The Role of Hoxb8 in Myeloid Progenitor Cell Immortalisation

Presented By

Marika Salmanidis

Submitted in total fulfillment of the requirements of the degree of

Doctor of Philosophy

Department of Paediatrics

Faculty of Medicine, Dentistry and Health Sciences

The University of Melbourne

August 2013

Produced on archival quality paper

Declaration

This is to certify that

• the thesis comprises only my original work towards the PhD except where indicated in the Preface,

• due acknowledgement has been made in the text to all other material used,

• the thesis is fewer than 100,000 words in length, exclusive of tables, maps, bibliographies and appendices

Marika Salmanidis

Department of Paediatrics

University of Melbourne;

Parkville, Victoria 3052

Australia

Preface

I would like to acknowledge the following persons who have contributed work in this thesis: G. Brumatti assisted in experiments involving cell survival, proliferation and cell cycle after 4-OHT withdrawal in Figures 3.13, 3.14, 3.15, 4.6 and 4.7. G Brumatti also completed Figures 3.17B and Figure 3.18 H. Puthalakath and R. Weston cloned the Bim promoter and 3’UTR regions into the pGL2 luciferase vectors L. Rohbeck cloned the 3’UTR segments into the FUGW lentiviral plasmid A. Bert set up and completed post-run analysis on the miRNA PCR array. He also created the heat map in Figure 5.2 N. Narayan and S. Conos cloned miR-150 and miR-211 into the doxycycline inducible system and carried out induction experiments for Figure 6.2.

The proportion of work carried out by myself per results chapter: Chapter 3: 78% Chapter 4: 72% Chapter 5: 90%

Total work: 80%

Acknowledgements

This body of work has been a large labour of love for the past five years. Had it not been for the support and guidance of the following people, this work would not have been possible.

I would firstly like to thank my principal supervisor, Associate Professor Paul Ekert. His continued enthusiasm and passion for science has been an inspiration and solid ground to base my own interest in science. His never-ending patience has defused many a tense situation, calmed a very stressed student and for that I am very thankful.

Also, I would like to especially thank my second supervisor, Doctor Anissa Jabbour. As a supervisor she has guided me through the trickiest of scientific questions and has never lost faith. It was a blessing to have her as a close friend and confidant.

Secondly, I would like to thank Doctor Gabriela Brumatti. Her support and friendship in and outside of the lab made it so much easier to go to work everyday and get through each year.

I would also like to thank my ‘PhD buddy’, Mimi. Her enthusiasm and tenacity was very contagious. Sitting next to her throughout my PhD kept me fired yet level headed.

Thanks is also deserving to the other Ekert lab members who have, through their little ways, being that of preparing reagents or accompanying me on coffee breaks, contributed to the completion of this thesis.

Thank you also to my mother and father and to my siblings, Sotiris, Ioanna and Dora, who have been very patient and supportive throughout these five years.

I am eternally thankful and will never forget the love and assistance I received from my grandmother. Her wisdom and never-failing spirit will be something to always aspire to.

Finally, even though we spent the majority of this PhD separated by 800km, the support of my partner, Dickson, was always felt and never faltering.

Table of Contents

1.0 Introduction...... 1

1.1 Haematopoiesis...... 1 1.1.1 Origin of the Haematopoietic Stem Cell...... 1 1.1.2 Differentiation of the HSC ...... 1

1.2 Cytokine signalling in haematopoiesis ...... 2 1.2.1 Cytokines required for haematopoietic survival and differentiation...... 2 1.2.2 Cytokine receptors and intracellular signalling...... 2

1.3 Cell Death pathways in haematopoiesis...... 7 1.3.1 The intrinsic cell death pathway...... 7 1.3.1.1 The role of Bim in haematopoeisis ...... 10 1.3.3 The extrinsic cell death pathway ...... 12

1.4 miRNAs in haematopoiesis ...... 12 1.4.1 Function of miRNAs...... 12 1.4.2 Targets of miRNA regulation in haematopoiesis...... 13 1.4.3 The miR-17~92 cluster of miRNAs ...... 13

1.5 Hox genes ...... 15 1.5.1 Evolution and pattern of Hox gene expression...... 15 1.5.2 Regulation of Hox gene expression ...... 16 1.5.2.1 Hox regulation through chromatin modification ...... 17 1.5.2.2 Hox regulation through non-coding RNAs...... 17 1.5.3 Hox interactions with the TALE family of proteins ...... 20

1.6 Hox genes in haematopoiesis...... 22 1.6.1 Hox gene expression in haematopoiesis ...... 22 1.6.2 Requirement for Hoxb8 in haematopoiesis...... 24 1.6.3 Regulatory pathways influenced by Hox gene expression in haematopoiesis...25 1.6.4 Hox genes regulating cell death ...... 26

1.7 Leukaemia ...... 27 1.7.1 Origin of Acute Myeloid Leukaemia...... 27 1.7.1.1 Mutations in Signal Transduction pathways in acute myeloid leukemia ...28 1.7.1.2 Mutations in transcription factors in acute myeloid leukemia...... 28 1.7.1.3 Mutations not confined to Type I or Type II classifications...... 29 1.7.2 The role of Bcl-2 family proteins in AML development...... 30 1.7.3 The role of miRNAs in AML development ...... 31

1.8 The role of Hox genes in AML...... 32 1.8.1 Hox gene over-expression co-operates with activated signal transduction to cause leukaemia...... 32 1.8.2 Chromosomal rearrangements involving Hox genes in leukaemia ...... 33 1.8.3 Origin of the WEHI-3B leukaemia...... 34 1.8.4 The recapitulation of the WEHI-3B leukaemia through IL-3 and Hoxb8 over- expression ...... 35 1.8.5 Hoxb8 over-expression in human leukaemia...... 35

1.9 Hypothesis and Aims of thesis ...... 36 1.9.1 Aim 1 – To examine the behaviour of haematopoietic progenitor cells after immortalisation with the conditional Hoxb8 expression system...... 36 1.9.2 Aim 2 – To examine the behaviour of Hoxb8 immortalised progenitor cells upon withdrawal of Hoxb8 expression...... 36 1.9.3 Aim 3 – To investigate gene expression pathways that are regulated by Hoxb8 to promote progenitor cell immortalisation...... 37

2.0 Materials and Methods...... 39

2.1 Cloning...... 39 2.1.1 Conditional Hoxb8 lentiviral systems...... 39 2.1.1.1 Creating the pF 5xUAS Hoxb8 SV40 puro GEV16 plasmid...... 39 2.1.1.2 Creating the pF 7xTetOP Hoxb8 GSlinker RS PGK Hygro TetRVP16 plasmid...... 41 2.1.2 Description of cloning methods/sources for all other expression plasmids ...... 41 2.1.3 Genotyping...... 44

2.2 Maintenance of commonly used cell lines...... 45

2.3 Mouse models ...... 46

2.4 Creation of IL-3 dependent, conditional Hoxb8 myeloid progenitor cell lines.46 2.4.1 Production of lentivirus ...... 46 2.4.2 Determination of lentiviral titre...... 47 2.4.3 Isolation of fetal liver c-kit+ve/lin-ve progenitor cells ...... 47 +ve -ve 2.4.3.1 Isolating a c-kit /lin population using FACS ...... 48 2.4.3.2 Isolating an enriched progenitor population using Mouse Haematopoietic Progenitor (Stem) Cell Enrichment Set – DM (BD)...... 48 2.4.4 Infection of cells...... 49 2.4.5 Culture conditions post infection...... 49 2.4.6 Infection of Hoxb8 immortalised progenitor cells with MPZen-IL-3 retrovirus50

2.5 Cell proliferation and survival assays...... 50 2.5.1 Cell counts ...... 50 2.5.2 Analysis of Cell survival ...... 51 2.5.3 Analysis of Cell cycle...... 51 2.5.4 Soft agar...... 51 2.5.5 Luciferase assays ...... 52 2.5.6 GFP reporter assays...... 53

2.6 Differentiation assays ...... 53 2.6.1 Analysis of surface marker expression ...... 53 2.6.2 May Grunwald/Giemsa staining...... 54

2.7 Protein expression analysis ...... 54 2.7.1 Western Blots ...... 54 2.7.2 Hoxb8 intracellular staining...... 55 2.7.3 IL-3 Receptor staining by Flow Cytometry...... 56

2.8 mRNA analysis...... 56 2.8.1 Detection of mRNA using the Universal Probe Library (Roche) ...... 56

2.9 miRNA analysis...... 58 2.9.1 Detection of miRNAs using the Taqman Small RNA Assay Kit ...... 58 2.9.2 Detection of miRNAs using the Taqman miRNA qPCR array ...... 59 2.9.3 Using the TargetScan software to detect predicted miRNA binding sites ...... 61

3.0 Development and characterisation of the inducible Hoxb8, immortalised progenitor cell line ...... 62

3.1 Establishment of an immortalised progenitor cell line dependent on inducible expression of Hoxb8...... 62 3.1.1 Description of the bicistronic, 4-OHT inducible lentiviral vector...... 62 3.1.2 Description of the bicistronic, Doxycycline repressible, lentiviral vector ...... 64 3.1.3 Lentiviral infection of Murine E14 fetal liver multi-potential progenitor cells.64 3.1.4 Immortalisation of c-kit+ve/lin-ve progenitor cells is dependent on over- expressed Hoxb8 and exogenously supplied IL-3...... 67 3.1.5 Hoxb8 and IL-3 immortalise cells that exhibit a myeloid phenotype...... 73

3.2 The survival and proliferation of Hoxb8 immortalised progenitor cells upon Hoxb8 withdrawal...... 75 3.2.1 Hoxb8 levels are tightly controlled by the 4-OHT inducible and Doxycycline repressible lentiviral systems...... 75 3.2.2 Hoxb8 immortalised progenitor cells exhibit myeloid differentiation upon 4- OHT withdrawal ...... 78 3.2.3 Hoxb8 immortalised progenitor cells exit the cell cycle and undergo apoptosis after 4-OHT withdrawal ...... 82

3.3 Hoxb8 withdrawal induces Bax/Bak, caspase-dependent apoptosis...... 88

3.4 Discussion ...... 96 3.4.1 The 4-OHT inducible Hoxb8 lentiviral system is a successful model for examining Hoxb8 mediated effects on myeloid progenitor cells ...... 96 3.4.2 Hoxb8 is required to prevent myeloid differentiation...... 97 3.4.3 Hoxb8 is required to prevent cell cycle arrest and cell death independent of signalling through the IL-3 receptor ...... 97

4.0 Hoxb8 represses the pro-apoptotic protein, Bim ...... 101

4.1 Bim is repressed in Hoxb8 immortalised myeloid progenitor cells...... 101

4.2 Bim is partially required for the cell cycle arrest and cell death induced after Hoxb8 withdrawal...... 107

4.3 Bim mRNA is repressed by Hoxb8 through mechanisms targeting the 3’UTR ...... 112

4.4 Discussion ...... 116 4.4.1 Hox mediated repression of a BH3-only protein ...... 117 4.4.2 Advantages of Bim repression in maintaining an immortalised state ...... 118 4.4.3 Long-term self-renewal in the absence of Bax, Bak and Bim...... 120 5.0 The miR-17~92 cluster is regulated by Hoxb8 and is required for optimal cell survival and proliferation...... 123

5.1 The global analysis of miRNAs in Hoxb8 immortalised progenitor cells reveals the miR-17~92 cluster as a possible candidate for Bim repression...... 123 5.1.1 Hoxb8 can regulate the expression of 71 miRNAs ...... 124 5.1.2 miRNAs predicted to bind the Bim 3’UTR are significantly upregulated during Hoxb8 over-expression ...... 129

5.2 Other known targets of miR-17~92 are repressed during Hoxb8 over- expression...... 131

5.3 The miR-17~92 cluster is required in Hoxb8 immortalised progenitor cells to preserve an immortalised state...... 137 5.3.1 Description of the miR-17~92flx/flx mouse model...... 137 5.3.2 Hoxb8 and Hoxa9 immortalised miR-17~92flxflx progenitor cells lose clonogenic potential after cre expression ...... 143 5.3.3 Hoxb8 immortalised progenitor cells lacking miR-17~92 undergo negative selection in culture...... 143

5.4 Discussion ...... 147 5.4.1 miRNA mediated regulation of Bim ...... 147 5.4.2 The requirement for miR-17~92 expression in tumour progression ...... 149 5.4.3 Mechanisms of direct regulation of the miR-17~92 cluster...... 149

6.0 Conclusions...... 151

6.1 Revised model of Hoxb8 mediated immortalisation of myeloid progenitor cells ...... 151 6.1.1 Is the oncogenic function of Hoxb8 mediated through Bim repression?...... 151 6.1.2 Hoxb8 directly or indirectly regulates miRNA expression ...... 152

6.2 The use of miRNAs as targets for therapy ...... 155

6.3 Future directions...... 156

7.0 References...... 161

APPENDIX...... i

Figures

Figure 1.1 Haematopoietic differentiation………………………………………………3 Figure 1.2 Intracellular signaling pathways that promote cell survival after stimulation of the beta common chain receptor ……………………………………………………..6 Figure 1.3 The intrinsic and extrinsic apoptotic pathways……………………………...9 Figure 1.4 Schematic representation of the murine Bim genomic region and alternate isoforms………………………………………………………………………………...11 Figure 1.5 The pathway of miRNA processing………………………………………..14 Figure 1.6 Comparison of Hox Clusters found in Caenorhabditis Elegans, Drosophila Melanogaster and Mus Musculus/Homo Sapien……………………………………….19 Figure 1.7 Structure of the HoxB1:Pbx1 interaction bound to DNA………………….21 Figure 2.1: Schematic diagrams of luciferase reporter constructs…………………….43 Figure 2.2 Flow diagram of sample preparation and running of Taqman® MicroRNA array Cards……………………………………………………………………………...60 Figure 3.1 The 4-OHT inducible, Hoxb8 lentiviral vector…………………………….63 Figure 3.2 The doxycycline repressible Hoxb8, lentiviral vector……………………..65 Figure 3.3 Infection protocol for the creation of conditional Hoxb8 immortalised progenitor cell line……………………………………………………………………...66 Figure 3.4 Hoxb8 immortalised progenitor cells are clonogenically viable only in the presence of over-expressed Hoxb8……………………………………………………..68 Figure 3.5 Hoxb8 immortalised progenitor cells require IL-3 for survival and proliferation…………………………………………………………………………….69 Figure 3.6 Immortalisation of c-kit+ve/lin-ve progenitor cells by Hoxb8 occurs at the same efficiency in high and low concentrations of cytokine…………………………..71 Figure 3.7 SCF and GM-CSF cannot substitute for IL-3 to promote clonal viability of Hoxb8 immortalised progenitor cells…………………………………………………..72 Figure 3.8 c-kit+ve/lin-ve progenitor cells exhibit a myeloid phenotype after immortalisation with the 4-OHT inducible Hoxb8 lentivirus………………………….74 Figure 3.9 Hoxb8 can be tightly controlled in 4-OHT inducible, Hoxb8 immortalised progenitor cells…………………………………………………………………………76 Figure 3.10 Hoxb8 can be tightly regulated in progenitor cells immortalised with Doxycyline repressible Hoxb8…………………………………………………………77 Figure 3.11 Hoxb8 immortalised progenitor cells undergo morphological differentiation after 4-OHT withdrawal………..………………………………………79 Figure 3.12 Hoxb8 immortalised progenitor cells exhibit a slight change in surface marker expression after 4-OHT withdrawal……………………………………………80 Figure 3.13 Hoxb8 immortalised myeloid progenitor cells decrease in number after 4- OHT withdrawal………………………………………………………………………..83 Figure 3.14 Hoxb8 immortalised progenitor cells undergo cell cycle arrest after 4-OHT withdrawal……………………………………………………………………………...84 Figure 3.15 Hoxb8 immortalised progenitor cells undergo cell death after 4-OHT withdrawal……………………………………………………………………………...85 Figure 3.16 Cell death after Hoxb8 withdrawal is mediated by the loss of Hoxb8 and cannot be rescued by the addition of other cytokines…………………………………..87 Figure 3.17 All components of the IL-3 receptor remain stably expressed in the presence and absence of Hoxb8………………………………………………………..89 Figure 3.18 Hoxb8 immortalised progenitor cells do not undergo cell death after 4- OHT withdrawal in the presence of the caspase inhibitor, QVD-OPh…………………91 Figure 3.19 Bax-/-;Bak-/- Hoxb8 immortalised progenitor cells do not undergo apoptosis after IL-3 withdrawal…………………………………………………………………...92 Figure 3.20 Hoxb8 immortalised progenitor cells lacking Bax and Bak do not undergo apoptosis after Hoxb8 withdrawal……………………………………………………...93 Figure 3.21 Bax-/-;Bak-/-, Hoxb8 immortalised progenitor cells exit the cell cycle after 4-OHT withdrawal……………………………………………………………………...95 Figure 4.1 Bim protein levels are repressed during Hoxb8 over-expression and increase upon Hoxb8 withdrawal. ……………………………………………………………..102 Figure 4.2 Bim expression is repressed after Hoxb8 down-regulation in Doxycycline repressible, Hoxb8 immortalised progenitor cells…………………………………….104 Figure 4.3 Bim mRNA levels increase upon Hoxb8 withdrawal…………………….105 Figure 4.4 Hoxb8 over-expression cannot repress Bim in other transformed cell lines……………………………………………………………………………………106 Figure 4.5 The reduction in cell viability after Hoxb8 withdrawal is delayed in Bim-/- immortalised progenitor cells…………………………………………………………108 Figure 4.6 Cell cycle arrest in Bim-/- Hoxb8 immortalised progenitor cells is delayed after Hoxb8 withdrawal……………………………………………………………….109 Figure 4.7 Bim-/- Hoxb8 immortalised progenitor cells exhibit higher self-renewal potential than wild type or Bax-/-;Bak-/-, Hoxb8 immortalised progenitor cells only in conditions of over-expressed Hoxb8.…………………………………………………111 Figure 4.8 Hoxb8 represses Bim through mechanisms targeting the 3’UTR………...113 Figure 4.9 Bim 3’UTR segments, which contain binding sites for miR-17/20a/106a/b, miR-9, miR-214, miR-19a/b and miR-92/25, are required for Hoxb8 mediated repressionof Bim...... 114 Figure 5.1 Overview of miRNA expression patterns in Hoxb8 immortalised progenitor cells derived from the Taqman® MicroRNA Array Cards.………………………...... 126 Figure 5.2 The withdrawal of Hoxb8 results in a change in expression of 74 miRNAs……………………………………………………………………………….127 Figure 5.3 The miR-17~92 cluster and corresponding paralogue clusters, miR-106a-363 and miR-106a~25.…………………………………………………………………….132 Figure 5.4 miR-17-5p, miR-19a-3p, miR-19b-3p, miR-20a-5p and miR-92-3p are all elevated during conditions of Hoxb8 over-expression. .……………………………...136 Figure 5.5 p21, another known target of miR-17~92 is repressed in conditions of over- expressed Hoxb8. .……………………………………………………………………138 Figure 5.6 The miR-17~92 cluster can be conditionally knocked out upon treatment with cre-recombinase. .………………………………………………………………..140 Figure 5.7 Knockout of the miR-17~92 cluster can be achieved after constitutive expression of Cre.……………………………………………………………………..141 Figure 5.8 Cre induction in wild type Hoxb8 immortalised progenitor cells elevates Bim and p21 expression..……………………………………………………………..142 Figure 5.9 Expression of cre results in reduced clonogenicity in both Hoxa9 and Hoxb8 immortalised, wild type and miR-17~92flx/flx progenitor cells .………………………144 Figure 5.10 Hoxb8 immortalised miR-17~92flx/flx progenitor cells lacking both miR- 17~92 alleles are selected against in prolonged culture conditions .………………….146 Figure 6.1 Revised model of Hoxb8 targets and function during myeloid progenitor cell immortalisation in the presence of IL-3..……………………………………………..153 Figure 6.2 Conditional induction of miR-150 and miR-211 in Hoxb8 immortalised myeloid progenitor cells.……………………………………………………………...158

Tables

Table 1.1 Major cytokines required for haematopoiesis………………………………...4 Table 1.2 Hox genes implicated in haematopoiesis and leukaemiagenesis……………23 Table 2.1 Oligonucleotides used for amplification and sequencing of Hoxb8………...41 Table 2.2 Oligonucleotides used for amplification and sequencing of Hoxa9………...42 Table 2.3 Oligonucleotides used for amplification of murine Bim 3’UTR segments…44 Table 2.4 Oligonucleotides used for genotyping of miR-17~92flx/flx mice…………….45 Table 2.5 Oligonucleotides used for mRNA analysis………………….………………57 Table 5.1 Condensed list of miRNAs predicted to bind the Bim 3’UTR and which significantly change in expression pattern after Hoxb8 withdrawal………………….130 Table 5.2 Grouping of miRNAs from the miR-17~92 cluster and paralogue clusters, miR-106a~363 and miR-106a~25, according to identical guide strand seed sequences……………………………………………………………………………...133 Table 5.3 Average Ct values, Standard Deviations and Fold Changes of miRNAs from the miR-17~92 cluster as observed in conditions of Hoxb8 expression (4-OHT +) and withdrawal (4-OHT-)…………………………………………………………………134 Abbreviations

4-OHT – 4-hydroxy tamoxifen AAV- adenoviral associated AKT/PKB – Protein Kinase B ALL – Acute Lymphoblastic Leukemia AML – Acute Myeloid Leukemia AnV – AnnexinV APC - Allophycocyanin Bim EL – Bim Extra Long Bim L – Bim Long Bim S – Bim Short C. Elegans – Caenorhabditis Elegans cDNA – complementary Deoxyribonucleic Acid ChIP – Chromatin Immunoprecipitation CML – Chronic Myeloid Leukemia Cre – Cre recombinase Ct – Cycle Threshold D. Melanogaster –Drosophila Melanogaster DNA – Deoxyribonucleic Acid ERT2 – Modified Estrogen Receptor FACs – Fluorescence Activated Cell Sorter FDC-P – Factor Dependent Cell Progenitors FITC - Fluorescein Flx - floxed GFP –Green Fluorescent Protein GM-CSF – Granulocyte Macrophage – Colony Stimulating Factor HSC – Haematopoietic Stem Cell Hygro - Hygromycin IL - Interleukin Lin - Lineage LNA - Locked Nucleic Acid M-CSF – Macrophage – Colony Stimulating Factor MEF – Murine Embryonic Fibroblast miRNA - microRNA MLL – Mixed Lineage Leukemia PCR – Polymerase Chain Reaction PE - Phycoerythrin PGK – Phosphoglycerate Kinase PI – Propidium Iodide PI3K – Phosphatidylinositol 3-kinase PTEN – Phosphatase and Tensin Homologue qRT-PCR – quantitative Real Time – Polymerase Chain Reaction QVD-Oph/QVD - quinolyl-valyl-O-methylaspartyl-[2,6-difluorophenoxy]-methyl ketone rIL-3 – recombinant Interleukin 3 RNA – Ribonucleic Acid SCF – Stem Cell Factor SEM – Standard Error of the Mean SV40 – Simian Virus 40 Abbreviations cont…

UAS – Upstream Activator Sequence UTR – Untranslated Region WT – Wild Type Abstract Hox genes are a group of transcription factors that share a conserved DNA-binding domain, the homeodomain and have essential roles in embryonic development. They also have a critical role in regulating haematopoiesis by influencing the differentiation pathway of cells. In certain haematopoietic lineages the enforced expression of Hox genes inhibits differentiation and results in an accumulation of immature progenitor cells. When combined with mutations that promote enhanced survival and proliferative signals, leukaemia develops. Hoxb8 contributes to the development of murine myeloid leukaemia when over-expressed in combination with high levels of the cytokine, Interleukin-3 (IL-3). The exact mechanisms utilised by Hoxb8 in combination with IL-3 to promote tumourigenesis are still not known. To explore this, we have utilised a 4- OHT inducible system to conditionally over-express Hoxb8 in c-kit+ve, lin-ve progenitor cells derived from E14.5 fetal livers to create primary cell lines, known as Hoxb8 immortalised progenitor cells. These cells are dependent on Hoxb8 over-expression and IL-3 for survival and proliferation. Using these lines we have found that Hoxb8 has a critical role in maintaining the proliferation and survival of immortalised progenitors, in part by selectively reducing the mRNA levels of the pro-apoptotic protein, Bim. The expression of Bim, a BH3-only protein, induces cell death through the intrinsic cell death pathway. The reduction in Hoxb8 expression resulted in the up-regulation of Bim expression followed by cell cycle arrest and an increase in cell death. Bim-/- Hoxb8 immortalised progenitor cells were still dependent on Hoxb8 over-expression for survival however exited the cell cycle and died at a slower rate than wild type progenitors. The intrinsic cell death pathway is absolutely dependent on activation of two other BH3-only proteins, Bax and Bak. Unlike Bim-/- Hoxb8 immortalised progenitor cells, Bax-/-;Bak-/- progenitors did not die after Hoxb8 withdrawal indicating that the cell death occurring after HoxB8 withdrawal was via the intrinsic cell death pathway. Similar to Bim-/- Hoxb8 immortalised progenitor cells, Bax-/-;Bak-/- progenitors could not retain their self-renewal potential after Hoxb8 withdrawal, illustrating the requirement for Hoxb8 in processes independent of cell survival. The Bim 3’UTR was specifically required by Hoxb8 to repress Bim expression. This repression was centred around regions that contained binding sites for several miRNAs, miR-17-5p, miR-19a, miR-19b and miR-92. miRNAs are short, single strands of RNA that modulate gene repression by specifically targeting mRNA for degradation or translational repression. The miRNA binding sites on the Bim 3’UTR recognise miRNAs that belong to a cluster of six miRNAs known as the miR-17~92 cluster and all six miRNAs from this cluster are expressed at elevated levels during Hoxb8 over-expression. The conditional knockout of the miR-17~92 cluster in Hoxb8 immortalised progenitor cells reduced the survival and proliferative advantage of Hoxb8 over-expression during in vitro growth. A screen of the expression profile of 641 mouse miRNAs in Hoxb8 immortalised progenitor cells uncovered a large number of miRNAs whose expression pattern was influenced by Hoxb8. While some of these miRNAs, such as miR-150 and miR-155 have known roles in haematopoiesis and leukaemia, several including miR-881 and miR-1901 are still to be characterised. Further characterisation of these miRNAs may uncover an important role in maintaining a Hoxb8 immortalised state and contributing to the development of acute myeloid leukaemia.

1.0 Introduction

1.1 Haematopoiesis

1.1.1 Origin of the Haematopoietic Stem Cell Haematopoiesis is a dynamic process, which regulates blood cell development during the lifetime of an organism. Central to haematopoiesis is the haematopoietic stem cell (HSC), originating from the precursor cell, the hemangioblast. In mice the hemangioblast is first found in the yolk sac at E7.5 of embryonic development (Kabrun et al., 1997; Moore and Metcalf, 1970; Shalaby et al., 1995; Spangrude et al., 1988). The HSC is multipotent and capable of generating all mature blood cells. It is also self- renewing, however achieves its greatest population expansion only during embryogenesis. Between E7.5 and E11, HSCs are detected in several embryonic regions, including the chorion and allontois, regions later to become the placenta and umbilical cord, the aorta-gonad-mesonephros region (AGM) and at E11, the fetal liver (Alvarez-Silva et al., 2003; Johnson and Moore, 1975; Medvinsky and Dzierzak, 1996). In the fetal liver HSCs undergo multiple rounds of replication before colonizing the bone marrow at E17 (Christensen et al., 2004). After birth and throughout adult life, HSCs reside in the bone marrow making it the major site of haematopoiesis.

1.1.2 Differentiation of the HSC HSCs are stimulated to differentiate in response to various growth factors, secreted proteins and small molecules (Austin et al., 1997; Peled et al., 2005; Willert et al., 2003). Upon receiving differentiation stimuli, HSCs first differentiate into multipotent progenitor cells (MPPs). These progenitors retain the capacity to differentiate into any mature blood cell however they exhibit limited self-renewal. (Figure 1.1) (Morrison et al., 1997; Morrison and Weissman, 1994). MPPs begin to exhibit lineage exclusivity at the next differentiation stage, where they differentiate into either common lymphoid progenitors (CLPs) or common myeloid progenitors (CMPs). These progenitor cells then give rise to lineage restricted progenitor cells, which in turn produce the mature, effector cells. CLPs give rise to Pro-B and Pro-T cells, which differentiate to form the B, T and Natural Killer cell populations, respectively (Kondo et al., 1997). The CMP

cells can differentiate into lineage-restricted progenitor cells that result in the production of platelets, erythrocytes, monocytes/macrophages and granulocytes including, neutrophils, basophils and eosinophils (Figure 1) (Akashi and Traver, 2000). The genetic lesions, which cause myeloid leukaemia block the differentiation program at various stages of myeloid differentiation, as early as the CMP to as late as the more differentiated progenitor cell. In this thesis, I will be exploring the molecular mechanisms by which one such lesion, the over-expression of a Hox gene, promotes self-renewal and a block in differentiation.

1.2 Cytokine signalling in haematopoiesis

1.2.1 Cytokines required for haematopoietic survival and differentiation Throughout all stages of differentiation, haematopoietic cells respond to a range of growth factors, known as cytokines. These cytokines support haematopoietic cell survival, proliferation and direct the specific differentiation of progenitor cells. Multiple cell types produce cytokines, including endothelial cells and fibroblasts from various organs, progenitor and mature haematopoietic cells as well as the surrounding bone marrow stroma. Cytokines signal through specific cell surface receptors, which initiate intracellular signalling pathways with the purpose of controlling gene expression profiles. Table 1.1 describes a selection of the most common cytokines involved in haematopoiesis in human and mouse, the origin of these cytokines and the haematological consequences of gene deletion.

1.2.2 Cytokine receptors and intracellular signalling Cytokine receptors are transmembrane proteins, which form complexes on the plasma membrane surface to internally relay cytokine signals. Signal transduction is initiated by tyrosine kinase activity and tyrosine phosphorylation. This activity may be intrinsic to the receptor or, as is the case most relevant to the work presented in this thesis, the tyrosine kinase is associated with the receptor, in the form of a Janus Kinase (JAK) (Parganas et al., 1998; Quelle et al., 1994). This receptor system is the IL-3, IL-5 and GM-CSF heterodimeric family of receptors, which possess a specific ligand-binding alpha chain and a common signal-transduction beta chain (Guthridge et al., 1998). These two chains can heterodimerise upon ligand binding to initiate signal transduction

Figure 1.1: Haematopoietic differentiation Schematic of haematopoietic differentiation from the HSC through to the mature, effector cells from each lineage. The cytokines involved in promoting in vivo and in vitro cell differentiation, proliferation and survival are also shown. HSC- Haematopoietic Stem Cell, MPP-MultiPotent Progenitor, CMP-Common Myeloid Progenitor, CLP-Common Lymphoid Progenitor, MEP-Megakaryocyte/Erythroid Progenitor, GMP-Granulocyte/Macrophage progenitor, TNK-T cell/Natural Killer cell progenitor, BCP-B Cell Progenitor, NK-Natural Killer, IL- Interleukin, TPO- Thrombopoietin, EPO-Erythropoietin, M-CSF-Macrophage-Colony Stimulating Factor, G-SCF-Granulocyte-Colony Stimulating Factor, GM-CSF-Granulocyte/Macrophage- colony stimulating factor.

Table 1.1: Major cytokines required for haematopoiesis Consequence of Cytokine Produced by Target cells knockout in murine Reference models -Embyronic lethal if mice are (Besmer et al., lacking both SCF and c-kit - Bone marrow stromal 1992; Chabot et receptor SCF cells - HSC al., 1988; -Abnormalities in germ cell - HSC Migliaccio et al., development 1991) -Unpigmented skin - Decreased numbers of - Hepatocytes - HSC megakaryocyte progenitors (Qian et al., 1998; - Kidney and skeletal TPO - Megakaryocyte - 10% decrease in platelet Sungaran et al., muscle cells progenitors number 1997) - Liver - Reduced number of HSC (Broudy et al., - Severe anemia resulting in 1991; Koury et al., EPO - 90% by Kidney cells - Erythroid progenitors death 1989; Wu et al., 1995) (Ekert et al., 2004; - Activated T cells - Mast cells Ishizuka et al., - Mast cells - Normal development of - Basophils 1999; Lopez et al., IL-3 - Small amounts by bone haematopoietic system -Myeloid progenitor 1990; Mach et al., marrow stroma cells 1998; Peterseim et - Keratinocytes al., 1993) - Monocytes - Monocytes - Bone matrix formation (Begg et al., 1993; - Granulocytes - Macrophages - Reduced haematopoiesis in Wiktor- M-CSF - Endothelial Cells - Dendritic Cells bone marrow, which resolves Jedrzejczak et al., - Fibroblasts - Microglia with age 1982) - Activated T and B cells - Osteoclasts - Endothelial Cells - Fibroblasts and -Granulocyte and - Chronic neutropenia (Lieschke et al., G-CSF Macrophages in all organs Macrophage progenitors - Delayed response to Listeria 1994; Sieff et al., after stimulation with - Neutrophils monoytogenes infection 1988) TNFα, IL-1 and IL-6 - Macrophages (Blin et al., 2003; - Granulocyte and - No defects in haematopoiesis - T cells Nicola, 1989; GM-CSF Macrophage progenitors - Abnormal lung development - Fibroblasts Stanley et al., - Mature Macrophages and response to lung infection - Endothelial cells 1994) - Thymic and bone - Fetal NK cells marrow cells, - Dendritic Precursors (Peschon et al., -Cells in the liver, spleen - Common Lymphoid - Reduction in T and B cell 1994; von IL-7 and kidney progenitors number Freeden-Jeffry et - Keratinocytes, - T and B cells al., 1995) - Stromal cells - BM-derived macrophages - Mast cells - B and T cell development - Basophils - Th2 cells upon IL-4 normal however (Kuhn et al., 1991) - NKT cells and Th2 exposure to antigen loss of IgE and IgG1 response cells (Anguille et al., - Fibroblasts, - Antigen presenting 2009; Armitage et - Keratinocytes Dendritic cells - Decreased number of total al., 1995; Blauvelt - Epithelial cells - Monocytes and CD8+ T cells IL-15 et al., 1996; - Nerve cells Macrophages - Absence of memory CD8+ T Carson et al., - Monocytes/macrophages - T, B and NK cells cells, NK cells, NK/T cells 1995; Kennedy et - Dendritic cells - Mast cells al., 2000) - T and B cells - Normal development (Bernad et al., - Monocytes - Activated B cells - Exhibit defects in response to 1994; Hirano et al., - Fibroblasts - Granulocyte and infection with Listeria 1986; Kopf et al., - Keratinocytes Macrophage progenitors IL-6 monocytogenes 1994; Ulich et al., - Endothelial cells for production of - Abnormal levels of 1989; Yoshida et - Mesangial cells neutrophils committed cells of the myeloid al., 2010) - Adipocytes - T cells lineage - Some tumour cells - CD4+ T-helper in secondary lymphoid - Naïve CD8+ T cells and - Systemic autoimmunity due (Sadlack et al., organs Memory CD4+ T cells IL-2 to impaired development of 1995; Sadlack et - Less by CD8+ T cells, - CD8+ T cells and NK Treg cells al., 1993) NK cells, NKT cells, Mast cells cells, Dendritic cells

(Stomski et al., 1996; Stomski et al., 1998). The crystal structure of an activated GM- CSF receptor has been solved and illustrates the formation of a large, dodameric complex, essential for initiation of downstream signalling (Hansen et al., 2008). The structure of an activated IL-3 receptor complex has not yet been solved but is predicted to be similar to that of GM-CSF. The mouse IL-3 signaling complex is multifaceted containing two IL-3 receptor beta subunits, IL-3 receptor beta common, which can heterodimerise with GM-CSF, IL-5 and IL-3 receptor alpha chains and IL-3 receptor beta specific, which can only dimerise to the IL-3 receptor alpha chain (Hara and Miyajima, 1992).

Intracellular signal transduction through the common beta chain initially proceeds through phosphorylation of the receptor-associated tyrosine kinases, JAKs. The exact mechanisms in which an ‘active’ receptor complex can mediate the phosphorylation of Jak is still not known, however the recently solved structure of the GM-CSF receptor suggests that the active form of the receptor brings two Jak2 molecules into sufficiently close proximity to permit transphosphorylation (Hansen et al., 2008). Jak2 phosphorylation is required for signal transduction mediated by IL-3, GM-CSF, EPO and TPO cytokines (Parganas et al., 1998). Jak2-/- mice are not viable past E12 due to the absence of definitive erythropoiesis (Neubauer et al., 1998). This phenotype is similar to mice lacking either the EPO ligand or receptor and indicates the essential role for Jak2 in signal transduction (Wu et al., 1995). Mutation of the Jak2 binding site in the common beta chain abolishes IL-3 and GM-CSF receptor signalling (Quelle et al., 1994).

The phosphorylation of Jak2 upon IL-3/GM-CSF receptor activation triggers multiple signalling pathways, which promote cell survival, proliferation and differentiation. Several of these pathways are described in Figure 1.2. Phosphorylated Jak2 can directly phosphorylate and activate the signal transducers and activators of transcription, or STATs. Once phosphorylated, Stats translocate to the nucleus to directly regulate genes required for survival, such as Bcl-XL, Pim1 and Pim2 (Dumon et al., 1999; Mui et al., 1996). Jak2 phosphorylation can also activate the Ras/Raf/MAPK pathway, which initiates survival signals through the repression of Bim (Ewings et al., 2007). Phosphorylation of members of the PI3K/AKT pathway induced by Jak2 activation can also promote cell survival through the AKT mediated phosphorylation of the pro-

Figure 1.2: Intracellular signalling pathways that promote cell survival after stimulation of the beta common chain receptor The binding of ligand, in this instance, IL-3, GM-CSF or IL-5 to the beta common chain results in Jak2 phosphorylation and initiation of intracellular signalling cascades. Jak2 can phosphorylate Stat5 and induce its translocation to the nucleus where it can direct activation of genes such as Bcl-xL, Pim1 and Pim2. Signalling through the Ras/Raf/MAPK pathway, reduces the intracellular levels of Bim. Further repression can be achieved through the activation of the PI3K/AKT pathway. Jak2 phosphorylation begins a signalling cascade, which induces the phosphorylation of PI3K, PIP3 and AKT. Phosphorylated AKT can inhibit Bim and Puma transcription by phosphorylating and inactivating Foxo3a. Phosphorylated AKT can also directly phosphorylate the pro-apoptotic protein, Bad and target it for proteasomal degradation. GSK-3 can also be phosphorylated by AKT, resulting in increased expression levels of the pro-survival protein, Mcl-1. Figure taken from (Brumatti et al., 2010)

apoptotic protein, Bad and the transcriptional downregulation of Bim due to the phosphorylation and inactivation of the Bim transcriptional activator, Foxo3a (reviewed in (Vivanco and Sawyers, 2002))(Figure 1.2).

1.3 Cell Death pathways in haematopoiesis

1.3.1 The intrinsic cell death pathway The dynamic and rapid haematopoietic process requires a functional apoptotic or controlled cell death system to keep cell numbers in check. Apoptosis in haematopoietic cells can be triggered in numerous circumstances, including after exposure to cellular stresses or as a process of removing cells from circulation at the end of their normal lifespan. The intrinsic cell death pathway, or the Bcl-2 regulatable pathway, mediates the apoptotic response in cells which have been exposed to cellular stress such as cytokine deprivation, DNA damage or even developmental cues (reviewed in (Youle and Strasser, 2008). The activation of apoptosis through intrinsic stresses sets this pathway apart from the extrinsic pathway, which requires an externally activated death receptor for initiation.

The intrinsic cell death pathway is regulated through complex interactions between members of the Bcl-2 family of proteins. These proteins are grouped according to similarities in function and structure. Bcl-2 family members contain up to four Bcl-2 homology (BH) domains, with all members possessing at least one of these four. Functionally, the Bcl-2 family of proteins is divided into the anti-apoptotic or pro- apoptotic proteins. The anti-apoptotic proteins can promote cell survival and consist of the founding family member, Bcl-2, as well as Bcl-XL, A1/Bfl-1, Mcl-1, Bcl-W and Boo/Diva. The pro-apoptotic family of proteins induce cell death and can be divided into two groups according to protein structure. Bim, Bad, Puma, Noxa, Bik, Bid, Hrk and Bmf form part of the ‘BH3 only’ group of pro-apoptotic proteins, all containing only the third of four BH domains (reviewed in Huang and Strasser 2000). Bax, Bak and Bok belong to a second group of pro-apoptotic proteins termed the Bax-Bak or ‘multi-domain’ family, which contain BH1, BH2 and BH3 domains (Green and Kroemer, 2004).

The loss of cytokine signalling, for example IL-3 and GM-CSF receptor signalling, results in cell death through activation of the intrinsic pathway. The immediate response to cytokine withdrawal is an increase in the expression of pro-apoptotic proteins, particularly the BH3-only proteins. These pro-apoptotic proteins initiate cell death pathway activation in two distinct, and probably co-existing ways, through the ‘direct’ and ‘indirect’ activation of Bax and Bak.

Before briefly discussing direct and indirect functions of BH3-only proteins, it is important to appreciate the central role of Bax and Bak in intrinsic apoptosis pathways. It is the activation of Bax and Bak that determines whether cells commit to apoptosis. Cells lacking Bax and Bak are completely resistant to cell death caused by stress stimuli including cytokine withdrawal and DNA damage (Ekert et al., 2006; Jabbour et al., 2010; Jabbour et al., 2009)(Lindsten 2000, Rathmol 2002). The activation of Bax and Bak is a result of conformational changes and oligomerisation. It is thought that Bax and Bak oligomers assemble to form pores in the outer mitochondrial membrane. These pores facilitate the release of cytochrome c (reviewed in (Hengartner, 2000). Once in the cytosol, cytochrome c, couples with the protein Apaf-1 and dATP to form a caspase- cleaving complex called the apoptosome. The apoptosome is the molecular machine that activates the initiator caspase, pro-caspase-9. This in turn leads to the further cleavage and activation of effector caspases, 3, 6 and 7. These active caspases begin breaking down cellular contents leading to cell destruction (Figure 1.3).

In the ‘direct activation’ model, a small subset of BH3 only proteins, tBid, Bim and possibly Puma, bind directly to Bax and Bak to initiate conformation changes and oligomerisation. In this model, the anti-apoptotic proteins are required in healthy cells to hold the BH3 only proteins and prevent them from activating Bax and Bak. In the ‘indirect activation’ model, elevated BH3 only proteins bind to anti-apoptotic proteins and prevent them from binding and sequestering ‘primed’ forms of Bax and Bak. Once Bax and Bak are no longer held by the anti-apoptotic proteins they can now proceed to a fully activated state. The interactions between pro and anti apoptotic proteins have been well studied and have shown that Bim, Puma and Bid can bind to all anti-apoptotic proteins, with Bax binding to Bcl-2, Bcl-XL and Mcl-1 and Bak to Bcl-XL and Mcl-1 only. Both models of Bax and Bak activation are required for the efficient induction of apoptosis.

Figure 1.3: The intrinsic and extrinsic apoptotic pathways Activation of the intrinsic pathway stimulated by cytokine withdrawal and the extrinsic pathway stimulated by Fas ligand binding to the Fas receptor. Cytokine withdrawal induces the up-regulation of BH3 only proteins which can either sequester and inhibit activity of the Bcl-2 family of anti-apoptotic proteins, or directly activate mitochondrial membrane associated proteins, Bax and Bak. Once activated, Bax and Bak form pores on the mitochondrial membrane surface, releasing cytochrome c, which complexes with APAF-1 and dATP to form the apoptosome. The apoptosome cleaves pro-caspase 9 to its active substrate, which can activate caspases 3, 6 and 7 to commit cells to destruction. Signalling through the FAS receptor results in the formation of the death inducing signalling complex (DISC), which is composed of FADD and pro-caspase 8. Pro-caspase 8 can then be cleaved and activate effector caspases, 3, 6 and 7. Caspase 8 can also cleave the pro-apoptotic protein, Bid, to induce cell death through mitochondrial permeabilisation and cytochrome c release.

1.3.1.1 The role of Bim in haematopoeisis The BH3-only protein Bim binds and suppresses all Bcl-2 anti-apoptotic proteins and is also capable of directly activating Bax to induce apoptosis (Gavathiotis et al., 2008). The Bim gene spans 36kB on chromosome 2 in mice and 25kB on chromosome 20 in humans. It has 6 short exons, separated by large intronic regions (Figure 1.4A). The start codon of Bim is in Exon 2 and three alternative splice variants, BimEL, BimL and BimS are generated (O'Connor et al., 1998). The BH3 domain is encoded in Exon 5 and is present in all splice variants (Figure 1.4B). BimS lacks the dynein LC8 binding domain (LBD), responsible for the localisation of Bim to the cytoskeleton. The GC-rich promoter of Bim contains multiple binding sites for transcription factors such as Sp-1, c-myb, c-myc and FOXO, however only a region 800bp upstream of Exon1 is essential for transcriptional activation (Bouillet et al., 2001). Transcriptional regulatory elements have also been found in the first intron of Bim, which contains binding sites for the regulator of mitotic cell death, p73, as well as FOXO transcription factor binding sites (Gilley and Ham, 2005; Toh et al., 2010). The transcriptional up-regulation of Bim following ER-stress is in part mediated by the binding of CHOP/C-EBPα to sites in the first intron (Puthalakath et al., 2007). The 3’UTR of Bim is a target of microRNA (miRNA) mediated repression, particularly in B and T lymphocytes (Xiao et al., 2008).

Bim is required for normal haematopoiesis with Bim-/- mice exhibiting increased cellularity across all lineages (Bouillet et al., 1999). Bim is absolutely required for the deletion of autoreactive T lymphocytes by activation of the TCR-CD3 receptor complex (Bouillet et al., 2002). The cell death response in granulocytes upon cytokine withdrawal and treatment with cytotoxic agents is diminished in Bim-deleted mice (Villunger et al., 2003). The cell death of phagocytic macrophages is also dependent on Bim, which increases in expression after activation of cell surface Toll Like Receptors (TLR) (Hacker et al., 2006; Kirschnek et al., 2005). This demonstrates the critical role of Bim in regulating cell death to clear unwanted haematopoietic cells in development and throughout adult life.

Figure 1.4: Schematic representation of the murine Bim genomic region and alternate isoforms (A) Schematic representation of the entire genomic region of the murine Bim gene. The intronic and exonic regions of Bim are indicated as well as their size, as noted above. Genomic regions, which can be regulated by trans-acting components, are indicated below the schematic. (B) The three main isoforms of Bim, Bim Extra Long (EL), Bim Long (L) and Bim Short (S). The coloured squares indicate individual exons. Exon 5 contains the BH3 domain (BH3), while Exon 4 contains the dynein, light chain-8 binding domain (LBD). The BimS isoform does not preserve this domain.

1.3.3 The extrinsic cell death pathway Although not directly relevant to the work presented in this thesis, it is important to remember that specific avenues of cytokine signalling can in several instances initiate death in haematopoietic cells. Extrinsic cell death is mediated by a subset of the Tumour Necrosis Family (TNF) of cytokines and receptors. These receptors are characterized by the presence of a cytoplasmic domain referred to as the ‘death domain’. This domain is required for the assembly of the death-inducing signalling complex (DISC) by recruiting the adapter protein, FADD and initiating cleavage of pro-caspase 8 (Kischkel 1995, Boatwright 2003). Active caspase-8 can then cleave and activate the effector caspases, 3, 6 and 7 resulting in cell death (Figure 1.3). Active caspase-8 can also cleave the pro-apoptotic Bcl-2 family member, Bid, to truncated or ‘tBid’. This permits the extrinsic death signal to ‘feed’ into the intrinsic cell death pathway and promote cell death through Bax and Bak mediated mitochondrial permeabilisation (Li et al 1998, Luo et al 1998)(Figure 1.3). TNF receptor family signalling plays an important role in lymphocyte homeostasis (Watanabe 1995, Fukuyuma et al 1998, Komano 1999, Schlomchik 1994 Hao 2004).

1.4 miRNAs in haematopoiesis

1.4.1 Function of miRNAs Another level of regulation of haematopoietic cell survival, proliferation and differentiation is through non-coding RNAs, specifically microRNAs (miRNAs). These are short, single strands of RNA, which bind to complementary, or semi complementary regions on the 3’UTR of mRNA to repress protein expression. This occurs either through the direct cleavage of mRNA, or in most cases, through the inhibition of translation. miRNAs are initially transcribed by RNA Polymerase II as pri-miRNAs, and fold into stem-loop structures with an added ~100bp extension on either side of the stem (Figure 1.5). miRNAs are found in intragenic and extragenic regions and are often transcribed as clusters, in which several microRNA transcripts appear in close proximity and are transcribed together into a large pri-miRNA. Cleavage of the ends of stem-loop structures in pri-miRNAs with the enzyme Drosha creates the pre-miRNA, which is transported out of the nucleus by Exportin 5. Clustered miRNAs are separated and form individual pre-miRNAs upon cleavage with Drosha. The cytoplasmic enzyme, Dicer, cleaves the stem loop structure into a ~22nt double stranded duplex. The double

strand is unwound and the ‘guide’ strand, is incorporated into the RNA Initiator of Silencing Complex (RISC), which assists in the interaction of the miRNA with its complementary mRNA strand. The second strand, also known as the star or passenger strand, is usually targeted for degradation. miRNAs contain a seed region between nucleotides 2-7 of the ‘guide strand that recognizes and binds to their target mRNA (Figure 1.5). If miRNAs exhibit total complementary binding to the target mRNA, the endonucleolytic activity of the RISC associated protein, Argonaute can directly cleave the mRNA. If miRNAs pair to miRNA with several mismatches, the RISC complex acts a block to prevent any further mRNA translation.

