DOCSLIB.ORG

Hyperekplexia: a Novel Mutation in a Family J Med Genet: First Published As 10.1136/Jmg.33.5.435 on 1 May 1996

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Hyperekplexia: a Novel Mutation in a Family J Med Genet: First Published As 10.1136/Jmg.33.5.435 on 1 May 1996 IJMed Genet 1996;33:435-436 435 Analysis of GLRA1 in hereditary and sporadic hyperekplexia: a novel mutation in a family J Med Genet: first published as 10.1136/jmg.33.5.435 on 1 May 1996. Downloaded from cosegregating for hyperekplexia and spastic paraparesis Frances V Elmslie, Simon M Hutchings, Valerie Spencer, Ann Curtis, Thanos Covanis, R Mark Gardiner, Michele Rees Abstract Hyperekplexia or startle disease is characterised Hyperekplexia is a rare condition char- by the presence of an exaggerated startle Department of acterised by the presence of neonatal to Paediatrics, University response unexpected auditory, visual, or College London hypertonia and an exaggerated startle re- sensory stimuli. Affected subjects frequently Medical School, sponse. Mutations have been described in present at birth with hypertonia. Hyperekplexia The Rayne Institute, GLRA1, the gene encoding the al subunit is usually inherited in an autosomal dominant S University Street, London WC1E 6JJ, UK of the glycine receptor, in dominant manner. Linkage studies localised the gene to F V Elmslie families with hyperekplexia and in a single distal chromosome 5q.' Subsequently, mut- S M Hutchings sporadic case, thought to represent an ations were detected in exon 6 of the gene R M Gardiner M Rees autosomal recessive form of the disease. encoding the ct, subunit ofthe glycine receptor, In this study the coding region of the GLRA1L2 The previously described mutations Department of Human GLRA1 was analysed in eight probands are listed in table 1. All occur in large dominant Genetics, University of Newcastle upon Tyne, with hyperekplexia by restriction digest pedigrees'-5 except for one which may represent 19120 Claremont Place, and sequencing. Two familial cases were a recessive form of the disease.5 In this study, Newcastle upon Tyne found to possess the previously described GLRA1 was analysed in eight probands with NE2 4AA, UK V Spencer G1192A (R271Q) mutation in exon 6. In an hyperekplexia. In three cases the families clearly A Curtis additional family in which hyperekplexia display dominant inheritance; four cases are cosegregates with spastic paraparesis, a sporadic. In one family (family R) the family Department of novel A to G transversion at nucleotide Neurology/ history is uncertain and it is possible that they Neurophysiology, 1206 in exon 6 was detected that changes may represent an autosomal recessive form of Aghia Sophia a lysine at amino acid 276 to a glutamate the disease. The pedigrees ofthe patients under Children's Hospital, (K276E). In four sporadic cases no mut- investigation are shown in the figure. In the Athens 11527, Greece http://jmg.bmj.com/ T Covanis ations were found. In addition, one fa- case of family N, lower limb spasticity was milial case did not have a mutation in the found to cosegregate with the hyperekplexia Correspondence to: Dr Rees. coding region of the gene. trait7 and is linked to markers in the GLRA1 Received 11 October 1995. (JMed Genet 1996;33:435-436) region on chromosome 5. Revised version accepted for DNA was extracted from each proband and publication 16 January 1996. Key words: hyperekplexia; glycine receptor; GLRA1. their relatives and intronic oligonucleotide primers flanking all exons ofthe GLRA1 gene23 Table 1 Previously reported GLRA1 mutations in hyperekplexia were used to amplify individual exons from on September 25, 2021 by guest. Protected copyright. each proband. Exon 6 PCR products from all Exon Base change Amino acid substitution Mode of inheritance Reference probands were investigated for the presence 6 G1192A Arg271Glu Dominant 2,3,4 of the most common mutations at nucleotide 6 G1192T Arg271Leu Dominant 2 7 A1216G Tyr279Cys Dominant 3 position 192 by restriction digestion withXhoI. 