DOCSLIB.ORG

Expression Patterns of T1R3 in Duodenal Epithelial Cells with Some Gastrointestinal Hormone＊

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Expression Patterns of T1R3 in Duodenal Epithelial Cells with Some Gastrointestinal Hormone＊ Arch Histol Cytol, 73 (4/5): 177-185 (2010/2011) Expression patterns of T1R3 in duodenal epithelial cells with some gastrointestinal hormone＊ Masafumi Oda1, 2, Yuji Seta2, Shinji Kataoka3, Takashi Toyono2, Kuniaki Toyoshima2, and Yasuhiro Morimoto1 1Department of Oral Diagnostic Science, 2Division of Oral Histology and Neurobiology, 3 Division of Anatomy, Department of Bioscience, Kyushu Dental College, Kitakyushu, Japan Summary. Recent studies have demonstrated that taste may regulate the secretion of serotonin by stimuli other receptors, T1Rs and T2Rs, are expressed not only in taste than a mechanical one. buds but also in the gut. In the duodenum, it is thought that the secretion of secretin (S cells) and somatostatin (D cells) is stimulated by acid, that gastrin (G cells) and Introduction cholecystokinin (CCK) (I cells) are stimulated by proteins and amino acids, and that serotonin (EC cells) scretion is The taste system, which is made up of taste receptor cells triggerd by mechanical stimulation sensing gut endocrine clustered in taste buds at the surface of the tongue and the cells. soft palate, plays a key role in the decision to ingest or We examined the expression of T1R3 in the duodenum reject food. Its function is therefore, essential to protect by reverse transcription polymerase chain reaction (RT- organisms against harmful toxins and select the most PCR) and in situ hybridization. Double-label studies appropriate nutrients. Ingested nutrients stimulate the showed that approximately 50% of secretin positive cells secretion of gastrointestinal hormones necessary for the (S cells) were coexpressed with T1R3, and approximately coordinated processes of food digestion. 33% of AADC positive cells (EC cells) were coexpressed The T1Rs, G-protein-coupled receptors (GPCRs) with T1R3. On the other hand, T1R3 never colocalized that form two novel seven-transmembrane domains, are with somatostatin (D cells), gastrin (G cells), or CCK (I expressed in topographically distinct subpopulations of cells). These results suggest that S cells may regulate the taste receptor cells and taste buds (Hoon et al., 1999). The secretion of secretin, stimulated not only by acid but also functional expression of T1Rs is influenced by sweet and by sweet substances and/or amino acids. Similarly, EC cells umami taste stimuli. A T1R2/T1R3 heterodimer serves as a chemical receptor for sweet tastes (diverse natural and synthetic sweeteners). T1R1/T1R3 heterodimers Received October 12, 2010 are receptors for the umami compound l-glutamate, a response enhanced by 5'-ribonucleotides (Nelson et al., * This study was supported by a Grant-in-Aid for Scientific 2001; Li et al., 2002). Research (No. 21592338 to YS). from the Japan Society for Recent studies have demonstrated that solitary cells the Promotion of Science. expressing taste cell signal transduction proteins exist in hollow organs. It has been previously shown that T1Rs Address for correspondence: Dr. Yuji Seta, Division of Oral are expressed in the gastrointestinal tract (GI) (Hofer et Histology and Neurobiology, Department of Bioscience, al., 1996; Wu et al., 2002; Dyer et al., 2005; Grundy, Kyushu Dental College, 2-6-1 Manazuru, Kokurakita-ku, 2005). They are additionally expressed in the stomach, Kitakyushu 803-8580, Japan small intestine – including the duodenum, and colon in Ph: +81-93-582-1131ext.7932, Fax: +81-93-582-6089 mice and humans, with the exception of T1R2, which has E-mail: [email protected] not been detected in the mouse or human stomach or in the mouse colon (Bezençon et al., 2007). There have been 178 M. Oda et al.: numerous studies on the downstream cascade reactions confirm their identities. The primer sequences for mouse of gastrointestinal chemosensing by taste receptor T1R3 were as follows: components (Margolskee et