Neurology International 2019; volume 11:7959

A novel homozygous variation siblings of patients with PKAN who have a in the PANK2 gene in two novel variation of the PANK2 gene. Correspondence: Saeed Razmeh, Yasuj University of Medical Sciences, Kohgiluyeh Persian siblings with atypical and Boyer-Ahmad Province, Yasuj, Shahid pantothenate kinase Motahari Blvd, Iran. associated neurodegeneration Case Report E-mail: [email protected] A 32-year-old woman (case 1) was Key words: Pantothenate Kinase-associated Amir Hasan Habibi,1 Saeed Razmeh,2 referred to our clinic because of gait Neurodegeneration, novel variation, pan- Omid Aryani,1 Mohammad Rohani,1 difficulties that had started at the age of tothenate kinase-2 gene. Laleh Taghavian,2 Elham Alizadeh,2 about 16 years. The family history, drug Acknowledgements: The authors thank Dr. Karim Moradian Kokhedan2 history, and past medical history were noncontributory. On neurologic magid kheradmand maher for typing and edit- Maryam Zaribafian1 examination, the Mini-Mental State ing the manuscript. 1Iran University of Medical Sciences, Examination (MMSE) was normal. Cranial Contributions: the authors contributed equally. Tehran; 2Yasuj University of Medical nerve examination was normal and the Sciences, Yasuj, Iran Ophthalmologic evaluation indicated no Conflict of interest: the authors declare no evidence of visual impairment, Kayser- potential conflict of interest. Fleischer rings, pigmentary retinopathy and atrophy of optic nerve. She had hypokinesia Funding: none. Abstract and bradykinesia and limb rigidity, which was more on the right side, also there were Received for publication: 30 November 2018. Pantothenate Kinase-associated generalized dystonia and spasticity of lower Accepted for publication: 14 January 2019. Neurodegeneration (PKAN) is an autoso- limbs without cerebellar signs. mal recessive disorder that is caused by Acanthocytosis was not seen in the This work is licensed under a Creative Commons Attribution NonCommercial 4.0 variation in pantothenate kinase-2 gene peripheral blood smear and the other onlyLicense (CC BY-NC 4.0). (PANK2) gene on chromosome 20. The laboratory tests were normal. A brain common presentation of this disease magnetic resonance image (MRI) revealed ©Copyright A.H. Habibi et al., 2019 includes progressive dystonia, the eye of the tiger sign (Figure 1A), and the Licensee PAGEPress, Italy Parkinsonism, retinopathy, cognitive genetic analysis showed a homozygoususe Neurology International 2019; 11:7959 impairment, and spasticity. The typical variation in the PANK2 gene doi:10.4081/ni.2019.7959 magnetic resonance imaging finding is eye NM_153638.3:c.706_708delGAA (GAA of the tiger sign in globus pallidus and not deletion, p.E236 Del). performed on 2% agarose gels (Figure 2). pathogenic and not found in all patients. In The second patient (case 2) was a 30- The PCR products were sequenced with the the present study, we describe two siblings year-old man presents with generalized forward or reversed primers on an ABI who have a novel variation of the PANK2 dystonia and Parkinsonism that had started 3730XL sequencer (Macrogen Company, gene. These patients with the same geno- at the age of about 18 years. Gradually, the Korea) and compared with control samples type, have different ages at the onset of dis- dystonia increased in severity, His using the FinchTV program and analyzed ease and also the various severity of the dis- developmental history was normal, the on the NCBI website ease. The description of these cases helps to ophthalmological examination was normal (http://blast.ncbi.nlm.nih.gov/Blast.cgi).Wit understand this disease, its symptoms, with no evidence of visual impairment and h these methods, the target sequence for pathogenesis, and its treatment. retinopathy. He also had a generalized each patient was compared with the normal dystonia, hypokinesia, and limb rigidity. reference sequence, and mutations in the There were no pyramidal or cerebellar exons and the splicing sites of the introns in signs. Brain MRI discloses a typical eye-of- the PANK2 gene. All transcribed exons of Introduction the-tiger sign (Figure 1B), and a genetic the PANK2 gene were investigated in Non-commercialstudy detected a pathogenic variation in the Neurodegeneration with brain iron patients. delGAA homozygous mutation in PANK2 gene (GAA deletion, p.E236 Del). the exon2 was detected in both siblings and accumulation (NBIA) includes a For DNA extraction from type of blood heterogeneous group of hereditary their parent were heterozygous in this loca- cells, Q1AAMP DNA MICROKIT (Cat tion. Both patients were treated with neurodegenerative diseases that occur with number: 56304) was used. For Madopar 125 three times daily and symptoms such as dystonia, parkinsonism, comprehensive investigation of all the Deferiprone 500 twice daily, which we did cognitive impairment and vision loss.1-3 exons and splicing sites of the introns in not see any changes in symptoms after a The most common type is Pantothenate PANK2 gene, primers from another paper three month follow up. Kinase-associated Neurodegeneration 8 were used (Table 1). Briefly, PCR reaction We obtained the written informed (PKAN), due to a variation in the was performed in a final volume of 25 µL consent from the two patients for pantothenate kinase-2 gene (PANK2) gene containing 100-200 ng of total DNA, 10 publication of the case report on chromosome 20.4 The disease has two pmol of each primer, 2.5 mM MgCl2, 200 types, classic and atypical, the classical type mM each of dNTP and 1 U Taq DNA occurs at an earlier age and more severe. polymerase (Roche Diagnostics, The typical MRI finding is eye of the tiger Mannheim, Germany). The reaction Discussion and Conclusions sign that is T2-hypointensity surrounding a mixture was cycled 35 times at 95◦C for 1 central hyperintensity in globus pallidus min, annealing temperature (°C) for 1 min Pantothenate Kinase-Associated and not pathogenic and not found in all (refer to Table 1) and 72◦C for 1 min. Neurodegeneration (PKAN) is an patients.5-7 In this paper, we present two Electrophoresis of the PCR products was autosomal recessive disorder caused by a