6 Til12A Ile244Asn Recessive 4 G to A and G to T mutations at this position abolish an XhoI restriction site. Probands G and Mwere heterozygousforthis site. Sequence ana- Table 2 Sequencing primers used in the analysis of GLRAI lysis of exon 6 in both cases showed them to Primer cDNA Sequence (5'-3) be heterozygous for a G to A base transition Nucleotide No (22) resulting in an arginine to glutamate amino acid Exon 1 - F 62-78 GCAGGTCTGGACGCTCTC change. Restriction fragment analysis of exon 6 Exon 1 - R 281-264 'TGCTTTGTAGTCCACGAG PCR products from all available family mem- Exon 2 - F 382-400 GCTCGCTCCGCAACCAAGC Exon 2 - R 470-453 GGGCCTGATCCTGGCATC bers showed that these mutations segregated Exon 3 - F 486-503 CCAGTGAACGTGAGCTGC completely with the disease trait (data not Exon 3 - R 537-520 CAGCAATGGAACCAAAGC Exon 4 - F 559-576 TCAACATCTTCCTGCGGC shown). Exon 4 - R 762-744 AGAGGACATl'TCCCATTCC Exon 6 PCR products from probands not Exon 5A - F 781-800 TGACACTGGCCTGCCCCATG Exon 5A - R Intronic GATTTCTGCCTATCCCATGG possessing the 1192 mutation were subjected Exon 5B - F Intronic TGCTTCTGAGTGGTGACTG to sequence analysis (sequencing primers Exon 5B - R 983-965 GTGCTTGGTGCAGTATCTC Exon 6 - F 1131-1150 GCGGCAGATGGGTTACTACC shown in table 2) using paramagnetic bead Exon 6 - R 1203-1187 GCAGAGATGGCTCGAGAG technology and the Applied Biosystems Prism Exon 7 - F 1209-1222 GTGTCCTATGTGAAAGCCATTG Exon 7 - R 1341-1323 GCTTCCTCCTGAATCGGAG single stranded sequencing kit. A heterozygous Exon 8 - F 1424-1443 CAAGGATGGCATCTCAGTCA A to G base transition was detected at nuc- Exon 8 - R 1495-1477 GACTTAAGATGGTGCAGGAG leotide 1206 in family N predicted to cause a F = forward, R = reverse. Lys276Glu amino acid change in the mature 436 Elmslie, Hutchings, Spencer, Curtis, Covanis, Gardiner, Rees Family R Family T Family K Family N 1-1 1a i 2 OTO1112 J Med Genet: first published as 10.1136/jmg.33.5.435 on 1 May 1996. Downloaded from 11.1 11.2 11.1 11.2 11.3 11.1 11.2 111.1 111.2 1 111.3 IV.1 Family M Family H Family G 1} - 11 12 1.1 11.2 11-1 11.1 11.2 Family D 1 12 11-1 11.2 11.3 11.4 IV 1 IV.2 IV.3 Hyperekplexia pedigrees. Closed symbols indicate affected members and open symbols unaffected subjects. In family N the hyperekplexia trait cosegregates with spastic paraparesis. We would like to thank all the clinicians who referred patients: protein. This change results in the loss of a Dr Peter Baxter who referred family N, Dr L Dubowitz, Dr R StyI restriction site and was shown to segregate Davidson, Dr G McEnery, Dr J Wilson, and Professor A Harding. We are indebted to Drs R Shiang, S Ryan, and J consistently with the hyperekplexia/spastic pa- Wasmuth for their help and enthusiastic support. We would raparesis trait in this family (data not shown). like to thank all the families who participated so willingly. Dr This mutation was not observed in any of the F V Elmslie is an Action Research Training Fellow. other families investigated and in addition was 1 Ryan SG, Sherman SL, Terry JC, Sparkes RS, Cristina not observed in 100 normal chromosomes. Torres M, Mackey RW. Startle disease, or hyperekplexia: PCR products from all other exons were se- response to clonazepam and assignment of the gene (STHE) to chromosome 5q by linkage analysis. Ann Neurol quenced in all affected subjects; no further 1992;31:663-8. http://jmg.bmj.com/ mutations were detected. 2 Shiang R, Ryan SG, Ya-Zhen Z, Hahn AF, O'Connell P, Wasmuth JJ. Mutations in the oal subunit of the inhibitory We have therefore detected mutations in glycine receptor cause the dominant neurological disorder, GLRA1 in three out of eight probands with hyperekplexia. Nature Genet 1993;5:351-7. 