaging: A Translational Study in Healthy Volunteers and Patients with Ovarian Cancer. Clin Cancer Res (2016) 22:2929– 2938. doi:10.1158/1078-0432.CCR-15-2640

5. Rahmanian N, Hosseinimehr SJ, Khalaj A, Noaparast Z, Abedi SM, Sabzevari O. (99m)Tc-radiolabeled GE11-modified peptide for ovarian tumor targeting. Daru (2017) 25:13. doi:10.1186/s40199-017-0179-8

6. Santin AD, Cane S, Bellone S, Palmieri M, Siegel ER, Thomas M, Roman JJ, Burnett A, Cannon MJ, Pecorelli S. Treatment of chemotherapy-resistant human ovarian cancer

165

xenografts in C.B-17/SCID mice by intraperitoneal administration of Clostridium perfringens enterotoxin. Cancer Res (2005) 65:4334–4342. doi:10.1158/0008- 5472.CAN-04-3472

7. Cocco E, Casagrande F, Bellone S, Richter CE, Bellone M, Todeschini P, Holmberg JC, Fu HH, Montagna MK, Mor G, et al. Clostridium perfringens enterotoxin carboxy-terminal fragment is a novel tumor-homing peptide for human ovarian cancer. BMC Cancer (2010) 10:349. doi:10.1186/1471-2407-10-349

8. Cocco E, Shapiro EM, Gasparrini S, Lopez S, Schwab CL, Bellone S, Bortolomai I, Sumi NJ, Bonazzoli E, Nicoletti R, et al. Clostridium perfringens enterotoxin C-terminal domain labeled to fluorescent dyes for in vivo visualization of micrometastatic chemotherapy-resistant ovarian cancer. Int J cancer (2015) 137:2618–2629. doi:10.1002/ijc.29632

9. Cocco E, Deng Y, Shapiro EM, Bortolomai I, Lopez S, Lin K, Bellone S, Cui J, Menderes G, Black JD, et al. Dual-Targeting Nanoparticles for In Vivo Delivery of Suicide Genes to Chemotherapy-Resistant Ovarian Cancer Cells. Mol Cancer Ther (2017) 16:323–333. doi:10.1158/1535-7163.MCT-16-0501

10. ClinicalTrials.gov. OTL38 for Intra-operative Imaging of Folate Receptor Positive Ovarian Cancer. Natl Libr Med Available at: https://clinicaltrials.gov/ct2/show/NCT03180307?term=otl38&rank=3

11. Sala E, Kataoka MY, Priest AN, Gill AB, McLean MA, Joubert I, Graves MJ, Crawford RAF, Jimenez-Linan M, Earl HM, et al. Advanced ovarian cancer: multiparametric MR imaging demonstrates response- and metastasis-specific effects. Radiology (2012) 263:149–159. doi:10.1148/radiol.11110175

12. Spencer RP. Blood flow in transplanted tumors: quantitative approaches to radioisotopic studies. Yale J Biol Med (1970) 43:22–30.

13. Guo AC, Cummings TJ, Dash RC, Provenzale JM. Lymphomas and high-grade astrocytomas: comparison of water diffusibility and histologic characteristics. Radiology (2002) 224:177–183. doi:10.1148/radiol.2241010637

14. Musther H, Olivares-Morales A, Hatley OJD, Liu B, Rostami Hodjegan A. Animal versus human oral drug bioavailability: Do they correlate? Eur J Pharm Sci (2014) 57:280– 291. doi:10.1016/j.ejps.2013.08.018

15. Dalgaard L. Comparison of minipig, dog, monkey and human drug metabolism and disposition. J Pharmacol Toxicol Methods (2015) 74:80–92. doi:10.1016/j.vascn.2014.12.005

166

16. Skaanild MT. Porcine cytochrome P450 and metabolism. Curr Pharm Des (2006) 12:1421–1427.

17. Harmsen S, Teraphongphom N, Tweedle MF, Basilion JP, Rosenthal EL. Optical Surgical Navigation for Precision in Tumor Resections. Mol Imaging Biol (2017) 19:357–362. doi:10.1007/s11307-017-1054-1

18. Waide EH, Dekkers JCM, Ross JW, Rowland RRR, Wyatt CR, Ewen CL, Evans AB, Thekkoot DM, Boddicker NJ, Serão NVL, et al. Not All SCID Pigs Are Created Equally: Two Independent Mutations in the Artemis Gene Cause SCID in Pigs. J Immunol (2015) 195:3171 LP-3179. Available at: http://www.jimmunol.org/content/195/7/3171.abstract

19. Kang J-T, Cho B, Ryu J, Ray C, Lee E-J, Yun Y-J, Ahn S, Lee J, Ji D-Y, Jue N, et al. Biallelic modification of IL2RG leads to severe combined immunodeficiency in pigs. Reprod Biol Endocrinol (2016) 14:74. doi:10.1186/s12958-016-0206-5

20. Huang J, Guo X, Fan N, Song J, Zhao B, Ouyang Z, Liu Z, Zhao Y, Yan Q, Yi X, et al. RAG1/2 knockout pigs with severe combined immunodeficiency. J Immunol (2014) 193:1496–1503. doi:10.4049/jimmunol.1400915

21. Watanabe M, Nakano K, Matsunari H, Matsuda T, Maehara M, Kanai T, Kobayashi M, Matsumura Y, Sakai R, Kuramoto M, et al. Generation of interleukin-2 receptor gamma gene knockout pigs from somatic cells genetically modified by zinc finger nuclease-encoding mRNA. PLoS One (2013) 8:e76478. doi:10.1371/journal.pone.0076478

22. Ito T, Sendai Y, Yamazaki S, Seki-Soma M, Hirose K, Watanabe M, Fukawa K, Nakauchi H. Generation of recombination activating gene-1-deficient neonatal piglets: a model of T and B cell deficient severe combined immune deficiency. PLoS One (2014) 9:e113833. doi:10.1371/journal.pone.0113833

23. Boettcher AN, Loving CL, Cunnick JE, Tuggle CK. Development of severe combined immunodeficient (SCID) pig models for translational cancer modeling: future insights on how humanized SCID pigs can improve preclinical cancer research. Front Oncol (2018)

24. Basel MT, Balivada S, Beck AP, Kerrigan MA, Pyle MM, Dekkers JCM, Wyatt CR, Rowland RRR, Anderson DE, Bossmann SH, et al. Human Xenografts Are Not Rejected in a Naturally Occurring Immunodeficient Porcine Line: A Human Tumor Model in Pigs. Biores Open Access (2012) 1:63–68. doi:10.1089/biores.2012.9902

25. Lee K, Kwon D-N, Ezashi T, Choi Y-J, Park C, Ericsson AC, Brown AN, Samuel MS, Park K- W, Walters EM, et al. Engraftment of human iPS cells and allogeneic porcine cells into

167

pigs with inactivated RAG2</em> and accompanying severe combined immunodeficiency. Proc Natl Acad Sci (2014) 111:7260 LP-7265. Available at: http://www.pnas.org/content/111/20/7260.abstract

26. Leuchs S, Saalfrank A, Merkl C, Flisikowska T, Edlinger M, Durkovic M, Rezaei N, Kurome M, Zakhartchenko V, Kessler B, et al. Inactivation and inducible oncogenic mutation of p53 in gene targeted pigs. PLoS One (2012) 7:e43323. doi:10.1371/journal.pone.0043323

27. Sieren JC, Meyerholz DK, Wang X-J, Davis BT, Newell JD, Hammond E, Rohret JA, Rohret FA, Struzynski JT, Goeken JA, et al. Development and translational imaging of a TP53 porcine tumorigenesis model. J Clin Invest (2014) 124:4052–4066. doi:10.1172/JCI75447

28. Schook LB, Collares T V, Hu W, Liang Y, Rodrigues FM, Rund LA, Schachtschneider KM, Seixas FK, Singh K, Wells KD, et al. A Genetic Porcine Model of Cancer. PLoS One (2015) 10:e0128864. doi:10.1371/journal.pone.0128864

29. Li S, Edlinger M, Saalfrank A, Flisikowski K, Tschukes A, Kurome M, Zakhartchenko V, Kessler B, Saur D, Kind A, et al. Viable pigs with a conditionally-activated oncogenic KRAS mutation. Transgenic Res (2015) 24:509–517. doi:10.1007/s11248-015-9866-8

30. Powell EJ, Charley S, Boettcher AN, Varley L, Brown J, Schroyen M, Adur MK, Dekkers S, Isaacson D, Sauer M, et al. Creating effective biocontainment facilities and maintenance protocols for raising specific pathogen-free, severe combined immunodeficient (SCID) pigs. Lab Anim (2018)23677217750691. doi:10.1177/0023677217750691

31. Kobel M, Bak J, Bertelsen BI, Carpen O, Grove A, Hansen ES, Levin Jakobsen A-M, Lidang M, Masback A, Tolf A, et al. Ovarian carcinoma histotype determination is highly reproducible, and is improved through the use of immunohistochemistry. Histopathology (2014) 64:1004–1013. doi:10.1111/his.12349

32. Powell EJ, Cunnick JE, Knetter SM, Loving CL, Waide EH, Dekkers JCM, Tuggle CK. NK cells are intrinsically functional in pigs with Severe Combined Immunodeficiency (SCID) caused by spontaneous mutations in the Artemis gene. Vet Immunol Immunopathol (2016) 175:1–6. doi:10.1016/j.vetimm.2016.04.008

168

Figures

Figure 6.1. OSPC-ARK1 cells develop into carcinomas after subcutaneous and intramuscular injection in SCID pigs

SCID pigs were injected with OSPC-ARK1 cells subcutaneously in the ear and intramuscularly in the neck. Of the four SCID pigs, three developed carcinomas in the ear, and two developed carcinomas in the neck. S3 developed a palpable tumor on the ear 11 days after inoculation. H&E staining of carcinomas from the ear of S4 and neck of S3 are shown. Elongated cleft like glandular structures lined by anaplastic neoplastic cells and surrounded by a scirrhous response are a characteristic finding of high grade serous ovarian carcinomas and are easily recognizable in both the original human patient carcinoma and the carcinoma developing in the SCID pig.

169

Figure 6.2. OSPC-ARK1 carcinomas in SCID pigs resemble the human ovarian serous papillary carcinoma morphologically and demonstrate the same immunophenotype.

OSPC human patient ovarian carcinoma, OSPC-ARK1 carcinoma from S1, OSPC-ARK1 carcinoma from a SCID mouse, and OSPC-ARK1 neoplastic cells were stained with H&E and immunohistochemically labeled with Claudin 3, Claudin 4, CK7, p16, and EMA.

170

Tables

Table 6.1. SCID and non-SCID pig descriptions and tumor growth locations

Pig ID Sex Days on trial Age at end of trial R Ear L Ear R Neck L Neck

S1 F 13 56 d + - + - S2 F 30 73 d - - - - S3 M 11 29 d + + + + S4 M 7 25 d - + - - NS1 M 30 73 d - - - - NS2 M 30 73 d - - - -

171

CHAPTER 7

MUTATIONS IN ARTEMIS CAN LEAD TO LEAKY CD3ε+ CELL DEVELOPMENT IN SWINE WITH SEVERE COMBINED IMMUNODEFICIENCY

Prepared for submission to PLOS ONE.

Adeline N. Boettcher1, A. Giselle Cino-Ozuna2, Yash Solanki1, Ellis J. Powell1, Jeana L. Owens2, Sara A Crane1, Amanda Ahrens3, Crystal L. Loving4, Joan. E. Cunnick1, Raymond R.R. Rowland5, Sara E. Charley1, Jack C.M. Dekkers1, Christopher K. Tuggle1

1Iowa State University, Department of Animal Science, Ames, IA, USA 2Kansas State University, Veterinary Diagnostic Laboratory, Manhattan, KS, USA 3Iowa State University, Laboratory Animal Research, Ames, IA, USA 4US Department of Agriculture, Agricultural Research Service, National Animal Disease Center, Food Safety and Enteric Pathogen Unit, Ames, IA, USA 5 Kansas State University, Diagnostic Medicine and Pathobiology Department, Manhattan, KS, USA

Author Contributions ANB designed experiments, ran flow cytometry, and wrote manuscript. AGCO and JLO performed immunohistochemistry on tissues. EJP performed flow cytometry experiments. YS and SAC performed TCR PCR analysis on lymph node tissues. AA performed necropsies on animals and collected tissue and blood samples. CLL, JEC, RRRR, and JCMD were involved in experiment planning. SEC was involved with SCID pig care, genotyping, and tissue collection. CKT was involved in all aspects of the manuscript. All authors read and edited the manuscript.

