DOCSLIB.ORG

Non-Commercial Use Only

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Neurology International 2019; volume 11:7959 A novel homozygous variation siblings of patients with PKAN who have a in the PANK2 gene in two novel variation of the PANK2 gene. Correspondence: Saeed Razmeh, Yasuj University of Medical Sciences, Kohgiluyeh Persian siblings with atypical and Boyer-Ahmad Province, Yasuj, Shahid pantothenate kinase Motahari Blvd, Iran. associated neurodegeneration Case Report E-mail: [email protected] A 32-year-old woman (case 1) was Key words: Pantothenate Kinase-associated Amir Hasan Habibi,1 Saeed Razmeh,2 referred to our clinic because of gait Neurodegeneration, novel variation, pan- Omid Aryani,1 Mohammad Rohani,1 difficulties that had started at the age of tothenate kinase-2 gene. Laleh Taghavian,2 Elham Alizadeh,2 about 16 years. The family history, drug Acknowledgements: The authors thank Dr. Karim Moradian Kokhedan2 history, and past medical history were noncontributory. On neurologic magid kheradmand maher for typing and edit- Maryam Zaribafian1 examination, the Mini-Mental State ing the manuscript. 1Iran University of Medical Sciences, Examination (MMSE) was normal. Cranial Contributions: the authors contributed equally. Tehran; 2Yasuj University of Medical nerve examination was normal and the Sciences, Yasuj, Iran Ophthalmologic evaluation indicated no Conflict of interest: the authors declare no evidence of visual impairment, Kayser- potential conflict of interest. Fleischer rings, pigmentary retinopathy and atrophy of optic nerve. She had hypokinesia Funding: none. Abstract and bradykinesia and limb rigidity, which was more on the right side, also there were Received for publication: 30 November 2018. Pantothenate Kinase-associated generalized dystonia and spasticity of lower Accepted for publication: 14 January 2019. Neurodegeneration (PKAN) is an autoso- limbs without cerebellar signs. mal recessive disorder that is caused by Acanthocytosis was not seen in the This work is licensed under a Creative Commons Attribution NonCommercial 4.0 variation in pantothenate kinase-2 gene peripheral blood smear and the other onlyLicense (CC BY-NC 4.0). (PANK2) gene on chromosome 20. The laboratory tests were normal. A brain common presentation of this disease magnetic resonance image (MRI) revealed ©Copyright A.H. Habibi et al., 2019 includes progressive dystonia, the eye of the tiger sign (Figure 1A), and the Licensee PAGEPress, Italy Parkinsonism, retinopathy, cognitive genetic analysis showed a homozygoususe Neurology International 2019; 11:7959 impairment, and spasticity. The typical variation in the PANK2 gene doi:10.4081/ni.2019.7959 magnetic resonance imaging finding is eye NM_153638.3:c.706_708delGAA (GAA of the tiger sign in globus pallidus and not deletion, p.E236 Del). performed on 2% agarose gels (Figure 2). pathogenic and not found in all patients. In The second patient (case 2) was a 30- The PCR products were sequenced with the the present study, we describe two siblings year-old man presents with generalized forward or reversed primers on an ABI who have a novel variation of the PANK2 dystonia and Parkinsonism that had started 3730XL sequencer (Macrogen Company, gene. These patients with the same geno- at the age of about 18 years. Gradually, the Korea) and compared with control samples type, have different ages at the onset of dis- dystonia increased in severity, His using the FinchTV program and analyzed ease and also the various severity of the dis- developmental history was normal, the on the NCBI website ease. The description of these cases helps to ophthalmological examination was normal (http://blast.ncbi.nlm.nih.gov/Blast.cgi).Wit understand this disease, its symptoms, with no evidence of visual impairment and h these methods, the target sequence for pathogenesis, and its treatment. retinopathy. He also had a generalized each patient was compared with the normal dystonia, hypokinesia, and limb rigidity. reference sequence, and mutations in the There were no pyramidal or cerebellar exons and the splicing sites of the introns in signs. Brain MRI discloses a typical eye-of- the PANK2 gene. All transcribed exons of Introduction the-tiger sign (Figure 1B), and a genetic the PANK2 gene were investigated in Non-commercialstudy detected a pathogenic variation in the Neurodegeneration with brain iron patients. delGAA homozygous mutation in PANK2 gene (GAA deletion, p.E236 Del). the exon2 was detected in both siblings and accumulation (NBIA) includes a For DNA extraction from type of blood heterogeneous group of hereditary their parent were heterozygous in this loca- cells, Q1AAMP DNA MICROKIT (Cat tion. Both patients were treated with neurodegenerative diseases that occur with number: 56304) was used. For Madopar 125 three times daily and symptoms such as dystonia, parkinsonism, comprehensive investigation of all the Deferiprone 500 twice daily, which we did cognitive impairment and vision loss.1-3 exons and splicing sites of the introns in not see any changes in symptoms after a The most common type is Pantothenate PANK2 gene, primers from another paper three month follow up. Kinase-associated Neurodegeneration 8 were