al., 2007; Rozengurt and Forward: 5'- TTGTGCTGTCACTCCTCCTG -3' and Sternini, 2007; Jang et al., 2007; Mace et al., 2007; Shin Reverse: 5'- TAAGCTAGCATGGCGAAGGT -3'. et al., 2008; Sternini et al., 2008). T1R3 and gustducin in the gut regulate the secretion of glucagon-like peptide-1 Tissue preparation (GLP-1) – an incretin hormone that promotes the augmented insulin release from the pancreas in response All mice were anesthetized by an intraperitoneal injection to glucose in the gut lumen more than to intravenous of pentobarbital (50 mg/kg) and perfusion through the injected glucose (Kokrashvili et al., 2009) – as well as left ventricle with 4% paraformaldehyde (PFA) in a the expression of the Na+-glucose cotransporter 1 that phosphate buffer, pH 7.4. Duodenums from perfused mice transports dietary sugars from the intestinal lumen into were fixed overnight in the same fixative. They were then absorptive enterocytes (Margolskee et al., 2007). There rinsed overnight in a phosphate buffer containing 30% is a study showing that T1R3 is expressed in the brush sucrose, embedded in OCT compound (Sakura, Torrance, cells and ghrelin-producing cells of the murine stomach CA, USA) and snap-frozen in a dry ice-isopentane (Hass et al., 2010). However, no reports have described mixture. Cryostat sections (5μm) were mounted on the relationship between the initial reaction and hormone Superfrost slides (Matsunami, Japan) and stored in secretion. We therefore, aimed to determine whether the airtight boxes at －80℃. T1R3 that is a common component of sweet and umami receptors is the initial chemoreceptor for these secreting In situ hybridization reactions. After a brief washing in PBS, treatment for 5 min each with 0.2 N HCl and PBS containing 1 μg/ml proteinase Materials and Methods K (Wako, Osaka) at 37℃, the sections were refixed for 20 min in 4% PFA and then treated twice for 15 min Adult ICR mice of both sexes were used in this study. The with 2 mg/ml glycine/PBS. Sections were prehybridized use of these animals was approved by the Kyushu Dental for 30 min at room temperature in a hybridization buffer College Animal Care and Use Committee and conformed (50% deionized formamide/ 300 mM NaCl/ 5 mM EDTA/ to the National Institute of Health Guidelines. 0.1% Tween 20/ 0.5% CHAPS/ 1% Blocking Buffer). Digoxigenin-labeled antisense and sense riboprobes were produced from plasmids containing T1R3. Hybridization RT-PCR was performed overnight at 67℃ in a hybridization buffer For RT-PCR, dissected duodenum tissue containing containing 100μg/ml tRNA, 0.05 mg/ml, and 0.5μg/ml epithelium was incubated for 60 min at room temperature riboprobe. After hybridization, the slides were washed for in RNHsafer Stabilizer Reagent (Omega Bio-Tek, 30 min in 2×SSC at room temperature, followed by 1 h Norcross, GA, USA). For the extraction of RNA from in 2×SSC at 67℃, 1 h in 0.1×SSC at 67℃, and 30 min tissues, we used the RNA Purification System (Roche in maleic acid buffer (MABT) (0.1 M maleic acid/ 0.15 Applied Science, Mannheim, Germany) and degraded M NaCl/ 0.1% Tween 20) at room temperature. Next, the the DNA by incubation at 37℃ for 1 h with DNase. sections were incubated for 2 h with anti-digoxigenin-AP The resultant total RNAs were reverse transcribed using diluted 1:250 in 2% (wt/vol) blocking reagent (Roche). random 9-mers and Avian Myeloblastosis Virus (AMV) After a 15-min washing in MABT, a 5-min equilibration reverse transcriptase at 42℃ for 15 h to yield single- in a NBT/BCIP buffer [100 mM Tris·HCl (pH 9.5)/ 100 stranded cDNAs. Following denaturation at 99℃ for mM NaCl/ 50 mM MgCl2], and a 3-h incubation in the 5 min, PCR amplification was performed under the dark in NBT/BCIP buffer containing 10% polyvinyl following conditions: 94℃ for 30 sec, 58℃ for 30 alcohol and a NBT/BCIP mixture (Roche) diluted 1:50, sec, and 72℃ for 1 min, for a total of 35 cycles. The the slides were washed for 5 min in 10 mM Tris·HCl (pH reaction was terminated after a 15-min elongation step 8.0) and 1mM EDTA and then rinsed in PBS. at 72℃. The reverse transcriptase step