C-Terminal Tyrosine Phosphorylation of the Viral Matrix Protein Is a Key Regulator

Home , Tyrosine phosphorylation

Philippe Gallay, Simon Swingler, Christopher Aiken, et al., 1992) that closely resembles the prototypic SV40 and Didier Trono large T antigen NLS (Kalderon et al., 1984). A peptide Infectious Disease Laboratory based on the MA NLS acts as a nuclear targeting se- The Salk Institute for Biological Studies quence when coupled to a heterologous protein in vitro 10010 North Torrey Pines Road (Bukrinsky et al., 1993a). In cells acutely infected with H IV-l, La Jolla, California 92037 MA was detected in fractions containing partially purified HIV-1 preintegration complexes (Bukrinsky et al., 1993b), as well as in the nucleus (Sharova and Bukrinskaya, 1991). Summary In the absence of a functional vpr gene, the critical role of the MA NLS is further revealed: vpr-MA-NLS double The HIV-1 matrix (MA) protei n contains two subcellular mutant viruses show a defect in nuclear import and, as a localization signals with opposing effects. A myristoy- result, have an impaired ability to infect nondividing cells lated N-terminus governs particle assembly at the such as macrophages (Bukrinsky et al., 1993a; Heinzinger plasma membrane, and a nucleophilic motif facilitates et al., 1994; von Schwedler et al., 1994). import of the viral preintegration complex into the nu- In addition to fulfilling this critical function at an early cleus of nondividing cells. Here, we show that myris- step of the infection process, MA also plays an essential toylation acts as the MA dominant targeting signal in role in virus morphogenesis. Indeed, a myristate residue HIV-1 producer cells. During virus assembly, a subset at the N-terminus of MA directs Gag to the plasma mem- of MA is phosphorylated on the C-terminal tyrosine by brane. This targeting is essential for the proper assembly a virion-associated cellular protein kinase. Tyrosine- of viral particles and for their release into the extracellular phosphorylated MA is then preferentially transported space (Varmus and Swanstrom, 1984). In the process, MA to the nucleus of target cells. An MA tyrosine mutant also recruits the envelope glycoprotein at the surface of virus grows normally in dividing cells, but is blocked virions (Yu et al., 1992a, 1992b; Dorfman et al., 1994). for nuclear import in terminally differentiated macro- Correspondingly, MA has been localized to the periphery phages. MA tyrosine phosphorylation thus reveals the of mature HIV-1 particles, bound to the inner leaflet of the karyophilic properties of this protein within the HIV-1 virus lipid bilayer (Gelderblom et al., 1987). preintegration complex, thereby playing a critical role Since the myristoylation signal and the N LS have oppos- for infection of nondividing cells. ing influences on the subcellular localization of MA, their respective effects must be tightly regulated. The present Introduction work reveals the mechanism of this regulation. We find that myristoylation acts as a dominant targeting signal for Retroviruses are single-stranded RNAviruses whose repli- MA in HIV-1 producer cells, preventing the NLS-mediated cation depends on the integration of a double-stranded nuclear import of the protein. We further demonstrate that DNA intermediate, termed the provirus, into the host cell a small subset of MA molecules undergo C-terminal tyro- genome. For oncoretroviruses, this process depends on sine phosphorylation at the time of particle assembly. Both cell proliferation (Humphries and Temin, 1972, 1974), be- membrane association and proteolytic cleavage of Gag cause the breakdown of the nuclear envelope at mitosis are necessary for this modification, which can be observed is necessary for bringing the viral preintegration complex in the absence of other viral proteins. Accordingly, tyrosine in contact with the cell chromosomes (Roe et al., 1993; phosphorylation can be observed when recombinant MA Lewis and Emerman, 1994). In contrast, human immuno- is exposed to cellular extracts, as well as viral lysates. deficiency virus type 1 (HIV-1) has the ability to infect non- Although only 1% of all MA molecules internalized by dividing cells (Lewis et al., 1992). This property is shared newly infected cells migrate to the nucleus, the majority with other lentiviruses and reflects the existence of deter- of those phosphorylated on tyrosine are rapidly translo- minants that govern the active transport of the viral preinte- cated to this compartment. Mutating the C-terminal tyro- gration complex through the nucleopore (Bukrinsky et al., sine of MA to phenylalanine does not alter Gag processing, 1992). It likely plays a crucial role in AIDS pathogenesis nor replication of the resulting virus in dividing cells, such because it allows the spread of HIV-1 in such critical tar- as activated T lymphocytes. However, in the absence of gets as terminally differentiated macrophages (Weinberg a functional vpr gene, the MA tyrosine mutant is profoundly et al., 1991). defective for growth in terminally differentiated macro- Two viral proteins, matrix (MA) and Vpr, have been phages, owing to a block in the nuclear import of the viral shown to participate in this process in a partly redundant preintegration complex. These results thus demonstrate manner (Bukrinsky et al., 1993a; Heinzinger et al., 1994; that tyrosine phosphorylation reveals the karyophilic func- von Schwedler et al., 1994). MA is the N-term inal cleavage tion of MA in the context of the HIV-1 preintegration com- product of the HIV-1 Gag precursor by the viral protease plex, thereby playing a crucial role for infection of nonpro- and contains a nuclear localization signal (NLS) (Myers liferating cells such as macrophages. Cell 380

Figure 1. Myristoylation Prevents the NLS- KK*~KLKH S, C ..... ~,,,J-C'~'~!! ! !! !!!!!iia~m m~I Mediated NuclearImport of HIV-1 MA in Pro- ducer Cells MA: (A) Schematic representationof MA variants TTK~LK. analyzed in these experiments. MAG2A/KK27Tr: A ~ iii~ ~|~ T~KLK* (B) MA,H~sand MA~, variantsare nonmyristoy- rated. [3H]myristate-labeledextracts from 293

CA: cells transfected with proviral constructs ex- CX pressing either wild-typeMA, or the two N-ter- WT MAG2A minus mutated forms of the protein (see [A]), were analyzed by immunoprecipitationwith MA-specific antibody. @ ~ ~ ~ tubulir (C) Subcellular localization of MA in trans-

Irealrnent: -- fected cells. Cytoplasmic (CX) and nuclear (NX) fractions of 293 cells transfected with DNAs expressing the various forms of MA

1 2 3 4 5 6 1 2 3 4 5 6 7 1 2 3 4 5 6 shown in (A) (minus: mock) were analyzedby Western blotting, with antibodiesagainst MA (top), CA (middle), and tubulin (bottom). Wild- type MA (lane 2) is found exclusivelyin the cytoplasm, whereaslarge amounts of the two nonmyristoylatedforms of MA (lanes 3 and 5) migrate to the nucleus. Nucleartransport of nonmyristoylatedMA is greatly reduced by a mutationin the NLS (lanes4 and 6). CA and the tubulin control are restricted to the cytoplasm. (D) Wild-type MA is tightly bound to the plasmamembrane. 293 ceils expressingwild-type and a nonmyristoylatedform of MA were separated into plasmamembrane, cytosol, and nucleusfractions, followedby immunoprecipitationwith MA-specific antibodyand Western blotting. (E) Nuclearimport of nonmyristoylatedMA is blockedby NLS peptideand wheatgerm agglutinin(WGA), 293 cells expressingMAGu, were treated overnight as indicatedabove each lane (minus: mock). Nuclearfractions were then analyzedby immunoprecipitationwith MA-specific antibody, followed by Western blotting. The effect of WGA could be preventedby additionof N-acetylglucosamine,as described (Forbes, 1992).