used (Table 1). Briefly, PCR reaction We obtained the written informed (PKAN), due to a variation in the was performed in a final volume of 25 µL consent from the two patients for pantothenate kinase-2 gene (PANK2) gene containing 100-200 ng of total DNA, 10 publication of the case report on chromosome 20.4 The disease has two pmol of each primer, 2.5 mM MgCl2, 200 types, classic and atypical, the classical type mM each of dNTP and 1 U Taq DNA occurs at an earlier age and more severe. polymerase (Roche Diagnostics, The typical MRI finding is eye of the tiger Mannheim, Germany). The reaction Discussion and Conclusions sign that is T2-hypointensity surrounding a mixture was cycled 35 times at 95◦C for 1 central hyperintensity in globus pallidus min, annealing temperature (°C) for 1 min Pantothenate Kinase-Associated and not pathogenic and not found in all (refer to Table 1) and 72◦C for 1 min. Neurodegeneration (PKAN) is an patients.5-7 In this paper, we present two Electrophoresis of the PCR products was autosomal recessive disorder caused by a [Neurology International 2019; 11:7959] [page 9] Case Report variation in the PANK2 gene. The clinical about 18 years, with slow progression and brain barrier and reduces brain iron and manifestations include speech disorder the severity of the symptoms was milder. reduces the oxidative stress response in the Parkinsonism, dystonia, spasticity, Visual Usually Bulbar symptoms, generalized dys- brain.21-24 In conclusion, although the dis- loss, dysphagia seizure, and dementia.2,3,9 tonia, and gait disturbance, are more com- ease is rare. But familiarity with clinical and All of the patients with Pantothenate Kinase mon in classical form and tremors, segmen- radiological symptoms can help to diagnose Associated Neurodegeneration do not have tal dystonia, seizure, psychiatric disorders this disease more easily. eye-of-the-tiger sign especially in the early and Parkinsonism more common in atypical stages of this disease and all of the patients form of PKAN disease.4,16,17 Because the with this sign do not have a PANK2 precise mechanism of these diseases has not mutation.10-13 This gene has seven exons, been discovered so far, most of the treat- References most variations are missense but ments used so far reduce the severity of 1. Gregory A, Polster BJ, Hayflick SJ. duplication, deletion and splice also symptoms to some extent.1,18 The dystonia Clinical and genetic delineation of neu- reported,6,14,15 in our patients, there is a is debilitating in these patients and is exac- rodegeneration with brain iron accumu- novel variation that was GAA deletion erbated over time and is treated with drugs lation. J Med Genet 2009;46:73-80. resulting in the p.E236del that such as Oral and Intrathecal Baclofen, 2. Schipper HM. Neurodegeneration with bioinformatically or in silico showed it is Botulinum Toxin, gabapentin and anti- brain iron accumulation: clinical syn- probably pathogenic mutation but needs cholinergics. Surgery such as Deep brain dromes and neuroimaging. Biochim further investigation. Two of our patients stimulation, ablative pallidotomy or thalam- Biophys Acta 2012;1822:350-60. had manifestations but the progression, and otomy is also used to treat this disease.18-21 3. Schneider SA, Hardy J, Bhatia KP. severity of the disease was different. The Iron chelator drugs such as deferiprone Syndromes of neurodegeneration with course of the disease in the first patient was have been used in some studies in neurode- brain iron accumulation (NBIA): an faster and the symptoms were more severe. generative diseases and have promising update on clinical presentations, histo- Case 2 had a later onset of symptoms, results. This drug passes through the blood- logical and genetic underpinnings, and treatment considerations. Mov Disord 2012;27:42-53. Table 1. Primers for studying the PANK2 gene by PCR-sequencing. only 4. Pellecchia M, Valente E, Cif L, et al. Primers Forward/Reverse Product size (bp) TM(°C) The diverse phenotype and genotype of pantothenate kinase-associated neu- 1 F: GGAACTAGGCCGAGGGACAAAG 1200 63 R:GAAGGTACCGCTTTCGGAG use rodegeneration. Neurology 2005;64: 1810-2. 2 F: GCCCCAAAACCCTTTTGC 650 60 R: ACCACCTCTAGATGGCCAACTC 5. Gregory A, Hayflick SJ. Pantothenate kinase-associated neurodegeneration. 3 F: TGGGTCTGTAGTAGCAGG 580 54 R: CATTTGTTTGCATAATCCAG 2013. Seattle (WA): University of Washington, Seattle. 4 F: GACATGGGCCCTGTGTTTTG 438 60 6. Parmar A, Khare S, Srivastav V. R: GGCCCGCCTGTATTTCTTAG Pantothenate-kinase associated neu- 5 F: GCTCTGTTTGAAGTTTGC 402 54 rodegeneration. J Assoc Physicians R:ATGACTACATTTAGGCACTG India 2012;60:74-6. 6 F: TCCTGTGACATTATCTAGCATG 429 54 7. Zorzi G, Zibordi F, Chiapparini L, et al. R: AGCCCATTTCACCTCCAC Iron-related MRI images in patients 7 F:TCTGAAGTGCTTGGATAGTC 454 54 with pantothenate kinase–associated R:CTTCCTGGTTGCTAATTTAG neurodegeneration (PKAN) treated with deferiprone: Results of a phase II pilot trial. Mov Disord 2011;26:1755-9. 8. Aryani O, Houshmand M, Fatehi F. A Non-commercial novel PANK2 gene mutation in a Persian boy: the first report from Iran.
Recommended publications
  • Clinical Rating Scale for Pantothenate Kinase-Associated Neurodegeneration: a Pilot Study

