ARPC1A Antibody Cat
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Dual Proteome-Scale Networks Reveal Cell-Specific Remodeling of the Human Interactome
bioRxiv preprint doi: https://doi.org/10.1101/2020.01.19.905109; this version posted January 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Dual Proteome-scale Networks Reveal Cell-specific Remodeling of the Human Interactome Edward L. Huttlin1*, Raphael J. Bruckner1,3, Jose Navarrete-Perea1, Joe R. Cannon1,4, Kurt Baltier1,5, Fana Gebreab1, Melanie P. Gygi1, Alexandra Thornock1, Gabriela Zarraga1,6, Stanley Tam1,7, John Szpyt1, Alexandra Panov1, Hannah Parzen1,8, Sipei Fu1, Arvene Golbazi1, Eila Maenpaa1, Keegan Stricker1, Sanjukta Guha Thakurta1, Ramin Rad1, Joshua Pan2, David P. Nusinow1, Joao A. Paulo1, Devin K. Schweppe1, Laura Pontano Vaites1, J. Wade Harper1*, Steven P. Gygi1*# 1Department of Cell Biology, Harvard Medical School, Boston, MA, 02115, USA. 2Broad Institute, Cambridge, MA, 02142, USA. 3Present address: ICCB-Longwood Screening Facility, Harvard Medical School, Boston, MA, 02115, USA. 4Present address: Merck, West Point, PA, 19486, USA. 5Present address: IQ Proteomics, Cambridge, MA, 02139, USA. 6Present address: Vor Biopharma, Cambridge, MA, 02142, USA. 7Present address: Rubius Therapeutics, Cambridge, MA, 02139, USA. 8Present address: RPS North America, South Kingstown, RI, 02879, USA. *Correspondence: [email protected] (E.L.H.), [email protected] (J.W.H.), [email protected] (S.P.G.) #Lead Contact: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.01.19.905109; this version posted January 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. -
WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT
(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT (51) International Patent Classification: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, C12Q 1/68 (2018.01) A61P 31/18 (2006.01) DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, C12Q 1/70 (2006.01) HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, (21) International Application Number: MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, PCT/US2018/056167 OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, (22) International Filing Date: SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, 16 October 2018 (16. 10.2018) TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (26) Publication Language: English GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, (30) Priority Data: UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, 62/573,025 16 October 2017 (16. 10.2017) US TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, ΓΕ , IS, IT, LT, LU, LV, (71) Applicant: MASSACHUSETTS INSTITUTE OF MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TECHNOLOGY [US/US]; 77 Massachusetts Avenue, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, Cambridge, Massachusetts 02139 (US). -
Integrating Protein Copy Numbers with Interaction Networks to Quantify Stoichiometry in Mammalian Endocytosis
bioRxiv preprint doi: https://doi.org/10.1101/2020.10.29.361196; this version posted October 29, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Integrating protein copy numbers with interaction networks to quantify stoichiometry in mammalian endocytosis Daisy Duan1, Meretta Hanson1, David O. Holland2, Margaret E Johnson1* 1TC Jenkins Department of Biophysics, Johns Hopkins University, 3400 N Charles St, Baltimore, MD 21218. 