Results HIV-1 preintegration complex (Gulizia et al., 1994), as well as that of other karyophiles harboring a related signal (Mi- Myristoylation Prevents the NLS-Mediated chaud and Goldfarb, 1993). Finally, nuclear import of non- Transport of MA to the Nucleus myristoylated MA could be prevented by wheat germ ag- of HIV-1 Producer Cells glutinin (Figure 1E, lanes 5-7), a lectin that specifically Altered forms of the HIV-1 MA protein were generated in blocks transport through the nuclear pore (reviewed by the context of a full-length proviral construct (Figure 1A). Forbes, 1992). First, two nonmyristoylated variants were created, one by In these experiments, MA was expressed together with replacing the MA N-terminal glycine by alanine, the sec- the other products of the gag and pol genes, raising the ond by introducing six histidines at the proximal end of possibility that these additional polypeptides altered its Gag. Both mutations effectively prevented myristoylation localization. These studies were thus repeated with HIV-1- (Figure 1 B). N LS-defective versions of these proteins were derived constructs in which the sequence encoding wild- also derived by replacing two lysines in the NLS by threo- type or nonmyristoylated MA was immediately followed by nines, a change previously shown to abrogate the function a stop codon. The respective distribution of these proteins of this motif (von Schwedler et al., 1994). Cytoplasmic and was similar to that observed in the context of full-length nuclear extracts of cells transfected with these constructs precursors, indicating that MA subcellular targeting is in- were then analyzed by Western blotting (Figure 1C). Wild- dependent from other Gag and Pol proteins (data not type MA was found exclusively in the cytoplasm (Figure shown). 1C, lane 2), as was the viral capsid (CA); tubulin, a protein normally restricted to this compartment, sewed as a con- MA Molecules Imported to the Nucleus of Newly trol. Further separation of the cytoplasm in membrane and Infected Cells Are Myristoylated cytosol fractions revealed that myristoylated MA was asso- The above data indicate that MA has intrinsic nucleophilic ciated with the plasma membrane, as previously de- properties conferred by the NLS, but in virus producer scribed (Varmus and Swanstrom, 1984; Spearman et al., cells, these are masked by myristoylation. Yet, once HIV-1 1994) (Figure 1D, lanes 1-3). In contrast, large amounts enters target cells, a functional MA NLS prevails and plays of both forms of nonmyristoylated MA were associated a major role in facilitating the nuclear import of the viral with the nucleus (Figure 1C, lanes 3 and 5; Figure 1D, preintegration complex (Bukrinsky et al., 1993a; von lanes 4-6). This process was NLS-dependent, since muta- Schwedler et al., 1994). One possible explanation for this tions in this motif induced the partial redistribution of non- paradox was that some unmyristoylated MA was incorpo- myristoylated MA to the cytoplasm (Figure 1C, lanes 4 rated in vidons and was selectively imported to the nucleus and 6). Furthermore, the nuclear import of nonmyristoy- of newly infected cells. Alternatively, proteolytic cleavage lated MA was effectively blocked by peptide containing could occur on a subset of MA molecules, removing the the prototypic SV40 large T antigen NLS (Figure 1E, lanes myristoylated N-terminus. To test these hypotheses, growth- 1-4). This correlates the previous demonstration that such arrested cells were acutely infected with viruses labeled peptide can inhibit the MA-mediated nuclear import of the with either [3sS]cysteine or [3H]myristic acid. Cytoplasmic MA Tyrosine Phosphorylationand HIV Nuclear Import 381

A 35S-cysteine-labelledvirions V CX NX treatment: _o~ x (z-MA:

cpm: 14,422 134 (0.93%)

B 3H-myristate-labelledvitions: c~-pTyr: p17-IP' V CX NX 1 2 3 MA-"~ B cpm: 19,516 192 (0.98%) c~-MA: Figure 2. MAMoleculeslmportedtotheNucleusofHIV-1TargetCells pt7"1~' @ Are Myristoylated Cytoplasmic(CX) and nuclear(NX) fractionsof y-irradiatedP4-2 cells acutely infected with virions purified from Molt IIIB cells labeledwith c~-pTyr: pl 7 "1~~ either pS]cysteine (A) or [3H]myristate(B) were immunoprecipitated with MA-specific antibody. V, virions. After autoradiography,bands 1 2 3 4 5 6 7 were excised and counted; the number of cpm recovered in each case is shown. Approximately1% of internalizedMA molecules,fully KKKYKLKH Y VSQNYPIVQN myristoylated, migrate to the nucleus of acutely infected cells. myr-G ~ and nuclear extracts, prepared at 6 hr postinfection, were C then analyzed for their respective MA contents. This revealed that approximately 99% of internalized MA molecules were found in a cytoplasmic fraction (Figure 2), mostly in association with the plasma membrane (data not shown). In contrast, 1% of MA molecules were present in a nuclear fraction. An identical nucieocytoplasmic ratio for MA was obtained when radioactive counts obtained from -Fill -F~I. [3sS]cysteine- or from [3H]myristic acid-labeled protein Figure 3. HIV-1 MA Is Phosphorylatedon C-TerminalTyrosine were used to calculate this number. On that basis, it can (A) Lysates of virions purified from HIV-l-infected CEM cells were be inferred that MA molecules associated with the nucleus analyzedby Western blottingwith MA- and phosphotyrosine-specific of newly infected cells are fully myristoylated. antibodies,as indicated,with or withoutprior treatmentwith phosphatase (CIP), or phosphataseplus orthovanadate(CIP + OV). (B) The same analysis, on virions produced by transfection of 293 The C-Terminal Tyrosine of MA Is Phosphorylated cells with constructs containing indicated tyrosine-to-phenylalanine Taken together, these results demonstrate that myristoy- mutations in MA. The C-terminaltyrosine of MA (Y132) is the target lation acts as a dominant targeting signal for MA during of phosphorylation. viral particle formation, yet for 1% of the molecules, it (C) Two-dimensionalphosphoamino acid analysisof s2P-labeledMA (wild type and Y132F) from virions isolatedfrom infectedCEM cells. becomes recessive once HIV-1 enters target cells. This Wild type (WT) containsphosphoserine and phosphotyrosine;MAy132F suggests a model in which some modification of MA, dur- contains phosphoserineonly. ing or after assembly, is responsible for silencing the influ- ence of myristoylation, thereby revealing the NLS effect. Interestingly, the membrane association of HIV-1 Gag de- reacted with an anti-phosphotyrosine antibody in Western pends not only on myristate, but also on nearby positively blots (Figure 3A, lane 1). The signal could be abolished charged residues predicted to interact with negatively by prior treatment of viral extracts with calf intestine phos- charged phospholipids in the plasma membrane (Zhou et phatase (Figure 3A, lane 2), unless the phosphatase inhibi- al., 1994). Such an electrostatic mechanism implies that tor orthovanadate was added (Figure 3A, lane 3). MA tyro- reversible membrane binding of MA might be achieved sine phosphorylation was not restricted to T cell-produced by introduction of appropriately placed negative charges virus, as it was also observed with virions purified from into the protein, for instance through phosphorylation. By the supernatant of transfected fibroblasts (Figure 3B). analogy, platelet-derived growth factor stimulation of 3T3 HIV-1 MA contains three highly conserved tyrosines, at cells is accompanied by N-terminal phosphorylation of positions 29, 86, and 132, respectively (Myers et al., 1992). myristoylated pp60°src, which is then released from the Each of these tyrosines was changed individually to phe- cell membrane (Walker et al., 1993). Similarly, phosphory- nylalanine, in the context of a full-length proviral construct. lation of membrane-bound myristoylated alanine-rich C Virions obtained from cells transfected with the resulting kinase substrate (MARCKS) by protein kinase C releases plasmids were analyzed by anti-phosphotyrosine Western this protein into the cytosol (Thelen et al., 1991). blotting (Figure 3B). This identified the C-terminal tyrosine Based on these precedents, the phosphorylation status of MA, at position 132, as the target of phosphorylation. of HIV-1 MAwas examined. It was thus found that, in HIV-1 Phosphoamino acid analysis of virions produced from 32p. virions purified from acutely infected T lymphoid cells, MA labeled cells confirmed that MA is phosphorylated on Tyr- Cell 382