Abstract

Severe combined immunodeficiency (SCID) is described as the lack of functional T and B cells. In some cases, mutant genes encoding proteins involved in the process of VDJ recombination retain partial activity and are classified as hypomorphs. Such hypomorphic activity can allow for the development of a leaky T and B cell phenotype in patients and animals afflicted with SCID. We previously described two natural single nucleotide variants in

Artemis (DCLR1EC) in a line of Yorkshire pigs. One of these alleles contains a splice site mutation within intron 8 of the Artemis gene (Art16), while the other mutation is within

172 exon 10 that results in a premature stop codon (Art12). Art16/16, Art12/16, and Art12/12

SCID pigs develop small populations of CD3ε+, but in most cases not CD79α+, cells in circulation and in lymph nodes. Neonatal pigs (0 days of age) have CD3ε+ cells within lymph nodes prior to any environmental antigen stimulation. CD3ε+ cells in SCID pigs appear to have a skewed CD4α+CD8α+ T helper memory phenotype in most animals. We additionally confirmed that, in some pigs, functional VDJ joints can be found in lymph nodes as probed by PCR amplification of TCRδ V5 and J1, as well as TCRβ V20 and J1.2, providing evidence of residual activity of Artemis activity. This is the first description of a natural leaky T cell phenotype in SCID pigs. Documentation of this phenotype is important for SCID pig biomedical researchers, as well as potentially using this system as a model for human SCID patients.

Introduction

We have identified and described two natural mutations within the Artemis gene in two separate alleles (termed Art16 and Art12) in a line of Yorkshire pigs, which leads to SCID in a homozygous or heterozygous state.1 The Art16 allele contains a splice site mutation within intron 8 of Artemis and all transcripts in homozygous Art16/16 fibroblasts are missing exon 8. The Art12 allele contains a nonsense mutation in exon 10 that leads to a premature stop codon and many of the transcripts in Art12/12 fibroblasts are missing large portions of all exons.1 Upon the discovery of the Art SCID pigs, bone marrow transplantation (BMT) was performed to further study these animals. Among the SCID pigs that underwent BMT, two

Art16/16 pigs developed host derived CD3+ T cell lymphomas.2 This led us to hypothesize that the Art16 allele potentially produced a protein with residual activity. Hypomorphic

173 mutations have been reported in RAG3 and Artemis4,5 in human patients, and can lead to complications such as cancer5,6 and Omenn’s syndrome.7 We describe here the development of leaky CD3ε+ cells in pigs with Artemis deficient SCID phenotype.

Results

Circulating CD16- CD3ε+ cells in SCID pigs raised in conventional housing

Our initial discovery of circulating CD3ε+ cells in SCID pigs occurred during a routine engraftment check on a SCID pig that had previously received a bone marrow transplantation. During this engraftment check, peripheral blood mononuclear cells (PBMCs) from a carrier, the putative BMT, and negative control SCID animals were assessed for CD3ε expression. Flow cytometry analysis revealed that the control SCID pig tested had a small population of CD3ε+ cells within the blood lymphocyte population (data not shown). Blood was tested again from a carrier (Pig 1; p1), Art12/16 (p2), and Art16/16 (p3) littermate pigs, all of which were 7 weeks of age and raised in conventional (non-biocontainment) rooms. NK cells in our Art model are present and functional in vitro9, and thus PBMCs from these animals were stained for CD3ε and CD16 to help identify if the cells observed were NKT cells.

CD3ε+ cells in SCID pigs were observed again, confirming the earlier observation of “leaky”

SCID. All SCID pig CD3ε+ populations were CD16-, suggesting that they were not of NK cell origin (Figure 7.1A).

SCID pigs in biocontainment facilities develop CD3ε+, but not CD79α+ cells

We next sought to determine when these CD3ε+ cells develop and if raising the pigs in clean biocontainment facilities8 would reduce the prevalence of CD3ε+ cellular development, as there would be a reduced pathogen exposure than standard conventional

174 housing settings8. PBMCs were analyzed from four pigs born and raised in biocontainment facilities over a 3 to 4 month period. PBMCs were stained for CD3ε and CD79α to access for leaky T and B cells. Carrier animals were stained along with SCID samples, and consistently had 70-90% CD3ε+ cells and 5-15% CD79α+ cells (data not shown) within the lymphocyte population. PBMCs from SCID pigs were gated on mononuclear cells (lymphocytes and monocytes) due to difficulties in distinguishing the two populations by FSC and SSC.

Art16/16 (p4 and p5) animals had low to no circulating CD3ε+ cells, while the Art12/12 (p6) and Art12/16 (p7) and pigs showed variable amounts of CD3ε+ cells (Figure 7.1B).

Interestingly, upon necropsy at 4 months of age, p4 had thymic tissue (Figure 7.S1A) which stained profusely positively for CD3ε+ cells, despite having low levels of circulating CD3ε+ cells (Figure 7.S1B). None of the animals had circulating CD79α+ cells during the 3-4 month period (Figure 7.1C).

We next wanted to determine the cellular phenotypes of the CD3ε+ cells in the SCID pigs. To assess the cellular phenotypes, PBMCs were stained for SWC6, CD4α, CD8α, and

CD8β. SWC6 is expressed on a subset of γδ T cells found within the blood10,11. PBMCs from p7 (Art12/16), p6 (Art12/12), and p8 (carrier) were analyzed for these T cell markers at 3 months of age. Cells were gated on lymphocytes for both animals for analysis. Both animals appeared to have a very small population of CD3ε+ SWC6+ cells (Figure 7.1D). The CD3ε+

SWC6- population in both p6 and p7 were primarily CD8α+ CD8β+CD4α- and CD8α+ CD8β-

CD4α+. T helper memory cells in swine have previously been described to have a CD8α+

CD4α+ CD8β- cellular phenotype12.

175

CD3ε+ cells in the lymph nodes of neonatal SCID pigs

Since we found that CD3ε+ cells circulate in older animals, we next asked if these cells were present in neonatal SCID pigs. Lymph nodes were collected from 0 day old SCID pigs with Art16/16 (p9 and p10), Art12/16 (p11 and p12), Art12/12 (p13 and p14), and carrier

(p15) genotypes and assessed for the presence of CD3ε+ and CD79α+ cells by immunohistochemistry (IHC). Two animals for each genotype were assessed; representative histology images are shown in Figure 7.2A. All SCID genotypes had some level of CD3ε+ cells present. P13 and p14 (Art12/12) lymph nodes had fewer CD3ε+ cells, which were punctate within the lymph node. Lymph node architecture in all SCID animals was abnormal compared to wild type tissues. CD79α+ cells were only found in p10 (Art16/16). These results indicate that leaky CD3ε+ cells, and in rare cases CD79α+ cells, initiate development in utero.

CD3ε+ cells in 5 and 6 month old SCID pigs

We additionally collected lymph nodes from Art16/16 SCID pigs that were 5 and 6 months of age. P16 was originally raised in biocontainment facilities and was later moved to conventional housing at approximately 3 months of age. At 6 months of age, she developed severe skin lesions due to an allergic or hypersensitivity response. At the time of euthanasia, a blood sample was collected from this animal, and 33% of lymphocytes were found to be

CD3ε+ (Figure 7.2B). Other T cell markers were not assessed at this time. Lymph nodes were also collected, and CD3ε+, but not CD79α+, cells were present (Figure 7.2C)

Another older animal, p17, was also raised to 5 and a half months of age in biocontainment facilities. He succumbed to an E. coli bacterial infection and was euthanized due to failure to thrive. Lymph nodes were collected from this animal and were assessed by

176 flow cytometry and histological analysis (Figure 7.2D, E). Mononuclear cells (MNCs) from a popliteal lymph node were isolated and analyzed by flow cytometry. Of gated MNCs, 64% of cells were CD3ε+. A small portion of the CD3ε+ cells were also SWC6+. CD3ε+ cells in p17 lymph nodes consisted of CD8α+ CD4α- and CD8α+ CD4α+. Expression of CD8β was not assessed at this time. IHC staining of the same lymph nodes showed presence of large number of CD3ε+ cells throughout the entire lymph node. CD79α+ cells were not present in lymph nodes.

SCID pigs have the potential to produce cells with TCR rearrangements

CD3ε is a coreceptor for the T cell receptor (TCR), and thus we wanted to determine if VDJ recombination was occurring at TCR loci. PCR analysis was performed using primers that were specific for TCRδV5 and TCRδJ1 , as well as TCRβV20 and TCRβJ1.2 13 (Figure 7.2F).

The TCRβJ1.2 gene is 87 base pairs away from the TCRβJ1.1 gene segment, so we were able to capture TCRβJ1.1 rearrangement with this primer, as well.

SCID pigs of all three genotypes (p6, p16-25) were assessed. At least one pig from each SCID genotype had recombination between the V and J segments for both TCR complexes, although not every animal showed evidence of recombination. PCR products

(with asterisks) were sequenced to confirm amplificons contained V and J gene segments

(Figure 7.S2, 7.S3). Two SCID pigs (p20 and p24) had amplicons that sequenced through the

VDJ joint, indicating that the there was only a single clone for the V and J gene segments tested (Figure 7.S4). Wildtype TCRδV5- J1.1 amplicons only sequenced to the end of the V5 gene due to the more diverse repertoire of these rearrangements (Figure 7.S2). Together,

177 these results show that VDJ recombination can occur in SCID pigs, although the repertoire is not expansive.

Discussion

Here we report the description of a leaky T cell phenotype in SCID pigs with naturally occurring mutations in Artemis. We first observed that CD3ε+ cells were capable of developing in these SCID pigs when two Art16/16 bone marrow transplanted pigs developed host derived T cell lymphoma2. We followed these findings by next asking if CD3ε+ cells were found in circulation of pigs housed in conventional settings and biocontainment. We found that SCID pigs raised in either setting and across all three SCID genotypes (Art16/16,

Art12/16, and Art12/12) had a leaky T cell phenotype. We next assessed if neonatal SCID pigs had CD3ε+ cells in lymph nodes to gain insight on when these cells could be developing.

We found CD3ε+ cells in lymph nodes of all SCID genotypes, although Art12/12 SCID pigs had fewer cells in those that we analyzed. Lastly, we assessed for VDJ recombination by amplifying TCRβ and δ with V and J specific primers and found that all three SCID genotypes are capable of VDJ recombination. We suspect the TCR repertoire is limited in these SCIDs, as not all SCID pigs had recombination, and in some animals, there appears to be a clonal repertoire for the recombination events tested.

Hypomorphic mutations are reported in human patients within RAG114, Artemis15, and IL2RG16 genes. Such mutations can lead to Omenn’s syndrome7 or cancer development4,6. Omenn’s syndrome is characterized by the development and expansion of a population of self-reactive T cells. Symptoms of Omenn’s syndrome include diarrhea, eosinophilia, and lethargy17. Additionally, T cell lymphomas can develop due to

178 recombination errors made during VDJ recombination.5 Identifying that SCID pigs with Art16 and Art12 alleles are capable of producing CD3ε+ cells suggests that such complications could arise in SCID pigs. We have previously had SCID pigs with severe rashes, diarrhea, as well as masses of lymphoid tissue that may be explained as Omenn’s syndrome or cancer

(unpublished observation). The characterization of CD3ε+ cell development in our SCID pigs suggest that these ailments could occur in our Art SCID model. Other SCID pig models exist with mutations in RAG1/2 and IL2RG in which similar diseases could occur. Researchers and veterinarians working with SCID pigs need to be aware of the potential of leaky T cell development. Presence of these cells could affect the health and potential use of these animals in different biomedical models.