1.4.2 Targets of miRNA regulation in haematopoiesis The requirement for miRNAs in haematopoietic function is demarcated in Dicer-/- animal models. The conditional deletion of Dicer results in a drastically reduced population of HSCs and deficiencies in erythroid and early T and B cell differentiation (Buza-Vidas et al., 2012; Koralov et al., 2008; Muljo et al., 2005). Several lines of evidence indicate that individual miRNAs have essential role in haematopoietic differentiation. The transcriptome analysis of miR-155 deficient CD4+ T lymphocytes identified miR-155 as a key regulator of c-Maf, a transactivator of the IL-4 receptor (Rodriguez et al., 2007). miR-155 is also required to maintain the correct cytokine signature in germinal centres to maintain T-helper cell numbers and a normal antibody response (Thai et al., 2007). Contradicting reports implicate miR-223 in both granulocytic differentiation as well as maintenance of a granulocytic progenitor pool (Fazi et al., 2005; Johnnidis et al., 2008). miRNAs can be regulated by differentiation associated genes including GATA-1, which upregulates miR-451 and miR-144 to assist in erythroid differentiation and PU.1 which upregulates miR-424 to induce macrophage differentiation and proliferation (Dore et al., 2008; Forrest et al., 2009)

1.4.3 The miR-17~92 cluster of miRNAs The first cluster of miRNAs implicated in haematopoiesis, particularly in leukaemiagenesis, is the miR-17~92 cluster of miRNAs (He et al., 2005). This cluster contains 6 miRNAs, miR-17-5p, miR-19a, miR-19b, miR-20a, miR-18 and miR-92a and in humans is located on the third intron of the non-coding gene known as C13orf24. Amplification of the chromosomal region containing this cluster, 13q31, is found not

Figure 1.5: The pathway of miRNA processing After Polymerase II mediated transcription, miRNAs form pri-miRNA stem-loop structures with long extensions on either side of the loop. The enzyme Drosha cleaves these extensions to form pre-miRNAs. Pre-miRNAs are transported out of the nucleus by the karyopherin, Exportin 5. Once in the cytoplasm, pre-miRNA is cleaved from the stem loop structure by the enzyme Dicer. Unwinding of this duplex produces two strands, the ‘guide strand’ (green) and the ‘star strand’ (black). The guide strand is incorporated into the RISC complex, which assists in the binding of the miRNA to mRNA. In the majority of cases, semi-complementary binding results in translational inhibition while complementary binding result in mRNA cleavage.

only in MLL leukaemia but also a wide range of solid tumours, including retinoblastoma, lung cancer, colorectal adenoma and adenocarcinoma (Conkrite et al., 2011; Diosdado et al., 2009; Hayashita et al., 2005). Two clusters paralogous to miR- 17~92, miR-106a~363 and miR-106b~25, also exist. The miRNAs across these three clusters can be grouped according to identical seed sequences with similar mRNA binding targets. Mice lacking the miR-17~92 cluster are not viable after birth, while mice lacking one of the two paralogue clusters exhibit no abnormalities in development or during adult life (Ventura et al., 2008). miR-17~92, miR-106a~363 and miR- 106b~25 triple compound knockouts show severe embryonic defects and do not survive past E15, indicating both independent and redundant functions across these three clusters during embryonic development (Ventura et al., 2008). miRNAs from the miR-17~92 cluster are required for normal development of both B and T cells. miR-17~92-/- mice exhibit abnormal B cell differentiation due to an increase in apoptosis of pro-B cells and the consequent reduction in pre-B cell number (Ventura et al., 2008). Apoptosis in these pro-B cells was as a result of increased expression of the pro-apoptotic protein, Bim, a direct target of several miRNAs from this cluster. Mice engineered to over-express the miR-17~92 cluster in lymphocytes die prematurely due to a lymphoproliferative disease and autoimmunity (Xiao et al., 2008). This disease is in part instigated by the reduced levels of Bim and Phosphatase and Tensin homologue (PTEN) expression as a result of elevated expression of miR-17~92. In myeloid progenitor cells, elevated expression of miR-17-5p, miR-20 and miR-106a repress Runx1, preventing the upregulation of the M-CSF receptor and myeloid differentiation while in independent studies, enforced expression of miR-19a and miR- 92a induces B cell hyperplasia and erythroleukaemia (Fontana et al., 2007; Li et al., 2012b).

1.5 Hox genes

1.5.1 Evolution and pattern of Hox gene expression The Hox genes are a family of transcription factors that have a crucial and nonredundant role in embryonic development and haematopoiesis. During haematopoiesis, Hox genes are responsible in regulating differentiation, and when aberrantly expressed, contribute to haematopoietic cell transformation and leukaemia. Hox gene over-

expression in haematopoietic progenitor cells can block differentiation and promote cytokine dependent immortalisation. This is a model used extensively in this work and will be discussed in more detail in sections 1.6.2 and 1.8.

Hox genes are primarily defined as major regulators of embryonic development and have been traced back to appear in all bilaterian animals following the cnidarian- bilateral evolutionary split (de Rosa et al., 1999) (Garcia-Fernandez, 2005). Hox genes are arranged in clusters with mammals possessing 39 Hox genes divided across four paralogue clusters (Figure 1.6). The arrangement of each Hox gene in the cluster is an indication of their spatial and temporal expression in the developing embryo. In mammals, Hox genes are required to identify cell fates along the embryonic spinal axis and achieve this through their co-ordinate expression in a manner known as spatial colinearity. Maturing organs and limbs express Hox genes in a temporal collinear manner, observed in the developing lung kidney and digits (Bogue et al., 1994) (Bogue et al., 1996) (Wellik et al., 2002) (Peichel et al., 1997). Also, genes from the 5’ end of the cluster appear to have a more potent and non-redundant role in morphogenesis in a pattern of expression known as posterior prevelance (Goodman, 2002).

All Hox proteins contain a 60 amino acid, DNA-binding domain, termed the homeodomain. This evolutionarily conserved domain is found in the second of two exons and consists of three alpha-helices and an amino terminal extension that becomes partially ordered upon binding to DNA (Wolberger et al., 1991). Four residues in helix three make contact with DNA, binding to a consensus DNA site of TNAT. The base in the second position can change from an A, T, C or G depending on the specificity of the Hox gene. More posterior Hox genes, those found on the 5’ end of the cluster, commonly recognise a C in the second position, while more anterior Hox genes prefer a G (Shen et al., 1997a).

1.5.2 Regulation of Hox gene expression Multiple regulatory processes maintain the correct spatial and temporal expression of Hox genes during embryonic development. Hox gene clusters contain specialized enhancer sequences, which define both specific and overlapping expression boundaries. Global enhancers regulate multiple expression domains by regulating several Hox gene

promoters (Peichel et al., 1997; van der Hoeven et al., 1996; Zakany and Duboule, 1996). A further level of regulation exists to allow enhancers access to the promoter sequences and relies upon chromatin modification mediated by the polycomb and trithorax proteins. Non-coding RNAs can also regulate Hox expression.

1.5.2.1 Hox regulation through chromatin modification Hox gene expression is regulated through changes in chromatin mediated by Polycomb (Pc-G) and Trithorax (Trx-G) proteins, which induce a closed or open state of chromatin, respectively (Canaani et al., 2001; Papoulas et al., 1998) (Fischle et al., 2003; King et al., 2002). Regulation of the Drosophila Hox genes in the Antennapedia (ANT-C) and Bithorax (BX-C) complexes by chromatin modification has been well- described (Beisel et al., 2007; Breen and Harte, 1993) (Breen and Harte, 1991; Sedkov et al., 1994). In mammals, the homologs of pc-G and trx are bmi-1 and mll respectively. Expression of these genes during mammalian embryogenesis is required to define Hox expression boundaries and ensure normal development of the mouse (Cao et al., 2005) (van der Lugt et al., 1996) (Yu et al., 1995). Abnormal expression of these polycomb or trithorax proteins outside of embryogenesis can also alter normal Hox gene expression. The aberrant expression of MLL in leukeamias characterised by MLL-translocations is strongly associated with elevated levels of Hox genes, in particular HOXA9, HOXA10 and the Hox co-factor, MEIS1. This is discussed in more detail in section 1.7.3.

1.5.2.2 Hox regulation through non-coding RNAs Long non coding RNAs (ncRNA), between 300bp and 10kB in size, regulate Hox gene expression by controlling accessibility of the Polycomb Repressive Complex (PRCs) to chromatin (Cam et al., 2009). HOTAIR, a long ncRNA transcribed from the human HoxC cluster, promotes the binding of the PRC2 to the HoxD cluster to prevent expression of HoxD genes (Rinn et al., 2007; Tsai et al., 2010). HOTAIR is not highly conserved across species suggesting that it evolved in mammals to accommodate a function required only for human development (Schorderet and Duboule, 2011).

Shorter stranded miRNAs are encoded in Hox clusters between Hox coding regions. In D. Melanogaster, miR-993, miR-10, miR-iab-4 and miR-iab-8 are all transcribed from the single Hox cluster (Figure 1.6). D. Melanogaster Hox genes having predicted miRNA binding sites in their 3’UTRs however fail to show reduced expression levels

during embryogenesis upon the over-expression of these miRNAs when examined in vivo (reviewed in (Pearson et al., 2005) (Lemons et al., 2012). This suggests that the true function of miRNAs in controlling Hox expression may require alternate stimuli or combinations of miRNA expression to mediate an effect. In mammals, Hoxb8 is a known and verified target of miR-196, which is encoded in the HoxA and HoxB cluster (Lagos-Quintana et al., 2003; Lim et al., 2003). miR-196 binds to the 3’UTR of Hoxb8 with exact complementarity to induce cleavage of mRNA (Yekta et al., 2004). In embryonic development, miR-196 regulates neural tube patterning and hindlimb development by specifically regulating temporal Hoxb8 expression (Asli and Kessel, 2010; Hornstein et al., 2005).

While Hoxb8 is a well-defined target of miRNAs, the regulation of miRNAs by Hoxb8 is not described. The few reports that do define Hox regulation of miRNAs are usually confined to those miRNAs found within the Hox clusters. For example, miR-196 and miR-10 follow a Hox dependent expression pattern in the developing embryo, suggesting that Hox genes are regulating their expression (Asli and Kessel, 2010; Hornstein et al., 2005; Woltering and Durston, 2008). In C.Elegans, a negative feedback loop between miR-57 and the posterior Hox gene, nob-1, regulates the identity of cells from the AB lineage positioned in the posterior regions of the worm (Zhao et al., 2010). In mammalian haematopoiesis, the over-expression of Hoxa9 upregulates a large number of miRNAs (Hu et al., 2010). These include miR-19b, miR-211, miR-147, miR- 122 and miR-155, a miRNA known to regulate granulocytic and myeloid differentiation through the downregulation of PU.1 and Meis1 (O'Connell et al., 2008; Romania et al., 2008). Whether Hoxa9 directly or indirectly regulates expression of these miRNAs has not yet been defined. The work presented in this thesis provides further evidence that Hox genes other than Hoxa9 can regulate a multitude of miRNAs and suggests

Figure 1.6: Comparison of Hox Clusters found in Caenorhabditis Elegans, Drosophila Melanogaster and Mus Musculus/Homo Sapien Schematic representation of Hox genes clustered in Caenorhabditis Elegans, Drosophila Melanogaster and Mus Musculus/Homo Sapien. Each box represents a single Hox gene, with similar coloured boxes representing homologous genes between organisms. Mammalian Hox genes can be further grouped according to class, as indicated below the clusters. miRNAs encoded on Drosophila melanogaster and Mus musculus/Homo Sapien clusters are also indicated by stem loop structures.

1.5.3 Hox interactions with the TALE family of proteins Hox genes commonly function as part of regulatory complexes that include Pbx and Meis/Prep proteins (Hunger et al., 1991; Kamps et al., 1991; Moskow et al., 1995; Nourse et al., 1990). Hox can bind directly to Pbx and Meis however it is likely that these regulatory complexes contain a number of other transcription factors including, C/EBPalpha and CBP (Huang et al., 2012). Pbx and Meis are also transcription factors that bind DNA using a homeodomain similar to the Hox homeodomain (Kamps et al., 1990; Moskow et al., 1995; Nourse et al., 1990). This domain in Pbx and Meis is atypical due to the insertion of a three-amino acid loop extension (TALE) between the first and third alpha helices (Burglin, 1997). The formation of Pbx-Hox, Meis-Hox, or Pbx-Meis-Hox complexes before or during the binding of Hox proteins to DNA allows for greater target site specificity. Pbx and Meis in complex with Hox proteins bind to DNA, increasing the Hox consensus binding site from four to eight nucleotides in length. Binding between Pbx and Hox proteins is mediated through the interaction of a conserved, hexapeptide domain within the Hox protein. This domain, defined by the conserved amino acid sequence, Y/F-P-W-M-K/R, interacts with the three-amino-acid loop extension and the third alpha-helix of the Pbx homeodomain (Chang et al., 1995; Knoepfler and Kamps, 1995; Neuteboom et al., 1995) (LaRonde-LeBlanc and Wolberger, 2003; Passner et al., 1999; Piper et al., 1999) (Figure 1.7). Hoxb8 can bind to Pbx1, 2 and 3 isoforms and requires the tryptophan residue in the hexapeptide domain to maintain this interaction (Knoepfler et al., 2001; Neuteboom et al., 1995). The inability of Hoxb8 to bind to Pbx mimics a loss-of-function phenotype and results in skeletal abnormalities in transgenic mice (Medina-Martinez and Ramirez-Solis, 2003).

Figure 1.7: Structure of the HoxB1:Pbx1 interaction bound to DNA HoxB1 and Pbx1 homeodomains are shown bound to DNA. The Hox hexapeptide domain binds into a pocket in the Pbx1 homeodomain that encompasses interactions with the three-amino acid loop extension and the third alpha helix of the Pbx1 homeodomain. The HoxB1 homeodomain is separated by a linker region (red dotted line) from the hexapeptide domain to allow it to bind to the opposite face of the DNA helix. Figure taken from (Piper et al., 1999).

Meis1 proteins can dimerise independently with Pbx proteins or Hox proteins primarily from the Abdominal B Class. In mammals, this consists of Hox genes from the Hox-9 through to the Hox-13 paralogue groups (Chang et al., 1997; Shen et al., 1997b). The expression of Meis1 can accelerate disease progression in long latency AML induced by Hox gene over-expression (Fischbach et al., 2005; Pineault et al., 2004; Pineault et al., 2003; Wang et al., 2005). In this context Meis-1 co-expression may expand the binding targets of Hox genes to induce gene expression profiles that accelerate leukaemia formation. Recent work has suggested that in myeloid cells, Meis1 and Hoxa9 can interact within a larger DNA-binding complex that also includes RUNX1, C/EBPalpha, STAT5 and PU.1 (Huang et al., 2012). No such complex has yet been derived for Hox- Pbx interactions.

1.6 Hox genes in haematopoiesis

1.6.1 Hox gene expression in haematopoiesis Hox gene expression during haematopoiesis was first identified upon screening of murine haematopoietic cDNA libraries (Kongsuwan et al., 1988). Defining the pattern of Hox expression during normal haematopoiesis has been difficult, due to differences in the sources and purification of starting cell populations, as well as variables in the techniques used to quantify Hox expression. Thus the requirement for Hox genes in haematopoiesis is best defined in knockout models, which are listed in Table 1.2. The most consistent data clearly identifies genes from the Hoxa/HoxA cluster as highly expressed in primitive murine and human haematopoietic stem cells (Kawagoe et al., 1999; Lebert-Ghali et al., 2010; Moretti et al., 1994; Pineault et al., 2002). Elevated numbers of short term-HSCs (ST-HSC) in Hoxa cluster-/- mice were encountered with severely reduced mature cells in the bone marrow, spleen and thymus (Di-Poi et al., 2010; Lebert-Ghali et al., 2010). The same defect was observed in Hoxa cluster-/+ mice, and indicates that Hox genes from the A cluster have a haploinsuffient and nonredundant role in haematopoiesis. These findings implicate Hoxa genes as crucial mediators required for initiation of early differentiation in the HSC compartment

Table 1.2: Hox genes implicated in haematopoiesis and leukaemiagenesis

Effect of over- Hox Expression in Effect of Implications in expression in Reference gene haematopoiesis knockout leukaemia progenitor cells - Reduced T-cell - Required for (Bach et al., numbers maintenance of human 2010; Izon et - HSCs - Reduced - Immortalisation of and murine al., 1998; Hoxa9 - Early progenitor repopulation myeloid progenitor leukaemias with Lawrence et al., cells potential in cells in vitro MLL-chromosomal 1997; Pineault lethally irradiated translocations et al., 2002) mice - Selection for - Over-expressed in megakaryocytic cells human T cell acute and against lymphoblastic (Speleman et - Unknown for - Myeloid progenitor macrophage and B cell leukaemia al., 2005; Hoxa10 haematopoiesis cells lineages in vivo characterised by Thorsteinsdottir

- Development of chromosomal et al., 1996) leukaemia with latency inversion of 19-50 weeks inv(7)(p15q34) - Mice die at (Bach et al., E15.5 due to 2010; - Involved in a placental Fromental- - Expressed at low (t7;11)(p15;p15) abnormalities - No observed change Ramain et al., Hoxa13 levels in HSCs and translocation with - Unknown in cell behaviour 1996; Lebert- MPPs NUP98 in human defects in Ghali et al., AML embryonic 2010; Taketani haematopoiesis et al., 2002a) (Antonchuk et - HSCs - Massive increase in - Mild reduced - Long latency AML al., 2002; Brun - Late erythroid and HSC self-renewal Hoxb4 haematopoietic in mice only with et al., 2004; granulocytic when cultured in SCF cellularity Meis1 over-expression Giampaolo et differentiation in vitro al., 1995) - Preferentially - Expressed at low - Long latency AML (Fischbach et promotes survival and levels during late - No knockout in mice, which is al., 2005; Hoxb6 proliferation of HSCs granulocytic mouse shortened with Meis1 Giampaolo et and myeloid progenitor differentiation over-expression al., 1995) cells in vitro - Expressed in T - No knockout (Inamori et al., Hoxb7 cells, in particular the - Not tested N/A mouse 1993) CD4+ population - Rapid and fatal (Chen et al., murine AML when 2010; Greer and - Mice have - Not yet detected in combined with IL-3 Capecchi, 2002; skeletal defects - Immortalisation of mouse overexpression Perkins et al., Hoxb8 as well as myeloid progenitor -Detected in human - Over-expressed in 1990; neurological cells in vitro bone marrow AML characterized by Sauvageau et abnormalities CDX2 over- al., 1994; Scholl expression et al., 2007) (Auvray et al., - Erythroid - Majority die 2012; Bijl et al., - Expands HSC progenitor cells before weaning 1996; Boulet Hoxc4 population by N/A - During maturation age due to and Capecchi, promoting self-renewal of T and B cells esophageal defect 1996; Takeshita et al., 1993) - Involved in a t(2;11)(q31;p15) - No knockout (Pineault et al., Hoxd13 - Not yet detected Not tested translocation with mouse 2003) NUP98 in human AML N/A: No prior implication in leukemia

(Di-Poi et al., 2010; Lebert-Ghali et al., 2010). The deletion of Hoxa9 produces the most severe phenotype among all Hox gene knock out models. Mice lacking Hoxa9 have severe reductions in T cell number and exhibit reduced in vivo repopulation potential due to the decreased numbers of CFU-blasts (Izon et al., 1998; Lawrence et al., 1997).

The data for Hoxb cluster genes is less clear. In two separate models of EPO and GM- CSF stimulated differentiation, both fluctuating and stable levels of Hox expression was observed (Giampaolo et al., 1994). The deletion of almost the entire Hoxb cluster has no overt effects on differentiation, however a decrease in mRNA levels of all Hoxa cluster genes as well as a specific increase in expression of Hoxc4 was noted (Bijl et al., 2006; Bjornsson et al., 2003). Expression of Hoxc cluster genes has been identified in several cell populations at differing stages of differentiation including but not limited to Hoxc4, Hoxc6 and Hoxc10 in erythroid progenitor cells and Hoxc4 in CD4+ helper T cell populations (Deguchi et al., 1991; Inamori et al., 1993) (Bijl et al., 1998; Takeshita et al., 1993). The expression of Hoxd cluster genes has not yet been detected in any cell population during any stage of differentiation.

1.6.2 Requirement for Hoxb8 in haematopoiesis Hoxb8 expression during haematopoiesis has not yet been observed in murine bone marrow progenitor cells, however is detected in human bone marrow cells in both the stem cell compartment and cells characterized with a myeloid phenotype (Giampaolo et al., 1995; Giampaolo et al., 1994; Sauvageau et al., 1994). Haematopoiesis proceeds normally in the absence of Hoxb8 however an obsessive grooming phenotype in Hoxb8 deficient mice has been linked to defects in microglial cells, the resident macrophages of the brain (Chen et al., 2010; Greer and Capecchi, 2002). Enforced expression of Hoxb8 alters the differentiation outcome of myeloid cell lines upon treatment with various stimuli. Hoxb8 over-expression prevents di-methyl sulfoxide (DMSO) mediated granulocytic differentiation of the myeloblastic cell line, HL-60 (Dalton et al., 1988; Krishnaraju et al., 1997). Hoxb8 over-expression also induced cell death rather than granulocytic differentiation of the progenitor cell line, 32Dcl3, upon stimulation with G-CSF (Greenberger et al., 1983; Krishnaraju et al., 1997). In this same cell line, the

differentiation phenotype typically induced by GM-CSF can be phenocopied by the over-expression of Hoxb8 (Krishnaraju et al., 1997).

Alterations in normal differentiation by aberrant Hoxb8 expression is also illustrated during the immortalisation of murine bone marrow progenitors with conditional Hoxb8. When over-expressed in primitive haematopoietic cells, Hoxb8 can immortalise cells and bestow them with the ability to proliferate and survive continuously in vitro if cultured in the presence of growth factors. The removal of Hoxb8 after immortalisation results in the gradual differentiation of cells. The path of differentiation is dependent on the cytokines in which Hoxb8 immortalised progenitor cells were cultured with during Hoxb8 over-expression. Bone marrow progenitor cells immortalised with conditional Hoxb8 and continuously cultured in the presence of either SCF or GM-CSF differentiate into neutrophils or macrophages, respectively, after Hoxb8 withdrawal (Rosas et al., 2011; Wang et al., 2006). The similarities between Hoxb8 derived macrophages and naturally derived bone marrow macrophages has resulted in the exploitation of this system to culture large amounts of differentiated cells in vitro for further characterization (Rosas et al., 2011).

1.6.3 Regulatory pathways influenced by Hox gene expression in haematopoiesis Hox genes influence the expression of a multitude of genes involved in cell signalling and differentiation pathways. Microarray expression analysis in Hoxb4 immortalised HSCs have identified apoptosis associated genes such as Bim and Gadd45 and cell cycle inhibitors, p21, p27 and Cyclin G2 as regulated by Hoxb4 (Antonchuk et al., 2002; Schiedlmeier et al., 2007). Likewise, myeloid progenitor cells immortalised with Hoxb8 exhibit a reduction in the expression of haematopoietic progenitor associated genes such as CD34, Meis1 and Sox4 and an increase in differentiation related genes, CD34, Itgam, Sirpb1 and Cxcl2, following loss of Hoxb8 expression and consequential myeloid differentiation (Wang et al., 2006). These have not however been further identified as direct or indirect targets of Hoxb8. We present here the first observation of Hoxb8 regulating miRNA expression in myeloid progenitor cells.

The direct targets of Hox proteins in haematopoiesis are not well defined. Hox gene deletion studies in mice have produced several abnormal phenotypes yet no extensive

identification of Hox specific target genes. Hoxa9 is the most extensively studied Hox gene, with direct targets identified with Chromatin Immunoprecipiation (ChIP) analysis. In normal haematopoietic cells, Hoxa9 can directly induce expression of the serine- threonine kinase, Pim1, to activate signal transduction pathways and promote cell survival and proliferation (Fox et al., 2003; Macdonald et al., 2006) (Hu et al., 2007). Other direct targets of Hoxa9 may include Foxp1, Hoxb5, C/EBPalpha, CD34, Sox4 and Flt3, however these targets still require further validation (Huang et al., 2012).

1.6.4 Hox genes regulating cell death The linking of Hox genes to cell death pathways during the specification of embryonic cell fate has been observed in both vertebrate and invertebrate cells. The core apoptotic pathway of C.elegans consists of four genes that are homologous to the mammalian intrinsic cell death pathway. They are known as the C.Elegans Death (CED) genes. CED-9 is a Bcl-2 homologue, and represses apoptosis by preventing the formation of the apoptosome. The apoptosome is formed by the Apaf-1 homologue, CED-4, which can activate the principal C.Elegans caspase, CED-3 (Hengartner et al., 1992; Hengartner and Horvitz, 1994). For apoptosis to occur, the transcriptional upregulation of the BH3-only homologue, EGL-1, binds to and represses CED-9 (Conradt and Horvitz, 1998; Hengartner et al., 1992; Wu et al., 1997). This is homologous to the indirect model of BH3-only function referred to in section 1.3.1. C.elegans has six Hox genes, grouped in three pairs on Chromosome III. The Hox gene, lin-39, induced by the trithorax group gene, lin-59, promotes the survival of cells in the developing ventral nerve cord by directly repressing EGL-1 (Kenyon, 1986; Potts et al., 2009). The Hox gene, mab-5, in complex with the Pbx1 homologue, ceh-20, can promote the cell death of two cells in the posterior ventral nerve cord by directly inducing the expression of EGL-1 (Liu et al., 2005). Thus in this organism, Hox genes function to inhibit or promote EGL-1 expression to influence cell death.

In D. Melanogaster, the major mediators of cell death during embryogenesis are the genes reaper (rpr), head involution defective (hid), sickle and grim (Abrams et al., 1994; Chen et al., 1996; Christich et al., 2002; Grether et al., 1995; Srinivasula et al., 2002; Wing et al., 2002). Their respective proteins all share a short inhibitor of apoptosis binding proteins (IAP) binding motif, which is also found in the mammalian

protein, SMAC/Diablo and HtrA2. These cell death proteins induce apoptosis by binding to and inactivating IAPs resulting in the activation of caspases (Du et al., 2000; Suzuki et al., 2001; Verhagen et al., 2000). Cells in the developing D. Melanogaster embryo undergo apoptosis during normal development, in many cases under the direct control of Hox genes. D. Melanogaster have eight Hox genes grouped on a single chromosome and are absolutely required for embryogenesis (Figure 1.6). The embryonic head region is a site of extensive apoptosis with evidence supporting the direct induction of the death inducing gene, rpr by the Hox gene Dfd to induce apoptosis, particularly in the maxillary/mandibular boundary (Lohmann et al., 2002; Nassif et al., 1998)

One would anticipate that a function of Hox genes to control cell death gene expression would also be conserved in mammalian systems. There is, however, much less evidence to date to either support or refute this. In mammals, Hox knockout models more often exhibit a reduction in cell number suggesting that Hox genes are required to prevent apoptosis. Increased cell death of motor-neurons in Hoxc8-/- mice prevent the correct innervation of muscles in the front paws (Tiret et al., 1998). In haematopoiesis, Hoxa9-/- mice have a smaller thymus and reduced numbers of T lymphocytes correlated to a decrease in expression of the anti-apoptotic protein, Bcl-2 (Izon et al., 1998). Unlike C.Elegans and D. Melanogaster, no evidence in mammals links the direct regulation of cell death proteins by Hox genes, in particular mammalian orthologues of EGL-1. In this work I provide evidence that this function is preserved at least for Hoxb8, although the transcriptional mechanism does not appear to be direct.

1.7 Leukaemia

1.7.1 Origin of Acute Myeloid Leukaemia Leukaemia is characterized by the abnormal and uncontrolled growth of haematopoietic cells. The accumulation of these abnormal cells compromises the health and function of other surrounding haematopoietic cells resulting in reduced haematopoietic function. Acute Myeloid Leukaemia (AML) is a leukaemia defined by the abnormal growth of cells derived from the myeloid lineage. The development of AML is a multistep process and progenitor cells must acquire mutations that prevent any further differentiation and promote continuous survival and proliferation. These mutations can be characterised as

either Type I or Type II. Type I mutations target signal transduction pathways with frequent mutations in the Flt3 and c-kit receptors and their downstream effectors, NRAS and KRAS (Jiang et al., 2004; Kiyoi et al., 1999; Kohl et al., 2005; Neubauer et al., 1994). Type II mutations target transcription factors which normally regulate differentiation pathways. These include proteins AML1/RUNX1 and CBFβ, which form part of the heterodimeric transcription factor complex, core-binding factor (CBF), as well members of the Hox gene family (Kroon et al., 2001; Speck et al., 1999).

1.7.1.1 Mutations in Signal Transduction pathways in acute myeloid leukemia (Type I) FLT3 is a growth factor that promotes survival of primitive haematopoietic cells (Hannum et al., 1994). Mutations in the FLT3 receptor are found in 30-35% of all AMLs (Frohling et al., 2002; Kottaridis et al., 2001). The most common is the FLT3- ITD mutation, in which the receptor contains internal tandem duplications (ITDs) that renders it constitutively active in the absence of Flt3 ligand (Li et al., 2007; Nakao et al., 1996). Mutations in the c-kit receptor leading to spontaneous receptor dimerisation and intracellular receptor mutations that constitutively activate STAT3 can increase the expression of downstream survival proteins such as Bcl-XL and c-myc (Kohl et al., 2005; Ning et al., 2001).

1.7.1.2 Mutations in transcription factors in acute myeloid leukemia (Type II) Mutations affecting the function of RUNX1, C/EBFα and Notch1 can result in the acquisition of self-renewal properties through the impairment of differentiation (Frohling et al., 2004; Liang et al., 2004; Weng et al., 2004). Both AML1 and CBFβ are involved in chromosomal translocations that result in loss of function. The most frequently observed translocations include AML-ETO, CBFβ-SMMHC and TEL- AML1 (Golub et al., 1995; Hiebert et al., 1996; Lutterbach et al., 1999; Meyers et al., 1995). In most cases, the presence of these mutations is not sufficient to transform a cell and the accumulation of multiple lesions is required to reach a fully leukaemic state. TEL-AML1 is present in neonatal blood yet children present with the disease at around 2-3 years of age, suggesting that further lesions are acquired to progress to leukaemia during this long latency (Ford et al., 1998; Wiemels et al., 1999a; Wiemels et al.,

1999b). The fusion protein PML-RARα causes a myeloproliferative disease in mice, which can progress into long latency AML after acquisition of other mutations (Pollock et al., 1999; Zimonjic et al., 2000)

1.7.1.3 Mutations not confined to Type I or Type II classifications Recently, several mutations in AML have been detected in large patient cohorts that do not conform to either Type I or Type II characterised mutations. Mutations in the DNA methyltransferase, DNMT3A have been detected in around 20% of large cohorts of paediatric and adult AML (Gaidzik et al., 2013; Ley et al., 2010; Yan et al., 2011). DNMT3A is a methyltransferase that catalyses the addition of methyl groups to cytosine residues of CpG dinucleotides, mediating gene repression. Mutations in DNMT3A are most often associated with no change in DNMT3A expression or changes to the methylation profile, however in older patient cohorts, DNMT3A mutations are associated with poorer prognosis (Ley et al., 2010; Yan et al., 2011). Flt3-ITD, Nucleophosmin 1 (NPM1) and Isocitrate Dehydrogenase 1 and 2 (IDH1/2) mutations also accompany DNMT3A mutations (Gaidzik et al., 2013). These mutations affect the overall outcome of patients, depending on age and type of AML.

Nucleophosmin 1 (NPM1) mutations are found in 30% of AML patients with a normal karyotype. NPM1 is a chaperone protein that shuttles cellular components between the cytoplasm and nucleus (Borer et al., 1989). Mutations to this gene affect its cellular localization and interrupt its normal function (Falini et al., 2005). NPM1 participates as a fusion protein with genes such as Anaplastic Lymphoma Kinase (ALP) and Myeloid Leukemia Factor 1 (MLF1) and is thought to promote tumour development by enhancing the oncogenic effects of its fused gene partners (Bischof et al., 1997; Morris et al., 1994). Patients with a NPM1 mutation that prevents NPM1 shuttling from the cytoplasm to the nucleus generally have positive outcomes for survival, however this is compromised if Flt3-ITD mutations are also present (Thiede et al., 2006).

Isocitrate Dehydrogenase 1 and 2 (IDH1/2) are part of the Isocitrate Dehydrogenase family of enzymes that catalyze the conversion of isocitrate to α-ketoglutarate (Haselbeck and McAlister-Henn, 1993). The pR.132C mutation in IDH1 was first reported in liver metastasis from a colorectal tumour and has since been detected, as

well as multiple other mutations, in both paediatric and adult AML (Andersson et al., 2011; Sjoblom et al., 2006). IDH1 and 2 mutations occur more frequently in cytogenetically normal AML and are prognostic markers for an overall poorer survival, particularly if the NPM1 gene is also mutated (Paschka et al., 2010). Recently, the use of chemical inhibitors to block the function of mutant IDH2/R140Q and IDH1/R132H induced the differentiation of the TF-1 erythroleukemic cell line and glioma cells, respectively (Rohle et al., 2013; Wang et al., 2013) showing promise as effective targets for leukemia treatment.

1.7.2 The role of Bcl-2 family proteins in AML development It is a well-established principal that decreased apoptosis, either by the over-expression of anti-apoptotic or the inactivation of pro-apoptotic proteins can contribute to oncogenesis. Abnormalities in the cell death pathway are common occurrences in AML and have been well characterised. The over-expression of anti-apoptotic proteins such as Bcl-2 and Mcl-1 contribute to leukeamia development. Bcl-2 is frequently upregulated in follicular lymphoma and diffuse B cell lymphomas due to the chromosomal recombination that results in the t(14:18) translocation of Bcl-2 downstream of the immunoglobulin heavy chain (IgH) enhancer (Chen-Levy et al., 1989; Fukuhara et al., 1979; Potter, 2008; Tsujimoto et al., 1984). Bcl-2 co-operates with elevated c-myc levels to enhance the proliferative potential of B cells and enhance leukaemia development (Vaux et al., 1988). Mcl-1 is elevated in many cases of human AML, chronic lymphocytic leukaemia and multiple myeloma and is required for continued leukaemiagenesis in AML mouse models (Beroukhim et al., 2010; Glaser et al., 2012; Pedersen et al., 2002) (Hussain et al., 2007; Kitada et al., 1998). FLT3-ITD also specifically elevates Mcl-1 to promote cell survival and proliferation (Kasper et al., 2012; Yoshimoto et al., 2009).

The treatment of leukemia with elevated levels of Bcl-2, Bcl-xL or Bcl-w has surged ahead with the advent of BH3 mimetics, particularly, ABT-737. This mimetic binds to the hydrophobic cleft of pro-survival Bcl-2 proteins, in particular, Bcl-2, Bcl-xL and Bcl-w to prevent the binding and neutralization of BH3 only pro-apoptotic proteins (Oltersdorf et al., 2005). The oral derivative of ABT-737, ABT-263 (navitoclax), has shown a 35% response rate in relapsed and refractory CLL in clinical trials, however is

accompanied with a sudden drop in platelet numbers due to loss of BcL-xL activity (Mason et al., 2007; Roberts et al., 2012; Tse et al., 2008). Resistance to the effects of ABT-737 is observed by the up-regulation of A1 and Mcl-1, which cannot bind ABT- 737, or decreases in the expression of pro-apoptotic proteins. Blocking A1 and Mcl-1, or even knocking down BH3 only proteins can improve the efficacy of ABT-737 (Happo et al., 2010; van Delft et al., 2006). A new BH3 mimetic, ABT-199, which selectively binds Bcl-2, exhibits a decreased toxicity towards platelets and has shown rapid efficacy in both human and mouse preliminary tests (Souers et al., 2013; Vandenberg and Cory, 2013).

The inactivation of pro-apoptotic proteins in leukaemia leads to a poor chemotherapeutic response and overall inferior long-term prognosis. The epigenetic repression of Bim reduces sensitivity to glucocorticoids used in the treatment of acute lymphoblastic leukaemia (Bachmann et al., 2010). The treatment of chronic myeloid leukaemia (CML) involves the administration of Tyrosine Kinase Inhibitors (TKIs), which mediate cell death through upregulation of Bim expression (Cragg et al., 2007; Gong et al., 2007). The detection of an alternate splicing variant of Bim in which the BH3 domain is excluded, can lead to TKI resistance in CML and Epidermal Growth Factor Receptor Non-Small Cell like Carcinoma (EGFR NSCLC) (Ng et al., 2012). I describe the first report of the repression of the pro-apoptotic protein Bim by Hoxb8 to promote cell immortalisation.

1.7.3 The role of miRNAs in AML development Correlations between miRNA expression and leukaemia are becoming more frequent and can be used as prognostic indicators of disease severity (Marcucci et al., 2011). miR-155 is over-expressed in AML characterized by FLT3-ITD mutations, although its expression is regulated independently of FLT3-ITD (Garzon et al., 2008a; Garzon et al., 2008b). miR-155 negatively regulates SHIP1, a phosphatase involved in suppression of the signalling pathway, and can also repress C/EBPalpha, which is required for normal granulocytic differentiation (Costinean et al., 2009; O'Connell et al., 2009). miR-196b, a strong negative regulator of Hoxb8, is upregulated in patients with MLL rearrangements and is associated with the upregulation of Hox genes from the HoxA cluster, commonly over-expressed in AML (Popovic et al., 2009; Schotte et al., 2010; Yekta et al., 2004).

The miR-17~92 cluster, an important component of this thesis, is implicated in many solid tumours and leukaemias (Hayashita et al., 2005; He et al., 2005). Its elevated expression is commonly associated with leukaemias involving MLL translocations and is an indicator of a poorer prognosis (Mi et al., 2010; Wong et al., 2010). Over- expression of this cluster is also associated with B cell malignancies, particularly in the context of c-myc over-expression (Navarro et al., 2009; Tagawa and Seto, 2005). This cluster consists of six miRNAs, and the independent over-expression of some are more likely to contribute to leukaemia formation than others. The over-expression of miR-92 results in erythroleukaemia development in mice in a manner requiring the suppression of p53 (Li et al., 2012b). miR-19 over-expression promotes the rapid development of Eµ-myc induced B cell lymphomagenesis by suppressing PTEN and promoting enhanced survival through the AKT pathway while miR-17-5p mediates the repression of p21 in therapy-resistant neuroblastoma. (Olive et al., 2009). We report here that the elevated expression of all miRNAs in this cluster can also promote the immortalisation of myeloid progenitor cells by Hoxb8 over-expression.

1.8 The role of Hox genes in AML

1.8.1 Hox gene over-expression co-operates with activated signal transduction to cause leukaemia The enforced expression of several Hox genes, such as Hoxa9 or Hoxb8, can over time result in leukaemia. However, the latency for this process is very long and penetrance is low. The aberrant expression of a growing selection of genes over-expressed together with certain Hox genes can reduce latency periods and induce a more potent leukemia. When Hoxa9 is over-expressed together with Meis1, leukaemia develops more rapidly and with almost 100 percent frequency (Kroon et al., 1998; Pineault et al., 2005). Leukaemia induced by Hoxa9 and Meis1 is characterized by an increase in transcription of the Flt3 receptor and an enhanced survival and proliferative response to Flt3 ligand (FL) (Wang et al., 2005). It should be noted that the kinetics of leukaemia progression following Hoxa9 and Meis1 co-expression in the absence of Flt3 was not reduced, indicating that there remains some controversy about the role of Flt3 in this model of AML (Morgado et al., 2007). However, the expression of other Hox genes, especially

HoxB3, in human AML is strongly correlated with the over-expression of Flt3 (Roche et al., 2004).

The abnormally elevated expression of Pbx3 is frequently found as part of the HoxA9/HoxA7/HoxA11 molecular signature characteristic of certain subtypes of cytogenetically abnormal AML, particular those with MLL-rearranged AML (Bullinger et al., 2004; Li et al., 2013). In normal conditions, Pbx3 assists in Hox target specificity by forming a heterodimer with Hox proteins and increasing the length of the Hox DNA binding sequence. Pbx3 is required for optimal survival of MLL-rearranged leukemias and can enhance in vitro and in vivo growth of HoxA9 dependent leukemias (Li et al., 2013). Treatment with the HXR9 peptide, which blocks Hox and Pbx interactions severely diminishes the colony forming potential of a various MLL-rearranged cell lines and AML patient samples, indicating the interaction of Hox genes with Pbx is essential for the function of Pbx in enhancing leukemiagenesis.

Other proteins linked to Hox over-expression and leukemia development include SHP2, LMO2 and AP-2α. Lim Domain Only 2 (LMO2) normally co-operates with Hox genes during limb development in the growing embryo, however its elevated expression in leukemia is associated with poor prognosis (Calero-Nieto et al., 2013). Activator Protein 2α (AP-2α) is widely known as a tumour suppressor and is inactivated in many melanoma, breast cancer and prostate tumours (Ruiz et al., 2004; Schwartz et al., 2007; Tellez et al., 2003). In several human leukemia cell lines however, the over-expression of AP-2α could directly upregulate Hoxa9, Hoxa7 and Meis1 to promote a more aggressive and invasive leukemia in mice (Ding et al., 2013). Further analysis of human patient samples is required to ascertain any pattern between AP-2α expression and survival prognosis.

1.8.2 Chromosomal rearrangements involving Hox genes in leukaemia Ten percent of all leukaemias display chromosomal rearrangements involving the 11q23 breakpoint. This region encompasses the N-terminal of Mixed Lineage Leukaemia (MLL) and the C-terminal of over 60 other fusion partners (Balgobind et al., 2009; Ziemin-van der Poel et al., 1991). MLL fusion proteins are almost always associated with elevated expression of genes from the HoxA cluster, in particular Hoxa9, Hoxa7

and with elevated Meis1 expression (Meyer et al., 2009; Milne et al., 2010; Ross et al., 2000; Zeisig et al., 2004). Indeed, leukaemias characterized by MLL translocations, especially MLL-ENL, require the continued expression of Hoxa9 and Meis1 in order to survive (Ayton and Cleary, 2003; Horton et al., 2005).

Hox genes also participate as fusion partners with the nucleoporin protein, NUP98. This translocation involving the breakpoint, 11p15.1, fuses the amino terminal end of NUP98 with the carboxy terminal of up to an estimated 28 other genes, with seven of these being Hox genes (Borrow et al., 1996; Nakamura et al., 1996; Taketani et al., 2002a; Taketani et al., 2002b; Taketani et al., 2002c). Fusions involving Hoxa9, t(7:11)(p15:p15), Hoxd13 t(2:11)(q31:p15) and Hoxa13, t(7:11)(p15:p15) have been well characterized, with myeloproliferative disorders and long latency AML generated in murine models after prolonged over-expression (Borrow et al., 1996; Calvo et al., 2002; Pineault et al., 2003). Similar to long latency AML generated by Hoxa9 over- expression, this latency can be shortened with the over-expression of Meis1 (Kroon et al., 2001; Pineault et al., 2005). In humans, NUP98 fusions are most commonly found in AMLs, post-therapy AML and CML and are almost always associated with expression of Meis1 (Andreeff et al., 2008; Romana et al., 2006).

1.8.3 Origin of the WEHI-3B leukaemia Hoxb8 was first implicated in the genesis of murine, acute myeloid leukaemia when it was identified as highly expressed in the myelomonocytic cell line, WEHI-3B (Blatt et al., 1988; Kongsuwan et al., 1989). This cell line was generated from a leukaemia created in BALB/c mice given injections of mineral oil to induce plasma cell tumours (Warner et al., 1969). Cell suspensions from four mice receiving a transplant of the original tumour were created into 4 tumour sublines, termed A, B, C and D. All sublines were serially transplanted for 21 generations and each acquired distinct phenotypes (Warner et al., 1969). Subline ‘B’, also known as WEHI-3B was characterized by a hypodiploid number of chromosomes and the ability to maintain the growth of untransformed bone marrow progenitor cells in the absence of CSFs (Metcalf et al., 1969; Warner et al., 1969). When transplanted into mice, the WEHI-3B cell line generated an aggressive myeloid leukaemia with a latency of 21 days.

1.8.4 The recapitulation of the WEHI-3B leukaemia through IL-3 and Hoxb8 over- expression It was soon discovered that the insertion of a retroviral element, an intracisternal A particle (IAP), 413bp upstream of the start codon, resulted in the constitutive expression of Hoxb8 in the WEHI-3B cell line (Kongsuwan et al., 1989). An IAP element was also detected 215 bp upstream of the TATA box of the IL-3 gene, resulting in the constitutive expression of the IL-3 ligand (Ymer et al., 1985). The over-expression of both Hoxb8 and IL-3 can recapitulate the ferocity of leukaemia formation and in vitro characteristics of the WEHI-3B cell line (Perkins et al., 1990; Perkins and Cory, 1993). In discerning the role of each over-expressed gene in leukaemia development it was found that mice transplanted with bone marrow cells over-expressing IL-3 alone succumbed to a myeloproliferative disease with a latency period of 30-85 days (Perkins et al., 1990). The over-expression of Hoxb8 alone in transplanted bone marrow cells could not induce tumour formation in mice but resulted in an increase in colony forming units (CFUs) in the spleen and bone marrow of experimental mice (Perkins and Cory, 1993). From these experiments it was thought that Hoxb8 over-expression provided the block in myeloid differentiation while the high levels of IL-3 induced the rapid proliferation and continued survival of these transformed cells

1.8.5 Hoxb8 over-expression in human leukaemia The association between Hoxb8 expression and human AML is much weaker in human than in murine models. Hoxb8 in the development of human leukaemia has been linked only to AML characterized by the over-expression of the caudal-type homeobox gene CDX2. CDX2 is normally expressed during mammalian embryogenesis and directly regulates Hox gene expression (Charite et al., 1998). In 90% of AML samples of various cytogenetic subgroups including those with a normal karyotype, t(9;11)(p22;q23), t(15;17)(q22;q11~21), t(8;21)(q22;q22) and inv(16)(p13q22) karyotypes, CDX2 is elevated with increased levels correlating with a poorer prognosis (Scholl et al., 2007). Several human myeloid leukaemia cell lines over-expressing CDX2 are dependent on Hoxb8 expression for optimal clonogenic activity (Scholl et al., 2007). This is also observed in murine bone marrow progenitor cells induced to over- express CDX2 (Frohling et al., 2005) Scholl et al., 2007).

1.9 Hypothesis and Aims of thesis While the identity of Hox gene abnormalities in leukaemiagenesis are well defined, the mechanisms behind their role in cell transformation are not as well characterised. The ability of Hoxb8 to alter the differentiation outcome of cell lines cultured in several different myeloid lineage specific cytokines, indicates a clear role in influencing the differentiation pathway (Krishnaraju et al., 1997). Hoxb8 can induce an acute, and fatal myeloid leukeamia when coupled with elevated levels of IL-3 (Perkins et al., 1990; Perkins and Cory, 1993). The mechanisms in which Hoxb8 contributes to creating this leukaemia have not been defined. In fact, no known targets of Hoxb8 in haematopoiesis have yet been identified. The overall aim of this project is to elucidate the mechanisms by which Hoxb8 can transform an IL-3 dependent myeloid progenitor cell. The aims can be subdivided as described below.

1.9.1 Aim 1 – To examine the behaviour of haematopoietic progenitor cells after immortalisation with the conditional Hoxb8 expression system. The requirement for Hoxb8 in myeloid cell immortalisation will be examined using a conditional Hoxb8 lentiviral system, in which Hoxb8 expression is regulated using the estrogen analogue, 4-hydroxy-tamoxifen (4-OHT). Using this system, I hypothesise that: - c-kit+ve/lin-ve progenitor cells are immortalised by the conditional over- expression of Hoxb8 in a similar manner as cell lines with constitutive expression of Hoxb8, in the presence of IL-3. - These conditionally immortalised Hoxb8 progenitor cells exhibit similar characteristics to previously engineered models of Hoxb8 and IL-3 dependent cell lines.

1.9.2 Aim 2 – To examine the behaviour of Hoxb8 immortalised progenitor cells upon withdrawal of Hoxb8 expression. The exact mechanisms utilized by Hoxb8 to confer an indefinite self-renewal potential on myeloid progenitor cells are not yet known. By removing Hoxb8 expression after immortalisation, it will be possible to assess cell behaviour and determine in what way

these immortalised progenitor cells require continued Hoxb8 expression. I hypothesise that: - The removal of Hoxb8 expression will prevent the continued self-renewal potential of Hoxb8 immortalised progenitor cells. - This reduction in self-renewal will be due to the inability of cells to survive and proliferate in culture. Given that these cells are immortalised myeloid progenitor cells, this reduction in survival and proliferation would be most likely due to the differentiation of previously immortalised cells. This hypothesis is supported by strong evidence that implicates Hoxb8 in influencing the differentiation patterns of other haematopoietic cell lines under certain cytokine conditions. - The presence of IL-3 in culture will also play a role in any effect of Hoxb8 mediated withdrawal. The dependency of Hoxb8 immortalised progenitor cells on IL-3 for survival and proliferation and also in vivo growth and tumourigenicity may influence any Hoxb8 withdrawal mediated behaviour. IL-3 is a cytokine that has more influence on survival and proliferation pathways in haematopoietic cells rather than differentiation pathways. The presence of this cytokine could influence the differentiation pathway upon Hoxb8 withdrawal.

1.9.3 Aim 3 – To investigate gene expression pathways that are regulated by Hoxb8 to promote progenitor cell immortalisation. As a transcription factor, Hoxb8 controls gene expression by binding to regulatory regions of genes to influence transcription. To this date, no direct or indirect targets of Hoxb8 have been elucidated. This third aim is to determine what genes Hoxb8 alters, either directly or indirectly, to influence cell behaviour and promote an immortalised state. I hypothesise that: - Following on from the cell behavioural effects observed in Aim 2 after Hoxb8 withdrawal, Hoxb8 influences the expression of critical genes that modulate the capacity for Hoxb8 to successfully immortalise haematopoietic progenitor cells. - These genes would be a combination regulated both in a Hoxb8 dependent manner that could not be similarly regulated by other Hox genes and those in which all Hox genes from the same cluster or paralagous family target. This hypothesis is based on data, which shows that the over-expression of individual

HoxA genes in haematopoietic cells, results in similar transformation capabilities (Bach et al., 2010).

The results obtained from this study will expand the current knowledge on the mechanisms in which Hox genes can induce haematopoietic progenitor cell transformation and tumour development. Using a model in vitro system, we can identify genes and pathways regulated by Hoxb8 that are absolutely required for tumour formation. The similarity in sequence and domains between multiple Hox genes suggests that the influential targets identified in this study could be similar and relevant to other models of Hox dependent leukeamia.