A A B

'k'~"c "~-~'~ "~" '~'Y'~ c~-CA: ~,0 c~-MA: p55 -~'

~-pTyr: (~-pTyr: 12345 4-'11 +q p55

p18 p17 ,~" 4 1 2 3 4 ~J

##~o -

o~-MA: %&"~ t~" t*~" 17 p24(ng): 70 7070 8 0 lane: 2 3 4 5 p68~

Fraction No. c~-pTyr: Figure 5. MA Protein Kinase Activity in Cells and in Virions p68 "~' (A) In vitro phosphorylation of recombinant wild-type and Y132F MA protein, using [7-32P]ATP and pelleted supernatant from human T 1 2 3 lymphoid CEM cells (PCS). After reactions were performed as indi- CD4 cated, MA was purified on a nickel column, resolved by SDS-PAGE, and transferred to a PVDF membrane that was exposed to X-ray film. (B) Two-dimensional phosphoamino acid analysis of in vitro phosphorylated recombinant MA recovered from (A), showing incorporation of Figure 4. Requirements of MA Tyrosine Phosphorylation phosphate on serine, threonine and tyrosine in the case of wild-type, (A) 293 cells stably expressing various forms of Gag (Figure 1 ; MAsTop and on serine and threonine only in the case of MAY132F. encodes a truncated Gag precursor, owing to a stop codon right after (C, left panel) in vitro phosphorylation of recombinant MA, using the MA coding sequence), or a protease-defective provirus (APro), [y;32P]ATP and fractions from a Sephacryl S-1000 gel filtration purifica- were analyzed by Western blotting with MA-, CA- and phosphotyrosine- tion of HIV-1 virions from chronically infected Molt IIIB cells. Curve specific antibodies as indicated. MA tyrosine phosphorylation depends indicates p24 antigen content of each fraction. Phosphoamino acid on myristoylation and proteolytic cleavage of Gag. analysis (inset) shows that serine, threonine, and tyrosine kinase activi- (B) The same analysis on 293 cells transiently transfected with vectors ties are associated with HIV-1 particles. expressing a CD4/MA chimera represented below blot, with tyrosine (C, right panel) Virions present in fractions 3 and 4 were further immu- (44MA) or phenylalanine (44MAy~32F)at the MA C-terminus. MA under- noprecipitated with a mixture of gp120 and gp41 antibodies, or with goes tyrosine phosphorylation when recruited to the membrane as a control antiserum; the products were then used in an in vitro kinase part of an integral membrane protein. assay with recombinant MA as substrate. Lane 1, crude viral pellet; lane 2, Sephacryl S-1000-purified virions; lane 3, as lane 2, followed by immunoprecipitation with envelope-specific antibodies; lane 4, as lane 2, followed by immunoprecipitation with control serum, lane 5, negative control (no lysate). The amount of p24 antigen present in each sample is indicated below each lane. 132, as well as on serine (Figure 3C). Furthermore, radioactive measurements, done by comparing the amounts of [~S]cysteine and 32p incorporated in virus-associated MA when producer cells were labeled for 2 days, indicated for a regulatory event controlling, in a timely manner, the that approximately lS/o of MA molecules present in virions karyophilic properties of this protein. are phosphorylated (data not shown). To explore further the factors important for MA tyrosine phosphorylation, a chimeric integral membrane protein Requirements for MA Tyrosine Phosphorylation was constructed, with an extracellular and transmem- The requirements for MA tyrosine phosphorylation were brane region derived from CD4 and a cytoplasmic domain then determined. It revealed that this modification was made by MA. A variant of this chimera, in which the C-ter- dependent on the plasma membrane association of Gag, minal tyrosine of MA was changed to phenylalanine, served as nonmyristoylated forms of MA were not tyrosine phos- as control. These proteins, called 44MA and 44MAyt32F, phorylated (Figure 4A, lanes 1 and 2). If MA was produced respectively, were then analyzed by Western blotting with in the absence of other Gag and Psi proteins, its exposed MA- and phosphotyrosine-specific antibodies (Figure 4B). C-terminus underwent tyrosine phosphorylation (Figure The result showed that the tyrosine phosphorylation of the 4A, lane 4). However, no phosphotyrosine was detected in MA C-terminus occurred efficiently in the 44MA protein. the p55 Gag precursor, whether it was produced in normal It confirmed that this process is independent of the recog- amounts by wild-type virus or accumulated by a protease- nition of a specific receptor by the myristoylated end of defective mutant (Figure 4A, lane 5). The need for Gag MA. Furthermore, it demonstrated that MA tyrosine phos- proteolytic cleavage implies that MA tyrosi ne phosphoryla- phorylation does not require particle formation per se, nor tion is coupled with virus maturation, as might be expected the presence of any other viral protein. MA TyroeinePhosphorylation and HIV NuclearImport 383

A Co-culture: The pattern of tryptic phosphopeptides of phosphorylated hours; 0 1 2 3 6 0 1 2 3 6 MA molecules obtained in these experiments was examined and found to be comparable to that observed with virus-associated MA labeled in vivo (data not shown). Sig- ~-pTyr nificant levels of MA serine, threonine, and tyrosine kinase activities were also found in HIV-1 virions, purified from B Cell free infection: a chronically infected human T lymphoid cell line by size hours: 0 2 4 8 0 2 4 8 fractionation (Figure 5C, left). Moreover, the MA protein o~-MA -~ kinase activity remained associated with the viral particles when these were purified further by immunoprecipitation

c~-pTyr with antibodies against the viral envelope (Figure 5C, right). Cytoplasm Nucleus

C + NLS pepticle: Tyrosine-Phosphorylated MA Is Rapidly Imported hours: 0 2 4 0 2 4 8 to the Nucleus of Newly Infected Cells

