DOCSLIB.ORG

The Mla Pathway Is Critical for Pseudomonas Aeruginosa Resistance to Outer Membrane Permeabilization and Host Innate Immune Clearance

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Mla Pathway Is Critical for Pseudomonas Aeruginosa Resistance to Outer Membrane Permeabilization and Host Innate Immune Clearance JMolMed DOI 10.1007/s00109-017-1579-4 ORIGINAL ARTICLE The Mla pathway is critical for Pseudomonas aeruginosa resistance to outer membrane permeabilization and host innate immune clearance 1,2 1 3 1 Jason Munguia & Doris L. LaRock & Hannah Tsunemoto & Joshua Olson & 1 3 1,4,5 Ingrid Cornax & Joseph Pogliano & Victor Nizet Received: 30 November 2016 /Revised: 14 August 2017 /Accepted: 14 August 2017 # Springer-Verlag GmbH Germany 2017 Abstract burden, and reduced lung damage when compared to the Pseudomonas aeruginosa is an important opportunistic path- wild-type strain. This study highlights the potential in thera- ogen that has become a serious problem due to increased rates peutically targeting the VacJ/Mla pathway in sensitizing of antibiotic resistance. Due to this along with a dearth in P. aeruginosa to killing by the host innate immune response. novel antibiotic development, especially against Gram- negative pathogens, new therapeutic strategies are needed to Key messages prevent a post-antibiotic era. Here, we describe the importance • The Mla pathway regulates outer membrane dynamics in of the vacJ/Mla pathway in resisting bactericidal actions of the human pathogen Pseudomonas aeruginosa (PA). host innate immune response. P. aeruginosa tn5 transposon • Disruption of Mla pathway gene vacJ sensitizes PA to host mutants in genes from the VacJ/Mla pathway showed in- cathelicidin antimicrobial peptide LL-37. creased susceptibility to killing by the host cathelicidin anti- • Loss of vacJ expression renders PA more sensitive to human microbial peptide, LL-37, when compared to the wild-type whole blood and serum killing. parent strain. The P. aeruginosa vacJ− mutant demonstrated • Loss of vacJ expression reduces PA survival and virulence in increased membrane permeability upon damage as well as amurinelunginfectionmodel. sensitivity to killing in the presence of the detergent sodium • The Mla pathway merits exploration as a pharmacologic dodecyl sulfate and the divalent cation chelator EDTA. When target to sensitize PA to host innate immunity. exposed to human whole blood and serum complement, the vacJ− mutant was killed more rapidly when compared to the Keywords Pseudomonas aeruginosa . Mla pathway . Innate wild-type parent strain and complemented mutant. Finally, in immunity . Antimicrobial peptide . Cathelicidin . Pneumonia an in vivo mouse lung infection model, infection with the vacJ− mutant resulted in reduced mortality, lower bacterial Introduction * Victor Nizet Pseudomonas aeruginosa is a ubiquitous Gram-negative fac- [email protected] ultative anaerobic bacterium that inhabits both soil and aqueous environments. A leading opportunistic human pathogen, 1 Department of Pediatrics, University of California San Diego, La P. aeruginosa,ishighlyadaptableandintrinsicallyabletoresist Jolla, CA, USA diverse antibiotic classes posing a tremendous challenge to 2 Biomedical Sciences Graduate Program, University of California San medical management [1]. P. aeruginosa preferentially colo- Diego, La Jolla, CA, USA nizes immunocompromised patients thereby causing many 3 Division of Biological Sciences, University of California San Diego, nosocomial infections including ventilator-associated pneumo- La Jolla, CA, USA nia, urinary tract infections, bacteremia, and infections of sur- 4 Skaggs School of Pharmacy and Pharmaceutical Sciences, gical sites or burn wounds [1, 2]. Individuals with cystic fibro- University of California San Diego, La Jolla, CA, USA sis are at extreme risk of chronic pulmonary infection with 5 Rady Children’s Hospital, San Diego, CA, USA P. aeruginosa, with 47.5% of patients being colonized [3]. J Mol Med