3 Shiang R, Ryan SG, Zhu Y-Z, et al. Mutational analysis of hyperekplexia, all of whom originate from familial and sporadic hyperekplexia. Ann Neurol 1995;38: families in which there is a clear autosomal 85-91. is 4 Schorderet DF, Pescia G, Bernasconi A, Regli F. An ad- dominant pattern of inheritance. It possible ditional family with startle disease and a Gl192A mutation that the remaining five cases could represent at the oal subunit of the inhibitory glycine receptor gene. new dominant mutations, or an alternative, Hum Mol Genet 1994;3:1201. on September 25, 2021 by guest. Protected copyright. 5 Rees MI, Andrew M, Jawad S, Owen NJ. Evidence for autosomal recessive form of the disease as has recessive as well as dominant forms of startle disease been suggested previously.5 (hyperekplexia) caused by mutations in the oal subunit of the inhibitory glycine receptor. Hum Mol Genet 1994;3: The finding of a mutation in GLRA1 in a 2175-9. family in which hyperekplexia cosegregates 6 Dubowitz LMS, Bouza H, Hird MF, Jaeken J. Low cere- brospinal fluid concentration of free gamma aminobutyric with lower limb spasticity raises the possibility acid in startle disease. Lancet 1992;340:80-1. that other related phenotypes may be at- 7 Baxter P, Connolly S, Curtis A, et al. Codominant in- heritance of hyperekplexia and spastic paraparesis. Dev tributable to mutations in GLRA1. Autosomal Med Child Neurol (in press). dominant pure hereditary spastic paraparesis is 8 Hazan J, Lamy C, Melki J, Munnich A, de Recondo J, to and Weissenbach J. Autosomal dominant familial spastic para- known display genetic heterogeneity plegia is genetically heterogeneous and one locus maps to there are families in which the trait appears chromosome 14q. Nature Genet 1993;5:163-7. unlinked to any of the three mapped loci on 9 Hazan J, Fontaine B, Bruyn RPM, et al. Linkage of a new locus for autosomal dominant spastic paraplegia to chromosomes 14, 2, or 15.-11 GLRA1 may chromosome 2p. Hum Mol Genet 1994;3:1569-73. therefore represent a candidate gene for these 10 Hentati A, Pericak-Vance MA, Lennon F, et al. Linkage of a locus for autosomal dominant familial spastic paraplegia unlinked families.
Load more

Recommended publications
  • PLATFORM ABSTRACTS Abstract Abstract Numbers Numbers Tuesday, November 6 41
    American Society of Human Genetics 62nd Annual Meeting November 6–10, 2012 San Francisco, California PLATFORM ABSTRACTS Abstract Abstract Numbers Numbers Tuesday, November 6 41. Genes Underlying Neurological Disease Room 134 #196–#204 2. 4:30–6:30pm: Plenary Abstract 42. Cancer Genetics III: Common Presentations Hall D #1–#6 Variants Ballroom 104 #205–#213 43. Genetics of Craniofacial and Wednesday, November 7 Musculoskeletal Disorders Room 124 #214–#222 10:30am–12:45 pm: Concurrent Platform Session A (11–19): 44. Tools for Phenotype Analysis Room 132 #223–#231 11. Genetics of Autism Spectrum 45. Therapy of Genetic Disorders Room 130 #232–#240 Disorders Hall D #7–#15 46. Pharmacogenetics: From Discovery 12. New Methods for Big Data Ballroom 103 #16–#24 to Implementation Room 123 #241–#249 13. Cancer Genetics I: Rare Variants Room 135 #25–#33 14. Quantitation and Measurement of Friday, November 9 Regulatory Oversight by the Cell Room 134 #34–#42 8:00am–10:15am: Concurrent Platform Session D (47–55): 15. New Loci for Obesity, Diabetes, and 47. Structural and Regulatory Genomic Related Traits Ballroom 104 #43–#51 Variation Hall D #250–#258 16. Neuromuscular Disease and 48. Neuropsychiatric Disorders Ballroom 103 #259–#267 Deafness Room 124 #52–#60 49. Common Variants, Rare Variants, 17. Chromosomes and Disease Room 132 #61–#69 and Everything in-Between Room 135 #268–#276 18. Prenatal and Perinatal Genetics Room 130 #70–#78 50. Population Genetics Genome-Wide Room 134 #277–#285 19. Vascular and Congenital Heart 51. Endless Forms Most Beautiful: Disease Room 123 #79–#87 Variant Discovery in Genomic Data Ballroom 104 #286–#294 52.