~-MA -~" To ask whether tyrosine phosphorylation influences the karyophilic properties of MA, growth-arrested cells were exposed to HIV-1 and fractionated in cytoplasmic and nu- c(-pTyr clear fractions, at various times postinfection. These fractions were then analyzed by Western blotting, with MA- Cytoplasm Nucleus and phosphotyrosine-specific antibodies (Figures 6A and Figure 6. Tyrosine-PhosphorylatedMA Is RapidlyTransported to the 6B). As seen previously (Figure 3), the vast majority of Nucleus of Acutely InfectedCells MA molecules remained associated with the cytoplasm. Cytoplasmic and nuclear fractions of ,'/-irradiated P4-2 cells acutely In contrast, most of those phosphorylated on tyrosine were infected either by coculture (at a ratio of 50:1 with Molt IIIB cells) (A) rapidly transported to the nucleus. If cells were treated or with cell-freevirions (5 Ilg of p24) (B), harvestedat the indicated with NLS peptide, total levels of phosphotyrosine-con- times postinfection,were analyzedby immunoprecipitationwith anti- MA antibody, followedby Western blotting with MA- or phoephotyro- taining MA were not significantly changed, but this protein sine-specific antibody. Whereas the majority of MA remains in the was retained in the cytoplasm (Figure 6C). This indicates cytoplasm (associatedwith the plasma membrane,.data not shown), that the nuclear accumulation of tyrosine-phosphorylated most tyrosine-phosphorylatedMA rapidly migratesto the nucleus. MA does not reflect de novo phosphorylation in this com- ((3) Cell-freeinfection repeatedin the presenceof NLS peptide (500 IIM). Nuclear import of MA is blocked, but tyroeine-phosphorylated partment, but instead the rapid and preferential transloca- species are still detected,demonstrating that they are not generated tion of this protein from the cytoplasm to the nucleus of in the nucleus. acutely infected cells.

MA Tyrosine Phosphorylation Is Accomplished by An HIV-1 Strain Defective for MA Tyrosine a Cellular Protein Kinase Present in Virions Phosphorylation Is Blocked for Growth in The last point implied that a cellular kinase is responsible Terminally Differentiated Macrophages for MA tyrosine phosphorylation. This was tested by in Owing to a Defect in Nuclear Import vitro kinase assays employing recombinant MA protein as Our findings were compatible with a role for MA tyrosine substrate (Figure 5). When incubated in the presence of phosphorylation in HIV-1 nuclear import and, hence, for reaction buffer and ATP, MA did not autophosphorylate. infection of nondividing cells. To probe this issue, the repli- In contrast, phosphate moieties were transferred from cation of viruses containing wild-type and phosphotyro- [y-32P]ATP to MA, when either crude extracts of CEM or sine-defective versions of MA were compared under con- 293 cells or pelleted CEM supernatant were added (Figure ditions of cell proliferation and growth arrest. A virus with 5A). Greater levels of 3~p incorporation were seen when a mutation in the MA NLS served as additional control, pelleted cell supernatant, as opposed to cellular extract, as it was previously shown to be defective specifically in was used as the source of protein kinase activity. However, nondividing cells (von Schwedler et al., 1994). Since Vpr this was due to higher levels of endogenous ATP in the can partly substitute for MA in facilitating the nuclear mi- cells, which interfered with the incorporation of 32p into the gration of HIV-1 in nonmitotic targets (Heinzinger et al., MA substrate: when reactions were normalized by adding 1994), these experiments were done with viral strains car- nonradioactive ATP to 20 raM, cell extracts were found rying a defective vprgene. Substituting a phenylalaninefor to be more effective at phosphorylating MA (data not the C-terminal tyrosine of MA did not alter Gag processing shown). In these in vitro assays, incorporation of phos- (Figure 3) nor replication of the resulting HIV-1 mutant in phate was less efficient on tyrosine than on serine, and activated peripheral blood lymphocytes (Figure 7, top). some phosphothreonine was also observed, whereas However, like the MA NLS mutant, this variant was unable none was found with in vivo labeled MA. However, the to grow in terminally differentiated macrophages (Figure C-terminal tyrosine of MA was specifically modified, as 7, bottom). no phosphotyrosine was recovered when reactions were To examine further this parallel and to determine the performed on a recombinant MAy~32Fvariant (Figure 5B). level at which the replication of the tyrosine mutant was Cell 384

3o I tLme: 3 h 8 h 24 h 32 h 48 h 28 Target: PHA-activeted PBL 26 p,\ ar'-~-]c ~ aF"~¢ lab clla b c' 24 • R7Bal ; • 2021 -- O-- MAKK27.n-.R7Bal ,,./ " --O"- MAyI32F.RTBal 18" "-•'" R7 *" '" 16 ' ,;' *.

14"12" y~O 10" LL -Ib 8 " 6" /, /4 4'

¢ 2 4 6 8 10 12 ~ 30" Ci 28 " Target:Macrophages

24 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 22 2O Figure 8. NuclearImport of MA PhosphotyrosineMutant HIV-1 Is De- 18 16 fective in Macrophages 14 Terminally differentiated macrophages infected with wild-type MA 12 10 (a: R7BaL), MA phosphotyrosine-defective(b: MA¥132~R7BaL),or 8 NLS-defective (c: MAKK2TI-FR7BaL)viruses (all of which encode a 62 4 2 nonfunctional Vpr protein) were analyzed by PCR at the indicated 22 timepoints, with primers specificfor variousproducts of reversetrans-