P. aeruginosa can also cause community-acquired infections In this study, we explored for the first time the role(s) of the including keratitis, otitis externa, and skin and soft tissue infec- Mla pathway in P. aeruginosa resistance to host innate im- tions. Therapeutic options aredwindlingduetoadecreasein mune defenses and animal virulence. Though failing to show novel antibiotic development as well as an emergence of highly agrowthdefectinstandardbacteriologicalandtissueculture multidrug-resistant P. aeruginosa strains, placing the pathogen media conditions, P. a erugino sa Mla pathway mutants on the Centers for Disease Control list of Bserious threats^ [4]. showed increased susceptibility to human cathelicidin antimi- The discovery of new targets and alternate strategies for crobial peptide LL-37 associated with increased membrane treating P. aeruginosa infections is imperative. permeability. Compared to wild-type parent strain, an isogenic Gram-negative bacteria such as P.aeruginosa are protected P.aeruginosa vacJ− mutant showed increased susceptibility to by their outer membrane (OM), which is highly impermeable LL-37 and the cationic peptide antibiotics colistin and poly- to toxic compounds such as detergents, bile salts, and antibi- myxin B, along with decreased survival in human whole otics [5]. This OM is composed of an asymmetric bilayer blood and serum containing active complement; wild-type containing lipopolysaccharide (LPS) on the outer leaflet and resistance to these factors was restored by complementation phospholipids (PLs) on the inner leaflet. Perturbation of the of the vacJ− mutant with the wild-type gene with a transposon OM can lead to accumulation of PLs on the outer leaflet, insertion. The P. aeruginosa vacJ− mutant showed decreased which can make the bacteria vulnerable to further OM dam- virulence in a murine in vivo pneumonia model, as measured age. The Mla system is involved in maintaining OM lipid by lower bacterial burden in the lungs and blood, diminished asymmetry and is composed of seven proteins that are distrib- lung injury and inflammation, and reduced mortality. uted across the cell envelope [6, 7]. VacJ (also known as Together, our results show the importance of the Mla pathway MlaA) and other components of the Mla pathway have been in P. aeruginosa resistance to the bactericidal activities of the shown to play a role in intracellular spread of Shigella flexneri innate immune system. [8, 9], for survival of Haemophilus influenzae during lung infections and in serum [10, 11], resistance to surfactants in Escherichia coli [6, 12, 13]andPseudomonas putida [14], Materials and methods antibiotic resistance in P. aeruginosa [15, 16]and Salmonella enterica serovar Typhimurium [17], and has a Bacterial strains and reagents possible role in the creation of outer membrane vesicles [18]. VacJ has also been explored as a possible vaccine target P. aeruginosa PAO1 [38] along with corresponding transpo- in Pasteurella multocida [19]. Genes encoding components of son Tn5 IS50L mutants [39]disruptingthegenesencoding the Mla pathway, including VacJ, are upregulated in response mlaA (vacJ)andmlaC-F were generously provided by to colistin, and mutations in the pathway have been observed Professor Colin Manoil (University of Washington, Seattle, in colistin-resistant mutants [20–22]. WA). Strains were propagated in Luria broth (LB) medium Among the critical frontline effectors of host innate im- (Hardy Diagnostics) or on LB agar (LA) plates at 37 °C. For mune defense are endogenous cationic antimicrobial peptides infection studies, bacteria were grown to mid-log phase (AMPs), which are produced by epithelial cells and circulat- (OD600 nm =0.4)beforedilutingtoexperimentalinoculum. ing or tissue-resident leukocytes, and are known to provide Complementation was performed as previously described protection against invasive bacterial infections [23, 24]. [40]. Briefly, P. aeruginosa vacJ gene and its upstream region Cathelicidins are