[Neurology International 2019; 11:7959] [page 9] Case Report variation in the PANK2 gene. The clinical about 18 years, with slow progression and brain barrier and reduces brain iron and manifestations include speech disorder the severity of the symptoms was milder. reduces the oxidative stress response in the Parkinsonism, dystonia, spasticity, Visual Usually Bulbar symptoms, generalized dys- brain.21-24 In conclusion, although the dis- loss, dysphagia seizure, and dementia.2,3,9 tonia, and gait disturbance, are more com- ease is rare. But familiarity with clinical and All of the patients with Pantothenate Kinase mon in classical form and tremors, segmen- radiological symptoms can help to diagnose Associated Neurodegeneration do not have tal dystonia, seizure, psychiatric disorders this disease more easily. eye-of-the-tiger sign especially in the early and Parkinsonism more common in atypical stages of this disease and all of the patients form of PKAN disease.4,16,17 Because the with this sign do not have a PANK2 precise mechanism of these diseases has not mutation.10-13 This gene has seven exons, been discovered so far, most of the treat- References most variations are missense but ments used so far reduce the severity of 1. Gregory A, Polster BJ, Hayflick SJ. duplication, deletion and splice also symptoms to some extent.1,18 The dystonia Clinical and genetic delineation of neu- reported,6,14,15 in our patients, there is a is debilitating in these patients and is exac- rodegeneration with brain iron accumu- novel variation that was GAA deletion erbated over time and is treated with drugs lation. J Med Genet 2009;46:73-80. resulting in the p.E236del that such as Oral and Intrathecal Baclofen, 2. Schipper HM. Neurodegeneration with bioinformatically or in silico showed it is Botulinum Toxin, gabapentin and anti- brain iron accumulation: clinical syn- probably pathogenic mutation but needs cholinergics. Surgery such as Deep brain dromes and neuroimaging. Biochim further investigation. Two of our patients stimulation, ablative pallidotomy or thalam- Biophys Acta 2012;1822:350-60. had manifestations but the progression, and otomy is also used to treat this disease.18-21 3. Schneider SA, Hardy J, Bhatia KP. severity of the disease was different. The Iron chelator drugs such as deferiprone Syndromes of neurodegeneration with course of the disease in the first patient was have been used in some studies in neurode- brain iron accumulation (NBIA): an faster and the symptoms were more severe. generative diseases and have promising update on clinical presentations, histo- Case 2 had a later onset of symptoms, results. This drug passes through the blood- logical and genetic underpinnings, and treatment considerations. Mov Disord 2012;27:42-53. Table 1. Primers for studying the PANK2 gene by PCR-sequencing. only 4. Pellecchia M, Valente E, Cif L, et al. Primers Forward/Reverse Product size (bp) TM(°C) The diverse phenotype and genotype of pantothenate kinase-associated neu- 1 F: GGAACTAGGCCGAGGGACAAAG 1200 63 R:GAAGGTACCGCTTTCGGAG use rodegeneration. Neurology 2005;64: 1810-2. 2 F: GCCCCAAAACCCTTTTGC 650 60 R: ACCACCTCTAGATGGCCAACTC 5. Gregory A, Hayflick SJ. Pantothenate kinase-associated neurodegeneration. 3 F: TGGGTCTGTAGTAGCAGG 580 54 R: CATTTGTTTGCATAATCCAG 2013. Seattle (WA): University of Washington, Seattle. 4 F: GACATGGGCCCTGTGTTTTG 438 60 6. Parmar A, Khare S, Srivastav V. R: GGCCCGCCTGTATTTCTTAG Pantothenate-kinase associated neu- 5 F: GCTCTGTTTGAAGTTTGC 402 54 rodegeneration. J Assoc Physicians R:ATGACTACATTTAGGCACTG India 2012;60:74-6. 6 F: TCCTGTGACATTATCTAGCATG 429 54 7. Zorzi G, Zibordi F, Chiapparini L, et al. R: AGCCCATTTCACCTCCAC Iron-related MRI images in patients 7 F:TCTGAAGTGCTTGGATAGTC 454 54 with pantothenate kinase–associated R:CTTCCTGGTTGCTAATTTAG neurodegeneration (PKAN) treated with deferiprone: Results of a phase II pilot trial. Mov Disord 2011;26:1755-9. 8. Aryani O, Houshmand M, Fatehi F. A Non-commercial novel PANK2 gene mutation in a Persian boy: the first report from Iran. Clin Neurol Neurosurg 2013;115:1170. 9. Razmeh S, Habibi AH, Orooji M, et al. Pantothenate kinase-associated neu- rodegeneration: Clinical aspects, diag- nosis and treatments. Neurol Intern 2018;10. 10. Chiapparini L, Savoiardo M, D’Arrigo S, et al. The “eye-of-the-tiger” sign may be absent in the early stages of classic pantothenate kinase associated neu- rodegeneration. Neuropediatrics 2011;42:159-62. 11. Hájek M, Adamovičová M, Herynek V, et al. MR relaxometry and 1H MR spec- troscopy for the determination of iron Figure 1. Brain magnetic resonance imaging T2-FLAIR images of case 1 (A) and 2 (B) revealed the eye of the tiger sign. and metabolite concentrations in PKAN patients. Eur Radiol 2005;15:1060-8.

