DOCSLIB.ORG

Functional Characterization of Purinergic Receptor P2Y14 in the Japanese flounder (Paralichthys Olivaceus) Head Kidney Macrophages T

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Functional Characterization of Purinergic Receptor P2Y14 in the Japanese flounder (Paralichthys Olivaceus) Head Kidney Macrophages T Fish and Shellfish Immunology 93 (2019) 200–207 Contents lists available at ScienceDirect Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi Full length article Functional characterization of purinergic receptor P2Y14 in the Japanese flounder (Paralichthys olivaceus) head kidney macrophages T Shuo Lia,1, Nan Wanga, Yu Fenga, Jiafang Lia, Xuyun Gengb, Jinsheng Suna,* a Tianjin Key Laboratory of Animal and Plant Resistance, College of Life Sciences, Tianjin Normal University, 393 West Binshui Road, Xiqing District, Tianjin, 300387, China b Tianjin Fisheries Research Institute, 442 South Jiefang Road, Hexi District, Tianjin, 300221, China ARTICLE INFO ABSTRACT Keywords: Extracellular nucleotides and nucleotide sugars are important danger-associated signaling molecules that play P2Y receptor critical roles in regulation of immune responses in mammals through activation of purinergic receptors located Inflammation regulation on the cell surface. However, the immunological role of extracellular UDP-glucose-activated P2Y14 receptor ERK1/2 signaling (P2Y14R) in fish still remains unknown. In this study, we identified and characterized a P2Y14R paralog in the Paralichthys olivaceus Japanese flounder (Paralichthys olivaceus). The mRNA transcripts of P2Y14R are detected in all examined Japanese flounder tissues. Compared with the UDP-activated P2Y6 receptor, however, P2Y14R gene is highly expressed in Japanese flounder head kidney macrophages (HKMs). In addition, P2Y14R is significantly upre- gulated following inflammatory stimulation with LPS and poly (I:C) in the HKMs, suggesting a role of P2Y14Rin response to inflammation in fish. Furthermore, activation of P2Y14 receptor with its potent and selective agonist MRS 2905 resulted in a decreased expression of LPS-induced pro-inflammatory cytokine IL-1beta gene in the HKMs. In contrast, inhibition of P2Y14 receptor activity or down-regulation of the endogenous expression of P2Y14R by small interfering RNA significantly upregulates the LPS-induced pro-inflammatory cytokine IL-1beta gene expression in the HKMs, demonstrating that P2Y14R is involved in inflammation regulation in fish. Moreover, stimulation of the Japanese flounder HKMs with UDP-glucose evoked a rapid increase of extracellular signal-regulated kinase 1/2 (ERK1/2) phosphorylation in a dose- and time-dependent manner, indicating the involvement of P2Y14R in activation of ERK1/2 signaling in fish immune cells. Taken together, we demonstrated that the inducible P2Y14R plays an important role in regulation of fish innate immunity. 1. Introduction UDP and UDP-sugars [7], is highly expressed in immune and in- flammatory cells [7,8]. Activation of P2Y14R regulates a range of im- Extracellular nucleotides such as ATP, ADP, UTP, and UDP and mune responses including maturation of dendritic cells [9], inhibition nucleotide sugars such as uridine 5′-diphosphoglucose (UDP-glucose) of T lymphocyte proliferation [10], chemotaxis of bone-marrow he- are important danger signaling molecules that play an important role in matopoietic stem cells [11] and neutrophils [12], and secretion of the the regulation of immune responses through binding to and activating potent neutrophil chemoattractant CXCL8/IL-8 in airway epithelial of different members of plasma membrane P2 receptors, which are cells [13]. In addition, it has been demonstrated that UDP-glucose and widely expressed on immune cells [1–3]. P2Y receptors belonging to its receptor P2Y14R are key front line players able to trigger innate the G-protein-coupled receptors (GPCRs) superfamily, are a family of mucosal immune responses in mouse female