    Clinical Rating Scale for Pantothenate Kinase-Associated Neurodegeneration: a Pilot Study

    RESEARCH ARTICLE Clinical Rating Scale for Pantothenate Kinase-Associated Neurodegeneration: A Pilot Study Alejandra Darling, MD,1 Cristina Tello, PhD,2 Marı´a Josep Martı´, MD, PhD,3 Cristina Garrido, MD,4 Sergio Aguilera-Albesa, MD, PhD,5 Miguel Tomas Vila, MD,6 Itziar Gaston, MD,7 Marcos Madruga, MD,8 Luis Gonzalez Gutierrez, MD,9 Julio Ramos Lizana, MD,10 Montserrat Pujol, MD,11 Tania Gavilan Iglesias, MD,12 Kylee Tustin,13 Jean Pierre Lin, MD, PhD,13 Giovanna Zorzi, MD, PhD,14 Nardo Nardocci, MD, PhD,14 Loreto Martorell, PhD,15 Gustavo Lorenzo Sanz, MD,16 Fuencisla Gutierrez, MD,17 Pedro J. Garcı´a, MD,18 Lidia Vela, MD,19 Carlos Hernandez Lahoz, MD,20 Juan Darı´o Ortigoza Escobar, MD,1 Laura Martı´ Sanchez, 1 Fradique Moreira, MD ,21 Miguel Coelho, MD,22 Leonor Correia Guedes,23 Ana Castro Caldas, MD,24 Joaquim Ferreira, MD,22,23 Paula Pires, MD,24 Cristina Costa, MD,25 Paulo Rego, MD,26 Marina Magalhaes,~ MD,27 Marı´a Stamelou, MD,28,29 Daniel Cuadras Palleja, MD,30 Carmen Rodrı´guez-Blazquez, PhD,31 Pablo Martı´nez-Martı´n, MD, PhD,31 Vincenzo Lupo, PhD,2 Leonidas Stefanis, MD,28 Roser Pons, MD,32 Carmen Espinos, PhD,2 Teresa Temudo, MD, PhD,4 and Belen Perez Duenas,~ MD, PhD1,33* 1Unit of Pediatric Movement Disorders, Hospital Sant Joan de Deu, Barcelona, Spain 2Unit of Genetics and Genomics of Neuromuscular and Neurodegenerative Disorders, Centro de Investigacion Prı´ncipe Felipe, Valencia, Spain 3Neurology Department, Hospital Clı´nic de Barcelona, Institut d’Investigacions Biomediques IDIBAPS.
  • Management of Postpolio Syndrome