Materials and Methods

Ethics statement

All animal procedures and protocols were approved by Iowa State University’s

Institutional Animal Care and Use Committee.

Generation of piglets and rearing

SCID pigs were generated as previously described1 and were housed in either clean conventional rooms or in biocontainment facilities8. All pigs, genotypes, housing conditions, age, CD3ε result summaries, analysis methods and figure references are in Table 7.1.

Flow cytometry of PBMCs and MNCs

PBMCs were isolated as previously described9. To collect MNCs, lymph node tissue was first placed in HBSS with 10μg/mL gentamicin. Tissues were minced in a digestion solution of HBSS with 300 mg/L of collagenase, 3% FBS, and 2 mM HEPES (referred to herein

179 as d-HBSS). The tissue and d-HBSS mixture was left to incubate for one hour at 37˚C with vortexing every 15 minutes. The suspension was then strained over a 100 μm cell strainer.

Cells were washed once more in d-HBSS. Isolated PBMCs and MNCs were counted by flow cytometry using a BD cell counting kit.

PBMCs were stained with anti-pig CD16 (G7; Bio-Rad) with a goat anti-mouse IgG1 secondary antibody, anti-pig CD3ε (BB23-8E6-8C8), and anti- human CD79α (HM47) for preliminary analysis. An intracellular staining kit was used to stain the cells for CD79α (BD

Biosciences). To analyze CD3ε+ cells in blood and tissues, PBMCs and MNCs were stained with anti-pig CD8β (PPT23), anti-pig CD8α (76-2-11), anti-pig SWC6 (MAC320), anti-pig CD4α

(74-12-4), and anti-pig SWC6 (MAC320). SWC6 is an uncharacterized membrane marker found to identify a population of γδ TCR+ T cells that are CD2- CD8α-, known as null γδ T cells, which are the predominate γδ T cell subset found in the blood10,11. Cells were fixed in 2% PBS formaldehyde and data was acquired in a FACs Canto II. Data was analyzed using FlowJo.

Immunohistochemistry of collected lymphoid tissues

Tissues were collected and placed into 3.7% formaldehyde in 1X phosphate buffered saline for 24 hours. Tissues were then moved to 70% ethanol until processing.

Immunohistochemical (IHC) staining for T and B lymphocyte markers was performed in paraffin-embedded tissue thin sections at Kansas State Veterinary Diagnostic Laboratory

(KSVDL). Briefly, deparaffinized slide-mounted thin sections were pre-treated for 5 minutes with a peroxide block, followed by incubation with primary antibody. Primary antibodies included mouse monoclonal anti-CD3ε (clone LN10, Leica Biosystems) and mouse monoclonal anti-CD79α (clone HM57, Abcam). Primary antibodies were incubated for 25

180 min with PowerVision Poly-HRP anti-mouse IgG at room temperature, with DAB chromagen, and counterstained with hematoxylin.

PCR of lymph node DNA for TCRβ and TCRγ V and J rearrangements

PCR analysis was performed on lymph node tissue collected from SCID and carrier pigs. Zymo Research Genomic-DNA™ Tissue Miniprep Kit was used to extract the genomic

DNA from the tissue. A 40µl PCR reaction volume was used. 160 nanograms of Genomic DNA was used as a template, and amplification was carried out using Promega GoTaq® Green

Master Mix. TCRβ recombination was assessed by using primers designed for TCRβV20 (5’

GATGTCATGGACATCATTTGCCATC 3’)13 and TCRβJ1.2 (5’ GGGCCGAAGTTATAGTCATA 3’).

TCRδ recombination was assessed by using primers designed for TCRδV5 (5’

TTCAGACACGTGACCTTCAG 3’)13 and TCRδJ1 (5’ GTTCCACAACCAGCTGAGTC 3’)13. Germline sequence of TCRβV20 was amplified as a positive control using the TCRβV20 primer listed above with a reverse primer (5’ GCTGAGATTCTGGGATTCAC 3’)13. All samples used the same thermal cycling parameters: 94°C for 10 minutes, followed by 39 cycles of 95°C for 30 s, 62°C for 30 s, 72°C for 1 min 30 s, followed by a final step of 72°C for 10 min.

References

1. Waide, E. H. et al. Not All SCID Pigs Are Created Equally: Two Independent Mutations in the Artemis Gene Cause SCID in Pigs. J. Immunol. 195, 3171 LP-3179 (2015). 2. Powell, E. J. et al. T Cell Lymphoma and Leukemia in Severe Combined Immunodeficiency Pigs following Bone Marrow Transplantation: A Case Report. Front. Immunol. 8, 813 (2017). 3. de Villartay, J.-P. et al. A novel immunodeficiency associated with hypomorphic RAG1 mutations and CMV infection. J. Clin. Invest. 115, 3291–3299 (2005). 4. Huang, Y. et al. Impact of a hypomorphic Artemis disease allele on lymphocyte development, DNA end processing, and genome stability. J. Exp. Med. 206, 893 LP-908 (2009).

181

5. Jacobs, C. et al. A hypomorphic Artemis human disease allele causes aberrant chromosomal rearrangements and tumorigenesis. Hum. Mol. Genet. 20, 806–819 (2011). 6. Moshous, D. et al. Partial T and B lymphocyte immunodeficiency and predisposition to lymphoma in patients with hypomorphic mutations in Artemis. J. Clin. Invest. 111, 381–387 (2003). 7. Ege, M. et al. Omenn syndrome due to ARTEMIS mutations. Blood 105, 4179 LP-4186 (2005). 8. Powell, E. J. et al. Creating effective biocontainment facilities and maintenance protocols for raising specific pathogen-free, severe combined immunodeficient (SCID) pigs. Lab. Anim. 23677217750691 (2018). doi:10.1177/0023677217750691 9. Powell, E. J. et al. NK cells are intrinsically functional in pigs with Severe Combined Immunodeficiency (SCID) caused by spontaneous mutations in the Artemis gene. Vet. Immunol. Immunopathol. 175, 1–6 (2016). 10. Davis, W. C. et al. Analysis of monoclonal antibodies that recognize gamma delta T/null cells. Vet. Immunol. Immunopathol. 60, 305–316 (1998). 11. Binns, R. M., Duncan, I. A., Powis, S. J., Hutchings, A. & Butcher, G. W. Subsets of null and gamma delta T-cell receptor+ T lymphocytes in the blood of young pigs identified by specific monoclonal antibodies. Immunology 77, 219–227 (1992). 12. Summerfield, A., Rziha, H. J. & Saalmuller, A. Functional characterization of porcine CD4+CD8+ extrathymic T lymphocytes. Cell. Immunol. 168, 291–296 (1996). 13. Suzuki, S. et al. Generation and characterization of RAG2 knockout pigs as animal model for severe combined immunodeficiency. Vet. Immunol. Immunopathol. 178, 37–49 (2016). 14. Ott de Bruin, L. M. et al. Hypomorphic Rag1 mutations alter the preimmune repertoire at early stages of lymphoid development. Blood 132, 281–292 (2018). 15. Giblin, W. et al. Leaky severe combined immunodeficiency and aberrant DNA rearrangements due to a hypomorphic RAG1 mutation. Blood 113, 2965–2975 (2009). 16. Kuijpers, T. W. et al. A reversion of an IL2RG mutation in combined immunodeficiency providing competitive advantage to the majority of CD8(+) T cells. Haematologica 98, 1030–1038 (2013). 17. Elnour, I. B., Ahmed, S., Halim, K. & Nirmala, V. Omenn’s Syndrome: A rare primary immunodeficiency disorder. Sultan Qaboos Univ. Med. J. 7, 133–138 (2007).

182

Figures

183

Figure 7.1. SCID pigs have CD3ε+ cells in circulation, but not CD79α+ cells

(A) PBMCs from a carrier and SCID pigs housed in conventional clean rooms were stained for CD16 and CD3ε. All CD3ε+ cells in SCID pigs were CD16-. (B) Four SCID pigs (p4- Art16/16, p5- Art16/16, p6-Art12/16, and p7- Art12/12) were monitored over a three to four month period for circulating CD3ε+ and CD79α+ cells. P6 and p7 had variable levels of CD3ε+ cells throughout this period. CD79α+ cells were not detected in any of the four SCID pigs. (C) CD3ε+ cells from p6 and p7 were assed for expression of SWC6, CD4α, CD8α, and CD8β. CD3ε+ cells within the SCID pigs were primarily CD8α+ CD8β+ CD4α- and CD4α+ CD8α+ CD8β- indicative of cytotoxic T cell and memory T cell phenotypes, respectively.

184

185

Figure 7.2. CD3ε+ cells are present in SCID lymph nodes at various ages.

(A) Lymph nodes were collected from 0 day old SCID pigs (p15- carrier, p10-Art16/16, p11; Art12/16, p14- Art12/12) and were stained for CD3ε and CD79α. All genotypes had CD3ε+ cells present; cells were punctate within SCID pigs with the Art12/12 genetic background. Only one SCID pig (p10) had CD79α+ cells present. (B) PBMCs (gated on lymphocytes) were stained for CD3ε expression from a 6 month old Art16/16 SCID (p16). (C) Lymph nodes were stained for CD3ε and CD79α expression from p16. (D) Mononuclear cells were isolated from a popliteal lymph node from p17 and stained for CD3ε, SWC6, CD4, and CD8α. A small population of CD3ε+ SWC6+ cells were present. A majority of the CD3+ SWC6- population were CD4α+ CD8α+. (E) Lymph nodes were stained for CD3 and CD79α expression from p17. (F) DNA from lymph node was amplified with primers specific for TCRδV5 – TCRδJ1, as well as TCRβ V20- TCRβ J1.2 from SCID pigs with all genotypes. P18 is a carrier. P19, p20, p21, and p17 are Art16/16. P22, p23, and p24 are Art12/16. P25 and p6 are Art12/12. Bands with asterisks were sequenced to confirm presence of V gene segment within the amplificon (Figure 7.S2 and 7.S3)

Tables

Table 7.1. Overview of SCID pigs, genotypes, and description of CD3ε and CD79α cells found in blood or lymph nodes

Pig # Genotype Housing Age Immunophenotype Analysis Figure ref.

1 ART12/+ C 7 W Control animal F 1A 2 ART12/16 C 7 W CD3+ CD16- cells in PB F 1A 3 ART16/16 C 7 W CD3+ CD16- cells in PB F 1A Low levels of CD3ε+ cells in PB; thymic 4 ART16/16 B 4 M tissue with CD3ε+ cells present; LN with F, IHC 1B-C; S1 CD3ε+ cells present 5 ART16/16 B 4 M Low levels of CD3ε+ cells in PB F 1B-C, 1C 186 + 6 ART12/12 B 3 M CD3ε cells present in PB F, PCR 1B-D, 2F 7 ART12/16 B 3 M CD3ε+ cells present in PB F 1B-D 8 ART12/+ B 4 M Control animal F 1D 9 ART16/16 N/A 0 D No CD3ε+ or CD79α+ cells in LN IHC N/A 10 ART16/16 N/A 0 D CD3ε+ and CD79α+ cells present in LN IHC 2A CD3ε+ cells present, and no CD79α+ cells 11 ART12/16 N/A 0 D presnt in LN IHC 2A Punctate CD3ε+ cells present, and no 12 ART12/16 N/A 0 D CD79α+ cells present in LN IHC N/A Punctate CD3ε+ cells present, and no 13 ART12/12 N/A 0 D CD79α+ cells present in LN IHC N/A

187

Table 7.1 Cont. Overview of SCID pigs, genotypes, and description of CD3ε and CD79α cells found in blood or lymph nodes

Pig # Genotype Housing Age Immunophenotype Analysis Figure ref.