reproductive tract [14]. the metabotropic purinergic receptors for adenine and uridine nucleo- We showed previously that extracellular UDP-activated P2Y6 re- tides and nucleotide sugars. Eight P2Y receptor subtypes (P2Y1, P2Y2, ceptors functions importantly in the Japanese flounder Paralichthys P2Y4, P2Y6, P2Y11, P2Y12, P2Y13 and P2Y14) with differences in both olivaceus peripheral blood leukocytes [15]. Because extracellular UDP pharmacology and downstream signaling pathways have been identi- can also activate P2Y14 receptors [8], we presumed the hypothesis that fied in mammals [4–6]. P2Y14 receptors could play a role in Japanese flounder innate im- In particular, P2Y14R that is potently and selectively activated by munity. For this purpose, we cloned P2Y14 receptor gene and * Corresponding author. College of Life Sciences, Tianjin Normal University, 393 West Binshui Road, Xiqing District, Tianjin, 300387, China. E-mail addresses: [email protected] (S. Li), [email protected] (J. Sun). 1 S. Li is a senior author. https://doi.org/10.1016/j.fsi.2019.07.053 Received 22 April 2019; Received in revised form 15 July 2019; Accepted 18 July 2019 Available online 18 July 2019 1050-4648/ © 2019 Elsevier Ltd. All rights reserved. S. Li, et al. Fish and Shellfish Immunology 93 (2019) 200–207 characterized its expression under normal and inflammatory conditions Table 1 in Japanese flounder head kidney macrophages (HKMs). By pharma- Sequence of primers used in this study. cological activation or inhibition of P2Y14R activities, and down-reg- Primers Sequence (5'→3′) ulation of the P2Y14R endogenous expression in the HKMs, we explored the potential role of the P2Y14 receptor in Japanese flounder innate F ATGGATCCCTTCAACGTCAG R TCCTGTTGTCGGTTTTCTCA immunity. In addition, we investigated the consequence of P2Y14R fi qP2Y14R-f GGGTCGCTGTTC TGGGTGA activation on ERK signaling in the HKMs. Taken our ndings together, qP2Y R-r ATCCAACCGCAGCATCTTC fi 14 we for the rst time demonstrated that the inducible P2Y14R plays an qP2Y6R-f AGTGCGGAGATGCGGGAC important role in regulation of fish innate immune response and in qP2Y6R-r GGTATCGTGGCTGTGTGAAGTA activation of ERK signaling pathway in fish immune cells. qP2Y2R-f TTCCTCCCAGCGAAGACG qP2Y2R-r CAGACGGACGTAGCAACCAG qP2Y12R-f ACTGGCCTGCGTGTGTTTG 2. Material and methods qP2Y12R-r AGATGGAGCCCGAGAGAAGC qβ-actin-f AGGTTCCGTTGTCCCG 2.1. Experimental animals qβ-actin-r TGGTTCCTCCAGATAGCAC qIL-1β-f CCTGTCGTTCTGGGCATCAA qIL-1β-r CACCCCGCTGTCCTGCTT Japanese flounder P. olivaceus were obtained from a local fish farm in Tianjin, China. Fish were cultured in an aerated recirculating sea- q: quantitative real-time PCR; f: forward; r: reverse. water system at 21 °C in the laboratory for two weeks before use in experiments. Fish were handled and clinically examined as described in 2.5. Expression analysis of P2Y14R mRNA transcripts in Japanese flounder our previous study [16]. Only animals with healthy appearance and tissues and head kidney macrophages normal activity were used in experiments. qRT-PCR analysis (see section 2.8) was performed to determine the 2.2. Chemicals and antibodies relative basal gene expression level of P2Y14R in various Japanese flounder tissues including blood, gill, head kidney, trunk kidney, heart, UDP-glucose, LPS and poly (I:C) were obtained from Sigma-Aldrich. liver, skin, muscle, intestine and spleen with a protocol described in the ′ α The potent and selective P2Y14 receptor agonist 2-Thiouridine-5 -O-( , previous study [21]. In addition, qRT-PCR analysis was also applied to β-methylene)diphosphate trisodium salt (MRS 2905) and high affinity compare the relative gene expression level of P2Y2, P2Y6, P2Y12 and and selective P2Y receptor antagonist 4-[4-(4-Piperidinyl)-phenyl]-7- 14 P2Y14 receptors in the Japanese flounder HKMs. To this aim, total RNA ® [4-(trifluoromethyl)-phenyl]-2-naphthalenecarboxylic acid (PPTN) from the HKM cells and tissues was purified with a PureLink