    Management of Postpolio Syndrome

    Review Management of postpolio syndrome Henrik Gonzalez, Tomas Olsson, Kristian Borg Lancet Neurol 2010; 9: 634–42 Postpolio syndrome is characterised by the exacerbation of existing or new health problems, most often muscle weakness See Refl ection and Reaction and fatigability, general fatigue, and pain, after a period of stability subsequent to acute polio infection. Diagnosis is page 561 based on the presence of a lower motor neuron disorder that is supported by neurophysiological fi ndings, with exclusion Division of Rehabilitation of other disorders as causes of the new symptoms. The muscle-related eff ects of postpolio syndrome are possibly Medicine, Department of associated with an ongoing process of denervation and reinnervation, reaching a point at which denervation is no Clinical Sciences, Danderyd Hospital (H Gonzalez MD, longer compensated for by reinnervation. The cause of this denervation is unknown, but an infl ammatory process is K Borg MD) and Department of possible. Rehabilitation in patients with postpolio syndrome should take a multiprofessional and multidisciplinary Clinical Neurosciences, Centre approach, with an emphasis on physiotherapy, including enhanced or individually modifi ed physical activity, and muscle for Molecular Medicine training. Patients with postpolio syndrome should be advised to avoid both inactivity and overuse of weak muscles. (T Olsson MD), Karolinska Institute, Stockholm, Sweden Evaluation of the need for orthoses and assistive devices is often required. Correspondence to: Henrik Gonzalez, Division of Introduction summary of the pathophysiology and clinical Rehabilitation Medicine, 12–20 million people worldwide have sequelae of characteristics of postpolio syndrome, outline diagnostic Department of Clinical Sciences, poliomyelitis, according to Post-Polio Health and treatment options, and suggest future research Karolinska Institute, Danderyd Hospital, S-182 88 Stockholm, International.
  • PANK2 Gene Pantothenate Kinase 2

    PANK2 Gene Pantothenate Kinase 2

    PANK2 gene pantothenate kinase 2 Normal Function The PANK2 gene provides instructions for making an enzyme called pantothenate kinase 2. This enzyme is active in specialized cellular structures called mitochondria, which are the cell's energy-producing centers. Within mitochondria, pantothenate kinase 2 regulates the formation of a molecule called coenzyme A. Coenzyme A is found in all living cells, where it is essential for the body's production of energy from carbohydrates, fats, and some protein building blocks (amino acids). PANK2 is one of four human genes that provide instructions for making versions of pantothenate kinase. The functions of these different versions probably vary among tissue types and parts of the cell. The version produced by the PANK2 gene is active in cells throughout the body, including nerve cells in the brain. Health Conditions Related to Genetic Changes Pantothenate kinase-associated neurodegeneration About 100 mutations in the PANK2 gene have been identified in people with pantothenate kinase-associated neurodegeneration. Typically, people with the more severe, early-onset form of the disorder have PANK2 mutations that prevent cells from producing any functional pantothenate kinase 2. People affected by the atypical, later- onset form usually have mutations that change single amino acids in the enzyme, which makes the enzyme unstable or disrupts its activity. In some cases, single amino acid changes allow the enzyme to retain some function. The most common PANK2 mutation replaces the amino acid glycine with the amino acid arginine at position 411 of the enzyme (written as Gly411Arg or G411R). When pantothenate kinase 2 is altered or missing, the normal production of coenzyme A is disrupted and potentially harmful compounds can build up in the brain.
  • Pantothenate Kinase-Associated Neurodegeneration