was omitted in negative control samples to confirm the removal of all Immunofluorescence genomic DNA. Amplification products were analyzed in 2% agarose gels and visualized with ethidium bromide. Following in situ hybridization, the sections were Amplification products were subcloned and sequenced to analyzed for the presence of gastrointestinal hormone- T1R3 in duodenal epithelial cells 179 secreting cells, secretin, somatostatin, gastrin, CCK, obtained with an Olympus DP72 CCD camera mounted and Aromatic L-amino acid decarboxylase (AADC). on an Olympus BX50 microscope. Digital images were The sections were rinsed in PBS and then incubated acquired with DP2-BSW software, converted to TIFF with primary rabbit anti-secretin (1:200; Phoenix format, and then contrast- and color-adjusted using Adobe Pharmaceuticals, Inc., Burlingame, CA, USA), anti- Photoshop CS3 for Macintosh. Overlays of fluorescent somatostatin (1:1000; Invitrogen, Carlsbad, CA), anti- and in situ hybridization images were also generated in gastrin (1:1; Cell Marque, Rocklin, CA), anti-CCK Photoshop as follows: the in situ hybridization image (1:1000; Affinity BioReagents, Rockford, IL, USA), or was first inverted, and the blue and green channel portion AADC antibody (1:500; Gene Tex, Inc., Irvine, CA) deleted to black, leaving an inverted, pseudocolored overnight at room temperature in a humidified chamber. red image. Then the green fluorescence image of the After rinsing with PBS, the sections were incubated same field of view was pasted into the green channel, to with Alexa Fluor 488-conjugated goat anti-rabbit IgG produce the overlay. (Molecular Probes, Eugene, OR, USA) overnight at room temperature. The slides were rinsed with PBS and Data analysis coverslipped with Vectashield (Vector Laboratories, Inc., Burlingame, CA). For quantification, every second section was examined Immunofluorescent and in situ hybridization images were (to avoid counting the same cells).
Load more

Recommended publications
  • Cells Using Gene Expression Profiling and Insulin Gene Methylation
    RESEARCH ARTICLE Comparison of enteroendocrine cells and pancreatic β-cells using gene expression profiling and insulin gene methylation ☯ ☯ Gyeong Ryul Ryu , Esder Lee , Jong Jin Kim, Sung-Dae MoonID, Seung-Hyun Ko, Yu- Bae Ahn, Ki-Ho SongID* Division of Endocrinology & Metabolism, Department of Internal Medicine, College of Medicine, The Catholic University of Korea, Seoul, Korea ☯ These authors contributed equally to this work. a1111111111 * [email protected] a1111111111 a1111111111 a1111111111 a1111111111 Abstract Various subtypes of enteroendocrine cells (EECs) are present in the gut epithelium. EECs and pancreatic β-cells share similar pathways of differentiation during embryonic develop- ment and after birth. In this study, similarities between EECs and β-cells were evaluated in OPEN ACCESS detail. To obtain specific subtypes of EECs, cell sorting by flow cytometry was conducted Citation: Ryu GR, Lee E, Kim JJ, Moon S-D, Ko S- from STC-1 cells (a heterogenous EEC line), and each single cell was cultured and pas- H, Ahn Y-B, et al. (2018) Comparison of saged. Five EEC subtypes were established according to hormone expression, measured enteroendocrine cells and pancreatic β-cells using by quantitative RT-PCR and immunostaining: L, K, I, G and S cells expressing glucagon-like gene expression profiling and insulin gene methylation. PLoS ONE 13(10): e0206401. https:// peptide-1, glucose-dependent insulinotropic polypeptide, cholecystokinin, gastrin and doi.org/10.1371/journal.pone.0206401 secretin, respectively. Each EEC subtype was found to express not only the corresponding Editor: Wataru Nishimura, International University gut hormone but also other gut hormones. Global microarray gene expression profiles of Health and Welfare School of Medicine, JAPAN revealed a higher similarity between each EEC subtype and MIN6 cells (a β-cell line) than Received: March 29, 2018 between C2C12 cells (a myoblast cell line) and MIN6 cells, and all EEC subtypes were highly similar to each other.