RNA Mini were purchased from Tocris Bioscience. Rabbit monoclonal antibodies Kit and TRIzol reagent (Invitrogen), respectively, according to the against phospho-p44/p42 MAPK (p-Erk1/2) and against total p44/p42 manufacturer's recommendations. RNA was quantified by a NanoDrop MAPK (Erk1/2) were purchased from Cell Signaling Technology. spectrophotometer and treated with RNase Free DNase I (Invitrogen) to ® Lipofectamine RNAiMAX transfection reagent, HRP-labeled goat anti- digest possible contaminating genomic DNA following the manufac- mouse and goat anti-rabbit secondary antibodies and mouse mono- turer's protocol. The treated RNA was then transcribed into cDNAs clonal antibody against beta-actin were obtained from ThermoFisher using a SuperScript III reverse transcriptase kit (Invitrogen) according Scientific. to the manufacturer's directions. The relative gene expression levels for the individual P2Y receptor genes were determined by qRT-PCR (see 2.3. Preparation and cell culture of Japanese flounder head kidney section 2.8) with beta-actin serving as an internal reference gene. macrophages 2.6. In vitro immune challenge experiments in the Japanese flounder HKMs To collect head kidney tissues, Japanese flounder were anesthetized using 0.25 g/L tricaine methanesulfonate (Sigma-Aldrich) and the head To study the involvement of P2Y R in Japanese innate immune kidney was rapidly dissected under sterilized conditions. The dissected 14 responses, Japanese flounder HKMs were challenged with pathogen- head kidney tissues were used to prepare head kidney primary cells associated molecular patterns (PAMPs) LPS and poly (I:C) as described with the procedure described previously [17]. The head kidney mac- in a previous study [22]. Briefly, overnight-cultured Japanese flounder rophages (HKMs) were further purified from the obtained primary head HKMs (5 × 106 cells/well) were stimulated with 20 μg/ml LPS or poly kidney cell suspensions by discontinuous Percoll (GE Biosciences)
Load more

Recommended publications
  • P2Y6 Receptors Regulate CXCL10 Expression and Secretion in Mouse Intestinal Epithelial Cells
    fphar-09-00149 February 26, 2018 Time: 17:57 # 1 ORIGINAL RESEARCH published: 28 February 2018 doi: 10.3389/fphar.2018.00149 P2Y6 Receptors Regulate CXCL10 Expression and Secretion in Mouse Intestinal Epithelial Cells Mabrouka Salem1,2, Alain Tremblay2, Julie Pelletier2, Bernard Robaye3 and Jean Sévigny1,2* 1 Département de Microbiologie-Infectiologie et d’Immunologie, Faculté de Médecine, Université Laval, Québec City, QC, Canada, 2 Centre de Recherche du CHU de Québec – Université Laval, Québec City, QC, Canada, 3 Institut de Recherche Interdisciplinaire en Biologie Humaine et Moléculaire, Université Libre de Bruxelles, Gosselies, Belgium In this study, we investigated the role of extracellular nucleotides in chemokine (KC, MIP- 2, MCP-1, and CXCL10) expression and secretion by murine primary intestinal epithelial cells (IECs) with a focus on P2Y6 receptors. qRT-PCR experiments showed that P2Y6 was the dominant nucleotide receptor expressed in mouse IEC. In addition, the P2Y6 Edited by: ligand UDP induced expression and secretion of CXCL10. For the other studies, we Kenneth A. Jacobson, −=− National Institutes of Health (NIH), took advantage of mice deficient in P2Y6 (P2ry6 ). Similar expression levels of P2Y1, −=− United States P2Y2, P2X2, P2X4, and A2A were detected in P2ry6 and WT IEC. Agonists of Reviewed by: TLR3 (poly(I:C)), TLR4 (LPS), P2Y1, and P2Y2 increased the expression and secretion Fernando Ochoa-Cortes, of CXCL10 more prominently in P2ry6−=− IEC than in WT IEC. CXCL10 expression Universidad Autónoma de San Luis −=− Potosí, Mexico and secretion induced by poly(I:C) in both P2ry6 and WT IEC were inhibited by Markus Neurath, general P2 antagonists (suramin and Reactive-Blue-2), by apyrase, and by specific Universitätsklinikum Erlangen, Germany antagonists of P2Y1, P2Y2, P2Y6 (only in WT), and P2X4.