    Pantothenate Kinase-Associated Neurodegeneration

    Pantothenate kinase-associated neurodegeneration Description Pantothenate kinase-associated neurodegeneration (formerly called Hallervorden-Spatz syndrome) is a disorder of the nervous system. This condition is characterized by progressive difficulty with movement, typically beginning in childhood. Movement abnormalities include involuntary muscle spasms, rigidity, and trouble with walking that worsens over time. Many people with this condition also develop problems with speech ( dysarthria), and some develop vision loss. Additionally, affected individuals may experience a loss of intellectual function (dementia) and psychiatric symptoms such as behavioral problems, personality changes, and depression. Pantothenate kinase-associated neurodegeneration is characterized by an abnormal buildup of iron in certain areas of the brain. A particular change called the eye-of-the- tiger sign, which indicates an accumulation of iron, is typically seen on magnetic resonance imaging (MRI) scans of the brain in people with this disorder. Researchers have described classic and atypical forms of pantothenate kinase- associated neurodegeneration. The classic form usually appears in early childhood, causing severe problems with movement that worsen rapidly. Features of the atypical form appear later in childhood or adolescence and progress more slowly. Signs and symptoms vary, but the atypical form is more likely than the classic form to involve speech defects and psychiatric problems. A condition called HARP (hypoprebetalipoproteinemia, acanthocytosis, retinitis pigmentosa, and pallidal degeneration) syndrome, which was historically described as a separate syndrome, is now considered part of pantothenate kinase-associated neurodegeneration. Frequency The precise incidence of this condition is unknown. It is estimated to affect 1 to 3 per million people worldwide. Causes Mutations in the PANK2 gene cause pantothenate kinase-associated neurodegeneration.
  • High Throughput Computational Mouse Genetic Analysis

    High Throughput Computational Mouse Genetic Analysis

    bioRxiv preprint doi: https://doi.org/10.1101/2020.09.01.278465; this version posted January 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. High Throughput Computational Mouse Genetic Analysis Ahmed Arslan1+, Yuan Guan1+, Zhuoqing Fang1, Xinyu Chen1, Robin Donaldson2&, Wan Zhu, Madeline Ford1, Manhong Wu, Ming Zheng1, David L. Dill2* and Gary Peltz1* 1Department of Anesthesia, Stanford University School of Medicine, Stanford, CA; and 2Department of Computer Science, Stanford University, Stanford, CA +These authors contributed equally to this paper & Current Address: Ecree Durham, NC 27701 *Address correspondence to: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.09.01.278465; this version posted January 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Background: Genetic factors affecting multiple biomedical traits in mice have been identified when GWAS data that measured responses in panels of inbred mouse strains was analyzed using haplotype-based computational genetic mapping (HBCGM). Although this method was previously used to analyze one dataset at a time; but now, a vast amount of mouse phenotypic data is now publicly available, which could lead to many more genetic discoveries. Results: HBCGM and a whole genome SNP map covering 53 inbred strains was used to analyze 8462 publicly available datasets of biomedical responses (1.52M individual datapoints) measured in panels of inbred mouse strains. As proof of concept, causative genetic factors affecting susceptibility for eye, metabolic and infectious diseases were identified when structured automated methods were used to analyze the output.
  • Episodic Visual Snow Associated with Migraine Attacks

    Episodic Visual Snow Associated with Migraine Attacks

    Letters RESEARCH LETTER Discussion | Three patients report episodes of VS exclusively at the beginning or during migraine attacks. The description was Episodic Visual Snow Associated identical and matched the definition of VS in VSS except for With Migraine Attacks not being continuous.1,2 In the syndrome-defining study,1 only Visual snow syndrome (VSS) is a debilitating disorder charac- patients with continuous VS were included, impeding the iden- terized by continuous visual snow (VS), ie, tiny flickering dots tification of an episodic form. Based on the present case se- in the entire visual field resembling the view of a badly tuned ries, we propose to distinguish between VSS, a debilitating dis- analog television (Figure), plus additional visual symptoms, order characterized by continuous VS and additional visual such as photophobia and palinopsia. There is a high comor- symptoms persisting over years, and eVS, an uncommon self- 1 bidity with migraine and migraine aura. To our knowledge, limiting symptom during migraine attacks. this is the first report of patients with an episodic form of VS The relationship between migraine and VSS is still (eVS), strictly co-occurring with migraine attacks. unresolved.3 Although the severity of VS in VSS does not fluc- tuate in parallel to the migraine cycle,1 the strict co-occurrence Methods | Between January 2016 and December 2017, we saw of eVS and migraine reported here epitomizes a close proxim- 3 patients with eVS and 1934 patients with migraine at our ter- ity.This is in agreement with the clinical picture of migraine being tiary outpatient headache center.
  • Exacerbation of Motor Neuron Disease by Chronic Stimulation of Innate Immunity in a Mouse Model of Amyotrophic Lateral Sclerosis