2NIH, Bethesda, MD, 20892. *Corresponding Author: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.10.29.361196; this version posted October 29, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Abstract Proteins that drive processes like clathrin-mediated endocytosis (CME) are expressed at various copy numbers within a cell, from hundreds (e.g. auxilin) to millions (e.g. clathrin). Between cell types with identical genomes, copy numbers further vary significantly both in absolute and relative abundance. These variations contain essential information about each protein’s function, but how significant are these variations and how can they be quantified to infer useful functional behavior? Here, we address this by quantifying the stoichiometry of proteins involved in the CME network. We find robust trends across three cell types in proteins that are sub- vs super-stoichiometric in terms of protein function, network topology (e.g. -
ARPC1A Antibody (Center) Purified Rabbit Polyclonal Antibody (Pab) Catalog # Ap6519c
10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 ARPC1A Antibody (Center) Purified Rabbit Polyclonal Antibody (Pab) Catalog # AP6519c Specification ARPC1A Antibody (Center) - Product Information Application WB, IHC-P, FC,E Primary Accession Q92747 Other Accession Q99PD4, Q9R0Q6, Q1JP79, Q8AVT9, A0A1L8EXB5 Reactivity Human Predicted Xenopus, Bovine, Mouse, Rat Host Rabbit Clonality Polyclonal Isotype Rabbit Ig Calculated MW 41569 Antigen Region 157-184 Western blot analysis of ARPC1A antibody ARPC1A Antibody (Center) - Additional (Center) (Cat.# AP6519c) in Y79 cell line Information lysates (35ug/lane). ARPC1A (arrow) was detected using the purified Pab. Gene ID 10552 Other Names Actin-related protein 2/3 complex subunit 1A, SOP2-like protein, ARPC1A, SOP2L Target/Specificity This ARPC1A antibody is generated from rabbits immunized with a KLH conjugated synthetic peptide between 157-184 amino acids from the Central region of human ARPC1A. Dilution WB~~1:1000 ARPC1A Antibody (Center) (Cat. #AP6519c) IHC-P~~1:50~100 immunohistochemistry analysis in formalin FC~~1:10~50 fixed and paraffin embedded human brain tissue followed by peroxidase conjugation of Format the secondary antibody and DAB staining. Purified polyclonal antibody supplied in PBS This data demonstrates the use of the with 0.09% (W/V) sodium azide. This ARPC1A Antibody (Center) for antibody is prepared by Saturated immunohistochemistry. Clinical relevance has Ammonium Sulfate (SAS) precipitation not been evaluated. followed by dialysis against PBS. Storage Maintain refrigerated at 2-8°C for up to 2 weeks. For long term storage store at -20°C Page 1/2 10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 in small aliquots to prevent freeze-thaw cycles. -
ARPC1A (NM 001190996) Human Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC230814L4 ARPC1A (NM_001190996) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: ARPC1A (NM_001190996) Human Tagged ORF Clone Tag: mGFP Symbol: ARPC1A Synonyms: Arc40; HEL-68; HEL-S-307; SOP2Hs; SOP2L Vector: pLenti-C-mGFP-P2A-Puro (PS100093) E. coli Selection: Chloramphenicol (34 ug/mL) Cell Selection: Puromycin ORF Nucleotide The ORF insert of this clone is exactly the same as(RC230814). Sequence: Restriction Sites: SgfI-MluI Cloning Scheme: ACCN: NM_001190996 ORF Size: 1068 bp This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 ARPC1A (NM_001190996) Human Tagged ORF Clone – RC230814L4 OTI Disclaimer: The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info OTI Annotation: This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. RefSeq: NM_001190996.1, NP_001177925.1 RefSeq ORF: 1071 bp Locus ID: 10552 Protein Pathways: Fc gamma R-mediated phagocytosis, Pathogenic Escherichia coli infection, Regulation of actin cytoskeleton MW: 40.1 kDa Gene Summary: This gene encodes one of seven subunits of the human Arp2/3 protein complex. -
Eight Common Genetic Variants Associated with Serum DHEAS Levels Suggest a Key Role in Ageing Mechanisms