    [Show full text]
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
    [Show full text]
  • Lysophosphatidic Acid and Its Receptors: Pharmacology and Therapeutic Potential in Atherosclerosis and Vascular Disease
    JPT-107404; No of Pages 13 Pharmacology & Therapeutics xxx (2019) xxx Contents lists available at ScienceDirect Pharmacology & Therapeutics journal homepage: www.elsevier.com/locate/pharmthera Lysophosphatidic acid and its receptors: pharmacology and therapeutic potential in atherosclerosis and vascular disease Ying Zhou a, Peter J. Little a,b, Hang T. Ta a,c, Suowen Xu d, Danielle Kamato a,b,⁎ a School of Pharmacy, University of Queensland, Pharmacy Australia Centre of Excellence, Woolloongabba, QLD 4102, Australia b Department of Pharmacy, Xinhua College of Sun Yat-sen University, Tianhe District, Guangzhou 510520, China c Australian Institute for Bioengineering and Nanotechnology, The University of Queensland, Brisbane, St Lucia, QLD 4072, Australia d Aab Cardiovascular Research Institute, Department of Medicine, University of Rochester School of Medicine and Dentistry, Rochester, NY 14642, USA article info abstract Available online xxxx Lysophosphatidic acid (LPA) is a collective name for a set of bioactive lipid species. Via six widely distributed G protein-coupled receptors (GPCRs), LPA elicits a plethora of biological responses, contributing to inflammation, Keywords: thrombosis and atherosclerosis. There have recently been considerable advances in GPCR signaling especially Lysophosphatidic acid recognition of the extended role for GPCR transactivation of tyrosine and serine/threonine kinase growth factor G-protein coupled receptors receptors. This review covers LPA signaling pathways in the light of new information. The use of transgenic and Atherosclerosis gene knockout animals, gene manipulated cells, pharmacological LPA receptor agonists and antagonists have Gproteins fi β-arrestins provided many insights into the biological signi cance of LPA and individual LPA receptors in the progression Transactivation of atherosclerosis and vascular diseases.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Identification of C3 As a Therapeutic Target for Diabetic Nephropathy By
    www.nature.com/scientificreports OPEN Identifcation of C3 as a therapeutic target for diabetic nephropathy by bioinformatics analysis ShuMei Tang, XiuFen Wang, TianCi Deng, HuiPeng Ge & XiangCheng Xiao* The pathogenesis of diabetic nephropathy is not completely understood, and the efects of existing treatments are not satisfactory. Various public platforms already contain extensive data for deeper bioinformatics analysis. From the GSE30529 dataset based on diabetic nephropathy tubular samples, we identifed 345 genes through diferential expression analysis and weighted gene coexpression correlation network analysis. GO annotations mainly included neutrophil activation, regulation of immune efector process, positive regulation of cytokine production and neutrophil-mediated immunity. KEGG pathways mostly included phagosome, complement and coagulation cascades, cell adhesion molecules and the AGE-RAGE signalling pathway in diabetic complications. Additional datasets were analysed to understand the mechanisms of diferential gene expression from an epigenetic perspective. Diferentially expressed miRNAs were obtained to construct a miRNA-mRNA network from the miRNA profles in the GSE57674 dataset. The miR-1237-3p/SH2B3, miR-1238-5p/ ZNF652 and miR-766-3p/TGFBI axes may be involved in diabetic nephropathy. The methylation levels of the 345 genes were also tested based on the gene methylation profles of the GSE121820 dataset. The top 20 hub genes in the PPI network were discerned using the CytoHubba tool. Correlation analysis with GFR showed that SYK, CXCL1, LYN, VWF, ANXA1, C3, HLA-E, RHOA, SERPING1, EGF and KNG1 may be involved in diabetic nephropathy. Eight small molecule compounds were identifed as potential therapeutic drugs using Connectivity Map. It is estimated that a total of 451 million people sufered from diabetes by 2017, and the number is speculated to be 693 million by 2045 1.