2.0 Materials and Methods

2.1 Cloning

2.1.1 Conditional Hoxb8 lentiviral systems

2.1.1.1 Creating the pF 5xUAS Hoxb8 SV40 puro GEV16 plasmid. The mouse Hoxb8 cDNA was amplified using PCR from pET Hoxb8 HIS-tag kana using oligonucleotides #1 and #2 from Table 1. All PCR reactions included 10x PCR reaction buffer (Roche), 8mM MgCl2 (Roche), 2mM dNTPs (Applied Biosystems), 0.5nM forward and reverse oligonucleotides (Geneworks), Taq polymerase (Roche) and dH20 to a final volume of 100µL. PCR was conducted on a MJ Mini (BioRad) PCR machine with the following parameters: 95°C for 5 minutes, 15 cycles of 95°C for 30 seconds, 55°C for 30 seconds and 72°C for 30 seconds and 72°C for 5 minutes. PCR product was purified using the PCR purification kit (Qiagen) as per manufacturers instructions. Successful amplification of Hoxb8 was visualized using gel electrophoresis on a 1% agarose (Bioline) gel. Oligonucleotide #1 introduced unique restriction sites BamHI, BglII, and AgeI, 5’ to the start codon of Hoxb8 and oligonucleotide #2 introduced unique restriction sites BstXI, NheI and NotI, 3’ to the stop codon. The Hoxb8 PCR product was digested using BglII and NotI. All restriction enzymes and buffers were obtained from New England Biolabs and reactions conducted as per manufacturers instructions with 30µL of purified PCR DNA or 2µg of plasmid DNA. Digested DNA was run on a 1% agarose gel for verification of correct digest pattern.

BglII-NotI digested Hoxb8 was first subcloned into the shuttle vector, gGALL-(HIS3), together with a BamHI-NotI fragment digested from the pF 5xUAS eGFP SV40 puro GEV16 vector, encompassing a region upstream of the MCS (Yeap et al., 2010). gGALL-(HIS3) was digested with NotI and treated with calf intestinal alkaline phosphatase (Promega) prior to ligation. The ligation reaction was performed overnight at room temperature using 2xLigase buffer (Invitrogen), T4 Ligase (Invitrogen), 1µL of NotI digested gGALL-(HIS3), 3µL of BglII-NotI digested Hoxb8 and 3µL of the BamHI-NotI pF 5xUAS eGFP SV40 puro GEV16 fragment. The ligated plasmid was isolated using 1µL tRNA, 80µL dH20, 10µL 3M Sodium Acetate and 300µL EtOH. Purified ligation was electroporated into electrocompetant STBL4 bacteria (Invitrogen).

Bacteria were spread onto 2YT agar plates (1.6% Tryptone, 1% Yeast Extract, 0.5% NaCl, 1.5% Agar) with Ampicillin (Gibco) and placed at 30°C overnight.

Any colonies arising from overnight culture were picked and cultured, shaking, for 37 hours at 30°C in 2YT broth (1.6% Tryptone, 1% Yeast Extract, 0.5% NaCl). Bacteria were spun down and plasmid DNA extracted using the Mini-prep, Plasmid DNA extraction kit (Nucleospin – Macherey-Nagel). Successful ligation was confirmed by restriction enzyme digest using NotI and BamHI. After confirmation, 1µL of miniprep purified DNA was heat-shocked into calcium-competent MC1061 bacteria at 4°C for five minutes, 45°C for 90 seconds, then 4°C at five minutes. Heat-shocked bacteria were streaked onto 2YT agar plates with Ampicillin and placed overnight at 37°C. One colony was then picked and placed into 100mLs of 2YT broth with Ampicillin, and cultured overnight, shaking, at 37°C. The following day, bacteria were spun down at 10,000rpm for 20 minutes (Sorvell RC 5C plus) and plasmid DNA extracted from bacteria using the MIDI-prep DNA extraction kit (Qiagen). DNA concentration was measured using the Nanodrop 1000 spectrophotometer (ThermoScientific) and DNA once again digested with NotI and BamHI to ensure correct plasmid.

Hoxb8 was sequenced from the gGALL-(HIS3) vector using capillary sequencing (Service provided by Department of Pathology, Melbourne University, Australia). Briefly, 250ng of plasmid DNA was combined with 1µL of oligonucleotides #1-4

(Table 2.1) at 3.2µM and dH20 in a final volume of 15.5µL. This was then combined with 1µL of BDT v.3.1 (Applied Biosystems) and 3.5µL of 5xBDT Dilution Buffer (Applied Biosystems). DNA was amplified at 96°C for one minute and 30 cycles of 96°C for ten seconds, 50°C for five seconds, 60°C for four minutes. DNA was precipitated using 2µL of 125mM EDTA, 2µL of 3M Sodium Acetate and 50µL of 100% Ethanol. Samples were incubated at room temperature for 15 minutes before centrifuged at 13000rpm for 20 minutes at 4°C. Supernatant was immediately removed and pellet washed with 100µL of 70% EtOH at 13000rpm for five minutes at 4°C. Pellet was dried at 100°C for one minute. Samples were then sequenced and analysed using ApE (Universal) software.

Hoxb8 and the pF 5xUAS eGFP SV40 puro GEV16 vector fragment were digested from the gGALL-(HIS3) shuttle vector using NotI and ligated into the NotI digested pF 5xUAS eGFP SV40 puro GEV16 vector. Successfully ligated, mini-prepped DNA was visualized using an EcoRI-NotI diagnostic digest, which could detect the correct orientation of the DNA insert. DNA was MIDI-prepped and concentration measured using the Nanodrop.

2.1.1.2 Creating the pF 7xTetOP Hoxb8 GSlinker RS PGK Hygro TetRVP16 plasmid BglII-NheI digested Hoxb8 was cloned into the BamHI-NheI digested Doxycycline repressible lentiviral vector, pF 7xTetOP GSlinker RS PGK Hygro TetRVP16 (a kind gift from Assoc. Prof. John Silke, Walter and Eliza Hall Institute, Australia) using techniques described in 2.1.1.1. Ligated plasmids were digested with BamHI and EcoRI to confirm correct insertion of Hoxb8. Hoxb8 was also sequenced using oligonucleotides #1-4 in Table 2.1 as described in 2.1.1.1.

Table 2.1: Oligonucleotides used for amplification and sequencing of Hoxb8

# Oligonucleotide sequence

1 5’ GCAGATCTACCGGTGGATCCGCCATGAGCTCTTATTTCGTCAA CTC 3’ 2 5’ GCGCGGCCGCGCTAGCCCAGGCCGCTGGCTACTTCTTGTCACC CTTCTGC 3’ 3 5’ TCCCTATCTGACTCGCAAGC 3’ 4 5’ GCTGCTGGTAGGGAGCTGT 3’ .

2.1.2 Description of cloning methods/sources for all other expression plasmids Hoxb8 cDNA was amplified by PCR from pET Hoxb8 HIS-tag kana using oligonucleotides #1 and #2 from Table 2.1 and as described in 2.1.1.1. Hoxa9 was amplified by PCR from pMSCV Flag Hoxa9 (Addgene) using oligonucleotides #1 and #2 from Table 2. Both Hoxb8 and Hoxa9 PCR products were digested with BglII-NheI and ligated into the BamHI-NheI digested lentiviral vector, pFU SV40 puro W (kind gift from Prof. David Vaux, Walter and Eliza Hall Institute, Australia). Successful ligation of pFU SV40 Hoxb8 puro W and pFU SV40 Hoxa9 puro W was verified using

restriction enzyme digests with BamHI and NheI. Hoxb8 was sequenced using oligonucleotides #1-4 from Table 2.1 and Hoxa9 with oligonucleotides #1-4 from Table 2.2.

Table 2.2: Oligonucleotides used for amplification and sequencing of Hoxa9

# Oligonucleotide sequence 1 5’ GCACCGGTCCGCCATGGACTACAAGGACGACGATGACAAG 3’ 2 5’ GCGCTAGCAAGCTTACAATACCTCCTCCATCA 3’. 3 5’ TTAAACCTGAACCGCTCTCG 3’ 4 5’ GCTCTCATTCTCGGCATTGT 3’

The MPZenIL-3 retrovirus was a kind gift from Prof. Suzanne Cory (Walter & Eliza Hall Institute, Australia). Previously described in (Perkins et al., 1990). The pFU cre PGK Hygro plasmid was a kind gift from Assoc. Prof. John Silke (Walter and Eliza Hall Insititute, Australia).

Doxycycline inducible cre recombinase expression was achieved using the pFTREtight MCS rtTAadvanced GFP lentiviral vector (Kahn, Okamoto and Huang – manuscript in preparation). Cre recombinase was digested from pFU cre PGK Hygro W using BamHI- NheI and ligated into the BamHI-NheI digested pFTREtight MCS rtTAadvanced GFP lentiviral vector. Successful ligation was confirmed by diagnostic digest using BamHI and NheI.

The murine Bim 3.6kB promoter region upstream of Exon 1 as well as full-length Intron 1 were cloned into the pGL2 basic plasmid (Promega), using restriction enzyme sites HindIII and KpnI (Figure 2.1B and C). The murine Bim 3’UTR was cloned into the pGL3 promoter plasmid (Promega) using restriction enzyme sites SpeI and BamHI (Figure 2.1A). All plasmids were a kind gift from Hamsa Puthalakath (LaTrobe University, VIC, Australia).

Figure 2.1: Schematic diagrams of luciferase reporter constructs A) Schematic representation of pGL3 promoter vector with murine Bim 3’UTR. A SV40 promoter (light blue arrow) drives expression of the luciferase gene. The Bim 3’UTR was cloned into the vector using SpeI and BamHI. The SpeI site was lost after ligation with an XheI site. B) Schematic representation of pGL2 basic vector with the first intron of murine Bim. The segment of the first intron was cloned into the vector using SacI and HindIII. C) Schematic representation of pGL2 basic vector, as in B, with the 3.6kB Bim murine promoter. This segment of the Bim promoter was cloned in using SacI and HindIII. Direction of arrows in each vector indicates the transcriptional direction of each vector feature. Total length of vector is indicated inside each schematic.

The individual Bim 3’UTR segments were cloned into the FUGW (flap-Ub-promoter- GFP-WRE) lentiviral plasmid into an EcoRI site. Oligonucleotides used to amplify the individual Bim 3’UTR segments from mouse genomic DNA include segment 1: #1 and #2, segment 2: #3 and #4, segment 3: #5 and #6, segment 4: #7 and #8 (Table 2.3). Successful ligation was verified by diagnostic digest including XhoI and NheI for 3’UTR Segment 1, SphI for 3’UTR Segment 2 and PstI for 3’UTR Segments 3 and 4. All constructs were a kind gift from Dr. Marco Herold and Leona Rohrbeck (Walter and Eliza Hall Institute, VIC, Australia).

Table 2.3: Oligonucleotides used for amplification of murine Bim 3’UTR segments

# Oligonucleotide sequence 1 5’ ATGCGAATTCCAGGATCTACATGCAGCCAG 3’ 2 5’ TGCAGAATTCATGAAATTCAGGAATCACAGGC 3’ 3 5’ TCGAGAATTCTGGGATGTAGCCCTGCTCAC 3’ 4 5’ TGACGAATTCGTTCTTGAATACTTCTACAATTCA 3’ 5 5’ TCGAGAATTCCTGGCCGCTGAAGCAGCTC 3’ 6 5’ TGACGAATTCAAAATTCTTCC CCATCTGCTG 3’ 7 5’ GTCAGAATTCCAGACTCACCAGTAAGTTGGC 3’ 8 5’ TGACGAATTCTTTTGAAAGCTAGTCGCAAGTTTT 3’

2.1.3 Genotyping For genotyping E14.5 embryos derived from the mating of miR-17~92flx/+ mice, the following method was untilised. To genotype embryos, genomic DNA was extracted from the E14.5 embryonic tail. Briefly, embryonic tails were washed in PBS then resuspended in lysis buffer (100mM NaCl, 10mM Tris HCl pH 8.0, 25mM EDTA, 0.5% SDS) and 30µL Proteinase K at 600mAU/mL (Sigma). Tail suspensions were incubated at 55°C for two hours before 30µL of Proteinase K was re-added and incubation continued overnight. The following day, samples were vortexed and spun at 13,000rpm for three minutes. Supernatant was transferred to a new tube and combined with an equal volume of isopropanol (Merck). Samples were spun at 4ºC for two min at

13,000rpm. DNA pellet was then washed with 70% EtOH then dried at 42ºC before resuspended in TE buffer (Qiagen) with RNase (Sigma). Genomic DNA extracted from Hoxb8 and Hoxa9 immortalised progenitor cells was performed in a similar manner with genomic DNA extracted from a minimum of 5x10^4 cells.

Genotyping PCR to amplify 5’ loxp site in miR-17~92flx/flx mice was conducted using oligonucleotides #1 and #2 from Table 2.4 in a PCR reaction with the following parameters: 94ºC for three minutes, 35 cycles of 94ºC for 20 seconds, 55ºC for 30 seconds, 72ºC for 40 seconds, followed by 72ºC for five minutes. To detect the deleted miR-17~92 allele, oligonucleotide #3 from Table 2.4 was also included in the PCR reaction. PCR products were visualized on a 2% agarose gel.

Table 2.4: Oligonucleotides used for genotyping of miR-17~92flx/flx mice

# Oligonucleotide sequence

1 5’ TCGAGTATCTGACAATGTGG 3’

2 5’ TAGCCAGAAGTTCCAAATTGG 3’

3 5’ ATAGCCTGAAACCAACTGTGC 3’

2.2 Maintenance of commonly used cell lines 293T-HEK cells were maintained in High Glucose DMEM (Gibco #12100-069,

NaHCO3) supplemented with 10% FCS. Cells were seeded in 10cm plates and passaged every four days. To passage, cells were washed in 5mL of PBS then incubated with 1mL of Trypsin (137mM NaCl, 5.4mM KCl, 5.55mM D-Glucose, 7mM NaHCO3, 0.05% Trypsin1:250, 1.3mM EDTA) for five minutes at 37°C. Trypsin was inactivated with 9mLs of high glucose DMEM, cells collected and spun at 500g for five minutes to pellet. Media was aspirated and pellet resuspended in high glucose DMEM/10% FCS. Cells were replated at a low density in 10mLs of high glucose DMEM. Cells were kept at 37°C in a 5% humidified incubator.

FDC-P1 cells were maintained in low glucose DMEM/10% FCS and 0.05ng/mL IL-3. Cells were seeded at low density in six well plates and passaged every four days. Cells were kept at 37°C in a 10% humidified incubator.

HeLa cells were maintained in Rosewell Park Memorial Insititute (RPMI) media (RPMI

1640 Gibco #31800-089, NaCl, Sodium Pyruvate, NaHCO3), with 20% FCS. Cells were seeded in 10cm plates and passaged as described for 293T cells. Cells were kept at 37°C in a 5% humidified incubator.

MM6 cells were maintained in RPMI with 20% FCS and L-glutamine (Gibco). Cells were seeded in six well plates and passaged every four days. Cells were kept at 37°C in a 10% humidified incubator.

SV40 Murine Embryonic Fibroblasts were cultured in high glucose DMEM with 10% FCS. Cells were seeded in 10cm plates and passaged as described for 293T cells every four days. Cells were kept at 37°C in a 5% humidified incubator.

2.3 Mouse models All wild type cell lines were derived from C57BL/6 E14.5 embryos. The Bim-/-, Bax-/- ;Bak-/- and miR-17~92flx/flx mice have been previously described (Bouillet et al., 1999; Lindsten et al., 2000; van Delft et al., 2006; Ventura et al., 2008). Mcl-1flx/flx embryos were a kind gift from Dr. David Huang (Walter and Eliza Hall Institute, Australia).

2.4 Creation of IL-3 dependent, conditional Hoxb8 myeloid progenitor cell lines

2.4.1 Production of lentivirus The over-expression of Hoxb8 from the pF 5xUAS Hoxb8 SV40 puro GEV16 plasmid was achieved by producing a lentivirus in HEK-293T (293T) cells followed by infection of this lentivirus into haemtopoietic progenitor cells. The following method describes production of the lentivirus by transient transfection of plasmids containing all components required to produce the lentivirus. 293T cells were prepared the day before in a 10cm plate at a density of 3x10^6 cells. The following day, a DNA transfection mix

of 2.5µg of pCMV δR8.2 (Dull et al., 1998), 1µg of pMD2G VSVG (Dull et al., 1998) and 1.5µg of the lentiviral vector containing the gene of interest was prepared using the Effectene Transfection Kit (Qiagen), as per manufacturers instructions. 48 hours after initial transfection, 10mLs of media containing virus was filtered using 40µm filters (Sartorius Stedium Biotech) and collected in 5mL cryotubes (Greiner Bio-one). Lentivirus was either used immediately or stored at -80°C.

2.4.2 Determination of lentiviral titre In order to infect haematopoietic progenitor cells with lentivirus all with an equal level of infection potential, the viral titre of each batch of lentivirus was determined by infecting FDC-P1 cells with limiting dilutions of lentivirus. 10^4 FDC-P1 cells were prepared per well in a 12 well plate and infected with either neat, 1:2, 1:20, 1:200 or 1:2000 dilutions of lentivirus. An uninfected sample was also included. Cells were infected by spinoculation at 30°C, 2500rpm for 90 min in the presence of 5µg/mL polybrene (Sigma) and cultured overnight with virus. The following day, lentivirus was removed and 48 hours after infection, cells were treated with 0.5µg/mL puromycin (Sigma). After 48 hours of puromycin treatment, cell survival was analysed by FITC- coupled AnnexinV (Invitrogen) and Propidium Iodide (Sigma Aldrich) staining. The viral titre was calculated as the percentage of viable cells after puromycin treatment following infection with 1mL of virus.

2.4.3 Isolation of fetal liver c-kit+ve/lin-ve progenitor cells The starting population of all Hoxb8 immortalised progenitor cell lines except Bax-/- ;Bak-/- were derived from progenitor cells isolated from the fetal liver of an E14.5 embryo. Progenitor cells from Bax-/-;Bak-/- embryos were taken at E13.5. Fetal livers were extracted from embryos in a sterile environment and resuspended gently using a P1000 pipette (Gilson) in 2% FCS (JRH Laboratories, Heat inactivated and filtered)/ PBS (Na2HPO4.2H2O, NaH2PO4.H2O, NaCl). Cells were spun at 500g for five minutes. Cells were washed once more in 2% FCS/PBS then sorted as described below.

+ve -ve 2.4.3.1 Isolating a c-kit /lin population using FACS The mouse fetal liver at E14.5 contains many different cell populations; therefore to obtain a pure population of progenitor cells for lentiviral infection, single cell susupensions of fetal liver were sorted to isolate the c-kit+ve, lin-ve progenitor cell population. These cells were isolated by fluorescence activated cell sorting (FACS) using an antibody cocktail mix of c-kit-APC (553356), Gr-1(Ly-6G/Ly-6C)-FITC (553126), NK1.1-FITC (553164), B220-FITC (533087-Clone RA3-6B2) and TER-119- FITC (557915) (All from BD Pharmingen). Antibodies were diluted to a working concentration in 2% FCS/PBS. Cells were stained for 45 minutes at 4°C before washed twice in 2% FCS/PBS. Cells were resuspended in 500µL of 2% FCS/PBS and 10µg/mL of Propidium Iodide (PI) (Sigma) and filtered using a 100µM filter (BD) to exclude debris and clumps of cells. Penicillin/Streptomycin (Gibco) was also added to prevent bacterial contamination during sorting. Cell sorting using the Mo-Flow Cell Sorter (Becton Dickinson) proceeded with the initial exclusion of PI positive cells, followed by exclusion of any FITC positive, Gr-1, NK1.1, B220 and TER-119 expressing cells. Only cells staining positive for APC were collected in 500µL of low glucose DMEM

(Invitrogen DME #31600-083, NaHCO3), 10% FCS, 0.25ng/mL Interleukin-3 (IL-3) (R&D), 0.5ng/mL Stem Cell Factor (SCF) (Invitrogen) and Penicillin/Streptomycin.

Sorted cells were placed into a 12 well plate and kept in a humidified 37°C, 10% CO2 incubator (HeraCell 150) overnight.

2.4.3.2 Isolating an enriched progenitor population using Mouse Haematopoietic Progenitor (Stem) Cell Enrichment Set – DM (BD) Instead of using flow cytometry to sort for haematopoietic progenitor cells from miR- 17~92flx/flx E14.5 fetal livers, the Biotin Mouse Lineage Depletion Cocktail (558451-BD IMag) was used instead. Upon filtering, the single cell suspension of fetal liver cells was resuspended at 5µL/1x10^6 cells in a cocktail of biotin-conjugated CD11b, CD3, TER-119, Gr-1 and B220 (BD). After a 15-minute incubation on ice, cells are washed with 10x excess 2%FCS/PBS buffer at 300g for seven minutes. Supernatant was aspirated before BD IMag Streptavidin Particles Plus – DM (BD) was added to cells at 5µL/1x10^6. Cells were incubated at 4°C for 30 minutes. Volume was increased to a final concentration of 20x10^6 cells/mL with 2%FCS/PBS and cells were transferred to a round-bottom test tube and placed onto the BD IMagnet for eight minutes for

magnetic depletion of all biotin positive cells. All cells remaining in buffer were spun down at 500g for five minutes and placed into low glucose DMEM, 10% FCS and 3.15ng/mL SCF, 2.5ng/mL IL-6 (made in-house, Walter and Eliza Hall Institute, Melbourne, Australia) and 1.5ng/mL IL-3.

2.4.4 Infection of cells After haematopoietic progenitor cells were sorted, cells were left overnight in the cytokine conditions described above in a humidified 37°C, 10% CO2 incubator. The following day, between 1x105 and 5x105 cells were infected in a 12 well plate with lentivirus at equal viral titre. IL-3 at 0.25ng/mL and SCF at 0.5ng/mL were added to replenish cytokines that were absent from the lentiviral supernatant. Polybrene was added to all infections at a concentration of 5µg/mL. Cells were infected by spinoculation at 30°C, 2500rpm for 90 min, then kept at 30°C for a further one hour after infection. Cells were transferred to a humidified 37°C, 10% CO2 incubator for overnight culture.

2.4.5 Culture conditions post infection C-kit+ve, lin-ve cells infected with the 4-OHT inducible Hoxb8 lentivirus were kept in virus overnight before cells were washed and replated in DMEM/10% FCS, 0.25ng/mL IL-3 and 0.1µM 4-Hydroxy-Tamoxifen (4-OHT) (Sigma). 48 hours after infection, cells were cultured in 0.5µg/mL puromycin for a period of ten days to select for infected cells. Hoxb8 immortalised progenitor cells were maintained in 4mLs low glucose DMEM/10% FCS, 0.25ng/mL IL-3 and 0.1µM 4-OHT in six well plates, and topped up with fresh media every three days, including 4-OHT to ensure continuous expression of Hoxb8. Every six days, cells were passaged into new wells. For cell expansions, cells were progressively cultured into larger flasks, refed every three days, spun down and resuspended into a larger volume every six days. Cells were frozen in 10% DMSO (Sigma)/FCS in 1mL cryotubes and placed into a Frostyboy (Nalgene) at -80°C before transferred to liquid nitrogen storage.

C-kit+ve, lin-ve cells infected with the Doxycycline repressible Hoxb8 lentivirus were kept in virus overnight before cells were washed and replated in DMEM/10% FCS and 0.25ng/mL IL-3. Forty-eight hours after infection cells were cultured with 300µg/mL of Hygromycin (Sigma) for a period of 14 days. Cells were maintained in six well plates and re-fed after three days. Every six days, cells were passaged. Hoxb8 was repressed with the addition of 0.5µg/mL Doxycycline (Sigma), which was re-added every three days to maintain Hoxb8 repression.

C-kit+ve, lin-ve cells infected with the constitutive Hoxb8 and Hoxa9 lentivirus were kept in virus overnight before cells were replated in 3.15ng/mL SCF, 2.5ng/mL IL-6 and 1.5ng/mL IL-3. Forty-eight hours after infection, cells were selected in 0.5µg/mL of puromycin for a period of ten days. Cells were continuously maintained thereafter in DMEM/10% FCS, 3.15ng/mL SCF, 2.5ng/mL IL-6 and 1.5ng/mL IL-3. Constitutive Hoxb8 and Hoxa9 immortalised progenitor cells were maintained in six well plates, refed every three days and passaged into a new well every six days.

2.4.6 Infection of Hoxb8 immortalised progenitor cells with MPZen-IL-3 retrovirus To introduce the MPZenIL-3 retrovirus into 4-OHT inducible, Hoxb8 immortalised progenitor cells, cells were co-cultured for five days with fibroblasts (ψ2 cells) that expressed all components to manufacture the IL-3 retrovirus (kind gift from Suzanne Cory) (Perkins et al., 1990). Cells were kept in 0.25ng/mL IL-3 and 0.1µM 4-OHT during co-culture. Following infection, Hoxb8 immortalised progenitor cells were cultured in the absence of recombinant IL-3 but continued presence of 4-OHT. Any residual adherent ψ2 cells in culture were selected out during continous passaging. Cells were tested for endogenous IL-3 expression by survival in liquid culture and growth in soft agar in the absence of exogenous IL-3.

2.5 Cell proliferation and survival assays

2.5.1 Cell counts Cell counts were conducted in one of three ways. Trypan blue (Invitrogen) dye exclusion was used for general cell counts conducted with either a haemocytometer

(Neubauer) or Cell Countess (Invitrogen). Cell counts were also conducted by incubating cells with a 1:10 dilution of a known concentration of Fluorescent Microsphere beads (Beckman Coulter). A minimum of 10000 cells was acquired by flow cytometry (LSRII-Becton Dickinson) and the total cell number was determined by the number of viable cells acquired divided by the number of beads/µl detected.

2.5.2 Analysis of Cell survival As a measure of cell death, cells were stained with 10µg/mL of Propidium Iodide (Sigma Aldrich) and FITC-coupled, Annexin V (Invitrogen-V13245) at a 1:1000 dilution, in a balanced salt solution (10mM HEPES pH7.4, 140mM NaCl and 5mM

CaCl2) for one hour on ice. Cells were then analysed by flow cytometry (LSRII-Becton Dickinson) using the FL1 channel to detect FITC and the FL3 channel to detect PI. Cell debris was gated out of all analysis.

2.5.3 Analysis of Cell cycle The total DNA content of cells was analysed by staining cells with PI in a hypotonic solution (0.1% Na3Citrate in ddH20, 0.1% TritonX-100, 50µg/mL PI, 25µg/mL RNaseA). Cells are incubated on ice for one hour before analysed using flow cytometry (LSRII-Becton Dickinson) on the FL3 channel. Data was analysed using the ModFit LT™ software.

2.5.4 Soft agar Individual clones of Hoxb8 immortalised progenitor cells were generated in soft agar. 100, 1000 or 10,000 Hoxb8 immortalised progenitor cells were plated in six well plates together with low glucose DMEM, 20% FCS, 1µM 4-OHT, 0.3ng/mL IL-3 and 0.3% soft agar. After 14 days, colonies were visualised using the WILD Heerbrugg M8 microscope and picked from agar with a p200 pipette (Gilson). Colonies were placed into 48 well plates with 500µL of low glucose DMEM/10% FCS, 0.25ng/mL IL-3, 0.1µM 4-OHT and 1:100 penicillin/streptomycin. Colonies were expanded in the absence of penicillin/streptomycin and cultured as per usual.

Clonogenic assays to determine long term survival were conducted in soft agar or single cell sorted into 96 well plates. Soft agar was prepared as described above. The amount of DMEM, FCS and soft agar remained constant across all experiments while 4-OHT and IL-3 were added or removed depending on the experimental design. Cytokines added to soft agar were added at the following concentrations: IL-3: 0.3ng/mL, SCF: 0.5ng/mL, GM-CSF: 10ng/mL. Colonies were counted 14 days after initial plating.

To sort into 96 well plates, 5x10^4 Hoxb8 immortalised progenitor cells were resuspended in 2%FCS/PBS with 10µg/mL PI and passed through a 100µM filter (BD). Cells were sorted into 96 well plates containing 100µL of low glucose DMEM, 10% FCS, 0.25ng/mL IL-3 and 0.1µM 4-OHT, by FACS (Mo-Flow Cell Sorter – BD). Seven days after sort, a further 100µL of media was added to each well. Colonies were detected as a cluster of cells growing at the bottom of the well.

2.5.5 Luciferase assays All luciferase assays were completed in the easily transfectable 293T cells. In order to induce Hoxb8 or control GFP expression in these cells, the Doxycycline repressible Hoxb8 or GFP lentivirus was infected into 293T cells using experimental methods described in Section 2.4.4 while cultured in high glucose DMEM in the absence of cytokine. Cells were selected in 300µg/mL hygromycin for 14 days. Once selected, 293T cells were seeded at 10^5 cells/well in a 12 well plate. The following day, cells were transfected with 1.5µg of firefly luciferase plasmids containing Bim genomic DNA and 0.5µg of renilla luciferase plasmid as a transfection control. Cells were transfected using the Effectene Transfection Kit (Qiagen) as per manufacturers instructions. 24 hours after transfection, culture medium was replaced. 72hrs after initial transfection, cells were lysed using the Passive Lysis Buffer from the Dual Luciferase Reporter Assay System (Promega) and 5µl of lysed sample loaded onto a white, 96 well plate. Luciferase was detected using the Dual Luciferase® Reporter Assay System (Promega) on the FLUOstar Optima (BMG Labtechnologies). Firefly luciferase from each lysate was made relative to renilla luciferase.

2.5.6 GFP reporter assays The GFP reporter assays were also conducted in 293T cells, however the preparation of these cells was slightly different to those used in the luciferase reporter assays. 293T cells were first stably infected with the pFUGW lentiviral plasmids containing either sections one, two, three, or four of the Bim 3’UTR as well as an ‘empty’ pFUGW plasmid (See Figure 4.9A). Cells were sorted using FACS to isolate GFP positive cells. The GFP positive population of cells were then infected with the Doxycycline repressible Hoxb8 lentivirus, cultured in the absence of Doxycycline and selected in 300µg/mL hygromycin for 14 days. Once selected, GFP expression was analysed using flow cytometry.

2.6 Differentiation assays

2.6.1 Analysis of surface marker expression To analyse the expression of surface markers on Hoxb8 immortalised progenitor cells, 10^5 cells were resuspended in 200µl of 2% FCS/PBS, placed into a 96 well plate and washed. Cells were then resuspended in 50µl of fluorochrome conjugated antibody cocktails including Cocktail 1: c-kit-APC (553356 – Clone 2B8), NK1.1-FITC (553164 – Clone PK136) and CD11b-PE (557397 – M1/70), Cocktail 2: B220-APC (553092 – Clone RA3-6B2), TER-119-FITC (557915 - Clone TER-119) and F4/80-PE (MCA497PE – Clone C1:A3-1) and Cocktail 3: Sca-1-PE (553336 – Clone E13-161.7) and Gr-1-FITC (553127 – Clone RB6-8C5). All antibodies were supplied by BD Biosciences except for F4/80-PE, which was purchased from AbD Serotec. An unstained control was included for each cell line. Cells were incubated with antibodies in the dark at 4°C for 45 minutes. Cells were then washed twice with 2%FCS/PBS and transferred to round bottom FACS tubes in 200µl of 2%FCS/PBS. Live cells were gated and fluorescence analysed by flow cytometry. APC was detected using the FL4 channel, FITC was detected with FL1 and PE detected using FL2. Compensation controls were also prepared using Hoxa8 immortalised progenitor cells which expressed high levels of CD11b-PE, B220-APC or Gr-1-FITC. Compensation was calculated using the FACSDIVA analysis program (Becton Dickinson).

2.6.2 May Grunwald/Giemsa staining To analyse Hoxb8 immortalised progenitor cell morphology, cells were prepared at 8x104 in 100µl of 2% FCS/PBS and cytospun at 1400rpm for five minutes onto microscope slides using the Shandon Cytospin 2. Slides were air-dried for at least one hour before cells were fixed in clean methanol for ten minutes. Fixed cells were stained for twenty minutes in a 1:2 working solution of May-Grunwald (Sigma) diluted in buffered water (pH6.8) then counterstained for ten minutes in a 1:10 working solution of Giemsa (Sigma) also diluted in buffered water. Buffered water was made by combining 50.8mLs of 66mmol/L KH2PO4 and 49.2mLs of 66mmol/L Na2PO4, then adjusting to reach a pH of 6.8. Stained slides were washed in three consecutive changes of buffered water then dried upright. Stained cells were examined on an Olympus IX70 microscope and photographs taken using the Olympus DP70 camera.

2.7 Protein expression analysis

2.7.1 Western Blots To examine protein expression in Hoxb8 immortalised progenitor cells and any other cell line, a known number of cells were lysed and examined using Western Blots. 5x104 cells/µl were washed once in PBS and lysed in RIPA buffer (150mM NaCl, 50mM TrisHCl pH7.4, 0.5% sodium deoxycholate (DOC), 0.1% SDS, 1% NP40) with protease inhibitor cocktail (Merck) and phosphatase inhibitors (5mM ßglycerophosphate, 1mM Na Molybdate, 2mM Na Pyrophosphate, 10mM NaF). Lysates were centrifuged at 10,000rpm for ten minutes at 4°C. The supernatant was collected, diluted 1:5 with 5x SDS-PAGE loading buffer (250mM Tris.Cl pH 6.8, 10% 2-mercaptoethanol, 10% SDS, 0.2% Bromophenol blue and 50% glycerol) and boiled for 10 minutes. Lysates were also made using SDS buffer (2%SDS, 0.5mM EDTA, 20mM HEPES pH7.9). After resuspension in SDS buffer, samples were kept on ice for half an hour before boiled for ten minutes with 5x SDS-PAGE loading buffer.

Lysates were loaded equally by cell number onto either 10% or 12% Acrylamide (BioRad) SDS-PAGE gels and transferred to PVDF transfer membranes (Hydrobond). Membranes were blocked for one hour at room temperature in 5% Skim Milk (SM)(Devondale)/0.1%Tween20(Sigma-Aldrich) and 1xTBS(Trisma Base-Invitrogen

#1504-020, NaCl) or 5% Bovine Serum Albumin (BSA) in 0.1%Tween20/1xTBS. Antibodies were probed overnight at 4°C diluted in 5%SM/0.1%Tween20/1xTBS or 5%BSA/0.1%Tween20/1xTBS according to manufacturers instructions. The following day membranes were washed three times in 0.1%Tween20/1xTBS then probed with secondary antibody conjugated to horseradish peroxidase (HRP) diluted in 5%SM/0.1%Tween20/1xTBS for one hour at room temperature. After three consecutive washes in 0.1%Tween20/1xTBS, HRP signal was detected using Super Signal West Dura chemiluminescence reagent (Pierce) on either the Kodak Xomat 300RA processor or Chemidoc (BioRad).

Membranes were probed with the following antibodies: anti-Hoxb8(Abnova- H00003218-MO1), anti-Bim (Stressgen-AAP-330), anti-Bid (kind gift from Andreas Strasser), anti-Bax (Sigma-B9054-Clone 5B7), anti-Bak (Sigma-B5897), anti-Puma (ProSci-3043), anti-Mcl-1 (Rockland-600-401-394), anti-Bcl-xL (R&D Systems- AF800), anti-Bcl-2 (BD Pharmingen-610539), anti-Bmf (kind gift from Lorraine O- Reilly), anti-Noxa (Millipore-AB5761), anti-IL-3 alpha chain and anti-IL-3 ß-specific chain (R&D systems-MAB983-Clone 151231, AF549), anti-p21 (Abcam-556430), anti- PTEN (Cell Signalling-9552), anti-HSP-70 (Cell Signalling-4872) anti-ß-actin (Sigma Aldrich-A1978), anti-cre (Novagen-69050), anti-rat-HRP (Amersham-NA935), anti- rabbit-IgG-HRP (Amersham-(NA934), anti-mouse-IgG-HRP (Sigma-A2304).

2.7.2 Hoxb8 intracellular staining The Hoxb8 antibody could also recognize Hoxb8 in its native form and hence could be used to qualitatively assess the amount of Hoxb8 expression in each individual cell using FACs analysis. 1x105 Hoxb8 immortalised progenitor cells were washed in 2% FCS/PBS and placed into a 96 well plate. Cells were fixed in 50µl of 1% paraformaldehyde (Sigma) for 10 minutes followed by two washes in 2% FCS/PBS. Cells were then stained with anti-Hoxb8 (Abnova-H00003218-MO1) in a 0.3% Saponin (Sigma)/2%FCS/PBS solution at 4°C overnight. The following day, cells were washed twice in a 0.03% Saponin/2%FCS/PBS solution then stained for 45 minutes with a PE conjugated goat anti-mouse IgG-RPE antibody (Southern Biotech-1030-09), in 2% FCS/PBS/0.03% Saponin. Cells were washed twice in 2%FCS/PBS/0.03% Saponin and resuspended in 2%FCS/PBS followed by analysis using flow cytometry.

2.7.3 IL-3 Receptor staining by Flow Cytometry To analyse the expression of the components of the IL-3 Receptor on the surface of Hoxb8 immortalised progenitor cells, cells were washed in PBS and 1x105 cells were blocked for 15 minutes with 24G2 FcR (kindly provided by Lorraine O’Reilly). Cells were stained with either PE-conjugated IgG2A Isotype Control (R&D Systems-IC006P- Clone 130705) or PE conjugated anti-mouse IL-3ß common chain/CD131 (R&D Systems – FAB5492P) at a final antibody dilution of 1:10 for 45 minutes. Cells were washed twice with 2% FCS/PBS, resuspended in 200µl of 2%FCS/PBS and analysed by flow cytometry. PE was detected using the FL2 channel and expressed relative to cells stained with the PE-conjugated IgG2A Isotype Control to account for non-specific binding of the antibody.

2.8 mRNA analysis

2.8.1 Detection of mRNA using the Universal Probe Library (Roche) For analysis of mRNA expression during conditions of Hoxb8 expression and withrdrawal, RNA was extracted from 5.5x106 cells using the RNeasy RNA extraction kit (Qiagen), as per manufacturer’s instructions. 1.5µg of RNA was reverse transcribed using H-HLMV (Promega) and random primers (Promega). Briefly, 1.5µg of RNA was added to a 20µl reaction containing 4µl M-MLV buffer (Promega), 2mM dNTPs (Applied Biosystems), 40U/µl RNAsin (Promega), 1µl Oligo dT (Promega), 0.1M DTT

(Promega) and dH20 to make a final volume of 19µl. Samples were placed at 65°C for five minutes then 37°C for ten minutes. 1µl of M-MLV was added to each reaction before incubation at 37°C for 50 minutes. Samples were placed at 90°C to inactivate the enzyme. For each sample of RNA, a separate reaction was included in which dH20 was added instead of M-MLV. cDNA was used as template in a PCR reaction to amplify beta-actin and verify that RNA was successfully reverse transcribed to cDNA. Oligonucleotides for this reaction are listed as # 1 and #2 in Table 2.5. The PCR reaction was prepared and run as described in 2.1.1.1.

1µl of cDNA was used to detect murine Bim using the Universal Probe Library (Roche) and Faststart Taqman Probe Mastermix (Roche Diagnostics). Each reaction consisted of 1µl of cDNA, 5µl of 2xLightCycler 480 Master Mix (Roche), 0.1µl of the Bim

universal probe at 10µM, 1µl each of forward and reverse Bim specific primers (Geneworks) at 1µM and 1.9µl of dH20 to make a final reaction volume of 10µl. Universal probe #49 was used to detect Bim together with primers # 3 and #4 from Table 2.5. These primers were designed using the online Universal Probe Library Assay Design Centre http://www.roche-applied- science.com/sis/rtpcr/upl/index.jsp?id=UP030000. To normalize Bim levels in each sample, two house-keeping genes, Sdha and Polr2a were used as a reference. Universal probe #71 together with oligonucleotides #5 and #6 from Table 2.5 were used to detect Sdh2a and universal probe # 69 together with oligonucleotides #7 and #8 were used to detect Polr2a. The RT-PCR reaction was run on the ABI 7900 HT instrument (Applied Biosystems Foster City, CA) using the following parameters: 95ºC for ten minutes to activate the polymerase followed by 40 cycles at 95ºC for 15 seconds and 60ºC for one minute in a two-step thermal cycle. Results were analysed using the LightCycle 480 software where individual Ct values were extracted. An expression profile from the Raw Ct values was determined using the comparative Ct (ΔΔCT) method. Expression levels were made relative to the highest expressing sample.

Table 2.5: Oligonucleotides used for mRNA analysis

# Oligonucleotide 1 5’ CTGGCACCACACCTTCTACAATGAGCTGCG 3’ 2 5’ GCACAGCCTGGATGGCTACGTACATGGC 3’ 3 5’ CATCGCGGTATTCGGTTC 3’ 4 5’ GCTTTGCCATTTGGTCTTTTT 3’ 5 5’ TGTTCAGTTCCACCCCACA 3’ 6 5’ TCTCCACGACACCCTTCTG 3’ 7 5’ AATCCGCATCATGAACAGTG 3’ 8 5’ TCATCATCCATTTTATCCACCA 3’

2.9 miRNA analysis

2.9.1 Detection of miRNAs using the Taqman Small RNA Assay Kit For detection and quantitative analysis of miRNA in Hoxb8 immortalised progenitor cell in the presence and absence of Hoxb8, total RNA from 5x106 Hoxb8 immortalised progenitor cells was extracted using Trizol (Sigma-Aldrich). Briefly, cells were resuspended in 1mL of Trizol (Sigma-Aldrich) and 200µl chloroform added. Samples were shaken for 15 seconds and left at room temperature for two to three minutes. Samples were spun at 4ºC for five minutes at 12,000rpm before upper aqueous phase transferred to new tube. 500µl of isopropanol was added and gently mixed. Samples were spun at ten minutes for 13,000rpm, then washed in 75% Ethanol for ten minutes at 13,000rpm. Pellet was left to dry at room temperature for ten minutes before resuspended in 50µl of RNAse free water.

10ng of RNA was reverse transcribed as per manufacturers instructions using a Taqman miRNA Reverse Transcription (RT) Kit (Applied Biosystems). RT specific primers from the Taqman Small RNA assay kit (Applied Biosystems) were used to detect age- miR-17-3p (000392), age-miR-17-5p (000393), hsa-miR-16-5p (000391), hsa-miR-20a- 5p (000580), hsa-miR-19b-3p (000396), hsa-miR-92a-3p (000431), age-miR-18 (000394), hsa-miR-19a-3p (000395) and U6 snRNA(001973) as per manufacturers instructions. RT reaction was carried out with the following parameters: 16ºC for 30 minutes, 42ºC for 30 minutes and 85ºC for 5 minutes. 1.33µl of the RT reaction was used in the qPCR reaction together with 1µl of the Taqman Small RNA assay, 10µl of 2x Taqman Universal PCR Mastermix (II) no UNG (Applied Biosystems) and nuclease free dH20 for a final reaction volume of 20µl, as per manufacturers instructions. qPCR was performed using the Viia7 Real-Time PCR system (Applied Biosystems) using the following parameters: 95ºC for ten minutes and 40 cycles of 95ºC for 15 seconds and 60ºC for 60 seconds. Ct values were extracted using the Viaa7 software (Applied Biosystems) and expression profiles analysed using the comparative Ct (ΔΔCT) method.

2.9.2 Detection of miRNAs using the Taqman miRNA qPCR array To analyse the expression of 741 rodent miRNAs in Hoxb8 immortalised progenitor cells at any one time, I utilised the Taqman miRNA qPCR array, which contained an individual miRNA primer set per well across two 384 well plates. To prepare cells for this assay, wild type Hoxb8 immortalised progenitor cells maintained in IL-3 were cultured in the absence of 4-OHT to remove Hoxb8 expression (Figure 2.1). After four days of 4-OHT withdrawal, RNA was extracted using Trizol and 300ng of RNA reverse transcribed using TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems) and Megaplex RT Primers, Rodent Pool A & Pool B v3.0 (Applied Biosystems). Amplified product was then loaded onto Taqman Array Rodent v3.0 miRNA (A+B) cards (Applied Biosystems) and PCR performed on the 7900-HT real-time PCR system (Applied Biosystems). The array card contains Taqman probes for 641 unique mouse miRNAs. Plate A could detect miRNAs found more frequently and expressed at higher levels in the mouse or rat while Plate B was loaded with primers to detect miRNAs that were functionally less defined and expressed at lower levels. Plates were subjected to a RT-PCR reaction and Ct values extracted. Ct values were extracted for each miRNA using RQ Manager software (Applied Biosystems). All rat miRNAs were excluded from analysis. miRNA data was expressed as ∆CT relative to U6snRNA then normalised between samples based on global miRNA expression of the 50% highest expressing miRNAs. miRNAs with primary expression of Ct<35 and differential miRNA expression of greater than 1.5 fold with P values ≤0.05 (Student T test, 2 tailed, independent) were considered to be significant. Fold change is the ∆∆Ct of the difference in the average normalised ∆Ct across three biological samples for both +4- OHT and -4-OHT.

Figure 2.2: Flow diagram of sample preparation and running of Taqman® MicroRNA array Cards Wild type Hoxb8 immortalised progenitor cells were cultured in IL-3 and in the presence or four-day absence of 4-OHT. RNA was extracted from cells and miRNAs reverse transcribed using the Megaplex RT Primer mix. cDNA were pre-amplified using the Megaplex pre-Amp Primers before loaded across two 384 well plates, Plate A and Plate B. miRNAs were amplified during the RT-PCR reaction and Ct values extracted and analysed.

2.9.3 Using the TargetScan software to detect predicted miRNA binding sites TargetScan is a software that predicts the biological binding sites of miRNAs to their mRNA targets. Prediction is based on complementarity of the 7-mer or 8-mer ‘seed’ region of the miRNA, the 3’ pairing of the miRNA, seed-pairing stability and target-site abundance (Friedman et al., 2009; Garcia et al., 2011; Grimson et al., 2007; Lewis et al., 2005). These parameters were also used to determine the probability of conserved targeting. miRNAs considered ‘broadly conserved’ were conserved across all vertebrates up to Danio rerio (Friedman et al., 2009). Only miRNAs that exhibited a broad conservation in targeting the Bim 3’UTR were considered.

3.0 Development and characterisation of the inducible Hoxb8, immortalised progenitor cell line

3.1 Establishment of an immortalised progenitor cell line dependent on inducible expression of Hoxb8 It has been well characterised that the over-expression of Hoxb8 in a population of haematopoietic progenitor cells can prevent normal cell maturation and promote enhanced proliferative capacity when combined with an endogenously activated or exogenously provided IL-3 signal (Perkins et al., 1990; Perkins and Cory, 1993). The molecular mechanisms by which elevated levels of Hoxb8 can promote self-renewal and block differentiation are largely unknown. To investigate how Hoxb8 contributes to the immortalisation of myeloid progenitor cells capable of developing into an aggressive myelomonocytic leukaemia, I generated IL-3 dependent cell lines in which Hoxb8 was conditionally expressed. In this way, cell survival, proliferation and differentiation could be examined in the same cells in conditions of elevated Hoxb8 expression, and conditions in which Hoxb8 was no longer expressed.

3.1.1 Description of the bicistronic, 4-OHT inducible lentiviral vector To establish cell lines with inducible Hoxb8 over-expression, the Mus musculus cDNA of Hoxb8 (NM_010461), was cloned into a lentiviral expression system that utilises the estrogen analogue, 4-hydroxy tamoxifen (4-OHT) to induce Hoxb8 expression (Figure 3.1A). This bicistronic, lentiviral vector, constitutively expresses a ‘GEV16’ fusion protein under the control of an SV40 promoter. This fusion protein consists of the Gal4 transcription factor fused to an estrogen receptor (ERT2) and the transcriptional enhancer VP16. The Gal4 transcription factor, derived from yeast, recognises the UAS promoter, which exhibits low basal promoter activity but strong inducible activity in the presence of the GEV16 fusion protein (Baselmann et al., 1993). Modification of the estrogen receptor enhanced receptor affinity to 4-OHT (Webster et al., 1988). The transactivation domain of the herpes virus protein, VP16, broadens the cell types, which can respond to 4-OHT induction as well as increases estrogen receptor induced gene expression by five fold (Baselmann et al., 1993). Hoxb8 is expressed under the control of 5 tandemly repeated UAS promoter sequences.

Figure 3.1: The 4-OHT inducible, Hoxb8 lentiviral vector (A) Linear schematic of the 4-OHT inducible lentiviral vector. Arrows indicate direction of transcription and are colour-coded to match their labels. Unique restriction enzyme sites appear in grey font above the schematic. Plasmid was generated using the plasmid editing software, ApE v1.18 (M.Wayne Davis). (B) Diagram describing the mechanism of action of the 4-OHT inducible system. Box on the left (-4-OHT), represents conditions of Hoxb8 repression. After lentiviral infection and integration of the lentiviral DNA into the host genome, the SV40 promoter transcribes the fusion protein, GEV16. Once translated, GEV16 is held in the cytoplasm bound to the cytoplasmic, chaperone protein, HSP90, via the estrogen receptor. Box on the right (+4-OHT), represents conditions of Hoxb8 expression. The addition of 4-OHT outcompetes HSP90 for binding to the estrogen receptor, allowing the GEV16 protein to translocate into the nucleus where the Gal4 transcription factor, can bind to the Gal4 UAS promoter upstream of Hoxb8 to induce transcription.

In conditions where 4-OHT is absent and Hoxb8 is repressed, the GEV16 fusion protein is sequestered in the cytoplasm bound to HeatShock Protein 90 (HSP90) (Figure 3.1B). When 4-OHT is added, it displaces HSP90, by virtue of greater ERT2 affinity. This permits GEV16 to translocate to the nucleus and drive the UAS promoter, inducing Hoxb8 expression (Figure 3.1B)

3.1.2 Description of the bicistronic, Doxycycline repressible, lentiviral vector I also utilised a biscistronic, lentiviral system in which Hoxb8 expression is repressed by the addition of Doxycycline to cell cultures (Figure 3.2A) (Lluis et al., 2010). A PGK promoter constitutively drives expression of a fusion protein of the hygromycin resistance gene, the Tet Responsive Element and the VP16 transcriptional activator. The Tet Responsive Element can bind to the Tet Operon (Tet-Op) promoter region and direct transcription of Hoxb8 (Figure 3.2B). To repress Hoxb8 expression, addition of Doxycycline sequesters the fusion protein by binding to the Tet Responsive Element and preventing any transcription mediated by the Tet Op promoter (Figure 3.2B).

