Diversity of Yeasts Associated with Wood and the Gut of Wood-Feeding

Louisiana State University LSU Digital Commons

LSU Doctoral Dissertations Graduate School

2012 Diversity of yeasts associated with wood and the gut of wood-feeding insects Hector Raul Urbina Louisiana State University and Agricultural and Mechanical College, [email protected]

Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_dissertations

Recommended Citation Urbina, Hector Raul, "Diversity of yeasts associated with wood and the gut of wood-feeding insects" (2012). LSU Doctoral Dissertations. 1172. https://digitalcommons.lsu.edu/gradschool_dissertations/1172

This Dissertation is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Doctoral Dissertations by an authorized graduate school editor of LSU Digital Commons. For more information, please [email protected]. DIVERSITY OF YEASTS ASSOCIATED WITH WOOD AND THE GUT OF WOOD- FEEDING INSECTS

A Dissertation

Submitted to the Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College in partial fulfillment of the requirements for the degree of Doctor of Philosophy

The Department of Biological Sciences

by Hector Raul Urbina M.S. Universidad Simón Bolívar, 2005 December 2012

To my lovely family: my mother Lilia, my father Raúl and my brother Federico

ACKNOWLEDGMENTS

I would like to truthfully express my gratitude for the energy, experience, and inspiration of my major professor, Meredith Blackwell. I could not have a better professor to guide me across the years in my development as a researcher. I would also like to thank the professors that composed my advisory committee, Cathie Aime,

Prosanta Chakrabarty, James Cronin, Frederick Sheldon, and Ronald Thune for their helpful comments and support. In addition I thank Jeremy Brown for insightful discussions.

Many thanks go to Maritza Abril and Stephanie Gross for all of their help with the laboratory routine. At the same time, I would like to thank the undergraduate students

Callie Comstock, Elizabeth Cooper, Robert Donner, Robert Frank, Juan Herrera,

Matthew Knight, and Simone Mack, for their help during the development of my research.

Special thanks to my mates in the Department of Biological Sciences, Anthony

Chow, Sandra Galeano, and Metha Klock for several good moments. I also owe a debt of gratitude to Sung-Oui Suh, Nhu Nguyen, and Joseph McHugh and his students at the

University of Georgia, who did the early work on the passalid yeast system that served as the basis for my study.

I would like to recognize to the National Sciences Foundation (NSF), Mycological

Society of America (MSA), Louisiana Experimental Program to Stimulate Competitive

Research (LINK-EPSCoR), Boyd Professor fund, the LSU Graduate School, and

Biograds (the departmental graduate student organization), for funding my research. I

iii

would especially like to thank the Louisiana State University Department of Biological

Sciences for it support and use of facilities.

TABLE OF CONTENTS

ACKNOWLEDGMENTS ...... iii

ABSTRACT ...... vi

CHAPTER 1: GENERAL INTRODUCTION ...... 1

CHAPTER 2: MULTILOCUS PHYLOGENETIC STUDY OF THE SCHEFFERSOMYCES YEAST CLADE AND CHARACTERIZATION OF THE N- TERMINAL REGION OF THE XYLOSE REDUCTASE GENE ...... 4 2.1. Introduction ...... 4 2.2. Materials and methods ...... 6 2.3. Results ...... 11 2.4. Discussion ...... 23

CHAPTER 3: SCHEFFERSOMYCES CRYPTOPCERCUS: A NEW XYLOSE- FERMENTING YEAST ASSOCIATED WITH THE GUT OF WOOD ROACHES AND NEW COMBINATIONS IN THE SUGIYAMAELLA YEAST CLADE ...... 32 3.1. Introduction ...... 32 3.2. Materials and methods ...... 33 3.3. Results and discussion ...... 38

CHAPTER 4: DIVERSITY OF YEASTS ASSOCIATED WITH GUATEMALAN PASSALID BEETLES ...... 48 4.1. Introduction ...... 48 4.2. Materials and methods ...... 52 4.3. Results and discussion ...... 58 4.4. Conclusions ...... 75

CHAPTER 5: DIVERSITY OF YEASTS ASSOCIATED WITH THAI PASSALID BEETLES ...... 77 5.1. Introduction ...... 77 5.2. Materials and methods ...... 80 5.3. Results and discussion ...... 81

CHAPTER 6: PURIFYING SELECTION MAINTAINS XYLOSE REDUCTASE ACTIVITY AMONG ASCOMYCETE YEASTS ...... 89 6.1. Introduction ...... 89 6.2. Materials and methods ...... 92 6.3. Results and discussion ...... 95

