IJMed Genet 1996;33:435-436 435 Analysis of GLRA1 in hereditary and sporadic hyperekplexia: a novel mutation in a family J Med Genet: first published as 10.1136/jmg.33.5.435 on 1 May 1996. Downloaded from cosegregating for hyperekplexia and spastic paraparesis Frances V Elmslie, Simon M Hutchings, Valerie Spencer, Ann Curtis, Thanos Covanis, R Mark Gardiner, Michele Rees Abstract Hyperekplexia or startle disease is characterised Hyperekplexia is a rare condition char- by the presence of an exaggerated startle Department of acterised by the presence of neonatal to Paediatrics, University response unexpected auditory, visual, or College London hypertonia and an exaggerated startle re- sensory stimuli. Affected subjects frequently Medical School, sponse. Mutations have been described in present at birth with hypertonia. Hyperekplexia The Rayne Institute, GLRA1, the gene encoding the al subunit is usually inherited in an autosomal dominant S University Street, London WC1E 6JJ, UK of the glycine receptor, in dominant manner. Linkage studies localised the gene to F V Elmslie families with hyperekplexia and in a single distal chromosome 5q.' Subsequently, mut- S M Hutchings sporadic case, thought to represent an ations were detected in exon 6 of the gene R M Gardiner M Rees autosomal recessive form of the disease. encoding the ct, subunit ofthe glycine receptor, In this study the coding region of the GLRA1L2 The previously described mutations Department of Human GLRA1 was analysed in eight probands are listed in table 1. All occur in large dominant Genetics, University of Newcastle upon Tyne, with hyperekplexia by restriction digest pedigrees'-5 except for one which may represent 19120 Claremont Place, and sequencing. Two familial cases were a recessive form of the disease.5 In this study, Newcastle upon Tyne found to possess the previously described GLRA1 was analysed in eight probands with NE2 4AA, UK V Spencer G1192A (R271Q) mutation in exon 6. In an hyperekplexia. In three cases the families clearly A Curtis additional family in which hyperekplexia display dominant inheritance; four cases are cosegregates with spastic paraparesis, a sporadic. In one family (family R) the family Department of novel A to G transversion at nucleotide Neurology/ history is uncertain and it is possible that they Neurophysiology, 1206 in exon 6 was detected that changes may represent an autosomal recessive form of Aghia Sophia a lysine at amino acid 276 to a glutamate the disease. The pedigrees ofthe patients under Children's Hospital, (K276E). In four sporadic cases no mut- investigation are shown in the figure. In the Athens 11527, Greece http://jmg.bmj.com/ T Covanis ations were found. In addition, one fa- case of family N, lower limb spasticity was milial case did not have a mutation in the found to cosegregate with the hyperekplexia Correspondence to: Dr Rees. coding region of the gene. trait7 and is linked to markers in the GLRA1 Received 11 October 1995. (JMed Genet 1996;33:435-436) region on chromosome 5. Revised version accepted for DNA was extracted from each proband and publication 16 January 1996. Key words: hyperekplexia; glycine receptor; GLRA1. their relatives and intronic oligonucleotide primers flanking all exons ofthe GLRA1 gene23 Table 1 Previously reported GLRA1 mutations in hyperekplexia were used to amplify individual exons from on September 25, 2021 by guest. Protected copyright. each proband. Exon 6 PCR products from all Exon Base change Amino acid substitution Mode of inheritance Reference probands were investigated for the presence 6 G1192A Arg271Glu Dominant 2,3,4 of the most common mutations at nucleotide 6 G1192T Arg271Leu Dominant 2 7 A1216G Tyr279Cys Dominant 3 position 192 by restriction digestion withXhoI. 6 Til12A Ile244Asn Recessive 4 G to A and G to T mutations at this position abolish an XhoI restriction site. Probands G and Mwere heterozygousforthis site. Sequence ana- Table 2 Sequencing primers used in the analysis of GLRAI lysis of exon 6 in both cases showed them to Primer cDNA Sequence (5'-3) be heterozygous for a G to A base transition Nucleotide No (22) resulting in an arginine to glutamate amino acid Exon 1 - F 62-78 GCAGGTCTGGACGCTCTC change. Restriction fragment analysis of exon 6 Exon 1 - R 281-264 'TGCTTTGTAGTCCACGAG PCR products from all available family mem- Exon 2 - F 382-400 GCTCGCTCCGCAACCAAGC Exon 2 - R 470-453 GGGCCTGATCCTGGCATC bers showed that these mutations segregated Exon 3 - F 486-503 CCAGTGAACGTGAGCTGC completely with the disease trait (data not Exon 3 - R 537-520 CAGCAATGGAACCAAAGC Exon 4 - F 559-576 TCAACATCTTCCTGCGGC shown). Exon 4 - R 762-744 AGAGGACATl'TCCCATTCC Exon 6 PCR products from probands not Exon 5A - F 781-800 TGACACTGGCCTGCCCCATG Exon 5A - R Intronic GATTTCTGCCTATCCCATGG possessing the 