    [Show full text]
  • Enteric Nervous System (ENS): 1) Myenteric (Auerbach) Plexus & 2
    Enteric Nervous System (ENS): 1) Myenteric (Auerbach) plexus & 2) Submucosal (Meissner’s) plexus à both triggered by sensory neurons with chemo- and mechanoreceptors in the mucosal epithelium; effector motors neurons of the myenteric plexus control contraction/motility of the GI tract, and effector motor neurons of the submucosal plexus control secretion of GI mucosa & organs. Although ENS neurons can function independently, they are subject to regulation by ANS. Autonomic Nervous System (ANS): 1) parasympathetic (rest & digest) – can innervate the GI tract and form connections with ENS neurons that promote motility and secretion, enhancing/speeding up the process of digestion 2) sympathetic (fight or flight) – can innervate the GI tract and inhibit motility & secretion by inhibiting neurons of the ENS Sections and dimensions of the GI tract (alimentary canal): Esophagus à ~ 10 inches Stomach à ~ 12 inches and holds ~ 1-2 L (full) up to ~ 3-4 L (distended) Duodenum à first 10 inches of the small intestine Jejunum à next 3 feet of small intestine (when smooth muscle tone is lost upon death, extends to 8 feet) Ileum à final 6 feet of small intestine (when smooth muscle tone is lost upon death, extends to 12 feet) Large intestine à 5 feet General Histology of the GI Tract: 4 layers – Mucosa, Submucosa, Muscularis Externa, and Serosa Mucosa à epithelium, lamina propria (areolar connective tissue), & muscularis mucosae Submucosa à areolar connective tissue Muscularis externa à skeletal muscle (in select parts of the tract); smooth muscle (at least 2 layers – inner layer of circular muscle and outer layer of longitudinal muscle; stomach has a third layer of oblique muscle under the circular layer) Serosa à superficial layer made of areolar connective tissue and simple squamous epithelium (a.k.a.
    [Show full text]
  • S41467-019-14258-Z.Pdf
    ARTICLE https://doi.org/10.1038/s41467-019-14258-z OPEN Erythroid differentiation regulator-1 induced by microbiota in early life drives intestinal stem cell proliferation and regeneration Hirohito Abo1, Benoit Chassaing 1,2,3,4, Akihito Harusato 1, Miguel Quiros5, Jennifer C. Brazil5, Vu L. Ngo1, Emilie Viennois6, Didier Merlin6,7, Andrew T. Gewirtz1, Asma Nusrat5 & Timothy L. Denning1* 1234567890():,; Gut microbiota and their metabolites are instrumental in regulating intestinal homeostasis. However, early-life microbiota associated influences on intestinal development remain incompletely understood. Here we demonstrate that co-housing of germ-free (GF) mice with specific-pathogen free (SPF) mice at weaning (exGF) results in altered intestinal gene expression. Our results reveal that one highly differentially expressed gene, erythroid dif- ferentiation regulator-1 (Erdr1), is induced during development in SPF but not GF or exGF mice and localizes to Lgr5+ stem cells and transit amplifying (TA) cells. Erdr1 functions to induce Wnt signaling in epithelial cells, increase Lgr5+ stem cell expansion, and promote intestinal organoid growth. Additionally, Erdr1 accelerates scratch-wound closure in vitro, increases Lgr5+ intestinal stem cell regeneration following radiation-induced injury in vivo, and enhances recovery from dextran sodium sulfate (DSS)-induced colonic damage. Col- lectively, our findings indicate that early-life microbiota controls Erdr1-mediated intestinal epithelial proliferation and regeneration in response to mucosal damage. 1 Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences, Georgia State University, 100 Piedmont Ave, Atlanta, GA 30303, USA. 2 Neuroscience Institute and Institute for Biomedical Sciences, Georgia State University, Atlanta, Georgia, USA. 3 INSERM, U1016, Paris, France. 4 Université de Paris, Paris, France.