CHAPTER 7. CONCLUSIONS ...... 102

REFERENCES ...... 106

VITA ...... 129

ABSTRACT

The gut of insects and plant tissues are productive sources for the isolation of undescribed species of yeasts. In particular, the gut of lignicolous insects is colonized by yeasts that can carry out the fermentation of several sugars. The consistent association between xylose-fermenting (X-F) yeasts and the gut of lignicolous insects has been used as evidence of a symbiotic relationship between them. In general passalid beetles (Passalidae) and wood-roaches (Cryptocercidae) feed on rotted wood where they spend most of their lives. Digestion of the substrate depends on the symbiotic microbiota, which include strict and facultative anaerobic microorganisms such as bacteria, parabasalids, and fungi. The objectives of this study were to describe the yeasts associated with hardwoods in Louisiana (Chapter 2), the gut of the wood roach Cryptocercus collected in the Appalachian Mountains (Chapter 3), passalids collected in Guatemala (Chapter 4) and in Thailand (Chapter 5), and to study selection acting on xylose reductase (XR) in yeasts (Chapter 6). This study confirmed the routine presence of ascomycete yeasts from the clades Scheffersomyces, Spathaspora,

Lodderomyces, and Sugiyamaella in the guts of wood roaches and passalid beetles, as well as basidiomycete yeasts in the genera Cryptococcus and Trichosporon in passalids exclusively. In this investigation, four new X-F yeasts, Scheffersomyces illinoinensis, Sc. quercinus, Sc. virginianus, and Sc. cryptocercus, were proposed based on multilocus phylogenetic analyses, molecular, and biochemical characterization. The X-F yeasts in the Scheffersomyces clade were the most abundant species in the gut of both wood- roaches and Guatemalan passalids, results that support and expand the previously described relationship between X-F yeasts and lignicolous insects. This finding,

however, was not observed in Thai passalids, where the most abundant yeasts were closely related to Candida insectamans (Spathaspora clade) that does not ferment xylose. In addition, this study determined that the gut of lignicolous insects is a niche rich in undescribed yeasts classified in several clades. The xylose reductase gene

(XYL1) has been shown to be useful as a molecular marker for rapid identification of cryptic yeast species, and the xylose reductase enzyme (XR) has been exposed to purifying selection in ascomycete yeasts.

vii

CHAPTER 1: GENERAL INTRODUCTION

The term “yeast” is used to describe a specific fungal growth form that is unicellular with multiplication by budding at some stage in the life cycle, although hyphal growth often may be present (Alexopoulos et al. 1996, Vega and Dowd 2005). All members of Saccharomycotina (Ascomycota), consisting of more than 1500 species in about 93 genera are considered to be yeasts (Barnett et al. 2000, Vega and Dowd 2005

Suh et al. 2006a, Hibbett et al. 2007). Yeast-like forms also occur in the other subphyla of ascomycetes (Taphrinomycotina and Pezizomycotina) and in all subphyla in

Basidiomycota (Agaricomycotina, Pucciniomycotina, and Ustilagomycotina) (Aime et al.

2006, Suh et al. 2006a, Hibbett et al. 2007).

Yeast diversity has increased since the advent of molecular characterization and the investigation of understudied habitats. Sources of many undescribed yeasts have included flowers, plant tissues, soil, and insects (Lachance et al. 2003, Lachance et al.

2010, de Vega et al. 2012). The insect gut has become increasingly recognized as an important source for the isolation of new ascomycete and basidiomycete yeast taxa

(Suh et al. 2001, 2004, 2006a,b, 2008, Suh and Blackwell 2004, 2005, 2006, Nguyen et al. 2006, 2007, Fuentefria et al. 2008, Suh and Zhou 2010, 2011, Gujjari et al. 2011,

Houseknecht et al. 2011). Of particular interest are yeasts from the gut of insects that feed on plant tissues, which are capable of carrying out the fermentation of 5-carbon sugars such as D-xylose and D-arabinose (Barbosa et al. 2009, Cadete et al. 2009,

2012, Santos et al. 2011, Calderon and Berkov 2012). Several studies on the characterization of gut-inhabiting microbes and feeding behavior of the lignicolous beetle Odontotaenius disjunctus have shown a consistent association between the

xylose-fermenting (X-F) yeast Scheffersomyces stipitis, as well several species of yeasts that can ferment or assimilate numerous wood components. In fact the ability of insects to digest wood is almost always due to the presence of gut microbes (Collings

1966, Suh et al. 2004, Nardi et al. 2006, Nguyen et al. 2006, Suh and Zhou 2011).