    [Show full text]
  • The Developmental and Behavioral Effects of Δ9-Tetrahydrocannabinol
    Kennesaw State University DigitalCommons@Kennesaw State University Department of Ecology, Evolution, and Organismal Master of Science in Integrative Biology Theses Biology Summer 6-26-2019 The evelopmeD ntal and Behavioral Effects of Δ9-Tetrahydrocannabinol on a Spastic Mutant Victoria Mendiola Follow this and additional works at: https://digitalcommons.kennesaw.edu/integrbiol_etd Part of the Integrative Biology Commons Recommended Citation Mendiola, Victoria, "The eD velopmental and Behavioral Effects of Δ9-Tetrahydrocannabinol on a Spastic Mutant" (2019). Master of Science in Integrative Biology Theses. 42. https://digitalcommons.kennesaw.edu/integrbiol_etd/42 This Thesis is brought to you for free and open access by the Department of Ecology, Evolution, and Organismal Biology at DigitalCommons@Kennesaw State University. It has been accepted for inclusion in Master of Science in Integrative Biology Theses by an authorized administrator of DigitalCommons@Kennesaw State University. For more information, please contact [email protected]. The Developmental and Behavioral Effects of �9-Tetrahydrocannabinol on a Spastic Mutant Kennesaw State University MSIB Thesis Summer 2019 Victoria Mendiola Dr. Lisa Ganser Dr. Martin Hudson Dr. Bill Ensign 2 Table of Contents ABSTRACT ............................................................................................................................................................ 3 CHAPTER ONE: INTRODUCTION ...........................................................................................................................
    [Show full text]
  • Myoclonus Aspen Summer 2020
    Hallett Myoclonus Aspen Summer 2020 Myoclonus (Chapter 20) Aspen 2020 1 Myoclonus: Definition Quick muscle jerks Either irregular or rhythmic, but always simple 2 1 Hallett Myoclonus Aspen Summer 2020 Myoclonus • Spontaneous • Action myoclonus: activated or accentuated by voluntary movement • Reflex myoclonus: activated or accentuated by sensory stimulation 3 Myoclonus • Focal: involving only few adjacent muscles • Generalized: involving most or many of the muscles of the body • Multifocal: involving many muscles, but in different jerks 4 2 Hallett Myoclonus Aspen Summer 2020 Differential diagnosis of myoclonus • Simple tics • Some components of chorea • Tremor • Peripheral disorders – Fasciculation – Myokymia – Hemifacial spasm 9 Classification of Myoclonus Site of Origin • Cortex – Cortical myoclonus, epilepsia partialis continua, cortical tremor • Brainstem – Reticular myoclonus, exaggerated startle, palatal myoclonus • Spinal cord – Segmental, propriospinal • Peripheral – Rare, likely due to secondary CNS changes 10 3 Hallett Myoclonus Aspen Summer 2020 Classification of myoclonus to guide therapy • First consideration: Etiological classification – Is there a metabolic encephalopathy to be treated? Is there a tumor to be removed? Is a drug responsible? • Second consideration: Physiological classification – Can the myoclonus be treated symptomatically even if the underlying condition remains unchanged? 12 Myoclonus: Physiological Classification • Epileptic • Non‐epileptic The basic question to ask is whether the myoclonus is a “fragment
    [Show full text]