    Exacerbation of Motor Neuron Disease by Chronic Stimulation of Innate Immunity in a Mouse Model of Amyotrophic Lateral Sclerosis

    1340 • The Journal of Neuroscience, February 11, 2004 • 24(6):1340–1349 Neurobiology of Disease Exacerbation of Motor Neuron Disease by Chronic Stimulation of Innate Immunity in a Mouse Model of Amyotrophic Lateral Sclerosis Minh Dang Nguyen,1 Thierry D’Aigle,2 Genevie`ve Gowing,1,2 Jean-Pierre Julien,1,2 and Serge Rivest2 1McGill University Health Center, Centre for Research in Neurosciences, McGill University, The Montreal General Hospital Research Institute, Montre´al, Que´bec H3G 1A4, Canada, and 2Laboratory of Molecular Endocrinology, Laval University Medical Center Research Center and Department of Anatomy and Physiology, Laval University, Sainte-Foy, Que´bec G1V 4G2, Canada Innate immunity is a specific and organized immunological program engaged by peripheral organs and the CNS to maintain homeostasis after stress and injury. In neurodegenerative disorders, its putative deregulation, featured by inflammation and activation of glial cells resulting from inherited mutations or viral/bacterial infections, likely contributes to neuronal death. However, it remains unclear to what extent environmental factors and innate immunity cooperate to modulate the interactions between the neuronal and non-neuronal elements in the perturbed CNS. In the present study, we addressed the effects of acute and chronic administration of lipopolysaccharide (LPS), a Gram-negative bacterial wall component, in a genetic model of neurodegeneration. Transgenic mice expressing a mutant form of the superoxide dismutase 1 (SOD1 G37R) linked to familial amyotrophic lateral sclerosis were challenged intraperitoneally with a single nontoxic or repeated injections of LPS (1 mg/kg). At different ages, SOD1 G37R mice responded normally to acute endotoxemia. Remark- ably, only a chronic challenge with LPS in presymptomatic 6-month-old SOD1 G37R mice exacerbated disease progression by 3 weeks and motor axon degeneration.
  • Treatment for Disease Modification in Chronic Neurodegeneration

    Treatment for Disease Modification in Chronic Neurodegeneration

    cells Review Perspective: Treatment for Disease Modification in Chronic Neurodegeneration Thomas Müller 1,* , Bernhard Klaus Mueller 1 and Peter Riederer 2,3 1 Department of Neurology, St. Joseph Hospital Berlin-Weissensee, Gartenstr. 1, 13088 Berlin, Germany; [email protected] 2 Center of Mental Health, Department of Psychiatry, Psychosomatics and Psychotherapy, University Hospital Würzburg, Margarete-Höppel-Platz 1, 97080 Würzburg, Germany; [email protected] 3 Department of Psychiatry, Southern Denmark University Odense, J.B. Winslows Vey 18, 5000 Odense, Denmark * Correspondence: [email protected] Abstract: Symptomatic treatments are available for Parkinson’s disease and Alzheimer’s disease. An unmet need is cure or disease modification. This review discusses possible reasons for negative clinical study outcomes on disease modification following promising positive findings from experi- mental research. It scrutinizes current research paradigms for disease modification with antibodies against pathological protein enrichment, such as α-synuclein, amyloid or tau, based on post mortem findings. Instead a more uniform regenerative and reparative therapeutic approach for chronic neurodegenerative disease entities is proposed with stimulation of an endogenously existing repair system, which acts independent of specific disease mechanisms. The repulsive guidance molecule A pathway is involved in the regulation of peripheral and central neuronal restoration. Therapeutic antagonism of repulsive guidance molecule A reverses neurodegeneration according to experimental Citation: Müller, T.; Mueller, B.K.; outcomes in numerous disease models in rodents and monkeys. Antibodies against repulsive guid- Riederer, P. Perspective: Treatment for ance molecule A exist. First clinical studies in neurological conditions with an acute onset are under Disease Modification in Chronic Neurodegeneration. Cells 2021, 10, way.
  • Gut–Brain Axis and Neurodegeneration: State-Of-The-Art of Meta-Omics Sciences for Microbiota Characterization