The interactions between many yeasts and insects are not well understood, but in some associations the fungus provides digestive enzymes and improves nutritional quality (e.g. essential amino acids, vitamins, and sterols) to the insect host (Vega and

Dowd 2005). Yeasts also may play an important role in the detoxification of plant metabolites in the diet of the hosts, and receive in exchange, dispersal, chemical signaling molecules, protection, and an environment rich in organic compounds (Vega and Dowd 2005). Such associations are believed to have promoted fungal diversity and the expansion of insects into nutrient-poor substrates (Suh et al. 2005).

New findings about the microbial communities inhabiting the gut of insects have been accumulating (Kurtzman et al. 2011). Among insects, the bacterial gut communities of termites, beetles, and wood roaches have been studied extensively, but for these taxa the fungal communities are less well known. Most studies of gut inhabitants of wood roaches (Cryptocercus spp.) were focused on enumeration of bacteria, especially endosymbiotic bacteria, and protists, without mention of fungi that may have been present (Sacchi et al. 1998, Clark and Kambhampati 2003, Kitade 2004,

Maekawa et al. 2005, Noda et al. 2006, Klass et al. 2008, Berlanga et al. 2009,

Carpenter et al. 2009, Ohkuma et al. 2009, Carpenter et al. 2010, 2011). Only one study is focused on the isolation of a yeast species from Cryptocercus punctulatus (Prillinger et al. 1996, Prillinger and König 2006). Gut-inhabiting bacterial and fungal communities

of O. disjunctus (Coleoptera, Passalidae) are well characterized (Houseknecht et al.

2011, Rivera et al. 2009, Suh and Blackwell 2005, 2006, Suh et al. 2003, 2004a, 2005a,

2006a,b, Cejo-Navarro et al. 2012), but the microbial gut communities from other passalid species are poorly understood.

The focus of this dissertation is the formal description of undescribed X-F yeasts based on the molecular, morphological, and biochemical characterization isolated from wood (Chapter 2) and the guts of wood-roaches (Chapter 3), and the study of the yeast diversity associated with wood-feeding passalids collected in Guatemala (Chapter 4) and Thailand (Chapter 5). In addition an investigation of selection acting on the xylose reductase (XR) gene draws on the large collection of yeasts from phylogenetically and biogeographically diverse passalid beetles (Chapter 6).

CHAPTER 2: MULTILOCUS PHYLOGENETIC STUDY OF THE SCHEFFERSOMYCES YEAST CLADE AND CHARACTERIZATION OF THE N- TERMINAL REGION OF THE XYLOSE REDUCTASE GENE1

2.1. Introduction

D-xylose is a five-carbon backbone molecule of the hemicellulose component of plant cell walls and is one of the most abundant renewable carbon resources on Earth.

Some bacteria and certain fungi, including fewer than twenty-five species of the more than 1000 described ascomycete yeasts, share the ability to produce ethanol by the fermentation of D-xylose (Kurtzman et al. 2011). In order to ferment D-xylose, yeasts express xylose reductase (XR), xylitol dehydrogenase (XDH), and xylulose kinase (XK) to convert D-xylose to D-xylulose-5-phosphate; D-xylulose-5-phosphate is then incorporated into the pentose phosphate pathway to be catalyzed to ethanol (Jeffries and Kurtzman 1994, Hahn-Hagerdal et al. 2007a,b,c).

Xylose fermentation is the focus of several studies in order to identify differences in the catabolic rate between strains (Jeffries and Shi 1999, Shi et al. 1999, Hamacher et al. 2002, Jin and Jeffries 2003, Jeffries et al. 2007, Karhumaa et al. 2007a,b,c, Hector et al. 2008, Kumar and Gummadi 2011, Hughes et al. 2012). Overexpression, homologous and heterologous expression, and direct mutagenesis of genes involved in

D-xylose assimilation and fermentation have only modestly enhanced the quantity of ethanol production by yeasts due to several metabolic constraints; these include rate of regeneration of the cofactor NADP(H) required by XR and XDH, repression by glucose, and anaerobic respiration regulatory control (Shi et al. 2002, Jeffries 2006, van Vleet et al. 2008). These studies resulted in the present understanding of the biochemical

1 Open access article published in PLoS ONE 7(6): e39128, doi:10.1371/journal.pone.0039128. 4

pathway, but the main goal of bioengineering yeasts capable of fermenting D-xylose at a rapid rate to be used at industrial scales has not yet been achieved. Consequently, recent studies focused on the discovery of new X-F yeasts, e.g. Spathaspora passalidarum and Candida jeffriesii (Spathaspora clade) (Nguyen et al. 2006), and

Spathaspora arborariae and other taxa (Cadete et al. 2009, 2012), from the gut of lignicolous beetles and rotted wood, niches from which a number of X-F yeasts have been isolated (Suh et al. 2003, Grunwald et al. 2010, Tanahashi et al. 2010).