    [Show full text]
  • Genomic Selection Signatures in Sheep from the Western Pyrenees Otsanda Ruiz-Larrañaga, Jorge Langa, Fernando Rendo, Carmen Manzano, Mikel Iriondo, Andone Estonba
    Genomic selection signatures in sheep from the Western Pyrenees Otsanda Ruiz-Larrañaga, Jorge Langa, Fernando Rendo, Carmen Manzano, Mikel Iriondo, Andone Estonba To cite this version: Otsanda Ruiz-Larrañaga, Jorge Langa, Fernando Rendo, Carmen Manzano, Mikel Iriondo, et al.. Genomic selection signatures in sheep from the Western Pyrenees. Genetics Selection Evolution, BioMed Central, 2018, 50 (1), pp.9. 10.1186/s12711-018-0378-x. hal-02405217 HAL Id: hal-02405217 https://hal.archives-ouvertes.fr/hal-02405217 Submitted on 11 Dec 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution| 4.0 International License Ruiz-Larrañaga et al. Genet Sel Evol (2018) 50:9 https://doi.org/10.1186/s12711-018-0378-x Genetics Selection Evolution RESEARCH ARTICLE Open Access Genomic selection signatures in sheep from the Western Pyrenees Otsanda Ruiz‑Larrañaga1* , Jorge Langa1, Fernando Rendo2, Carmen Manzano1, Mikel Iriondo1 and Andone Estonba1 Abstract Background: The current large spectrum of sheep phenotypic diversity
    [Show full text]
  • P2Y Purinergic Receptors, Endothelial Dysfunction, and Cardiovascular Diseases
    International Journal of Molecular Sciences Review P2Y Purinergic Receptors, Endothelial Dysfunction, and Cardiovascular Diseases Derek Strassheim 1, Alexander Verin 2, Robert Batori 2 , Hala Nijmeh 3, Nana Burns 1, Anita Kovacs-Kasa 2, Nagavedi S. Umapathy 4, Janavi Kotamarthi 5, Yash S. Gokhale 5, Vijaya Karoor 1, Kurt R. Stenmark 1,3 and Evgenia Gerasimovskaya 1,3,* 1 The Department of Medicine Cardiovascular and Pulmonary Research Laboratory, University of Colorado Denver, Aurora, CO 80045, USA; [email protected] (D.S.); [email protected] (N.B.); [email protected] (V.K.); [email protected] (K.R.S.) 2 Vascular Biology Center, Augusta University, Augusta, GA 30912, USA; [email protected] (A.V.); [email protected] (R.B.); [email protected] (A.K.-K.) 3 The Department of Pediatrics, Division of Critical Care Medicine, University of Colorado Denver, Aurora, CO 80045, USA; [email protected] 4 Center for Blood Disorders, Augusta University, Augusta, GA 30912, USA; [email protected] 5 The Department of BioMedical Engineering, University of Wisconsin, Madison, WI 53706, USA; [email protected] (J.K.); [email protected] (Y.S.G.) * Correspondence: [email protected]; Tel.: +1-303-724-5614 Received: 25 August 2020; Accepted: 15 September 2020; Published: 18 September 2020 Abstract: Purinergic G-protein-coupled receptors are ancient and the most abundant group of G-protein-coupled receptors (GPCRs). The wide distribution of purinergic receptors in the cardiovascular system, together with the expression of multiple receptor subtypes in endothelial cells (ECs) and other vascular cells demonstrates the physiological importance of the purinergic signaling system in the regulation of the cardiovascular system.