    Gut–Brain Axis and Neurodegeneration: State-Of-The-Art of Meta-Omics Sciences for Microbiota Characterization

    International Journal of Molecular Sciences Review Gut–Brain Axis and Neurodegeneration: State-of-the-Art of Meta-Omics Sciences for Microbiota Characterization Bruno Tilocca 1 , Luisa Pieroni 2 , Alessio Soggiu 3,4 , Domenico Britti 1 , Luigi Bonizzi 4, 1, , 5,6, Paola Roncada * y and Viviana Greco * 1 Department of Health Sciences, University “Magna Græcia” of Catanzaro, viale Europa, 88100 Catanzaro, Italy; [email protected] (B.T.); [email protected] (D.B.) 2 Proteomics and Metabonomics Unit, Fondazione Santa Lucia-IRCCS, via del Fosso di Fiorano, 64-00143 Rome, Italy; [email protected] 3 Department of Biomedical, Surgical and Dental Sciences- One Health Unit, University of Milano, via Celoria 10, 20133 Milano, Italy; [email protected] 4 Department of Veterinary Medicine, University of Milano, Via dell’Università, 6- 26900 Lodi, Italy; [email protected] 5 Department of Basic Biotechnological Sciences, Intensivological and Perioperative Clinics, Università Cattolica del Sacro Cuore, Largo F. Vito 1, 00168 Rome, Italy 6 Fondazione Policlinico Universitario Agostino Gemelli, Largo A. Gemelli, 8-00168 Rome, Italy * Correspondence: [email protected] (P.R.); [email protected] (V.G.) Which represents the co-corresponding author. y Received: 14 May 2020; Accepted: 4 June 2020; Published: 5 June 2020 Abstract: Recent advances in the field of meta-omics sciences and related bioinformatics tools have allowed a comprehensive investigation of human-associated microbiota and its contribution to achieving and maintaining the homeostatic balance. Bioactive compounds from the microbial community harboring the human gut are involved in a finely tuned network of interconnections with the host, orchestrating a wide variety of physiological processes.
  • Capsaicin Prevents Degeneration of Dopamine Neurons by Inhibiting Glial Activation and Oxidative Stress in the MPTP Model of Parkinson’S Disease

    Capsaicin Prevents Degeneration of Dopamine Neurons by Inhibiting Glial Activation and Oxidative Stress in the MPTP Model of Parkinson’S Disease

    OPEN Experimental & Molecular Medicine (2017) 49, e298; doi:10.1038/emm.2016.159 & 2017 KSBMB. All rights reserved 2092-6413/17 www.nature.com/emm ORIGINAL ARTICLE Capsaicin prevents degeneration of dopamine neurons by inhibiting glial activation and oxidative stress in the MPTP model of Parkinson’s disease Young C Chung1,8, Jeong Y Baek2,8, Sang R Kim3,4, Hyuk W Ko1, Eugene Bok4, Won-Ho Shin5, So-Yoon Won6 and Byung K Jin2,7 The effects of capsaicin (CAP), a transient receptor potential vanilloid subtype 1 (TRPV1) agonist, were determined on nigrostriatal dopamine (DA) neurons in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) mouse model of Parkinson’s disease (PD). The results showed that TRPV1 activation by CAP rescued nigrostriatal DA neurons, enhanced striatal DA functions and improved behavioral recovery in MPTP-treated mice. CAP neuroprotection was associated with reduced expression of proinflammatory cytokines (tumor necrosis factor-α and interleukin-1β) and reactive oxygen species/reactive nitrogen species from activated microglia-derived NADPH oxidase, inducible nitric oxide synthase or reactive astrocyte-derived myeloidperoxidase. These beneficial effects of CAP were reversed by treatment with the TRPV1 antagonists capsazepine and iodo-resiniferatoxin, indicating TRPV1 involvement. This study demonstrates that TRPV1 activation by CAP protects nigrostriatal DA neurons via inhibition of glial activation-mediated oxidative stress and neuroinflammation in the MPTP mouse model of PD. These results suggest that CAP and its analogs may be beneficial therapeutic agents for the treatment of PD and other neurodegenerative disorders that are associated with neuroinflammation and glial activation-derived oxidative damage.
  • Ipsc-Derived Neuronal Models of PANK2- Associated Neurodegeneration Reveal Mitochondrial Dysfunction Contributing to Early Disease