5 10 15 20 25 30 cription. EL, early linear products (elongated minus-stand DNA); LL, late linear products (generated after the second template switch); Ci, days post-infection two-LTR circles (formed in the nucleus).Both MA mutants inducewild- Figure 7. MA Phosphotyrosine Mutant HIV-1 Is Unable to Grow in type levelsof linear DNA but dramaticallyreduced amounts of circles. Macrophages Growth of NLS-defective (MAKK2rcrR7Bak) and MA phosphotyrosine- defective viruses(MA¥132FR7BaL) were compared with that of the wild- Discussion type parent (R7Bak) in PHA-activated PBL (top) and terminally differentiated macrophages(bottom). The T cell tropic strain R7, which cannot The HIV-1 MA protein fulfills two crucial functions at differ- infect macrophages, served as control. All viruses encode a truncated ent stages of the virus life cycle, as it is required for both Vpr that cannnot substitutefor MA NLS function in macrophages(yon particle assembly and nuclear import of the viral preinte- Schwedler et al., 1994). gration complex. The myristoylation signal and the NLS, which exert contradictory influences on the subcellular lo- blocked, viral DNA synthesis in freshly infected macro- calization of MA, are each essential for one of these two phages was studied. The accepted model for reverse functions. Here, we present a model for the regulatory transcription includes a series of steps, beginning with the mechanism that allows MA to play its dual role. We first synthesis of DNA complementary to the U5 and R regions show that myristoylation acts as a dominant targeting sig- of the viral long terminal repeat (minus-strand strong-stop nal for MA in virus producer cells, leading to particle forma- DNA), continuing with the elongation of this minus-strand tion at the plasma membrane and release of new virions after a first template switch, and culminating in the genera- into the extracellular space. We then demonstrate that a tion of a full-length double-stranded DNA molecule follow- small subset of MA molecules undergo tyrosine phosphor- ing a second template switch. Once the viral DNA is trans- ylation. The dependence of this process on both mem- ported to the nucleus, full-length linear molecules can brane association and proteolytic cleavage of Gag sug- circularize either by ligation of their two ends or through gests that it occurs concomitantly with virus maturation. recombinatorial events (Varmus and Swanstrom, 1984). A protein kinase activity that transfers phosphate to the The appearance of these various intermediates and prod- C-terminal tyrosine of recombinant MA can be detected ucts of reverse transcription was thus monitored by poly- in cells as well as in purified virions. A crucial link between merase chain reaction (PCR), in terminally differentiated MA tyrosine phosphorylation and the subsequent import macrophages acutely infected with the HIV-l-derived vi- of the HIV-1 preintegration complex is revealed by two ruses (Figure 8). This revealed that the phosphotyrosine- lines of evidence. First, there is rapid translocation of tyro- defective virus directed the synthesis of wild-type amounts sine-phosphorylated MA to the nucleus of newly infected of viral linear DNA, indicating that its entry and reverse cells, whereas the bulk of MA, not phosphorylated on tyro- transcription proceeded normally. In contrast, and like the sine, remains at the plasma membrane. Second, a mutant NLS mutant, this variant produced much lower levels of virus in which the critical MA tyrosine is changed to phen- viral DNA circles compared with wild type. These results ylalanine is selectively impaired for growth in terminally indicated that the absence of tyrosine at the C-terminal differentiated macrophages, owing to a block in nuclear end of MA specifically impairs the nuclear import of HIV-1 import. DNA. These data thus allow us to conclude that tyrosine phosphorylation reveals the karyophilic properties of MA MA Tyrosine Phosphorylation and HIV-1 Nuclear in the context of the HIV-1 preintegration complex, thereby Import: Potential Mechanisms playing an esential role for infection of terminally differenti- The nucleophilic properties of several other proteins are ated macrophages. derepressed following phosphorylation, For instance, treat- MA Tyrosine Phosphorylationand HIV Nuclear Import 385

ment of cells with interferon-a (IFN-~) induces tyrosine On the one hand, there could be an additive effect of MA phosphorylation and nuclear translocation of the IFN-cc- serine phosphorylation, and in agreement with such a stimulated gene factor 3 (ISGF3), a transcriptional regula- model, our preliminary studies indicate that this modi- tor involved in mediating cellular responses to the cytokine fication too is coupled to virus maturation (S. S. and (Schindler et al., 1992). In that case, an interaction be- D. T., unpublished data). Alternatively, it could be that MA tween the phosphotyrosine and an SH2 domain mediates is preferentially released from the membrane of virions the dimerization of the protein, perhaps exposing a yet rather than from the membrane of virus producer cells. In unidentified nucleophilic motif (Shuai et al., 1994). Also, that respect, the fluidity and lipidic composition of the the nuclear import of SV40 large T antigen is significantly HIV-1 membrane have been shown to significantly differ reduced when sequences flanking the NLS and containing from those of the host cell plasma membrane (Aloia et al., casein kinase II (CKII) phosphorylation sites are removed 1993). Finally, tyrosine phosphorylation could trigger an (Rihs and Peters, 1989). This might reflect an increased association between MA and one of the proteins that are affinity of phosphorylated T antigen for a cytoplasmic re- directed to the central region of the core during virus matu- ceptor responsible for its routing to the nuclear envelope. ration and are ultimately involved in forming the virus pre- It is likely that tyrosine phosphorylation enhances the integration complex, such as the integrase and the reverse nuclear transport of HIV-1 MA through a different mecha- transcriptase. The nuclear magnetic resonance analysis nism. Indeed, nonmyristoylated MA is effectively imported of MA predicts that the C-terminal 20 amino acids of the to the nucleus even though it is not tyrosine phosphory- protein do not adopt a rigid conformation and, therefore, lated (Figures 1 and 4). Based on this, it is probable that might be available for such an interaction (Matthews et phosphorylation triggers the redistribution of MA from the al., 1994). membrane to the inner region of the virus, thereby allowing An implication of all the above models is that tyrosine- the NLS to play its role in the context of the viral preintegra- phosphorylated MA molecules might be found inside the tion complex. This could be accomplished by at least two viral core. Previous immunoelectron microscopic studies nonmutually exclusive mechanisms: by simply disrupting have instead localized MA at the periphery of virions, interactions between MA and the viral membrane, or by tightly bound to the inner leaflet of the virus membrane stimulating the binding of MA to another component of (Gelderblom et al., 1987). However, of the 1500 MA mole- the viral core nucleoprotein complex. cules estimated to be present in each virion (Gelderblom, Membrane release of MA could result from a major con- 1991), on the basis of our data, we would not expect more formational change in the protein following phosphoryla- than 1°, or approximately 15, to be associated with the tion. However, a more subtle mechanism could achieve core. Indeed, this represents the fraction subsequently the same result. Indeed, the proximal region of HIV-1 Gag imported to the nucleus of newly infected cells (Figure 3). contains a bipartite membrane targeting signal, compris- It is reasonable to assume that such a small number of ing the myristoylated N-terminal 14 residues, plus an adja- MA molecules would have escaped detection by electron cent sequence of 17 amino acids, a number of which are microscopy. Another prediction derived from our experi- positively charged (Spearman et al., 1994; Zhou et al., ments is that, following fusion of the virus and target cell 1994). This more distal region, which has been shown to membranes, tyrosine-phosphorylated MA molecules are bind to acidic phospholipids in vitro (Zhou et al., 1994), is the ones whose NLS is recognized by a cytoplasmic chap- predicted to establish electrostatic interactions with nega- erone responsible for leading the preintegration complex tively charged phospholipids located on the inner leaflet to the nucleopore (Adam and Gerace, 1991; Forbes, of the membrane bilayer. Thus, by introducing negative 1992). Our preliminary analyses show that MA molecules charges in MA, phosphorylation could disrupt these inter- contained in the preintegration complex are indeed phos- actions, thereby releasing the protein from the plasma phorylated on tyrosine, supporting this hypothesis (P. G. membrane. A similar mechanism has been shown to ac- and D. T., unpublished data). count for the release of myristoylated pp60~~'° and MARCKS from the plasma membrane into the cytosol following phosphorylation by protein kinases A and C, respectively A Virus-Associated Cellular Protein Kinase (Walker et al., 1993; Thelen et al., 1991). With MA, detach- Responsible for MA Tyrosine Phosphorylation ment from the membrane would unleash the karyophilic The data presented here provide strong evidence indicat- potential conferred by the NLS. ing that MA tyrosine phosphorylation is accomplished by However, two arguments can be advanced against this a cellular protein kinase. The MA tyrosine kinase activity simple model. First, the tyrosine that becomes phosphory- is not restricted to T lymphocytes but is also found in fibre- lated is at a significant distance from the region of MA blasts. It fails to phosphorylate nonmyristoylated MA, and involved in membrane binding, not only considering a lin- so it is likely associated with the cell membrane. This activ- ear map of the protein but also its recently proposed struc- ity can also be detected in the cell supernatant, most prob- ture (Matthews et al., 1994). Second, tyrosine-phosphor- ably due to cellular breakdown, rather than to secretion. ylated MA is detected in virus producer or MA-expressing Remarkably, the MA tyrosine kinase is present in HIV-1 cells (Figure 1; data not shown), yet in these cells it re- virions purified by size fractionation followed by immune- sides in the cytoplasm but not the nucleus. This suggests precipitation with anti-envelope antibodies. Whether this that an additional factor potentiates the effect of MA tyro- reflects the stable binding of the enzyme to its MA sub- sine phosphorylation once HIV-1 leaves producer cells. strate or the passive incorporation of a membrane-bound Cell 386

