Polymorphic Human Prostaglandin H Synthase-2 Proteins and Their Interactions with Cyclooxygenase Substrates and Inhibitors
Total Page：16
File Type：pdf, Size：1020Kb
The Pharmacogenomics Journal (2011) 11, 337–347 & 2011 Macmillan Publishers Limited. All rights reserved 1470-269X/11 www.nature.com/tpj ORIGINAL ARTICLE Polymorphic human prostaglandin H synthase-2 proteins and their interactions with cyclooxygenase substrates and inhibitors W Liu1, EM Poole2,3,4, The cyclooxygenase (COX) activity of prostaglandin H synthase-2 (PGHS-2) 2,5 1 is implicated in colorectal cancer and is targeted by nonsteroidal anti- CM Ulrich and RJ Kulmacz inflammatory drugs (NSAIDs) and dietary nÀ3 fatty acids. We used purified, 1Department of Internal Medicine, University of recombinant proteins to evaluate the functional impacts of the R228H, Texas Health Science Center at Houston, E488G, V511A and G587R PGHS-2 polymorphisms on COX activity, fatty Houston, TX, USA; 2Public Health Sciences acid selectivity and NSAID actions. Compared to wild-type PGHS-2, COX Division, Fred Hutchinson Cancer Research activity with arachidonate was B20% lower in 488G and B20% higher in Center, Seattle, WA, USA; 3Department of Medicine, Brigham and Women’s Hospital, 511A. All variants showed time-dependent inhibition by the COX-2-specific Harvard Medical School, Boston, MA, USA; inhibitor (coxib) nimesulide, but 488G and 511A had 30–60% higher 4Department of Epidemiology, Harvard School of residual COX activity; 511A also showed up to 70% higher residual activity 5 Public Health, Boston, MA, USA and Division of with other time-dependent inhibitors. In addition, 488G and 511A differed Preventive Oncology, German Cancer Research Center, Heidelberg, Germany significantly from wild type in Vmax values with the two fatty acids: 488G showed B20% less and 511A showed B20% more discrimination against Correspondence: eicosapentaenoic acid. The Vmax value for eicosapentaenoate was not Dr RJ Kulmacz, Department of Internal affected in 228H or 587R, nor were the Km values or the COX activation Medicine, University of Texas Health Science efficiency (with arachidonate) significantly altered in any variant. Thus, the Center at Houston, 6431 Fannin Street, Houston, TX 77030, USA. E488G and V511A PGHS-2 polymorphisms may predict who will most likely E-mail: [email protected] benefit from interventions with some NSAIDs or nÀ3 fatty acids. The Pharmacogenomics Journal (2011) 11, 337–347; doi:10.1038/tpj.2010.49; published online 15 June 2010 Keywords: prostaglandin H synthase-2 polymorphisms; cyclooxygenase; nonsteroidal anti- inflammatory drugs; arachidonic acid; eicosapentaenoic acid Introduction The cyclooxygenase (COX) activity of prostaglandin H synthase isoforms 1 and 2 (PGHS-1 and PGHS-2) catalyzes a key step in the biosynthesis of prostaglandins from nÀ6 and nÀ3 polyunsaturated fatty acids such as arachidonic acid (AA) and eicosapentaenoic acid (EPA).1 The prostaglandins, which include prosta- glandin E, prostacyclin and thromboxane, serve as potent signaling molecules in many pathophysiological processes.2 The two PGHS isoforms are functionally specialized, with PGHS-1 generally considered a constitutive, housekeeping enzyme, whereas PGHS-2 is strongly induced by cytokines and mitogens in a variety of cells and has been linked to the initiation and resolution phases of inflammation and to cell proliferation.3,4 PGHS-2 levels are elevated in many tumors and COX-2 activity has been implicated in the development of several types of cancer, including colorectal cancer.5,6 Received 31 October 2009; revised 16 March 2010; accepted 26 April 2010; published COX catalysis is strongly regulated by the availability of unesterified fatty acid online 15 June 2010 substrate, the structure of the substrate (for example, nÀ6 vs. nÀ3) and the level Enzyme kinetics of cyclooxygenase-2 polymorphisms W Liu et al 338 of peroxide, which is required to generate the protein-based stocks of the fatty acids were dissolved in toluene, butylated radical at Tyr385 that begins the catalytic cycle.1 In hydroxytoluene (0.001 mol/mol) was added and the solu- addition, COX catalysis is the primary target of NSAIDs tions stored at À20 1C. Working suspensions (3–30 mM)in (nonsteroidal anti-inflammatory drugs); these agents 0.1 M Tris (pH 8.5) were prepared fresh each day and kept on include aspirin, ibuprofen, naproxen and the COX-2 ice. Tween 20 was from Anatrace (Maumee, OH, USA). inhibitors (coxibs), which are selective for inhibition of Coxibs were from Cayman Chemical (Ann Arbor, MI, USA) COX-2.3 NSAID use is linked to significantly decreased risk or Tocris Bioscience (Ellisville, MO, USA). Restriction of colorectal cancer in humans.5 enzymes and T4 DNA ligase were purchased from New A limited number of nonsynonymous polymorphisms England Biolabs (Beverly, MA, USA). Oligonucleotides