3.1.3 Lentiviral infection of Murine E14 fetal liver multi-potential progenitor cells The fetal liver is the major site of embryonic haematopoiesis from days 12 to 15 post coitus (pc) and contains a higher proportion of long-term repopulating multi-potential progenitors than the bone marrow, in particular at E14 (Morrison et al., 1995). I isolated c-kit positive, lineage negative (c-kit+ve/lin-ve) progenitor cells from E14.5 fetal liver by sorting cells using fluorescence activated cells sorting (FACS) and excluding cells stained positive for mature lineage surface antigens, NK1.1, TER-119, B220 and Gr-1, markers found on Natural Killer Cells, Erythrocytes, B cells and Granulocytic cells respectively (Figure 3.3A). Sorted cells were cultured in 0.25ng/ml of IL-3 and 0.5ng/ml of SCF overnight and then infected with Hoxb8 expressing lentivirus (as described in Section 2.4 and depicted in Figure 3.3B). Cells expressing Hoxb8 driven by the addition of 4-OHT were cultured in the presence of 0.25ng/ml of IL-3 and 0.1µM of 4-OHT whereas cells in which Hoxb8 was regulated by Doxycycline were cultured in 0.25ng/ml of IL-3 alone. Cell lines were cultured either in the presence of 0.5µg/ml puromycin or 0.3mg/ml hygromycin for ten days to select for infected cells. Hoxb8

Figure 3.2: The Doxycycline repressible Hoxb8, lentiviral vector (A) Linear schematic of the Doxycycline repressible lentiviral vector. Arrows indicate direction of transcription and are colour-coded to match their labels. Unique restriction enzyme sites appear in grey font above the schematic. Plasmid was generated using the plasmid editing software, ApE v1.18 (M.Wayne Davis). (B) Diagram describing the mechanism of action of the doxycycline repressible system. Box on the left, (-Doxycycline), indicates conditions of Hoxb8 expression. Integration of lentiviral DNA into host after infection results in the constitutive transcription of the Hygromycin resistance gene/TetR/VP16 fusion protein by the PGK promoter. In the absence of Doxycycline, the fusion protein can re-enter the nucleus where the Tet responsive element (TetR) can bind to the 7xTetOp sequences and induce Hoxb8 expression. Box on the right, (+Doxycycline), indicates conditions of Hoxb8 repression. Once added to cells, Doxycycline binds to the fusion protein and prevents it from translocating to the nucleus, resulting in no additional Hoxb8 expression.

Figure 3.3: Infection protocol for the creation of conditional Hoxb8 immortalised progenitor cell lines (A) Representative FACS dot plot of fetal liver cells sorted for c-kit+ve, lin-ve expression. Cells enclosed in box labelled ‘c-kit’ represent the population of cells retained for lentiviral infection. Cells excluded from the sorted population are those found outside of the box positive for lineage markers, B220, NK1.1, TER-119 and Gr-1. (B) Flow diagram of the protocol used to create conditionally expressing Hoxb8 cell lines. The fetal liver of E14.5 embryos, indicated within the red circle, was prepared into a single cell suspension and enriched for c-kit+ve/lin-ve progenitor cells. Sorted cells were kept in 0.5ng/ml SCF and 0.25ng/ml IL-3 overnight before infection with conditional Hoxb8 lentivirus. If cells were infected with the 4-OHT inducible Hoxb8 lentivirus, 24 hours after infection, cells were placed in media with 0.25ng/ml IL-3, 0.5µg/ml puromycin and 0.1µM 4-OHT to induce expression of Hoxb8. Cells infected with the doxycycline repressible Hoxb8 lentivirus were cultured in 0.25ng/ml IL-3 and 0.3mg/ml hygromycin. After ten days in selection, 4-OHT inducible cells were continuously cultured in 0.25ng/ml IL-3 and 0.1µM 4-OHT and Doxycycline inducible cells in 0.25ng/ml IL-3. (C) Representative histograms of c-kit+ve, lin-ve progenitor cells infected (+) or not (-) with the 4- OHT inducible lentivirus. Cells were fixed and stained with anti-Hoxb8 antibody before counterstained with anti-IgG conjugated to PE.

expression could be detected in this final cell population, as observed in 4-OHT inducible, Hoxb8 immortalised progenitor cells after puromycin selection (Figure 3.3C).

3.1.4 Immortalisation of c-kit+ve/lin-ve progenitor cells is dependent on over- expressed Hoxb8 and exogenously supplied IL-3 As described previously, the over-expression of Hoxb8 in the presence of IL-3 is essential in obtaining an immortalised cell line (Perkins and Cory, 1993). To ensure that the cell lines established from lentiviral infection were dependent on the over- expression of Hoxb8, c-kit+ve/lin-ve progenitor cells were infected with the 4-OHT- inducible Hoxb8 lentivirus, or a GFP control and tested for Hoxb8 dependence by assessing colony formation. Cells were allowed to grow for 14 days before colonies counted. GFP infected cells were cultured in the presence of 4-OHT, while Hoxb8 infected cells were cultured in either the presence or absence of 4-OHT. No colonies were detected after 14 days in culture from cells over-expressing GFP (Figure 3.4). It was possible to repeatedly achieve robust colony formation from cells infected with the inducible Hoxb8 lentivirus and cultured in 4-OHT, indicating that colony formation was dependent on Hoxb8 over-expression (Figure 3.4). Around two percent of colonies arose from c-kit+ve/lin-ve cells infected with the inducible Hoxb8 lentivirus but cultured in the absence of 4-OHT suggesting some background expression of Hoxb8.

To determine whether the established Hoxb8 immortalised progenitor cell lines were dependent on IL-3 for survival and continued clonogenic proliferation, IL-3 was removed from culture conditions and cell survival analysed by AnnexinV (AnV) and propidium iodide (PI) staining (Figure 3.5A). The withdrawal of IL-3 for as little as 48 hours resulted in the death of almost all Hoxb8 immortalised progenitor cells. I also infected Hoxb8 immortalised progenitor cells with the retrovirus, MPZEN IL-3, which induced constitutive expression of the IL-3 ligand (Figure 3.5B). These cells were clonogenically viable when cultured in the absence of recombinant IL-3, indicating that endogenous production of IL-3 could substitute for exogenous IL-3 in the culture media. This further emphasised the absolute requirement for IL-3 in the culture media for survival and clonogenic renewal of Hoxb8 immortalised progenitor cells.

Figure 3.4: Hoxb8 immortalised progenitor cells are clonogenically viable only in the presence of over-expressed Hoxb8 C-kit+ve/lin-ve sorted progenitor cells were infected with the 4-OHT inducible lentivirus containing Hoxb8 or GFP. Cells infected with Hoxb8 lentivirus were cultured either in the presence (+) or absence (-) of 4-OHT, while cells infected with GFP lentivirus were cultured only in the presence (+) of 4-OHT. Successfully infected cells were selected with puromycin for 3 days before PI negative cells were single cell sorted into 96 well plates. Single cells that had formed a colony, represented by a cluster of cells in each well, were counted after 14 days. Results represent mean ±SEM of four independent infections in four individual pools of c-kit+ve/lin-ve cells.

Figure 3.5: Hoxb8 immortalised progenitor cells require IL-3 for survival and proliferation (A) Hoxb8 immortalised progenitor cells were cultured in the presence of 4-OHT but absence of IL-3. At the indicated time-points after IL-3 withdrawal, viability was assessed by PI and FITC-conjugated AnnexinV staining. Results indicate means ±SEM of five independent clones in two independent experiments. (B) Hoxb8 immortalised progenitor cells maintained in recombinant IL-3 (rIL-3) were assessed for clonogenic potential when placed in soft agar in the presence of 4-OHT and either in the presence (+) or absence (-) of rIL-3. Progenitor cells already immortalised by Hoxb8 in the presence of rIL-3, were infected with the retrovirus, MPZEN IL-3. After establishment of rIL-3 independent Hoxb8 immortalised progenitor cell lines, cells were placed in soft agar in the presence of 4-OHT and either in the presence or absence of rIL-3. 14 days after initial plating, colonies were counted and determined as the number arising for every 1000 cells plated. Results are mean ±SEM of four independent clones each for Hoxb8 immortalised progenitor cells infected with and without MPZEN IL-3.

Previous reports have suggested that culturing fetal liver or bone marrow derived progenitor cells in a cytokine cocktail of SCF, IL-3 and IL-6 during immortalisation, facilitates and enhances the efficient growth of progenitor cells ex vivo (Haylock et al., 1992). To determine whether the cytokine cocktail of SCF, IL-3 and IL-6 could increase the efficiency of Hoxb8 mediated immortalisation, an equal number of c-kit+ve/lin-ve progenitors were infected with equal titre of 4-OHT-inducible, Hoxb8 lentivirus in the presence of either 50ng/ml SCF, 25ng/ml IL-3 and 25ng/ml IL-6 or 0.25ng/ml IL-3 and 0.5ng/ml SCF. Cells were kept in these cytokine conditions during and after lentiviral infection. 48 hours after lentiviral infection, cells were placed into semi-solid agar with the same cytokines used during infection and the ability to form a colony determined. Overall, the efficiency of Hoxb8 immortalisation of progenitor cells was very low, with one to seven in 10,000 progenitor cells able to form a colony after infection with the 4- OHT-inducible Hoxb8 lentivirus (Figure 3.6A). This result may indicate a much lower Hoxb8 mediated immortalisation efficiency than expected due to the stresses involved during soft agar colony formation. While overall clonogenic efficiency was low, higher concentrations of IL-3, IL-6 and SCF did not enhance clonogenic efficiency. These colonies were picked from soft agar and could grow indefinitely in liquid culture, an indication of successful immortalisation. Low viral titre was excluded as a cause of low infection efficiency as testing on the FDC-P1 cell line, another IL-3 dependent myeloid progenitor cell line, resulted in a lentiviral infection efficiency of between 40 and 50 percent when virus was added to cells at a 1:2 dilution. (Figure 3.6B). These results indicate that while the number of c-kit+ve/lin-ve progenitor cells immortalised by Hoxb8 is low, the exclusion of IL-6 as well as the use of a 100 fold lower concentration of SCF and IL-3 has no detrimental effect on the overall number of c-kit+ve/lin-ve progenitor cells immortalised by Hoxb8.

Bone marrow progenitor cells immortalised by Hoxb8 have been previously shown to survive in culture in the presence of either SCF or GM-CSF and without the requirement of IL-3 (Wang et al., 2006). To determine whether it was possible to substitute other cytokines for IL-3 and still maintain clonogenic potential post immortalisation, Hoxb8 immortalised progenitor cells were cultured in soft agar medium supplemented with 0.25ng/ml IL-3, 0.5ng/ml SCF or 2ng/ml GM-CSF. No colony formation was observed when cells were cultured in agar with SCF and very few colonies formed when Hoxb8 immortalised progenitor cells were cultured in GM-CSF

Figure 3.6: Immortalisation of c-kit+ve/lin-ve progenitor cells by Hoxb8 occurs at the same efficiency in high and low concentrations of cytokine (A) c-kit+ve/lin-ve progenitor cells derived from the same E14.5 fetal liver were infected with the 4-OHT inducible, Hoxb8 lentivirus in the presence of either 0.25ng/ml IL-3 and 0.5ng/ml SCF or 25ng/ml IL-3, 25ng/ml IL-6 and 50ng/ml SCF. 48 hours after infection, cells were placed into soft agar with puromycin and colonies were counted 14 days later. Results are means ±SEM of three independent infections in three independent pools. (B) FDC-P1 cell lines were infected with the 4-OHT inducible, Hoxb8 lentivirus at differing viral titrations. 48 hours after infection, puromycin was added to cultures and viability analysed by PI and FITC-conjugated, AnV staining, 48 hours after puromycin addition. A 1:2 lentiviral titration shown here corresponds to the lentiviral titre used for infections completed in (A). Result shown is a representative of a single lentiviral infection.

Figure 3.7: SCF and GM-CSF cannot substitute for IL-3 to promote clonal viability of Hoxb8 immortalised progenitor cells Hoxb8 immortalised progenitor cells were washed to remove IL-3 from culture and then replated in soft agar in the presence of 4-OHT and 0.25ng/ml IL-3, 0.5ng/ml SCF or 2ng/ml GM-CSF. After 14 days in soft agar, colonies were counted and represented as the number of colonies formed/1000 cells plated. Results are means ±SEM of three independent clones tested in two independent experiments.

alone compared to cells cultured in IL-3 (Figure 3.7). Once cells were immortalised with Hoxb8, 40 percent of cells plated in soft agar formed colonies in the presence of IL-3. This indicates that both SCF and GM-CSF could not substitute for IL-3 to promote colony formation of Hoxb8 immortalised progenitors immortalised in IL-3. Once fetal liver derived progenitor cells have been immortalised by Hoxb8 in the presence of solely IL-3, their growth and proliferation is absolutely dependent on IL-3 in culture.

3.1.5 Hoxb8 and IL-3 immortalise cells that exhibit a myeloid phenotype. The starting population of progenitor cells before Hoxb8 infection exhibited a c- kit+ve/lin-ve phenotype. To determine whether the over-expression of Hoxb8 resulted in a change in the expression of surface antigens, Hoxb8 immortalised progenitor cells were stained with antibodies to detect antigens from several different haematopoietic lineages. The over-expression of Hoxb8 and consequent immortalisation resulted in a complete down-regulation of the progenitor cell marker, c-kit (Figure 3.8). Sca-1, an antigen also used to distinguish early haematopoietic progenitor cells was not expressed. An almost exclusive macrophage/monocytic surface marker profile was observed on Hoxb8 immortalised progenitor cells with all cells expressing CD11b, an antigen commonly found on monocytes and differentiated macrophages. Almost all cells also expressed F4/80, a surface proteoglycan present on mature macrophages. This indicated that c-kit+ve/lin-ve progenitor cells immortalised with over-expressed Hoxb8 exhibited a myeloid phenotype and had lost their early haematopoietic progenitor cell identity. Fifteen percent of cells expressed the granulocytic cell marker, Gr-1, while less than five percent of cells expressed NK1.1 and TER-119, markers that distinguish Natural Killer cells and cells of the erythroid lineage. 25 percent of cells also expressed the B cell marker, B220. This expression profile is similar to clones derived from the original WEHI-3B cell line, as well as cell lines originating from the bone marrow of mice transplanted with bone marrow cells retrovirally over-expressing Hoxb8 and IL-3 (Perkins et al., 1990; Perkins and Cory, 1993).

Figure 3.8: c-kit+ve/lin-ve progenitor cells exhibit a myeloid phenotype after immortalisation with the 4-OHT inducible Hoxb8 lentivirus. Representative dot plots of surface antigen staining on Hoxb8 immortalised progenitor cells. Cells cultured in the presence of IL-3 and 4-OHT were stained with fluorochrome conjugated antibodies including c-kit-APC, Sca-1-PE, CD11b-PE, F480-PE, Gr-1-FITC, NK1.1-FITC, B220-APC and TER-119-FITC. Once stained, cells were analysed by flow cytometry. Dot plots were prepared using the Weasel FACs analysis software.

3.2 The survival and proliferation of Hoxb8 immortalised progenitor cells upon Hoxb8 withdrawal Bone marrow progenitor cells over-expressing Hoxb8 fully repopulate the haematopoietic compartment of lethally irradiated mice and are capable of differentiating into all haematopoietic lineages (Perkins and Cory, 1993). However, bone marrow and spleen progenitor cells from these mice have an almost 1000 fold increase in in vitro colony forming cell (CFC) potential than that of cells isolated from control mice, indicating that Hoxb8 drives an increase in progenitor cell number, specifically, the self renewal of myeloid progenitor cells (Perkins and Cory, 1993). To determine the requirement for Hoxb8 expression in maintaining the self-renewal capacity of myeloid progenitor cells, 4-OHT was removed from Hoxb8 immortalised progenitor cells and differentiation, survival and proliferation analysed.

3.2.1 Hoxb8 levels are tightly controlled by the 4-OHT inducible and Doxycycline repressible lentiviral systems To be certain that the removal of 4-OHT from culture conditions resulted in the withdrawal of Hoxb8 expression, Hoxb8 protein levels were observed zero, two, four and six days after 4-OHT was removed from cultures. Hoxb8 protein was detected both by Western blot as well as using flow cytometric analysis, where cells permeabilised by saponin (see Chapter 2.7.2) were stained with a primary Hoxb8 antibody and counterstained with a fluorochrome conjugated secondary antibody for detection of Hoxb8 protein in its natural folded state (Figure 3.9). A decrease in Hoxb8 protein levels was observed after just two days of 4-OHT withdrawal, and was undetectable after four days of culture in the absence of 4-OHT (Figure 3.9A and B). Hoxb8 expression could be reinstated in these same cells after just two days of 4-OHT re-addition into culture, with expression increasing steadily until day six. The intracellular staining of permeabilised cells at six days after 4-OHT re-addition, uncovered a small proportion of cells that had not yet re-expressed Hoxb8 (Figure 3.9B). These results indicate that the 4-OHT inducible system can tightly control Hoxb8 expression, with levels undetectable by 4 days after the removal of 4-OHT. The re-addition of 4-OHT can successfully re-induce Hoxb8 in almost all cells to levels observed before initial 4-OHT withdrawal.

Figure 3.9: Hoxb8 can be tightly controlled in 4-OHT-inducible, Hoxb8 immortalised progenitor cells (A) Representative Western Blot of Hoxb8 expression after 4-OHT withdrawal and re- addition in Hoxb8 immortalised progenitor cells. Cells were cultured in the presence of IL-3 but absence of 4-OHT, with samples taken at zero, two, four and six days after 4- OHT withdrawal. Four days after withdrawal, 4-OHT was re-added to a proportion of cells, and timepoints taken at two, four and six days after 4-OHT re-addition. Membranes were probed with antibodies towards Hoxb8 and beta-actin as a loading control. (B) Representative histograms of Hoxb8 expression in Hoxb8 immortalised progenitor cells as measured by intracellular Hoxb8 staining. Cells were cultured as described in (A). At each timepoint, cells were permeabilised using Saponin, stained with an anti-mouse Hoxb8 antibody then counter-stained with a PE-conjugated anti- mouse IgG antibody. Cells were analysed for PE staining by flow cytometric analysis.

Figure 3.10: Hoxb8 can be tightly regulated in progenitor cells immortalised with doxycycline repressible Hoxb8 Representative Western Blot of Doxycyline repressible, Hoxb8 immortalised progenitor cells. Cells were cultured in the presence of IL-3 and 0.5µg/ml Doxycycline. Timepoints were taken at zero, two, four and six days after Doxycycline addition with Doxycycline readded at day four. Membrane was probed with antibodies towards Hoxb8 and beta actin as a loading control. Arrow represents correct Hoxb8 band.

Hoxb8 expression was also tightly controlled by the Doxycycline repressible lentiviral system. The addition of 0.5µg/ml of Doxycycline to the culture media for just two days was able to suppress Hoxb8 protein expression to almost undetectable levels (Figure 3.10). Hoxb8 protein levels remained undetectable up to day six after Doxycycline addition, noting that Doxycycline was re-added to cultures at day four to maintain repression.

For consistency, the 4-OHT inducible system was used for all experiments examining cell differentiation, survival and proliferation after Hoxb8 withdrawal.

3.2.2 Hoxb8 immortalised progenitor cells exhibit myeloid differentiation upon 4- OHT withdrawal Hoxb8 has previously been shown to immortalise bone marrow derived cell lines capable of differentiation into granulocytes and macrophages after Hoxb8 withdrawal (Rosas et al., 2011; Wang et al., 2006). To examine whether the removal of Hoxb8 expression could induce myeloid differentiation in our IL-3 dependent, Hoxb8 immortalised progenitor cell lines, we examined cell phenotype pre and post 4-OHT withdrawal by May-Grunwald and Giemsa staining as well as analysis of surface antigen expression. Hoxb8 immortalised progenitor cells were cultured in the presence or six-day absence of 4-OHT before analysis. Hoxb8 immortalised progenitor cells over-expressing Hoxb8 exhibited morphological characteristics similar to myeloblasts and monoblasts, with cells boasting a large nucleus and small cytoplasmic volume (Figure 3.11). After a 6-day withdrawal of 4-OHT, cells were morphologically larger many with kidney shaped nuclei and enlarged cytoplasmic volume, characteristic of more differentiated monocytes. A number of cells also had lobulated nuclei (Figure 3.11). Few, if any cells were observed to adhere to the cell culture dish, commonly found with macrophages.

As previously noted in Section 3.1.5, the over-expression of Hoxb8 in c-kit+ve/lin-ve fetal liver progenitors induced the expression of myeloid lineage markers CD11b and F4/80. The surface antigen expression profile of Hoxb8 immortalised progenitor cells did not alter significantly after Hoxb8 withdrawal. The number of cells expressing CD11b did

Figure 3.11: Hoxb8 immortalised progenitor cells undergo morphological differentiation after 4-OHT withdrawal Representative May-Grunwald and Giesma staining of Hoxb8 immortalised progenitor cells cultured in the presence (+) and six-day absence (-) of 4-OHT. Cells were cultured in IL-3 alone or either in the presence of IL-3 and GM-CSF.

Figure 3.12: Hoxb8 immortalised progenitor cells exhibit a slight change in surface marker expression after 4-OHT withdrawal (A) Surface antigen expression profile of Hoxb8 immortalised progenitor cells cultured either in the presence of 4-OHT and IL-3 or the absence of 4-OHT in either the presence of IL-3 or IL-3 and GM-CSF. Cells were stained with fluorochrome-conjugated antibodies, c-kit-APC, Sca-1-PE, CD11b-PE, F480-PE, Gr-1-FITC, NK1.1-FITC, B220-APC and TER-119-FITC before flow cytometric analysis. Results are means ±SEM of four independent clones in three independent experiments. (B) Representative histograms of Hoxb8 immortalised progenitor cells cultured in either the presence (+) or six-day absence (-) of 4-OHT and stained with conjugated antibodies as described in (A). Red peaks indicate unstained populations, solid black peaks indicate cells cultured in IL-3, while peaks defined with a broken line indicate cells cultured in IL-3 and GM-CSF. The shift in fluorescent peaks in CD11b and F4/80 stained cell populations is shown as a solid line connecting two broken lines, running through the mean of the unstained and stained peaks respectively. The changes in fluorescence for the CD11b and F4/80 histogram, + and – 4-OHT are quantitated below their respective histograms.

not change while a slight increase was observed in the expression of F4/80 after 4-OHT withdrawal (Figure 3.12A). No significant change in surface marker expression of either c-kit, Sca-1, Gr-1, NK1.1, B220 or TER-119 was detected. While the number of cells expressing both CD11b and F4/80 did not increase after 4-OHT withdrawal, the intensity of antigen peaks detected, did in some instances, increase. This is indicated by the increase in fluorescence intensity between histogram of unstained and stained cell populations. (Figure 3.12B). These results suggest that the removal of Hoxb8 expression from IL-3 dependent, Hoxb8 immortalised progenitor cells was initiating myeloid differentiation, with a clear change in cell morphology and increased surface antigen expression of myeloid specific antigens.

Given that Hoxb8 immortalised progenitor cells show some evidence of myeloid differentiation, it is possible that this differentiation could be enhanced by the addition of GM-CSF. GM-CSF is a cytokine that directs myeloid differentiation and is a growth factor that promotes the survival and differentiation of fully functioning macrophages in vitro (Metcalf and Burgess, 1982; Nicola, 1989). To determine whether IL-3 dependent, Hoxb8 immortalised, progenitor cells required another cytokine, together with IL-3 to enhance differentiation after 4-OHT withdrawal, Hoxb8 immortalised progenitor cells were cultured in the presence and absence of 4-OHT in media containing both IL-3 and GM-CSF. The presence of GM-CSF when Hoxb8 was over-expressed had no effect on the morphology of these myeloid progenitors (Figure 3.11). Hoxb8 withdrawal in the presence of IL-3 and GM-CSF resulted in differentiation, with cells exhibiting a larger cytoplasmic volume than in the absence of GM-CSF. The presence of GM-CSF did not change the expression profile of surface antigens on Hoxb8 immortalised progenitor cells in the presence or absence of Hoxb8 (Figure 3.12A and B). Overall, the addition of GM-CSF to culture conditions together with IL-3 in the absence of Hoxb8 resulted in the appearance of larger and more mature cells, which could only be detected by observing morphological changes by May-Grunwald and Giemsa staining.

3.2.3 Hoxb8 immortalised progenitor cells exit the cell cycle and undergo apoptosis after 4-OHT withdrawal Myeloid cell differentiation after 4-OHT withdrawal was also accompanied by a decrease in the number of cells in culture. Hoxb8 immortalised progenitor cells were cultured in IL-3 in the presence or absence of 4-OHT for a period of 18 days and cells counted every three days. Cells continuously cultured in IL-3 and 4-OHT to induce Hoxb8 expression grew exponentially (Figure 3.13). Between days six and nine, the increase in cell numbers slowed as cultures approached maximum density and required splitting. Cells cultured in the absence of 4-OHT, but continued presence of IL-3, followed a similar growth pattern to cells cultured in 4-OHT for the first six days, but thereafter cell numbers declined until day 12. By day 18, approximately 5000 cells remained in culture; ten fold less than the starting population. The re-addition of 4-OHT to cells cultured without for three days could prevent the further decrease in cell number and re-established proliferation after six days of Hoxb8 re-expression (Figure 3.13).

The loss of proliferation in the absence of Hoxb8 suggested that cells may be exiting the cell cycle. To determine if this was true, we used hypotonic staining to measure the DNA content of Hoxb8 immortalised progenitor cells in the presence or absence of Hoxb8. Cells were placed in similar conditions as described in Figure 3.13 and stained with hypotonic-Propidium Iodide (hypo-PI) solution. A decrease in the number of cells transitioning between 2n and 4n after just three days of 4-OHT withdrawal reflected a decrease in the number of cells cycling through S phase (Figure 3.14A). Concurrently, the increased proportion of cells with 2n DNA content indicated that cells were accumulating in G1 (Figure 3.14B). By day nine, almost all cells had arrested in G1 phase. The re-entry of cells into cell cycle as soon as three days after 4-OHT re-addition was represented by the increase in cells in S phase and a decrease of cells in G1 (Figures 3.14A and B). These results indicate that Hoxb8 expression was required to maintain cell cycle progression, even if IL-3 was continuously present in culture conditions.

The withdrawal of 4-OHT also resulted in an increase in the appearance of dead cells in the culture dish and was consistent with an increase in the sub-2n population of cells (Figure 3.14C). We quantitated this cell death by staining Hoxb8 immortalised

Figure 3.13: Hoxb8 immortalised myeloid progenitor cells decrease in number after 4-OHT withdrawal Cell counts of Hoxb8 immortalised progenitor cells cultured in the presence of IL-3 and presence or absence of 4-OHT. At Day 0, cells were washed to remove 4-OHT and then replated in IL-3 either in the presence (+) or absence (-) of 4-OHT. 4-OHT was also re-added to a population of cells cultured in the absence of 4-OHT for three days (re-added). At the indicated time points, cell number was determined by flow cytometric counting (see Section 2.5.1). Results are means ±SEM of seven independent clones in three independent experiments.

Figure 3.14: Hoxb8 immortalised progenitor cells undergo cell cycle arrest after 4- OHT withdrawal (A) Cell cycle progression was analysed in Hoxb8 immortalised progenitor cells cultured in the presence of IL-3 but absence (-) of 4-OHT. At day 3, 4-OHT was re-added to a population of cells cultured in the absence of 4-OHT (re-added). At the indicated timepoints (Days), cells were stained with a hypo-PI solution then analysed by flow cytometry. The percentage of cells in S phase was determined using the cell-cycle analysis software ModFit LT™. Results indicate means ±SEM of seven independent clones in three independent experiments. (B) Cells were prepared and stained with hypo-PI solution as described in (A), with the percentage of cells in G1 phase determined using the software, Modfit LT™. Results indicate means ±SEM of seven independent clones in three independent experiments. (C) Representative histograms of the DNA content of Hoxb8 immortalised progenitor cells in the presence (+) or six-day absence (-) of 4-OHT. Red line indicates the sub-2n population of cells and numbers represent the percentage of total cells in sub-2n.

Figure 3.15: Hoxb8 immortalised progenitor cells undergo cell death after 4-OHT withdrawal The cell viability in Hoxb8 immortalised progenitor cells after 4–OHT withdrawal was measured by culturing cells in the presence of IL-3 and either the presence (+), absence (-) or re-addition of 4-OHT to cells that have been cultured in the absence of 4-OHT for three days (re-added). At the indicated timepoints (Days), viable cells were determined by PI and FITC conjugated AnnexinV staining. Results are means ±SEM of seven independent clones in three independent experiments.

progenitor cells with FITC conjugated AnV and PI. Cells continuously cultured in the presence of 4-OHT maintained a basal survival rate of between 80 and 90 percent (Figure 3.15). Decreased viability was first observed between days three and six after 4- OHT withdrawal and viability continued to decline until day nine before stabilising by day 12. It was possible to halt the continued cell death observed after 4-OHT withdrawal by re-adding 4-OHT to the culture medium. The re-addition of 4-OHT to cells that had been cultured in the absence for three days decreased the rate of apoptosis and allowed the remaining viable cells to start proliferating once again (Figure 3.15). Cell viability increased to almost reach the levels observed in cultures in which 4-OHT was continuously maintained. These results indicate that together with cell proliferation, Hoxb8 expression was required to maintain cell viability at optimum levels, even if IL-3 was continuously preserved in culture.

One explanation for the improvement in cell survival and proliferation after re-addition of 4-OHT could be the selection and growth of cells that had become IL-3 independent after 4-OHT deprivation. To exclude this possibility, Hoxb8 immortalised progenitor cells cultured in the presence or 4-day absence of 4-OHT were withdrawn of IL-3 and survival analysed by AnV and PI staining (Figure 3.16A). In the presence or absence of 4-OHT, cells remained absolutely dependent on IL-3 for viability. All cells had undergone apoptosis by 72 hours after removal of IL-3. This indicated that cells had not acquired the ability to survive and proliferate independently of IL-3 after Hoxb8 withdrawal.

Since Hoxb8 immortalised progenitor cells were also undergoing differentiation after 4- OHT withdrawal, the absence of appropriate cytokines to support the survival of more mature myeloid progenitor cells could explain the increased cell death. To determine whether this was the case, 4-OHT was withdrawn from Hoxb8 immortalised progenitor cells and replated in IL-3, IL-3 and M-CSF or IL-3 and GM-CSF. IL-3 was included in all cytokine conditions as Hoxb8 immortalised progenitor cells cultured in the absence of IL-3 undergo rapid cell death. The addition of either M-CSF or GM-CSF to cultures after 4-OHT withdrawal, did not prevent the loss in viability occurring after Hoxb8 withdrawal with overall survival decreasing in all three cytokine conditions (Figure 3.16B). This signified that cells differentiating after 4-OHT withdrawal were

Figure 3.16: Cell death after Hoxb8 withdrawal is mediated by the loss of Hoxb8 and cannot be rescued by the addition of other cytokines (A) Hoxb8 immortalised progenitor cells were cultured with IL-3 in the presence or absence of 4-OHT for 72 hours. IL-3 was then removed from the culture medium and viability determined at the indicated timepoints by PI and FITC-conjugated AnnexinV staining. Results show means ±SEM of five independent clones in two independent experiments. (B) Hoxb8 immortalised progenitor cells were cultured in the absence of 4- OHT and either in the presence of IL-3, IL-3 and M-CSF or IL-3 and GM-CSF. At the indicated timepoints after 4-OHT withdrawal, cell viability was analysed by PI and FITC-conjugated AnV staining. Results show means ±SEM of five independent clones in two independent experiments.

unresponsive to these cytokines and suggested that the decrease in survival after Hoxb8 withdrawal was not a result of a deficiency in cytokine specific survival signals.

It was apparent that the withdrawal of Hoxb8 had a similar impact on cells as the deprivation of IL-3. In both instances, cells exit the cell cycle, arrest in G1 and then activate apoptosis pathways. One principal difference is the rate at which this occurs. In IL-3 deprivation, most cells are dead at 48 hours after cytokine withdrawal. After Hoxb8 downregulation, cells begin to die at day three and gradually continue to lose viability until day nine. One consequence of Hoxb8 withdrawal in immortalised progenitor cells could be the downregulation of the components of the IL-3 receptor. This would, in effect, replicate IL-3 deprivation. To test this possibility, I used both western blotting and immunostaining detected using flow cytometry to determine the expression of components of the IL-3 receptor in the presence or absence of Hoxb8. The mouse IL-3 receptor consists of a unique alpha chain (CD123) and a common β chain (β common of βc), which is shared by the IL-5 and GM-CSF receptor. There is also an IL-3 specific chain, which does not exist in humans. Representative western blots showed only a slight decrease in the levels of the IL-3 receptor alpha chain and no change in expression of the IL-3 receptor beta specific chain (Figure 3.17A). No change in the IL-3 receptor beta common chain in either the presence or absence of Hoxb8 was observed using flow cytometric analysis (Figure 3.17B). These results indicate that loss of Hoxb8 expression does not result in loss of expression of the IL-3 receptor and eliminates the possibility that the self-renewal potential of cells after Hoxb8 withdrawal is compromised by the failure of cells to signal through the IL-3 receptor.

3.3 Hoxb8 withdrawal induces Bax/Bak, caspase-dependent apoptosis I sought to determine if the apoptotic pathways activated by Hoxb8 deprivation were similar to those activated in response to IL-3 deprivation. I first determined whether caspase inhibitors would block apoptosis after Hoxb8 withdrawal. Caspases are the cysteine proteases activated in response to apoptotic stimuli. These proteases are the final common mediator of cell death pathways. They cleave substrates (which may include other caspases), at specific aspartate residues, which is responsible for the morphological and biochemical characteristics of apoptosis. Hoxb8 immortalised

Figure 3.17: All components of the IL-3 receptor remain stably expressed in the presence and absence of Hoxb8 (A) Representative Western Blot of the IL-3 receptor alpha-chain and the IL-3 receptor specific beta chain. Hoxb8 immortalised progenitor cells were cultured in the presence of IL-3 and either in the presence (+) or four-day absence (-) or 4-OHT. Lysates were run on membranes probed with antibodies towards the IL-3 receptor alpha chain and the IL-3 receptor specific beta chain. Beta actin is shown as a loading control. (B) Representative histograms of beta-common chain expression (filled histogram) in Hoxb8 immortalised progenitor cells cultured under the same conditions as in (A). Unfilled histograms indicate cells stained with an isotype control antibody. Numbers inside each panel indicate mean percentage of beta-common positive cells ±SEM of two independent pools in two independent experiments.

progenitor cells were treated with the pan-caspase inhibitor Q-VD-OPh (quinolyl-valyl- O-methylaspartyl-[2,6-difluorophenoxy]-methyl ketone) or QVD. QVD prevents the activation of caspases, by alkylating the active cysteine site of caspases and has been shown to effectively block caspases three, nine, eight and twelve (Caserta et al., 2003). QVD was added to Hoxb8 immortalised progenitor cells at the time of 4-OHT withdrawal and cell survival analysed after six days. QVD treatment was provided as a single dose at the time of 4-OHT withdrawal due to its long half-life. QVD treatment prevented 4-OHT withdrawal-induced cell death with cell viability remaining at similar levels to cells cultured continuously in 4-OHT (Figure 3.18). This shows that apoptosis after Hoxb8 withdrawal is caspase dependent.

IL-3 withdrawal proceeds by apoptosis pathways regulated by the Bcl-2 family of proteins. It absolutely requires two key pro-apoptotic Bcl-2 family members, Bax and Bak. I speculated that Hoxb8 withdrawal induced apoptosis also requires Bax and Bak. To examine this, c-kit+ve/lin-ve progenitor cells derived from Bax-/-;Bak-/- fetal livers were immortalised with the 4-OHT inducible Hoxb8 lentivirus. These cell lines behaved similarly as I had previously observed and were completely resistant to apoptosis after IL-3 withdrawal (Ekert et al., 2006; Jabbour et al., 2010; Jabbour et al., 2009) (Figure 3.19).

Hoxb8 expression in Bax-/-;Bak-/- Hoxb8 immortalised progenitor cells was detectable by Western Blot and could be regulated by 4-OHT. Hoxb8 protein levels decreased to undetectable levels 6 days after 4-OHT was removed from culture conditions. (Figure 3.20A). To determine whether Bax-/-;Bak-/- Hoxb8 immortalised progenitor cells were protected from Hoxb8 withdrawal induced cell death, cells were cultured in the absence of 4-OHT, and viability analysed by PI and FITC-conjugated AnnexinV staining. The withdrawal of 4-OHT from Bax-/-;Bak-/- Hoxb8 immortalised progenitor cells over a period of nine days did not result in any cell death, with viability remaining at levels observed when cells were continuously cultured in 4-OHT (Figure 3.20B). This result clearly demonstrates that the cell death mediated by Hoxb8 withdrawal requires both Bax and Bak, indicating that apoptosis proceeds by an intrinsic cell death pathway regulated by the Bcl-2 family of proteins.

Figure 3.18: Hoxb8 immortalised progenitor cells do not undergo cell death after 4- OHT withdrawal in the presence of the caspase inhibitor, QVD-OPh Hoxb8 immortalised progenitor cells were cultured in IL-3 and either in the presence or six-day absence of 4-OHT and 100µM of the caspase inhibitor Q-VD-OpH. Viability was determined by PI and FITC-conjugated AnV staining. Results are means ±SEM of four independent clones in three independent experiments.

Figure 3.19: Bax-/-;Bak-/- Hoxb8 immortalised progenitor cells do not undergo apoptosis after IL-3 withdrawal Bax-/-;Bak-/-, Hoxb8 immortalised progenitor cells were cultured in the presence of 4-OHT and either the presence or absence of IL-3 for 24, 48 and 72 hours. Cell viability was determined by PI and FITC-conjugated, AnV staining. Results are means ±SEM of six independent clones.

Figure 3.20: Hoxb8 immortalised progenitor cells lacking Bax and Bak do not undergo apoptosis after Hoxb8 withdrawal (A) Representative Western Blot of Hoxb8 expression in Bax-/-;Bak-/-, Hoxb8 immortalised progenitor cells. Cells were cultured in the presence of IL-3 and in the absence of 4-OHT with lysates made at zero, three and six days after 4-OHT withdrawal. Membranes were probed with antibodies towards Hoxb8 and beta actin as a loading control. (B) Bax-/-;Bak-/- Hoxb8 immortalised progenitor cells were cultured in the presence of IL-3 and either in the presence or absence of 4-OHT. At the indicated timepoints after 4-OHT withdrawal, cell viability was determined by PI exclusion and FITC-conjugated, AnnexinV staining. Results are means ±SEM of five independent clones in two independent experiments.

To determine whether Hoxb8 withdrawal induced cell cycle arrest in cells resistant to apoptosis, Bax-/-;Bak-/- Hoxb8 immortalised progenitor cells were stained with a hypo- PI solution over a nine-day period of 4-OHT withdrawal. Over this timecourse Bax-/- ;Bak-/- Hoxb8 immortalised progenitor cells exited the cell cycle and entered into G1 arrest (Figure 3.21). As was the case in wild type progenitor cells, less than five percent of Bax-/-;Bak-/- Hoxb8 immortalised progenitors were still in S phase six days after 4- OHT withdrawal. Almost all cells were arrested in G1. This indicated that while Bax and/or Bak were essential for the cell death that occurred after Hoxb8 withdrawal, the cell cycle exit transpired independently of these apoptosis pathways. Further characterisation of these pathways is described in Chapter Four.

Figure 3.21: Bax-/-;Bak-/-, Hoxb8 immortalised progenitor cells exit the cell cycle after 4-OHT withdrawal DNA content in Bax-/-;Bak-/-, Hoxb8 immortalised progenitor cells was analysed in the presence of IL-3 but absence of 4-OHT. At the indicated timepoints after 4-OHT withdrawal, cells were stained with Hypo-PI solution and analysed by flow cytometry. The left vertical axis corresponds to cells in G1 phase indicated by the black bars, while the right vertical axis corresponds to cells in S phase indicated by the white bars. Results were analysed using the software, Modfit LT™. Results are means ±SEM of five independent clones in two independent experiments.

3.4 Discussion Using an inducible Hoxb8 system, we have created an in vitro model of Hoxb8 mediated immortalisation of myeloid progenitor cells, similar to the WEHI-3B cell line (Perkins and Cory, 1993), in which cells were absolutely dependent on Hoxb8 and IL-3 for survival. In the absence of Hoxb8 but continued presence of growth factor signalling, Hoxb8 immortalised progenitor cells underwent cell cycle arrest, and subsequently succumbed to cell death mediated by the two essential apoptosis inducing proteins, Bax and Bak. This occurred as cells exhibited signs of myeloid differentiation. The re-expression of Hoxb8 allowed a proportion of surviving cells to re-enter cell cycle and proliferate. Thus Hoxb8 has a role in maintaining the responsiveness of these cells to the self-renewal and viability signals transduced by the IL-3 receptor.

3.4.1 The 4-OHT inducible Hoxb8 lentiviral system is a successful model for examining Hoxb8 mediated effects on myeloid progenitor cells In order to examine the role of Hoxb8 in IL-3 dependent myeloid cell immortalisation, it was imperative that the cell line created with the inducible Hoxb8 lentivirus could immortalise cells with similar characteristics to cell lines immortalised with constitutive retroviral Hoxb8 (Perkins and Cory, 1993). Just as important was the requirement for an inducible system with tightly controlled expression of Hoxb8. The system we have used satisfied these requirements. 4-OHT inducible Hoxb8 progenitor cells were morphologically similar to monoblasts and promonocytes and were equally dependent on IL-3 for survival. Hoxb8 expression was tightly regulated and much cleaner than previously used inducible Hoxb8 models in which Hoxb8 was expressed as an estrogen receptor tagged protein (Wang et al., 2006). The leakiness with the 4-OHT inducible system used here is likely due to the spontaneous translocation of the GEV16 fusion from the cytoplasm to the nucleus. However the amount of Hoxb8 expressed when 4- OHT is removed from culture conditions is undetectable by Western blot and indicates a reliable, tightly regulated system of Hoxb8 expression. Also, the selection of clones with tight Hoxb8 regulation allows selection against cells that exhibit high levels of Hoxb8 expression, particularly after 4-OHT withdrawal.

3.4.2 Hoxb8 is required to prevent myeloid differentiation The myeloid differentiation observed after Hoxb8 withdrawal followed the well- established responses observed in other systems, however the effects were much more subtle. The immortalisation of CD117 enriched bone marrow progenitors with Hoxb8 in the presence of GM-CSF or M-CSF, results in the generation of cell lines that differentiate into macrophages retaining functional responses to activating stimuli after Hoxb8 withdrawal (Rosas et al., 2011). If continuously cultured in SCF, Hoxb8 immortalised progenitors differentiate into cells with a neutrophil phenotype after Hoxb8 withdrawal (Wang et al., 2006). This differentiation specific effect of Hoxb8 has been exploited for the rapid and unlimited mass generation of mature macrophages and neutrophils.

Hoxb8 can block differentiation of other cell types and systems. DMSO-induced granulocytic differentiation of the human myeloblastic cell line HL-60 can be prevented by the over-expression of Hoxb8 (Krishnaraju et al., 1997). Hoxb8 over-expression in M1 mouse myeloid leukaemia cell lines can prevent differentiation induced by IL-6, instead promoting the continued self-renewal and leukemic properties of these cells (Blatt et al., 1992). These examples suggest Hoxb8 has a conserved capacity when over- expressed, to immortalise and block the differentiation of several myeloid progenitor cells of various phenotypes. Hoxb8 may be regulating a common differentiation response, which functions in all these models. Differences exist in conditions of Hoxb8 withdrawal with differentiation outcomes, in part, dependent on the cytokine in which cells are cultured.

3.4.3 Hoxb8 is required to prevent cell cycle arrest and cell death independent of signalling through the IL-3 receptor Hoxb8 had a critical role in maintaining the viability of these 4-OHT inducible, IL-3 dependent immortalised cells. Since the increase in cell death after Hoxb8 withdrawal was not due to loss in IL-3 receptor expression, it strongly suggests that Hoxb8 was required to maintain the ability of these cells to respond specifically to IL-3 initiated intracellular signalling. This was also exemplified by the inability of other growth factors to be substituted for IL-3 to promote survival and proliferation. There is

precedent for Hox genes to regulate cell death pathways in various organisms, but this is the first time Hoxb8 has been implicated.

In vertebrates, Hoxb13 plays a role in suppressing growth and promoting apoptosis in caudal regions of the mouse, while Hoxc8 is required to prevent the apoptosis of neurons essential for innervation of muscles in the mouse forepaw (Economides et al., 2003; Tiret et al., 1998). Hoxa13 and d13 have also been implicated in the apoptosis of interdigital webbing with mice lacking these Hox genes retaining this webbing after birth (Fromental-Ramain et al., 1996). While these examples illustrate Hox gene involvement in cell death during embryonic development, no precedence exists for excluding the possibility that this method of regulation can also occur in the haematopoietic system. Apoptosis is essential during haematopoiesis due to the dynamic and ever-changing requirement for different haematopoietic cell types depending on the immune response the body requires. Deletion of several Hox genes in the mouse can result in the accumulation or the diminution of haematopoietic cell numbers. Hoxa9 has already been shown to be important for maintaining normal leukocyte numbers with a reduction in cells, namely lymphocytes, in homozygous deleted mice (Izon et al., 1998; Lawrence et al., 2005). Hoxb8-/- mice have no obvious defects in haematopoiesis (Chen et al., 2010; Greer and Capecchi, 2002), the high expression levels of Hoxb8 in the context of progenitor cell immortalisation may initiate certain pathways that are common to Hox genes in general.

The over-expression of certain Hox genes in specific tumours has been shown to promote oncogenic potential by preventing cell death. HoxA9, which is expressed at elevated levels in human leukaemia characterised with MLL translocations is required for the survival of leukaemic cells harbouring MLL-rearrangements (Krivtsov and Armstrong, 2007). shRNA mediated knockdown of HoxA9 results in the cell cycle arrest and apoptosis of these cells (Ayton and Cleary, 2003; Faber et al., 2009). Glioma tumours including diffuse astrocytoma, anaplastic astrocytoma and glioblastoma multiform, are characterised by elevated levels of several Hox genes including HoxA6, A7, A9, A13, B13, D1, D9, D8 D10, D12 and D14 (Abdel-Fattah et al., 2006; Buccoliero et al., 2009). The expression of HoxD9 is tumour specific and not found in normal brain tissue. The shRNA mediated silencing of HoxD9 in glioma derived cell

lines and tissue samples leads to their decreased proliferation and apoptosis, suggesting that HoxD9 is absolutely required for survival of this tumour (Tabuse et al., 2011).

In the developing D.Melanogaster embryo, Hox gene expression can both suppress and induce cell death, depending on the cell type. During production of post-embryonic neuroblasts, or stem-cell like neuron precursors, on-going proliferation is halted by apoptosis initiated specifically by a pulse of Hox gene expression, namely, Abdominal- A (AbdA) (Bello et al., 2003). In two neuroblast lineages of the developing D.Melanogaster embryo, the two Hox genes, Antennapaedia (Antp) and Ultrabithorax (Ubx), are required to either prevent or activate apoptosis, respectively (Rogulja- Ortmann et al., 2008). In its role in activating apoptosis, Ubx can directly prevent Antp induced cell survival through mechanisms as yet unclear.

Cell death occurring after Hoxb8 withdrawal is Bax and Bak dependent, and signifies that Hoxb8 regulates the activation of intrinsic cell death pathways. Bax and Bak are also required for the cell death occurring after IL-3 withdrawal in these same Hoxb8 immortalised progenitor cells, suggesting a common apoptosis pathway is activated by Hoxb8 and IL-3 deprivation (Ekert et al., 2006; Jabbour et al., 2010; Jabbour et al., 2009). In a leukemic setting, it is plausible that the anti-apoptotic functions of Hoxb8 contribute importantly to immortalisation. The function of Hoxb8 in blocking differentiation and maintaining self-renewal capacity can only contribute to oncogenesis if cells also remain alive. In the next chapter I explore the molecular mechanisms linking Hoxb8 expression with cell viability.

100

4.0 Hoxb8 represses the pro-apoptotic protein, Bim The function of Hoxb8 in maintaining the survival of immortalised myeloid progenitor cells suggested a link between Hoxb8 and the intrinsic cell death pathway. In haematopoietic cells, activators of the intrinsic cell death pathway include the loss of cytokine signalling or exposure to chemotoxic agents or irradiation (Youle and Strasser, 2008). Activation of this pathway is absolutely dependent on the presence of Bax and Bak. My observation that apoptosis induced by loss of Hoxb8 expression was completely inhibited by deletion of Bax and Bak, clearly implicates the intrinsic cell death pathway. Intrinsic cell death pathways are regulated by interactions between the Bcl-2 family of proteins. I therefore set out to determine which Bcl-2 proteins were involved in apoptosis induced by Hoxb8 deprivation and how Hoxb8 regulates them.

4.1 Bim is repressed in Hoxb8 immortalised myeloid progenitor cells The withdrawal of 4-OHT in Hoxb8 immortalised progenitor cells results in Bax and Bak dependent cell death. Using Western Blotting, I followed the changes in expression of Bcl-2 proteins in wild type Hoxb8 immortalised progenitor cells, as Hoxb8 was down-regulated and then re-expressed (Figure 4.1). In all clones tested, decreased Hoxb8 expression resulted in increased expression of the pro-apoptotic protein, Bim, in particular the extra long isoform (BimEL). The two shorter Bim isoforms, BimL and BimS were rarely detected in Hoxb8 immortalised progenitor cells. It was observed that clones expressing more BimEL were also likely to express BimL (See Figure 5.5B). The BimS isoform was not expressed in any cell lines examined. Bim expression increased the longer cells were cultured in the absence of 4-OHT and continued to be expressed for several days after the re-addition of 4-OHT (Figure 4.1). This is due to the presence of cells that were still undergoing apoptosis. The viability of Hoxb8 immortalised progenitor cells returns to baseline levels at least six days after 4-OHT re- addition (Figure 3.15), so it is not surprising that Bim continues to be detected over this time period. Bmf was the only other pro-apoptotic Bcl-2 protein to increase after 4- OHT withdrawal. The expression of Bid, Noxa, Puma, Bax and Bak remained stable across all timepoints. The expression of the anti-apoptotic protein, Bcl-2, was not influenced by changing Hoxb8 levels. Both Bcl-xL and Mcl-1 altered slightly after 4- OHT withdrawal and re-addition, however these changes were not consistent in all clones tested suggesting changes in

101

Figure 4.1: Bim protein levels are repressed during Hoxb8 over-expression and increase upon Hoxb8 withdrawal. Representative Western Blots of Bcl-2 family proteins in Hoxb8 immortalised progenitor cells upon 4-OHT withdrawal and re-stimulation. Cells were cultured in the presence of IL-3 but absence of 4-OHT with lysates made at zero, two, four and six days after 4-OHT withdrawal. Four days after withdrawal, 4-OHT was re-added to a population of cells and lysates made at two, four and six days after 4-OHT re- addition. Membranes were probed with antibodies towards, Hoxb8, Bim, Bid, Bmf, Noxa, Puma, Bax, Bak, Bcl-2, Mcl-1 and Bcl-xl. Beta-actin is shown as a loading control for Hoxb8 and Bim, while the IL-3 Receptor alpha chain is shown as loading control for Puma. Arrows indicate correct protein bands for Hoxb8 and Puma respectively.