a family of mammalian AMPs with broad- were cloned into pUC18T-mini-Tn7T-hph using primers spectrum antimicrobial activity against Gram-negative and PA2800-miniTn7t-F (TGCTGCAAAGCCTGCACGGA Gram-positive bacteria, as well as certain fungi, viruses, and TCCACTAGTGAGCTCATGC), PA2800-miniTn7t-R protozoan parasites [25]. The human cathelicidin AMP, LL- (GAGGTGGAGGACGACTTCTAACCAGATAAGTG 37, is an alpha-helical, amphipathic, and anionic peptide that AAATCTAGTTCAAAAC), miniTn7t-PA2800-F integrates and destabilizes bacterial cell membranes causing (GCATGAGCTCACTAGTGGATCCGTGCAGGCTT bacterial death [26]. LL-37 also has important immunomodu- TGCAGCA), and miniTn7T-PA2800-R (GTTTGGAA latory roles in the proper regulation of cytokine release, che- CTAGATTTCACTTATCTGGTTAGAAGTCGTCCTCCA motaxis, and antigen presentation (reviewed in [27]). Animals CCTC). PA2800-miniTn7t-F and -R primers were used to deficient in cathelicidin are hyper-susceptible to bacterial in- amplify the pUC18T-mini-Tn7T-hph PCR product with por- fection in multiple organs including the skin [28], lung [29, tions of the vacJ gene, while primers miniTn7t-F and -R were 30], gut [31, 32], brain [33], kidney [34], and eye [35]. A used to amplify the vacJ gene with a portion of pUC18T-mini- bacterial pathogen producing significant clinical disease in Tn7T-hph.PCRproductswerecombined1:1and the human host must maintain some level of functional resis- electroporated into E. coli TOP10 cells, and transformants tance to endogenous AMPs including cathelicidin in order for selected on LB agar plates containing 100 μg/mL infection to persist [36, 37]. Hygromycin B (Life Technologies). qPCR of wild-type, JMolMed vacJ mutant, and complemented strains was performed on Whole blood and serum killing RNA isolated using RNeasy mini kit (Qiagen) and following primers: PAO1_PA2800_qPCR_F (GCGTACGTCGTCCA Heparinized blood was collected
Load more

Recommended publications
  • Victor Nizet, M.D
    Victor Nizet, M.D. Professor & Vice Chair for Basic Research, Department of Pediatrics Chief, Division of Host-Microbe Systems & Therapeutics University of California, San Diego School of Medicine Professor, Skaggs School of Pharmacy & Pharmaceutical Sciences Biomedical Research Facility II Building, Room 4113 Mail Code 0760, 9500 Gilman Drive, La Jolla, CA 92093-0760 Phone: (858) 534-7408; FAX: (858) 246-1868; email: [email protected] URL: http://nizetlab.ucsd.edu PERSONAL Born Dec 24, 1962 in Augusta, Georgia, USA Married (Christine), Son (Oliver) MAJOR AREAS OF ACADEMIC INTEREST The interest of my laboratory lies in understanding fundamental mechanisms of bacterial pathogenesis and the innate immune system, with a special focus on human streptococcal and staphylococcal infections and emerging antibiotic-resistant pathogens. Using a wide variety of molecular genetic approaches, the laboratory discovers and characterizes bacterial virulence determinants involved in cytotoxicity, adherence, invasion, inflammation, molecular mimicry and resistance to immunologic clearance. In companion studies, we investigate the contribution of host factors such as antimicrobial peptides, cytokines, leukocyte surface receptors, signal transduction pathways, and transcription factors in defense against invasive bacterial infection. Ultimately, we believe the basic discovoeries gained through this platform will inform novel treatment strategies for infectious diseases, including targeted neutralization of microbial virulence phenotypes, pharmacologic augmentation of host immune function, novel monoclonal antibodies and vaccines, and repurposing of FDA-approved drugs to beneficial impact at the host-pathogen interface. My other longstanding academic focus areas include cross-disciplinary research and educational program development, enhancing graduate and postdoctoral training in biological, medical and pharmaceutical sciences, junior faculty development, encouragement of academic-industry collaborations, and public engagement in the sciences.