enzyme in budding virions is still to be defined. The target TransfecUons and Infections of the tyrosine kinase is the last amino acid of MA, a pre- Tranfections and preparations of viral stocks were as previously described (von Schwedler et al., 1993; Aiken et al., 1994). Infections of viously unseen placement for a phosphotyrosine. Only the PBLs (2 x 106 cells) and macropbages (0.5 x 10 e cells) were per- free end of MA is recognized, either after it is liberated by formed with 20 ng of p24 of 293 cell-produced viruses as previously proteolytic cleavage of the Gag precursor or when it is described (von Schwedler et al., 1994). For virus growth curves, cells naturally exposed, for instance in the MAsToP and 44MA were washed extensively after virus adsorption and p24 antigen production was monitored by ELISA (DuPont). Experiments were re- molecules (Figure 4). This appears to permit a coupling peated many times with cells from different donors, with similar resu Its. between virus maturation and MA tyrosine phosphor- In rare instances, however, both NLS and tyrosine mutants showed ylation. a less pronounced phenotype, perhaps linked to the state of arrest The MA tyrosine kinase remains to be formally identi- or differentiation of the macrophages. To follow MA nuclear import, fied. However, the present work establishes that it plays infections of P4-2 irradiated cells were performed either by coculture with Molt IIIB cells at a ratio of 50 to 1, or by the addition of cell-free a crucial role in facilitating HIV-1 replication in terminally virus purified from the same cells (5 p.g of p24 antigen per 3 x 107 differentiated macrophages, cells thought to be critical for P4-2 cells). In the experiments of Figure 2, infections were performed both the persistence and the dissemination of the infection using cell-free virus produced by Molt IIIB cells radiolabeled for 20 hr, (Gartner and Popovic, 1990). Efforts aimed at identifying either with 200 p.Ci/ml of Tran~S-label (ICN) or with 500 i~Ci/ml of compounds that block MA tyrosine phosphorylation are [3H]myristic acid (Amersham). Virions used for in vitro kinase assays were prepared by gel fractionation on a Sephacryl S-100O column as thus warranted, as they may lead to novel therapies for previously described (Trono, 1992). slowing the spread of the virus in HIV-infected individuals. Western Blots and Immunoprecipitstions Rabbit anti-HIV-1 MA serum was obtained by immunization with the Experimental Procedures above described recombinant histidine-tagged HIV-1 MA protein. Monoclonal antibodies against p24/p55 (ST-3) and tubulin were pur- DNA Constructions chased from Bethesda Research Laboratories and Boehringer Mann- PCR-mediated mutagenesis was used to introduce site-specific muta- helm, respectively. Rabbit anti-phosphotyrosine serum was a gift from tions in the MA- or protease-encoding regions of plasmid R7 (Kim et B. Seffon, Salk institute. Of note, several commercially available anti- al., 1989; yon Schwedler et al., 1993), which contains the HIV-1HXB2D phosphotyrosine monoclonal antibodies failed to recognize the tyro- provirat DNA (Shaw et al., 1984) with a full-length nef reading frame, sine-phosphorylated form of MA. Western blot and immunoprecipita- as well as in R7BaL, which encodes a macrophage-tropic virus (von tion studies were as previously described (Aiken et al., 1994). Schwedler et al., 1994). Both R7 and R7BaL produce a truncated Vpr protein, 78 amino acids in length, previously shown to be unable to Subcellular FracUonation substitute for the NLS function of MA in macrophages (von Schwedler Cells were lysed in cold hypotonic buffer (20 mM potassium HEPES et al., 1994). The MAG~ variant has the N-terminal glycine of Gag [pH 7.8], 5 mM potassium acetate, 0.5 mM MgCI2, 0.5 mM dithiothreitol, changed to alanine. The proximal sequence of the MA,H,, protein is 1 mM sodium orthovanadate, 1 p.g/ml leupeptin, 1 p~g/ml aprotinin, 1 Met/Gly/(His)JSer, in which Ser is normally the sixth residue of Gag. ~g/ml pepstatin A, 1 mM phenylmethylsulfonyl fluoride [PMSF]) using APro has a 45 nt deletion in the pol gene (bases 2384-2428, as num- several strokes of a Dounce homogenizer as described by Sugasawa bered by Ratner et al., 1985). The various mutations were also intro- et al. (1990). Nuclear preservation during cell lysis was followed by duced in a modified proviral DNA construct, 3E-neo, which expresses phase-contrast microscopy. Cytoplasmic and nuclear extracts were an env-defective version of R7 and contains the sequence encoding separated by centrifugation at 750 x g for 5 rain, and nuclei were for neomycin phosph0transferase instead of nef (Trono, 1992). The extracted with a hypertonic buffer (20 mM potassium HEPES [pH 7.8], 44MA and 44MA~132Fchimeras were constructed by PCR, introducing 0.5 mM MgCI2, 500 mM potassium acetate, 0.5 mM dithiothreitol, 1 a unique cloning site at the junction between the transmembrane re- mM sodium orthovanadate, 1 p.g/ml leupeptin, 1 ~g/ml aprotinin, 1 gion of CD4 and the N-terminal end of MA, in the context of a CMV- p.g/ml pepstatin A, 1 mM PMSF). Membrane and cytosol fractions were based expression vector (Aiken et al., 1994). Recombinant MA carrying isolated from cytoplasmic extracts as described (Lin et al., 1991). High an N-terminal histidine tag was produced in Escherichia coil using the pressure liquid chromatography (H PLC)-purified peptides correspond- bacterial expression vector pET-15b (Novagen) and purified by affinity ing to the prototypic SV40 T antigen NLS in the sense (PKKKR- chromatography on a nickel-Sepharose column according to the in- KVEDPYC) and reverse (PDEVKRKKKPYC) orientations were used structions of the manufacturer. as described (Gulizia et al., 1994). Wheat germ agglutinin (WGA) was used at 10 I~M, with or without addition of N-acetylglucosamine (450 Cells I~M), as described in Finlay et al. (1987). All cells were maintained as previously described (Aiken et al., 1994; von Schwedler et al., 1994). HIV-t-infected Molt IIIB human T lymphoid Phosphorylation Studies cell lines were obtained from C. Farnet through the NIH AIDS Research HIV-1 DNA (40 I~g) was transfected into 5 × 106 CEM ceils by electro- and Reference Program. HeLa-derived P4-2 cells (Charneau et al., poration. At the peak of p24 viral antigen production, ceils were radiola- 1990) were a gift from F. Clavel. Peripheral blood lymphocytes (PBLs) beled with 35 mCi of ~P H3PO4 (DuPont) for 48 hr at 37°C. Labeled and monocyte-derived macrophages were purified as previously de- virions were first filtered and pelleted, and then incubated for 10 rain scribed (von Schwedler et al., 1994). Macrophages were kept in culture in viral lysis buffer (12 mM Tris-HCI [pH 8.0], 0.5% Triton X-100, 300 for 2 weeks before infection. For stimulation, PBLs were incubated mM NaCI, 1 mM MgCI2, 0.5 mM dithiothreitol, and 100 rim sodium with phytohemagglutinin (Bethesda Research Laboratories) at 3 ~g/ orthovanadate). M A protein was the n immunoprecipitated with a mono- ml for 48 hr and then maintained in RPMI 1640 containing 10% fetal clonal anti-HIV-1 IIIB MA antibody (Advanced Biotechnologies Inc.)on calf serum and recombinant interleukin-2 (Sigma) at 10 U/ml. To induce protein A-Sepharose beads. After SDS-PAGE and electrobiotting to growth arrest, P4-2 cells were exposed for 20 min to a 61Co source polyvinylidene difluoride (PVDF) membrane, phosphorylated MA was calibrated at 200 rad/min. After irradiation, cells were diluted for infec- visualized by autoradicgraphy and analyzed further for phosphoamino tion to 1 x 106/ml and plated. The arrested state of the cells at the acid content, essentially as described by Boyle et al. (1991). time of infection was verified by propidium iodide staining of their DNA and flow cytometry to ascertain that all cells were in the G2 phase of PCR Analysis of Acutely Infected Cells the cycle. Stable 293 cell lines expressing various MA variants, as PCR analysis was performed as previously described (yon $chwedler well as APro, were created by transfection with LIE-neo-derived plas- et al., 1993). The sequences of HIV-specific primers are as follows raids and selection in 0.5 mg/ml G418. (positions of nucleotides in the HIV-1H×B~D sequence, according to MA Tyrosine Phosphorylation and HIV Nuclear tmport 387