Eight Common Genetic Variants Associated with Serum DHEAS Levels Suggest a Key Role in Ageing Mechanisms The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Zhai, Guangju, Alexander Teumer, Lisette Stolk, John R. B. Perry, Liesbeth Vandenput, Andrea D. Coviello, Annemarie Koster, et al. 2011. Eight common genetic variants associated with serum DHEAS levels suggest a key role in ageing mechanisms. PLoS Genetics 7(4): e1002025. Published Version doi:10.1371/journal.pgen.1002025 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:5146966 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Eight Common Genetic Variants Associated with Serum DHEAS Levels Suggest a Key Role in Ageing Mechanisms Guangju Zhai1., Alexander Teumer2., Lisette Stolk3,4., John R. B. Perry5,6., Liesbeth Vandenput7., Andrea D. Coviello8., Annemarie Koster9., Jordana T. Bell1,6, Shalender Bhasin10, Joel Eriksson7, Anna Eriksson7, Florian Ernst2, Luigi Ferrucci11, Timothy M. Frayling5, Daniel Glass1, Elin Grundberg1,12, Robin Haring13,A˚ sa K. Hedman6, Albert Hofman4,14, Douglas P. Kiel15, Heyo K. Kroemer16, Yongmei Liu17, Kathryn L. Lunetta18, Marcello Maggio19, Mattias Lorentzon7, Massimo Mangino1, David Melzer5, Iva Miljkovic20, MuTHER Consortium, Alexandra Nica12,21, Brenda W. J. H. Penninx22, Ramachandran S. Vasan8,23, Fernando Rivadeneira3,4, Kerrin S. Small1,12, Nicole Soranzo1,12, Andre´ G. Uitterlinden3,4,14, Henry Vo¨ lzke24, Scott G. -
Loss of the Arp2/3 Complex Component ARPC1B Causes Platelet Abnormalities and Predisposes to Inflammatory Disease
ARTICLE Received 9 Nov 2016 | Accepted 31 Jan 2017 | Published 3 Apr 2017 DOI: 10.1038/ncomms14816 OPEN Loss of the Arp2/3 complex component ARPC1B causes platelet abnormalities and predisposes to inflammatory disease Walter H.A. Kahr1,2,3, Fred G. Pluthero1, Abdul Elkadri1,4,5, Neil Warner1,4, Marko Drobac1,3, Chang Hua Chen1,3, Richard W. Lo1,3, Ling Li1, Ren Li1,QiLi1,4, Cornelia Thoeni1,4, Jie Pan1,4, Gabriella Leung1,4, Irene Lara-Corrales6, Ryan Murchie1,4, Ernest Cutz7, Ronald M. Laxer8,9, Julia Upton10, Chaim M. Roifman10, Rae S.M. Yeung1,5,8,11, John H. Brumell1,4,5,12 & Aleixo M. Muise1,3,4,5 Human actin-related protein 2/3 complex (Arp2/3), required for actin filament branching, has two ARPC1 component isoforms, with ARPC1B prominently expressed in blood cells. Here we show in a child with microthrombocytopenia, eosinophilia and inflammatory disease, a homozygous frameshift mutation in ARPC1B (p.Val91Trpfs*30). Platelet lysates reveal no ARPC1B protein and greatly reduced Arp2/3 complex. Missense ARPC1B mutations are identified in an unrelated patient with similar symptoms and ARPC1B deficiency. ARPC1B- deficient platelets are microthrombocytes similar to those seen in Wiskott–Aldrich syndrome that show aberrant spreading consistent with loss of Arp2/3 function. Knockout of ARPC1B in megakaryocytic cells results in decreased proplatelet formation, and as observed in platelets from patients, increased ARPC1A expression. Thus loss of ARPC1B produces a unique set of platelet abnormalities, and is associated with haematopoietic/immune symptoms affecting cell lineages where this isoform predominates. In agreement with recent experimental studies, our findings suggest that ARPC1 isoforms are not functionally interchangeable. -
Csde1 Binds Transcripts Involved in Protein Homeostasis and Controls