    [Show full text]
  • Innate Antimicrobial Peptide Protects the Skin from Invasive Bacterial Infection
    letters to nature ................................................................. injections of cathelicidin-sensitive GAS in wild-type, heterozygous Innate antimicrobial peptide and homozygous-null mice, CRAMP-de®cient mice were observed to develop much larger areas of infection (Fig. 2a, b). Lesion areas protects the skin from increased more rapidly, reached larger maximal size, and persisted longer in CRAMP-de®cient mice than in normal littermates while invasive bacterial infection heterozygotes tended to have lesions of intermediate size (Fig. 2c). Cultures of equal amounts of tissue from lesions biopsied at day 7 Victor Nizet*, Takaaki Ohtake²³, Xavier Lauth²³, Janet Trowbridge²³, after injection demonstrated persistent infection with b-haemolytic Jennifer Rudisill²³, Robert A. Dorschner²³, Vasumati Pestonjamasp²³, GAS in CRAMP-de®cient mice but not in normal mice (Fig. 2d). No Joseph Piraino§, Kenneth Huttner§ & Richard L. Gallo*²³ difference in GAS lesion size was seen when wild-type parental strains C57BL/6 and 129/SVJ were compared. * Department of Pediatrics; and ² Division of Dermatology, A complementary approach to demonstrating the importance of University of California, San Diego, California 92161, USA cathelicidins in host defence is to examine the effects in vivo of ³ Veterans Affairs San Diego Healthcare System, San Diego, California 92161, altering bacterial sensitivity to CRAMP. If the antimicrobial action USA of cathelicidin is essential to control a GAS skin infection, as § Division of Neonatology, Massachusetts
    [Show full text]
  • Endogenous Production of Antimicrobial Peptides in Innate Immunity and Human Disease Richard L
    Endogenous Production of Antimicrobial Peptides in Innate Immunity and Human Disease Richard L. Gallo, MD, PhD, and Victor Nizet, MD Address The definition of an AMP has been loosely applied to Departments of Medicine and Pediatrics, Division of Dermatology, Uni- any peptide with the capacity to inhibit the growth of versity of California San Diego, and VA San Diego Healthcare System, microbes. AMPs might exhibit potent killing or inhibi- San Diego, CA, USA. E-mail: [email protected] tion of a broad range of microorganisms, including gram- positive and -negative bacteria as well as fungi and certain Current Allergy and Asthma Reports 2003, 3:402–409 Current Science Inc. ISSN 1529-7322 viruses. More than 800 such AMPs have been described, Copyright © 2003 by Current Science Inc. and an updated list can be found at the website: http:// www.bbcm.units.it/~tossi/pag1.htm. Some of these AMPs Antimicrobial peptides are diverse and evolutionarily ancient have now been demonstrated to protect diverse organ- molecules produced by all living organisms. Peptides belong- isms, including plants, insects, and mammals, against ing to the cathelicidin and defensin gene families exhibit an infection. AMP sequence analysis has shown that the pep- immune strategy as they defend against infection by inhibiting tide immune system is evolutionarily ancient, and the microbial survival, and modify hosts through triggering tis- conservation of AMP gene families throughout the ani- sue-specific defense and repair events. A variety of processes mal kingdom further supports their biologic significance. have evolved in microbes to evade the action of antimicrobial Antimicrobial peptides function within the conceptual peptides, including the ability to degrade or inactivate antimi- framework of the innate immune system.
    [Show full text]
  • 3970.Full.Pdf
    Cellular Activation, Phagocytosis, and Bactericidal Activity Against Group B Streptococcus Involve Parallel Myeloid Differentiation Factor 88-Dependent and This information is current as Independent Signaling Pathways of September 27, 2021. Philipp Henneke, Osamu Takeuchi, Richard Malley, Egil Lien, Robin R. Ingalls, Mason W. Freeman, Tanya Mayadas, Victor Nizet, Shizuo Akira, Dennis L. Kasper and Douglas T. Golenbock Downloaded from J Immunol 2002; 169:3970-3977; ; doi: 10.4049/jimmunol.169.7.3970 http://www.jimmunol.org/content/169/7/3970 http://www.jimmunol.org/ References This article cites 61 articles, 36 of which you can access for free at: http://www.jimmunol.org/content/169/7/3970.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision by guest on September 27, 2021 • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2002 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Cellular Activation, Phagocytosis, and Bactericidal Activity Against Group B Streptococcus Involve Parallel Myeloid Differentiation Factor 88-Dependent and Independent Signaling Pathways1 Philipp Henneke,*† Osamu Takeuchi,‡ Richard Malley,§ Egil Lien,* Robin R.
    [Show full text]
  • Antimicrobial Defense by Phagocyte Extracellular Traps
    J Mol Med DOI 10.1007/s00109-009-0481-0 REVIEW Innate immunity turned inside-out: antimicrobial defense by phagocyte extracellular traps Maren von Köckritz-Blickwede & Victor Nizet Received: 11 March 2009 /Revised: 15 April 2009 /Accepted: 23 April 2009 # The Author(s) 2009. This article is published with open access at Springerlink.com Abstract The formation of extracellular traps (ETs) by Keywords Neutrophil . Mast cell . Eosinophil . phagocytic cells has been recognized as a novel and Extracellular trap . Innate immunity. Bacterial infection . important mechanism of the host innate immune response Virulence factors . Antimicrobial peptides . DNA . Histones . against infections. ETs are formed by different host immune Mitochondria cells such as neutrophils, mast cells, and eosinophils after stimulation with mitogens, cytokines, or pathogens them- selves, in a process dependent upon induction of a reactive- Introduction oxygen-species-mediated signaling cascade. ETs consist of nuclear or mitochondrial DNA as a backbone with The frontline function of phagocytes such as neutrophils embedded antimicrobial peptides, histones, and cell- and macrophages in our innate immune defense has been specific proteases and thereby provide a matrix to entrap classically understood to reflect a variety of potent and kill microbes and to induce the contact system. This intracellular microbicidal mechanisms. Upon contact with review summarizes the latest research on ETs and their role the invading pathogen, phagocytes engulf the microbes into in innate immunity and host innate defense. Attention is their phagocytic vacuoles (phagosomes). Efficient uptake is also given to mechanisms by which certain leading facilitated through prior opsonization of the microbe with bacterial pathogens have evolved to avoid entrapment and circulating complement or, in the nonnaïve host, specific killing in these specialized structures.