Xylose-fermenting yeasts appear scattered throughout the Saccharomycotina, the yeasts that exhibit the highest rate of xylose fermentation under most conditions are members of the Scheffersomyces clade (Suh et al. 2003, 2006, Jeffries et al. 2007), and for this reason fermentative ability has been intensively studied in this group (Jeffries

1983, 1986, Toivola et al. 1984, Delgenes et al. 1986, Sreenath et al. 1986, Alexander et al. 1987, 1988, 1989, Prior et al. 1988, Delgenes et al. 1989, Laplace et al. 1992,

Jeffries and Kurtzman 1994, Dahn et al. 1996, Shi et al. 2002, Jin and Jeffries 2003,

Agbogbo et al. 2007, Jeffries et al. 2007, Ni et al. 2007). Few studies, however, have undertaken clarification of the phylogenetic relationships among the yeasts of the clade

(Kreger-van Rij 1970, Vaughan-Martini 1984, Kurtzman 1990, Passoth et al. 1992,

Kurtzman and Robnett 1998, Suh et al. 2004, Kurtzman and Suzuki 2010, Kurtzman et al. 2011). Therefore, a robust, well-supported phylogeny including as many taxa as possible is necessary to clarify the phylogenetic relationships among the

Scheffersomyces clade members and to compare nucleotide mutations and enzymatic activity of the XR to understand the importance of the biochemical ability in the speciation process of this yeast clade.

In order to distinguish species in the Scheffersomyces clade we used BLAST searches, biochemical and morphological characterization, and a multilocus phylogenetic analysis that included the traditional SSU and LSU rRNA genes (rDNA), the orthologous RPB1, and the recently proposed ITS rDNA barcoding region for fungi

(Schoch et al. 2012). We present a taxonomic revision of the Scheffersomyces clade and propose three new species of X-F yeasts, Scheffersomyces illinoinensis NRRL Y-

48827T (=CBS 12624), Scheffersomyces quercinus NRRL Y-48825T (=CBS 12625), and

Scheffersomyces virginianus NRRL Y-48822T (=CBS 12626) associated with rotted hardwoods, Carya illinoinensis (pecan), Quercus nigra (water oak), and Quercus virginiana (live oak). We performed a molecular study of the XYL1 gene that codifies XR in certain members of the Scheffersomyces clade.

2.2. Materials and methods

2.2.1. Yeast isolation and culture

Partially decayed logs and fallen branches of Carya illinoinensis (pecan, 30 cm diam), Quercus nigra (water oak, approximately 10 cm diam), and Quercus virginiana

(live oak, approximately 10 cm diam) were collected from Pecan Drive, Saint Gabriel,

Ascension Parish, Louisiana, and LSU Burden Center and the corner of Highland Road and S. Stadium Drive on the LSU campus, Baton Rouge, East Baton Rouge Parish,

Louisiana, United States, respectively, between Sep and Oct 2007. The wood samples were divided into approximately 1 cm2 samples, and each sample was placed in a 1.5 mL microcentrifuge tube with 1 mL of sterile water. Tubes were vortexed for 30 s and a

100 µL aliquot was plated on acidified yeast medium agar (Suh et al. 2004). Plates were

incubated for 3 d at 25 °C, and single colonies were isolated and streaked 4 times to obtain pure cultures.

2.2.2. Molecular identification

Genomic DNA was extracted using a Wizard® Genomic DNA purification kit

(Promega). The concentration, integrity, and purity of total DNA extracted were confirmed by gel electrophoresis in 0.8% agarose in 0.5 ✕ Tris-Borate-EDTA (TBE) buffer. Initial rapid identification was carried out by PCR amplification and sequencing of the LSU (D1/D2 region ~600 bp) rDNA for use in BLAST searches (Kurtzman and

Robnett 1998, Kurtzman et al. 2011). In order to increase the robustness of the phylogenetic analyses, PCR amplifications of the small subunit (SSU ~1.6 Kbp) and internal transcribed spacers 1 and 2 (ITS ~500 bp) of the rDNA marker were carried out in addition to the D1/D2 region (White et al. 1990, Hibbett 1996) and the SSU rDNA was amplified using the combination of primers NS1 (forward) (5’-