  • Novel GLRA1 Missense Mutation (P250T) in Dominant Hyperekplexia Defines an Intracellular Determinant of Glycine Receptor Channel Gating
    The Journal of Neuroscience, February 1, 1999, 19(3):869–877 Novel GLRA1 Missense Mutation (P250T) in Dominant Hyperekplexia Defines an Intracellular Determinant of Glycine Receptor Channel Gating Brigitta Saul,1 Thomas Kuner,2 Diana Sobetzko,1,4 Wolfram Brune,3 Folker Hanefeld,4 Hans-Michael Meinck3 and Cord-Michael Becker1 1Institut fu¨ r Biochemie, Universita¨ t Erlangen-Nu¨ rnberg, D-91054 Erlangen, Germany, 2Max-Planck-Institut fu¨ r Medizinische Forschung, D-69120 Heidelberg, Germany, 3Neurologische Klinik, Universita¨ t Heidelberg, D-69120 Heidelberg, Germany, and 4Zentrum fu¨ r Kinderheilkunde, Schwerpunkt Neuropa¨ diatrie, Universita¨tGo¨ ttingen, D-37075 Go¨ ttingen, Germany Missense mutations as well as a null allele of the human glycine tion, consistent with a prolonged recovery from desensitization. receptor a1 subunit gene GLRA1 result in the neurological Apparent glycine binding was less affected, yielding an approx- disorder hyperekplexia [startle disease, stiff baby syndrome, imately fivefold increase in Ki values. Topological analysis pre- Mendelian Inheritance in Man (MIM) #149400]. In a pedigree dicts that the substitution of proline 250 leads to the loss of an showing dominant transmission of hyperekplexia, we identified angular polypeptide structure, thereby destabilizing open chan- a novel point mutation C1128A of GLRA1. This mutation en- nel conformations. Thus, the novel GLRA1 mutant allele P250T codes an amino acid substitution (P250T) in the cytoplasmic defines an intracellular determinant of glycine receptor channel
    [Show full text]
  • Defining Stiff Person Syndrome P a G E | 1
    Defining Stiff Person Syndrome P a g e | 1 Defining Stiff Person Syndrome Diana L. Hurwitz DISCOVERY At Mayo Clinic, physicians Dr. Frederick Moersch (1889-1975) and Dr. Henry Woltman (1889-1964) collected case studies of patients who presented with progressive, symmetrical rigidity of axial and proximal limb muscles.[1,2] In 1956, they presented a paper covering fourteen patients collected over thirty-two years. Ten patients were men; four were women. The average age of onset was forty-one years. All were progressive and responded poorly to treatments. Four had diabetes mellitus. Two had epilepsy, one with grand-mal seizures, and one with petit-mal seizures. They concluded, because of the fluctuating nature of the symptoms and the association with diabetes, that a metabolic basis for the disease should be considered. The disease was initially named Moersch-Woltman Syndrome in their honor. The patients suffered spasms triggered by startles from voluntary movement, touch, or emotional stress. This startle, stiffening, and fall response earned the nicknames tin-man syndrome and stiff-man syndrome. When it became clear that women as well as men were affected by the disease, it was changed to stiff- person syndrome.[1] RARE DISEASE CLASSIFICATION Stiff-person syndrome affects +/- one in a million people (7,000 out of 7 billion). This figure is possibly higher due to misdiagnoses and underreporting. It is represented by the National Organization for Rare Diseases (NORD). It can take many years for a patient to receive a proper diagnosis, usually after undergoing years of trial and error treatments and ruling out other neuromuscular differentials.