    [Show full text]
  • Program-2018.Pdf
    Immunotherapy for Infectious Diseases Conference November 12–14, 2018 Hotel Galvez, Galveston, TX, USA CONFERENCE HOSTS Agenda NOVEMBER 12, 2018 7:30–8:30 AM Registration and Breakfast—Room: West Promenade 8:15–8:30 AM Welcome Remarks Magnus Hook and Zhiqiang An SESSION 1 ANTIBODY BASED DRUG DEVELOPMENT—Room: Music Hall Moderator: Livia Visai 8:30–9:20 AM Therapeutic Antibodies: Past, Present and Future Keynote Speaker: John McCafferty, Iontas Ltd. 9:20–9:55 AM Antibody Phage Display: Generating Antibodies for Diagnostic and Treatment of Infectious Diseases Michael Hust, Institute for Biochemistry, Biotechnology and Bioinformatics 9:55–10:30 AM Antibody Engineering: Humanization, Affinity Maturation and Selection Techniques Zhiqiang An, University of Texas Health Science Center 10:30–10:50 AM Break—Room: West Promenade 10:50–11:25 AM Immunobiology and Pathogenesis of Severe Scrub Typhus: Implications in Treatment Lynn Soong, The University of Texas Medical Branch 11:25 AM–12:00 PM Regulatory Considerations in Development of Biologic Products Sumathi Nambiar, U.S. Food Drug and Administration 12:00–2:00 PM Lunch—Room: West Promenade | Poster Session—Room: Music Hall SESSION 2 IMMUNOTHERAPY AGAINST VIRAL INFECTIONS—Room: Music Hall Moderator: Zhiqiang An 2:00–2:35 PM A Replication Defective Human Cytomegalovirus as a Vaccine to Prevent Congenital Infection and Disease Tong-Ming Fu, Merck 2:35–3:10 PM Vaccine-like Effects of Antiviral Monoclonal Antibodies: Converting Immunotherapies from Passive to Active Mireia Pelegrin, Institut de Génétique
    [Show full text]
  • Neutrophils-Immature.Pdf
    Early Human Development 103 (2016) 1–7 Contents lists available at ScienceDirect Early Human Development journal homepage: www.elsevier.com/locate/earlhumdev Alterations in neonatal neutrophil function attributable to increased immature forms Marjorie Makoni a,1, Jeffrey Eckert a,H.AnnePereirab, Victor Nizet c,d,ShelleyM.Lawrencea,e,⁎ a University of Oklahoma Health Sciences Center, College of Medicine, Department of Pediatrics, Division of Neonatal-Perinatal Medicine, United States b University of Oklahoma Health Sciences Center, College of Pharmacy, Department of Pharmaceutical Sciences, Department of Cell Biology, Department of Pathology, & Oklahoma Center for Neuroscience, United States c University of California, San Diego, Department of Pediatrics, Division of Host-Microbe Systems and Therapeutics, United States d University of California, San Diego, Skaggs School of Pharmacy and Pharmaceutical Sciences, United States e University of California, San Diego, College of Medicine, Department of Pediatrics, Division of Neonatal-Perinatal Medicine, United States article info abstract Article history: At birth neonatal neutrophil composition differs from that of adults due to a higher number of circulating imma- Received 16 December 2015 ture forms. To date only a single study has evaluated neutrophil performance based on cell maturity. For this Received in revised form 28 April 2016 study, we examined functional differences in chemotaxis and phagocytosis between neonatal and adult neutro- Accepted 25 May 2016 phils based on cell development and labor exposure. Methods: Neutrophils were obtained by venipuncture from Available online xxxx adults and cord blood from healthy term neonates delivered vaginally or by cesarean section. Transwells and the chemoattractant fMLP were used to evaluate chemotaxis. Phagocytosis assays were performed using GFP-labeled E.coli (RS218) and whole blood.