GTAGTCATATGCTTGTCTC-3’) and NS8 (reverse) (5’-TCCGCAGGTTCACCTACGGA-

3’); ITS1-LSU markers were amplified using the combination of primers, ITS1 (forward)

(5’-TCCGTAGGTGAACCTGCGG-3’) and LR3 (reverse) (5’-CCGTGTTTCAAGACGGG-

3’), in a PCR reaction with 20 µg of total DNA, 0.5 mM DTPs, 2.5 mM MgSO4, 0.8 µM of each primer set, 1 ✕ PCR buffer, and 1U of Taq polymerase (Promega) in 25 µL of final volume. The PCR amplification protocol included 5 min of DNA pre-denaturation at 95

°C followed by 35 cycles of 1 min of DNA denaturation at 95 °C, 45 s of primer annealing at 55 °C, and a 2 min extension at 72 °C, and 10 min final PCR extension.

In addition, another nuclear locus, RNA polymerase II subunit I (RPB1), was used in the phylogenetic analysis. A fragment of ~700 bp of the RPB1 gene was

amplified by the primer pair RPB1-Af (forward) 5’-GARTGYCCDGGDCAYTTYGG-3’ and RPB1-Cr (reverse) 5’-CCNGCDATNTCRTTRTCCATRTA-3’ (Sullivan et al. 1995,

Tanabe et al. 2004). The PCR reaction was performed using 100 µg of total DNA, 0.6 mM DTPs, 2.5 mM MgSO4, 1 µM of each primer, 1 ✕ PCR buffer, and 1.5 U of Taq polymerase (Promega) in 35 µL total final volume of reaction. The PCR amplification program included 5 min of DNA pre-denaturation at 95 °C followed by 35 cycles of 1 min of DNA denaturation at 95 °C, 45 s of primer annealing at 55 °C, and 2 min of extension at 72 °C, and 10 min final PCR extension. The purified PCR products were sequenced in both directions by Beckman Coulter Genomics (Danvers, MA). Each molecular marker was sequenced on three independent occasions in order to avoid nucleotide differences due to sequencing errors. GenBank accession numbers are indicated on the Table 2.1.

2.2.3. RAPD-PCR fingerprinting

RAPD–PCR analysis was performed with the oligonucleotide primer CDU (5′-

GCGATCCCCA-3′) (Sullivan et al. 1995, Fadda et al. 2004, Fuentefria et al. 2008,

Fadda et al. 2010). Aliquots of 25 µL of amplified product were analyzed by electrophoresis on 1.8% agarose gel in 1 ✕ TBE buffer with 1 ✕ SYBR® Safe DNA Gel

Stain (Invitrogen, Grand Island, NY) at 70 V for 80 min. DNA fragments were visualized with a UV-light transilluminator and photographed using a Polaroid system.

2.2.4. Morphological, biochemical and physiological characteristics

The yeast standard description based on phenotypic characters was executed following standardized protocols (Yarrow 1998, Barnett et al. 2000, Kurtzman et al.

2011).

Table 2.1: Accession number of the nucleotide sequences. In bold sequences generated in this study Species Codes 18S ITS LSU RPB1 XYL1