Punctate CD3ε+ cells present, and no 14 ART12/12 N/A 0 D CD79α+ cells present in LN IHC 2A 15 ART12/+ N/A 0 D Control animal IHC 2A CD3ε+ cells present in PB; CD3ε+ cells 16 ART16/16 B/C 6 M present, and no CD79α+ cells present in F, IHC 2B-C LN CD3ε+ cells present, and no CD79α+ cells 17 ART16/16 C 5.5 M present in LN. SWC6+ cells present in F, IHC, PCR 2D-F LN; TCRβ recombination 18 ART16/+ C 6 W Control animal PCR 2F 19 ART16/16 C 6 W No TCRδ or TCRβ rearrangement PCR 2F 20 ART16/16 C 6 W TCRδ rearrangement PCR 2F 21 ART16/16 C 6 W TCRδ rearrangement PCR 2F 22 ART12/16 C 6 W No TCRδ or TCRβ rearrangement PCR 2F 23 ART12/16 B 11 W TCRδ rearrangement PCR 2F 24 ART12/16 B 4 W TCRδ and TCRβ rearrangement PCR 2F 25 ART12/12 B 10 W No TCRδ or TCRβ rearrangement PCR 2F

C: Conventional housing, B: Biocontainment, PB: peripheral blood, LN: lymph node, F: Flow cytometry, IHC: immunohistochemistry, PCR: polymerase chain reaction, TCR δ: Recombination between V5 and J1, TCR β: Recombination between V20 and J1.2

188

Supplemental Figures

Figure 7.S1. Thymic and lymph node tissue from an Art16/16 SCID pig (p4) stained positively for CD3ε

(A) P4 (Art16/16) had thymic tissue present at 4 months of age. (B) Thymic tissue and (C) lymph node tissue were stained for CD3ε. (B) Thymic tissue stained robustly positive for CD3ε. (C) CD3ε+ cells were present within the lymph node as well. Interestingly, this animal did not have remarkable levels of circulating CD3ε+ cells (Figure 7.1).

189

Reference_V5 ACCTGAAAGGAAAAGAAAATGATTCTTGTGGGCTTTGGCCTTTTGTTTTTCTGTAAGTAC 213_04_Carrier_Pig18 ACCTGAAAGGAAAAGAAAATGATTCTTGTGGGCTTTGGCCTTTTGTTTTTCTGTAAGTAC 213_07_1616_Pig20 ACCTGAAAGGAAAAGAAAATGATTCTTGTGGGCTTTGGCCTTTTGTTTTTCTGTAAGTAC 213_10_1616_Pig21 CCTGGAAAAGAAAAGAAAATGATTCCTCTGCACTCTCCCCATGTCTGTTTCTCTACTTGC 217_05_1216_Pig23 ACCTGAAATGAAAAGAAACTGATTCTTGTGTGCTTTAGCCTTTTGTTTTTCTGTAAGTAC 222_04_1216_Pig24 ACCTGAAAGGAAAAGAAAATGATTCTTGTGGGCTTTGGCCTTTTGTTTTTCTGTAAGTAC 223_07_1212_Pig6 CCCTGAATGGAAAAAAAAATGATTCTTGTGGGCTTNANCCTTTTGTTTTTCTGTAAGTAC Reference_J1 ------

Reference_V5 ATTTGTTCTCACGTCCCACTTGTTCTACCGCCCTGATTCCCTTTTTCTGACTTTCTTAAG 213_04_Carrier_Pig18 ATTTGTTCTCACGTCCCACTTGTTCTACCGCCCTGATTCCCTTTTTCTGACTTTCTTAAG 213_07_1616_Pig20 ATTTGTTCTCACGTCCCACTTGTTCTACCGCCCTGATTCCCTTTTTCTGACTTTCTTAAG 213_10_1616_Pig21 ATTTGTTCACACGTCCCACTTGTTCTACCGCCCTGATTCCCTTTTTCTGACTTTCTTAAC 217_05_1216_Pig23 ATTTGTTCTCACGTCCCACTTGTTCTACCGCCCTGATTCCCTTTTTCTGACTTTCTTAAG 222_04_1216_Pig24 ATTTGTTCTCACGTCCCACTTGTTCTACCGCCCTGATTCCCTTTTTCTGACTTTCTTAAG 223_07_1212_Pig6 ATTTGTTCTCACGTCCCACTTGTTCTACCGCCCTGATTCCCTTTTTCTGACTTTCTTAAG Reference_J1 ------

Reference_V5 GCTTGGTTTCTTTTTCATTCACTTGGCTTTGCAGTGATTTTCTGCCTTTATTTTTCATCT 213_04_Carrier_Pig18 GCTTGGTTTCTTTTTCATTCACTTGGCTTTGCAGTGATTTTCTGCCTTTATTTTTCATCT 213_07_1616_Pig20 GCTTGGTTTCTTTTTCATTCACTTGGCTTTGCAGTGATTTTCTGCCTTTATTTTTCATCT 213_10_1616_Pig21 GCTTGGTTTCTTTTTCATTCACTTGGCTTTGCAGTGATTTTCTGCCTTTATTTTTCATCT 217_05_1216_Pig23 GCTTGGTTTCTTTTTCATTCACTTGGCTTTGCAGTGATTTTCTGCCTTTATTTTTCATCT 222_04_1216_Pig24 GCTTGGTTTCTTTTTCATTCACTTGGCTTTGCAGTGATTTTCTGCCTTTATTTTTCATCT 223_07_1212_Pig6 GCTTGGTTTCTTTTTCATTCACTTGGCTTTGCAGTGATTTTCTGCCTTTATTTTTCATCT Reference_J1 ------

Reference_V5 GTGTGTCCCTCCCCTGCCTCTGCCCATTGAGTTCCCTCAGGGTGGGCTTGTGCTGGACCC 213_04_Carrier_Pig18 GTGTGTCCCTCCCCTGCCTCTGCCCATTGAGTTCCCTCAGGGTGGGCTTGTGCTGGACCC 213_07_1616_Pig20 GTGTGTCCCTCCCCTGCCTCTGCCCATTGAGTTCCCTCAGGGTGGGCTTGTGCTGGACCC 213_10_1616_Pig21 GTGTGTCCCTCCCCTGCCTCTGCCCATTGAGTTCCCTCAGGGTGGGCTTGTGCTGGACCC 217_05_1216_Pig23 GTGTGTCCCTCCCCTGCCTCTGCCCATTGAGTTCCCTCAGGGTGGGCTTGTGCTGGACCC 222_04_1216_Pig24 GTGTGTCCCTCCCCTGCCTCTGCCCATTGAGTTCCCTCAGGGTGGGCTTGTGCTGGACCC 223_07_1212_Pig6 GTGTGTCCCTCCCCTGCCTCTGCCCATTGAGTTCCCTCAGGGTGGGCTTGTGCTGGACCC Reference_J1 ------

Reference_V5 CGTGCCTGTGGAGTGCAGGACTTATACCTTCCTTATTTCCTGTTTCCTTATTTCTTCTCT 213_04_Carrier_Pig18 CGTGCCTGTGGAGTGCAGGACTTATACCTTCCTTATTTCCTGTTTCCTTATTTCTTCTCT 213_07_1616_Pig20 CGTGCCTGTGGAGTGCAGGACTTATGTCTTCCTTATTTCCTGTTTCCTTATTTCTTCTCT 213_10_1616_Pig21 CGCGCCTGTGGAGTGCAGGACTTATACCTTCCTTATTTCCTGTTTCCTTATTTCTTCTCT 217_05_1216_Pig23 CGTGCCTGTGGAGTGCAGGACTTATACCTTCCTTATTTCCTGTTTCCTTATTTCTTCTCT 222_04_1216_Pig24 CGTGCCTGTGGAGTGCAGGACTTATACCTTCCTTATTTCCTGTTTCCTTATTTCTTCTCT 223_07_1212_Pig6 CGTGCCTGTGGAGTGCAGGACTTATACCTTCCTTATTTCCTGTTTCCTTATTTCTTCTCT Reference_J1 ------

Reference_V5 TCACAGACAAGGGTGTGCTGTGTAACAAAGTGACCCAGACTTCCCTGGAAGAGGTGGTGG 213_04_Carrier_Pig18 TCACAGACAAGGGTGTGCTGTGTAACAAAGTGACCCAGACTTCCCTGGAAGAGGTGGTGG 213_07_1616_Pig20 TCACAGACAAGGGTGTGCTGTGTAACAAAGTGACCCAGACTTCCCTGGAAGAGGTGGTGG 213_10_1616_Pig21 TCACAGACAAGGGTGTGCTGTGTAACAAAGTGACCCAGACTTCCCTGGAAGAGGTGGTGG 217_05_1216_Pig23 TCACAGACAAGGGTGTGCTGTGTAACAAAGTGACCCAGACTTCCCTGGAAGAGGTGGTGG 222_04_1216_Pig24 TCACAGACAAGGGTGTGCTGTGTAACAAAGTGACCCAGACTTCCCTGGAAGAGGTGGTGG 223_07_1212_Pig6 TCACAGACAAGGGTGTGCTGTGTAACAAAGTGACCCAGACTTCCCTGGAAGAGGTGGAGG Reference_J1 ------

Reference_V5 TGAGTGGCAGTAAGGTGACACTGCCCTGCACTTTTGAAACCTCACACTCAGATCCAGACC 213_04_Carrier_Pig18 TGAGTGGCAGTAAGGTGACACTGCCCTGCACTTTTGAAACCTCACACTCAGATCCAGACC 213_07_1616_Pig20 TGAGTGGCAGTAAGGTGACACTGCCCTGCACTTTTGAAACCTCACACTCAAATCCAGACC 213_10_1616_Pig21 TGAGTGGCAGTAAAGTGACACTGCCCTGCACTTTTGAAACCTCACACTCAAATCCAGACC 217_05_1216_Pig23 TGAGTGGCAGTAAGGTGACACTGCCCTGCACTTTTGAAACCTCACACTCAGATCCAGACC 222_04_1216_Pig24 TGAGTGGCAGTAAGGTGACACTGCCCTGCACTTTTGAAACCTCACACTCAGATCCAGACC 223_07_1212_Pig6 TGAGTGGCAGTAAGGTGACACTGCCCTGCACTTTTGAAACCTCACACTCAGATCCAGACC Reference_J1 ------

190

Reference_V5 TCTACTGGTACCGAATACGTCCAGATCGTACCTTCCAGCTTGTCTTGTACAGGGATAATA 213_04_Carrier_Pig18 TCTACTGGTACCGAATACGTCCAGATCGTACCTTCCAGCTTGTCTTGTACAGGGATAATA 213_07_1616_Pig20 TCTACTGGTACCGAATACGTCCAGATCGTACCTTCCAGTTTGTCTTGTACAGGAATAATA 213_10_1616_Pig21 TCTACTGGTACCGAATACGTCCTGATCGTACCTTCCAGATTGNCTTGTACACGGATCATA 217_05_1216_Pig23 TCTACTGGTACCGAATACGTCCAGATCGTACCTTCCAGCTTGTCTTGTACAGGGATAATA 222_04_1216_Pig24 TCTACTGGTACCGAATACGTCCAGATCGTACCTTCCAGCTTGTCTTGTACAGGGATAATA 223_07_1212_Pig6 TCTACTGGCACCGAATACGTCCAGATCGCACCTTCCAGCTTGTCTTGTACAGGGATAATA Reference_J1 ------

Reference_V5 CTAGGTCCTACGATGCT-GATTTTGCTCGGGGTAGATTTTC-TGTGCAGCACAGTCTGG 213_04_Carrier_Pig18 CTAGGTCCTACGATGCT-GATTTTGCTCGGGGTAGATTTTC-TGTGCAGCACAGTCTGG 213_07_1616_Pig20 CTAGGTCCTACGATGCT-GATTTTGCTCGGGGTAGATTTTC-TGTGCAGCACAGTCTGG 213_10_1616_Pig21 CTAGGTCCTACGATGCTTGATTTTGCTCTGGTTATATTTTCCTGTGCTTCACAGTCTGG 217_05_1216_Pig23 CTAGGTCCTACGATGCT-GATTTTGCTCGGGGTAGATTTTC-TGTGCAGCACAGTCTGG 222_04_1216_Pig24 CTAGGTCCTACGATGCT-GATTTTGCTCGGGGTAGATTTTC-TGTGCAGCACAGTCTGG 223_07_1212_Pig6 CTAGGTCCTACGATGCT-GATTTTGCTCGGGGTAGATTTTC-TGTGCAGCACAGTCTGG Reference_J1 ------