    [Show full text]
  • Neural and Neuroendocrine Control of Digestion: Regulation of Gastrointestinal Hormone Secretion
    Neural and Neuroendocrine Control of Digestion: Regulation of Gastrointestinal Hormone Secretion (Chapter 15 in “Eckert Animal Physiology) (Chapter 4 in Hill, Wise & Anderson: “Animal Physiology”) (Chapter 10 in Hadley: “Endocrinology”) General Concepts Covered: — neural and neuroendocrine integration of a complex physiological process — co-ordination of endocrine and exocrine secretion — exocrine secretion affecting endocrine status — endocrine influences on neural, muscle and secretory functions — paracrine and autocrine effects — local influences — positive and negative “feed-back” actions — enzymatic cascades — integration of carbohydrate, fat and protein digestion and appetite control General Introduction — digestion requires co-ordination of movement of food particles, mechanical and chemical digestion of food — opening and closing of sphincter muscles to contain food particles in certain gut compartments for appropriate processing, also control passage through compartments — proper sequential enzymatic processing General Introduction (cont.) — peristaltic action to move food through gut — kneading movement to mix food particles with enzymes and to expose new surfaces for digestion, as well as for absorption From Eckert Secretin - first proposed hormone — 1902, WM Baylist and EH Starling (observations in dogs) — addition of food or acid in stomach is usually followed by pancreatic enzyme secretion into intestine — dennervate and tie off duodenum from stomach, then 1) add acid to stomach - no pancreatic enzyme secretion 2) add acid to
    [Show full text]
  • Pancreatic Amylase
    1. Functional Anatomy • The pancreas which lies parallel to and beneath the stomach is composed of: 1. The endocrine islets of Langerhans which secrete: Hormone Type of cell % of secretion Insulin Beta cells 60% crucial for normal regulation of glucose, Glucagon Alpha cells ~25% lipid & protein metabolism Somatostatin delta cells ~10% 1. Acinar gland tissues which produce pancreatic juice (the main source of digestive enzymes). • The pancreatic digestive enzymes are secreted by pancreatic acini. • Large volumes of sodium Bicarbonate solution are secreted by the small ductules and larger ducts leading from the acini. • Pancreatic juice is secreted in Response to the presence of Chyme in the upper portions of the small intestine. 2. Major Components of Pancreatic Secretion and Their Physiologic Roles & 5. Activation of Pancreatic Enzymes • The major functions of pancreatic secretion: 1. To neutralize the acids in the duodenal chyme to optimum range (pH= 7.0-8.0) for activity of pancreatic enzymes. 2. To prevent damage to duodenal mucosa by acid & pepsin. 3. To produce enzymes involved in the digestion of dietary carbohydrate, fat, and protein. Pancreatic Enzymes: The pancreas secrests enzymes that act on all major types of food stuffs. 1. Pancreatic Proteolytic Enzymes (Trypsin, Chymotrypsin, Carboxypolypeptidase, Elastase) • Trypsin & Chymotrypsin split whole and partially digested proteins into peptides of various sizes but do not cause release of individual amino acids. • Carboxypolypeptidase splits some peptides into individual amino acids, thus completing digestion of some proteins to amino acids. • When first synthesized in the pancreatic cells, digestive enzymes are in the inactive forms; these enzymes become activated only after they are secreted into the intestinal tract.
    [Show full text]
  • Secretin Stimulates the Secretion of Bile from the Liver. It Also Increases Watery Bicarbonate Solution from Pancreatic Duct Epithelium
    Name Secretin acetate Cat # PP-1670 Size 1 g, 10 g, 100, g and bulk custom packages CAS# 17034-35-4 Mol. Mass 3055.47 Formula C130H220N44O41 Sequence H-His-Ser-Asp-Gly-Thr-Phe-Thr-Ser-Glu-Leu-Ser-Arg-Leu-Arg-Asp-Ser- Ala-Arg-Leu-Gln-Arg-Leu-Leu-Gln-Gly-Leu-Val-NH2 Purity >95% Secretin is a peptide hormone produced in the S cells of the duodenum in the crypts of Lieberkühn. Its primary effect is to regulate the pH of the duodenal contents via the control of gastric acid secretion and buffering with bicarbonate. Secretin stimulates the secretion of bile from the liver. It also increases watery bicarbonate solution from pancreatic duct epithelium. Pancreatic acinar cells have secretin receptors in their plasma membrane. As secretin binds to these receptors, it stimulates adenylate cyclase activity and converts ATP to cyclic AMP.[12] Cyclic AMP acts as second messenger in intracellular signal transduction and leads to increase in release of watery carbonate.It is known to promote the normal growth and maintenance of the pancreas. Secretin increases water and bicarbonate secretion from duodenal Brunner's glands in order to buffer the incoming protons of the acidic chyme.[13] It also enhances the effects of cholecystokinin to induce the secretion of digestive enzymes and bile from pancreas and gallbladder, respectively. It counteracts blood glucose concentration spikes by triggering increased insulin release from pancreas, following oral glucose intake.<[14] It also reduces acid secretion from the stomach by inhibiting gastrin release from G cells.[citation needed] This helps neutralize the pH of the digestive products entering the duodenum from the stomach, as digestive enzymes from the pancreas (eg, pancreatic amylase and pancreatic lipase) function optimally at neutral pH.[citation needed] In addition, secretin simulates pepsin secretion which can help break down proteins in food digestion.