C. bolitotheriT NRRL Y-27587, CBS AY242142 AY242249 JN804828 - 9832, BG 00-8-15-1-1 C. terraborumT NRRL Y-27573, CBS AY426956 AY309810 JN804831 - 9826, BG 02-7-15-019A- 2-1 C. panamericanaT NRRL Y-27567, CBS AY426960 AY309872 JN804835 - 9834, BG 01-7-26-006B- 2-1 S. coipomoensisT NRRL Y-17651, ATCC HQ651931 HQ652070 HQ651966 EU344070 - 58904, CBS 8178 S. lignicolaT ATCC MYA-4674, CBS AY845351 HQ652074 AY845350 - - 10610, BCC 7733 S. ergatensisT NRRL Y-17652, ATCC AB013524 EU343826 U45746 EU344098 22589, CBS 6248 S. insectosumT NRRL Y-12854, ATCC AB013583 HQ652064 FM200041 JN804842 JQ235697 66611, CBS 4286 S. lignosumT NRRL Y-12856, ATCC HQ651941 JN943262 U45772 JN804837 58779, CBS 4705 S. segobiensisT NRRL Y-11571, ATCC AB054288 DQ409166 U45742 EF599429 58375, CBS 6857 L. elongisporusT NRRL YB-4239, ATCC HQ876033 HQ876042 HQ876050 AY653537 - 11503, CBS 2605 C. tropicalisT NRRL Y-12968, ATCC EU348785 AB437068 U45749 - - 4563, CBS 616 S. queiroziaeT NRRL Y-48722, UFMG- - HM566445 HM566445 - - CLM 5.1, CBS 11853 S. gosingicusT CBS-11433, BCRC HQ876040 HQ999978 HQ999955 - - 23194, SJ7S11 S. spartinaeT NRRL Y-7322, ATCC FJ153139 HQ876044 U45764 - - 18866, CBS 6059 S. stiptisT NRRL Y-7124, ATCC AB054280 JN943257 U45741 JN804841 JQ235696 58376, CBS 5773 S. amazonensisT NRRL Y-48762, CBS - JF826438 JF826438 - - 12363, UFMG HMD-26.3 S. shehataeT NRRL Y-12858, CBS AB013582 JN943264 AF178049 JQ235691 5813, ATCC 34887 S. quercinusT NRRL Y-XXXXX, CBS JN943260 JN703957 JN804838 JQ008829 XXXXX, W07-09-15-1-3- 2 S. virginianusT NRRL Y-XXXXX, CBS JN943259 JN703958 JN804839 JQ235695 XXXXX, W07-10-04-4-6- 2 S. illinoinensisT NRRL Y-XXXXX, CBS JN943261 JN703959 JN804840 JQ235694 XXXXX, W07-11-15-9-2- 1

2.2.5. Xylose reductase (XR) molecular studies

The ~600 bp fragment of the XYL1 was amplified using the following degenerate primers: XYL1-forward (5’-GGTYTTYGGMTGYTGGAARSTC-3’) and XYL1-reverse (5’-

AAWGATTGWGGWCCRAAWGAWGA-3’) designed in this study, in a PCR reaction

with 100 µg of total DNA, 0.4 mM DTPs, 4 mM MgSO4, 1 µM of each primer, 1 ✕ PCR buffer, and 1U of Taq polymerase (Promega) in a final volume of 25 µL. The PCR amplification program included 5 min of DNA pre-denaturation at 95 °C followed by 35 cycles of 1 min of denaturation at 95 °C, 1 min primer annealing at 57 °C, 1 min extension at 72 °C, and 10 min final PCR extension. The purified PCR products were sequenced as described above.

2.2.6. Phylogenetic analyses

Contig sequences and sequencing manipulations were performed with Se-AL v2.01a11 (http://tree.bio.ed.ac.uk/software/seal/) and MESQUITE v2.74 (Maddison and

Maddison 2005). The sequence alignments were carried out using the online interface

MAFFT v6.859 (http://mafft.cbrc.jp/alignment/software/) with different advanced alignment strategies per locus: LSU, RPB1, and XYL1 global homology (G-INS-i); ITS, one conserved domain (L-INS-i); and SSU, secondary structure of RNA (Q-INS-i). In particular ITS loci were realigned using the software SATé v2.1.2 (Liu et al. 2012), and ambiguous sequence alignment ends were eliminated in all the alignments. Maximum likelihood (ML) phylogenic inference was performed in RAxML-VI-HPC (Stamatakis

2006) using a partitioned multilocus matrix (each partition for SSU, ITS1, 5.8S, ITS2, and LSU rDNA, and RPB1) under a general time reversible model with a gamma distribution of site rate variation (GTRGAMMA), and ML support was estimated using

1000 bootstrap replicates. The sequences for RPB1 and XR were obtained using

SEQUIN v11.0 (http://www.ncbi.nlm.nih.gov/Sequin/) with the alternative yeast nuclear codon bias (Ohama et al. 1993, Wohlbach et al. 2011). Phylogenetic analysis using the amino acid matrix was performed in RAxML-VI-HPC under the VT AA selection model

(Muller and Vingron 2000), and ML support was estimated using 1000 bootstrap replicates. Tree editing was done with FigTree v1.3.1 software

(http://tree.bio.ed.ac.uk/software/figtree/).

2.3. Results

2.3.1. Diversity of yeasts isolated from rotted wood

The initial rapid molecular identification of the 29 yeast strains isolated from the wood samples using the D1/D2 LSU region, confirmed the presence of several closely related species classified in the Scheffersomyces (11 isolates), Sugiyamaella (10 isolates), Trichomonascus (5 isolates), Meyerozyma (2 isolates), and Candida tanzawaensis (1 isolate) clades (Fig. 2.1). Initial biochemical characterization of fermentation abilities performed on all the isolates showed that only strains classified in the Scheffersomyces clade had the ability to ferment xylose. In addition, we obtained different banding patterns using CDU RAPD-PCR fingerprinting primers (Fig. 2.3).