Reference_V5 CCCACAAAACCTTTCACTTGGTGATCTCCTCAGTGACAACTAAAGACACTGCCACTTACT 213_04_Carrier_Pig18 CCCACAAAACCTTTCACTTGGTGATCTCCTCAGTGACAACTAAAGACACTGCCACTTACT 213_07_1616_Pig20 CCCACAAAACCTTTCACTTGGTGATCTCCTCAGTGACAACTAAAGACACTGCCACTTACT 213_10_1616_Pig21 CCCACAAAACCTATCACTTGGTGAGCTCCTCATTGACAACTAAAGACACTGCCACTTTAC 217_05_1216_Pig23 CCCACAAAACCTTTCACTTGGTGATCTCCTCAGTGACAACTAAAGACACTGCCACTTACT 222_04_1216_Pig24 CCCACAAAACCTTTCACTTGGTGATCTCCTCAGTGACAACTAAAGACACTGCCACTTACT 223_07_1212_Pig6 CCCACATAACCTTTCACTTGGTGATCTCCTCAGTGACAACTAAAGACACTGCCACTTACT Reference_J1 ------

Reference_V5 ACTGTGCCTT-GGACTCC------213_04_Carrier_Pig18 ACTGTGCCTT-GGACTCC------213_07_1616_Pig20 ACTGTGCCTT-GGACTC------CGGAGATAAACTCATCTTTGGA-AAAGGGAC 213_10_1616_Pig21 TACTTTGCCCTTGNNNNGTCACCTACCTTCCGTAGTATACTACATCTATCAGAAAGGGTC 217_05_1216_Pig23 ACTGTGCCTT-GGACTCCGGAGTCGATATACTCG-T------222_04_1216_Pig24 ACTGTGCCTT-GACGAGATCTCGTACCTCCGGAGGTAAACTCATCTTTGGA-AAAGGGAC 223_07_1212_Pig6 ACTGCGCCTT-GGAATCNGCATGTNNNGCTACGGNTCANCTAGTTGTNGGA-CANNTGCG Reference_J1 ------ATGATACAGATAAACTCATCTTTGGA-AAAGGGAC

Reference_V5 ------213_04_Carrier_Pig18 ------213_07_1616_Pig20 TCAGCTGGTTGTGGAAC 213_10_1616_Pig21 ACTCAAACTTCTTT--- 217_05_1216_Pig23 ------222_04_1216_Pig24 TCAGCTGGTTGTGGAAC 223_07_1212_Pig6 TCAATAGCCTCTGCAAC Reference_J1 TCAGCTGGTTGTGGAAC

Figure 7.S2. Sequence alignment of TCRδ V5 and J1 products from carrier and SCID pigs.

DNA from lymph node tissue was amplified with primers specific for TCRδ V5 and J1 of TCR delta (shown in yellow). Sequences above were acquired by sequencing with the forward (first) primer. Reference sequences TCR_DeltaV5 and TCR_DeltaJ1 were derived from sequence accession number AB182371.1 from NCBI. Red indicate the V5 sequence, while blue indicate the J1 sequence. Bolded nucleotides indicate that the nucleotide matches the reference sequence.

191

TCR_BetaV20 GATGTCATGGACATCATTTGCCATCATAGACGACGACCACTAGGGGGCGGAGTAGTGAG-CAGGATTAGTAGGCAGCCAA Pig17_1616 GTTGTTAAGGACAGCAATGGGCATCATAGAGGACGTCCACTAGGGGGGGGAGTAGTGAGGCAGGATTAGCAGGCAGGCAA Pig24_1216 ---GTTATGGACATCATTTGCCTTCATAGACGACNNCCCCTTGGGGGCGGAGTAGTGAG-CAGGATTAGTAGGCAGCCAA

TCR_BetaV20 CCGGCCTTCTATGGGTG-GAGAACAGAAGATTGGGGGGCAAGGTCGCACCTTCCTTCAGAGAGGTGTGGTGCCAGGCCAG Pig17_1616 CTCGTCTTCCAAGGGTGGAGAGCAAGTAGACTGGGGGGCAAGGTCGCACCGTCCTTCAGAGAGGTGCGGNGCCAGGGAAG Pig24_1216 CCAGCCTTCCATGGGTG-GAGAACAGAAGATTGGGGGGCAAGGTCGCACCTTCTTTCAGAGAGGTGTGGTGCGAGGCCAG

TCR_BetaV20 CAGCTGAAGATGCTGGTGCTTCTGCTGCTTCTGGGACCCAGTAAGAGCCTTATTACCTGAGTAGCTTGGGCGAGTATGCG Pig17_1616 CAGCTGAAGATGCAGGTGCATGTGCGGCTTCTGCGACCCAGTGAGAGCGTTATGGCCTGAGTAGGTTGGGCGAGTATGCG Pig24_1216 CAGATGAAGATGCTGGTGCTTCTGCTGCTTCTGGGACTCAGTAAGAGCGTTATTACCTGAGTAGCTTGGGCGAGTATGCG

TCR_BetaV20 TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTGGCGTGAGTCGGGTGGGAGCCGGGGATTGTGGATTCTTTAGT Pig17_1616 TGTG------TGTGAGTGTTGGCGTGAGTTGGGTGGGAGCCGGGGATTGTGGAATCTTTAGG Pig24_1216 GGTGTGTGTGT------TGTGTGTGTGTGTGTGTGTTGGCGTGAGTTGGGTGGGAGCCGGGGATTGTGGATTCTTTAGG

TCR_BetaV20 CTGATCAAAACAAGAGGGGACCTCCACGCTTTCTGGAGGTGGAAAGGGTAAAGCGAGAAGCCACCAGTCGTGGGGGGAGT Pig17_1616 GTGATTAAAACNNGAGGGGACGTCCACGATGTGTGGAGGTGGAAAGGGTAAAGCGAGAAGCCGTCAGTCGCGGGGGA-GT Pig24_1216 CTGATCAAAACAAGAGGGGACCTCCTCGCTCTCTGGAGGTGGAAAGGGTAAAGCGAGAAGCCACCTGTCGTGGGGGT-GT

TCR_BetaV20 GAGGGTTAT-GACCCTAAGAAGTAGGACAGAGAGACTTCGGAAAGCCAATGGGATTCCCTGGGAGCTGTGAGAAAGGGAA Pig17_1616 GAGGGCTAT-GACCCTAAGAAGTGGGACAGAGAGACTTCGGAAAGCCAGTGGGATTCCCTGGGAGATGTGAGAAAGGGAA Pig24_1216 GAGGGTTATGGACCCTAAGAAGTAGGACAGTGAGACTTCAGAAAGCCAATGGGATTCCCTGGGAGCTGTGAGAAAGGGAA

TCR_BetaV20 GGGAGCCAGGCTGATTTTCTGCCCATGGTCAGGTCCGCCTGGTCCTGCCGGCTGCTCATCTCTTTGACCTCTGTCTCAGC Pig17_1616 GGGAGCCAGGCTGATCTTCTGCCCATGGTCAGGTCCGCATGGTCGTGCCGGATGCTCATCTCTTTGACCTCTGTCTCAGC Pig24_1216 GGGAGCCAGGCTGATTTTCTGTCCATGGTCGGGTCCGCCTGGTCCTGCCGGCTGCTCATCTCTTTGACCTCTGTCTCAGC

TCR_BetaV20 AGGCTACGGGTTTGGCGCCCTCGTCTCTCAACATCCCGGCAGGGCCATCTGTAAGAGTGGTGCCTCTGTGACCATCCAGT Pig17_1616 AGGCTACGNNTATGGCGCCCTGGTGTNNCCACATCCCAGCAGGGCCATCTGTAAGAGCGGTGCCTCTGTGTCCATCCAGT Pig24_1216 AGGGTACGGGTTTGGCGCCCTCGTCTCTCAACATCCCGGCAGGGCCATCTGTAAGAGCGGTGCCTCTGTGACCATCCAGT

TCR_BetaV20 GCCGTACAGTGGACCTTCAAGCCACAACTATGTTCTGGTATCATCAGTTCCCAGA-ACAG-GGCCCCCTGCTGATAGCAA Pig17_1616 GCCGTTCAGTGGACTTTCAAACCACATCAATGTTATGATATCATCAGGTGC-ACAGAACAGGTGCTCCTGCCAGCAGCAA Pig24_1216 GCCGTACAGTGGACCTTCAAGCCATAACTATGTTCTGGTATCATCAGTTCCCAGA-ACAG-GGCCCCCTGCTGATAGCAA

TCR_BetaV20 CTTCTAACATGGGCTCT-AATGCCACCTACGAAAAAGGTTATAACAGCGCCAAGTTTCTCATC--AGCCACCCAAACCA- Pig17_1616 CTTCTCACGTGGGAAATCAAG-GCCACCGAGGAGTATGGTTTCAAGGAGGCCGCAGTNTGATGTCATGGACATCATGCGC Pig24_1216 CTTCTGACGTGGGCTCT-AATGCCACCTACGAAAAAGGTTATAACAGCGCCAAGTTTCTCATC--AGCCACCCAGACCA-

TCR_BetaV20 -AAGGTTTTCATCTCTGGTGGTGAGAAGCGTGCATCCTGCCGACAGCAGCCTCTACTTTTGTGGTGCTAGTGA Pig17_1616 CATCTCTCTGTTCANNTGTGGGCCGAAGTTATAGTCATACAGAG------TGTAAATTGGAGGTCCAAGGAC Pig24_1216 -AACGTTTTCATCTCTGGTGGTGAGAAGCGTGCATCCTGCCGACAGCAGCCTCTACCTTTGTTGAGATGGAGG

Figure 7.S3. Sequence alignment of TCRβ V20 and J1.2 products from carrier and SCID pigs.

DNA from lymph node tissue was amplified with primers specific for TCRβ V20 and J1.2. The SCID animals were sequenced with the reverse primer and then aligned with TCRβV20 (derived from accession number AB476299.1 from NCBI). Red indicate the TCRβV20 sequence. Bold nucleotides indicate the nucleotides that match the reference sequence.

192

Figure 7.S4. Chromatograms of V-D-J joins in TCRβ (V20 and J1.2) and TCRδ (V5 and J1) show evidence of single TCR clones

Chromatograms are shown for TCRδ (top) and TCRβ (bottom) amplicons from lymph nodes of SCID pigs p20 (Art16/16) and p24 (Art12/16). Clean sequences were obtained through the VDJ joint for TCRδ, indicating that the repertoire for the TCRδV5 and TCRδJ1 is clonal in these two SCID pigs (top). Slightly more variability was observed in TCRβV20- TCRβJ1.1 suggesting there may be more than one clone, however the repertoire is still limited.

193

CHAPTER 8

DISSERTATION SUMMARY

Within this work I have described the initiation of three potential biomedical models within the SCID pig: (1) an immunologically humanized SCID pig model, (2) an ovarian cancer model, and (3) leaky T cell development in SCID pigs.