www.nature.com/scientificreports OPEN Csde1 binds transcripts involved in protein homeostasis and controls their expression in an erythroid cell Received: 17 August 2017 Accepted: 18 January 2018 line Published: xx xx xxxx Kat S. Moore1, Nurcan Yagci1, Floris van Alphen2, Nahuel A. Paolini1, Rastislav Horos3, Ntsiki M. Held4, Riekelt H. Houtkooper4, Emile van den Akker1, Alexander B. Meijer2,5, Peter A. C. ‘t Hoen 6 & Marieke von Lindern1 Expression of the RNA-binding protein Csde1 (Cold shock domain protein e1) is strongly upregulated during erythropoiesis compared to other hematopoietic lineages. Csde1 expression is impaired in the severe congenital anemia Diamond Blackfan Anemia (DBA), and reduced expression of Csde1 in healthy erythroblasts impaired their proliferation and diferentiation. To investigate the cellular pathways controlled by Csde1 in erythropoiesis, we identifed the transcripts that physically associate with Csde1 in erythroid cells. These mainly encoded proteins involved in ribogenesis, mRNA translation and protein degradation, but also proteins associated with the mitochondrial respiratory chain and mitosis. Crispr/ Cas9-mediated deletion of the frst cold shock domain of Csde1 afected RNA expression and/or protein expression of Csde1-bound transcripts. For instance, protein expression of Pabpc1 was enhanced while Pabpc1 mRNA expression was reduced indicating more efcient translation of Pabpc1 followed by negative feedback on mRNA stability. Overall, the efect of reduced Csde1 function on mRNA stability and translation of Csde1-bound transcripts was modest. Clones with complete loss of Csde1, however, could not be generated. We suggest that Csde1 is involved in feed-back control in protein homeostasis and that it dampens stochastic changes in mRNA expression. -
4036.Full.Pdf
The Journal of Immunology Disruption of Thrombocyte and T Lymphocyte Development by a Mutation in ARPC1B Raz Somech,*,† Atar Lev,*,† Yu Nee Lee,*,† Amos J. Simon,*,†,‡ Ortal Barel,†,x Ginette Schiby,{ Camila Avivi,{ Iris Barshack,{ Michele Rhodes,‖ Jiejing Yin,‖ Minshi Wang,‖ Yibin Yang,‖ Jennifer Rhodes,‖ Nufar Marcus,# Ben-Zion Garty,# Jerry Stein,** Ninette Amariglio,†,‡,x,†† Gideon Rechavi,†,x David L. Wiest,‖,1 and Yong Zhang‖,1 Regulation of the actin cytoskeleton is crucial for normal development and function of the immune system, as evidenced by the severe immune abnormalities exhibited by patients bearing inactivating mutations in the Wiskott–Aldrich syndrome protein (WASP), a key regulator of actin dynamics. WASP exerts its effects on actin dynamics through a multisubunit complex termed Arp2/3. Despite the critical role played by Arp2/3 as an effector of WASP-mediated control over actin polymerization, mutations in protein components of the Arp2/3 complex had not previously been identified as a cause of immunodeficiency. Here, we describe two brothers with hematopoietic and immunologic symptoms reminiscent of Wiskott–Aldrich syndrome (WAS). However, these patients lacked mutations in any of the genes previously associated with WAS. Whole-exome sequencing revealed a homozygous 2 bp deletion, n.c.G623DEL-TC (p.V208VfsX20), in Arp2/3 complex component ARPC1B that causes a frame shift resulting in premature termination. Modeling of the disease in zebrafish revealed that ARPC1B plays a critical role in supporting T cell and thrombocyte development. Moreover, the defects in development caused by ARPC1B loss could be rescued by the intact human ARPC1B ortholog, but not by the p.V208VfsX20 variant identified in the patients. -
Product Size GOT1 P00504 F CAAGCTGT
Table S1. List of primer sequences for RT-qPCR. Gene Product Uniprot ID F/R Sequence(5’-3’) name size GOT1 P00504 F CAAGCTGTCAAGCTGCTGTC 71 R CGTGGAGGAAAGCTAGCAAC OGDHL E1BTL0 F CCCTTCTCACTTGGAAGCAG 81 R CCTGCAGTATCCCCTCGATA UGT2A1 F1NMB3 F GGAGCAAAGCACTTGAGACC 93 R GGCTGCACAGATGAACAAGA GART P21872 F GGAGATGGCTCGGACATTTA 90 R TTCTGCACATCCTTGAGCAC GSTT1L E1BUB6 F GTGCTACCGAGGAGCTGAAC 105 R CTACGAGGTCTGCCAAGGAG IARS Q5ZKA2 F GACAGGTTTCCTGGCATTGT 148 R GGGCTTGATGAACAACACCT RARS Q5ZM11 F TCATTGCTCACCTGCAAGAC 146 R CAGCACCACACATTGGTAGG GSS F1NLE4 F ACTGGATGTGGGTGAAGAGG 89 R CTCCTTCTCGCTGTGGTTTC CYP2D6 F1NJG4 F AGGAGAAAGGAGGCAGAAGC 113 R TGTTGCTCCAAGATGACAGC GAPDH P00356 F GACGTGCAGCAGGAACACTA 112 R