These fingerprinting primers have been used previously to discriminate among cryptic yeast species (Milan et al. 2001, Fadda et al. 2004, 2010).

2.3.2. New xylose-fermenting yeasts

Species delimitation of Sc. illinoinensis, Sc. quercinus, and Sc. virginianus was based on phylogenetic placement, nucleotide differences in the rDNA markers (SSU,

ITS and LSU), RPB1, and XYL1, and biochemical assay differences compared with their closest relatives (Table 2.2, 2.3, 2.4; Fig. 2.2).

Figure 2.1. Maximum likelihood tree based of the D1/D2 LSU region using a 606- character matrix for yeast species isolated from the wood samples (in bold). Schizosaccharomyces pombe was used as an outgroup taxon (in grey). X-F, xylose- fermenting yeasts. Numbers above each branch refer to bootstrap values of 1000 repetitions. Final ML score -11353.90.

Figure 2.2. Maximum likelihood tree based on a multilocus dataset (SSU, ITS, LSU, and RPB1 loci) using a 3488-character matrix for the Scheffersomyces clade. Candida tropicalis (in grey) was used as an outgroup taxon. C-F and X- F, cellobiose- and xylose-fermenting yeasts respectively. Numbers above each branch refer to bootstrap values out of 1000 repetitions. Final ML score - 13300.52.

Species description of Scheffersomyces quercinus Urbina & M. Blackw. sp. nov.

Fig. 2.4, a-b

MycoBank accession number: MB 563719.

After 7 d growth in YM broth at 25 °C, cells are subglobose (5–8 ✕ 5–7.5 µm), and

occur singly, in pairs, or in chains. Pseudohyphae are present; true hyphae are absent.

After 7 days on YM agar at 25 °C, colonies are cream-colored with pale-pinkish

perimeter on some older colonies, smooth, flat, and/or with scattered filaments at the

margin. After 10 d of Dalmau plate culture on corn meal agar at 25 °C, true hyphae are

present. Aerobic growth is white, shiny, and smooth with filamentous margin. Asci and

ascospores are not observed on YM or V8 agar. Diazonium blue B reaction is negative.

See Table 2.4 for physiological characterization.

Type strain. NRRL Y-48825T (=CBS 12625; W07-09-15-1-3-2) is preserved as a

lyophilized preparation in the Agricultural Research Service Culture Collection (NRRL),

Peoria, Illinois, United States. The strain was isolated from rotted wood (Quercus niger),

collected on 15 Nov 2007 at Louisiana State University, Burden Research Plantation,

Baton Rouge, East Baton Rouge Parish, Louisiana, United States, N30°40’59”-

W91°10’29”.

Etymology. The species name quercinus (N.L. gen. n.) refers to the genus of the

substrate, Quercus niger, from which this species was isolated.

Species description of Scheffersomyces virginianus Urbina & M. Blackw. sp. nov. Fig. 2.4, c-d MycoBank accession number: MB 563720.

After 7 d growth in YM broth at 25 °C, cells are globose to ellipsoidal (5.5–10 ✕ 4–6.5

µm), and occur singly, in pairs, in short chains, or in small clusters. Pseudohyphae are present; true hyphae are absent. After 7 d on YM agar at 25 °C, cream-colored to light pink with abundant filaments at margin. After 10 d Dalmau plate culture on corn meal agar at 25 °C, pseudohyphae are present; septate hyphae are absent. Aerobic growth is white, shiny, and smooth with filaments at margin. Asci and ascospores are not observed on YM or V8 agar. Diazonium blue B reaction is negative. See Table 2.4 for physiological characterization.

T T T T T T T

illinoinensisstipitisquercinus virginianusinsectosa 1 Kb Log Sc.molecular Sc. marker Sc. Sc. Sc. Sc. lignosusSc. shehatae

1 Kb

0.5 Kb Figure 2.3. Characterization of Sc. illinoinensis, Sc. quercinus, and Sc. virginianus using RAPD-PCR CDU fingerprinting primers.

Type strain. NRRL Y-48822T (=CBS 12626; W07-10-04-4-6-2) is preserved as a lyophilized preparation in the Agricultural Research Service Culture Collection (NRRL),

Peoria, Illinois, United States. The strain was isolated from rotted wood (Quercus

virginiana) collected on 15 Sep 2007, Highland Rd. and S. Stadium Dr, Louisiana State

University, Baton Rouge, East Baton Rouge Parish, Louisiana, United States,

N30°40’90”-W91°17’60”.