In Chapters 3-5 I describe the beginning stages of developing a humanized SCID pig. I described in Chapter 3 that porcine SIRPA recognizes and binds to human CD47 to prevent subsequent phagocytosis of human cells. This was an important question to investigate because it allowed us to answer that SIRPA-CD47 dependent phagocytosis of human cells by porcine monocytes in an in vivo environment should not occur. Such phagocytosis would inhibit the ability for human hematopoietic stem cells (HSCs) to engraft. Next, in Chapter 4, I describe laparotomy surgery protocols that were developed to allow for the injection human HSCs into the fetal liver and intraperitoneal space. In Chapter 5 we were able to bring together elements of Chapter 3 and 4 to utilize laparotomy procedures to inject human HSCs into Art-/- IL2RG-/Y SCID pig fetuses. The phenotype of the Art-/- IL2RG-/Y pigs were T- B- NK-. In mouse models, SCID mice lacking NK cells have higher levels of human immune cell engraftment. Thus, the generation of the Art-/- IL2RG-/Y SCID pig provided an improved alternative to our original T- B- NK+ Art-/- model. In our first attempt at humanization, we observed that human T cells developed and engrafted within lymphoid organs after in utero injections. Analysis for other human cell types (B cells and hematopoietic stem cells) within lymphoid tissues is ongoing.

194

In Chapter 6 I describe the early stages of a model of ovarian cancer in SCID pigs. I describe that SCID pigs can successfully develop ovarian carcinomas when injected with ovarian cancer cell line OSPC-ARK1. In our initial trials, we injected cancer cells in an ectopic site (ear and neck). Since we were able to show that carcinomas developed, the next step will be to inject the cells into the ovaries of SCID pigs. In conjunction with this orthotopic model, targeted imaging techniques could also be tested.

Lastly, in Chapter 7, I describe leaky T cell development in SCID pigs. Human patients afflicted with certain mutations within Artemis or RAG1/2 genes can sometimes develop leaky T cells that can cause issues such as Omenn’s syndrome or lymphoma development. I describe the basic characterization of the T cells in the SCID pigs. Further investigation into the leaky nature of the T cells in the SCID pigs may warrant their use to better understand hypomorphic mutations and their negative impacts on human health.

Together, the chapters in this dissertation provide a basis for the continual development of cancer and immunological biomedical models within the SCID pig.

GENERAL DISCUSSION

Improvement of BMT in SCID pigs

The SCID pig holds potential to be utilized as a bone marrow transplantation (BMT) model that could bear relevant information for human patients afflicted with SCID.

Specifically, we have utilized BMT to rescue SCID pigs in the past. In some of these BMT cases (in Art-/- and Art-/-IL2RG-/Y SCID pigs), B cell reconstitution did not occur, or was very slow. One example of this was shown in Chapter 5 with the Art-/- IL2RG-/Y SCID pig that had low levels of B cells six months after a 100% SLA matched BMT. One interesting report in an

195

Artemis null human SCID patient described that after an BMT from an HLA identical sibling,

T cells developed, but not B cells1. This patient underwent a second BMT from the same donor approximately 2.5 years after the first transplant. During this second transplant procedure, the patient was conditioned with busulfan. Within 1 month post-BMT, the patient had detectable circulating B cells 1. The SCID pig could prove to be a useful large animal model for investigating how to improve cellular reconstitution after BMT.

One leading hypothesis as to why B cells fail to develop after BMT in some SCID patients is that that available B cell niche is occupied by host non-developing pre-B cells 2.

Conditioning with busulfan and cyclophosphamide prior to BMT has been associated with increased engraftment after BMT3. An interesting experiment that could be performed within SCID pigs is how different drug conditioning regimens impact the premature B cell populations in the bone marrow. This would allow researchers and other medical professionals to determine exactly how these different drugs could impact the B cell niche within the bone marrow. These investigations could lead to insight on optimal conditioning regimens for individuals undergoing BMT, whether for human or pigs with SCID.

Additionally, tools required for CD34+ stem cell isolation from pigs could be improved so they can be utilized in BMT procedures. Currently, there are no published methods to isolate CD34+ cells from bone marrow or cord blood in pigs. In our current BMT protocols, we use a whole-unfractionated bone marrow suspension for infusion into BMT recipients. As such, this protocol requires that our BMT donors are a 100% SLA (swine leukocyte antigen) match to the recipients because we do not deplete donor T cells. Finding

100% SLA matched pigs can be difficult at times due to limited pig availability. Development

196 of protocols to specifically isolate CD34+ cells would facilitate finding donors for the SCID pigs because a 100% SLA match would not be required for BMT.

One method for pig CD34+ cell isolation is through sorting bone marrow or cord blood by labeling with anti-pig CD34 antibodies. R&D Systems has a commercially available anti-pig CD3+ antibody (Cat # AF3890) that works in direct ELISAs and Western blots. This antibody could be tested with porcine cord blood or bone marrow for reactivity in a whole cell suspension for flow cytometry. Additionally, Layton et al (2007)4 generated an anti- porcine CD34 antibody for flow cytometry analysis. They found that approximately 4% of porcine bone marrow cells express CD34 in the femurs of one week old pigs4. Both antibodies could be tested first with flow cytometry, and then with Protein G Magnetic

Sepharose beads for the magnetic isolation of porcine CD34+ cells.

Culturing kits are commercially available for the expansion of human CD34+ cells.

These kits include a cocktail of cytokines including human FLT-3L, stem cell factor (SCF), and thrombopoietin (TPO). In Chapter 2, I show that porcine and human FLT-3L, SCF, and TPO cytokines share relatively high amino acid homology (85%, 74%, and 90%, respectively), suggesting that porcine cytokine receptors may functionally recognize porcine cytokines, and vice versa. An experimental question that could be addressed is if porcine CD34+ cells

(whether isolated or in a mixture with other cell types) can proliferate and expand in culture with these human cytokines. If these human cytokines are functional on porcine hematopoietic stem cells, banks of porcine stem cells could be expanded and frozen for future BMTs.

197

Future improvements for in utero humanization of SCID pigs

One major accomplishment described in this dissertation work was showing that human T and B cells can differentiate and engraft in Art-/- IL2RG-/Y SCID pigs after in utero injection. These first “humanized” pigs had human T cells in circulation, spleen, ileum, and mesenteric lymph nodes. A few Pax5+ cells were found in mesenteric lymph nodes and spleen (preliminary data not shown in Chapter 5). These pigs did not show evidence of engraftment of human RBC, NK, or myeloid lineage cells. In future humanization attempts, we need to develop methods to increase the total number of cells that engraft, as well as begin to understand why certain cell subsets failed to develop. There are a few major steps that can be done to understand human engraftment within SCID pigs, as well as protocol modifications to improve reconstitution: (1) determine cross reactivity of porcine cytokines on human cells, (2) understand normal immune cell differentiation and homing in a developing immunocompetent fetal pig, (3) inject human CD34+ cells at an earlier time point in gestation, (4) inject a higher dosage of human CD34+ cells within SCID pig fetuses (5) administer an in utero conditioning regimen, and (6) stimulate the immune system in IU injected neonatal SCID pigs. Table 8.1 provides an overview of our current protocols and how they can be modified in the future.

Firstly, in continuing the development of this model, it will be necessary to understand how porcine cytokines interact with developing human immune cells.

Engraftment of human hematopoietic stem cells will initially depend on cytokine signaling from porcine cells. Cytokines important for growth, proliferation, maintenance of hematopoietic stem cells (CD34+) are FLT-3L, SCF, and TPO5–8. These three swine cytokines

198 are commercially available (Abcam, Kingfisher Biotech, Cloud-Clone) and could be tested in vitro for activity with both human and porcine stem cells (description on porcine CD34+ isolation is described above). Similar approaches can be utilized for cytokines responsible for driving myelopoiesis (IL-3, GM-CSF, M-CSF), lymphopoiesis (IL-17), B cell development

(IL-4, IL-7), NK cell development (IL-15), RBC development (EPO), and others. These in vitro tests will give insight as to when in vivo development of human immune cells may be halted due to incompatibilities between human receptors and porcine cytokines.

A second necessary step in understanding why certain lineages of human cells may not have developed (or developed at low frequencies) in our initial attempt, is to appreciate hematopoiesis within fetal swine. Figure 8.1 shows an overview of hematopoietic events in fetal swine, as well as an overview on past in utero injections. At gestational day 20 (DG) fetal Ig VDJ recombination occurs within the yolk sac9,10. B cell development then transitions to the fetal liver at approximately 30 DG, and then to the bone marrow at 45 DG 9,10. B cells are the first lymphocytes that are found in the periphery of fetal piglets11. T cell development coincides with these events, with the first lymphopoiesis occurring in the fetal liver between DG 20-60, peaking at DG 4011. Thymocytes are first detected in the fetal thymus at around 38 days of gestation11,12. Myelopoiesis in swine is not as well documented as T and B cell development.

In Chapter 5 we injected Art-/- IL2RG-/Y SCID pigs at 41 DG. We chose this day because it had been previously published that administration of human cells at this time point in pre-immune, normal animals, resulted in differentiation of small populations of human T, B, myeloid and NK cells 13–16. In our SCID trial, we showed that human T and B

199 cells developed and engrafted within the lymphoid organs such as the thymus (T cells), spleen and mesenteric lymph nodes (T and B cells). One explanation for the lack of robust B cell development was that we injected stem cells at a point in gestation where B cell development is transitioning from the fetal liver to the bone marrow9,10. As such, expression of cytokines required for B cell development may be downregulated in the fetal liver during this period. Injection of human CD34+ cells at an earlier timepoint, between 30-35 DG, may provide a richer fetal liver environment to enhance human B cell development. Analysis of cytokine expression levels within the swine fetal liver at different time points in gestation

(ie. DG 30, 35, 40, 45) would be insightful for identifying when the fetal liver has the highest hematopoietic potential.

Taking the above into consideration, the third step to potentially improving engraftment is to inject human stem cells into the SCID fetuses at an earlier point in gestation. In the first description of IU injections into pig fetuses, Fujiki et al. (2003)13 attempted injections at an earlier timepoint of 33 DG and were successful in observing engraftment. There are technical difficulties with injecting at an earlier gestational time point because the fetuses are smaller and potentially more difficult to aim for via ultrasound guidance. However, injecting into the fetus at an earlier time point may increase engraftment potential given that the human cell number (per fetus) could remain the same

(4 million) or more. This would increase the dosage per fetus (per kg), as well as potentially allow more dispersion of cells within the injection site, and therefore within the developing piglet. Additionally, the fetal liver may provide a more robust environment for hematopoiesis, as described in the paragraph above.

200

A fourth step in progressing this model is to administer a higher dose of human hematopoietic stem cells within the SCID pig fetuses. In our initial trial of IU injections, human CD34+ stem cells were cultured in the presence of thrombopoietin, stem cell factor, and FLT-3L to expand the cells for the proper dosage of 2-4 million cells per fetus. After initial magnetic isolation of CD34+ cells from cord blood, purity ranges from 70-95%. After seven days in culture, approximately 20-25% of the human cells maintained expression of

CD34. Taking CD34+ cell proportion into account, a total cell dosage of 2-4 million cultured cells would only equate to 0.25-1 million CD34+ cells per fetus. Culturing within these three cytokines promotes differentiation in vitro5–8 and may restrict the differentiation within the

SCID pig. For example, engraftment of human lymphoid cells within the SCID pig would be restricted since these culturing methods promote the differentiation of myeloid lineage in vitro. In future trials, CD34+ expression should be closely monitored during the culturing period; this would ensure that the cellular dose administered to the fetuses contains 4 million CD34+ cells. Since we were able to show that a dosage of 4 million cells was safe, we could attempt to double this dosage to 8 million cells in future trials. An additional CD34+ magnetic purification could also be performed immediately prior to in utero injections to ensure a pure stem cell suspension would be injected into the fetuses.

A fifth consideration that could be made for improving this model is IU plerixafor conditioning, as well as co-injection with human mesenchymal stem cells. There are not many publications describing these techniques in large animals, however Goodrich et al

(2014)17 established these techniques in sheep, which we can adapt for our swine system.