    [Show full text]
  • Hereditary Hyperekplexia
    Hereditary hyperekplexia Description Hereditary hyperekplexia is a condition in which affected infants have increased muscle tone (hypertonia) and an exaggerated startle reaction to unexpected stimuli, especially loud noises. Following the startle reaction, infants experience a brief period in which they are very rigid and unable to move. During these rigid periods, some infants stop breathing, which, if prolonged, can be fatal. Infants with hereditary hyperekplexia have hypertonia at all times, except when they are sleeping. Other signs and symptoms of hereditary hyperekplexia can include muscle twitches when falling asleep (hypnagogic myoclonus) and movements of the arms or legs while asleep. Some infants, when tapped on the nose, extend their head forward and have spasms of the limb and neck muscles. Rarely, infants with hereditary hyperekplexia experience recurrent seizures (epilepsy). The signs and symptoms of hereditary hyperekplexia typically fade by age 1. However, older individuals with hereditary hyperekplexia may still startle easily and have periods of rigidity, which can cause them to fall down. They may also continue to have hypnagogic myoclonus or movements during sleep. As they get older, individuals with this condition may have a low tolerance for crowded places and loud noises. People with hereditary hyperekplexia who have epilepsy have the seizure disorder throughout their lives. Hereditary hyperekplexia may explain some cases of sudden infant death syndrome ( SIDS), which is a major cause of unexplained death in babies younger than 1 year. Frequency The exact prevalence of hereditary hyperekplexia is unknown. This condition has been identified in more than 150 individuals worldwide. Causes Mutations in multiple genes have been found to cause hereditary hyperekplexia.
    [Show full text]
  • Hyperekplexia and Excessive Startle Response in an Infant: a Case Report
    Medical Journal of the Volume 18 Islamic Republic of Iran Number 1 Spring 1383 J. Akhoondian, et al. May 2004 HYPEREKPLEXIA AND EXCESSIVE STARTLE RESPONSE IN AN INFANT: A CASE REPORT J. AKHOONDIAN, M.D., M. JAFARZADEH, M.D., AND M.J. PARIZADEH, M.D. From the Department of Pediatrics, Imam Reza Hospital, Mashhad University of Medical Sciences, Mashhad, I.R. Iran. ABSTRACT We present an infant girl with hyperekplexia, hypertonia, hyperreflexia and a char- acteristic exaggerated response to nose tap.This disorder is important to recognize because of the increased risk of apnea and sudden infant death. This infant responded to clonazepam. MJIRI, Vol. 18, No. 1, 91-93, 2004. Keywords: Hyperekplexia, Hypertonia, Startle. INTRODUCTION and present weight was 3700 grams. Gag and sucking of this chid seemed to be hyperactive. Touching the child’s Hyperekplexia is a rare familial disorder associated face produced an immediate head recoil with extension with whole body myoclonus presenting as a hyperactive of the limbs. Tapping the nose appeared to be the most startle reflex which occurs during the neonatal or early effective method of eliciting the head recoil. Tone was infancy periods. When handled, a minority of infants symmetrically increased and ankle clonus was present. become stiff with severe hypertonia leading to apnea Deep tendon reflexes were increased. Feeding was diffi- and bradycardia. These movements must be distin- cult because touching the breast to her mouth elicited guished from startle epilepsy. Prognosis is variable, and the head recoil response. Tremor of the limbs was elic- seizures do not accompany the benign form of this dis- ited by touch, a loud sound, or by shining light in the order.
    [Show full text]
  • Familiar Hyperekplexia, a Potential Cause of Cautious Gait: a New Korean Case and a Systematic Review of Phenotypes
    JMD https://doi.org/10.14802/jmd.16044 / J Mov Disord 2017;10(1):53-58 pISSN 2005-940X / eISSN 2093-4939 CASE REPORT Familiar Hyperekplexia, a Potential Cause of Cautious Gait: A New Korean Case and a Systematic Review of Phenotypes Yoonju Lee1, Nan Young Kim2, Sangkyoon Hong2, Su Jin Chung1, Seong Ho Jeong1, Phil Hyu Lee1, Young H. Sohn1 1Department of Neurology, Yonsei University College of Medicine, Seoul, Korea 2Hallym Institute of Translational Genomics and Bioinformatics, Hallym University College of Medicine, Anyang, Korea ABSTRACT Familial hyperekplexia, also called startle disease, is a rare neurological disorder characterized by excessive startle responses to noise or touch. It can be associated with serious injury from frequent falls, apnea spells, and aspiration pneumonia. Familial hy- perekplexia has a heterogeneous genetic background with several identified causative genes; it demonstrates both dominant and recessive inheritance in the α1 subunit of the glycine receptor (GLRA1), the β subunit of the glycine receptor and the presynaptic sodium and chloride-dependent glycine transporter 2 genes. Clonazepam is an effective medical treatment for hyperekplexia. Here, we report genetically confirmed familial hyperekplexia patients presenting early adult cautious gait. Additionally, we re- view clinical features, mode of inheritance, ethnicity and the types and locations of mutations of previously reported hyperek- plexia cases with a GLRA1 gene mutation. Key WordsaaHyperekplexia; GLRA1; deep phenotyping. Hyperekplexia, or startle disease, is an uncommon nonepi- history were not remarkable. There was no developmental de- leptic disorder classically characterized by exaggerated startle lay or neurologic deficit; however, her parents had noticed sud- responses to unexpected stimuli.