were have been identified in PTGS2, the gene that encodes from Integrated DNA Technologies (Coralville, IA, USA). human PGHS-2 (hPGHS-2); these polymorphisms include Reagents for DNA manipulation were from Promega R228H, E488G, V511A and G587R.7,8 The prevalence of (Madison, WI, USA). Plasmid transfer vector pAcSG2 and these polymorphisms is low, with a minor allele frequency BaculoGold linearized baculovirus DNA were from ranging from 0.8 to 5% in the populations studied, Pharmingen (San Diego, CA, USA). QuikChange single and suggesting that there is strong selective pressure on PTGS2. multisite-directed mutagenesis kits and Escherichia coli strain Epidemiological studies have examined the relation of the XL-10 were from Stratagene (La Jolla, CA, USA). Sf9 insect V511A polymorphism to the risks of colorectal adenoma or cells (from Spodoptera frugiperda), E. coli strain DH5a, Grace’s cancer,8–10 breast cancer11 and cardiovascular disease.12 supplemented medium and fetal bovine serum were from Because these studies were generally small (NB400–1000) Invitrogen (Carlsbad, CA, USA). Ni-NTA agarose was and the variant allele is rare (B4%), none of the studies purchased from Qiagen (Valencia, CA, USA). The integrity found a statistically significant association with risk. How- of each plasmid described below was verified by restriction ever, two of the colorectal cancer studies reported inverse enzyme digestion and by DNA sequencing at the Micro- associations with the A allele and some suggestion of an biology and Molecular Genetics Core Facility, UT Health NSAID interaction.8,10 Similarly, gene–NSAID interactions Science Center at Houston. All other reagents were obtained and pharmacogenetic relationships have been reported from Sigma (St Louis, MO, USA). in noncoding PTGS2 single-nucleotide polymorphisms (SNPs).13 as well as in other genes related to prostaglandin Construction of plasmid for recombinant, 6 Â His-tagged hPGHS-2 synthesis.14,15 The 6 Â His tag sequence was introduced after the signal There have been few published studies on the nonsynon- peptide cleavage site near the N terminus of the hPGHS-2 ymous polymorphisms listed above,7–11,16,17 and the V511A wild type (major allele at all targeted positions), as polymorphism is the only nonsynonymous PTGS2 variant previously reported.22 Nucleotides coding for the six that has been studied for functional effects so far. Fritsche histidine residues were inserted into the hPGHS-2/pAcSG2 et al.7 observed no major differences between wild-type vector using PCR with PfuUltra HF DNA polymerase hPGHS-2 and the V511A variant for metabolism of AA or (Stratagene) and the following 50-primers: sense, 50-pCAC linoleic acid, nor any differences between the alleles for CATCACCCTTGCTGTTCCCACCCATGTCAAAACC-30; anti- inhibition by indomethacin or celecoxib. Lin et al.8 reported sense, 50-pATGGTGATGATTTGCTGTATGGCTGAGCGCCA that the major and minor alleles had similar V and K max m GGACC-30. values, but noted it was premature to conclude that the The PCR mixture was digested with DpnI; the resulting V511A variant had no functional effect without a more 7.4 kb product was separated by agarose gel electrophoresis thorough enzymological analysis. Several important aspects and ligated with T4 DNA ligase. The resulting plasmid was of COX-2 catalysis were not examined in the earlier studies. transformed into E. coli strain DH5a, and ampicillin- These aspects include: discrimination between nÀ6 and nÀ3 resistant colonies were analyzed by restriction enzyme substrates, which has considerable potential for diet-driven digest and DNA sequencing. modulation of prostanoid signaling;18 peroxide-dependent feedback activation, which contributes to regulation of COX activity;19 and time-dependent COX inhibition effects, Construction of plasmid for hPGHS-2 with R228H, E488G, V511A which characterize the more potent pharmacological or G587R minor alleles agents.20 The present studies were undertaken to address Plasmids coding for hPGHS-2 with the desired point these important aspects of COX functionality in V511A and mutations were constructed with the QuikChange mutagen- three other variants of hPGHS-2 using the purified recombi- esis kit using the pAcSG2 plasmid containing the 6 Â His- nant proteins. tagged, wild-type hPGHS-2 cDNA as template. Primer pairs were (base changes underlined) as follows: R228H-f, 50-C TGGCTAGACAGCATAAACTGCGCCTTTTC-30; R228H-r, 50-G Materials and methods AAAAGGCGCAGTTTATGCTGTCTAGCCAG-30;E488G-f,50-C ATCGATGCTGTGGGGCTGTATCCTGCCC-30; E488G-r, 50-GG High-purity AA and EPA were obtained in sealed ampules GCAGGATACAGCCCCACAGCATCGATG-30; V511A-f, 50-GA from Nu Chek Prep (Elysian, MN, USA) and handled under AACCATGGTAGAAGCTGGAGCACCATTCTC-30; V511A-r, 50-G conditions found to minimize peroxide formation.21 Briefly, AGAATGGTGCTCCAGCTTCTACCATGGTTTC-30;