    [Show full text]
  • Surviving Innate Immunity
    News & Comment TRENDS in Microbiology 1 Letter local or toxin-mediated disease effects, number of individuals colonized Surviving innate invading deep tissues only in groups with asymptomatically greatly exceeds the immunity broader defects in innate or acquired low incidence of invasive infection. Is it immunity (e.g. neonates, the elderly or possible that in rare events a quantum In a complex environment, higher chemotherapy patients). ‘switch’ to higher CAMP resistance allows organisms face the constant threat of As discussed by Dr Peschel, the genetic invasion? Alternatively, do some patients microbial infection. To defend against this approach of generating and screening have congenital or acquired defects onslaught of potential pathogens, all bacterial mutants for alterations in CAMP in their specific ability to mount an known members of the plant and animal sensitivity has been fruitful in elucidating appropriate CAMP response to minor kingdoms use an innate immune system. a feature common to several resistant injury? When considering the A key component of innate immunity species – and supports an unattractive pathogenesis of infections through is the production of small, cationic (sic) hypothesis: bacteria that can epithelial barriers, the ability of the antimicrobial peptides (CAMPs). In successfully modify the normal anionic microorganism to avoid or resist CAMP- mammals, recent discoveries from gene constituents of their cell walls with mediated defenses must be considered. therapy and gene-knockout studies have cationic substitutions repulse rather The defining quality of some important confirmed that CAMPs play a crucial role than attract positively charged natural human pathogens thus could be an ‘innate in defense against invasive bacterial antibiotics.
    [Show full text]
  • Heparan Sulfate Modulates Neutrophil and Endothelial Function in Antibacterial Innate Immunity
    Heparan Sulfate Modulates Neutrophil and Endothelial Function in Antibacterial Innate Immunity Ding Xu,a,c,f Joshua Olson,b Jason N. Cole,a,b,g Xander M. van Wijk,a,c Volker Brinkmann,h Arturo Zychlinsky,h Victor Nizet,a,b,d Jeffrey D. Esko,a,c Yung-Chi Changa,b,e Glycobiology Research and Training Center,a Department of Pediatrics,b Department of Cellular and Molecular Medicine,c and Skaggs School of Pharmacy and d Pharmaceutical Sciences, University of California, San Diego, La Jolla, California, USA; Graduate Institute of Microbiology, College of Medicine, National Taiwan University, Downloaded from Taipei, Taiwane; Department of Oral Biology, University at Buffalo, School of Dental Medicine, The State University of New York, Buffalo, New York, USAf; School of Chemistry and Molecular Biosciences and Australian Infectious Diseases Research Centre, The University of Queensland, St. Lucia, Queensland, Australiag; Department of Cellular Microbiology, Max Planck Institute for Infection Biology, Berlin, Germanyh Recently, we showed that endothelial heparan sulfate facilitates entry of a bacterial pathogen into the central nervous system. Here, we show that normal bactericidal activity of neutrophils is influenced by the sulfation pattern of heparan sulfate. Inactiva- tion of heparan sulfate uronyl 2-O-sulfotransferase (Hs2st) in neutrophils substantially reduced their bactericidal activity, and Hs2st deficiency rendered mice more susceptible to systemic infection with the pathogenic bacterium group B Streptococcus. http://iai.asm.org/ Specifically, altered sulfation of heparan sulfate in mutant neutrophils affected formation of neutrophil extracellular traps while not influencing phagocytosis, production of reactive oxygen species, or secretion of granular proteases. Heparan sulfate pro- teoglycan(s) is present in neutrophil extracellular traps, modulates histone affinity, and modulates their microbial activity.