    [Show full text]
  • NIH Public Access Author Manuscript Neuron Glia Biol
    NIH Public Access Author Manuscript Neuron Glia Biol. Author manuscript; available in PMC 2006 May 1. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Neuron Glia Biol. 2006 May ; 2(2): 125±138. Purinergic receptors activating rapid intracellular Ca2+ increases in microglia Alan R. Light1, Ying Wu2, Ronald W. Hughen1, and Peter B. Guthrie3 1 Department of Anesthesiology, University of Utah, Salt Lake City, UT, USA 2 Oral Biology Program, School of Dentistry, University of North Carolina at Chapel Hill, Chapel Hill, NC 27510, USA 3 Scientific Review Administrator, Center for Scientific Review, National Institutes of Health, 6701 Rockledge Drive, Room 4142 Msc 7850, Bethesda, MD 20892-7850, USA Abstract We provide both molecular and pharmacological evidence that the metabotropic, purinergic, P2Y6, P2Y12 and P2Y13 receptors and the ionotropic P2X4 receptor contribute strongly to the rapid calcium response caused by ATP and its analogues in mouse microglia. Real-time PCR demonstrates that the most prevalent P2 receptor in microglia is P2Y6 followed, in order, by P2X4, P2Y12, and P2X7 = P2Y13. Only very small quantities of mRNA for P2Y1, P2Y2, P2Y4, P2Y14, P2X3 and P2X5 were found. Dose-response curves of the rapid calcium response gave a potency order of: 2MeSADP>ADP=UDP=IDP=UTP>ATP>BzATP, whereas A2P4 had little effect. Pertussis toxin partially blocked responses to 2MeSADP, ADP and UDP. The P2X4 antagonist suramin, but not PPADS, significantly blocked responses to ATP. These data indicate that P2Y6, P2Y12, P2Y13 and P2X receptors mediate much of the rapid calcium responses and shape changes in microglia to low concentrations of ATP, presumably at least partly because ATP is rapidly hydrolyzed to ADP.
    [Show full text]
  • Introduction: P2 Receptors
    Current Topics in Medicinal Chemistry 2004, 4, 793-803 793 Introduction: P2 Receptors Geoffrey Burnstock* Autonomic Neuroscience Institute, Royal Free and University College, London NW3 2PF, U.K. Abstract: The current status of ligand gated ion channel P2X and G protein-coupled P2Y receptor subtypes is described. This is followed by a summary of what is known of the distribution and roles of these receptor subtypes. Potential therapeutic targets of purinoceptors are considered, including those involved in cardiovascular, nervous, respiratory, urinogenital, gastrointestinal, musculo-skeletal and special sensory diseases, as well as inflammation, cancer and diabetes. Lastly, there are some speculations about future developments in the purinergic signalling field. HISTORICAL BACKGROUND It is widely recognised that purinergic signalling is a primitive system [19] involved in many non-neuronal as well The first paper describing the potent actions of adenine as neuronal mechanisms and in both short-term and long- compounds was published by Drury & Szent-Györgyi in term (trophic) events [20], including exocrine and endocrine 1929 [1]. Many years later, ATP was proposed as the secretion, immune responses, inflammation, pain, platelet transmitter responsible for non-adrenergic, non-cholinergic aggregation, endothelial-mediated vasodilatation, cell proli- transmission in the gut and bladder and the term ‘purinergic’ feration and death [8, 21-23]. introduced by Burnstock [2]. Early resistance to this concept appeared to stem from the fact that ATP was recognized first P2X Receptors for its important intracellular roles and the intuitive feeling was that such a ubiquitous and simple compound was Members of the existing family of ionotropic P2X1-7 unlikely to be utilized as an extracellular messenger.
    [Show full text]
  • Blood Platelet Adenosine Receptors As Potential Targets for Anti-Platelet Therapy
    International Journal of Molecular Sciences Review Blood Platelet Adenosine Receptors as Potential Targets for Anti-Platelet Therapy Nina Wolska and Marcin Rozalski * Department of Haemostasis and Haemostatic Disorders, Chair of Biomedical Science, Medical University of Lodz, 92-215 Lodz, Poland; [email protected] * Correspondence: [email protected]; Tel.: +48-504-836-536 Received: 30 September 2019; Accepted: 1 November 2019; Published: 3 November 2019 Abstract: Adenosine receptors are a subfamily of highly-conserved G-protein coupled receptors. They are found in the membranes of various human cells and play many physiological functions. Blood platelets express two (A2A and A2B) of the four known adenosine receptor subtypes (A1,A2A, A2B, and A3). Agonization of these receptors results in an enhanced intracellular cAMP and the inhibition of platelet activation and aggregation. Therefore, adenosine receptors A2A and A2B could be targets for anti-platelet therapy, especially under circumstances when classic therapy based on antagonizing the purinergic receptor P2Y12 is insufficient or problematic. Apart from adenosine, there is a group of synthetic, selective, longer-lasting agonists of A2A and A2B receptors reported in the literature. This group includes agonists with good selectivity for A2A or A2B receptors, as well as non-selective compounds that activate more than one type of adenosine receptor. Chemically, most A2A and A2B adenosine receptor agonists are adenosine analogues, with either adenine or ribose substituted by single or multiple foreign substituents. However, a group of non-adenosine derivative agonists has also been described. This review aims to systematically describe known agonists of A2A and A2B receptors and review the available literature data on their effects on platelet function.