102

expression of these proteins was not consistently dependent on Hoxb8 expression levels. The only repeatable change observed after Hoxb8 withdrawal was the increase in Bim expression.

To exclude the possibility that Bim expression increased due to 4-OHT withdrawal and not reduced Hoxb8 expression, Bim protein was analysed in wild type progenitor cells expressing Doxycycline repressible Hoxb8 (Figure 4.2). Bim induction was observed in these cell lines following the withdrawal of Hoxb8, with Bim expression elevated at six days post Doxycycline addition, when Hoxb8 was no longer detected. This result proves that regardless of the conditional system used, the withdrawal of Hoxb8 increased the expression of Bim.

To determine whether the increase in Bim protein expression was due to an increase in Bim transcription, Bim mRNA was measured using real-time PCR (qRT-PCR). Hoxb8 immortalised progenitor cells were cultured in the absence of 4-OHT for a total of six days and mRNA measured every second day (Figure 4.3). Bim mRNA levels steadily increased the longer cells were cultured in the absence of 4-OHT, with the largest increase observed at Days 4 and 6 after withdrawal. These results suggest that Hoxb8 can repress Bim at the transcriptional level, with repression relieved upon Hoxb8 withdrawal.

To establish whether the enforced expression of Hoxb8 repressed Bim in cells other than Hoxb8 immortalised myeloid progenitors, Hoxb8 was over-expressed in three common transformed cell lines, SV40 transformed murine embryonic fibroblasts (MEFs), the human cervical carcinoma cell line, HeLa, and the human monocytic cell line, MM6. (Jones et al., 1971; Roemer et al., 1991; Tevethia, 1984). After infection with the 4-OHT inducible Hoxb8 lentivirus, SV40 transformed C57BL/6 MEFs were treated with 4-OHT to induce Hoxb8 expression (Figure 4.4A). While Bim expression varied slightly across timepoints, Bim levels did not diminish upon Hoxb8 induction, observed at six days following 4-OHT addition. Hoxb8 was induced in HeLa and MM6 cell lines following infection with the Doxycyline repressible Hoxb8 lentivirus (Figure 4.4B and C). The over-expression of Hoxb8 in these cell lines did not reduce Bim expression lower than that observed in uninfected or GFP over-expressing cells. These

103

Figure 4.2: Bim expression is repressed after Hoxb8 down-regulation in Doxycycline repressible, Hoxb8 immortalised progenitor cells Representative Western Blot of Hoxb8 and Bim expression in Doxycycline repressible, Hoxb8 immortalised progenitor cells. Cells were cultured in the presence of IL-3 and 500ng/ml Doxycycline and lysates made at zero, two, four and six days. Membranes were probed with antibodies towards Hoxb8, Bim and beta-actin as a loading control. Arrow in Hoxb8 blot indicates Hoxb8.

104

Figure 4.3: Bim mRNA levels increase upon Hoxb8 withdrawal Bim mRNA was detected in Hoxb8 immortalised progenitor cells cultured in the presence of IL-3 and absence of 4-OHT. Real-time PCR analysis of RNA harvested from wild type Hoxb8 immortalised progenitor cells, zero, two, four and six days after 4-OHT withdrawal. All samples were normalised to Sdh2a and Polr2a. Bim mRNA levels are expressed relative to the Bim mRNA level at six days after 4-OHT withdrawal (highest Bim mRNA levels). Results show means ±SEM of three independent pools in three independent experiments.

QVD

105

Figure 4.4: Hoxb8 over-expression cannot repress Bim in other transformed cell lines (A) Representative Western Blot of Bim expression in SV40 transformed, murine embryonic fibroblasts (MEFs), following over-expression of Hoxb8. Cells were infected with the 4-OHT inducible Hoxb8 lentivirus and selected in puromycin. After selection lysates were made from uninfected cells (-), or cells infected with the lentivirus and induced with 4-OHT for zero, three and six days. Membranes were probed with antibodies towards Hoxb8, Bim and beta actin as a loading control. Arrow indicates Hoxb8. (B) Representative Western Blot of Bim expression in HeLa cells following the over- expression of Hoxb8. HeLa cells were left uninfected (-), or infected with the Doxycycline repressible lentivirus containing either GFP or Hoxb8. After selection in hygromycin for 14 days, lysates were made. Membrane was probed with antibodies towards Hoxb8, Bim and beta-actin as a loading control. Arrow indicates Hoxb8. (C) Representative Western Blot of Bim expression in MM6 cells following the over-expression of Hoxb8. Lysates were made as described in (B). Membrane was probed with antibodies towards Hoxb8, Bim and beta-actin as a loading control. Arrow indicates Hoxb8.

106

results indicated that Bim repression by Hoxb8 was confined to cells specifically immortalised by Hoxb8. Hoxb8 expression in cells transformed by other mutations was not sufficient to repress Bim.

4.2 Bim is partially required for the cell cycle arrest and cell death induced after Hoxb8 withdrawal In Hoxb8 immortalised progenitor cells, increased Bim expression coincided with cell cycle arrest and cell death observed after Hoxb8 withdrawal. To determine whether Bim was required for the cell cycle arrest and apoptosis after Hoxb8 withdrawal, 4-OHT inducible, Hoxb8 immortalised progenitor cells were created from fetal liver derived Bim-/-, c-kit+ve/lin-ve progenitor cells. Hoxb8 expression was tightly regulated similar to wild type cells, with Hoxb8 undetectable four days after 4-OHT withdrawal (Figure 4.5A). Bim-/- Hoxb8 immortalised progenitor cells survived 4-OHT withdrawal longer than wild type cells, with viability beginning to decline only six days after withdrawal (Figure 4.5B). The viability of Bim-/- Hoxb8 immortalised progenitor cells continued to decline and to approach, but not reach that of wild type cells. This result indicates that Bim is required for efficient apoptosis after Hoxb8 withdrawal but that deletion of Bim does not abolish all apoptosis in response to Hoxb8 down-regulation. The inability of Bim-/- Hoxb8 immortalised progenitor cells to replicate the complete survival advantage of Bax-/-;Bak-/- Hoxb8 immortalised progenitor cells indicates that Bim independent, Bax and Bak dependent mechanisms are also contributing to loss of viability after Hoxb8 withdrawal.

To ascertain whether the absence of Bim in Hoxb8 immortalised progenitor cells delayed cell cycle arrest after Hoxb8 withdrawal, 4-OHT was removed from cultures of both wild type and Bim-/- Hoxb8 immortalised progenitor cells and cell cycle analysed by HypoPI staining. Bim-/- Hoxb8 immortalised progenitor cells were slower to exit the cell cycle than wild type cells, with no decrease in the percentage of cells in S phase until three days following 4-OHT withdrawal (Figure 4.6A). Representative histograms of DNA content at three days post 4-OHT withdrawal show Bim-/- Hoxb8 immortalised progenitor cells still cycling and wild type cells accumulating in G1 phase (Figure 4.6B). Between days three and six after 4-OHT withdrawal, Bim-/- Hoxb8 immortalised progenitor cells rapidly exited S phase to reach levels equal to those observed in wild

107

Figure 4.5: The reduction in cell viability after Hoxb8 withdrawal is delayed in Bim-/- immortalised progenitor cells (A) Western Blot of wild type and Bim-/- Hoxb8 immortalised progenitor cells cultured in the presence of IL-3 but absence of 4-OHT for zero, four and eight days. Membranes were probed with antibodies for Hoxb8 and Bim. Beta-actin is shown as a loading control. Arrows indicate Hoxb8 and BimEL bands respectively. (B) Cell survival of wild type and Bim-/- Hoxb8 immortalised progenitor cells cultured in the presence of IL-3 but absence of 4-OHT. Survival was analysed by PI and FITC-conjugated, AnnexinV staining at zero, three, six and nine days after 4-OHT withdrawal. Results are means ± SEM of eight independent clones in three independent experiments.

108

Figure 4.6: Cell cycle arrest in Bim-/- Hoxb8 immortalised progenitor cells is delayed after Hoxb8 withdrawal (A) Percentage of cells in S phase after 4-OHT withdrawal. Wild type and Bim-/- Hoxb8 immortalised progenitor cells were cultured in the presence of IL-3 but absence of 4-OHT for the indicated times. Cells were stained with hypotonic-PI solution and subjected to cell cycle analysis by flow cytometry. Results were analysed using Modfit LT™ and show means ± SEM of eight independent clones in three independent experiments. (B) Representative histograms of hypotonic PI staining of wild type and Bim-/- Hoxb8 immortalised progenitor cells cultured in the absence of 4-OHT for three days.

109

type cells (Figure 4.6A). These results show that the delayed cell death as a result of Bim deletion was accompanied by delayed exit from the cell cycle after 4-OHT withdrawal. However, Bim-/- Hoxb8 immortalised progenitor cells still eventually stop dividing.

Short term in vitro assays prove that Bim, Bax and Bak are required for the cell death occurring after Hoxb8 withdrawal. To determine whether deletion of these proteins and reduced apoptosis was associated with increased clonogenic proliferation, wild type, Bim-/- and Bax-/-;Bak-/-, Hoxb8 immortalised progenitor cells were cultured in soft agar in the presence of 4-OHT and the number of colonies assessed (Figure 4.7A). The absence of Bim in Hoxb8 immortalised progenitor cells was the most advantageous condition for clonogenic growth. Bim-/- Hoxb8 immortalised progenitor cells generated almost three fold more colonies that either Bax-/-;Bak-/- or wild type cell lines. The inability of Bax-/-;Bak-/- Hoxb8 immortalised progenitor cells to undergo cell death was not associated with enhanced colony formation under normal culture conditions. This result indicates that the absence of Bim can enhance the survival and proliferative potential of Hoxb8 immortalised progenitor cells and suggests that the repression of Bim by Hoxb8 contributes to Hoxb8-dependent immortalisation of myeloid progenitor cells.

I next extended the experiments to establish the clonogenic survival of Bim-/- and Bax-/- ;Bak-/- Hoxb8 immortalised progenitor cells after a period of Hoxb8 withdrawal. Wild type, Bim-/- and Bax-/-;Bak-/-, Hoxb8 immortalised progenitor cells were cultured without 4-OHT for several days before cells were replated in soft agar in the presence of 4-OHT to re-induce Hoxb8 expression (Figure 4.7B). Strikingly, wild type, Bim-/- and Bax-/- ;Bak-/-, Hoxb8 immortalised progenitor cells all exhibited a gradual decrease in clonogenicity after 4-OHT withdrawal, relative to Day zero. While Bax-/-;Bak-/-, Hoxb8 immortalised progenitor cells were incapable of dying after Hoxb8 withdrawal, they could not clonogenically proliferate once Hoxb8 was re-expressed. Similarly, Bim-/- Hoxb8 immortalised progenitor cells, which retain both a short term survival and proliferative advantage at least three days after Hoxb8 withdrawal, also could not maintain this advantage upon Hoxb8 re-expression, forming even fewer colonies than wild type or Bax-/-;Bak-/-, Hoxb8 immortalised progenitor cells (Figure 4.7B). The inability of these cells to sustain long-term self renewal even when Bim and Bax/Bak

110

Figure 4.7: Bim-/- Hoxb8 immortalised progenitor cells exhibit higher self-renewal potential than wild type or Bax-/-;Bak-/-, Hoxb8 immortalised progenitor cells only in conditions of over-expressed Hoxb8. (A) Wild type, Bax-/-;Bak-/- and Bim-/- Hoxb8 immortalised progenitor cells were placed into soft agar in the presence of IL-3 and 4-OHT. Colonies were counted 14 days later. Results show means ± SEM of four independent clones of each genotype in three independent experiments. (B) Relative clonogenic potential of wild type, Bim-/- and Bax-/-;Bak-/-, Hoxb8 immortalised progenitor cells upon 4-OHT re-stimulation. In the presence of IL-3, 4-OHT was removed from immortalised progenitor cells in liquid culture and at the indicated timepoints after 4-OHT withdrawal placed into soft agar in the presence of IL-3 and 4-OHT. Colonies were counted 14 days later. Results show means ± SEM of four independent clones of each genotype in three independent experiments.

111

dependent survival pathways are inactivated, suggests that other apoptosis independent processes are mediating the loss of self-renewal potential after Hoxb8 withdrawal.

4.3 Bim mRNA is repressed by Hoxb8 through mechanisms targeting the 3’UTR The increased Bim mRNA levels in response to Hoxb8 downregulation could be a result of direct transcriptional upregulation or increased Bim mRNA stability. To begin to distinguish these possibilities, I used a reporter system to establish which regulatory regions of the Bim gene were required for Hoxb8-dependent Bim repression. I generated 293T cells that stably expressed Hoxb8 or GFP by infecting these cells with Doxycycline repressible Hoxb8 or GFP lentivirus. Expression of Hoxb8 was confirmed by Western blot (Figure 4.8A). I then transiently transfected 293T cells with luciferase reporter constructs that encoded either the 3.6kB region upstream of Exon 1 or the first intron of Bim driving the expression of luciferase, or luciferase fused downstream to 4.2kB of the 3’UTR of Bim (Figure 4.8B). The enforced expression of Hoxb8 resulted in a 50 percent reduction in luciferase activity relative to GFP when luciferase was regulated by the Bim 3’UTR. Luciferase reporter activity from the 3.6kB promoter region and the first intron of Bim did not change in conditions of Hoxb8 expression. This result strongly suggests that in conditions of enforced Hoxb8, Bim is repressed through mechanisms targeting the 3’UTR, such as miRNAs.

To narrow down the region of the Bim 3’UTR that mediated Bim repression by Hoxb8, various segments of the murine Bim 3’UTR were fused downstream to a GFP reporter gene (Figure 4.9A). According to the miRNA target prediction software, Targetscan, a number of miRNAs are predicted to bind to the Bim 3’UTR. The coloured stars indicate these sites, and represent highly conserved mammalian miRNA binding sites (Figure 4.9A). These GFP reporter constructs, including an ‘Empty’ reporter construct, were expressed in 293T cells over-expressing Hoxb8. Reduced GFP expression indicated that the construct contained the region of the Bim 3’UTR sufficient to decrease GFP expression. A reduction in GFP reporter activity was observed from reporter constructs two and four. 293T cells expressing these reporters had an almost 50 percent reduction in GFP expression relative to uninfected cells (Figure 4.9B). No change was observed in 293T cells expressing reporter constructs containing the first and third regions of the

112

Figure 4.8: Hoxb8 represses Bim through mechanisms targeting the 3’UTR. (A) Representative Western Blot of Hoxb8 expression in 293T cells stably infected with Doxycycline repressible Hoxb8 lentivirus. Lysates of uninfected (-) or infected (+) 293T cells were probed with antibodies towards Hoxb8 and HSP70 as a loading control. (B) 293T cells were stably infected with lentivirus containing GFP or Hoxb8 under the control of the Doxycycline repressible promoter. After selection in hygromycin, cells were transiently transfected with luciferase reporter constructs containing the firefly luciferase gene downstream of either the 3.6kB promoter region upstream of Exon 1 (E1) or the first intron (I1). 3’UTR reporter activity was assessed using a luciferase reporter construct with the Bim 3’UTR cloned downstream of the luciferase gene, under the transcriptional control of an SV40 promoter. All cells were co-transfected with a plasmid expressing renilla luciferase to control for transfection efficiency. Luciferase levels are expressed relative to GFP-expressing 293T cells. Results show the mean ± SEM of three independent experiments. I: Intron, E: Exon. Complete diagrams of the constructs utilized in the luciferase experiment are shown in Figure 2.1.

113

Figure 4.9: Bim 3’UTR segments, which contain binding sites for miR- 17/20a/106a/b, miR-9, miR-214, miR-19a/b and miR-92/25, are required for Hoxb8 mediated repression of Bim. (A) Schematic representation of the Bim 3’UTR and predicted miRNA binding sites, as indicated by the coloured stars. Sites represented here are all highly conserved between mammals. All sites were derived from the miRNA binding prediction software, TargetScan. Numbers underneath each 3’UTR segment indicate the length and region of the Bim 3’UTR encompassed in each reporter construct. (B) Reporter activity measured by GFP fluorescence in 293T cells, uninfected or stably infected with the Doxycycline repressible Hoxb8 lentivirus. Cells were cultured in the absence of Doxycycline to maintain Hoxb8 over-expression. 293T cells over-expressing Hoxb8 were stably infected with Bim 3’UTR GFP reporter constructs. GFP fluorescence was analysed by flow cytometry and made relative to cells expressing the GFP reporter construct alone. Results are means ± SEM of three independent experiments. P values are derived from Student T-test, (2-tailed, equal variance).

114

Bim 3’UTR. This result narrows down the possible TargetScan predicted miRNAs involved in Hoxb8 mediated repression of Bim to miR-9, miR-214, miR17-5p, miR-19 and miR-92. Given that the latter three out of these five miRNAs are derived from the one genomic transcript, known as C13orf25, HG17 or the miR-17~92 cluster, the role of this cluster and all miRNAs transcribed from it, will be examined further in the next chapter in the context of Bim repression as well as Hoxb8 mediated immortalisation.

115

4.4 Discussion The most novel and interesting findings from Chapter Three were the association of Hoxb8 expression with repression of the intrinsic apoptosis pathway. Following on from these findings in Chapter Four, I have found that Hoxb8 could achieve this by mediating the repression of the pro-apoptotic molecule Bim. Unexpectedly, my experiments suggested that the mechanisms by which Bim expression is repressed required the Bim 3’UTR. This implicates miRNAs as a possible mechanism of regulation and several published reports describing miRNAs involved in Bim repression support this hypothesis (Kan et al., 2009; Ouyang et al., 2012; Xiao et al., 2008). While the luciferase assay does not rule out the possibility that Bim may be transcriptionally regulated by a distal enhancer, the result does implicate the Bim 3’UTR in containing an element that modulates protein expression. Whether such distal (or trans) regulatory elements exist is unknown. The miRNA mediated regulation of Bim expression in Hoxb8 immortalised progenitor cells will be extensively investigated and discussed in Chapter 5.

It is well described that Hoxb8 over-expression can block myeloid differentiation, and indeed differentiation of several models (Krishnaraju et al., 1997; Wang et al., 2006). The data presented in this chapter is the first experimental demonstration that Hoxb8 also regulates intrinsic cell death pathways. The crucial evidence for involvement of intrinsic cell death pathways is the complete abolition of apoptosis after Hoxb8 down- regulation in cells lacking both Bax and Bak. These two pro-apoptotic family members are absolutely required for cell death regulated by Bcl-2 family members to proceed (Lindsten et al., 2000). If other mechanisms of cell demise were involved after Hoxb8 withdrawal, for example extrinsic pathways mediated by death receptors, such as necroptosis, it would be expected that Bax-/-;Bak-/- Hoxb8 immortalised progenitor cells would not remain viable.

The activation of Bax and Bak requires the inhibition of the anti-apoptotic Bcl-2 family members such as Bcl-2, Bcl-xL and Mcl-1, and the activation of the proapoptotic BH3- only proteins (reviewed in (Youle and Strasser, 2008)). Analysis of the expression of the Bcl-2 family of pro and anti-apoptotic proteins showed that in the presence of Hoxb8, Bim expression was repressed. It was interesting to note that this phenomenon

116

was observed in cells that had been specifically immortalised by Hoxb8, and were Hoxb8-dependent. Hoxb8 expression was not sufficient to repress Bim in other transformed cell lines. This may be because Bim regulation in these lines is most strongly controlled by other Hoxb8 independent mechanisms or influenced by the many other genetic changes in these cells. For example, Bim is known to be transcriptionally upregulated by transcription factors such as c-myc and Foxo3a, which may be in higher abundance in these already transformed cell lines (Dijkers et al., 2000; Yamamura et al., 2006).

A reduction in cell proliferation due to Bim deficiency has been reported for several cell types including megakaryocytes as well as B cells upon engagement of the B Cell Receptor (BCR) and Toll Like Receptors 3 and 4 (Craxton et al., 2007; Kozuma et al., 2010). While there is no published role for Bim deletion on enhancing cell proliferation, the only other Bcl-2 family proteins whose deletion increased cell cycle progression are Bcl-2 and Bxl-xL. In fibroblasts, an increase in Bcl-2 and/or Bcl-xL enforced the expression of cyclin dependent inhibitors, p27 and p130, which slowed G1 progression (Greider et al., 2002; Vairo et al., 2000). In T cells, Bcl-2 deficiency promoted cell cycle progression by reducing the level of p27 and enhancing G0 to S phase cell cycle progression (Linette et al., 1996). It may also be the case that Bim expression in Hoxb8 immortalised progenitor cells negatively regulates cell cycle progression. This would further support the necessity for Hoxb8 to specifically target and repress Bim for efficient immortalisation and survival and also support the slower exit from the cell cycle after Hoxb8 withdrawal. Further analysis of cell cycle specific protein expression between wild type and Bim-/- Hoxb8 immortalised progenitor cells will shed some light on cell cycle regulation by Bim.

4.4.1 Hox mediated repression of a BH3-only protein In other organisms, such as invertebrates, Hox genes have been shown to directly influence apoptosis by targeting homologues of the Bcl-2 family of proteins. One of the Hox genes in C.Elegans, mab-5, is required to promote apoptosis of two cells, P11.aaap and P12.aaap in the ventral nerve cord by directly regulating the transcriptional upregulation of the BH3-only homologue, egl-1 (Liu et al., 2005). The cell death of ventral cord neurons can be prevented by repression of egl-1, instigated by the direct

117

binding of the C-Elegans Hox gene, lin-59 to the egl-1 promoter (Potts et al., 2009). In D.Melanogaster, the Hox gene, Dfd directly induces expression of the death-inducing gene, reaper, to induce apoptosis of cells in the maxillary/mandibular regions during embryonic development (Lohmann et al., 2002; Nassif et al., 1998). A key difference between the cell death induced by Hox genes in these lower organisms and that occurring in our Hoxb8 immortalised progenitor cells is the absence of direct regulation by Hox genes in mammalian cells. The requirement for this direct Hox specific target may have become redundant during evolution with the increased complexity of mammalian embryogenesis. Nevertheless, we have shown that through indirect mechanisms, Hoxb8, is still capable of inducing apoptosis through the intrinsic cell death pathway.

Evidence in mammals for direct Hoxb8 regulation of cell death pathways has not been previously demonstrated but circumstantial evidence indicates that various other Hox genes involved in haematopoiesis do regulate cell survival. Mice with the homozygous deletion of Hoxa9 have fewer thymic T cells in the developing embryo, with increased thymic apoptosis and associated decreased Bcl-2 expression (Izon et al., 1998). A synthetic peptide which blocks the Hox:Pbx interaction can induce the rapid cell death of melanoma and renal cancer cell lines as well as malignant B cells (Daniels et al., 2010; Morgan et al., 2007; Shears et al., 2008). This cell death however, is caspase independent, suggesting that the disruption of complexes formed by Hox and Pbx can activate cell death pathways that do not lead to apoptosis via the intrinsic pathway. The knockdown of Hoxa9 in acute myeloid leukaemia cell lines characterised by MLL- translocations also results in the cell death of these cells (Faber et al., 2009). No link between the direct regulation of cell death proteins by Hox genes has yet been made.

4.4.2 Advantages of Bim repression in maintaining an immortalised state The absence of Bim in Hoxb8 immortalised progenitor cells increased the clonogenic potential of cells over-expressing Hoxb8 by almost three-fold under normal culture conditions. Such an increase in clonogenicity in the absence of Bim may suggest that cells that express Bim above a certain threshold are not able to sustain growth in soft agar conditions. Both wild type and Bax-/-;Bak-/- Hoxb8 immortalised progenitor cells, in which Bim is repressed by Hoxb8 may be more sensitive to the stresses placed on

118

cells during this clonogenic assay, which may inadvertently increase Bim expression independent of Hoxb8. This effect however is more likely to be observed in wild type cells rather than Bax-/-;Bak-/- cells, which do not have the capacity to die through the intrinsic apoptosis pathway.

Other documented instances exist in which Bim repression enhances self-renewal. In a Bim-/- mouse model, the absence of Bim promotes the expansion of various cell types of the haematopoietic compartment including T and B lymphocytes, monocytes and granulocytes (Bouillet et al., 1999). The absence of Bim can also result in the accumulation of autoreactive B cells after engagement of the B cell receptor to self- antigen (Enders et al., 2003). While this could be a reflection of the reduction in apoptosis, it also does not rule out the possibility that these cells have an enhanced capacity to clonogenically proliferate. The repression of Bim could be a mechanism in which Hoxb8 augments the self-renewal of immortalised myeloid progenitor cells. Knockout of Bim in tumour models is especially advantageous in promoting cancer progression. The expression of c-myc under the Eµ promoter, exclusively expressed in B cells, can promote the clonal expansion of a pre-B cell population with the gradual development of lymphoma (Strasser et al., 1990). The repression of Bim in this model can significantly increase the incidence of tumour development, reducing the lymphoma latency in these mice (Egle et al., 2004). Bim deletion is also common in Mantle Cell Lymphomas characterised by the t(11;14)(q13;32) translocation as well as the 2q13 deletion (Tagawa et al., 2004).

It is curious that the same clonogenic advantage afforded by Bim deletion is not replicated in Bax-/-;Bak-/- Hoxb8 immortalised progenitor cells. Bax-/-;Bak-/- cells have a survival advantage over Bim-/- Hoxb8 immortalised progenitor cells exemplified in conditions of cytokine withdrawal and irradiation and Hoxb8 withdrawal mediated cell death (Ekert et al., 2006). Both the independent aberrant repression of Bax and Bak has been implicated in tumour development. In human colorectal cancer, Bak expression was repressed in combination with elevated expression of the anti-apoptotic protein, Bcl-xL (Krajewska et al., 1996). Frameshift mutations of the Bax gene, which reduce expression, has been detected in 50% of colon adenocarcinomas as well as 21% of human haematological malignancies, in particular, acute lymphoblastic leukaemia (Meijerink et al., 1998; Rampino et al., 1997). Bim, Bax and Bak all have the potential

119

to act as tumour suppressors, however, Hoxb8 dependent immortalisation of myeloid progenitor cells must create a genetic environment, which promotes the repression of Bim in enhancing clonogenic growth. Deletion of Bim specifically protects or increases a population of cells that retain the ability to form colonies, whereas deletion of Bax and Bak increases only the survival of all cells.

4.4.3 Long-term self-renewal in the absence of Bax, Bak and Bim It was evident in the clonogenic assays conducted in the absence of Hoxb8 expression that increased survival after Hoxb8 downregulation did not translate to increased colony formation. This was observed even in Bim-/- Hoxb8 immortalised progenitor cells, which exhibit increased baseline clonogenicity during Hoxb8 over-expression. Cells surviving Hoxb8 withdrawal do not continue proliferating, and their lack of clonogenic potential suggests that cells are differentiating or undergoing senescence, irreversible after re- expression of Hoxb8. As mentioned previously, murine bone marrow progenitor cells immortalised by Hoxb8 in the presence of SCF or GM-CSF undergo myeloid differentiation (Wang et al., 2006). This differentiation is clearly represented in the analysis of the gene expression profiles of these cell lines, pre and post Hoxb8 withdrawal. Cells cultured in the absence of Hoxb8 downregulate genes that promote cell cycle progression including Myc and Myb as well as their target genes, Nolc1, Shmt2, Prtn3, Ela2, Ctsg and Mpo. Genes associated with terminal differentiation including Fpr1, Fpr-rs2, Clec7a, Mrc1 and Fgr were upregulated after Hoxb8 withdrawal (Wang et al., 2006). These genes provide both phagocytic and adhesion qualities to monocytes and granulocytes, including Mrc1, which assists in the endocytosis of pathogenic glycoproteins and Fgr, which is expressed on the surface of differentiated monocytes to promote migration and adhesion (Ezekowitz et al., 1990; Lowell and Berton, 1999).

It is likely, that the loss of Hoxb8 expression sets the fate of cells to either differentiation or death, losing in all circumstances, the ability to keep proliferating. The survival and proliferative advantage that Bim-/- Hoxb8 immortalised progenitor cells exhibited after Hoxb8 withdrawal, was not sustained in long-term culture, most likely due to the induction of differentiation pathways that bypass any influence that Bim exhibits on the clonogenicity of these cells. By deleting Bim or Bax and Bak, it is

120

possible to prevent cell death, however impossible to prevent cells from differentiating or undergoing senescence. Targeting Hoxb8 in malignances in which this gene has a central transforming role could be an effective strategy, even if cells have mutations that inhibit apoptosis.

121

122

5.0 The miR-17~92 cluster is regulated by Hoxb8 and is required for optimal cell survival and proliferation.

My data is consistent with the hypothesis that Hoxb8 regulates Bim expression by regulating Bim mRNA stability. Regulation of Bim mRNA expression by miRNAs is well described and several key miRNA seed sequences are identified in the Bim 3’UTR. Most important are the miRNAs belonging to the miR-17~92 cluster (Molitoris et al., 2011; Ventura et al., 2008; Xiao et al., 2008). This cluster contains six miRNAs, miR- 17-5p, miR-18-3p, miR-19a-3p, miR-20a-5p, miR-19b-3p and miR-92a-3p, with miR- 17-5p, miR-19a-3p, miR-19b-3p and miR-92a-3p predicted to target the Bim 3’UTR.

The evidence supporting an oncogenic function of miRNA expression is strongest for miR-17~92. It is upregulated in many different tumour types including B-cell lymphomas, non-small cell lung and colon cancers and can accelerate the onset of lymphoproliferative disease and autoimmunity in mice (Diosdado et al., 2009; Hayashita et al., 2005; Mu et al., 2009; Xiao et al., 2008). Besides miRNAs from the miR-17~92 cluster, 78 other miRNAs have been predicted to bind the Bim 3’UTR. Thus, to identify potential miRNAs regulated by Hoxb8 that may in turn control Bim mRNA abundance, I chose to take an unbiased approach and assay the levels of all miRNAs in the presence and absence of Hoxb8.

5.1 The global analysis of miRNAs in Hoxb8 immortalised progenitor cells reveals the miR-17~92 cluster as a possible candidate for Bim repression. Several miRNAs have been previously linked to Bim repression including miR-24, miR-32, miR-106 and miRNAs miR-17-5p, 19a-3p, 19b-3p and 92a-3p from the miR- 17~92 cluster (Fontana et al., 2008; Gocek et al., 2011; Inomata et al., 2009; Qian et al., 2011; Ventura et al., 2008; Xiao et al., 2008). To determine whether any of the miRNAs previously reported or predicted to bind the Bim 3’UTR were expressed in Hoxb8 immortalised progenitor cells and specifically elevated during Hoxb8 over-expression, 761 mouse and rat miRNAs were assayed using the Taqman® Array Rodent v3.0 miRNA (A+B) cards.

123

5.1.1 Hoxb8 can regulate the expression of 71 miRNAs The Taqman® Array Rodent v3.0 miRNA (A+B) cards utilised 384 well plates, spotted with primers specific for a total of 761 miRNAs. 641 of these identify miRNAs found in the mouse genome while 373 identify miRNAs from the rat genome. All miRNAs included in the array were obtained from versions 13 and 14 of the miRNA database, miRBase (Griffiths-Jones, 2004; Griffiths-Jones et al., 2006; Griffiths-Jones et al., 2008; Kozomara and Griffiths-Jones, 2011). Both guide and star strands of most miRNAs could be detected in this array. While the mature strands of RNA are in almost all cases the major strand involved in miRNA-mediated repression, reports have recently suggested that the star strand could also target 3’UTRs to mediate repression (Kuchenbauer et al., 2011; Yang et al., 2011).

Total RNA was extracted from three independent IL-3-dependent Hoxb8 immortalised progenitor cell clones, cultured in the presence or absence of 4-OHT for four days. cDNA was aliquoted into plates A and B, containing the Taqman probes and analysed using RT-PCR. The ∆Ct values of each miRNA in each individual clone were calculated after normalisation to U6 and the top 50 highly expressed miRNAs. This ∆Ct value was averaged across all clones in conditions of Hoxb8 expression or withdrawal to obtain the mean ∆Ct for each miRNA. miRNAs with Ct values greater than 35 were not included in analysis as their abundance in the cell at this value was too low to be reliably detected. Fold changes in expression were derived from fold change in the mean ∆Ct values between Hoxb8 immortalised progenitor cells cultured in the presence or absence of Hoxb8. P-values were calculated using a 2-tailed t-test. Of the 641 miRNAs tested that were specific to mouse as well as homologous in rat, 286 of these, or 45%, were not detected in Hoxb8 immortalised progenitor cells in either the presence or absence of Hoxb8. The individual Ct values of these miRNAs are listed in table form in Appendix 1.1. Of those that were detected, 285 miRNAs or 44 percent did not significantly change in expression after the withdrawal of Hoxb8 (Appendix 1.2). 70 miRNAs, or a total of 11% of all miRNAs tested were differentially expressed with decreasing levels of Hoxb8 expression. Of these, 29 miRNAs increased in expression after Hoxb8 withdrawal while 41 decreased (Appendix 1.3 and 1.4). These results are summarised in Figure 5.1. Thus, from a starting population of 641 mouse miRNAs, Hoxb8 could influence the expression pattern of 70 of these with varying degrees of fold change.

124

The majority of these 70 significantly changing miRNAs exhibited only small changes in expression levels after Hoxb8 withdrawal. Although small, the reproducibility across the three biological replicates produced a high level of statistical significance (Appendix 1.3 and 1.4). Several miRNAs exhibited large changes in expression level after Hoxb8 withdrawal. miR-211-5p, miR-381-3p, miR-467a-5p and miR-687 all increased in expression by 1000 fold after Hoxb8 withdrawal while miR-214-3p and miR-450-5p decreased over 1000 fold (Figure 5.2 and Appendix 1.3 and 1.4). Several miRNAs exhibited a significant fold change, however their expression levels were consistently low across all biological replicates and in conditions of Hoxb8 expression and withdrawal. These miRNAs were excluded from any further analysis as they were detected at PCR cycle numbers that lie outside the range of confidence for true expression (Ct>35). Changes in expression are less accurately quantified if miRNAs are expressed at lower concentrations. Examples of these miRNAs include miR-692, miR- 409-3p, miR-881-5p and miR-1901, which, while significantly changing after Hoxb8 withdrawal, are present in very low levels across all samples. Re-validation of expression levels would be required to be certain of such changes.

125

Total # of miRNAs % of overall miRNAs Unexpressed 286 45% Expressed – 285 44% no change Lower expression 41 6% (-4-OHT) Higher expression 29 5% (-4-OHT) 641 100

Figure 5.1: Overview of miRNA expression patterns in Hoxb8 immortalised progenitor cells derived from the Taqman® MicroRNA Array Cards Representation of expression results from the Taqman® MicroRNA array. Pie chart represents the distribution of overall miRNAs, as indicate in the table, that were unexpressed across all samples, expressed but did not significantly change after withdrawal of Hoxb8, or expressed at significantly lower or higher levels after the withdrawal of Hoxb8. Total number of miRNAs in each group is also illustrated in the table.

126

127

Figure 5.2: Heat maps representing differential expression of miRNAs after Hoxb8 down-regulation. Wild type Hoxb8 immortalised progenitor cells were cultured in the presence of IL-3 and in the presence (+) or 4-day absence of 4-OHT (-). The left panel shows the fold change in expression in response to 4-OHT for the most affected miRNAs. For each miRNA, the change in Ct value in response to 4-OHT is shown relative to the average Ct of all six samples. This scheme allows visualisation of the degree of change for all levels of expression. The heat map on the right shows the actual Ct values, averaged across the three biological replicates for each treatment. Highest expression is represented as red and lowest expression as blue. Red arrows indicate guide strands from the miRNAs of the miR-17~92 cluster of miRNAs.

128

5.1.2 miRNAs predicted to bind the Bim 3’UTR are significantly upregulated during Hoxb8 over-expression 89 miRNAs included in the Taqman® MicroRNA Array Cards are predicted to bind the Bim 3’UTR. These are listed in Appendix 1.5. These predictions are derived from the publicly available on-line target prediction site, TargetScan http://www.targetscan.org/mmu_50/, which uses pre-defined algorithms to assess the likelihood of a particular miRNA binding to any 3’UTR in the genome (Garcia et al., 2011; Grimson et al., 2007). These algorithms are described briefly in Chapter 2.8.3. From the 89 predicted Bim 3’UTR target miRNAs, only 15 of these changed significantly in expression after Hoxb8 withdrawal. These are listed in Table 5.1. Of the 15 significantly changing miRNAs, three miRNAs, miR-24-3p, miR-301b-3p and miR- 24-2-5p were expressed at higher levels after Hoxb8 withdrawal (-4-OHT). This would not be consistent with elevated Bim expression after Hoxb8 downregulation, as increased miRNAs would be expected to reduce Bim mRNA abundance. The remaining miRNAs all declined after Hoxb8 withdrawal, most reduced between 1.5 and 4 fold. miR-214 exhibited the largest decrease in expression, with a fold decrease of 232086 times after Hoxb8 withdrawal, however large variations in Ct values across all 3 biological replicates raised concerns about the reliability of these results (Appendix 1.3 and Figure 5.2).

From this condensed list of miRNAs, eight belong to the miR-17~92 cluster or to its paralogue clusters, miR-106a~363 and miR-106b~25 (Figure 5.2). miRNAs from these three clusters can be grouped according to identical seed sequences that recognise matching mRNA target sites (Table 5.2 and Figure 5.3). miRNAs assigned to groups according to these seed regions are also indicated in Table 5.1. They include, miR-92a- 3p, miR-19b-3p, miR-106b-5p, miR-17-3p, miR-20a-5p, miR-106a-5p, miR-17-5p, miR-25-3p and miR-19a-3p. Of these miRNAs, miR-92a-3p, miR-17-3p, miR-25-3p, miR-19a-3p and miR-19b-3p are recognised as the mature strands. These five miRNAs are reported to downregulate Bim expression and are expressed significantly higher during Hoxb8 over-expression, suggesting a possible involvement in Hoxb8 mediated Bim repression.

129

Table 5.1: Condensed list of miRNAs predicted to bind the Bim 3’UTR and which significantly change in expression pattern after Hoxb8 withdrawal

Fold Common Higher Expression +4- Change in P-value Seed Region OHT or -4-OHT ∆Ct miR-92a-3p 2.2 0.0017 92 +4-OHT miR-24-3p 1.9 0.0042 -4-OHT miR-19b-3p 1.5 0.0078 19 +4-OHT miR-214-3p 232086 0.0097 +4-OHT miR-301b-3p 1.4 0.0105 -4-OHT miR-106b-3p 1.8 0.0133 +4-OHT miR-17-3p 1.6 0.0140 +4-OHT miR-24-2-5p 2.0 0.0232 -4-OHT miR-20a-5p* 1.7 0.0241 17 +4-OHT miR-9-5p 2.6 0.0260 +4-OHT miR-106a-5p* 1.7 0.0272 17 +4-OHT miR-181a-5p 4.1 0.0286 +4-OHT miR-17-5p* 1.8 0.0316 17 +4-OHT miR-25-3p 1.7 0.0361 92 +4-OHT miR-19a-3p 1.6 0.0370 19 +4-OHT * star forms

130

5.2 Other known targets of miR-17~92 are repressed during Hoxb8 over-expression. The miRNA array indicates that all six mature strands from the miR-17~92 cluster are expressed at elevated levels during Hoxb8 over-expression and decrease significantly after Hoxb8 withdrawal (Table 5.3 and Figure 5.2 - red arrows). The miR-17~92 cluster has not only been implicated in repressing Bim expression, but also tumour suppressor genes such as p21, PTEN and c-myc (Fontana et al., 2008; O'Donnell et al., 2005; Olive et al., 2009). Elevated levels of this cluster have been detected in B cell lymphomas as well as leukaemias characterised by MLL-translocations (Mu et al., 2009; Wong et al., 2010). To investigate this, we firstly validated the expression pattern of miRNAs from this cluster and determined whether any other known targets of miR-17~92 were influenced by changing Hoxb8 expression.

Along with the mature strands of miR-17~92 cluster associated miRNAs, the miRNA array also isolated two star forms, miR-17-3p and miR-18a-5p that significantly decreased in expression after Hoxb8 withdrawal (Table 5.3). Star strands are usually expressed at much lower levels than their ‘partner’ mature strands. The results indicate that this was true for miR-17-3p but not miR-18a-5p suggesting that this may not always apply for all miRNAs (Table 5.3). The Ct values of the mature miRNAs designates miR-19b-3p as the most highly expressed of the mature strands, followed by miR-17-5p, miR-20a-5p, miR-92a-3p, miR-19a-3p and miR-18-5p.

131

Figure 5.3: The miR-17~92 cluster and corresponding paralogue clusters, miR- 106a-363 and miR-106a~25 Schematic representation of miRNAs found in the miR-17~92 cluster and paralogous miRNAs on the miR-106a~363 and miR-106a~25 clusters. miRNAs are represented by the coloured boxes with smaller black boxes indicative of seed regions. Similar coloured boxes indicate miRNAs with similar seed regions. Chromosomes on which these miRNA clusters are found are listed on the right hand side. Chr.= Chromosome.

132

Table 5.2: Grouping of miRNAs from the miR-17~92 cluster and paralogue clusters, miR-106a~363 and miR-106a~25, according to identical guide strand seed sequences.

miRNA Mature strand^ Chromosome miR17-5p caaagugcuuacagugcagguag 14 miR-20a-5p uaaagugcuuauagugcagguag 14 ‘17’ seed miR-20b-5p caaagugcucauagugcagguag X region miR-106a-5p caaagugcuuacagugcagguag X miR-106b-5p uaaagugcugacagugcagau 5 miR-93-5p caaagugcuguucgugcagguag 5 miR-92a-3p uauugcacuugucccggccugu 14, X ‘92’ seed miR-92b-3p uauugcacucgucccggccucc 3 region miR-25-3p cauugcacuugucucggucuga 5 miR-363-3p aauugcacgguauccaucugua X ‘18’ seed miR-18a-5p uaaggugcaucuagugcagaua 14 region miR-18b-5p uaaggugcaucuagugcaguuag X ‘19’ seed miR-19a-3p ugugcaaaucuaugcaaaacuga 14 region miR-19b-3p ugugcaaauccaugcaaaacuga 14, X

^ - shaded sequence indicates seed region

133

Table 5.3: Average Ct values, Standard Deviations and Fold Changes of miRNAs from the miR-17~92 cluster as observed in conditions of Hoxb8 expression (4-OHT +) and withdrawal (4-OHT-)

4-OHT + 4-OHT - Average Average St. miRNA St. Dev Fold Change P-value Ct Ct Dev miR-17-5p 3.235 0.180 4.090 0.420 1.8 0.0316 miR-17-3p* 14.065 0.163 14.768 0.242 1.6 0.0140 miR-18a-3p 13.122 0.088 13.719 0.066 1.5 0.0007 miR-18a-5p* 8.144 0.186 8.820 0.318 1.6 0.0337 miR-19a-3p 6.155 0.080 6.815 0.363 1.6 0.0370 miR-20a-5p 3.744 0.176 4.518 0.336 1.7 0.0241 miR-19b-3p 2.475 0.083 3.098 0.201 1.5 0.0078 miR-92a-3p 4.437 0.030 5.587 0.265 2.2 0.0017 * - star strands

134

To validate the results from the Taqman® miRNA array, the expression of each miRNA in the miR-17~92 cluster was independently examined in conditions of Hoxb8 over- expression and withdrawal. Consistent with results from the miRNA array, miR-17-5p, miR-19a-3p, miR-19b-3p, miR-20a-5p and miR-92a-3p were all elevated in the presence of Hoxb8 and significantly decreased after Hoxb8 withdrawal (Figure 5.4). miR-19b-3p was expressed at higher levels than miR-20a-5p and miR-92a-3p. The expression of miR-17-5p, miR17-3p and miR-18-5p could not be validated to the miRNA array results. These three miRNAs were all expressed at lower levels than that detected by the miRNA array and no change in expression was observed after Hoxb8 withdrawal for miR-17-3p and miR-18-5p (Figure 5.4). Both of these miRNAs were almost at the limits of detection relative to the expression of all other mature strands in the cluster. The confirmation of increased expression of miR-19-3p, miR-20a-5p and miR-92-3p, three miRNAs with target sites in the Bim 3’UTR suggests a role for miR- 17~92 in Hoxb8 mediated immortalisation of myeloid progenitor cells.

Repression of both p21 and PTEN has previously been linked to the miR-17~92 cluster (Fontana et al., 2008; Xiao et al., 2008). The cyclin dependent kinase inhibitor, p21/WAF, or CDKN1A, can prevent cell cycle progression by inhibiting cyclin/cdk complexes (Gartel et al., 1996). As indicated by TargetScan, p21, contains one predicted binding site for miR-17-5p (Figure 5.5A). Phosphatase tensin homologue (PTEN) is a tumour suppressor with a role in dephosphorylating phosphatidylinositol- 3,4,5-triphosphate. This negatively regulates 3-phosphoinositide-dependent kinase (PDK) and AKT and leads to inhibition of cell growth (Li and Yen, 1997; Maehama and Dixon, 1998). PTEN contains one predicted binding site for miR-17~5p and miR- 92 as well as two binding sites for miR-19a/b (Figure 5.5A).

I examined the expression of these two proteins in three individually derived Hoxb8 immortalised progenitor cell lines, C1, C2 and C3 (Figure 5.5B and C). Cells were cultured in the presence or four-day absence of 4-OHT and protein expression analysed by Western Blot. p21 expression increased slightly in two of the three Hoxb8 immortalised cell lines after a four day period of 4-OHT withdrawal (Figure 5.5B). The third cell line, C3, expressed much lower levels of p21 and did not show signs of repression during Hoxb8 expression. Across all three Hoxb8 immortalised progenitor

135

Figure 5.4: miR-17-5p, miR-19a-3p, miR-19b-3p, miR-20a-5p and miR-92-3p are all elevated during conditions of Hoxb8 over-expression. The expression levels of miRNAs from the miR-17~92 cluster were independently quantitated in wild type Hoxb8 immortalised progenitor cells using the Taqman® miRNA qRT-PCR kit. Cells were cultured in the presence (+) or four-day absence (-) of 4-OHT and RNA extracted. The expression levels of miR-17~92 were normalised to U6 snRNA and expressed relative to control miRNA, miR-16. Results are means ± SEM of three independent biological replicates.

136

cells lines, PTEN protein levels decreased after 4-OHT withdrawal, excluding any possibility of repressive effects mediated by Hoxb8 (Figure 5.5C). This reduction was also consistent with the decrease in total protein, indicated by the decrease in expression of HSP-70, which was used as a loading control. These results indicate that p21 but not PTEN is repressed by Hoxb8 expression. P21 may be another miR-17~92 cluster targeted gene downregulated in Hoxb8 immortalised progenitor cells.

5.3 The miR-17~92 cluster is required in Hoxb8 immortalised progenitor cells to preserve an immortalised state Upregulated Bim and p21 expression coincided with decreased cell proliferation and viability following Hoxb8 withdrawal. This raised the possibility that miR-17~92 plays a required or critical role in Hoxb8 dependent immortalisation. To determine the requirement of the miR-17~92 cluster for Hoxb8-dependent immortalisation and Hoxb8 mediated repression of Bim and p21, I utilised a mouse model in which miR-17~92 could be conditionally deleted with cre-recombinase. This mouse model was previously used to determine the requirement of miR-17~92 in B cell development (Ventura et al., 2008).

5.3.1 Description of the miR-17~92flx/flx mouse model Hoxb8 immortalised progenitor cells were created from c-kit+ve/lin-ve haematopoietic cells from E14.5 fetal livers of a miR-17~92 conditional knockout mouse, miR- 17~92flx/flx (Ventura et al., 2008). This model is shown in Figure 5.6A. Upon expression of cre recombinase (cre), the two loxp sites recombine to delete the entire miR-17~92 cluster (Figure 5.6B) (Ventura et al., 2008).

The successful deletion of miR-17~92 requires the stable and reliable expression of cre- recombinase. To test whether the lentiviral mediated, constitutive over-expression of cre was successful in initiating loxp mediated gene knock-out, Mclflx/flx SV40 immortalised, murine embryonic fibroblasts (MEF)s were infected with the lentiviral plasmid, pFU cre PGK Hygro W and Mcl-1 protein expression analysed four days after infection (Figure 5.7A). Mcl-1 protein was no longer detected four days after lentiviral infection

137

Figure 5.5: p21, another known target of miRNAs from the miR-17~92 cluster, is repressed in conditions of over-expressed Hoxb8. (A) Schematic of the 3’UTR regions of the murine p21 and PTEN genes. Stars along the 3’UTR indicate the predicted binding sites of miRNAs from the miR-17~92 cluster, as identified by the miRNA binding site prediction software, TargetScan. Sites shown here are determined by TargetScan to be highly conserved across mammals. (B) Representative Western Blot of Bim and p21 expression in Hoxb8 immortalised progenitor cells. Three independently generated clones, C1, C2 and C3 were cultured in the presence (+) or absence (-) of 4-OHT for four days before lysates were made. Membrane was probed with antibodies towards Hoxb8, Bim, p21 and beta-actin as a loading control. (C) Representative Western Blot of PTEN expression in Hoxb8 immortalised progenitor cells. Lysates were made as described in (B) and membrane was probed with antibodies towards PTEN and HSP-70 as a loading control.

138

with the cre-expressing lentivirus and in the absence of hygromycin selection. This result verified that the constitutive over-expressing cre lentiviral plasmid was efficient at mediating loxp deletion of Mcl-1, and an appropriate system to use in the Hoxb8 immortalised, miR-17~92flx/flx progenitor cells.

I therefore expressed the pFU cre PGK Hygro W in Hoxb8 immortalised miR-17~92flx/flx progenitor cells and genotyped cells after fourteen days in hygromycin selection to determine whether this was sufficient to delete the miR-17~92 cluster (Figure 5.7B). As indicated in Figures 5.6 and 5.7B, successful deletion produces PCR products of alternate sizes and allows one to distinguish wild type alleles, floxed alleles and deleted alleles. Two oligonucleotides surrounding the 5’ loxp site are used to identify a miR- 17~92flx/flx allele from the wild type allele, 289bp and 255bp respectively (lanes 1-3, Figure 5.7B). Upon cre-mediated deletion of the cluster, the genomic region surrounding the site of the reverse oligonuclotide is deleted, allowing the most 3’ reverse oligonucleotide to contribute to the amplification of a deletion specific fragment of genomic DNA. This 450bp fragment is only detected after treatment with cre, visible in both miR-17~92flx/+ and miR-17~92flx/flx cell lines (lanes 4 and 6, Figure 5.7B) (Mu et al., 2009; Ventura et al., 2008).