    [Show full text]
  • UC San Diego UC San Diego Electronic Theses and Dissertations
    UC San Diego UC San Diego Electronic Theses and Dissertations Title Exploring Antibiotic and Innate Immune Synergies to Treat Multi-Drug Resistant Bacterial Infections Permalink https://escholarship.org/uc/item/8nw4n64p Author Lin, Leo Publication Date 2016 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California UNIVERSITY OF CALIFORNIA, SAN DIEGO Exploring Antibiotic and Innate Immune Synergies to Treat Multi-Drug Resistant Bacterial Infections A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Biomedical Sciences by Leo Lin Committee in charge: Professor Victor Nizet, Chair Professor Joe Pogliano Professor Sharon Reed Professor Stephen Spector Professor Elizabeth Winzeler 2016 Copyright Leo Lin, 2016 All rights reserved This Dissertation of Leo Lin is approved, and it is acceptable in quality and form for publication on microfilm and electronically: Chair University of California, San Diego 2016 iii DEDICATION To my family Pannyun & Nathan, parents Athena & Brian, and siblings Clinton & Maya: thank you all for your love, care, and encouragement and to Professor Nizet: I will always remember your selfless mentoring and passion for science. iv TABLE OF CONTENTS Signature Page ................................................................................................................... iii Dedication .........................................................................................................................
    [Show full text]
  • Bacteria and Phagocytes: Mortal Enemies
    Editorial Journal of Innate J Innate Immun 2010;2:505–507 Published online: September 10, 2010 Immunity DOI: 10.1159/000320473 Bacteria and Phagocytes: Mortal Enemies Victor Nizet Department of Pediatrics, School of Medicine and Skaggs School of Pharmacy and Pharmaceutical Sciences, University of California San Diego, La Jolla, Calif. , USA A critical first-line element of mammalian innate im- The research presented in this issue finds historical munity is the function of phagocytic cells, in particular resonance in a classical scientific debate. Russian biolo- neutrophils and macrophages. The effectiveness of these gist Ilya Metchnikoff [1, 2] was awarded the Nobel Prize specialized leukocytes in host defense reflects their ca- in 1908 for the development of the phagocyte theory, the pacity for directed migration, microbial uptake, and in- central tenet of which was that the ‘swallowing and diges- tra- and extracellular microbial killing; the latter is tion’ of bacteria by circulating ‘white corpuscles’ (neutro- achieved through the concerted action of reactive oxy- phils and macrophages), enhanced by prior opsonization, gen species, enzymatic proteolysis, and cationic antimi- provided immunity to infection [1–3] . However, a con- crobial peptides. Stimulated phagocytes also amplify in- temporary of Metchnikoff [1, 2] , the hygienist and bacte- flammatory and immune responses through the release riologist Oskar Bail [4] , who was working at the German of cytokines, nitric oxide, and vasoactive peptides. Their University (today named Charles University) in Prague, general importance is further exemplified by the in- was simultaneously developing a countering ‘aggressin creased susceptibility to invasive bacterial infection in doctrine’. This model cautioned that many pathogens, in- patients whose phagocyte numbers are markedly re- cluding S.
    [Show full text]
  • Staphylococcal Infections JOHN S
    14 Staphylococcal Infections JOHN S. BRADLEY and VICTOR NIZET CHAPTER OUTLINE Epidemiology and Transmission Pneumonia Staphylococcus Aureus Meningitis Coagulase-Negative Staphylococci Brain Abscess Microbiology Osteomyelitis and Septic Arthritis Staphylococcus Aureus Gastrointestinal Coagulase-Negative Staphylococci Diagnosis Pathogenesis of Disease Antibiotic Treatment Virulence Mechanisms of Staphylococcus General Principles Aureus Vancomycin Virulence Mechanisms of Coagulase- Clindamycin and Erythromycin Negative Staphylococci Linezolid Role of Host Defenses Daptomycin Pathology Quinupristin-Dalfopristin Clinical Manifestations Combination Antimicrobial Therapy Bacteremia/Sepsis Catheter Removal Toxic Shock Syndromes Prevention Endocarditis Hygienic Measures Pustulosis, Cutaneous Abscess, Cellulitis Antibiotic Prophylaxis Adenitis and Parotitis Immune Prophylaxis Breast Infection Conclusion Funisitis, Omphalitis, Necrotizing Fasciitis Staphylococcal Scalded Skin Syndrome and Bullous Impetigo Staphylococcal disease has been recognized in neonates for centuries and reported at least as early as 1773, when Epidemiology and Transmission 1 pemphigus neonatorum was described. Outbreaks of STAPHYLOCOCCUS AUREUS staphylococcal disease in nurseries were first noted in the late 1920s,2 and the memorable term “cloud baby” was Many factors influence transmission of staphylococci subsequently coined to describe index cases, often asymp- among newborns, including nursery design, density of tomatic, who contaminated the nursery atmosphere with the
    [Show full text]