    [Show full text]
  • Modulatory Roles of ATP and Adenosine in Cholinergic Neuromuscular Transmission
    International Journal of Molecular Sciences Review Modulatory Roles of ATP and Adenosine in Cholinergic Neuromuscular Transmission Ayrat U. Ziganshin 1,* , Adel E. Khairullin 2, Charles H. V. Hoyle 1 and Sergey N. Grishin 3 1 Department of Pharmacology, Kazan State Medical University, 49 Butlerov Street, 420012 Kazan, Russia; [email protected] 2 Department of Biochemistry, Laboratory and Clinical Diagnostics, Kazan State Medical University, 49 Butlerov Street, 420012 Kazan, Russia; [email protected] 3 Department of Medical and Biological Physics with Computer Science and Medical Equipment, Kazan State Medical University, 49 Butlerov Street, 420012 Kazan, Russia; [email protected] * Correspondence: [email protected]; Tel.: +7-843-236-0512 Received: 30 June 2020; Accepted: 1 September 2020; Published: 3 September 2020 Abstract: A review of the data on the modulatory action of adenosine 5’-triphosphate (ATP), the main co-transmitter with acetylcholine, and adenosine, the final ATP metabolite in the synaptic cleft, on neuromuscular transmission is presented. The effects of these endogenous modulators on pre- and post-synaptic processes are discussed. The contribution of purines to the processes of quantal and non- quantal secretion of acetylcholine into the synaptic cleft, as well as the influence of the postsynaptic effects of ATP and adenosine on the functioning of cholinergic receptors, are evaluated. As usual, the P2-receptor-mediated influence is minimal under physiological conditions, but it becomes very important in some pathophysiological situations such as hypothermia, stress, or ischemia. There are some data demonstrating the same in neuromuscular transmission. It is suggested that the role of endogenous purines is primarily to provide a safety factor for the efficiency of cholinergic neuromuscular transmission.
    [Show full text]
  • G Protein-Coupled Receptors
    S.P.H. Alexander et al. The Concise Guide to PHARMACOLOGY 2015/16: G protein-coupled receptors. British Journal of Pharmacology (2015) 172, 5744–5869 THE CONCISE GUIDE TO PHARMACOLOGY 2015/16: G protein-coupled receptors Stephen PH Alexander1, Anthony P Davenport2, Eamonn Kelly3, Neil Marrion3, John A Peters4, Helen E Benson5, Elena Faccenda5, Adam J Pawson5, Joanna L Sharman5, Christopher Southan5, Jamie A Davies5 and CGTP Collaborators 1School of Biomedical Sciences, University of Nottingham Medical School, Nottingham, NG7 2UH, UK, 2Clinical Pharmacology Unit, University of Cambridge, Cambridge, CB2 0QQ, UK, 3School of Physiology and Pharmacology, University of Bristol, Bristol, BS8 1TD, UK, 4Neuroscience Division, Medical Education Institute, Ninewells Hospital and Medical School, University of Dundee, Dundee, DD1 9SY, UK, 5Centre for Integrative Physiology, University of Edinburgh, Edinburgh, EH8 9XD, UK Abstract The Concise Guide to PHARMACOLOGY 2015/16 provides concise overviews of the key properties of over 1750 human drug targets with their pharmacology, plus links to an open access knowledgebase of drug targets and their ligands (www.guidetopharmacology.org), which provides more detailed views of target and ligand properties. The full contents can be found at http://onlinelibrary.wiley.com/doi/ 10.1111/bph.13348/full. G protein-coupled receptors are one of the eight major pharmacological targets into which the Guide is divided, with the others being: ligand-gated ion channels, voltage-gated ion channels, other ion channels, nuclear hormone receptors, catalytic receptors, enzymes and transporters. These are presented with nomenclature guidance and summary information on the best available pharmacological tools, alongside key references and suggestions for further reading.
    [Show full text]