Ratner etal. [1985], are indicated in parentheses). Vif6: GGGAAAGC- effect of structure on viral function. AIDS 5, 617-638. TAGGGGATGGI-]TTAT (5136-5159); Vif?: CAGGGTCTACTTGTGT- Gelderblom, H. R., Hausmann, E. H. S., C)zel, M., Pauli, G., and Koch, GCTATTC (5340-5317); LTR5: GGCTAACTAGGGAACCCACTGCTT M. A. (1987). Fine structure of human immunodeficiency virus (HIV) (496-516); 5NC2: CCGAGTCCTGCGTCGAGAGAGC (698-677); LTRS, and immunolocalization of structural proteins. Virology 156, 171-176. TCCCAGGCTCAGATCTGGTCTAAC (488-465 and 9572-9549); L TRg, Gulizia, J., Dempsey, M. P., Sharova, N., Bukrinsky, M. I., Spitz, L., GCCTCAATAAAGCTTGCCTTG (522-542 and 9606-9626). Vif6 plus Goldfarb, D., and Stevenson, M. (1994). Reduced nuclear import of Vif7 amplify elongated minus-strand DNA, LTR5 plus 5NC2 amplify human immunodeficiency virus type 1 preintegration complexes in the double-stranded molecules generated after the second template presence of a prototypic nuclear targeting signal. J. Virol. 68, 2021- switch, and LTR8 plus LTR9 amplify two-LTR circles. 2025. Heinzinger, N. K., Bukrinsky, M. I., Haggerty, S. A., Ragland, A. M., Acknowledgments Kewalramani, V., Lee, M.-A., Gendelman, H. E., Ratner, L., Stevenson, M., and Emerman, M. (1994). The Vpr protein of human immunodefi- Correspondence should be addressed to D. T. We thank Tony Hunter ciency virus type 1 influences nuclear localization of viral nucleic acids for helpful suggestions during the course 0I t'nese studies, as well as in nondividing host cells. Proc. Natl. Acad. Sci. USA 91,7311-7315. critical reading of this manuscript. We are indebted to Bart Sefton for Humphries, E. H., and Temin, H. M. (1972). Cell cycle dependent the gift of the anti-phosphoryrosine antibody, to Inder Verma, Tom activation of Rous sarcoma virus-infected stationary chicken cells: Hope, and Rick Bushman for insightful cormnents, to Jinping Song avian leukosis virus group-specific antigens and ribonucleic acid. J. for technical assistance, and to Verna Stitt for the artwork. This study Virol. 10, 82-87. was supported by a grant from the Berger Foundation to D. T. and Humphries, E. H., and Temin, H. M. (1974). Requirement for cell divi- by postdoctoral fellowships from the Swiss National Science Founda- sion for initiation of transcription of Rous sarcoma virus RNA, J. Virol. tion to P. G. and from the National Institutes of Health to C. A. As a 14, 531-546. Pew Scholar in the Biomedical Sciences, D. T. receives support from the Pew Charitable Trust. Kalderon, D., Roberts, B. L., Richardson, W. D., and Smith, A. E. (1984). A short amino acid sequence able to specify nuclear location. Received November 9, 1994; revised December 22, 1994. Cell 39, 499-509. Kim, S., Byrn, R., Groopman, J., and Baltimore, D. (1989). Temporal References aspects of DNA and RNA synthesis during human immunodeficiency virus infection: evidence for differential gone expression. J. Virol. 63, Adam, S. A., and Gerace, L. (1991). Cytosolic proteins that specifically 3708-3713. bind nuclear location signals are receptors for nuclear import. Cell 66, Lewis, P. F, and Emerman, M. (1994). Passage through mitosis is 837-847. required for oncoretroviruses but not for the human immunodeficiency Aiken, C., Konner, J., Landau, N. R., Lenburg, M. E., and Trono, D. virus. J. Virol. 68, 510-516. (1994). Nef induces CD4 endocytosis: requirement for a critical dileu- Lewis, P, Hensel, M., and Emerman, M. (1992). Human immunodefi- cine motif in the membrane-proximal CD4 cytoplasmic domain. Cell ciency virus infection of cell arrested in the cell cycle. EMBO J. 11, 76, 853-864. 3053-3058. Aloia, R. C., Tian, H., and Jensen, F. C. (1993). Lipid composition and Lin, P. H., Selinfreund, R., and Wharton, W. (1991). Isolation of cell fluidity of the human immunodeficiency virus envelope and host cell membrane for epidermal growth factor receptor studies. Meth. Enzy- plasma membranes. Prec. Natl. Acad. Sci. USA 90, 5181-5185. mol. 198, 251-259 Boyle, W. J., Van Der Geer, P., and Hunter, T. (1991). Phosphopeptide Matthews, S., Badow, P., Boyd, J., Barton, G., Russell, R., Mills, H., mapping and phosphoamino acid analysis by two-dimensional separa- Cunningham, M., Meyers, N., Burns, N., Clark, N., Kingsman, S., tion on thin-layer cellulose plates. Meth. Enzymol. 201, 110-256. Kingsman, A., and Campbell, I. (1994). Structural similarity between Bukrinsky, M I., Sharova, N., Dempsey, M. P., Stanwick, T. L., Bukrin- the p17 matrix protein of HIV-1 and interferon-~/. Nature 370, 666- skaya, A. G., Haggerty, S., and Stevenson, M. (1992). Active nuclear 668. import of human immunodeficiency virus type 1 preintegration com- Michaud, N., and Goldfarb, D. S. (1993). Most nuclear proteins are plexes. Proc. Natl. Acad. Sci. USA 89, 6580-6584. imported by a single pathway. Exp. Cell Res. 208, 128-136. Bukrinsky, M. I., Haggerty, S., Dempsey, M. P., Sharova, N., Adzhubei,,, Myers, G., Berzofsky, J. A., Pavlakis, G. N., Korber, B., and Smith, A., Spitz, L., Lewis, P., Goldfarb, D., Emerman, M., and Stevenson,,, R.F., eds. (1992). Human Retroviruses and AIDS 1992: A Compilation M. (1993a). A nuclear localization signal within HIV-1 matrix protein and Analysis of Nucleic Acid and Amino Acid Sequences (Los Alamos, that governs infection of non-dividing cells. Nature 365, 666-669. New Mexico: Los Alamos National Laboratory). Bukrinsky, M. I., Sharova, N., McDonald, T. L., Pushkarskaya,, T., Ratner, L., Haseltine, W. A., Patarca, R., Livak, K. J., Starcich, B., Tarpley, W. G., and Stevenson, M. (1993b). Association of integTase, Josephs, S. F., Doran, E. Z., Rafalski, J. A., Whitehorn, E. A., Baumeis- matrix, and reverse transcriptase antigens of human immu~odefi- ter, K., Ivanoff, L., Petteway, S. R., Pearson, M. L., Lautenberger, J. A., ciency virus type 1 with viral nucleic acids following acute infection. Papas, T. S., Ghrayeb, J., Chang, N., Gallo, R. C., and Wong-Staal, F. Proc. Natl. Acad. Sci. USA 90, 6125-6129. (1965). Complete nucleotide sequence of the AIDS virus, HTLV-III. Charneau, P., Alizon, M., and Clavel, F. (1990). A second origin of DNA Nature 313, 277-283. plus-strand synthesis is required for optimal human immunodeficiency Rihs, H.-P., and Peters, R. (1989). Nuclear transport kinetics depend virus replication. J. Virol. 66, 2814-2820. on phosphorylation-site-containing sequences flanking the karyophilic Dorfman, T., Mammano, F., Haseltine, W. A., and GSttlinger, H. G. signal of the Simian virus 40 T-antigen. EMBO J. 7, 1479-1484. (1994). Role of the matrix protein in the virion association of the human Roe, T., Reynolds, T. C., Yu, G., and Brown, P. O. (I993). Integration immunodeficiency virus type 1 envelope glycopro,tein. J. Virol. 68, of murine leukemia virus DNA depends on mitosis'..EMBO J. 12, 2099- 1689-1696. 2108. Finlay, D. R., Newmeyer, D. D., Price, T. M., and: Forbes, D. J. (1987). Schindler, C., Shuai, K., Prezioso, V. R., and Darnell, J. E., Jr. (19921, Inhibition of in vitro nuclear transport by a lectin that binds to nuclear Interferon-dependent tyrosine phosphoryla~ion of a latent cytoplasmic pores. J. Cell Biol. 104, 189-200. transcription factor. Science 257, 809-813. Forbes, D. J. (1992). Structure and function of the nuclear pore com- Sharova, N., and Bukrinskaya, A. (1991)~ p17 and p17-contai~ihg gag plex. Annu. Rev. Cell Biol. 8, 495-527. precursors of input human immunodeficiency virus are tra~,ported Gartner, S., and Popovic, M. (1990). Macrophage. trapism of HIV-I. into the nuclei of i~fected cells. AIDS Res. Hum. Retroviruse~ 7, 303- AIDS Res. Hum. Retroviruses 8, 1017-1021. 306. Gelderblom, H. R. (1991). Assembly and morphology of HIV: potential Shaw, G. M., Hahn, B. H., Arya, S. K., Groopman, J. E--~.Gallo, R. C., Cell 388