    [Show full text]
  • Cellular Localization of Gastric Inhibitory Polypeptide in the Duodenum and Jejunum
    Gut: first published as 10.1136/gut.14.4.284 on 1 April 1973. Downloaded from Gut, 1973, 14, 284-288 Cellular localization of gastric inhibitory polypeptide in the duodenum and jejunum JULIA M. POLAK, S. R. BLOOM', MARION KUZIO, J. C. BROWN, AND A. G. E. PEARSE From the Department ofHistochemistry, Royal Postgraduate Medical School, Hammersmith Hospital, London, and the Department ofPhysiology, University ofBritish Columbia, Vancouver, Canada SUMMARY Indirect immunofluorescence studies using an antiserum to purified porcine gastric inhibitory polypeptide indicate, in the gastrointestinal tract of dog and man, that this polypeptide is present in cells situated predominantly in the mid-zone of the glands in the duodenum and, to a lesser extent, in the jejunum. Absolute correlation of the gastric inhibitory polypeptide cell with one or other of the known endocrine-like cells identified by electron microscopy awaits confirmation by electron immunocytochemistry. It is here identified as an endocrine polypeptide cell of the APUD series and, provisionally, as the D, cell. While the hormonal status of a given polypeptide depends ultimately on physiological experiments the present results strengthen the view that gastric inhibitory polypeptide is indeed a hormone. In 1969 Brown, Pederson, Jorpes, and Mutt described We report here the results of immunofluorescence an enterogastrone, extractable from porcine intestine, studies on the localization of GIP in human and http://gut.bmj.com/ which strongly inhibited gastric acid secretion. The canine intestine. purification of an apparently similar enterogastrone was reported in the same year by Lucien, Itoh, Sun, Material and Methods Meyer, Carlton, and Schally. The first of these poly- peptides, named gastric inhibitory polypeptide Operative samples of duodenal and jejunal mucosa (GIP) by Brown, Mutt, and Pederson (1970), was from seven human subjects were studied.
    [Show full text]
  • Stomach, Duodenum, and Jejunum
    Gut, 1970, 11, 649-658 The endocrine polypeptide cells of the human Gut: first published as 10.1136/gut.11.8.649 on 1 August 1970. Downloaded from stomach, duodenum, and jejunum A. G. E. PEARSE, I. COULLING, B. WEAVERS, AND S. FRIESEN' From the Department of Histochemistry, Royal Postgraduate Medical School, London SUMMARY Thirty specimens of stomach, duodenum, and jejunum, removed at operation, were examined by optical microscopical, cytochemical, and electron microscopical techniques. The overall distribution of four types of endocrine polypeptide cell in the stomach, and three in the intestine, was determined. The seven cell types are described by names and letters belonging to a scheme for nomenclature agreed upon at the 1969 Wiesbaden conference o* gastrointestinal hormones. The gastrin-secreting G cell was the only cell for which firm identification with a known hormone was possible. Although there was wide variation in the distribution of the various cells, from one case to another, striking differences were never- theless observable, with respect to the G cell, between antra from carcinoma and from ulcer cases. http://gut.bmj.com/ This study was undertaken with a view to estab- tive shorthand terminology. Correlation with the lishing the overall topographical distribution of terminology used by Solcia, Vassallo, and Capella the various types of endocrine polypeptide cells (1969b) and by Vassallo, Solcia, and Capella in the human stomach and upper intestine. (1969) had to be equated, if possible, with the Adequate sampling was regarded as a pre- scheme used by Forssmann, Orci, Pictet, Renold, on September 28, 2021 by guest. Protected copyright.