The expression of cre–recombinase in certain cell types inhibits normal cell growth (Loonstra et al., 2001). Cre expression in MEFs induces the accumulation of cells at the G2/M stage of the cell cycle. Using a doxycycline inducible cre-recombinase construct, I showed that the expression of cre alone in wild type Hoxb8 immortalised progenitor cells induced the up-regulation of both Bim and p21 (Figure 5.8A). This was independent of miR-17~92 deletion. This result signified that any effect on Bim and p21 expression mediated by the knock-out of miR-17~92 could not be distinguished from the effect of cre-expression alone. Thus, conditional miR-17~92flx/flx deletion could not be utilised to accurately determine the effects of miR-17~92 deletion on Bim and p21 expression. It was also noted that miR-17~92flx/flx fetal liver cells immortalised with Hoxa9 also experienced an increase in Bim and p21 expression upon expression of cre- recombinase (Figure 5.8B). Hoxa9 immortalised progenitor cells express a higher level of basal Bim protein, therefore the induction with cre-recombinase expression is not as dramatic as that of Hoxb8.

139

Figure 5.6: The miR-17~92 cluster can be conditionally knocked out upon treatment with cre-recombinase. (A) Schematic of the genomic structure of the miR-17~92flx/flx allele before cre- mediated recombination. Two loxp sites, as indicated with red circles, border the miR- 17~92 cluster. Oligonucleotide binding sites for genotyping are indicated with arrows, with the direction of the arrow specifying the direction of amplification. (B) Schematic of the genomic structure of the miR-17~92flx/flx allele after cre-mediated recombination. Recombination results in loss of the cluster as well as the 5’ most reverse oligonucleotide.

140

Figure 5.7: Knockout of the miR-17~92 cluster can be achieved after constitutive expression of Cre (A) Representative Western Blot of Mcl-1 expression in SV40 transformed murine embryonic fibroblasts (MEFs) derived from E14.5 embryos of Mcl-1flx/flx mice. Cells were left uninfected (-), or infected (+) with the pFU cre PGK Hygro W lentivirus. Four days after infection, lysates were made. Membrane was probed with antibodies towards Mcl-1, cre and beta-actin as a loading control. (B) Representative genotyping pattern in heterozygote (flx/+), wild type (+/+) and conditional knockout (flx/flx) cells, before (-cre) and after (+cre) treatment with cre. Hoxb8 immortalised progenitor cells from all three genotypes were infected with a constitutive cre expressing lentivirus and selected for 14 days in hygromycin. At this timepoint, genomic DNA was extracted and PCR performed. dH20 indicates no DNA in PCR reaction. Wild type allele is indicated with a black arrow, loxp allele indicated with a green arrow and miR-17~92 deleted allele indicated with a red arrow.

141

Figure 5.8: Cre induction in wild type Hoxb8 and Hoxa9 immortalised progenitor cells elevates Bim and p21 expression. (A) Representative Western Blot of Bim and p21 expression in wild type Hoxb8 immortalised progenitor cells after cre treatment. Cells were cultured in the presence of IL-3 and 4-OHT and infected with the Doxycycline inducible cre lentivirus. Infected cells were treated for 72 hours with Doxycycline to induce cre expression and lysates were made. Membranes were probed with antibodies for Bim, p21 and cre. Beta actin is shown as a loading control. (B) As described in (A) however with Hoxa9 immortalised progenitor cells.

142

5.3.2 Hoxb8 and Hoxa9 immortalised miR-17~92flxflx progenitor cells lose clonogenic potential after cre expression To determine whether the induction of cre recombinase affected the survival and proliferation of Hoxb8 and Hoxa9 immortalised wild type and miR-17~92flx/flx progenitors, c-kit+ve/lin-ve progenitor cells derived from the fetal livers of miR-17~92flx/flx embryos were immortalised with lentivirus encoding constitutive expression of Hoxb8. Cells were also infected with a constitutive Hoxa9 lentivirus in parallel. The over- expression of Hoxa9 can immortalise myeloid progenitor cells, but Hoxa9 has no effect on Bim expression (Brumatti et al – manuscript submitted)(Calvo et al., 2000). Once immortalised, miR-17~92flx/flx progenitor cells were infected with the constitutive cre expressing lentivirus and selected for 14 days in hygromycin before plating in soft agar (Figure 5.9). This was to be certain that all colonies that grew after cre infection had deleted the miR-17~92 cluster. The clonogenic potential of all cell lines decreased after treatment with cre recombinase. In these experiments, cells immortalised by Hoxa9 over-expression produced an uncharacteristically low number of colonies, which was not exacerbated by cre expression. This result cannot be explained by any known factors considering that Hoxa9 immortalised miR-17~92flx/flx progenitors do no exhibit this reduction in colony number. The addition of further biological replicates may by more representative of true colony numbers.

5.3.3 Hoxb8 immortalised progenitor cells lacking miR-17~92 undergo negative selection in culture Given that both Hoxb8 and Hoxa9 immortalised miR-17~92flx/flx progenitor cells responded similarly to cre recombinase expression (Figure 5.8B), it was possible to assay the requirement for miR-17~92 expression for cell survival and proliferation by analysing the genotypes of colonies that grew up in soft agar. If miR-17~92 played no role in colony formation in both Hoxb8 and Hoxa9 immortalised progenitor cells, then the frequency of deletion would be comparable between both cell lines. To determine whether the colonies arising in soft agar after cre recombinase treatment had successfully deleted the miR-17~92 cluster, random colonies from soft agar cultures in Figure 5.9 were genotyped (Figure 5.10).

143

Figure 5.9: Expression of cre results in reduced clonogenicity in both Hoxa9 and Hoxb8 immortalised, wild type and miR-17~92flx/flx progenitor cells Hoxb8 and Hoxa9 immortalised wild type and miR-17~92flx/flx progenitor cells were infected (+) or not (-) with the constitutive cre expressing lentivirus. Fourteen days after selection in hygromycin, cells were placed into soft agar. Colonies were counted after 14 days and expressed as the number of colonies/1000 cells plated. Results are means ± SEM of two independent pools in three independent experiments.

144

A total of 41 and 42 colonies were selected across each of the independent experiments. Genomic DNA was extracted and the colonies typed for miR-17~92 alleles, as shown in Figure 5.7B. Given that the percentage of cells expressing cre recombinase would approach 100% after hygromycin treatment, the expectation was that miR-17~92 would be deleted in the majority of cells. The observed distribution of homozygous deletions, was, however, greatly below that expected, particularly in Hoxb8 immortalised progenitor cells. Only 14 percent of Hoxb8 immortalised progenitor colonies had deleted both miR-17~92 alleles, compared to 50 percent of Hoxa9 immortalised progenitor colonies (Figure 5.10A and B). Even if the rate of homozygous deletion of miR-17~92 in Hoxa9 immortalised progenitor cells represents the baseline efficiency of deletion, there is a clear selection against miR-17~92 deletion in Hoxb8 immortalised progenitor cells. These results show that the miR-17~92 cluster may be required to keep cells clonogenically viable by affecting survival and/or proliferation pathways. The effect of cre recombinase expression on colony growth makes it too difficult to verify the extent of Hoxb8 dependence on miR-17~92 for efficient immortalisation of haematopoietic cells. However, the bias to maintain at least one miR-17~92 allele in Hoxb8 immortalised cells, strongly suggests that miR-17~92 is required by Hoxb8 to maintain optimal survival and proliferation.

145

Figure 5.10: Hoxb8 immortalised miR-17~92flx/flx progenitor cells lacking both miR-17~92 alleles are selected against in prolonged culture conditions (A) Percentage of colonies genotyped after cre treatment and which have retained either both miR-17~92 alleles (flx/flx), one allele (-/flx), or no allele (-/-). Colonies derived from soft agar cultures after treatment with cre, as shown in Figure 5.9, were picked and cultured in liquid culture before genomic DNA was extracted. Colonies were scored depending on the genotyping pattern as described in Figure 5.7B. Forty- one Hoxb8 immortalised miR-17~92flx/flx colonies and 42 Hoxa9 immortalised miR- 17~92flx/flx colonies were genotyped. (B) Raw numbers of total genotyped colonies from (A). Chi-square test p-value is 0.00058.

146

5.4 Discussion Using a miRNA qRT-PCR array to analyse the expression profile of 641 miRNAs, I have detected 70 miRNAs in Hoxb8 immortalised progenitor cells whose expression is regulated in a Hoxb8-dependent manner. The expression of these miRNAs is either directly controlled by Hoxb8 or, perhaps more likely, these miRNAs are a central part of the differentiation and survival pathways that are regulated by Hoxb8 over- expression. Among these 70 miRNAs, all six guide strands from the miRNAs of the miR-17~92 cluster are expressed at elevated levels during Hoxb8 over-expression. Four of these miRNAs, miR-17-5p, miR-19a-3p, miR-19b-3p and miR-92-3p have been shown to target Bim mRNA. A target site for miR-17-5p is also found at the 3’UTR of p21, which is repressed during Hoxb8 over-expression. I examined the requirement for miR-17~92 mediated repression of Bim and p21 using Hoxb8 immortalised progenitor cell lines derived from a miR-17~92 conditional knock out mouse. While the detrimental effects of cre-recombinase prevented full elucidation of the requirement of miR-17~92 for cell survival and proliferation, preliminary results suggest that Hoxb8 may require this cluster for optimal clonogenicity. The complete list of key miR-17~92 targets beyond Bim and p21 remain to be determined.

5.4.1 miRNA mediated regulation of Bim The broad analysis of miRNAs in Hoxb8 immortalised progenitor cells narrowed down the possible miRNAs potentially involved in Bim repression. Of the 78 miRNAs that were predicted to bind Bim mRNA, only 12 miRNAs met all criteria, which included, a Ct value of no more than 35 and a significant decrease in expression upon Hoxb8 withdrawal. Eight of these miRNAs are from the miR-17~92 cluster, six as guide strands and two as star stands. The increase in all six miRNAs of the miR-17~92 cluster strongly suggests a role for this cluster in Hoxb8 mediated Bim repression. The link between Bim repression by miR-17~92 was first identified upon generation of a conditionally deleted miR-17~92 mouse model. While these mice did not survive after birth, repopulation of wild type mice with haematopoietic cells derived from miR- 17~92-/- embryos showed that B cell development was impaired at the pre-B cell stage (Ventura et al., 2008). Fewer cells were detected, which could be explained by the increased apoptosis as a result of elevated levels of Bim (Ventura et al., 2008). Transgenic mice with enforced expression of miR-17~92 in lymphocytes, exhibited

147

lower levels of Bim and PTEN (Xiao et al., 2008). This prevented the normal cell death of lymphocytes resulting in severe autoimmunity and the premature death of the mouse.

Two other miRNAs that made the final list of potential regulators of Bim were miR- 106b-3p and miR-25a-3p. These miRNAs are two of three miRNAs that make up the miR-106b~25 cluster. The miR-17~92 cluster has two paralogous clusters, miR- 106a~363 and miR-106b~25. miR-106b-3p and miR-25a-3p have identical binding sites to miR-17-5p and miR-92a-3p respectively, and can bind the same sites on the Bim 3’UTR (Mourelatos et al., 2002; Tanzer and Stadler, 2004). The over-expression of the miR-106b~25 cluster has been linked to esophageal adenocarcinoma as well as colorectal cancer (Kan et al., 2009; Nishida et al., 2012). miR-25a-3p could directly repress Bim expression while p21 was targeted by miR-106-3p (Kan et al., 2009). In a normal setting and in contrast to miR-17~92-/- models, mice lacking the miR-106b~25 are viable and show no obvious abnormalities (Ventura et al., 2008). The importance of miR-17~92 above miR-106b~25 in normal development suggests a greater requirement for and perhaps less redundancy on the part of miR-17~92. Greater dependency in normal development results in a more severe phenotype if aberrantly expressed. This would explain the increased frequency of miR-17~92 in oncogenesis over miR- 106b~25.

The upregulation of all miRNAs from the miR-17~92 cluster in Hoxb8 immortalised progenitor cells strongly suggests these miRNAs are involved in Bim repression. It was not possible to definitively establish, using these mice, a direct causal link between deletion of miR-17~92 and Bim and p21 upregulation independent of cre. It was possible to show that there was a selection against miR-17~92 cluster deletion in proliferating colonies, and that it is likely that Bim and p21 are important mediators of this effect. The over-expression of Cre recombinase has previously been reported to affect the proliferation of normal cells and this was no exception in Hoxb8 immortalised progenitor cell lines (Loonstra et al., 2001). The independent knock-down of miRNAs from this cluster will be another way in which Bim regulation by miR-17~92 could be examined with the added benefit of extracting the individual miRNAs that could be responsible for Bim regulation. miRNA knock down can be achieved with the use of miRNA inhibitors that use a technology known as LNA, or locked nucleic acid (Orom et al., 2006). These are antisense strands that capture and prevent miRNAs from

148

interacting with their target mRNAs. The use of a LNA increases the stability and hybridization properties of the oligonucleotide (Wengel et al., 2001)

5.4.2 The requirement for miR-17~92 expression in tumour progression In the context of tumour progression, ample evidence exists, which implicates the miR- 17~92 cluster as a bonafide oncogenic cluster. The chromosomal region housing the miR-17~92 cluster, 13q31-q32, is amplified in B-cell lymphomas and solid tumours such as gliomas, alveolar rhabdosarcoma and non-small cell lung cancer (Gordon et al., 2000; Ota et al., 2004). Leukaemia characterised by MLL translocations frequently exhibit elevated expression levels of this cluster as a consequence of direct binding of MLL-fusion products to the C13orf25 locus (Mi et al., 2010). The direct, enforced expression of this cluster enhanced proliferation and survival of leukemic cells, in part through the repression of the cyclin dependent kinase inhibitor, p21 (Mi et al., 2010; Wong et al., 2010). The development of Eµ-myc lymphoma models is absolutely dependent on the cluster, particularly through the miR-19b mediated repression of PTEN. Repression of PTEN ensured continuous signalling through the PI3K-AKT pathway and survival of these lymphomas (Mu et al., 2009; Olive et al., 2009).

A few instances have described tumour development through the miR-17~92 dependent repression of Bim. In models of therapy-resistant neuroblastoma with elevated MYCN levels, Bim repression as a result of upregulated miR-17~92 enhanced the growth potential of cells both in vitro and in vivo (Fontana et al., 2008). Independent reports have shown that elevated expression of miR-17~92 in Eµ-myc lymphomas is required for the survival of tumour cells while the loss of at least one allele of Bim can accelerate tumour progression (Egle et al., 2004; Mu et al., 2009). It is possible that elevated miR- 17~92, driven by c-myc, repress Bim expression in these lymphomas and promotes tumour formation. The over-expression of miR-19b in particular, which targets the Bim 3’UTR, is sufficient to decrease latency in tumour development (Olive et al., 2009).

5.4.3 Mechanisms of direct regulation of the miR-17~92 cluster The effect of miR-17~92 deletion on the survival and proliferation of both Hoxb8 and Hoxa9 immortalised progenitor cells may indicate that this miRNA cluster has an important role in Hox dependent immortalisation. Direct transcriptional regulators of

149

the cluster include fusion products of MLL-translocations, Egr-2 and c-myc. Both Egr-2 and MLL regulate the epigenetic signature surrounding the cluster to ready the locus for transcriptional activation. MLL, and to a greater extent, MLL-fusions, promote miR- 17~92 expression by H3 acetylation and H3K4 trimethylation of the upstream promoter region, C13orf25 (Mi et al., 2010). Egr-2 induces the differentiation of macrophages through the upregulation of the demethylase enzyme, Jarid1b, which represses the miR17~92 cluster leading to increased expression of EGR2, AML1, p21 and Bim (Pospisil et al., 2011). C-myc is a potent inducer of miR-17~92 cluster expression and participates in a negative feedback loop together with the transcription factor E2F1 (Aguda et al., 2008; O'Donnell et al., 2005).

Direct regulation of the miR-17~92 cluster by either Hoxb8 and Hoxa9 is also a possibility. The promoter region of C13orf25 contains one Hox binding site, which may be a target during elevated expression of these two Hox proteins. Reporter assays in which this site is mutated will give as an insight into whether direct Hoxb8 or Hoxa9 regulation of the cluster is possible. The greater dependency of Hoxb8 immortalised progenitor cells for miR-17~92 suggests that other Hoxb8 specific mechanisms exist that regulate the cluster or a regulated by the cluster. Comparisons between the expression of miR-17~92 in Hoxb8 and Hoxa9 immortalised progenitor cells will add insight into this model.

150

6.0 Conclusions

6.1 Revised model of Hoxb8 mediated immortalisation of myeloid progenitor cells The role of Hoxb8 in haematopoiesis has so far been restricted to regulating cell differentiation. The influence of Hoxb8 on differentiation can be extended to mechanisms by which over-expressed Hoxb8 promotes leukaemia, by enforcing a block in differentiation and promoting clonal proliferation. In this work, I have identified that over-expressed Hoxb8 also prevents apoptosis. In the presence of Hoxb8, myeloid progenitor cells remain responsive to survival and proliferative signals transduced through cytokine receptors such as IL-3. When Hoxb8 expression is lost, cells become refractory to these signals. Hoxb8 over-expression co-operates with IL-3 signalling to inhibit activation of the Bax and Bak dependent intrinsic cell death pathway. One mechanism by which Hoxb8 partly prevents activation of apoptosis is through the repression of the pro-apoptotic protein, Bim. This is indicated by the findings that Bim expression is low in the presence of Hoxb8 and rises after Hoxb8 down-regulation, even in the presence of IL-3. Deletion of Bim substantially delays the onset of apoptosis.

6.1.1 Is the oncogenic function of Hoxb8 mediated through Bim repression? Abundant evidence supports the role of Bim as a tumour suppressor. In murine models, deletion of Bim co-operates with the expression of other oncogenes such as c-myc to shorten the latency of lymphoma development (Egle et al., 2004). In humans, Bim expression is one of the predictors of responsiveness to corticosteroids during induction chemotherapy in childhood ALL (Bachmann et al., 2010). Further, a Bim polymorphism has been shown to be an independent predictor of the response to tyrosine kinase inhibitors in patients with CML (Ng et al., 2012). It is therefore possible that the repression of Bim is an important contributor to Hoxb8-dependent leukaemiagenesis. Some of the data represented in this thesis supports this theory. Bim-/- Hoxb8 immortalised progenitor cells were several-fold more clonogenic that wild type or even Bax-/-;Bak-/- Hoxb8 immortalised progenitor cells in the presence of normal IL-3 signalling and whilst Hoxb8 expression was maintained. This suggests that in Hoxb8- immortalised progenitor cells, deletion of Bim favours the selection of cells that have

151

the capacity to clonally proliferate. This is also supported by the surprising results that, in short-term assays, the deletion of Bim could slow cell cycle arrest after Hoxb8 withdrawal. These results suggests that Bim may have a role in negatively regulating cell cycle progression in a normal cell and a reduction in its expression, such as Hoxb8 mediated miRNA repression in the case of Hoxb8, would ensure that cells were cycling at an uninhibited rate. This would be most advantageous in a tumour setting. However, once cells begin to differentiate or commit to apoptosis following Hoxb8 withdrawal, deletion of Bim at best delayed apoptosis but was not sufficient to maintain viability in the long term. Thus it is likely that the repression of Bim does contribute to the oncogenic effects of Hoxb8 over-expression, however deletion of Bim does not provide a complete explanation.

6.1.2 Hoxb8 directly or indirectly regulates miRNA expression One of the most novel findings reported here is the regulation of multiple miRNAs by Hoxb8, including miRNAs from the miR-17~92 cluster. In the presence of Hoxb8, miR- 17~92 is expressed. When Hoxb8 is down-regulated, miR-17~92 expression also decreases. Among the mRNAs targeted by miRNAs from this cluster are those encoding Bim and p21. My data strongly support the hypothesis that Bim is a target repressed by the miR-17~92 cluster in the presence of Hoxb8 with evidence also supporting a role for the down-regulation of p21 (Conkrite et al., 2011; Fontana et al., 2008; Xiao et al., 2008). While further optimization is required to limit the influence of cre-mediated effects on Hoxb8 immortalised progenitor cells, early results suggest that miR-17~92 was required by Hoxb8 to maintain sufficient survival, proliferation and/or differentiation of Hoxb8 immortalised haematopoietic progenitor cells in the presence of IL-3. This is outlined in Figure 6.1. The question as to whether Hoxb8 directly controls the transcription of the miR-17~92 cluster was not established in this thesis. No commercially available Hoxb8-specific antibodies tested could robustly immunoprecipitate Hoxb8 under cross-linking conditions to permit ChIP-PCR or ChIP- sequencing experiments however FLAG-tagged Hoxb8 was successfully immunoprecipitated with anti-FLAG antibodies.

Hox genes have only been shown to regulate miRNAs within the Hox clusters as a means to control their temporal and spatial expression (Mansfield et al., 2012). We have

152

Figure 6.1 Revised model of Hoxb8 targets and function during myeloid progenitor cell immortalisation in the presence of IL-3. Hoxb8 over-expression represses the activation of Bax, Bak and Bim to promote cell survival. The Hoxb8 mediated repression of p21 and Bim could also be likely targets to promote continued cell proliferation. Hoxb8 can also prevent differentiation through mechanisms not yet clearly defined. The dotted black lines, indicate the potential targets of miRNAs regulated by Hoxb8, including miR-17~92. Cell survival, proliferation and differentiation pathways can all be targeted by miRNAs.

153

identified 70 other possible miRNA candidates that are regulated by Hoxb8. The screen I undertook used three independently generated Hoxb8 immortalised progenitor cells lines and compared miRNA expression in the presence or absence of Hoxb8. The 70 miRNAs identified where those whose expression significantly declined or increased across all three cell lines when Hoxb8 expression decreased. Clearly, the miRNAs whose expression depends in turn on Hoxb8 over-expression are those most likely to be directly regulated. The mechanisms regulating those miRNAs with increased levels after Hoxb8 down-regulation is less clear. The challenge now is to establish the importance of these miRNAs in Hoxb8 mediated immortalisation.

Several of these miRNAs have an already well-defined role in haematopoiesis and may fit into a model of Hoxb8 immortalisation. For example, miR-155 is found at elevated levels after Hoxb8 withdrawal. The expression of miR-155 has been linked to cell cycle arrest and apoptosis induction in myeloid cancer cell lines (Forrest et al., 2009). In contrast, transgenic expression of miR-155 increased tumourigenicity in B cell lymphomas (Eis et al., 2005; Kluiver et al., 2005). Clearly the oncogenic or tumour suppressor function of miR-155 may depend on variables such as the model used and the cell type. In Hoxb8 immortalised progenitor cells, the prediction would be that miRNAs such as miR-155, which are repressed after Hoxb8 withdrawal, are more likely to have oncogenic functions. miR-181 is another well defined AML-associated miRNA whose expression is increased slightly in conditions of Hoxb8 over-expression (Debernardi et al., 2007; Li et al., 2012c). miR-223, while highly expressed in the myeloid lineage is not found in AML however is elevated in several other tumour types including gastric cancer (Li et al., 2012a; Li et al., 2011). To determine whether any of these miRNAs are required for the function of Hoxb8 in a model of myeloid progenitor cell immortalisation, initial tests to over-express or repress expression of these miRNA are proposed. These initial experiments can pave the way for large-scale genome wide screens to identify multiple miRNA targets. These experiments are detailed further in Section 6.3.

Excitingly, I identified several miRNAs that as yet have no established roles in any mammalian biological systems. For example, miR-881, miR-1901, miR-2182 and miR- 1937, all of which are upregulated after Hoxb8 withdrawal, have not been connected to tumour formation or normal biological processes and were initially identified in a

154

screen of messenger-like non-coding RNAs (He et al., 2008). Further analysis of these miRNAs may establish a previously unknown role in regulating proliferation, survival or differentiation pathways in the haematopoietic system.

6.2 The use of miRNAs as targets for therapy The advent of miRNA-targeted therapeutics for cancer and viral treatments illustrates the relevance in pursuing miRNA targets of Hox expression. Both miRNA inhibitors and mimetics have been shown to successfully modulate miRNA expression and their specific effects (Choi et al., 2007; Ebert et al., 2007; Gumireddy et al., 2008; Krutzfeldt et al., 2005; Vester and Wengel, 2004). The efficacy of a locked nucleic acid (LNA) on miR-122 inhibition in the context of Hepatitis C viral infection is currently in phase II of human clinical trials (Elmen et al., 2008; Lanford et al., 2010) (Henke et al., 2008; Jopling et al., 2008; Jopling et al., 2005). The introduction of a miR-26a mimic through adenoviral-associated (AAV) infection to treat hepatocellular carcinoma has been successful in mice however no such models have reached human trials (Kota et al., 2009).

The use of miRNA targeted therapeutics in cancer treatment shows much promise however is yet to be trialed in humans. The knockdown of several miRNAs, including let-7, mir-21, miR-372 and miR-373 using in vivo mouse models, shows a dramatic ablation in tumour cell burden (Trang et al., 2010; Voorhoeve et al., 2006; Zhu et al., 2007). In the case of Hoxb8, the knock-down of miR-17~92 cluster miRNAs may have the effect of slowing down tumour progression or preventing tumour growth altogether. A comparison of miRNA screens already conducted for Hoxb8 (presented in this thesis), Hoxa9 (Hu et al., 2010) and AML samples characterized by Hox expression (Li et al., 2008) uncovers commonly upregulated miRNAs. miR-19b, miR-181c and miR- 124 are all upregulated in cell lines immortalised by Hoxb8 and Hoxa9 as well as leukaemias characterised by MLL tranlocations (for the case of miR-19b) and t(15;17) inversions (for miR-181c and miR-124). An ideal setting would exist in which the targeting of one or several miRNAs could successfully treat all Hox associated tumours.

Drugs targeting Hox genes have been proposed. The target interaction is the binding site between Hox proteins and their PBC cofactors. This interaction requires the

155

hexapeptide domain of Hox proteins and the structure has been solved for at least some Hox:Pbx dimers (LaRonde-LeBlanc and Wolberger, 2003; Merabet et al., 2003; Piper et al., 1999). A prototype, a peptide that matches the Hox hexapeptide has been used to block Hox:Pbx interactions. This has been tested in vitro and promising results were observed in several cancer cell lines including B cells, renal cancer and melanoma cell lines (Daniels et al., 2010; Morgan et al., 2007; Shears et al., 2008). There remain, however, significant caveats limiting this approach and major drug-design problems to be solved. For example, it appears that the Hox:Pbx interaction is not necessarily required for Hox over-expression to immortalise cells (Hudry et al., 2012). Further, Hox proteins from the Abd-B class do not bind to Pbx as readily as the labial and central classes (Chang et al., 1995). It is not clear how specificity for particular Hox:Pbx interactions could be built into any peptide or small molecule peptidomimetic.

6.3 Future directions Determining the physiological relevance of miRNA regulation by Hoxb8 is the main focus of future directions. The broad principal of this approach is to enforce or silence individual miRNA expression, in the presence or absence of Hoxb8. Any changes in survival, proliferation and differentiation would be examined. In this way, I could address the two principal questions that follow on from this work. Firstly, which miRNAs, if any, are necessary or sufficient to replicate the effects of Hoxb8 downregulation, and secondly, if any miRNA is necessary or sufficient to block the effects of Hoxb8 downregulation. This would provide a way to screen each regulated miRNA in vitro to prioritise those with the most profound biological effects before proceeding to conditional knockout or transgenic models. Another in vivo approach would be to use LNA to knockdown specific miRNAs and determine whether any are required for tumour development by enforced Hoxb8 and IL-3 expression. Alternatively, the enforced expression of miRNAs could be used to determine if tumour development was blocked or accelerated. My colleagues and I have already established lentiviral-mediated over-expression of several miRNAs identified in the screen. Examples of two of these miRNAs, miR-150 and miR-211 are shown in Figure 6.2. The expression of these miRNAs is induced by the addition of Doxycycline to the culture media. In the miRNA array, these two miRNAs were elevated only after Hoxb8

156

withdrawal. By over-expressing these miRNAs in the presence of Hoxb8, we can determine if either of these miRNAs is sufficient to replicate the effects of Hoxb8 down-regulation.

With reference to miR-17~92, the possibility of direct Hoxb8 binding to the miR-17~92 promoter will be explored. The promoter region of miR-17~92 contains a potential Hox/Meis1 binding site. A ChIP-on-ChIP or ChIP-PCR experiment to immunoprecipitate Hoxb8 and PCR any bound DNA, will determine whether Hoxb8 can bind in the vicinity of the miR-17~92 promoter. A ChIP-seq experiment, in which all possible DNA binding sites of Hoxb8 can be detected, will provide further information on all Hoxb8 targets. The limiting factor remains the appropriate antibody.

Another key question to be addressed is what are the mRNA targets of Hoxb8-regulated miRNAs? To address this, two high-throughput techniques can be utilized in cells in which expression of the specific miRNA is enforced. The expression of all RNA in cells in both the presence or absence of Hoxb8 can be measured by using RNA-seq. This process involves the direct sequencing of RNA to identify expression patterns of both RNA and miRNA with high specificity, resolution and low background noise (Jima et al., 2010; Mortazavi et al., 2008; Pickrell et al., 2010; Sultan et al., 2008; Sunkar et al., 2008; Wang et al., 2009). To complement the RNA-seq, a method to pull down and isolate miRNA:mRNA interactions called high-throughput sequencing of RNA isolated by cross-linked immunoprecipitation (HITS-CLIP), will be utilized (Chi et al., 2009; Zisoulis et al., 2010). In this approach, enrichment of mRNA targeted by miRNAs is achieved by cross-linking the interaction between the RNA Induced Silencing Complex (RISC) with the incorporated miRNA and mRNA target. This complex can be isolated by immunoprecipitation using antibodies towards the RISC associated protein, Argonaute. Together this approach can identify, on a large, high-throughput scale, the specific miRNAs that bind to mRNA to mediate their down-regulation. Bioinformatic as well as functional validation will be used to determine whether the identified mRNAs are valid miRNA targets. (Chen and Rajewsky, 2006; Friedman et al., 2009; Grimson et al., 2007; Krek et al., 2005; Lewis et al., 2005).

157

Figure 6.2: Conditional induction of miR-150 and miR-211 in Hoxb8 immortalised myeloid progenitor cells qRT-PCR analysis of miR-150 and miR-211 expression following doxycycline induction in Hoxb8 immortalised progenitor cells. Cells were cultured in the presence of IL-3 and 4- OHT and infected with the Doxycycline inducible lentivirus containing either the stem- loop structure of miR-150, miR-211 or an empty control. After sorting cells positive for Cherry Red expression, Doxycycline was added to the culture media and RNA extracted at zero and 48 hours after Doxycycline addition. miR-150 and miR-222 expression was analysed using the Taqman qRT-PCR assay and levels were normalized to miR-16. Results are means ± SEM of three independent experiments using three biological replicates.

158

In conclusion, I have found that the enforced expression of Hoxb8 in myeloid progenitor cells directly influences differentiation, proliferation and survival pathways. One mechanism in which Hoxb8 regulates these pathways is through the action of miRNAs, whose expression we have shown to be influenced by Hoxb8. While this thesis has suggested that the miR-17~92 cluster is required for the optimal survival and proliferation of Hoxb8 immortalised progenitor cells, a large number of other Hoxb8- regulated miRNAs have yet to be tested. This may unravel an as yet unrecognized role for miRNAs in contributing to Acute Myeloid Leukaemia dependent on dysregulated Hox gene expression.

159

160

7.0 References

Abdel-Fattah, R., Xiao, A., Bomgardner, D., Pease, C. S., Lopes, M. B., and Hussaini, I. M. (2006). Differential expression of HOX genes in neoplastic and non-neoplastic human astrocytes. The Journal of Pathology 209, 15-24. Abrams, J. M., Farrell, K., Grether, M. E., Steller, H., White, K., and Young, L. (1994). Genetic control of programmed cell death in Drosophila. Science 264, 677. Aguda, B. D., Kim, Y., Piper-Hunter, M. G., Friedman, A., and Marsh, C. B. (2008). MicroRNA regulation of a cancer network: Consequences of the feedback loops involving miR-17-92, E2F, and Myc. Proceedings of the National Academy of Sciences 105, 19678-19683. Akashi, K., and Traver, D. (2000). A clonogenic common myeloid progenitor that give rise to all myeloid lineages. Nature 404, 193-197. Alvarez-Silva, M., Belo-Diabangouaya, P., Salaun, J., and Dieterlen-Lievre, F. (2003). Mouse placenta is a major hematopoietic organ. Development 130, 5437-5444. Andersson, A. K., Miller, D. W., Lynch, J. A., Lemoff, A. S., Cai, Z., Pounds, S. B., Radtke, I., Yan, B., Schuetz, J. D., Rubnitz, J. E., et al. (2011). IDH1 and IDH2 mutations in pediatric acute leukemia. Leukemia 25, 1570-1577. Andreeff, M., Ruvolo, V., Gadgil, S., Zeng, C., Coombes, K., Chen, W., Kornblau, S., Baron, A. E., and Drabkin, H. A. (2008). HOX expression patterns identify a common signature for favorable AML. Leukemia 22, 2041-2047. Anguille, S., Smits, E. L. J. M., Cools, N., Goossens, H., Berneman, Z. N., and Van Tendeloo, V. F. I. (2009). Short-term cultured, interleukin-15 differentiated dendritic cells have potent immunostimulatory properties. Journal of Translational Medicine 7, 109-125. Antonchuk, J., Sauvageau, G., and Humphries, R. K. (2002). HoxB4 induced expansion of adult hematopoietic stem cells ex vivo. Cell 109, 39-45. Armitage, R. J., Macduff, B. M., Eisenman, J., Paxton, R., and Grabstein, K. H. (1995). IL-15 has stimulatory activity for the induction of B cell proliferation and differentiation. The Journal of Immunology 154, 483-490. Asli, N. S., and Kessel, M. (2010). Spatiotemporally restricted regulation of generic motor neuron programs by miR-196-mediated repression of Hoxb8. Developmental Biology 344, 857-868.

161

Austin, T. W., Solar, G. P., Ziegler, F. C., Liem, L., and Matthews, W. (1997). A Role for the Wnt Gene Family in Hematopoiesis: Expansion of Multilineage Progenitor Cells. Blood 89, 3624-3635. Auvray, C., Delahaye, A., Pflumio, F., Haddad, R., Amsellem, S., Miri-Nezhad, A., Broix, L., Yacia, A., Bulle, F., Fichelson, S., and Vigon, I. (2012). HOXC4 homeoprotein efficiently expands human hematopoietic stem cells and triggers similar molecular alterations as HOXB4. Haematologica 97, 168-178. Ayton, P. M., and Cleary, M. L. (2003). Transformation of myeloid progenitors by MLL oncoproteins is dependent on Hoxa7 and Hoxa9. Genes and Development 17, 2298-2307. Bach, C., Buhl, S., Mueller, D., Garcia-Cuellar, M., Maethner, E., and Slany, R. K. (2010). Leukemogenic transformation by HOXA cluster genes. Blood 115, 2910-2918. Bachmann, P. S., Piazza, R. G., Janes, M. E., Wong, N. C., Davies, C., Mogavero, A., Bhadri, V. A., Szymanska, B., Geninson, G., Magistroni, V., et al. (2010). Epigenetic silencing of BIM in glucocorticoid poor-responsive pediatric acute lymphoblastic leukemia, and its reversal by histone deacetylase inhibition. Blood 116, 3013-3022. Balgobind, B. V., Raimondi, S. C., Harbott, J., Zimmermann, M., Alonzo, T. A., Auvrignon, A., Beverloo, H. B., Chang, M., Creutzig, U., Dworzak, M. N., et al. (2009). Novel prognostic subgroups in childhood 11q23/MLL-rearranged acute myeloid leukemia: results of an international retrospective study. Blood 114, 2489-2496. Baselmann, S., Graninger, P., and Busslinger, M. (1993). A selective transcriptional induction system for mammalian cells based on Gal4-estrogen receptor fusion proteins. PNAS 90, 1657-1661. Begg, S. K., Radley, J. M., Pollard, J. W., Chisholm, O. T., Stanley, E. R., and Bertoncello, I. (1993). Delayed hematopoietic development in osteopetrotic (op/op) mice. The Journal of Experimental Medicine 177, 237-242. Beisel, C., Buness, A., Roustan-Espinosa, I. M., Koch, B., Schmitt, S., Haas, S. A., Hild, M., Katsuyama, T., and Paro, R. (2007). Comparing active and repressed expression states of genes controlled by the Polycomb/Trithorax group proteins. Proceedings of the National Academy of Sciences 104, 16615-16620. Bello, B. C., Hirth, F., and Gould, A. P. (2003). A Pulse of the Drosophila Hox Protein Abdominal-A Schedules the End of Neural Proliferation via Neuroblast Apoptosis. Neuron 37, 209-219.

162

Bernad, A., Kopf, M., Kulbacki, R., Weich, N., Koehler, G., and Gutierrez-Ramos, J. C. (1994). Interleukin-6 is required in vivo for the regulation of stem cells and committed progenitors of the hematopoietic system. Immunity 1, 725-731. Beroukhim, R., Mermel, C. H., Porter, D., Wei, G., Raychaudhuri, S., Donovan, J., Barretina, J., Boehm, J. S., Dobson, J., Urashima, M., et al. (2010). The landscape of somatic copy-number alteration across human cancers. Nature 463, 899-905. Besmer, P., Manova, K., Duttlinger, R., Huang, E. J., Packer, A., Gyssler, C., and Bachvarova, R. F. (1992). The kit-ligand (steel factor) and its receptor c- kit/W:pleiotropic roles in gametogenesis and melanogenesis. Dev Suppl, 125-137. Bijl, J., Thompson, A., Ramirez-Solis, R., Krosl, J., Grier, D. G., Lawrence, H. J., and Sauvageau, G. (2006). Analysis of HSC activity and compensatory Hox gene expression profile in Hoxb cluster mutant fetal liver cells. Blood 108, 116-122. Bijl, J., van Oostveen, J., Kreike, M., Rieger, E., van der Raaij-Helmer, L., Walboomers, J., Corte, G., Boncinelli, E., van den Brule, A., and Meijer, C. (1996). Expression of HOXC4, HOXC5, and HOXC6 in human lymphoid cell lines, leukemias, and benign and malignant lymphoid tissue. Blood 87, 1737-1745. Bijl, J. J., van Oostveen, J. W., Walboomers, J. J. M., Brink, A. T. P., Vos, W., Ossenkoppele, G. J., and Meijer, C. J. L. M. (1998). Differentiation and cell-type- restricted expression of HOXC4, HOXC5, HOXC6 in myeloid leukemias and normal myeloid cells. Leukemia 12, 1724-1732. Bischof, D., Pulford, K., Mason, D. Y., and Morris, S. W. (1997). Role of the nucleophosmin (NPM) portion of the non-Hodgkin's lymphoma-associated NPM- anaplastic lymphoma kinase fusion protein in oncogenesis. Molecular and Cellular Biology 17, 2312-2325. Bjornsson, J. M., Larsson, N., Brun, A. C. M., Magnusson, M., Andersson, E., Lundstrom, P., Larsson, J., Repetowska, E., Ehinger, M., Humphries, R. K., and Karlsson, S. (2003). Reduced Proliferative Capacity of Hematopoietic Stem Cells Deficient in Hoxb3 and Hoxb4. Molecular and Cellular Biology 23, 3872-3883. Blatt, C., Aberdam, D., Schwartz, R., and Sachs, L. (1988). DNA rearrangement of a homeobox gene in myeloid leukaemic cells. EMBO Journal 7, 4283-4290. Blatt, C., Lotem, J., and Sachs, L. (1992). Inhibition of Specific Pathways of Myeloid cells Differentiation by an Activated Hox-2.4 Homeobox Gene. Cell Growth and Differentiation 3, 671-676.

163

Blauvelt, A., Asada, H., Klaus-Kovtun, V., Altman, D. J., Lucey, D. R., and Katz, S. I. (1996). Interleukin-15 mRNA Is Expressed by Human Keratinocytes, Langerhans Cells, and Blood-Derived Dendritic Cells and Is Downregulated by Ultraviolet B Radiation. J Investig Dermatol 106, 1047-1052. Blin, M., Rabet, N., Deutsch, J. S., and Mouchel-Vielh, E. l. (2003). Possible implication of Hox genes Abdominal-B and abdominal-A in the specification of genital and abdominal segments in cirripedes. Development Genes And Evolution 213, 90-96. Bogue, C. W., Gross, I., Vasavada, H., Dynia, D. W., Wilson, C. M., and Jacobs, H. C. (1994). Identification of Hox genes in newborn lung and effects of gestational age and retinoic acid on their expression. American Journal of Physiology - Lung Cellular and Molecular Physiology 266, L448-L454. Bogue, C. W., Lou, L. J., Vasavada, H., Wilson, C. M., and Jacobs, H. C. (1996). Expression of Hoxb genes in the developing mouse foregut and lung. American Journal of Respiratory Cell and Molecular Biology 15, 163-171. Borer, R. A., Lehner, C. F., Eppenberger, H. M., and Nigg, E. A. (1989). Major nucleolar proteins shuttle between nucleus and cytoplasm. Cell 56, 379-390. Borrow, J., Shearman, A. A., Stanton Jr., V. P., Becher, R., Collins, T., J., W. A., Dube, I., Katz, F., L., K. Y., Morris, C., et al. (1996). The t(7;11)(p15;15) translocation in acute myeloid leukaemia fuses the genes for nucleoporin NUP98 and class I homeoprotein HOXA9. Nature Genetics 12, 159-169. Bouillet, P., Metcalf, D., Huang, D. C. S., Tarlinton, D. M., Kay, T. W., Kontgen, F., Adams, J. M., and Strasser, A. (1999). Proapoptotic Bcl-2 relative Bim required for certain apoptotic responses, Leukocyte homeostasis and to preclude autoimmunity. Science 286, 1735-1738. Bouillet, P., Purton, J. F., Godfrey, D. I., Zhang, L.-C., Coultas, L., Puthalakath, H., Pellegrini, M., Cory, S., Adams, J. M., and Strasser, A. (2002). BH3-only Bcl-2 family member Bim is required for apoptosis of autoreactive thymocytes. Nature 415, 922-926. Bouillet, P., Zhang, L. C., Huang, D., C.S., Webb, G. C., Bottema, C. D. K., Shore, P., Eyre, H. J., Sutherland, G. R., and Adams, J. M. (2001). Gene structure, alternative splicing, and chromosomal localization of pro-apoptotic Bcl-2 relative Bim. Mammalian Genome 12, 163-168. Boulet, A. M., and Capecchi, M. R. (1996). Targeted Disruption of Hoxc-4 Causes Esophageal Defects and Vertebral Transformations. Developmental Biology 177, 232- 249.

164

Breen, T. R., and Harte, P. J. (1991). Molecular characterization of the trithorax gene, a positive regulator of homeotic gene expression in Drosophila. Mechanisms of Development 35, 113-127. Breen, T. R., and Harte, P. J. (1993). Trithorax regulates multiple homeotic genes in the bithorax and Antennapedia complexes and exerts different tissue-specific, parasegment- specific and promoter-specific effects on each. Development 117, 119-134. Broudy, V., Lin, N., Brice, M., Nakamoto, B., and Papayannopoulou, T. (1991). Erythropoietin receptor characteristics on primary human erythroid cells. Blood 77, 2583-2590. Brumatti, G., Salmanidis, M., and Ekert, P. G. (2010). Crossing paths: interactions between the cell death machinery and growth factor survival signals. Cellular And Molecular Life Sciences: CMLS 67, 1619-1630. Brun, A. C. M., Bjornsson, J. M., Magnusson, M., Larsson, N., Leveen, P., Ehinger, M., Nilsson, E., and Karlsson, S. (2004). Hoxb4-deficient mice undergo normal hematopoietic development but exhibit a mild proliferation defect in hematopoietic stem cells. Blood 103, 4126-4133. Buccoliero, A., Castiglione, F., Degl’Innocenti, D., Ammanati, F., Giordano, F., Sanzo, M., Mussa, F., Genitori, L., and Taddei, G. (2009). Hox-D Genes Expression in Pediatric Low-grade Gliomas: Real-time-PCR Study. Cellular and Molecular Neurobiology 29, 1-6. Bullinger, L., Dohner, K., Bair, E., Frohling, S., Schlenk, R. F., Tibshirani, R., Dohner, H., and Pollack, J. R. (2004). Use of Gene-Expression Profiling to Identify Prognostic Subclasses in Adult Acute Myeloid Leukemia. New England Journal of Medicine 350, 1605-1616. Burglin, T. R. (1997). Analysis of TALE superclass homeobox genes (MEIS, PBC, KNOX, Iroquois, TGIF) reveals a novel domain conserved between plants and animals. Nucleic Acids Research 25, 4173-4180. Buza-Vidas, N., Cismasiu, V. B., Moore, S., Mead, A. J., Woll, P. S., Lutteropp, M., Melchiori, L., Luc, S., Bouriez-Jones, T., Atkinson, D., et al. (2012). Dicer is selectively important for the earliest stages of erythroid development. Blood. Calero-Nieto, F. J., Joshi, A., Bonadies, N., Kinston, S., Chan, W. I., Gudgin, E., Pridans, C., Landry, J. R., Kikuchi, J., Huntly, B. J., and Gottgens, B. (2013). HOX- mediated LMO2 expression in embryonic mesoderm is recapitulated in acute leukaemias. Oncogene.

165

Calvo, K. R., Sykes, D. B., Pasillas, M., and Kamps, M. P. (2000). Hoxa9 Immortalizes a Granulocyte-Macrophage Colony-Stimulating Factor-Dependent Promyelocyte Capable of Biphenotypic Differentiation to Neutrophils or Macrophages, Independent of Enforced Meis Expression. Mol Cell Biol 20, 3274-3285. Calvo, K. R., Sykes, D. B., Pasillas, M., and Kamps, M. P. (2002). Nup98-HoxA9 immortalizes myeloid progenitors, enforces expression of Hoxa9, Hoxa7 and Meis1, and alters cytokine-specific responses in a manner similar to that induced by retroviral co-expression of Hoxa9 and Meis1. Oncogene 21, 4247-4256. Cam, H. P., Chen, E. S., and Grewal, S. I. S. (2009). Transcriptional Scaffolds for Heterochromatin Assembly. Cell 136, 610-614. Canaani, E., Croce, C. M., Kraevski, V., Mazo, A., Nakamura, T., Petruk, S., Sedkov, Y., Smith, S., and Tillib, S. (2001). Trithorax and dCBP acting in a complex to maintain expression of a homeotic gene. (Reports). Science 294, 1331+. Cao, R., Tsukada, Y., and Zhang, Y. (2005). Role of Bmi-1 and Ring1A in H2A ubiquitylation and Hox gene silencing. Mol Cell 20, 845-854. Carson, W. E., Ross, M. E., Baiocchi, R. A., Marien, M. J., Boiani, N., Grabstein, K., and Caligiuri, M. A. (1995). Endogenous Production of Interleukin 15 by Activated Human Monocytes Is Critical for Optimal Production of Interferon-gamma by Natural Killer Cells In Vitro. Journal of clinical investigation 96, 2578-2582. Caserta, T. M., Smith, A. N., Gultice, A. D., Reedy, M. A., and Brown, T. L. (2003). Q- VD-OPh, a broad spectrum caspase inhibitor with potent antiapoptotic properties. Apoptosis 8, 345-352. Chabot, B., Stephenson, D. A., Chapman, V. M., Besmer, P., and Bernstein, A. (1988). The proto-oncogene c-kit encoding a transmembrane tyrosine kinase receptor maps to the mouse W locus. Nature 335, 88-89. Chang, C., Jacobs, Y., Nakamura, T., Jenkins, N. A., Copeland, N. G., and Cleary, M. L. (1997). Meis Proteins are Major In Vivo DNA Binding Partners for Wild-Type but Not Chimeric Pbx Proteins. Molecular and Cellular Biology 17, 5679-5687. Chang, C. P., Shen, W. F., Rozenfeld, S., Lawrence, H. J., Largman, C., and Cleary, M. L. (1995). Pbx proteins display hexapeptide-dependent cooperative DNA binding with a subset of Hox proteins. Genes and Development 9, 663-674. Charite, J., de Graaff, W., Consten, D., Reijnen, M. J., Korving, J., and Deschamps, J. (1998). Transducing positional information to the Hox genes: critical interaction of cdx

166

gene products with position-sensitive regulatory elements. Development 125, 4349- 4358. Chen, K., and Rajewsky, N. (2006). Natural selection on human microRNA binding sites inferred from SNP data. Nat Genet 38, 1452-1456. Chen, P., Nordstrom, W., Gish, B., and Abrams, J. M. (1996). grim, a novel cell death gene in Drosophila. Genes & Development 10, 1773-1782. Chen, S.-K., Tvrdik, P., Peden, E., Cho, S., Wu, S., Spangrude, G., and Capecchi, M. R. (2010). Hematopoietic Origin of Pathological Grooming in HoxB8 Mutant Mice. Cell 141, 775-785. Chen-Levy, Z., Nourse, J., and Cleary, M. L. (1989). The bcl-2 candidate proto- oncogene product is a 24-kilodalton integral-membrane protein highly expressed in lymphoid cell lines and lymphomas carrying the t(14;18) translocation. Molecular and Cellular Biology 9, 701-710. Chi, S. W., Zang, J. B., Mele, A., and Darnell, R. B. (2009). Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature 460, 479-486. Choi, W.-Y., Giraldez, A. J., and Schier, A. F. (2007). Target Protectors Reveal Dampening and Balancing of Nodal Agonist and Antagonist by miR-430. Science 318, 271-274. Christensen, J. L., Wright, D. E., Wagers, A. J., and Weissman, I. L. (2004). Circulation and Chemotaxis of Fetal Hematopoietic Stem Cells. PLoS Biol 2, e75. Christich, A., Kauppila, S., Chen, P., Sogame, N., Ho, S.-I., and Abrams, J. M. (2002). The Damage-Responsive Drosophila Gene sickle Encodes a Novel IAP Binding Protein Similar to but Distinct from reaper, grim, and hid. Current Biology 12, 137-140. Conkrite, K., Sundby, M., Mukai, S., Thomson, J. M., Mu, D., Hammond, S. M., and MacPherson, D. (2011). miR-17~92 cooperates with RB pathway mutations to promote retinoblastoma. Genes & Development 25, 1734-1745. Conradt, B., and Horvitz, H. R. (1998). The C. elegans Protein EGL-1 Is Required for Programmed Cell Death and Interacts with the Bcl-2-like Protein CED-9. Cell 93, 519- 529. Costinean, S., Sandhu, S. K., Pedersen, I. M., Tili, E., Trotta, R., Perrotti, D., Ciarlariello, D., Neviani, P., Harb, J., Kauffman, L. R., et al. (2009). Src homology 2 domain‚ containing inositol-5-phosphatase and CCAAT enhancer-binding protein are targeted by miR-155 in B cells of MiR-155 transgenic mice. Blood 114, 1374-1382.