    [Show full text]
  • Neurotransmitter Transporters Expressed in Glial Cells As Regulators of Synapse Function
    BRAIN RESEARCH REVIEWS 63 (2010) 103– 112 available at www.sciencedirect.com www.elsevier.com/locate/brainresrev Review Neurotransmitter transporters expressed in glial cells as regulators of synapse function Volker Eulenburga,⁎, Jesús Gomezab aDepartment for Neurochemistry, Max-Planck Institute for Brain Research, Deutschordenstrasse 46, 60529 Frankfurt, Germany bInstitute for Pharmaceutical Biology, Friedrich-Wilhelms-University, Nußallee 6, 53115 Bonn, Germany ARTICLE INFO ABSTRACT Article history: Synaptic neurotransmission at high temporal and spatial resolutions requires efficient Accepted 20 January 2010 removal and/or inactivation of presynaptically released transmitter to prevent spatial Available online 26 January 2010 spreading of transmitter by diffusion and allow for fast termination of the postsynaptic response. This action must be carefully regulated to result in the fine tuning of inhibitory Keywords: and excitatory neurotransmission, necessary for the proper processing of information in the Glial cells central nervous system. At many synapses, high-affinity neurotransmitter transporters are Synaptic transmission responsible for transmitter deactivation by removing it from the synaptic cleft. The most Neurotransmitter transporter prevailing neurotransmitters, glutamate, which mediates excitatory neurotransmission, as well as GABA and glycine, which act as inhibitory neurotransmitters, use these uptake systems. Neurotransmitter transporters have been found in both neuronal and glial cells, thus suggesting high cooperativity
    [Show full text]
  • Stiff Person Syndrome, Startle and Other Immune-Mediated Movement Disorders – New Insights
    Stiff person syndrome, startle and other immune-mediated movement disorders – new insights Bettina Balint, MD1,2 and Kailash P. Bhatia, MD, FRCP1 1 Sobell Department of Motor Neuroscience and Movement Disorders, UCL Institute of Neurology, Queen Square, London, UK 2 Department of Neurology, University Hospital Heidelberg, Heidelberg, Germany Dr Bettina Balint Sobell Department of Motor Neuroscience and Movement Disorders UCL Institute of Neurology Queen Square London WC1N 3BG UK Tel +442034488604 Email: [email protected] Abstract Purpose of review This review highlights the recent developments in immune-mediated movement disorders and how they reflect on clinical practise and our understanding of the underlying pathophysiological mechanisms. Recent findings The antibody spectrum associated with of Stiff Person syndrome and related disorders (SPSD) has broadened and, apart from the classic glutamic acid decarboxylase (GAD)-antibodies, includes now also antibodies against dipeptidyl-peptidase-like protein-6 (DPPX), gamma-aminobutyric acid type A receptor (GABAAR), glycine receptor (GlyR) and glycine transporter 2 (GlyT2). Recent studies support a pathogenic role of amphiphysin-antibodies despite their targeting an intracellular synaptic antigen, hitherto thought inaccessible to antibodies. The field of movement disorders with neuronal antibodies keeps expanding with the discovery for example of chorea with antibodies against leucine rich glioma inactivated protein 1 (LGI1) and contactin associated protein 2 (Caspr2), as well as N-methyl-D- aspartate receptor (NMDAR)-antibodies in choreoathetoid relapses after herpes simplex encephalitis. New antibodies targeting ARHGAP26- or ATP1A3 have been reported in cerebellar ataxia. Moreover, neuronal antibodies may partly account for movement disorders attributed e.g. to Sydenham’s chorea, coeliac disease, or steroid responsive encephalopathy with thyroid antibodies.