[page 10] [Neurology International 2019; 11:7959] Case Report

12. Hayflick S, Hartman M, Coryell J, et al. Koreans. J Mov Disord 2016;9:20. 21. Rohani M, Razmeh S, Shahidi GA, Brain MRI in neurodegeneration with 17. Marelli C, Piacentini S, Garavaglia B, Orooji M. A pilot trial of deferiprone in brain iron accumulation with and with- et al. Clinical and neuropsychological pantothenate kinase-associated neu- out PANK2 mutations. Am J correlates in two brothers with pan- rodegeneration patients. Neurol Int Neuroradiol 2006;27:1230-3. tothenate kinase–associated neurode- 2018;9:7279. 13. Kumar N, Boes CJ, Babovic- generation. Mov Disord 2005;20:208- 22. Cossu G, Abbruzzese G, Matta G, et al. Vuksanovic D, Boeve BF. The “eye-of- 12. the-tiger” sign is not pathognomonic of 18. Pratini NR, Sweeters N, Vichinsky E, Efficacy and safety of deferiprone for the PANK2 mutation. Arch Neurol Neufeld JA. Treatment of Classic the treatment of pantothenate kinase- 2006;63:292. Pantothenate Kinase-Associated associated neurodegeneration (PKAN) 14. Hartig M, Prokisch H, Meitinger T, Neurodegeneration (PKAN) with and neurodegeneration with brain iron Klopstock T. Pantothenate kinase-asso- Deferiprone and Intrathecal Baclofen. accumulation (NBIA): results from a ciated neurodegeneration. Curr Drug Am J Phys Med Rehabil 2013;92:728. four years follow-up. Parkinson Relat Targets 2012;13:1182-9. 19. Castelnau P, Cif L, Valente EM, et al. Disord 2014;20:651-4. 15. Lee C-H, Lu C-S, Chuang W-L, et al. Pallidal stimulation improves pan- 23. Rouault TA. Iron metabolism in the Phenotypes and genotypes of patients tothenate kinase–associated neurode- CNS: implications for neurodegenera- with pantothenate kinase-associated generation. Ann Neurol 2005;57:738- tive diseases. Nat Rev Neurosci neurodegeneration in Asian and 41. Caucasian populations: 2 cases and lit- 20. Mikati MA, Yehya A, Darwish H, et al. 2013;14:551. erature review. Sci World J 2013;2013. Deep brain stimulation as a mode of 24. Szumowski J, Bas E, Gaarder K, et al. 16. Lee J-H, Park J, Ryu H-S, et al. Clinical treatment of early onset pantothenate Measurement of brain iron distribution heterogeneity of atypical pantothenate kinase-associated neurodegeneration. in Hallevorden-Spatz syndrome. J kinase-associated neurodegeneration in Eur J Paediatr Neurol 2009;13:61-4. Magn Res Imag 2010;31:482-9. only use

Non-commercial

[Neurology International 2019; 11:7959] [page 11]