CTTGGACTTTGCCAGAGAGG Table S2. List of differentially expressed proteins during chronic heat stress. score name Description MW PI CC CH Down regulated by chronic heat stress A2M Uncharacterized protein 158 1 0.35 6.62 A2ML4 Uncharacterized protein 163 1 0.09 6.37 ABCA8 Uncharacterized protein 185 1 0.43 7.08 ABCB1 Uncharacterized protein 152 1 0.47 8.43 ACOX2 Cluster of Acyl-coenzyme A oxidase 75 1 0.21 8 ACTN1 Alpha-actinin-1 102 1 0.37 5.55 ALDOC Cluster of Fructose-bisphosphate aldolase 39 1 0.5 6.64 AMDHD1 Cluster of Uncharacterized protein 37 1 0.04 6.76 AMT Aminomethyltransferase, mitochondrial 42 1 0.29 9.14 AP1B1 AP complex subunit beta 103 1 0.15 5.16 APOA1BP NAD(P)H-hydrate epimerase 32 1 0.4 8.62 ARPC1A Actin-related protein 2/3 complex subunit 42 1 0.34 8.31 ASS1 Argininosuccinate synthase 47 1 0.04 6.67 ATP2A2 Cluster of Calcium-transporting -
Enrichment of in Vivo Transcription Data from Dietary Intervention
Hulst et al. Genes & Nutrition (2017) 12:11 DOI 10.1186/s12263-017-0559-1 RESEARCH Open Access Enrichment of in vivo transcription data from dietary intervention studies with in vitro data provides improved insight into gene regulation mechanisms in the intestinal mucosa Marcel Hulst1,3* , Alfons Jansman2, Ilonka Wijers1, Arjan Hoekman1, Stéphanie Vastenhouw3, Marinus van Krimpen2, Mari Smits1,3 and Dirkjan Schokker1 Abstract Background: Gene expression profiles of intestinal mucosa of chickens and pigs fed over long-term periods (days/ weeks) with a diet rich in rye and a diet supplemented with zinc, respectively, or of chickens after a one-day amoxicillin treatment of chickens, were recorded recently. Such dietary interventions are frequently used to modulate animal performance or therapeutically for monogastric livestock. In this study, changes in gene expression induced by these three interventions in cultured “Intestinal Porcine Epithelial Cells” (IPEC-J2) recorded after a short-term period of 2 and 6 hours, were compared to the in vivo gene expression profiles in order to evaluate the capability of this in vitro bioassay in predicting in vivo responses. Methods: Lists of response genes were analysed with bioinformatics programs to identify common biological pathways induced in vivo as well as in vitro. Furthermore, overlapping genes and pathways were evaluated for possible involvement in the biological processes induced in vivo by datamining and consulting literature. Results: For all three interventions, only a limited number of identical genes and a few common biological processes/ pathways were found to be affected by the respective interventions. However, several enterocyte-specific regulatory and secreted effector proteins that responded in vitro could be related to processes regulated in vivo, i.e. -
Primepcr™Assay Validation Report
PrimePCR™Assay Validation Report Gene Information Gene Name actin related protein 2/3 complex, subunit 1A Gene Symbol Arpc1a Organism Mouse Gene Summary Description Not Available Gene Aliases 0610010H08Rik, 1110030K07Rik, 41kDa, AA407347, Sid32, Sid329 RefSeq Accession No. NC_000071.6, NT_039324.8 UniGene ID Mm.371610 Ensembl Gene ID ENSMUSG00000029621 Entrez Gene ID 56443 Assay Information Unique Assay ID qMmuCID0005923 Assay Type SYBR® Green Detected Coding Transcript(s) ENSMUST00000031625 Amplicon Context Sequence CTGTGGGGAGCGGAGCCCGGCTCATCTCTGTCTGTTACTTTGAGTCTGAGAATG ACTGGTGGGTGAGCAAGCACATTAAGAAGCCGATCCGCTCCACAGT Amplicon Length (bp) 70 Chromosome Location 5:145096217-145097257 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 99 R2 0.9994 cDNA Cq 19.36 cDNA Tm (Celsius) 80 gDNA Cq 34.76 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Arpc1a, Mouse Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Mouse Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.