    [Show full text]
  • Amino Acid Transport Defects in Human Inherited Metabolic Disorders
    International Journal of Molecular Sciences Review Amino Acid Transport Defects in Human Inherited Metabolic Disorders Raquel Yahyaoui 1,2,* and Javier Pérez-Frías 3,4 1 Laboratory of Metabolic Disorders and Newborn Screening Center of Eastern Andalusia, Málaga Regional University Hospital, 29011 Málaga, Spain 2 Grupo Endocrinología y Nutrición, Diabetes y Obesidad, Instituto de Investigación Biomédica de Málaga-IBIMA, 29010 Málaga, Spain 3 Grupo Multidisciplinar de Investigación Pediátrica, Instituto de Investigación Biomédica de Málaga-IBIMA, 29010 Málaga, Spain; [email protected] 4 Departamento de Farmacología y Pediatría, Facultad de Medicina, Universidad de Málaga, 29010 Málaga, Spain * Correspondence: [email protected] Received: 26 November 2019; Accepted: 18 December 2019; Published: 23 December 2019 Abstract: Amino acid transporters play very important roles in nutrient uptake, neurotransmitter recycling, protein synthesis, gene expression, cell redox balance, cell signaling, and regulation of cell volume. With regard to transporters that are closely connected to metabolism, amino acid transporter-associated diseases are linked to metabolic disorders, particularly when they involve different organs, cell types, or cell compartments. To date, 65 different human solute carrier (SLC) families and more than 400 transporter genes have been identified, including 11 that are known to include amino acid transporters. This review intends to summarize and update all the conditions in which a strong association has been found between an amino acid transporter and an inherited metabolic disorder. Many of these inherited disorders have been identified in recent years. In this work, the physiological functions of amino acid transporters will be described by the inherited diseases that arise from transporter impairment. The pathogenesis, clinical phenotype, laboratory findings, diagnosis, genetics, and treatment of these disorders are also briefly described.
    [Show full text]
  • Stiff Person Syndrome (SPS): Literature Review and Case Report
    CASE REPORT Stiff person syndrome (SPS): Literature review and case report E Pretorius,1 MB ChB, FC Neurol (SA); W Struwig,2 MB ChB, MMed (Psych), FC Psych (SA) 1 Department of Neurology, Faculty of Health Sciences, University of the Free State, Bloemfontein, South Africa 2 Department of Internal Medicine, Faculty of Health Sciences, University of the Free State, Bloemfontein, South Africa Corresponding author: E Pretorius ([email protected]) Stiff person syndrome (SPS) is a rare, debilitating condition which presents with progressive and inconsistent neurological features. The main symptoms are stiffness and intermittent, painful muscle spasms, triggered and exacerbated by stressful and emotional stimuli. The fluctuating clinical nature of SPS, and otherwise normal neurological examination, often lead to a misdiagnosis of conversion disorder. Psychiatric symptoms frequently accompany this disorder and patients are often first seen by psychiatrists. SPS is autoimmune-based: antibodies are directed against glutamate decarboxylase, resulting in dysregulation of gamma-aminobutyric acid (GABA) in the brain which is considered the cause of the neuropsychiatric symptomatology. SPS should be considered in the differential diagnosis of conversion disorder. Effective management requires early detection, a collaborative approach with GABA-ergic medication and intravenous immunoglobulins, and management of concomitant psychiatric disorders. We describe a patient with SPS. Only one other case has been reported in South Africa. S Afr J Psych 2013;19(4):228-231. DOI:10.7196/SAJP.429 Stiff person syndrome (SPS) is a rare neurological can occur from the third to the sixth decade of life,[11,12] although cases condition with an intriguing pathophysiology and have been reported in children younger than 3 years.[13] may result in severe functional disability.
    [Show full text]