    [Show full text]
  • 19780525 Gr Im.Pdf
    0 0 0 2 TABLE OF CONTENTS I INTRODUCTION II HISTORICAL BACKGROUND III ORIGIN AND NATURE OF GI HORMONES: NEUROENDOCRINE SECRETION AND RELEASE OF PEPTIDES IV ANATOMIC AND CELLULAR DISTRIBUTION OF GI HORMONES V CHEMICAL AND BIOLOGICAL FEATURES OF GI HORMONES: STRUCTURE AS A GUIDE TO BIOLOGICAL ACTION VI GI HORMONES IN PHYSIOLOGY 1. Secretin 7. Pancreatic Polypeptide 2 .. Gastrin 8. Vasoactive Intestinal Polypeptide 3. Cholecystokinin-Pancreozymin 9. Somatostatin 4. Gastric Inhibitory Polypeptide 1o. Substance P 5. Motilin 11. Bombesin 6. Glucagon, Enteroglucagon 12. Other Peptides VII GI HORMONES IN DISEASE A. GI Hormone-Secreting Tumors: Gastrinoma (Zollinger-Ellison Syndrome), and other causes of Hypergastrinemia; MEA Syndromes; VIP-oma (Watery­ Diarrhea, WDHH or Werner-Morrison Syndrome); Glucagonoma; Somatostatinoma; Pancreatic Polypeptide in Tumors; Substance P (Carcinoid). B. GI Hormones in Other Pathologic States. C. Diagnostic & Therapeutic Uses. VIII CONCLUSION 3 GLOSSARY ACTH - Corticotropin (adrenocorticotropic hormone) AMP - Adenosine monophosphate APUD - Amine precursor uptake and decarboxylation CCK, CCK- PZ - Cholecystokinin-pancreozymin EC - Enterochromaffin EG - Enteroglucagon GI - Gastrointestinal GIP - Gastric-inhibitory polypeptide LES - Lower esophageal sphincter MEA - Multiple endocrine adenomatosis MSH - Melanocyte-stimulating hormone (melanotropin) PP - Pancreatic polypeptide PZ - Pancreozymin RIA - Radioimmunoassay SP - Substance P STM - Standard test meal VIP - Vasoactive intestinal polypeptide WDHH (or WDHA) - Watery
    [Show full text]
  • Pancreas and Fat/Lipid Digestion
    Exocrine Pancreas Physiology Pancreatic Anatomy Pancreatic secretion Pancreatic enzymes Daniel S. Kamin MD Boston Children’s Hospital [email protected] Content Reviewers: Sohail Z. Husain, MD Veronique Morinville MD, FRCP(C) NASPGHAN Physiology Education Series Series Editors: Christine Waasdorp Hurtado, MD, MSCS, FAAP [email protected] Daniel Kamin, MD [email protected] Learning Objectives • Understand the normal development and anatomy of the pancreas • Understand the stimuli and cellular factors giving rise to pancreatic secretion • Know the mechanisms by which pancreatic enzymes are activated and remain functional • Be aware of age-related deficiency in exocrine pancreatic function Night blindness • A young man with morbid obesity undergoes roux-en-y gastric bypass. • 1 year later he notices that in the evening he falls down his stairs. • Vitamin A deficiency is diagnosed. Understanding the physiology of pancreatic and bile secretion, Used with permission intraluminal lipolysis, and micellar function explains why this happens! http://www.citelighter.com/science/surgery/knowledgecards/gastric-bypass Pancreas Physiology Overview • Bulk of bicarbonate secretion (more than what secreted in bile and from duodenum) • Enzymes for intra- luminal digestion • Secretin and CCK regulate • Maturational pancreatic insufficiency Used with permission Image from http://www.aboutcancer.com/pancreas1.htm Pancreatic Development • See Embryology and Anatomy of the Gastrointestinal Tract Pancreatic Microanatomy Pancreatic Acinar Secretory Products A • Proteases • Trypsinogen* • Chymotrypsinogen* A • Proelastase* • Procarboxypeptidase* • Procarboxypeptidase B* • Amylolytic enzyme • Amylase A • Lipases • Lipase • B Nonspecific esterase • Prophospholipase A2* • Nucleases • Deoxyribonuclease • Ribonuclease • Others • Pro-colipase* • Trypsin inhibitors A. Exocrine pancreas-- ascinar cells filled • Monitor peptid with secretory granules, cuboidal duct Stored and secreted in inactive form cells secrete bicarbonate-rich fluid B.