Plerixafor disrupts the interaction between CXCL4 on hematopoietic stem cells and SDF1

201

(CXCR12) on stromal cells. This disruption leads to the mobilization of hematopoietic stem cells out of the bone marrow (and presumably the fetal liver), which vacates the stem cell niche. Goodrich et al. (2014)17 administered a combination of isolated human CD34+ derived stem cells, bone marrow derived mesenchymal stem cells (MSC), and plerixafor. They performed two sets of injections (DG 59 and DG 66) via injection through the abdominal skin into the uterus. The condition that led to the highest levels of human engraftment (20% human cells in peripheral blood 11 weeks post transplantation) was the following: Injection of 1 x 106 human MSC and 50,000 human CD34+ cells on DG 59 and injection of 80,000

CD34+ cells (same cord blood unit) at DG 66. These protocols could be adapted for use in

SCID pig fetuses. Currently we utilize laparotomy procedures, so we would be limited in performing two surgeries within this time period. However, administration of human CD34+ cells and MSC with plerixafor could be injected at a single timepoint around 30-35 DG.

These conditions could even be tested first in immunocompetent swine since this regimen has not yet been established in swine.

Lastly, a sixth consideration for increasing differentiation and mobilization of human cells within the SCID pig would be to stimulate the immune system through vaccination.

Assuming that human CD34+ cells remain engrafted within the SCID pig bone marrow at birth, these two methods could be potential routes to promote human immune development. One preliminary study showed that vaccination with Ovalbumin with L121 adjuvant led to an increase in the amount of Lin- Sca1- c-kit+ (LSK) progenitor cells in the bone marrow. Additionally, there was an increase in CD4+ and CD8+ single positive populations in the thymus of these animals18. Another study assessed the differences of

202 vaccination in mice with either acellular or whole cell vaccines of Bordetella pertussis 19. The researchers found that whole cell vaccinations led to a higher number of LSK population within the bone marrow. Additionally, there was a higher proportion of hematopoietic multipotent progenitor cells within the bone marrow. They hypothesize that the whole cell vaccination induces a more robust interferon response19. IFNα is reported to activate hematopoietic stem cells through phosphorylation of STAT1 and PKB/AKT20.

Together, a vaccination regimen with a strong adjuvant could be administered to the pigs to enhance differentiation of human cells. A potential experimental question could be to ask which regimens are most effective in the development of a humanized SCID pig model. In addition, such vaccination studies could provide answers to basic science questions about how vaccination impacts certain cell populations throughout the body.

Future outlooks for the development and distribution of new SCID pig biomedical models

The current SCID pig models that we have developed now could be utilized in cancer and stem cell therapy preclinical trials that involve adaptive immune system independent questions. The immunologically humanized SCID pig model requires optimization before it could be practically used in trials (improvements listed in above section). The SCID models that we have now (Art-/- and Art-/-IL2RG-/Y) have the potential to grow and engraft a multitude of human cell types, presumably within their respective orthotopic locations.

The SCID pig would prove to be an innovative in vivo drug testing model. Small molecule inhibitors that target altered metabolic pathways in cancer cells21 could be tested in tumor bearing SCID pigs. Methods could be developed to monitor tumor growth in the animals with different imaging techniques, while also testing the potential toxicity or side

203 effects of the drugs within human-sized pigs22. The benefit of utilizing SCID pigs over other rodent models is that tumors in these animals could be allowed to grow to sizes comparable to those found in humans. Thus, results obtained from such studies (dosage and potential toxicity) would be translatable to the human patient.

Additionally, the SCID pig holds promise as an imaging and tumor resection model.

In Chapter 6 I describe that OSPC-ARK1 cells successfully develop tumors within the SCID pig. A goal with developing the orthotopic model of ovarian cancer would be to utilize the described CPE peptide23,24 to fluorescently label the primary tumor and metastasized secondary tumors. There are a multitude peptide targeting techniques that are being developed 25,26 that could be tested within swine models.

One major hurdle that may exist for certain biomedical questions in the SCID pig is equipment and tissue accessibility. More advanced studies in SCID pigs, potentially involving surgical or imaging equipment may be difficult as the SCID pig requires housing in biocontainment. As interest in the SCID pig model expands, it will be necessary to expand biocontainment facilities to other clinical research facilities so that this animal model can be used more practically. Availability of this animal model near clinical research institutions would facilitate studies that would require the injection or implantation of patient derived tissues, such as patient derived xenograft cancer co-clinical trials that are often performed in mice models27. In addition, collaborations with pharmaceutical companies may expand financial opportunities for support to develop such facilities.

204

Concluding Remarks

The major theme of all the work described in this dissertation is the development of new toolboxes to further utilize the SCID pig in biomedical research. As swine are becoming a more popular animal model to use, it will be imperative that new tools are developed such that this model can be utilized to its maximum potential. By continual improvement and model development, the SCID pig could prove to be a new alternative animal model in the fields of cancer, transplantation, and regenerative medicine.

References

1. van der Burg, M. et al. B-cell recovery after stem cell transplantation of Artemis- deficient SCID requires elimination of autologous bone marrow precursor-B-cells. Haematologica 91, 1705–1709 (2006).

2. Noordzij, J. G. et al. Radiosensitive SCID patients with Artemis gene mutations show a complete B-cell differentiation arrest at the pre–B-cell receptor checkpoint in bone marrow. Blood 101, 1446 LP-1452 (2003).

3. Bertrand, Y. et al. Influence of severe combined immunodeficiency phenotype on the outcome of HLA non-identical, T-cell-depleted bone marrow transplantation: a retrospective European survey from the European group for bone marrow transplantation and the european society for . J. Pediatr. 134, 740–748 (1999).

4. Layton, D. S. et al. Development of an anti-porcine CD34 monoclonal antibody that identifies hematopoietic stem cells. Exp. Hematol. 35, 171–178 (2007).

5. Chen, W. et al. Thrombopoietin cooperates with FLT3-ligand in the generation of plasmacytoid dendritic cell precursors from human hematopoietic progenitors. Blood 103, 2547–2553 (2004).

6. de Graaf, C. A. & Metcalf, D. Thrombopoietin and hematopoietic stem cells. Cell Cycle 10, 1582–1589 (2011).

7. Piacibello, W. et al. Extensive amplification and self-renewal of human primitive hematopoietic stem cells from cord blood. Blood 89, 2644–2653 (1997).

205

8. Levac, K., Karanu, F. & Bhatia, M. Identification of growth factor conditions that reduce ex vivo cord blood progenitor expansion but do not alter human repopulating cell function in vivo. Haematologica 90, 166–172 (2005).

9. Sinkora, M., Sinkorova, J. & Butler, J. E. B cell development and VDJ rearrangement in the fetal pig. Vet. Immunol. Immunopathol. 87, 341–346 (2002).

10. Sinkora, M. et al. Antibody repertoire development in fetal and neonatal piglets. VI. B cell lymphogenesis occurs at multiple sites with differences in the frequency of in- frame rearrangements. J. Immunol. 170, 1781–1788 (2003).

11. Sinkora, M. et al. Prenatal ontogeny of lymphocyte subpopulations in pigs. Immunology 95, 595–603 (1998).

12. Sinkora, M., Sinkora, J., Rehakova, Z. & Butler, J. E. Early ontogeny of thymocytes in pigs: sequential colonization of the thymus by T cell progenitors. J. Immunol. 165, 1832–1839 (2000).

13. Fujiki, Y. et al. Successful multilineage engraftment of human cord blood cells in pigs after in utero transplantation. Transplantation 75, 916–922 (2003).

14. Ogle, B. M., Knudsen, B. E., Nishitai, R., Ogata, K. & Platt, J. L. Toward development and production of human T cells in swine for potential use in adoptive T cell immunotherapy. Tissue Eng. Part A 15, 1031–1040 (2009).

15. Ogle, B. M. et al. Spontaneous fusion of cells between species yields transdifferentiation and retroviral transfer in vivo. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 18, 548–550 (2004).

16. McConico, A. et al. In utero cell transfer between porcine littermates. Reprod. Fertil. Dev. 23, 297–302 (2011).

17. Goodrich, A. D. et al. Influence of a dual-injection regimen, plerixafor and CXCR4 on in utero hematopoietic stem cell transplantation and engraftment with use of the sheep model. Cytotherapy 16, 1280–1293 (2014).

18. Yang, Y.-W. & Chang, C.-F. Induction of differentiation of hematopoietic cells by the vaccine adjuvants. Am. Assoc. Immunol. Conf. (2012).

19. Varney, M. E. et al. Bordetella pertussis Whole Cell Immunization, Unlike Acellular Immunization, Mimics Naïve Infection by Driving Hematopoietic Stem and Progenitor Cell Expansion in Mice . Frontiers in Immunology 9, 2376 (2018).

206

20. Essers, M. A. G. et al. IFNalpha activates dormant haematopoietic stem cells in vivo. Nature 458, 904–908 (2009).

21. Mathupala, S. P. Metabolic targeting of malignant tumors: small-molecule inhibitors of bioenergetic flux. Recent Pat. Anticancer. Drug Discov. 6, 6–14 (2011).

22. Swindle, M. M., Makin, A., Herron, A. J., Clubb, F. J. & Frazier, K. S. Swine as Models in Biomedical Research and Toxicology Testing. Vet. Pathol. 49, 344–356 (2011).

23. Cocco, E. et al. Clostridium perfringens enterotoxin carboxy-terminal fragment is a novel tumor-homing peptide for human ovarian cancer. BMC Cancer 10, 349 (2010).

24. Cocco, E. et al. Dual-Targeting Nanoparticles for In Vivo Delivery of Suicide Genes to Chemotherapy-Resistant Ovarian Cancer Cells. Mol. Cancer Ther. 16, 323–333 (2017).

25. Hellebust, A. & Richards-Kortum, R. Advances in molecular imaging: targeted optical contrast agents for cancer diagnostics. Nanomedicine (Lond). 7, 429–445 (2012).

26. Le Joncour, V. & Laakkonen, P. Seek & Destroy, use of targeting peptides for cancer detection and drug delivery. Bioorg. Med. Chem. 26, 2797–2806 (2018).

27. Clohessy, J. G. & Pandolfi, P. P. Mouse hospital and co-clinical trial project--from bench to bedside. Nat. Rev. Clin. Oncol. 12, 491–498 (2015).

207

Figures

Figure 8.1. Hematopoiesis in the swine fetal liver and performed IU injections

Major lymphopoiesis events in fetal swine during gestation, as well as previously performed IU injections. YS: yolk sac, FL: fetal liver, BM: bone marrow.

208

Tables

Table 8.1. Modifications to improve human immune cell engraftment in SCID pigs

First humanization attempt Potential future attempts

Injection DG 41 30-35 Cell dosage 2-4 million 4-8 million %CD34+ in dose 25% 80-100% Genetic background ART -/- IL2RG -/Y ART -/- IL2RG -/Y , ART -/- , WT (for comparison) Conditioning regimen none Plerixafor (5mg/kg) in fetus Support cell co-injection none Bone marrow derived mesenchymal stem cells Vaccination none Inactivated (killed) vaccine

209

APPENDIX

Standard operating procedures for SCID pig characterization work

Isolation of peripheral blood mononuclear cells (PBMCs) from blood

Supplies:

• 15 mL conical tubes • 50 mL conical tubes • HEPES (1M) • Hanks Balanced Salt Solution (room temperature) • Ficoll-Paque PLUS (room temperature) • Sterile transfer pipettes • 10 mL transfer pipettes

Protocol:

1. Prepare HBSS-HEPES: Add 12.5 mL of 1M HEPES to 500 mL of HBSS for a total concentration of 25 mM HEPES. 2. Collect blood into heparin or EDTA tube 3. Move collected blood into a 50 mL conical tube (25 mL of blood per tube maximum) 4. Dilute blood in equal volume of HBSS (HEPES) up to an increment of 10 mL. Set aside. 5. In 15 mL conical tubes, add 3 mL of Ficoll-Paque PLUS. 6. Layer 10 mL of HBSS (HEPES) and blood mixture on top of the 3 mL of Ficoll. Be sure to layer slowly as to not disrupt the Ficoll layer. Disruption of this layer will not allow for proper cell separation. 7. Centrifuge at room temperature for 15-20 minutes at medium to high speed. 8. Once finished, remove upper layer (contains serum and HBSS) and discard with a transfer pipette 9. Remove buffy coat containing PBMCs with transfer pipette and move to clean 15 mL tube 10. Wash with 6-8 mL of HBSS and centrifuge. 11. Resuspend cells in desired volume. 12. Count cells for use.