1192 mutation were subjected Exon 5B - F Intronic TGCTTCTGAGTGGTGACTG to sequence analysis (sequencing primers Exon 5B - R 983-965 GTGCTTGGTGCAGTATCTC Exon 6 - F 1131-1150 GCGGCAGATGGGTTACTACC shown in table 2) using paramagnetic bead Exon 6 - R 1203-1187 GCAGAGATGGCTCGAGAG technology and the Applied Biosystems Prism Exon 7 - F 1209-1222 GTGTCCTATGTGAAAGCCATTG Exon 7 - R 1341-1323 GCTTCCTCCTGAATCGGAG single stranded sequencing kit. A heterozygous Exon 8 - F 1424-1443 CAAGGATGGCATCTCAGTCA A to G base transition was detected at nuc- Exon 8 - R 1495-1477 GACTTAAGATGGTGCAGGAG leotide 1206 in family N predicted to cause a F = forward, R = reverse. Lys276Glu amino acid change in the mature 436 Elmslie, Hutchings, Spencer, Curtis, Covanis, Gardiner, Rees Family R Family T Family K Family N 1-1 1a i 2 OTO1112 J Med Genet: first published as 10.1136/jmg.33.5.435 on 1 May 1996. Downloaded from 11.1 11.2 11.1 11.2 11.3 11.1 11.2 111.1 111.2 1 111.3 IV.1 Family M Family H Family G 1} - 11 12 1.1 11.2 11-1 11.1 11.2 Family D 1 12 11-1 11.2 11.3 11.4 IV 1 IV.2 IV.3 Hyperekplexia pedigrees. Closed symbols indicate affected members and open symbols unaffected subjects. In family N the hyperekplexia trait cosegregates with spastic paraparesis. We would like to thank all the clinicians who referred patients: protein. This change results in the loss of a Dr Peter Baxter who referred family N, Dr L Dubowitz, Dr R StyI restriction site and was shown to segregate Davidson, Dr G McEnery, Dr J Wilson, and Professor A Harding. We are indebted to Drs R Shiang, S Ryan, and J consistently with the hyperekplexia/spastic pa- Wasmuth for their help and enthusiastic support. We would raparesis trait in this family (data not shown). like to thank all the families who participated so willingly. Dr This mutation was not observed in any of the F V Elmslie is an Action Research Training Fellow. other families investigated and in addition was 1 Ryan SG, Sherman SL, Terry JC, Sparkes RS, Cristina not observed in 100 normal chromosomes. Torres M, Mackey RW. Startle disease, or hyperekplexia: PCR products from all other exons were se- response to clonazepam and assignment of the gene (STHE) to chromosome 5q by linkage analysis. Ann Neurol quenced in all affected subjects; no further 1992;31:663-8. http://jmg.bmj.com/ mutations were detected. 2 Shiang R, Ryan SG, Ya-Zhen Z, Hahn AF, O'Connell P, Wasmuth JJ. Mutations in the oal subunit of the inhibitory We have therefore detected mutations in glycine receptor cause the dominant neurological disorder, GLRA1 in three out of eight probands with hyperekplexia. Nature Genet 1993;5:351-7. 3 Shiang R, Ryan SG, Zhu Y-Z, et al. Mutational analysis of hyperekplexia, all of whom originate from familial and sporadic hyperekplexia. Ann Neurol 1995;38: families in which there is a clear autosomal 85-91. is 4 Schorderet DF, Pescia G, Bernasconi A, Regli F. An ad- dominant pattern of inheritance. It possible ditional family with startle disease and a Gl192A mutation that the remaining five cases could represent at the oal subunit of the inhibitory glycine receptor gene. new dominant mutations, or an alternative, Hum Mol Genet 1994;3:1201. on September 25, 2021 by guest. Protected copyright. 5 Rees MI, Andrew M, Jawad S, Owen NJ. Evidence for autosomal recessive form of the disease as has recessive as well as dominant forms of startle disease been suggested previously.5 (hyperekplexia) caused by mutations in the oal subunit of the inhibitory glycine receptor. Hum Mol Genet 1994;3: The finding of a mutation in GLRA1 in a 2175-9. family in which hyperekplexia cosegregates 6 Dubowitz LMS, Bouza H, Hird MF, Jaeken J. Low cere- brospinal fluid concentration of free gamma aminobutyric with lower limb spasticity raises the possibility acid in startle disease. Lancet 1992;340:80-1. that other related phenotypes may be at- 7 Baxter P, Connolly S, Curtis A, et al. Codominant in- heritance of hyperekplexia and spastic paraparesis. Dev tributable to mutations in GLRA1. Autosomal Med Child Neurol (in press). dominant pure hereditary spastic paraparesis is 8 Hazan J, Lamy C, Melki J, Munnich A, de Recondo J, to and Weissenbach J. Autosomal dominant familial spastic para- known display genetic heterogeneity plegia is genetically heterogeneous and one locus maps to there are families in which the trait appears chromosome 14q. Nature Genet 1993;5:163-7. unlinked to any of the three mapped loci on 9 Hazan J, Fontaine B, Bruyn RPM, et al. Linkage of a new locus for autosomal dominant spastic paraplegia to chromosomes 14, 2, or 15.-11 GLRA1 may chromosome 2p. Hum Mol Genet 1994;3:1569-73. therefore represent a candidate gene for these 10 Hentati A, Pericak-Vance MA, Lennon F, et al. Linkage of a locus for autosomal dominant familial spastic paraplegia unlinked families.