167

Cragg, M. S., Kuroda, J., Puthalakath, H., Huang, D. C. S., and Strasser, A. (2007). Gefitinib-Induced Killing of NSCLC Cell Lines Expressing Mutant EGFR Requires BIM and Can Be Enhanced by BH3 Mimetics. PLoS Med 4, e316. Craxton, A., Draves, K. E., and Clark, E. A. (2007). Bim regulates BCR-induced entry of B cells into the cell cycle. European Journal of Immunology 37, 2715-2722. Dalton, W. J., Ahearn, M., McCredie, K., Freireich, E., Stass, S., and Trujillo, J. (1988). HL-60 cell line was derived from a patient with FAB-M2 and not FAB-M3. Blood 71, 242-247. Daniels, T. R., Neacato, I. I., Rodriguez, J. A., Pandha, H. S., Morgan, R., and Penichet, M. L. (2010). Disruption of HOX activity leads to cell death that can be enhanced by the interference of iron uptake in malignant B cells. Leukemia 24, 1555-1565. de Rosa, R., Grenier, J. K., Andreeva, T., Cook, C. E., Adoutte, A., Akam, M., Carroll, S. B., and Balavoine, G. (1999). Hox genes in brachiopods and priapulids and protostome evolution. Nature 399, 772-776. Debernardi, S., Skoulakis, S., Molloy, G., Chaplin, T., Dixon-McIver, A., and Young, B. D. (2007). MicroRNA miR-181a correlates with morphological sub-class of acute myeloid leukaemia and the expression of its target genes in global genome-wide analysis. Leukemia (08876924) 21, 912-916. Deguchi, Y., Moroney, J., and Kehrl, J. (1991). Expression of the HOX-2.3 homeobox gene in human lymphocytes and lymphoid tissues. Blood 78, 445-450. Di-Poi, N., Koch, U., Radtke, F., and Duboule, D. (2010). Additive and global functions of HoxA cluster genes in mesoderm derivatives. Developmental Biology 341, 488-498. Dijkers, P. F., Medema, R. H., Lammers, J.-W. J., Koenderman, L., and Coffer, P. J. (2000). Expression of the pro-apoptotic Bcl-2 family member Bim is regulated by the forkhead transcription factor FKHR-L1. Current Biology 10, 1201-1204. Ding, X., Yang, Z., Zhou, F., Wang, F., Li, X., Chen, C., Li, X., Hu, X., Xiang, S., and Zhang, J. (2013). Transcription factor AP-2alpha regulates acute myeloid leukemia cell proliferation by influencing Hoxa gene expression. The International Journal of Biochemistry & Cell Biology 45, 1647-1656. Diosdado, B., van de Wiel, M. A., Terhaar Sive Droste, J. S., Mongera, S., Postma, C., Meijerink, W. J. H. J., Carvalho, B., and Meijer, G. A. (2009). MiR-17-92 cluster is associated with 13q gain and c-myc expression during colorectal adenoma to adenocarcinoma progression. Br J Cancer 101, 707-714.

168

Dore, L. C., Amigo, J. D., dos Santos, C. O., Zhang, Z., Gai, X., Tobias, J. W., Yu, D., Klein, A. M., Dorman, C., Wu, W., et al. (2008). A GATA-1-regulated microRNA locus essential for erythropoiesis. Proceedings of the National Academy of Sciences 105, 3333-3338. Du, C., Fang, M., Li, Y., Li, L., and Wang, X. (2000). Smac, a Mitochondrial Protein that Promotes Cytochrome c, Dependent Caspase Activation by Eliminating IAP Inhibition. Cell 102, 33-42. Dull, T., Zufferey, R., Kelly, M., Mandel, R. J., Nguyen, M., Trono, D., and Naldini, L. (1998). A Third-Generation Lentivirus Vector with a Conditional Packaging System. Journal of Virology 72, 8463-8471. Dumon, S., Constantino Rosa Santos, S., Debierre-Grockiego, F., Gouilleux-Gruart, B., Cocault, L., Boucheron, C., Mollart, P., Gisselbrecht, S., and F, G. (1999). IL-3 dependent regulation of Bcl-xL gene expression by STAT5 in a bone marrow derived cell line. Oncogene 18, 4191-4199. Ebert, M. S., Neilson, J. R., and Sharp, P. A. (2007). MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells. Nat Meth 4, 721-726. Economides, K. D., Zeltser, L., and Capecchi, M. R. (2003). Hoxb13 mutations cause overgrowth of caudal spinal cordand tail vertebrae. Developmental Biology 256, 317- 330. Egle, A., Harris, A. W., Bouillet, P., and Cory, S. (2004). Bim is a suppressor of Myc- induced mouse B cell leukemia. Proceedings of the National Academy of Sciences of the United States of America 101, 6164-6169. Eis, P. S., Tam, W., Sun, L., Chadburn, A., Li, Z., Gomez, M. F., Lund, E., and Dahlberg, J. E. (2005). Accumulation of miR-155 and BIC RNA in human B cell lymphomas. Proceedings of the National Academy of Sciences of the United States of America 102, 3627-3632. Ekert, P. G., H., R. S., Silke, J., Marsden, V. S., Kaufmann, H., Hawkins, C. J., Gerl, R., Kumar, S., and Vaux, D. L. (2004). Apaf-1 and caspase-9 accelerate apoptosis, but do not determine whether factor-deprived or drug-treated cells die. Journal of Cellular Biology 165, 835-842. Ekert, P. G., Jabbour, A. M., Manoharan, A., Heraud, J. E., Yu, J., Pakusch, M., Michalak, E. M., Kelly, P. N., Callus, B., Keifer, T., et al. (2006). Cell Death provoked by loss of interleukin-3 signaling is independent of Bad, Bim and PI3 kinase, but depends in part on Puma. Blood 108, 1461.

169

Elmen, J., Lindow, M., Schutz, S., Lawrence, M., Petri, A., Obad, S., Lindholm, M., Hedtjarn, M., Hansen, H. F., Berger, U., et al. (2008). LNA-mediated microRNA silencing in non-human primates. Nature 452, 896-899. Enders, A., Bouillet, P., Puthalakath, H., Xu, Y., Tarlinton, D. M., and Strasser, A. (2003). Loss of the Pro-Apoptotic BH3-only Bcl-2 Family Member Bim Inhibits BCR Stimulation-induced Apoptosis and Deletion of Autoreactive B Cells. The Journal of Experimental Medicine 198, 1119-1126. Ewings, K. E., Hadfield-Moorhouse, K., Wiggins, C. M., Wickenden, J. A., Balmanno, K., Gilley, R., Degenhardt, K., White, E., and Cook, S. J. (2007). ERK1/2-dependent phosphorylation of BimEL promotes its rapid dissociation from Mcl-1 and Bcl-xL. EMBO J 26, 2856-2867. Ezekowitz, R. A., Sastry, K., Bailly, P., and Warner, A. (1990). Molecular characterization of the human macrophage mannose receptor: demonstration of multiple carbohydrate recognition-like domains and phagocytosis of yeasts in Cos-1 cells. The Journal of Experimental Medicine 172, 1785-1794. Faber, J., Krivtsov, A. V., Stubbs, M. C., Wright, R., Davis, T. N., van den Heuvel- Eibrink, M., Zwaan, C. M., Kung, A. L., and Armstrong, S. A. (2009). HOXA9 is required for survival in human MLL-rearranged acute leukemias. Blood 113, 2375- 2385. Falini, B., Mecucci, C., Tiacci, E., Alcalay, M., Rosati, R., Pasqualucci, L., La Starza, R., Diverio, D., Colombo, E., Santucci, A., et al. (2005). Cytoplasmic Nucleophosmin in Acute Myelogenous Leukemia with a Normal Karyotype. New England Journal of Medicine 352, 254-266. Fazi, F., Rosa, A., Fatica, A., Gelmetti, V., De Marchis, M. L., Nervi, C., and Bozzoni, I. (2005). A Minicircuitry Comprised of MicroRNA-223 and Transcription Factors NFI- A and C/EBPalpha Regulates Human Granulopoiesis. Cell 123, 819-831. Fischbach, N. A., Rozenfeld, S., Shen, W., Fong, S., Chrobak, D., Ginzinger, D., Kogan, S. C., Radhakrishnan, A., Le Beau, M. M., Largman, C., and Lawrence, H. J. (2005). HOXB6 overexpression in murine bone marrow immortalizes a myelomonocytic precursor in vitro and causes hematopoietic stem cell expansion and acute myeloid leukemia in vivo. Blood 105, 1456-1466. Fischle, W., Wang, Y., Jacobs, S. A., Kim, Y., Allis, C. D., and Khorasanizadeh, S. (2003). Molecular basis for the discrimination of repressive methyl-lysine marks in

170

histone H3 by Polycomb and HP1 chromodomains. Genes & Development 17, 1870- 1881. Fontana, L., Fiori, M. E., Albini, S., Cifaldi, L., Giovinazzi, S., Forloni, M., Boldrini, R., Donfrancesco, A., Federici, V., Giacomini, P., et al. (2008). Antagomir-17-5p Abolishes the Growth of Therapy-Resistant Neuroblastoma through p21 and BIM. PLoS ONE 3, e2236. Fontana, L., Pelosi, E., Greco, P., Racanicchi, S., Testa, U., Liuzzi, F., Croce, C. M., Brunetti, E., Grignani, F., and Peschle, C. (2007). MicroRNAs 17-5p-20a-106a control monocytopoiesis through AML1 targeting and M-CSF receptor upregulation. Nat Cell Biol 9, 775-787. Ford, A. M., Bennett, C. A., Price, C. M., Bruin, M. C. A., Van Wering, E. R., and Greaves, M. (1998). Fetal origins of the TEL-AML1 fusion gene in identical twins with leukemia. Proceedings of the National Academy of Sciences 95, 4584-4588. Forrest, A. R. R., Kanamori-Katayama, M., Tomaru, Y., Lassmann, T., Ninomiya, N., Takahashi, Y., de Hoon, M. J. L., Kubosaki, A., Kaiho, A., Suzuki, M., et al. (2009). Induction of microRNAs, mir-155, mir-222, mir-424 and mir-503, promotes monocytic differentiation through combinatorial regulation. Leukemia 25, 460-466. Fox, C. J., Hammerman, P. S., Cinalli, R. M., Master, S. R., Chodosh, L. A., and Thompson, C. B. (2003). The serine/threonine kinase Pim-2 is a transcriptionally regulated apoptotic inhibitor. Genes & Development 17, 1841-1854. Friedman, R. C., Farh, K. K.-H., Burge, C. B., and Bartel, D. P. (2009). Most mammalian mRNAs are conserved targets of microRNAs. Genome Research 19, 92- 105. Frohling, S., Schlenk, R. F., Breitruck, J., Benner, A., Kreitmeier, S., Tobis, K., Dohner, H., and Dohner, K. (2002). Prognostic significance of activating FLT3 mutations in younger adults (16 to 60 years) with acute myeloid leukemia and normal cytogenetics: a study of the AML Study Group Ulm. Blood 100, 4372-4380. Frohling, S., Schlenk, R. F., Stolze, I., Bihlmayr, J., Benner, A., Kreitmeier, S., Tobis, K., Dohner, H., and Dohner, K. (2004). CEBPA Mutations in Younger Adults With Acute Myeloid Leukemia and Normal Cytogenetics: Prognostic Relevance and Analysis of Cooperating Mutations. Journal of Clinical Oncology 22, 624-633. Frohling, S., Scholl, C., Gilliland, D. G., and Levine, R. L. (2005). Genetics of Myeloid Malignancies: Pathogenetic and Clinical Implications. Journal of Clinical Oncology 23, 6285-6295.

171

Fromental-Ramain, C., Warot, X., Messadecq, N., LeMeur, M., Dolle, P., and Chambon, P. (1996). Hoxa-13 and Hoxd-13 play a crucial role in the patterning of the limb autopod. Development 122, 2997-3011. Fukuhara, S., Rowley, J. D., Variakojis, D., and Golomb, H. M. (1979). Chromosome Abnormalities in Poorly Differentiated Lymphocytic Lymphoma. Cancer Research 39, 3119-3128. Gaidzik, V. I., Schlenk, R. F., Paschka, P., Stolzle, A., Spath, D., Kuendgen, A., von Lilienfeld-Toal, M., Brugger, W., Derigs, H. G., Kremers, S., et al. (2013). Clinical impact of DNMT3A mutations in younger adult patients with acute myeloid leukemia: results of the AML Study Group (AMLSG). Blood 121, 4769-4777. Garcia, D. M., Baek, D., Shin, C., Bell, G. W., Grimson, A., and Bartel, D. P. (2011). Weak seed-pairing stability and high target-site abundance decrease the proficiency of lsy-6 and other microRNAs. Nature Structural & Molecular Biology 18, 1139-1146. Garcia-Fernandez, J. (2005). The genesis and evolution of Homeobox gene clusters. Nature Reviews 6, 881-892. Gartel, A. L., Serfas, M. S., and Tyner, A. L. (1996). p21-Negative Regulator of the Cell Cycle. Proceedings of the Society for Experimental Biology and Medicine Society for Experimental Biology and Medicine (New York, NY) 213, 138-149. Garzon, R., Garofalo, M., Martelli, M. P., Briesewitz, R., Wang, L., Fernandez- Cymering, C., Volinia, S., Liu, C.-G., Schnittger, S., Haferlach, T., et al. (2008a). Distinctive microRNA signature of acute myeloid leukemia bearing cytoplasmic mutated nucleophosmin. Proceedings of the National Academy of Sciences 105, 3945- 3950. Garzon, R., Volinia, S., Liu, C.-G., Fernandez-Cymering, C., Palumbo, T., Pichiorri, F., Fabbri, M., Coombes, K., Alder, H., Nakamura, T., et al. (2008b). MicroRNA signatures associated with cytogenetics and prognosis in acute myeloid leukemia. Blood 111, 3183-3189. Gavathiotis, E., Suzuki, M., Davis, M. L., Pitter, K., Bird, G. H., Katz, S. G., Tu, H.-C., Kim, H., Cheng, E. H. Y., Tjandra, N., and Walensky, L. D. (2008). BAX activation is initiated at a novel interaction site. Nature 455, 1076-1081. Giampaolo, A., Pelosi, E., Valtieri, M., Montesoro, E., Sterpetti, P., Samoggia, P., Camagna, A., Mastroberardino, G., Gabbianelli, M., and Testa, U. (1995). HOXB gene expression and function in differentiating purified hematopoietic progenitors. Stem Cells (Dayton, Ohio) 13 Suppl 1, 90-105.

172

Giampaolo, A., Sterpetti, P., Bulgarini, D., Samoggia, P., Pelosi, E., Valtieri, M., and Peschle, C. (1994). Key functional role and lineage-specific expression of selected HOXB genes in purified hematopoietic progenitor differentiation. Blood 84, 3637-3647. Gilley, J., and Ham, J. (2005). Evidence for Increased Complexity in the Regulation of Bim Expression in Sympathetic Neurons: Involvement of Novel Transcriptional and Translational Mechanisms. DNA and Cell Biology 24, 563-573. Glaser, S. P., Lee, E. F., Trounson, E., Bouillet, P., Wei, A., Fairlie, W. D., Izon, D. J., Zuber, J., Rappaport, A. R., Herold, M. J., et al. (2012). Anti-apoptotic Mcl-1 is essential for the development and sustained growth of acute myeloid leukemia. Genes & Development 26, 120-125. Gocek, E., Wang, X., Liu, X., Liu, C.-G., and Studzinski, G. P. (2011). MicroRNA-32 Upregulation by 1,25-Dihydroxyvitamin D3 in Human Myeloid Leukemia Cells Leads to Bim Targeting and Inhibition of AraC-Induced Apoptosis. Cancer Research 71, 6230-6239. Golub, T. R., Barker, G. F., Bohlander, S. K., Hiebert, S. W., Ward, D. C., Bray-Ward, P., Morgan, E., Raimondi, S. C., Rowley, J. D., and Gilliland, D. G. (1995). Fusion of the TEL gene on 12p13 to the AML1 gene on 21q22 in acute lymphoblastic leukemia. Proceedings of the National Academy of Sciences 92, 4917-4921. Gong, Y., Somwar, R., Politi, K., Balak, M., Chmielecki, J., Jiang, X., and Pao, W. (2007). Induction of BIM Is Essential for Apoptosis Triggered by EGFR Kinase Inhibitors in Mutant EGFR-Dependent Lung Adenocarcinomas. PLoS Med 4, e294. Goodman, F. R. (2002). Limb malformations and the human HOX genes. American Journal of Medical Genetics 112, 256-265. Gordon, A. T., Brinkschmidt, C., Anderson, J., Coleman, N., Dockhorn-Dworniczak, B., Pritchard-Jones, K., and Shipley, J. (2000). A novel and consistent amplicon at 13q31 associated with alveolar rhabdomyosarcoma. Genes, Chromosomes and Cancer 28, 220-226. Greenberger, J. S., Sakakeeny, M. A., Humphries, R. K., Eaves, C. J., and Eckner, R. J. (1983). Demonstration of permanent factor-dependent multipotential (erythroid/neutrophil/basophil) hematopoietic progenitor cell lines. Proceedings of the National Academy of Sciences 80, 2931-2935. Greer, J. M., and Capecchi, M. R. (2002). Hoxb8 is Required for Normal Grooming Behaviour in Mice. Neuron 33, 23-34.

173

Greider, C., Chattopadhyay, A., Parkhurst, C., and Yang, E. (2002). BCL-xL and BCL2 delay Myc-induced cell cycle entry through elevation of p27 and inhibition of G1 cyclin-dependent kinases. Oncogene 21, 7765-7775. Grether, M. E., Abrams, J. M., Agapite, J., White, K., and Steller, H. (1995). The head involution defective gene of Drosophila melanogaster functions in programmed cell death. Genes & Development 9, 1694-1708. Griffiths-Jones, S. (2004). The microRNA Registry. Nucleic Acids Research 32, D109- D111. Griffiths-Jones, S., Grocock, R. J., van Dongen, S., Bateman, A., and Enright, A. J. (2006). miRBase: microRNA sequences, targets and gene nomenclature. Nucleic Acids Research 34, D140-D144. Griffiths-Jones, S., Saini, H. K., van Dongen, S., and Enright, A. J. (2008). miRBase: tools for microRNA genomics. Nucleic Acids Research 36, D154-D158. Grimson, A., Farh, K. K.-H., Johnston, W. K., Garrett-Engele, P., Lim, L. P., and Bartel, D. P. (2007). MicroRNA Targeting Specificity in Mammals: Determinants beyond Seed Pairing. Molecular Cell 27, 91-105. Gumireddy, K., Young, D. D., Xiong, X., Hogenesch, J. B., Huang, Q., and Deiters, A. (2008). Small-Molecule Inhibitors of MicroRNA miR-21 Function. Angewandte Chemie International Edition 47, 7482-7484. Guthridge, M. A., Stomski, F. C., Thomas, D., Woodcock, J. M., Bagley, C. J., Berndt, M. C., and Lopez, A. F. (1998). Mechanism of Activation of the GM-CSF, IL-3, and IL-5 Family of Receptors. Stem Cells 16, 301-313. Hacker, G., Suttner, K., Harada, H., and Kirschnek, S. (2006). TLR-dependent Bim phosphorylation in macrophages is mediated by ERK and is connected to proteasomal degradation of the protein. International Immunology 18, 1749-1757. Hannum, C., Culpepper, J., Campbell, D., McClanahan, T., Zurawski, S., Kastelein, R., Bazan, J. F., Hudak, S., Wagner, J., Mattson, J., et al. (1994). Ligand for FLT3/FLK2 receptor tyrosine kinase regulates growth of haematopoietic stem cells and is encoded by variant RNAs. Nature 368, 643-648. Hansen, G., Hercus, T. R., McClure, B. J., Stomski, F. C., Dottore, M., Powell, J., Ramshaw, H., Woodcock, J. M., Xu, Y., Guthridge, M., et al. (2008). The Structure of the GM-CSF Receptor Complex Reveals a Distinct Mode of Cytokine Receptor Activation. Cell 134, 496-507.

174

Happo, L., Cragg, M. S., Phipson, B., Haga, J. M., Jansen, E. S., Herold, M. J., Dewson, G., Michalak, E. M., Vandenberg, C. J., Smyth, G. K., et al. (2010). Maximal killing of lymphoma cells by DNA damage-inducing therapy requires not only the p53 targets Puma and Noxa, but also Bim. Blood 116, 5256-5267. Hara, T., and Miyajima, A. (1992). Two distinct functional high affinity receptors for mouse interleukine-3 (IL-3). The EMBO Journal 11, 1875-1884. Haselbeck, R. J., and McAlister-Henn, L. (1993). Function and expression of yeast mitochondrial NAD- and NADP-specific isocitrate dehydrogenases. Journal of Biological Chemistry 268, 12116-12122. Hayashita, Y., Osada, H., Tatematsu, Y., Yamada, H., Yanagisawa, K., Tomida, S., Yatabe, Y., Kawahara, K., Sekido, Y., and Takahashi, T. (2005). A Polycistronic MicroRNA Cluster, miR-17-92, Is Overexpressed in Human Lung Cancers and Enhances Cell Proliferation. Cancer Research 65, 9628-9632. Haylock, D., To, L., Dowse, T., Juttner, C., and Simmons, P. (1992). Ex vivo expansion and maturation of peripheral blood CD34+ cells into the myeloid lineage. Blood 80, 1405-1412. He, L., Thomson, J. M., Hemann, M. T., Hernando-Monge, E., Mu, D., Goodson, S., Powers, S., Cordon-Cardo, C., Lowe, S. W., Hannon, G. J., and Hammond, S. M. (2005). A microRNA polycistron as a potential human oncogene. Nature 435, 828-833. He, S., Su, H., Liu, C., Skogerbo, G., He, H., He, D., Zhu, X., Liu, T., Zhao, Y., and Chen, R. (2008). MicroRNA-encoding long non-coding RNAs. BMC Genomics 9, 236. Hengartner, M. O. (2000). The biochemistry of apoptosis. Nature 407, 770-776. Hengartner, M. O., Ellis, R., and Horvitz, R. (1992). Caenorhabditis elegans gene ced-9 protects cells from programmed cell death. Nature 356, 494-499. Hengartner, M. O., and Horvitz, H. R. (1994). C. elegans cell survival gene ced-9 encodes a functional homolog of the mammalian proto-oncogene bcl-2. Cell 76, 665- 676. Henke, J. I., Goergen, D., Zheng, J., Song, Y., Schuttler, C. G., Fehr, C., Junemann, C., and Niepmann, M. (2008). microRNA-122 stimulates translation of hepatitis C virus RNA. The EMBO Journal 27, 3300-3310. Hiebert, S. W., Sun, W., Davis, J. N., Golub, T., Shurtleff, S., Buijs, A., Downing, J. R., Grosveld, G., Roussell, M. F., Gilliland, D. G., et al. (1996). The t(12;21) translocation converts AML-1B from an activator to a repressor of transcription. Molecular and Cellular Biology 16, 1349-1355.

175

Hirano, T., Yasukawa, K., Harada, H., Taga, T., Watanabe, Y., Matsuda, T., Kashiwamura, S., Nakajima, K., Koyama, K., Iwamatsu, A., et al. (1986). Complementary DNA for a novel human interleukin (BSF-2) that induces B lymphocytes to produce immunoglobulin. Nature 324, 73-76. Hornstein, E., Mansfield, J. H., Yekta, S., Jimmy Kuang-Hsien, H., Harfe, B. D., McManus, M. T., Baskerville, S., Bartel, D. P., and Tabin, C. J. (2005). The microRNA miR-196 acts upstream of Hoxb8 and Shh in limb development. In, (Nature Publishing Group), pp. 671-674. Horton, S. J., Grier, D. G., McGonigle, G. J., Thompson, A., Morrow, M., De Silva, I., Moulding, D. A., Kioussis, D., Lappin, T. R. J., Brady, H. J. M., and Williams, O. (2005). Continuous MLL-ENL Expression Is Necessary to Establish a Hox Code and Maintain Immortalization of Hematopoietic Progenitor Cells. Cancer Research 65, 9245-9252. Hu, Y., Fong, S., Largman, C., and Shen, W.-F. (2010). HOXA9 regulates miR-155 in hematopoietic cells. Nucleic Acids Research 38, 5472-5478. Hu, Y., Passegue, E., Fong, S., Largman, C., and Lawrence, H. J. (2007). Evidence that the Pim1 kinase gene is a direct target of HOXA9. Blood 109, 4732-4738. Huang, Y., Sitwala, K., Bronstein, J., Sanders, D., Dandekar, M., Collins, C., Robertson, G., MacDonald, J., Cezard, T., Bilenky, M., et al. (2012). Identification and characterization of Hoxa9 binding sites in hematopoietic cells. Blood 119, 388-398. Hudry, B., Remacle, S., Delfini, M.-C., Rezsohazy, R., Graba, Y., and Merabet, S. (2012). Hox Proteins Display a Common and Ancestral Ability to Diversify Their Interaction Mode with the PBC Class Cofactors. PLoS Biol 10, e1001351. Hunger, S., Galili, N., Carroll, A., Crist, W., Link, M., and Cleary, M. (1991). The t(1;19)(q23;p13) results in consistent fusion of E2A and PBX1 coding sequences in acute lymphoblastic leukemias. Blood 77, 687-693. Hussain, S.-R. A., Cheney, C. M., Johnson, A. J., Lin, T. S., Grever, M. R., Caligiuri, M. A., Lucas, D. M., and Byrd, J. C. (2007). Mcl-1 Is a Relevant Therapeutic Target in Acute and Chronic Lymphoid Malignancies: Down-Regulation Enhances Rituximab- Mediated Apoptosis and Complement-Dependent Cytotoxicity. Clinical Cancer Research 13, 2144-2150. Inamori, K., Takeshita, K., Chiba, S., Yazaki, Y., and Hirai, H. (1993). Identification of Homeobox Genes Expressed in Human T-Lymphocytes. Biochemical and Biophysical Research Communications 196, 203-208.

176

Inomata, M., Tagawa, H., Guo, Y.-M., Kameoka, Y., Takahashi, N., and Sawada, K. (2009). MicroRNA-17-92 down-regulates expression of distinct targets in different B- cell lymphoma subtypes. Blood 113, 396-402. Ishizuka, T., Okayama, Y., Kobayashi, H., and Mori, M. (1999). Interleukin-3 production by mast cells from human lung. Inflammation 23, 25-35. Izon, D. J., Rozenfeld, S., Fong, S. T., Komuves, L., Largman, C., and Lawrence, H. J. (1998). Loss of Function of the Homeobox Gene Hoxa-9 Perturbs Early T-Cell Development and Induces Apoptosis in Primitive Thymocytes. Blood 92, 383-393. Jabbour, A. M., Daunt, C. P., Green, B. D., Vogel, S., Gordon, L., Lee, R. S., Silke, N., Pearson, R. B., Vandenberg, C. J., Kelly, P. N., et al. (2010). Myeloid progenitor cells lacking p53 exhibit delayed up-regulation of Puma and prolonged survival after cytokine deprivation. Blood 115, 344-352. Jabbour, A. M., Heraud, J. E., Daunt, C. P., Kaufmann, T., Sandow, J., O'Reilly, L. A., Callus, B. A., Lopez, A., Strasser, A., Vaux, D. L., and Ekert, P. G. (2009). Puma indirectly activates Bax to cause apoptosis in the absence of Bid or Bim. Cell Death Differ 16, 555-563. Jiang, J., Paez, J. G., Lee, J. C., Bo, R., Stone, R. M., DeAngelo, D. J., Galinsky, I., Wolpin, B. M., Jonasova, A., Herman, P., et al. (2004). Identifying and characterizing a novel activating mutation of the FLT3 tyrosine kinase in AML. Blood 104, 1855-1858. Jima, D. D., Zhang, J., Jacobs, C., Richards, K. L., Dunphy, C. H., Choi, W. W. L., Yan Au, W., Srivastava, G., Czader, M. B., Rizzieri, D. A., et al. (2010). Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs. Blood 116, e118-e127. Johnnidis, J. B., Harris, M. H., Wheeler, R. T., Stehling-Sun, S., Lam, M. H., Kirak, O., Brummelkamp, T. R., Fleming, M. D., and Camargo, F. D. (2008). Regulation of progenitor cell proliferation and granulocyte function by microRNA-223. Nature 451, 1125-1129. Johnson, G. R., and Moore, M. A. S. (1975). Role of stem cell migration in initiation of mouse foetal liver haemopoiesis. Nature 258, 726-728. Jones, H. W. J., McKusick, V. A., Harper, P. S., and Wuu, K. D. (1971). George Otto Gey. (1899-1970). The HeLa cell and a reappraisal of its origin. Obstet Gynecol 38, 945-949.

177

Jopling, C. L., Schutz, S., and Sarnow, P. (2008). Position-Dependent Function for a Tandem MicroRNA miR-122-Binding Site Located in the Hepatitis C Virus RNA Genome. Cell Host & Microbe 4, 77-85. Jopling, C. L., Yi, M., Lancaster, A. M., Lemon, S. M., and Sarnow, P. (2005). Modulation of Hepatitis C Virus RNA Abundance by a Liver-Specific MicroRNA. Science 309, 1577-1581. Kabrun, N., Buhring, H. J., Choi, K., Ullrich, A., Risau, W., and Keller, G. (1997). Flk- 1 expression defines a population of early embryonic hematopoietic precursors. Development 124, 2039-2048. Kamps, M. P., Look, A. T., and Baltimore, D. (1991). The human t(1;19) translocation in pre-B ALL produces multiple nuclear E2A-Pbx1 fusion proteins with differing transforming potentials. Genes & Development 5, 358-368. Kamps, M. P., Murre, C., Sun, X.-h., and Baltimore, D. (1990). A new homeobox gene contributes the DNA binding domain of the t(1;19) translocation protein in pre-B all. Cell 60, 547-555. Kan, T., Sato, F., Ito, T., Matsumura, N., David, S., Cheng, Y., Agarwal, R., Paun, B. C., Jin, Z., Olaru, A. V., et al. (2009). The miR-106b-25 Polycistron, Activated by Genomic Amplification, Functions as an Oncogene by Suppressing p21 and Bim. Gastroenterology 136, 1689-1700. Kasper, S., Breitenbuecher, F., Heidel, F., Hoffarth, S., Markova, B., Schuler, M., and Fischer, T. (2012). Targeting MCL-1 sensitizes FLT3-ITD-positive leukemias to cytotoxic therapies. Blood Cancer Journal 2, e60. Kawagoe, H., Humphries, R. K., Blair, A., Sutherland, H. J., and Hogge, D. E. (1999). Expression of HOX genes, HOX cofactors, and MLL in phenotypically and functionally defined subpopulations of leukemic and normal human hematopoietic cells. Leukemia (08876924) 13, 687. Kennedy, M. K., Glaccum, M., Brown, S. N., Butz, E. A., Viney, J. L., Embers, M., Matsuki, N., Charrier, K., Sedger, L., Willis, C. R., et al. (2000). Reversible Defects in Natural Killer and Memory Cd8 T Cell Lineages in Interleukin 15‚ÄìDeficient Mice. The Journal of Experimental Medicine 191, 771-780. Kenyon, C. (1986). A gene involved in the development of the posterior body region of C. elegans. Cell 46, 477-487.

178

King, I. F. G., Francis, N. J., and Kingston, R. E. (2002). Native and Recombinant Polycomb Group Complexes Establish a Selective Block to Template Accessibility To Repress Transcription In Vitro. Molecular and Cellular Biology 22, 7919-7928. Kirschnek, S., Ying, S., Fischer, S. F., Hacker, H., Villunger, A., Hochrein, H., and Hacker, G. (2005). Phagocytosis-Induced Apoptosis in Macrophages Is Mediated by Up-Regulation and Activation of the Bcl-2 Homology Domain 3-Only Protein Bim. The Journal of Immunology 174, 671-679. Kitada, S., Andersen, J., Akar, S., Zapata, J. M., Takayama, S., Krajewski, S., Wang, H.-G., Zhang, X., Bullrich, F., Croce, C. M., et al. (1998). Expression of Apoptosis- Regulating Proteins in Chronic Lymphocytic Leukemia: Correlations With In Vitro and In Vivo Chemoresponses. Blood 91, 3379-3389. Kiyoi, H., Naoe, T., Nakano, Y., Yokota, S., Minami, S., Miyawaki, S., Asou, N., Kuriyama, K., Jinnai, I., Shimazaki, C., et al. (1999). Prognostic Implication of FLT3 and N-RAS Gene Mutations in Acute Myeloid Leukemia. Blood 93, 3074-3080. Kluiver, J., Poppema, S., de Jong, D., Blokzijl, T., Harms, G., Jacobs, S., Kroesen, B.- J., and van den Berg, A. (2005). BIC and miR-155 are highly expressed in Hodgkin, primary mediastinal and diffuse large B cell lymphomas. The Journal of Pathology 207, 243-249. Knoepfler, P. S., and Kamps, M. P. (1995). The pentapeptide motif of Hox proteins is required for cooperative DNA binding with Pbx1, Physically contacts Pbx1, and enhances DNA binding by Pbx1. Molecular and Cellular Biology 15, 5811-5819. Knoepfler, P. S., Sykes, D. B., Pasillas, M., and Kamps, M. P. (2001). HoxB8 requires its Pbx-interaction motif to block differentiation of primary myeloid progenitors and of most cell line models of myeloid differentiation. Oncogene 20, 5440-5448. Kohl, T. M., Schnittger, S., Ellwart, J. W., Hiddemann, W., and Spiekermann, K. (2005). KIT exon 8 mutations associated with core-binding factor (CBF)‚ Acute myeloid leukemia (AML) cause hyperactivation of the receptor in response to stem cell factor. Blood 105, 3319-3321. Kondo, M., Weissman, I. L., and Akashi, K. (1997). Identification of Clonogenic Common Lymphoid Progenitors in Mouse Bone Marrow. Cell 91, 661-672. Kongsuwan, K., Allen, J., and Adams, J. M. (1989). Expression of Hox2.4 homeobox gene directed by proviral insertion in myeloid leukemia. Nucleic Acids Research 17, 1881-1892.

179

Kongsuwan, K., Webb, E., Housiaux, P., and Adams, J. M. (1988). Expression of multiple homeobox genes within diverse mammalian haematopoietic lineages. EMBO Journal 7, 2131-2138. Kopf, M., Baumann, H., Freer, G., Freudenberg, M., Lamers, M., Kishimoto, T., Zinkernagel, R., Bluethmann, H., and Kohler, G. (1994). Impaired immune and acute- phase responses in interleukin-6-deficient mice. Nature 368, 339-342. Koralov, S. B., Muljo, S. A., Galler, G. R., Krek, A., Chakraborty, T., Kanellopoulou, C., Jensen, K., Cobb, B. S., Merkenschlager, M., Rajewsky, N., and Rajewsky, K. (2008). Dicer Ablation Affects Antibody Diversity and Cell Survival in the B Lymphocyte Lineage. Cell 132, 860-874. Kota, J., Chivukula, R. R., O'Donnell, K. A., Wentzel, E. A., Montgomery, C. L., Hwang, H., Chang, T.-C., Vivekanandan, P., Torbenson, M., Clark, K. R., et al. (2009). Therapeutic microRNA Delivery Suppresses Tumorigenesis in a Murine Liver Cancer Model. Cell 137, 1005-1017. Kottaridis, P. D., Gale, R. E., Frew, M. E., Harrison, G., Langabeer, S. E., Belton, A. A., Walker, H., Wheatley, K., Bowen, D. T., Burnett, A. K., et al. (2001). The presence of a FLT3 internal tandem duplication in patients with acute myeloid leukemia (AML) adds important prognostic information to cytogenetic risk group and response to the first cycle of chemotherapy: analysis of 854 patients from the United Kingdom Medical Research Council AML 10 and 12 trials. Blood 98, 1752-1759. Koury, S., Koury, M., Bondurant, M., Caro, J., and Graber, S. (1989). Quantitation of erythropoietin-producing cells in kidneys of mice by in situ hybridization: correlation with hematocrit, renal erythropoietin mRNA, and serum erythropoietin concentration. Blood 74, 645-651. Kozomara, A., and Griffiths-Jones, S. (2011). miRBase: integrating microRNA annotation and deep-sequencing data. Nucleic Acids Research 39, D152-D157. Kozuma, Y., Ninomiya, H., Murata, S., Kono, T., Mukai, H. Y., and Kojima, H. (2010). The pro-apoptotic BH3-only protein Bim regulates cell cycle progression of hematopoietic progenitors during megakaryopoiesis. Journal of Thrombosis and Haemostasis 8, 1088-1097. Krajewska, M., Moss, S. F., Krajewski, S., Song, K., Holt, P. R., and Reed, J. C. (1996). Elevated Expression of Bcl-X and Reduced Bak in Primary Colorectal Adenocarcinomas. Cancer Research 56, 2422-2427.

180

Krek, A., Grun, D., Poy, M. N., Wolf, R., Rosenberg, L., Epstein, E. J., MacMenamin, P., da Piedade, I., Gunsalus, K. C., Stoffel, M., and Rajewsky, N. (2005). Combinatorial microRNA target predictions. Nat Genet 37, 495-500. Krishnaraju, K., Hoffman, B., and Liebermann, D. A. (1997). Lineage-Specific Regulation of Hematopoiesis by HOX-B8 (HOX-2.4): Inhibition of Granulocytic Differentiation and Potentiation of Monocytic Differentiation. Blood 90, 1840-1849. Krivtsov, A. V., and Armstrong, S. A. (2007). MLL translocations, histone modifications and leukaemia stem-cell development. Nature Reviews Cancer 7, 823- 833. Kroon, E., Krosl, J., Thorsteinsdottir, U., Baban, S., Buchberg, A. M., and Sauvageau, G. (1998). Hoxa9 transforms primary bone marrow cells through specific collaboration with Meis1a but not Pbx1b. EMBO J 17, 3714-3725. Kroon, E., Thorsteinsdottir, U., Mayotte, N., Nakamura, T., and Sauvageau, G. (2001). NUP98-HOXA9 expression in hemopoietic stem cells induces chronic and acute myeloid leukemias in mice. EMBO Journal 20, 350-361. Krutzfeldt, J., Rajewsky, N., Braich, R., Rajeev, K. G., Tuschl, T., Manoharan, M., and Stoffel, M. (2005). Silencing of microRNAs in vivo with 'antagomirs'. Nature 438, 685- 689. Kuchenbauer, F., Mah, S. M., Heuser, M., McPherson, A., Ruschmann, J., Rouhi, A., Berg, T., Bullinger, L., Argiropoulos, B., Morin, R. D., et al. (2011). Comprehensive analysis of mammalian miRNA* species and their role in myeloid cells. Blood 118, 3350-3358. Kuhn, R., Muller, W., and Rajewsky, K. (1991). Generation and analysis of interleukin- 4 deficient mice. Science 254, 707+. Lagos-Quintana, M., Rauhut, R., Meyer, J., Borkhardt, A., and Tuschl, T. (2003). New microRNAs from mouse and human. RNA 9, 175-179. Lanford, R. E., Hildebrandt-Eriksen, E. S., Petri, A., Persson, R., Lindow, M., Munk, M. E., Kauppinen, S., and Orum, H. (2010). Therapeutic Silencing of MicroRNA-122 in Primates with Chronic Hepatitis C Virus Infection. Science 327, 198-201. LaRonde-LeBlanc, N. A., and Wolberger, C. (2003). Structure of HoxA9 and Pbx1 bound to DNA:Hox hexapeptide and DNA recognition anterior to posterior. Genes and Development 17, 2060-2072. Lawrence, H. J., Christensen, J., Fong, S., Hu, Y.-L., Weissman, I. L., Sauvageau, G., Humphries, K., R., and Largman, C. (2005). Loss of expression of the Hoxa-9

181

homeobox gene impairs the proliferation and repopulating ability of hematopoietic stem cells. Blood 106, 3988-3994. Lawrence, H. J., Helgason, C. D., Sauvageau, G., Fong, S., Izon, D. J., Humphries, R. K., and Largman, C. (1997). Mice Bearing a Targeted Interruption of the Homeobox Gene HOXA9 Have Defects in Myeloid, Erythroid, and Lymphoid Hematopoiesis. Blood 89, 1922-1930. Lebert-Ghali, C., Fournier, M., Dickson, G. J., Thompson, A., Sauvageau, G., and Bijl, J. J. (2010). HoxA cluster is haploinsufficient for activity of hematopoietic stem and progenitor cells. Experimental Hematology 38, 1074-1086.e1075. Lemons, D., Pare, A., and McGinnis, W. (2012). Three Drosophila Hox Complex microRNAs Do Not Have Major Effects on Expression of Evolutionarily Conserved Hox Gene Targets during Embryogenesis. PLoS ONE 7, e31365. Lewis, B. P., Burge, C. B., and Bartel, D. P. (2005). Conserved Seed Pairing, Often Flanked by Adenosines, Indicates that Thousands of Human Genes are MicroRNA Targets. Cell 120, 15-20. Ley, T. J., Ding, L., Walter, M. J., McLellan, M. D., Lamprecht, T., Larson, D. E., Kandoth, C., Payton, J. E., Baty, J., Welch, J., et al. (2010). DNMT3A Mutations in Acute Myeloid Leukemia. New England Journal of Medicine 363, 2424-2433. Li, J., Guo, Y., Liang, X., Sun, M., Wang, G., De, W., and Wu, W. (2012a). MicroRNA-223 functions as an oncogene in human gastric cancer by targeting FBXW7/hCdc4. Journal of Cancer Research and Clinical Oncology 138, 763-774. Li, J., and Yen, C. (1997). PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate canc. Science 275, 1943. Li, L., Piloto, O., Kim, K., Ye, Z., Nguyen, B., Yu, X., Levis, M., Cheng, L., and Small, D. (2007). FLT3/ITD expression increases expansion, survival and entry into cell cycle of human haematopoietic stem/progenitor cells. British Journal of Haematology 137, 64-75. Li, X., Zhang, Y., Zhang, H., Liu, X., Gong, T., Li, M., Sun, L., Ji, G., Shi, Y., Han, Z., et al. (2011). miRNA-223 Promotes Gastric Cancer Invasion and Metastasis by Targeting Tumor Suppressor EPB41L3. Molecular Cancer Research 9, 824-833. Li, Y., Vecchiarelli-Federico, L. M., Li, Y., Egan, S. E., Spaner, D., Hough, M. R., and Ben-David, Y. (2012b). The miR-17-92 cluster expands multipotent hematopoietic progenitors whereas imbalanced expression of its individual oncogenic miRNAs promotes leukemia in mice. Blood 119, 4486-4498.

182

Li, Z., Huang, H., Li, Y., Jiang, X., Chen, P., Arnovitz, S., Radmacher, M. D., Maharry, K., Elkahloun, A., Yang, X., et al. (2012c). Up-regulation of a HOXA-PBX3 homeobox-gene signature following down-regulation of miR-181 is associated with adverse prognosis in patients with cytogenetically abnormal AML. Blood 119, 2314- 2324. Li, Z., Lu, J., Sun, M., Mi, S., Zhang, H., Luo, R. T., Chen, P., Wang, Y., Yan, M., Qian, Z., et al. (2008). Distinct microRNA expression profiles in acute myeloid leukemia with common translocations. Proceedings of the National Academy of Sciences 105, 15535-15540. Li, Z., Zhang, Z., Li, Y., Arnovitz, S., Chen, P., Huang, H., Jiang, X., Hong, G., Kunjamma, R. B., Ren, H., et al. (2013). PBX3 is an important cofactor of HOXA9 in leukemogenesis. Blood 121, 1422-1431. Liang, D. C., Shih, L. Y., Huang, C. F., Hung, I. J., Yang, C. P., Liu, H. C., Jaing, T. H., Wang, L. Y., and Chang, W. H. (2004). CEBP[alpha] mutations in childhood acute myeloid leukemia. Leukemia 19, 410-414. Lieschke, G., Grail, D., Hodgson, G., Metcalf, D., Stanley, E., Cheers, C., Fowler, K., Basu, S., Zhan, Y., and Dunn, A. (1994). Mice lacking granulocyte colony-stimulating factor have chronic neutropenia, granulocyte and macrophage progenitor cell deficiency, and impaired neutrophil mobilization. Blood 84, 1737-1746. Lim, L. P., Glasner, M. E., Yekta, S., Burge, C. B., and Bartel, D. P. (2003). Vertebrate MicroRNA Genes. Science 299, 1540. Lindsten, T., Ross, A. J., King, A., Zong, W., Rathmell, J. C., Shiels, H. A., Ulrich, E., Waymire, K. G., Mahar, P., Frauwirth, K., et al. (2000). The Combined Functions of Proapoptotic Bcl-2 Family Members Bak and Bax Are Essential for Normal Development of Multiple Tissues. Molecular Cell 6, 1389-1399. Linette, G. P., Li, Y., Roth, K., and Korsmeyer, S. J. (1996). Cross talk between cell death and cell cycle progression: BCL-2 regulates NFAT-mediated activation. Proceedings of the National Academy of Sciences 93, 9545-9552. Liu, H., Strauss, T. J., Potts, M. B., and Cameron, S. (2005). Direct regulation of egl-1 and of programmed cell death by the Hox protein MAB-5 and by CEH-20, a C. elegans homolog of Pbx1. Development 133, 641-650. Lluis, J. M., Nachbur, U., Cook, W. D., Gentle, I. E., Moujalled, D., Moulin, M., Wong, W. W., Khan, N., Chau, D., Callas, B. A., et al. (2010). TAK1 is required for survival

183

of mouse fibroblasts treated with TRAIL, and does so by NF-kappaB dependent induction of cFLIPL. Plos One 5, e8620. Lohmann, I., McGinnis, N., Bodmer, M., and McGinnis, W. (2002). The Drosophila Hox Gene Deformed Sculpts Head Morphology via Direct Regulation of the Apoptosis Activator reaper. Cell 110, 457-466. Loonstra, A., Vooijs, M., Beverloo, H. B., Allak, B. A., van Drunen, E., Kanaar, R., Berns, A., and Jonkers, J. (2001). Growth inhibition and DNA damage induced by Cre recombinase in mammalian cells. Proceedings of the National Academy of Sciences 98, 9209-9214. Lopez, A. F., Eglinton, J. M., Lyons, A. B., Tapley, P. M., To, L. B., Park, L. S., Clark, S. C., and Vadas, M. A. (1990). Human Interleukin-3 inhibits the binding of granulocyte-macrophage colony-stimulating factor and interleukin-5 to basophils and strongly enhances their functional activity. Journal of Cellular Physiology 145, 69-77. Lowell, C. A., and Berton, G. (1999). Integrin signal transduction in myeloid leukocytes. Journal of Leukocyte Biology 65, 313-320. Lutterbach, B., Hou, Y., Durst, K. L., and Hiebert, S. W. (1999). The inv(16) encodes an acute myeloid leukemia 1 transcriptional corepressor. Proceedings of the National Academy of Sciences 96, 12822-12827. Macdonald, A., Campbell, D. G., Toth, R., McLauchlan, H., Hastie, C. J., and Arthur, J. S. C. (2006). Pim kinases phosphorylate multiple sites on Bad and promote 14-3-3 binding and dissociation from Bcl-XL. BMC Cell Biology 7, 1-14. Mach, N., Lantz, C. S., Galli, S. J., Reznikoff, G., Mihm, M., Small, C., Granstein, R., Beissert, S., Sadelain, M., Mulligan, R. C., and Dranoff, G. (1998). Involvement of Interleukin-3 in Delayed-Type Hypersensitivity. Blood 91, 778-783. Maehama, T., and Dixon, J. E. (1998). The Tumor Suppressor, PTEN/MMAC1, Dephosphorylates the Lipid Second Messenger, Phosphatidylinositol 3,4,5- Trisphosphate. Journal of Biological Chemistry 273, 13375-13378. Mansfield, J. H., McGlinn, E., and Eran, H. (2012). Chapter two - Evolution, Expression, and Developmental Function of Hox-Embedded miRNAs. In Current Topics in Developmental Biology, (Academic Press), pp. 31-57. Marcucci, G., Mrozek, K., Radmacher, M. D., Garzon, R., and Bloomfield, C. D. (2011). The prognostic and functional role of microRNAs in acute myeloid leukemia. Blood 117, 1121-1129.

184

Mason, K. D., Carpinelli, M. R., Fletcher, J. I., Collinge, J. E., Hilton, A. A., Ellis, S., Kelly, P. N., Ekert, P. G., Metcalf, D., Roberts, A. W., et al. (2007). Programmed Anuclear Cell Death Delimits Platelet Life Span. Cell 128, 1173-1186. Medina-Martinez, O., and Ramirez-Solis, R. (2003). In vivo mutagenesis of the Hoxb8 hexapeptide domain leads to dominant homeotic transformations that mimic the loss-of- function mutations in genes of the Hoxb cluster. Developmental Biology 264, 77-90. Medvinsky, A., and Dzierzak, E. (1996). Definitive Hematopoiesis Is Autonomously Initiated by the AGM Region. Cell 86, 897-906. Meijerink, J. P. P., Mensink, E. J. B. M., Wang, K., Sedlak, T. W., Sloetjes, A. W., de Witte, T., Waksman, G., and Korsmeyer, S. J. (1998). Hematopoietic Malignancies Demonstrate Loss-of-Function Mutations of BAX. Blood 91, 2991-2997. Merabet, S., Kambris, Z., Capovilla, M., Berenger, H., Pradel, J., and Graba, Y. (2003). The Hexapeptide and Linker Regions of the AbdA Hox Protein Regulate Its Activating and Repressive Functions. Developmental Cell 4, 761-768. Metcalf, D., and Burgess, A. W. (1982). Clonal analysis of progenitor cell commitment to granulocyte or macrophage production. Journal of Cellular Physiology 111, 275-283. Metcalf, D., Moore, M. A. S., and Warner, N. L. (1969). Colony formation In Vitro by Myelomonocytic Leukemic Cells. Journal of the National Cancer Institute 43, 983- 1001. Meyer, C., Kowarz, E., Hofmann, J., Renneville, A., Zuna, J., Trka, J., Ben Abdelali, R., Macintyre, E., De Braekeleer, E., De Braekeleer, M., et al. (2009). New insights to the MLL recombinome of acute leukemias. Leukemia 23, 1490-1499. Meyers, S., Lenny, N., and Hiebert, S. W. (1995). The t(8;21) fusion protein interferes with AML-1B-dependent transcriptional activation. Molecular and Cellular Biology 15, 1974-1982. Mi, S., Li, Z., Chen, P., He, C., Cao, D., Elkahloun, A., Lu, J., Pelloso, L. A., Wunderlich, M., Huang, H., et al. (2010). Aberrant overexpression and function of the miR-17-92 cluster in MLL-rearranged acute leukemia. Proceedings of the National Academy of Sciences 107, 3710-3715. Migliaccio, G., Migliaccio, A. R., Valinsky, J., Langley, K., Zsebo, K., Visser, J. W., and Adamson, J. W. (1991). Stem cell factor induces proliferation and differentiation of highly enriched murine hematopoietic cells. Proceedings of the National Academy of Sciences 88, 7420-7424.