210

Isolation of cells from lymphoid organs

Supplies:

• 50 mL conical tubes • 15 mL conical tubes • HEPES (1M) • Gentamicin • Hanks Balanced Salt Solution (room temperature) • Collagenase IV (powder) • 70% Ethanol • Scissors and forceps • Petri dish • 37 ˚C water bath or incubator • Vortex • Ficoll-Paque PLUS (room temperature) [optional] • Sterile transfer pipettes • 5, 10, and 25 mL transfer pipettes • 70-100 μm cell strainers

Protocol:

1. Prepare concentrated Collagenase IV: Add 150 mg of collagenase to 10 mL of HBSS. Mix well. Filter sterilize through 0.45 μm filter. 2. Prepare HBSS-HEPES-Collagenase IV: Add 10 mL of the filtered 15 mg/mL collagenase to 500 mL HBSS (final concentration 300 mg/L). Add 12.5 mL of 1M HEPES to 500 mL of HBSS for a total concentration of 25 mM HEPES. 3. Prepare HBSS-Gentamicin: Add 500 μl of 10mg/mL of Gentamicin (final concentration 10 μg/mL) to 500 mL of HBSS 4. In 50 mL conical tubes, pipette 20 mL of HBSS-Gentamicin. These will be used as collection tubes for pieces of tissue collected. 5. Collect tissue during necropsy. Place in HBSS-Gentamicin tubes. Place tubes on ice until ready to use in the lab. 6. Once ready to work with tissues, remove one half of a sterile petri dish and pipette 5-10 mL of HBSS-HEPES-Collagenase IV buffer. 7. Remove tissue from HBSS-Gentamicin and place into petri dish. 8. Cut tissue into small pieces with scissors. Wash tools with ethanol between samples 9. Once tissues are cut, use a transfer pipette (cut thin end off, so the opening is larger) to move tissue and HBSS buffer to a new 50 mL tube. 10. Add HBSS-HEPES-Collagenase buffer up to 20 mL. 11. Vortex for 10-20 seconds. 12. Place into 37˚C for 15 minutes. Vortex 10-20 seconds.

211

13. Repeat for up to 60 minutes. 14. Once incubation period is over, filter tissue/cell suspension through a cell filter into a new 50 mL conical tube. Add HBSS-HEPES up to 10 mL. Centrifuge 15. Remove supernatant and wash once more 16. Resuspend cells to desired volume. 17. OPTIONAL: If only interested in lymphocytes and monocytes, cells can be spun over Ficoll for isolation (As described in PBMC isolation protocol) 18. Count cells for use.

212

Counting cells with flow cytometry

Supplies:

• BD counting kit (beads, propidium iodide, thiazole orange) • Flow tubes (round bottom, 5 mL) • Cellular suspension • 1X phosphate buffered saline (PBS)

Protocol:

1. In a 5 mL flow tube, add the following: ▪ 200 μl PBS ▪ 25 μl beads (1,000 beads / μl) ▪ 25 μl cellular suspension ▪ 1 μl propidium iodide ▪ 1 μl thiazole Orange 2. Run on flow cytometer

The flow facility will run 1,000 beads. For the number of cellular events counted for every 1,000 beads, multiply by 1,000. For example, if 1,000 beads and 2,500 cell events are counted, the concentration in the cellular stock in 2,500,000 / mL.

213

Flow cytometry of isolated cells and whole blood

This is a general protocol that can be modified for project specific needs.

3. For phenotyping cells, stain between 100,000-300,000 cells in total. 4. To start, pipette 100 μl phosphate buffered saline with 0.1% Azide (PBS-Az) into a flow tube 5. Add cells. Typically want to add a volume of cells between 50-100 μl (concentrate cell stock if necessary) 6. Add first set of antibodies (titer antibodies beforehand). Let incubate at 4˚C in fridge for 15 minutes. 7. Add 2 mL PBS-Az to wash 8. Centrifuge for 5 minutes to pellet 9. Remove supernatant 10. Repeat antibody steps as necessary with given protocol. 11. After staining is complete, fix cells with 2% formaldehyde in PBS. Need at least 300 μl volume in flow tube for acquisition on flow cytometer 12. Keep refrigerated until ready to acquire data

214

Anticoagulant for cord blood collection

Supplies • Citric acid (powder) • Sodium citrate (powder) • Dextrose (powder) • DI water • 0.22 μm filter • 2 clean and sterilized 500 ml bottles Protocol 1. Add 300 mL of nanopure water to one 500 mL bottle 2. Add 3.65 g of citric acid [final concentration 38 mM] 3. Add 12.25 g of dextrose [final concentration 136 mM] 4. Add 11 g of sodium citrate [final concentration 85.25 mM] 5. Mix 6. Bring water up to 500 mL 7. Filter sterilize with 0.22 μm filter into a new bottle 8. Put 8 mL of anticoagulant into a 50 mL tube. This amount of anticoagulant will be enough for a full tube of blood (~40 mL) 9. Keep cold until use 10. Contact collaborating doctor at local hospital for drop off.

215

Isolation of human CD34+ cells from cord blood, freezing, thawing, and culturing

Supplies • Hanks balanced salt solution (HBSS) • 50 mL conical tubes • Ficoll-Paque PLUS • Miltenyi Biotech LS column • Miltenyi Biotech human CD34 microbeads • Miltenyi Biotech magnet • HBSS stem cell buffer (HBSS-SCB) (0.5% FBS and 2 mM EDTA) • Anti-human CD34 antibody • Mouse IgG1 isotype antibody (optional) • Freezing cryo media (90% FBS 10% DMSO) • 37˚ incubator/water bath • Complete RPMI (10% FBS, 2 mM glutamine, 50μg/mL gentamicin, 10 mM HEPES) • Miltenyi StemMACS HSC expansion media • Miltenyi StemMACS HSC expansion cocktail • Cell culture flasks

Protocol Mononuclear cell isolation from cord blood: 1. Receive blood from hospital 2. Dilute blood in same volume of HBSS (for ease of layering on Ficoll later, add 20 mL blood + 20 mL HBSS in a 50 mL conical tube for blood dilution) 3. Add 8 mL Ficoll to separate set of 50 mL conical tubes 4. Layer 40 mL of blood+ HBSS mixture over 8 mL Ficoll 5. Centrifuge at 1400 rpm for 15-20 minutes at room temperature (room temperature) 6. Once spin is complete, remove supernatant into waste bleach container 7. Place buffy coat layer into a new 50 mL conical tube with a transfer pipette (can consolidate cells from multiple buffy coats in the same new tube) 8. Wash buffy coat cells with HBSS 9. Centrifuge 5-7 minutes 10. Remove supernatant 11. Wash cells again in HBSS-SCB 12. Remove supernatant 13. Resuspend cells in ~300 ul of HBSS-SCB (Add larger volume if there is a large cell pellet) Preparation of MNC suspension for column separation 1. Add 100 ul* of FcR blocking reagent to MNC suspension

216

2. Add 100 ul* of CD34 microbeads to MNC suspension **If original cord blood volume was MORE than 75 mL, add 100 ul of each. If original cord blood volume was LESS than 75 mL, add 50 ul of each. 3. Mix well. Place a tube roller/shaker in a fridge and place tubes on it. Let incubate in fridge for 30-60 minutes 4. After incubation, wash cells by adding 10 ml of HBCC-SCB 5. Centrifuge 5-7 minutes 6. Remove supernatant 7. Resuspend cells in 1 mL of HBSS-SCF CD34+ cell isolation through column 1. Place LS column within the magnet 2. Rinse column with 3 mL of HBSS 3. Add cell suspension to column- collect flow through (this is the NEGATIVE fraction, while the column is in the magnet) 4. Wash column with HSSS (3 x 3 mL) and collect flow through (NEGATIVE) 5. Remove column from magnet and place over a NEW 15 mL conical tube 6. Flush column with 5 mL of HBSS by SLOWLY pushing plunger into the column (POSITIVE fraction) 7. Centrifuge cells and resuspend in 500 ul Analysis • Use anti human CD34 antibody on 10-15 ul of the 500 ul suspension to assess purity of isolated cells Freezing • To a freezing vial, add 500 ul cells and 500 ul of freezing media (90% FBS 10% DMSO) • Place tubes in -20C in Styrofoam and foil overnight • Move Styrofoam to -80C freezer overnight • Place tubes into boxes in -80C for long term storage

Thawing • Before removing tube from freezer, put 1 mL of complete RPMI media into a 15 mL conical tube • Remove tube of frozen cells from -80 and place tube into 37˚C water (make sure tube is sealed) • Monitor until thawed • Use 1 mL pipette to transfer cell suspension to the 1 mL of RPMI in the 15 mL conical tube • Add 1 mL at a time with mixing in between each addition up to 5 mL

217

• Add 5 mL more of RPMI, mix • Add 5 mL more of RPMI, mix • Centrifuge for ~5 minutes to pellet cells • Remove supernatant, wash with 10 mL RPMI once more • Centrifuge to pellet • Remove supernatant and resuspend at desired volume • Count cells and check viability Culturing • Prepare Miltenyi media according to manufacturer’s directions • Briefly, resuspend expansion cocktail (consisting of Stem Cell Factor, Thrombopoietin, FLT-3L) in 100 μl of sterile phosphate buffered saline. This is a 100X solution. Store in aliquots of 10μl • For every 10 mL of StemMACS HSC media, add 10μl of StemMACS HSC cocktail • Aliquot 5 mL of StemMACS HSC media/cocktail into cell culture flasks • Aliquot thawed stem cells at a concentration of 30-40,000 cells/mL in the media • Monitor CD34+ expression during culturing period; culture for up to 7 days • After 7 days, collected non-adherent cells for injection into fetuses • Wash cells in PBS 3X times to prepare for injection

218

List of antibodies used for flow cytometric analysis of human and pig cell subsets

Marker Clone Company Reference # Notes Anti-human CD3ε UCHT1 Biolegend 300401 human specific Anti-pig CD3ε BB23-8E6-8C8 BD Biosciences 561477 Anti-human CD4α RPA-T4 BioLegend 300511 human specific Anti-pig CD4α 74-12-4 BD Biosciences 561474 Anti-human CD8α HIT8a BioLegend 300907 human specific Anti-pig CD8β PPT23 BioRad MCA5954F Anti-pig CD8α 76-2-11 BD Biosciences 559584 Anti-human CD11b ICRF44 BioLegend 301322 human specific Anti-human CD15 H198 eBioscience 11-0159-41 human specific Anti-pig CD16 G7 Biorad MCA127GA Anti-human CD20 2H7 BD Biosciences 560960 human specific Anti-pig CD21 BB6-11C9.6 Southern Biotech 4530-31 Anti-human CD27 LG.7F9 Invitrogen 11-0271-81 human specific Anti-human CD27 323 Invitrogen 11-0279-41 human specific Anti-human CD28 CD28.2 Invitrogen 11-0699-41 human specific Anti-human CD33 WM53 BioLegend 303403 human specific APC anti-human CD34 AC136 Miltenyi 130-098139 Anti-human CD34 4H11 Invitrogen 11-0349-41 human specific Anti-human CD45-biotin H130 ebioscience 13-0459 human specific Anti-human CD47 B6H12 eBioscience 14-0479-82 human specific Anti-human CD47 2D3 eBioscience 14-0478-82 human specific Anti-human CD79α HM47 Invitrogen 12-0792-42 labels human and pig cells Anti-pig CD172 74-22-15A BD Biosciences 553640 Anti-human CD235 4720-4957 BioRad 4720-4957 human specific Anti-pig SWC6 MAC320 BD Biosciences 561482 Pe-Cy5 streptavidin x Biolegend 405205 BV421 anti-mouse IgG1 RMG1-1 Biolegend 406615 PE anti-mouse IgG1 Southern Biotech 1072-09 BV421 anti-rat IgG1/IgG2a G28-5 BD Biosciences 743849