and Wong-Staal, F. (1984). Molecular characterization of human T-cell leukemia (lymphotropic) virus type III in the acquired immune deficiency syndrome. Science 226, 1165-1171. Shuai, K., Horvath, C. M., Tsai Huang, L. H., Qureshi, S. A., Cowburn, D., and DarneU, J. E., Jr. (1994). Interferon activation of the transcription factor Stat91 involves dimerization through SH2-phosphotyrosyl peptide interactions. Cell 76, 821-826. Spearman, P., Wang, J.-J., Vander Heyden, N., and Rather; L. (1994). Identification of human immunodeficienvy virus type 1 Gag protein domains essential to membrane binding and particle assembly. J. Virol. 68, 3232-3242. Sugasawa, K., Murakami, Y., Miyamoto, N., Hanaoka, F., and Ui, M. (1990). Assembly of nascent DNA into nucleosome structures in simian virus 40 chromosomes by HeLa cell extract. J. Virol. 64, 4820-4829. Thelen, M., Rosen, A., Nairn, A. C., and Aderem, A. (1991). Regulation by phosphorylation reversible association of a myristoylated protein kinase C substrate with the plasma membrane. Nature 351,320-322. Trono, D. (1992). Partial reverse transcripts in virions from human immunodeficiency and routine leukemia viruses. J. Virol. 66, 4893- 4900. Varmus, H. E., and Swanstrom, R. (1984). Replication of Retroviruses. In RNA Tumor Viruses, Second Edition, R. A. Weiss, N. Teich, H. E. Varmus, and J. Coffin, eds. (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press), pp. 369-512. von Schwedler, U., Song, J., Aiken, C., and Trono, D. (1993). vif is crucial for human immunodeficiency virus type 1 proviral DNA synthesis in infected cells. J. Virol. 67, 4945-4955. von Schwedler, U., Kornbluth, R. S., and Trono, D. (1994). The nuclear localization signal of the matrix protein of human immunodeficiency virus type 1 allows the establishment of infection in macrophages and quiescent T lymphocytes. Proc. Natl. Acad. Sci. USA 91, 6992-6996. Walker, F., deBlaquiere, J., and Burgess, A. W. (1993). Translocation of pp60~'`rc from the plasma membrane to the cytosol after stimulation by platelet-derived growth factor. J. Biol. Chem. 268, 19552-19558. Weinberg, J. B., Matthews, T. J., Cullen, B. R., and Malim, M. H. (1991). Productive human immunodeficiency virus type 1 (HIV-1)infection of nonproliferating human monocytes. J. Exp. Med. 174, 1477-1482. Yu, X., Yu, Q,-C., Lee, T.-H., and Essex, M. (1992a)~ The C terminus of human immunodeficiency virus type 1 matrix protein is involved in early steps of the virus life cycle. J. Virol. 66, 5667-5670. Yu, X., Yuan, X., Matsuda, Z., Lee, T.-H., and Essex, M. (1992b). The matrix protein of human immunodeficiency virus type 1 is required for incorporation of viral envelope protein into mature virions. J. Virol. 66, 5966-5971. Zhou, W., Parent, L. J., Wills, J. W., and Resh, M. D. (1994). Identifica- tion of a membrane-binding domain within the amino-terminal region of human immunodeficiency virus type 1 Gag protein which interacts with acidic phospholipids. J. Virol. 68, 2556-2569.