185

Milne, T. A., Kim, J., Wang, G. G., Stadler, S. C., Basrur, V., Whitcomb, S. J., Wang, Z., Ruthenburg, A. J., Elenitoba-Johnson, K. S. J., Roeder, R. G., and Allis, C. D. (2010). Multiple Interactions Recruit MLL1 and MLL1 Fusion Proteins to the HOXA9 Locus in Leukemogenesis. Molecular Cell 38, 853-863. Molitoris, J. K., McColl, K. S., and Distelhorst, C. W. (2011). Glucocorticoid-Mediated Repression of the Oncogenic microRNA Cluster miR-17~92 Contributes to the Induction of Bim and Initiation of Apoptosis. Molecular Endocrinology 25, 409-420. Moore, M. A. S., and Metcalf, D. (1970). Ontogeny of the Haemopoietic System: Yolk Sac Origin of In Vivo and In Vitro Colony Forming Cells in the Developing Mouse Embryo. British Journal of Haematology 18, 279-296. Moretti, P., Simmons, P., Thomas, P., Haylock, D., Rathjen, P., Vadas, M., and D'Andrea, R., (1994). Identification of homeobox genes expressed in human haematopoietic progenitor cells. Gene 144, 213-219. Morgado, E., Albouhair, S., and Lavau, C. (2007). Flt3 is dispensible to the Hoxa9/Meis1 leukemogenic cooperation. Blood 109, 4020-4022. Morgan, R., Pirard, P. M., Shears, L., Sohal, J., Pettengell, R., and Pandha, H. S. (2007). Antagonism of HOX/PBX Dimer Formation Blocks the In vivo Proliferation of Melanoma. Cancer Research 67, 5806-5813. Morris, S., Kirstein, M., Valentine, M., Dittmer, K., Shapiro, D., Saltman, D., and Look, A. (1994). Fusion of a kinase gene, ALK, to a nucleolar protein gene, NPM, in non- Hodgkin's lymphoma. Science 263, 1281-1284. Morrison, S. J., Hemmati, H. D., Wandycz, A. M., and Weissman, I. L. (1995). The purification and characterization of fetal liver hematopoietic stem cells. Proceedings of the National Academy of Sciences 92, 10302-10306. Morrison, S. J., Wandycz, A. M., Hemmati, H. D., Wright, D. E., and Weissman, I. L. (1997). Identification of a lineage of multipotent hematopoietic progenitors. Development 124, 1929-1939. Morrison, S. J., and Weissman, I. L. (1994). The long-term repopulating subset of hematopoietic stem cells is deterministic and isolatable by phenotype. Immunity 1, 661- 673. Mortazavi, A., Williams, B. A., McCue, K., Schaeffer, L., and Wold, B. (2008). Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nature Methods 5, 621-628.

186

Moskow, J. J., Bullrich, F., Huebner, K., Daar, I. O., and Buchberg, A. M. (1995). Meis1, a PBX1-related homeobox gene involved in myeloid leukemia in BXH-2 mice. Molecular and Cellular Biology 15, 5434-5443. Mourelatos, Z., Dostie, J., Paushkin, S., Sharma, A., Charroux, B., Abel, L., Rappsilber, J., Mann, M., and Dreyfuss, G. (2002). miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs. Genes & Development 16, 720-728. Mu, P., Han, Y., Betel, D., Yao, E., Squatrito, M., Ogrodowski, P., de Stanchina, E., D'Andrea, A., Sander, C., and Ventura, A. (2009). Genetic dissection of the miR-17~92 cluster of microRNAs in Myc-induced B-cell lymphomas. Genes & Development 23, 2806-2811. Mui, A. L., Wakao, H., Kitamura, T., and Miyajima, A. (1996). Suppression of interleukin-3-induced gene expression by a C-terminal truncated Stat5: role of Stat5 in proliferation. EMBO J 15, 2425-2433. Muljo, S. A., Ansel, K. M., Kanellopoulou, C., Livingston, D. M., Rao, A., and Rajewsky, K. (2005). Aberrant T cell differentiation in the absence of Dicer. The Journal of Experimental Medicine 202, 261-269. Nakamura, T., Largaespada, D. A., Lee, M. P., Johnson, L. A., Ohyashiki, K., Toyama, K., Chen, S. J., Willman, C. L., Chen, I. M., Feinberg, A. P., et al. (1996). Fusion of the nucleoporin gene NUP98 to HOXA9 by the chromosome translocation t(7;11)(p15;p15) in human myeloid leukaemia. Nature Genetics 12, 154-158. Nakao, M., Yokota, S., Iwai, T., Kaneko, H., Horiike, S., Kashima, K., Sonodo, Y., Fujimoto, T., and Misawa, S. (1996). Internal tandem duplication of the flt3 gene found in acute myeloid leukemia. Leukemia 10, 1911-1918. Nassif, C., Daniel, A., Lengyel, J. A., and Hartenstein, V. (1998). The Role of Morphogenetic Cell Death during Drosophila Embryonic Head Development. Developmental Biology 197, 170-186. Navarro, A., Bea, S., Fernandez, V., Prieto, M., Salaverria, I., Jares, P., Hartmann, E., Mozos, A., Lopez-Guillermo, A., Villamor, N., et al. (2009). MicroRNA Expression, Chromosomal Alterations, and Immunoglobulin Variable Heavy Chain Hypermutations in Mantle Cell Lymphomas. Cancer Research 69, 7071-7078. Neubauer, A., Dodge, R., George, S., Davey, F., Silver, R., Schiffer, C., Mayer, R., Ball, E., Wurster-Hill, D., and Bloomfield, C. (1994). Prognostic importance of mutations in the ras proto-oncogenes in de novo acute myeloid leukemia. Blood 83, 1603-1611.

187

Neubauer, H., Cumano, A., Muller, M., Wu, H., Huffstadt, U., and Pfeffer, K. (1998). Jak2 Deficiency Defines an Essential Developmental Checkpoint in Definitive Hematopoiesis. Cell 93, 397-409. Neuteboom, S. T. C., Peltenburg, L. T. C., van Duk, M. A., and Murre, C. (1995). The hexapeptide LFPWMR in Hoxb-8 is required for cooperative DNA binding with Pbx1 and Pbx2 proteins. Proceedings of the National Academy of Science 92, 9166-9179. Ng, K. P., Hillmer, A. M., Chuah, C. T. H., Juan, W. C., Ko, T. K., Teo, A. S. M., Ariyaratne, P. N., Takahashi, N., Sawada, K., Fei, Y., et al. (2012). A common BIM deletion polymorphism mediates intrinsic resistance and inferior responses to tyrosine kinase inhibitors in cancer. Nature Medicine 18, 521-528. Nicola, N. A. (1989). Hemopoietic Cell Growth Factors and Their Receptors. Annual Review of Biochemistry 58, 45-77. Ning, Z., Li, J., McGuinness, M., and Arceci, R. J. (2001). STAT3 activity is required for Asp816 mutant c-Kit induced tumourigenicity. Oncogene 20, 4528-4536. Nishida, N., Nagahara, M., Sato, T., Mimori, K., Sudo, T., Tanaka, F., Shibata, K., Ishii, H., Sugihara, K., Doki, Y., and Mori, M. (2012). Microarray Analysis of Colorectal Cancer Stromal Tissue Reveals Upregulation of Two Oncogenic miRNA Clusters. Clinical Cancer Research 18, 3054-3070. Nourse, J., Mellentin, J. D., Galili, N., Wilkinson, J., Stanbridge, E., Smith, S. D., and Cleary, M. L. (1990). Chromosomal translocation t(1;19) results in synthesis of a homeobox fusion mRNA that codes for a potential chimeric transcription factor. Cell 60, 535-545. O'Connell, R. M., Chaudhuri, A. A., Rao, D. S., and Baltimore, D. (2009). Inositol phosphatase SHIP1 is a primary target of miR-155. Proceedings of the National Academy of Sciences 106, 7113-7118. O'Connell, R. M., Rao, D. S., Chaudhuri, A. A., Boldin, M. P., Taganov, K. D., Nicoll, J., Paquette, R. L., and Baltimore, D. (2008). Sustained expression of microRNA-155 in hematopoietic stem cells causes a myeloproliferative disorder. The Journal of Experimental Medicine 205, 585-594. O'Connor, L., Strasser, A., O'Reilly, L. A., Hausmann, G., Adams, J. M., Cory, S., and Huang, D. C. S. (1998). Bim: a novel member of the Bcl-2 family that promotes apoptosis. EMBO J 17, 384-395. O'Donnell, K. A., Wentzel, E. A., Zeller, K. I., Dang, C. V., and Mendell, J. T. (2005). c-Myc-regulated microRNAs modulate E2F1 expression. Nature 435, 839-843.

188

Olive, V., Bennett, M. J., Walker, J. C., Ma, C., Jiang, I., Cordon-Cardo, C., Li, Q.-J., Lowe, S. W., Hannon, G. J., and He, L. (2009). miR-19 is a key oncogenic component of mir-17-92. Genes & Development 23, 2839-2849. Oltersdorf, T., Elmore, S. W., Shoemaker, A. R., Armstrong, R. C., Augeri, D. J., Belli, B. A., Bruncko, M., Deckwerth, T. L., Dinges, J., Hajduk, P. J., et al. (2005). An inhibitor of Bcl-2 family proteins induces regression of solid tumours. Nature 435, 677- 681. Orom, U. A., Kauppinen, S., and Lund, A. H. (2006). LNA-modified oligonucleotides mediate specific inhibition of microRNA function. Gene 372, 137-141. Ota, A., Tagawa, H., Karnan, S., Tsuzuki, S., Karpas, A., Kira, S., Yoshida, Y., and Seto, M. (2004). Identification and Characterization of a Novel Gene, C13orf25, as a Target for 13q31-q32 Amplification in Malignant Lymphoma. Cancer Research 64, 3087-3095. Ouyang, Y., Lu, Y., Yue, S., and Giffard, R. G. (2012). miR-181 targets multiple Bcl-2 family members and influences apoptosis and mitochondrial function in astrocytes. Mitochondrion 12, 213-219. Papoulas, O., Beek, S. J., Moseley, S. L., McCallum, C. M., Sarte, M., Shearn, A., and Tamkun, J. W. (1998). The Drosophila trithorax group proteins BRM, ASH1 and ASH2 are subunits of distinct protein complexes. Development 125, 3955-3966. Parganas, E., Wang, D., Stravopodis, D., J., T. D., Marine, J. C., Teglund, S., Vanin, E. F., Bodner, S., R, C. O., van Deursen, J. M., et al. (1998). Jak2 is essential for signaling through a variety of cytokine receptors. Cell 93, 385-395. Paschka, P., Schlenk, R. F., Gaidzik, V. I., Habdank, M., Kronke, J., Bullinger, L., Spath, D., Kayser, S., Zucknick, M., Gotze, K., et al. (2010). IDH1 and IDH2 Mutations Are Frequent Genetic Alterations in Acute Myeloid Leukemia and Confer Adverse Prognosis in Cytogenetically Normal Acute Myeloid Leukemia With NPM1 Mutation Without FLT3 Internal Tandem Duplication. Journal of Clinical Oncology 28, 3636- 3643. Passner, J. M., Ryoo, H. D., Shen, L., Mann, R. S., and Aggarwal, A. K. (1999). Structure of DNA-bound Ultrabithorax-Extradenticle homeodomain complex. Nature 397, 714. Pearson, J. C., Lemons, D., and McGinnis, W. (2005). Modulating Hox gene functions during animal body patterning. Nature 6, 893-904.

189

Pedersen, I. M., Kitada, S., Leoni, L. M., Zapata, J. M., Karras, J. G., Tsukada, N., Kipps, T. J., Choi, Y. S., Bennett, F., and Reed, J. C. (2002). Protection of CLL B cells by a follicular dendritic cell line is dependent on induction of Mcl-1. Blood 100, 1795- 1801. Peichel, C. L., Prabhakaran, B., and Vogt, T. F. (1997). The mouse Ulnaless mutation deregulates posterior HoxD gene expression and alters appendicular patterning. Development 124, 3481-3492. Peled, T., Glukhman, E., Hasson, N., Adi, S., Assor, H., Yudin, D., Landor, C., Mandel, J., Landau, E., Prus, E., et al. (2005). Chelatable cellular copper modulates differentiation and self-renewal of cord blood‚ derived hematopoietic progenitor cells. Experimental Hematology 33, 1092-1100. Perkins, A., Kongsuwan, K., Visvader, J., Adams, J. M., and Cory, S. (1990). Homeobox gene expression plus autocrine growth factor production elicits myeloid leukaemia. Proceedings of the National Academy of Sciences 87, 8398-8402. Perkins, A. C., and Cory, C. (1993). Conditional immortalization of mouse myelomonocytic, megakaryocytic and mast cell progenitors by the Hox-2.4 homeobox gene. EMBO Journal 12, 3835-3846. Peschon, J. J., Morrissey, P. J., Grabstein, K. H., Ramsdell, F. J., Maraskovsky, E., Gliniak, B. C., Park, L. S., Ziegler, S. F., Williams, D. E., Ware, C. B., et al. (1994). Early lymphocyte expansion is severely impaired in interleukin 7 receptor-deficient mice. The Journal of Experimental Medicine 180, 1955-1960. Peterseim, U. M., Sarkar, S. N., and Kupper, T. S. (1993). Production of IL-3 by non- transformed primary neonatal murine keratinocytes: Evidence for constitutive IL-3 gene expression in neonatal epidermis. Cytokine 5, 240-249. Pickrell, J. K., Marioni, J. C., Pai, A. A., Degner, J. F., Engelhardt, B. E., Nkadori, E., Veyrieras, J., Stephens, M., Gilad, Y., and Pritchard, J. K. (2010). Understanding mechanisms underlying human gene expression variation with RNA sequencing. Nature 464, 768-772. Pineault, N., Abramovich, C., and Humphries, R. K. (2005). Transplantable cell lines generated with NUP98-Hox fusion genes undergo leukemic progression by Meis1 independent of its binding to DNA. Leukemia 19, 636-643. Pineault, N., Abramovich, C., Ohta, H., and Humphries, R. K. (2004). Differential and Common Leukemogenic Potentials of Multiple NUP98-Hox Fusion Proteins Alone or with Meis1. Molecular and Cellular Biology 24, 1907-1917.

190

Pineault, N., Buske, C., Feuring-Buske, M., Abramovich, C., Rosten, P., Hogge, D. E., Aplan, P. D., and Humphries, R. K. (2003). Induction of acute myeloid leukemia in mice by the human leukemia-specific fusion gene NUP98-HOXD13 in concert with Meis1. Blood 101, 4529-4538. Pineault, N., Helgason, C. D., Lawrence, H. J., and Humphries, R. K. (2002). Differential expression of Hox, Meis1, and Pbx1 genes in primitive cells throughout murine hematopoietic ontogeny. Experimental Hematology 20, 49-57. Piper, D. E., Batchelor, A. H., Chang, C., Cleary, M. L., and Wolberger, C. (1999). Structure of a HoxB1-Pbx1 Heterodimer Bound to DNA: Role of the Hexapeptide and a Fourth Homeodomain Helix in Complex Formation. Cell 96, 587-597. Pollock, J. L., Westervelt, P., Kurichety, A. K., Pelicci, P. G., Grisolano, J. L., and Ley, T. J. (1999). A bcr-3 isoform of RARalpha-PML potentiates the development of PML- RARalpha-driven acute promyelocytic leukemia. Proceedings of the National Academy of Sciences 96, 15103-15108. Popovic, R., Riesbeck, L. E., Velu, C. S., Chaubey, A., Zhang, J., Achille, N. J., Erfurth, F. E., Eaton, K., Lu, J., Grimes, H. L., et al. (2009). Regulation of mir-196b by MLL and its overexpression by MLL fusions contributes to immortalization. Blood 113, 3314-3322. Pospisil, V., Vargova, K., Kokavec, J., Rybarova, J., Savvulidi, F., Jonasova, A., Necas, E., Zavadil, J., Laslo, P., and Stopka, T. (2011). Epigenetic silencing of the oncogenic miR-17-92 cluster during PU.1-directed macrophage differentiation. EMBO J 30, 4450- 4464. Potter, M. (2008). Brief Historical Sketch of Chromosomal Translocations and Tumors. JNCI Monographs 2008, 2-7. Potts, M. B., Wang, D. P., and Cameron, S. (2009). Trithorax, Hox, and TALE-class homeodomain proteins ensure cell survival through repression of the BH3-only gene egl-1. Developmental Biology 329, 374-385. Puthalakath, H., O'Reilly, L. A., Gunn, P., Lee, L., Kelly, P. N., Huntington, N. D., Hughes, P. D., Michalak, E. M., McKimm-Breschkin, J., Motoyama, N., et al. (2007). ER Stress Triggers Apoptosis by Activating BH3-Only Protein Bim. Cell 129, 1337- 1349. Qian, L., Van Laake, L. W., Huang, Y., Liu, S., Wendland, M. F., and Srivastava, D. (2011). miR-24 inhibits apoptosis and represses Bim in mouse cardiomyocytes. The Journal of Experimental Medicine 208, 549-560.

191

Qian, S., Fu, F., Li, W., Chen, Q., and de Sauvage, F. J. (1998). Primary Role of the Liver in Thrombopoietin Production Shown by Tissue-Specific Knockout. Blood 92, 2189-2191. Quelle, F. W., Sato, N., Witthuhn, B. A., Inhorn, R. C., Eder, M., Miyajima, A., Griffin, J. D., and Ihle, J. (1994). JAK2 associates with the beta common chain of the receptor for granulocyte-macrophage colony-stimulating factor, and its activation requires the membrane-proximal region. Molecular and Cellular Biology 14, 4335-4341. Rampino, N., Yamamoto, H., Ionov, Y., Li, Y., Sawai, H., Reed, J. C., and Perucho, M. (1997). Somatic frameshift mutations in the BAX gene in colon cancers of the microsatellite mutator phenotype. Science 275, 967-969. Rinn, J. L., Kertesz, M., Wang, J. K., Squazzo, S. L., Xu, X., Brugmann, S. A., Goodnough, L. H., Helms, J. A., Farnham, P. J., Segal, E., and Chang, H. Y. (2007). Functional Demarcation of Active and Silent Chromatin Domains in Human HOX Loci by Noncoding RNAs. Cell 129, 1311-1323. Roberts, A. W., Seymour, J. F., Brown, J. R., Wierda, W. G., Kipps, T. J., Khaw, S. L., Carney, D. A., He, S. Z., Huang, D. C. S., Xiong, H., et al. (2012). Substantial Susceptibility of Chronic Lymphocytic Leukemia to BCL2 Inhibition: Results of a Phase I Study of Navitoclax in Patients With Relapsed or Refractory Disease. Journal of Clinical Oncology 30, 488-496. Roche, J., Zeng, C., Baron, A., Gadgil, S., Gemmil, R. M., Tigaud, I., Thomas, X., and Drabkin, H. A. (2004). Hox expression in AML identifies a distinct subset of patients with intermediate cytogenetics. Leukemia (08876924) 18, 1059-1063. Rodriguez, A., Vigorito, E., Clare, S., Warren, M. V., Couttet, P., Soond, D. R., van Dongen, S., Grocock, R. J., Das, P. P., Miska, E. A., et al. (2007). Requirement of bic/microRNA-155 for Normal Immune Function. Science 316, 608-611. Roemer, K., Johnson, P. A., and Friedmann, T. (1991). Activity of the simian virus 40 early promoter-enhancer in herpes simplex virus type 1 vectors is dependent on its position, the infected cell type, and the presence of Vmw175. Journal of Virology 65, 6900-6912. Rogulja-Ortmann, A., Renner, S., and Technau, G. M. (2008). Antagonistic roles for Ultrabithorax and Antennapedia in regulating segment-specific apoptosis of differentiated motoneurons in the Drosophila embryonic central nervous system. Development 135, 3435-3445.

192

Rohle, D., Popovici-Muller, J., Palaskas, N., Turcan, S., Grommes, C., Campos, C., Tsoi, J., Clark, O., Oldrini, B., Komisopoulou, E., et al. (2013). An Inhibitor of Mutant IDH1 Delays Growth and Promotes Differentiation of Glioma Cells. Science 340, 626- 630. Romana, S. P., Radford-Weiss, I., Ben Abdelali, R., Schluth, C., Petit, A., Dastugue, N., Talmant, P., Bilhou-Nabera, C., Mugneret, F., Lafage-Pochitaloff, M., et al. (2006). NUP98 rearrangements in hematopoietic malignancies: a study of the Groupe Francophone de Cytogenetique Hematologique. Leukemia 20, 696-706. Romania, P., Lulli, V., Pelosi, E., Biffoni, M., Peschle, C., and Marziali, G. (2008). MicroRNA 155 modulates megakaryopoiesis at progenitor and precursor level by targeting Ets-1 and Meis1 transcription factors. British Journal of Haematology 143, 570-580. Rosas, M., Osorio, F., Robinson, M. J., Davies, L. C., Dierkes, N., Jones, S. A., Reis e Sousa, C., and Taylor, P. R. (2011). Hoxb8 conditionally immortalised macrophage lines model inflammatory monocytic cells with important similarity to dendritic cells. European Journal of Immunology 41, 356-365. Ross, D. T., Scherf, U., Eisen, M. B., Perou, C. M., Rees, C., Spellman, P., Iyer, V., Jeffrey, S. S., Van de Rijn, M., Waltham, M., et al. (2000). Systematic variation in gene expression patterns in human cancer cell lines. Nature Genetics 24, 227. Ruiz, M., Pettaway, C., Song, R., Stoeltzing, O., Ellis, L., and Bar-Eli, M. (2004). Activator Protein 2alpha Inhibits Tumorigenicity and Represses Vascular Endothelial Growth Factor Transcription in Prostate Cancer Cells. Cancer Research 64, 631-638. Sadlack, B., Löhler, J., Schorle, H., Klebb, G., Haber, H., Sickel, E., Noelle, R. J., and Horak, I. (1995). Generalized autoimmune disease in interleukin-2-deficient mice is triggered by an uncontrolled activation and proliferation of CD4+ T cells. European Journal of Immunology 25, 3053-3059. Sadlack, B., Merz, H., Schorle, H., Schimpl, A., Feller, A. C., and Horak, I. (1993). Ulcerative colitis-like disease in mice with a disrupted interleukin-2 gene. Cell 75, 253- 261. Sauvageau, G., Lansdorp, P. M., Eaves, C. H., Hogge, D. E., Dragowska, W. H., Reid, D. S., Largman, C. S., Lawrence, H. J., and Humphries, R. K. (1994). Differential expression of Homeobox genes in functionally distinct CD34+ subpopulations of human bone marrow cells. Proceedings of the National Academy of Sciences 91, 12223-12227.

193

Schiedlmeier, B., Santos, A. C., Ribeiro, A., Moncaut, N., Lesinski, D., Auer, H., Kornacker, K., Ostertag, W., Baum, C., Mallo, M., and Klump, H. (2007). HOXB4's road map to stem cell expansion. Proceedings of the National Academy of Sciences 104, 16952-16957. Scholl, C., Bansal, D., Dohner, D., Eiwen, D., Huntly, B. J. P., Lee, B. H., Rucker, F. G., Schlenk, R. F., Bullinger, L., Dohner, H., et al. (2007). The homeobox gene CDX2 is aberrantly expressed in most cases of acute myeloid leukemia and promotes leukemogenesis. Journal of clinical investigation 117, 1037-1048. Schorderet, P., and Duboule, D. (2011). Structural and Functional Differences in the Long Non-Coding RNA Hotair in Mouse and Human. PLoS Genet 7, e1002071. Schotte, D., Lange-Turenhout, E. A. M., Stumpel, D. J. P. M., Stam, R. W., Buijs- Gladdines, J. G. C. A. M., Meijerink, J. P. P., Pieters, R., and Den Boer, M. L. (2010). Expression of miR-196b is not exclusively MLL-driven but is especially linked to activation of HOXA genes in pediatric acute lymphoblastic leukemia. Haematologica 95, 1675-1682. Schwartz, B., Melnikova, V. O., Tellez, C., Mourad-Zeidan, A., Blehm, K., Zhao, Y. J., McCarty, M., Adam, L., and Bar-Eli, M. (2007). Loss of AP-2[alpha] results in deregulation of E-cadherin and MMP-9 and an increase in tumorigenicity of colon cancer cells in vivo. Oncogene 26, 4049-4058. Sedkov, Y., Tillib, S., Mizrokhi, L., and Mazo, A. (1994). The bithorax complex is regulated by trithorax earlier during Drosophila embryogenesis than is the Antennapedia complex, correlating with a bithorax-like expression pattern of distinct early trithorax transcripts. Development 120, 1907-1917. Shalaby, F., Rossant, J., Yamaguchi, T. P., Gertsenstein, M., Wu, X.-F., Breitman, M. L., and Schuh, A. C. (1995). Failure of blood-island formation and vasculogenesis in Flk-1-deficient mice. Nature 376, 62-66. Shears, L., Plowright, L., Harrington, K., Pandha, H. S., and Morgan, R. (2008). Disrupting the Interaction Between HOX and PBX Causes Necrotic and Apoptotic Cell Death in the Renal Cancer Lines CaKi-2 and 769-P. Journal of Urology 18, 2196-2201. Shen, W. F., Rozenfeld, S., Lawrence, H. J., and Largman, C. (1997a). The Abd-B-like Hox Homeodomain Proteins Can Be Subdivided by the Ability to Form Complexes with Pbx1a on a Novel DNA Target. Journal of Biological Chemistry 272, 8198-8206.

194

Shen, W. F., Montgomery, J. C., Rozenfeld, S., Moskow, J. J., Lawrence, H. J., Buchberg, A. M., and Largman, C. (1997b). AbdB-like Hox proteins stabilize DNA binding by the Meis1 homeodomain proteins. Mol Cell Biol 17, 6448-6458. Sieff, C., Niemeyer, C., Mentzer, S., and Faller, D. (1988). Interleukin-1, tumor necrosis factor, and the production of colony- stimulating factors by cultured mesenchymal cells. Blood 72, 1316-1323. Sjoblom, T., Jones, S., Wood, L. D., Parsons, D. W., Lin, J., Barber, T. D., Mandelker, D., Leary, R. J., Ptak, J., Silliman, N., et al. (2006). The Consensus Coding Sequences of Human Breast and Colorectal Cancers. Science 314, 268-274. Souers, A. J., Leverson, J. D., Boghaert, E. R., Ackler, S. L., Catron, N. D., Chen, J., Dayton, B. D., Ding, H., Enschede, S. H., Fairbrother, W. J., et al. (2013). ABT-199, a potent and selective BCL-2 inhibitor, achieves antitumor activity while sparing platelets. Nature Medicine 19, 202-208. Spangrude, G., Heimfeld, S., and Weissman, I. (1988). Purification and characterization of mouse hematopoietic stem cells. Science 241, 58-62. Speck, N. A., Stacy, T., Wang, Q., North, T., Gu, T., Miller, J., Binder, M., and Marin- Padilla, M. (1999). Core-Binding Factor: A Central Player in Hematopoiesis and Leukemia. Cancer Research 59, 1789s-1793s. Speleman, F., Cauwelier, B., Dastugue, N., Cools, J., Verhasselt, B., Poppe, B., van Roy, N., Vandesompele, J., Graux, C., Uyttebroeck, A., et al. (2005). A new recurrent inversion, inv(7)(p15q34), leads to transcriptional activation of HOXA10 and HOXA11 in a subset of T-cell acute lymphoblastic leukemias. Leukemia 19, 358-366. Srinivasula, S. M., Datta, P., Kobayashi, M., Wu, J., Fujioka, M., Hegde, R., Zhang, Z., Mukattash, R., Fernandes-Alnemri, T., Shi, Y., et al. (2002). Sickle, a Novel Drosophila Death Gene in the reaper/hid/grim Region, Encodes an IAP-Inhibitory Protein. Current Biology 12, 125-130. Stanley, E., Lieschke, G. J., Grail, D., Metcalf, D., Hodgson, G., Gall, J. A., Maher, D. W., Cebon, J., Sinickas, V., and Dunn, A. R. (1994). Granulocyte/macrophage colony- stimulating factor-deficient mice show no major perturbation of hematopoiesis but develop a characteristic pulmonary pathology. Proceedings of the National Academy of Sciences 91, 5592-5596. Stomski, F. C., Sun, Q., Bagley, C. J., Woodcock, J., Goodall, G., Andrews, R. K., Berndt, M. C., and Lopez, A. F. (1996). Human interleukin-3 (IL-3) induces disulfide- linked IL-3 receptor alpha- and beta-chain heterodimerization, which is required for

195

receptor activation but not high-affinity binding. Molecular and Cellular Biology 16, 3035-3046. Stomski, F. C., Woodcock, J. M., Zacharakis, B., Bagley, C. J., Sun, Q., and Lopez, A. F. (1998). Identification of a Cys Motif in the Common beta Chain of the Interleukin 3, Granulocyte-Macrophage Colony-stimulating Factor, and Interleukin 5 Receptors Essential for Disulfide-linked Receptor Heterodimerization and Activation of All Three Receptors. Journal of Biological Chemistry 273, 1192-1199. Strasser, A., Harris, A. W., Bath, M. L., and Cory, S. (1990). Novel primitive lymphoid tumours induced in transgenic mice by cooperation between myc and bcl-2. Nature 348, 331-333. Sultan, M., Schulz, M. H., Richard, H., Magen, A., Klingenhoff, A., Scherf, M., Seifert, M., Borodina, T., Soldatov, A., Parkhomchuk, D., et al. (2008). A Global View of Gene Activity and Alternative Splicing by Deep Sequencing of the Human Transcriptome. Science 321, 956-960. Sungaran, R., Markovic, B., and Chong, B. H. (1997). Localization and Regulation of Thrombopoietin mRNA Expression in Human Kidney, Liver, Bone Marrow, and Spleen Using In Situ Hybridization. Blood 89, 101-107. Sunkar, R., Zhou, X., Zheng, Y., Zhang, W., and Zhu, J. K. (2008). Identification of novel and candidate miRNAs in rice by high throughput sequencing. BMC Plant Biology 8, 25-41. Suzuki, Y., Imai, Y., Nakayama, H., Takahashi, K., Takio, K., and Takahashi, R. (2001). A Serine Protease, HtrA2, Is Released from the Mitochondria and Interacts with XIAP, Inducing Cell Death. Molecular Cell 8, 613-621. Tabuse, M., Ohta, S., Ohashi, Y., Fukaya, R., Misawa, A., Yoshida, K., Kawase, T., Saya, H., Thirant, C., Chneiweiss, H., et al. (2011). Functional analysis of HOXD9 in human gliomas and glioma cancer stem cells. Molecular Cancer 10, 60. Tagawa, H., Karnan, S., Suzuki, R., Matsuo, K., Zhang, X., Ota, A., Morishima, Y., Nakamura, S., and Seto, M. (2004). Genome-wide array-based CGH for mantle cell lymphoma: identification of homozygous deletions of the proapoptotic gene BIM. Oncogene 24, 1348-1358. Tagawa, H., and Seto, M. (2005). A microRNA cluster as a target of genomic amplification in malignant lymphoma. Leukemia 2013-2016.

196

Takeshita, K., Bollekens, J. A., Hijiya, N., Ratajczak, M., Ruddle, F. H., and Gewirtz, A. M. (1993). A homeobox gene of the Antennapedia class is required for human adult erythropoiesis. Proceedings of the National Academy of Sciences 90, 3535-3538. Taketani, T., Taki, T., Ono, R., Kobayashi, Y., Ida, K., and Hayashi, Y. (2002a). The chromosome translocation t(7;11)(p15;p15) in acute myeloid leukemia results in fusion of the NUP98 gene with a HOXA cluster gene, HOXA13, but not HOXA9. Genes, Chromosomes and Cancer 34, 437-443. Taketani, T., Taki, T., Shibuya, N., Ito, E., Kitazawa, J., Terui, K., and Hayashi, Y. (2002b). The HOXD11 Gene Is Fused to the NUP98 Gene in Acute Myeloid Leukemia with t(2;11)(q31;p15). Cancer Research 62, 33-37. Taketani, T., Taki, T., Shibuya, N., Kikuchi, A., Hanada, R., and Hayashi, Y. (2002c). Novel NUP98-HOXC11 Fusion Gene Resulted from a Chromosomal Break within Exon 1 of HOXC11 in Acute Myeloid Leukemia with t(11;12)(p15;q13). Cancer Research 62, 4571-4574. Tanzer, A., and Stadler, P. F. (2004). Molecular Evolution of a MicroRNA Cluster. Journal of Molecular Biology 339, 327-335. Tellez, C., McCarty, M., Ruiz, M., and Bar-Eli, M. (2003). Loss of Activator Protein- 2alpha Results in Overexpression of Protease-activated Receptor-1 and Correlates with the Malignant Phenotype of Human Melanoma. Journal of Biological Chemistry 278, 46632-46642. Tevethia, M. J. (1984). Immortalization of primary mouse embryo fibroblasts with SV40 virions, viral DNA, and a subgenomic DNA fragment in a quantitative assay. Virology 137, 414-421. Thai, T., Calado, D. P., Casola, S., Ansel, K. M., Xiao, C., Xue, Y., Murphy, A., Frendewey, D., Valenzuela, D., Kutok, J. L., et al. (2007). Regulation of the Germinal Center Response by MicroRNA-155. Science 316, 604-608. Thiede, C., Koch, S., Creutzig, E., Steudel, C., Illmer, T., Schaich, M., and Ehninger, G. (2006). Prevalence and prognostic impact of NPM1 mutations in 1485 adult patients with acute myeloid leukemia (AML). Blood 107, 4011-4020. Thorsteinsdottir, U., Sauvageau, G., Hough, M. R., Dragowska, W. H., Lansdorp, P. M., Lawrence, H. J., Largman, C., and Humphries, R. K. (1996). Overexpression of HOXA10 in murine hematopoietic cells perturbs both myeloid and lymphoid differentiation and leads to acute myeloid leukemia. Molecular and Cellular Biology 17, 495-505.

197

Tiret, L., Le Mouellic, H., Maury, M., and Brulet, P. (1998). Increased apoptosis of motoneurons and altered somatotopic maps in the brachial spinal cord of Hoxc-8- deficient mice. Development 125, 279-291. Toh, W. H., Nam, S. Y., and Sabapathy, K. (2010). An essential role for p73 in regulating mitotic cell death. Cell Death Differ 17, 787-800. Trang, P., Medina, P. P., Wiggins, J. F., Ruffino, L., Kelnar, K., Omotola, M., Homer, R., Brown, D., Bader, A. G., Weidhaas, J. B., and Slack, F. J. (2010). Regression of murine lung tumors by the let-7 microRNA. Oncogene 29, 1580-1587. Tsai, M., Manor, O., Wan, Y., Mosammaparast, N., Wang, J. K., Lan, F., Shi, Y., Segal, E., and Chang, H. Y. (2010). Long Noncoding RNA as Modular Scaffold of Histone Modification Complexes. Science 329, 689-693. Tse, C., Shoemaker, A. R., Adickes, J., Anderson, M. G., Chen, J., Jin, S., Johnson, E. F., Marsh, K. C., Mitten, M. J., Nimmer, P., et al. (2008). ABT-263: A Potent and Orally Bioavailable Bcl-2 Family Inhibitor. Cancer Research 68, 3421-3428. Tsujimoto, Y., Finger, L. R., Yunis, J., Nowell, P. C., and Croce, C. M. (1984). Cloning of the Chromosome Breakpoint of Neoplastic B Cells with the t(14;18) Chromosome Translocation. Science 226, 1097-1099. Ulich, T., del Castillo, J., and Guo, K. (1989). In vivo hematologic effects of recombinant interleukin-6 on hematopoiesis and circulating numbers of RBCs and WBCs. Blood 73, 108-110. Vairo, G., Soos, T. J., Upton, T. M., Zalvide, J., DeCaprio, J. A., Ewen, M. E., Koff, A., and Adams, J. M. (2000). Bcl-2 Retards Cell Cycle Entry through p27Kip1, pRB Relative p130, and Altered E2F Regulation. Molecular and Cellular Biology 20, 4745- 4753. van Delft, M. F., Wei, A. H., Mason, K. D., Vandengerg, C. J., Chen, L., Czabotar, P. E., Willis, S. N., Scott, C. L., Day, C. L., Cory, C., et al. (2006). The BH3 mimetic, ABT-737 targets selective Bcl-2 proteins and efficiently induces apoptosis via Bak/Bax if Mcl-1 is neutralized. Cancer Cell 10, 389-399. van der Hoeven, F., Zakany, J., and Duboule, D. (1996). Gene Transpositions in the HoxD Complex Reveal a Hierarchy of Regulatory Controls. Cell 85, 1025-1035. van der Lugt, N. M. T., Alkema, M., Berns, A., and Deschamps, J. (1996). The Polycomb-group homolog Bmi-1 is a regulator of murine Hox gene expression. Mechanisms of Development 58, 153-164.

198

Vandenberg, C. J., and Cory, S. (2013). ABT-199, a new Bcl-2-specific BH3 mimetic, has in vivo efficacy against aggressive Myc-driven mouse lymphomas without provoking thrombocytopenia. Blood 121, 2285-2288. Vaux, D. L., Cory, S., and Adams, J. M. (1988). Bcl-2 gene promotes haemopoietic cell survival and cooperates with c-myc to immortalize pre-B cells. Nature 335, 440-442. Ventura, A., Young, A. G., Winslow, M. M., Lintault, L., Meissner, A., Erkeland, S. J., Newman, J., Bronson, R. T., Crowley, D., Stone, J. R., et al. (2008). Targeted Deletion Reveals Essential and Overlapping Functions of the miR-17~92 Family of miRNA Clusters. Cell 132, 875-886. Verhagen, A. M., Ekert, P. G., Pakusch, M., Silke, J., Connolly, L. M., Reid, G. E., Moritz, R. L., Simpson, R. J., and Vaux, D. L. (2000). Identification of DIABLO, a Mammalian Protein that Promotes Apoptosis by Binding to and Antagonizing IAP Proteins. Cell 102, 43-53. Vester, B., and Wengel, J. (2004). LNA (Locked Nucleic Acid): High-Affinity Targeting of Complementary RNA and DNA. Biochemistry 43, 13233-13241. Vivanco, I., and Sawyers, C. L. (2002). The phosphatidylinositol 3-Kinase-AKT pathway in human cancer. Nature Review Cancer 2, 489-501. von Freeden-Jeffry, U., Vieira, P., Lucian, L. A., McNeil, T., Burdach, S. E., and Murray, R. (1995). Lymphopenia in interleukin (IL)-7 gene-deleted mice identifies IL-7 as a nonredundant cytokine. The Journal of Experimental Medicine 181, 1519-1526. Voorhoeve, P. M., le Sage, C., Schrier, M., Gillis, A. J. M., Stoop, H., Nagel, R., Liu, Y., van Duijse, J., Drost, J., Griekspoor, A., et al. (2006). A Genetic Screen Implicates miRNA-372 and miRNA-373 As Oncogenes in Testicular Germ Cell Tumors. Cell 124, 1169-1181. Wang, F., Travins, J., DeLaBarre, B., Penard-Lacronique, V., Schalm, S., Hansen, E., Straley, K., Kernytsky, A., Liu, W., Gliser, C., et al. (2013). Targeted Inhibition of Mutant IDH2 in Leukemia Cells Induces Cellular Differentiation. Science 340, 622- 626. Wang, G. G., Calvo, K. R., Pasillas, M. P., Sykes, D. B., Hacker, H., and Kamps, M. P. (2006). Quantitative production of macrophages or neutrophils ex vivo using conditional Hoxb8. Nature Methods 3, 287-293. Wang, G. G., Pasillas, M. P., and Kamps, M. P. (2005). Meis1 programs transcription of FLT3 and cancer stem cell character, using a mechanism that requires interaction with Pbx and a novel function of the Meis1 C-terminus. Blood 106, 254-264.

199

Wang, Z., Gerstein, M., and Snyder, M. (2009). RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet 10, 57-63. Warner, N. L., Moore, M. A. S., and Metcalf, D. (1969). A Transplantable Myelomonocytic Leukemia in BALB/c Mice: Cytology, Karyotype and Murimidase Content. Journal of the National Cancer Institute 43, 963-982. Webster, N. J. G., Green, S., Rui Jin, J., and Chambon, P. (1988). The hormone-binding domains of the estrogen and glucocorticoid receptors contain an inducible transcription activation function. Cell 54, 199-207. Wellik, D. M., Hawkes, P. J., and Capecchi, M. R. (2002). Hox11 paralogous genes are essential for metanephric kidney induction. Genes and Development 16, 1423-1432. Weng, A. P., Ferrando, A. A., Lee, W., Morris, J. P., Silverman, L. B., Sanchez-Irizarry, C., Blacklow, S. C., Look, A. T., and Aster, J. C. (2004). Activating Mutations of NOTCH1 in Human T Cell Acute Lymphoblastic Leukemia. Science 306, 269-271. Wengel, J., Petersen, M., Nielsen, K. E., Jensen, G. A., Hakansson, A. E., Kumar, R., Sorensen, M. D., Rajwanshi, V. K., Bryld, T., and Jacobsen, J. P. (2001). LNA (Locked Nucleic Acid) and the Diastereoisomeric alpha-L-LNA: Conformational tuning and high-affinty recognisition of DNA/RNA targets. Nucleosides, Nucleotides and Nucleic Acids 20, 389-396. Wiemels, J. L., Cazzaniga, G., Daniotti, M., Eden, O. B., Addison, G. M., Masera, G., Saha, V., Biondi, A., and Greaves, M. F. (1999a). Prenatal origin of acute lymphoblastic leukaemia in children. The Lancet 354, 1499-1503. Wiemels, J. L., Ford, A. M., Van Wering, E. R., Postma, A., and Greaves, M. (1999b). Protracted and Variable Latency of Acute Lymphoblastic Leukemia After TEL-AML1 Gene Fusion In Utero. Blood 94, 1057-1062. Wiktor-Jedrzejczak, W. W., Ahmed, A., Szczylik, C., and Skelly, R. R. (1982). Hematological characterization of congenital osteopetrosis in op/op mouse. Possible mechanism for abnormal macrophage differentiation. The Journal of Experimental Medicine 156, 1516-1527. Willert, K., Brown, J. D., Danenberg, E., Duncan, A. W., Weissman, I. L., Reya, T., Yates, J. R., and Nusse, R. (2003). Wnt proteins are lipid-modified and can act as stem cell growth factors. Nature 423, 448-452. Wing, J. P., Karres, J. S., Ogdahl, J. L., Zhou, L., Schwartz, L. M., and Nambu, J. R. (2002). Drosophila sickle Is a Novel grim-reaper Cell Death Activator. Current Biology 12, 131-135.

200

Wolberger, C., Vershon, A. K., Liu, B., Johnson, A. D., and Pabo, C. O. (1991). Crystal structure of a MATalpha2 Homeodomain-Operator Complex Suggests a General Model for Homeodomain-DNA Interactions. Cell 67, 517-528. Woltering, J. M., and Durston, A. J. (2008). MiR-10 Represses HoxB1a and HoxB3a in Zebrafish. PLoS ONE 3, e1396. Wong, P., Iwasaki, M., Somervaille, T. C. P., Ficara, F., Carico, C., Arnold, C., Chen, C., and Cleary, M. L. (2010). The miR-17~92 microRNA Polycistron Regulates MLL Leukemia Stem Cell Potential by Modulating p21 Expression. Cancer Research 70, 3833-3842. Wu, D., Wallen, H. D., Inohara, N., and Nunez, G. (1997). Interaction and Regulation of the Caenorhabditis elegans Death Protease CED-3 by CED-4 and CED-9. Journal of Biological Chemistry 272, 21449-21454. Wu, H., Liu, X., Jaenisch, R., and Lodish, H. F. (1995). Generation of committed erythroid BFU-E and CFU-E progenitors does not require erythropoietin or the erythropoietin receptor. Cell 83, 59-67. Xiao, C., Srinivasan, L., Calado, D. P., Patterson, H. C., Zhang, B., Wang, J., Henderson, J. M., Kutok, J. L., and Rajewsky, K. (2008). Lymphoproliferative disease and autoimmunity in mice with increased miR-17-92 expression in lymphocytes. Nature Immunology 9, 405-414. Yamamura, Y., Lee, W. L., Inoue, K.-i., Ida, H., and Ito, Y. (2006). RUNX3 Cooperates with FoxO3a to Induce Apoptosis in Gastric Cancer Cells. Journal of Biological Chemistry 281, 5267-5276. Yan, X., Xu, J., Gu, Z., Pan, C.-M., Lu, G., Shen, Y., Shi, J., Zhu, Y.-M., Tang, L., Zhang, X., et al. (2011). Exome sequencing identifies somatic mutations of DNA methyltransferase gene DNMT3A in acute monocytic leukemia. Nat Genet 43, 309-315. Yang, J., Phillips, M. D., Betel, D., Mu, P., Ventura, A., Siepel, A. C., Chen, K. C., and Lai, E. C. (2011). Widespread regulatory activity of vertebrate microRNA* species. RNA 17, 312-326. Yeap, Y. Y. C., Ng, I. H. W., Badrian, B., Nguyen, T. Ä., Yip, Y. Y., Dhillon, A. S., Mutsaers, S. E., Silke, J., Bogoyevitch, M. A., and Ng, D. C. H. (2010). c-Jun N- terminal kinase/c-Jun inhibits fibroblast proliferation by negatively regulating the levels of stathmin/oncoprotein 18. Biochemical Journal 430, 345-354. Yekta, S., Shih, I., and Bartel, D. P. (2004). MicroRNA-Directed Cleavage of HOXB8 mRNA. Science 304, 594-596.

201

Ymer, S., Tucker, W. Q. J., Sanderson, C. J., Hapel, A. J., Campbell, H. D., and Young, I. G. (1985). Constitutive synthesis of interleukin-3 by leukaemia cell line WEHI-3B is due to retroviral insertion near the gene. Nature 317, 255-258. Yoshida, H., Hashizume, M., Suzuki, M., and Mihara, M. (2010). Anti-IL-6 receptor antibody suppressed T cell activation by inhibiting IL-2 production and inducing regulatory T cells. European Journal of Pharmacology 634, 178-183. Yoshimoto, G., Miyamoto, T., Jabbarzadeh-Tabrizi, S., Iino, T., Rocnik, J. L., Kikushige, Y., Mori, Y., Shima, T., Iwasaki, H., Takenaka, K., et al. (2009). FLT3-ITD up-regulates MCL-1 to promote survival of stem cells in acute myeloid leukemia via FLT3-ITD - specific STAT5 activation. Blood 114, 5034-5043. Youle, R. J., and Strasser, A. (2008). The BCL-2 protein family: opposing activities that mediate cell death. Nature Reviews Molecular Cell Biology 9, 47-59. Yu, B. D., Hess, J. L., Horning, S. E., Brown, G. A. J., and Korsmeyer, S. J. (1995). Altered Hox expression and segmental identity in Mll-mutant mice. Nature 378, 505- 508. Zakany, J., and Duboule, D. (1996). Synpolydactyly in mice with a targeted deficiency in the HoxD complex. Nature 384, 69-71. Zeisig, B. B., Milne, T., Garcia-Cuellar, M.-P., Schreiner, S., Martin, M.-E., Fuchs, U., Borkhardt, A., Chanda, S. K., Walker, J., Soden, R., et al. (2004). Hoxa9 and Meis1 Are Key Targets for MLL-ENL-Mediated Cellular Immortalization. Mol Cell Biol 24, 617- 628. Zhao, Z., Boyle, T. J., Liu, Z., Murray, J. I., Wood, W. B., and Waterston, R. H. (2010). A Negative Regulatory Loop between MicroRNA and Hox Gene Controls Posterior Identities in Caenorhabditis elegans. PLoS Genet 6, e1001089. Zhu, S., Si, M.-L., Wu, H., and Mo, Y.-Y. (2007). MicroRNA-21 Targets the Tumor Suppressor Gene Tropomyosin 1 (TPM1). Journal of Biological Chemistry 282, 14328- 14336. Ziemin-van der Poel, S., McCabe, N. R., Gill, H. J., Espinosa, R., Patel, Y., Harden, A., Rubinelli, P., Smith, S. D., LeBeau, M. M., and Rowley, J. D. (1991). Identification of a gene, MLL, that spans the breakpoint in 11q23 translocations associated with human leukemias. Proceedings of the National Academy of Sciences of the United States of America 88, 10735-10739. Zimonjic, D. B., Pollock, J. L., Westervelt, P., Popescu, N. C., and Ley, T. J. (2000). Acquired, nonrandom chromosomal abnormalities associated with the development of

202

acute promyelocytic leukemia in transgenic mice. Proceedings of the National Academy of Sciences 97, 13306-13311. Zisoulis, D. G., Lovci, M. T., Wilbert, M. L., Hutt, K. R., Liang, T. Y., Pasquinelli, A. E., and Yeo, G. W. (2010). Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans. Nature Structural and Molecular Biology 17, 173-179.

203

Minerva Access is the Institutional Repository of The University of Melbourne

Author/s: Salmanidis, Marika

Title: The role of Hoxb8 in myeloid progenitor cell immortalisation

Date: 2013

Citation: Salmanidis, M. (2013). The role of Hoxb8 in myeloid progenitor cell immortalisation. PhD thesis, Department of Paediatrics, Faculty of Medicine, Dentistry & Health Sciences, The University of Melbourne.

Persistent Link: http://hdl.handle.net/11343/38293

File Description: Thesis

Terms and Conditions: Terms and Conditions: Copyright in works deposited in Minerva Access is retained by the copyright owner. The work may not be altered without permission from the copyright owner. Readers may only download, print and save electronic copies of whole works for their own personal non-commercial use. Any use that exceeds these limits requires permission from the copyright owner. Attribution is essential when quoting or paraphrasing from these works.