    [Show full text]
  • Secretin: Structure of the Precursor and Tissue Distribution of the Mrna (Intestine/Preprohormone/Cdna/Polymerase Chain Reaction) ALAN S
    Proc. Nati. Acad. Sci. USA Vol. 87, pp. 2299-2303, March 1990 Biochemistry Secretin: Structure of the precursor and tissue distribution of the mRNA (intestine/preprohormone/cDNA/polymerase chain reaction) ALAN S. KoPIN*, MICHAEL B. WHEELER, AND ANDREW B. LEITER Division of Gastroenterology, Department of Medicine, New England Medical Center, Boston, MA 02111 Communicated by Donald F. Steiner, January 5, 1990 (receivedfor review, November 17, 1989) ABSTRACT Secretin is a 27-amino acid gastrointestinal denum, while the levels reported for hypothalamus, thala- hormone that stimulates the secretion of bicarbonate-rich mus, and olfactory lobe were comparable to those in small pancreatic fluid. The unusually high number ofserine, leucine, intestine (9). Others report that brain contains either small and arginine residues in secretin has precluded the use of amounts (10, 11) or no secretin-like immunoreactivity (12). oligonucleotides to screen cDNA libraries to isolate a secretin In the present study, we have isolated cDNAs encoding the cDNA. In the present study, a short cDNA encoding porcine rat and porcine secretin precursors.t The deduced amino acid secretin was amplified from duodenal mucosal first-strand sequence includes a signal peptide, an N-terminal peptide, cDNA template by using 16,384- and 4096-fold degenerate secretin, and a 72-amino acid C-terminal peptide. We have primers in the DNA polymerase chain reaction. From the used the secretin cDNA as a probe in Northern blot hybrid- sequence of the amplified cDNA, an unambiguous oligonucle- izations to address unresolved questions regarding the tissue otide probe was designed to screen a cDNA library. Here we localization of secretin biosynthesis in the rat CNS and report the sequences of cDNAs encoding the porcine and rat gastrointestinal tract.
    [Show full text]
  • Secretin Cells in Coeliac Disease
    Gut: first published as 10.1136/gut.14.11.870 on 1 November 1973. Downloaded from Gut, 1973, 14, 870-874 Secretin cells in coeliac disease JULIA M. POLAK, A. G. E. PEARSE, SUSAN VAN NOORDEN, S. R. BLOOM, AND MARY A. ROSSITER From the Department of Histochemistry, Royal Postgraduate Medical School, London, the Department of Clinical Research, Middlesex Hospital, London, and the Department of Gastroenterology, Queen Elizabeth Hospital, London SUMMARY Immunofluorescence (anti-secretin), cytochemical, and ultrastructural studies were carried out on jejunal biopsies from 16 children with coeliac disease and from 17 controls with suspected malabsorption but normal jejunal morphology. In 11 of the 16 coeliacs there was generalized hyperplasia of endocrine cells and, specifically, of the secretin (S) cells. Further studies, on adult coeliacs as well as on children, combined with serum secretin assays, may establish whether the S cells are abnormally storing hormone because of inability to release it or because of excess production. Present observations suggest that abnormal secretion children with coeliac disease only minimal changes in of certain gut hormones may be involved in the serum insulin were observed during a glucose toler- malfunction of the intestine in coeliac disease. ance test (Grant, 1973). In this disorder the secretory response of the The evidence summarized above points to the http://gut.bmj.com/ exocrine pancreas to a standard meal is reduced conclusion that the pancreas itself is capable of (Worming, Mullertz, Thaysen, and Bang, 1967), as normal function in coeliac disease but that normal it also is after perfusion of the intestine with amino stimulation by secretin and/or CCK/PZ is not acids (which stimulate cholecystokinin secretion).
    [Show full text]