    Ipsc-Derived Neuronal Models of PANK2- Associated Neurodegeneration Reveal Mitochondrial Dysfunction Contributing to Early Disease

    RESEARCH ARTICLE iPSC-derived neuronal models of PANK2- associated neurodegeneration reveal mitochondrial dysfunction contributing to early disease Charles Arber1*, Plamena R. Angelova1, Sarah Wiethoff1, Yugo Tsuchiya2, Francesca Mazzacuva3, Elisavet Preza1, Kailash P. Bhatia1, Kevin Mills3, Ivan Gout2, Andrey Y. Abramov1, John Hardy1, James A. Duce4, Henry Houlden1, Selina Wray1 a1111111111 a1111111111 1 Department of Molecular Neuroscience, Institute of Neurology, University College London, London, United Kingdom, 2 Institute of Structural and Molecular Biology, University College London, London, United a1111111111 Kingdom, 3 Centre for Translational Omics, Genetics and Genomic Medicine Programme, UCL Institute of a1111111111 Child Health, London, United Kingdom, 4 School of Molecular and Cellular Biology, Faculty of Biological a1111111111 Sciences, University of Leeds, Leeds, United Kingdom * [email protected] OPEN ACCESS Abstract Citation: Arber C, Angelova PR, Wiethoff S, Tsuchiya Y, Mazzacuva F, Preza E, et al. (2017) Mutations in PANK2 lead to neurodegeneration with brain iron accumulation. PANK2 has a iPSC-derived neuronal models of PANK2- role in the biosynthesis of coenzyme A (CoA) from dietary vitamin B5, but the neuropatho- associated neurodegeneration reveal mitochondrial logical mechanism and reasons for iron accumulation remain unknown. In this study, atypi- dysfunction contributing to early disease. PLoS cal patient-derived fibroblasts were reprogrammed into induced pluripotent stem cells ONE 12(9): e0184104. https://doi.org/10.1371/ journal.pone.0184104 (iPSCs) and subsequently differentiated into cortical neuronal cells for studying disease mechanisms in human neurons. We observed no changes in PANK2 expression between Editor: Fanis Missirlis, CINVESTAV-IPN, MEXICO control and patient cells, but a reduction in protein levels was apparent in patient cells.
  • Eye Movements in Neurodegenerative Diseases

    Eye Movements in Neurodegenerative Diseases

    REVIEW CURRENT OPINION Eye movements in neurodegenerative diseases Michael R. MacAskill a,b and Tim J. Andersona,b,c Purpose of review Abnormalities of oculomotor control accompany the pathological changes underlying many neurodegenerative diseases. Clinical examination of eye movements can contribute to differential diagnosis, whereas quantitative laboratory measures can provide detailed insight into the disease process. In this review of eye movements in neurodegenerative disease, we summarise recent empirical findings and conceptual advances. Recent findings Oculomotor researchers continue to be particularly prolific in studying Parkinson’s disease but there is also substantial activity in Alzheimer’s disease and spinocerebellar ataxia. Interesting findings have been reported in Huntington’s, motor neuron disease, and glaucoma. Most studies report laboratory-based investigations but useful progress in clinical description continues to be made. Summary Eye movements remain an active field of investigation across a variety of neurodegenerative conditions. Progress continues to be made at the clinical level as well by using laboratory techniques. Keywords Alzheimer’s disease, dementia, eye movement, neurodegeneration, Parkinson’s disease, saccade, spinocerebellar ataxia INTRODUCTION Mobile eye tracking technology is now also enabling The control of eye movement involves extensive insights into oculomotor control in more natural- networks of cerebral regions, spanning brainstem istic tasks (e.g. Fig. 2). to neo-cortex. Therefore, regardless