Etymology. The species name virginianus (N.L. gen. n.) refers to the species of the substrate, Quercus virginiana, from which this species was isolated.

Species description of Scheffersomyces illinoinensis Urbina & M. Blackw. sp. nov.

Fig. 2.4, e-f

MycoBank accession number: MB 563457.

After 7 d growth in YM broth at 25 °C, cells are globose (5−7.5 µm), and occur singly, in pairs, or in short chains. Pseudohyphae and hyphae are not present. After 7 d on YM agar at 25 °C, colonies are cream-colored, smooth, and flat with a smooth margin. After 10 d Dalmau plate culture on corn meal agar at 25 °C, pseudohyphae are present; septate hyphae are absent. Asci and ascospores are not observed on YM and

V8 agar. Diazonium blue B reaction is negative. See Table 2.4 for physiological characterization.

Type strain. NRRL Y-48827T (=CBS 12624; W07-11-15-9-2-1) is preserved as a lyophilized preparation in the Agricultural Research Service Culture Collection (NRRL),

Peoria, Illinois, United States. The strain was isolated from rotted wood (Carya illinoinensis) collected on 15 Nov 2007 at 810 Pecan Dr, St. Gabriel, Ascension Parish,

Louisiana, United States, N30°30’56”-W91°10’30”.

Etymology. The species name illinoinensis (N.L. gen. n.) refers to the species of the substrate, Carya illinoinensis, from which this species was isolated.

Table 2.2: Nucleotide differences and percentages of homology between the new xylose-fermenting yeasts and the type cultures of closest relatives, Sc. shehatae or Sc. stipitis. T = Type culture. Species SSU ITS D1/D2 LSU RPB1 XYL1 Sc. insectosaT 100% 98% (5n) 100% 94% (34n) 92% (44n) Sc. lignosusT 100% 98% (5n) 100% 94% (37n) 91% (46n) Sc. quercinusT 98% (27n) 99% (1n) 98% (7n) 98% (10n) 96% (11n) Sc. virginianusT 97% (54n) 99% (1n) 99% (4n) 98% (10n) 97% (8n) Sc. illinoinensisT 99% (3n) 99% (3n) 100% 95% (28n) 97% (15n)

Table 2.3. Differences in physiological reactions of Sc. illinoinensis, Sc. quercinus, and Sc. virginianus and their closest relatives*. T = Type culture. Species Rhammose Galactitol Lactate Cadaverine Glucosamine Tryptophan Melibiose Inulin

Sc. insectosaT - - - + - - - - Sc. lignosusT - + w + - - - - Sc. quercinusT - +,f + + + + - + Sc. shehataeT - - - + - - - - Sc. virginianusT w w - - + + + + Sc. stipitisT + - +/- + - - - - Sc. illinoinensisT + +/d +/d w + + w w

* Biochemical assay results of previously described species were complied from Kurtzman (1990) and Barnett et al. (2000). Abbreviations for reaction results: +, positive; -, negative; d, delayed positive; w, weak positive.

2.3.3. Multilocus phylogenetic study

The phylogenetic placement of Sc. illinoinensis, Sc. quercinus, and Sc. virginianus was based on ML analysis results of a concatenated nucleotide dataset containing 3488 characters (Fig. 2.2). The Scheffersomyces clade was divided into three subclades: 1) the early diverging Sc. spartinae and Sc. gosingicus subclade, 2) the cellobiose- fermenting Sc. ergatensis subclade, and 3) the largest, xylose-fermenting Sc. stipitis subclade to which the three new species belong.

Figure 2.4. Morphological characterization of Sc. quercinus, budding cells (a- b); Sc. virginianus, budding cells (c-d); and Sc. illinoinensis, budding cells (e-f); grown at 25 °C in YM broth and V8 agar at 7 d respectively, bar 10 µm.

Addition of more taxa and more molecular data in phylogenetic analyses has helped to define monophyletic clades among a number of genera now recognized as polyphyletic. One problematic taxon, Pichia, was based primarily on ascospore shape.

Hat-shaped ascospores, however, are found among several distant clades of yeasts as well as distantly related members of the Pezizomycotina. Scheffersomyces was

proposed recently for species in the Pichia stipitis clade (Kurtzman and Suzuki 2010).

The genus included the type species, Sc. stipitis, and Sc. ergatensis and Sc. spartinae

(Kurtzman and Suzuki 2010). We propose additional new combinations in the genus

Scheffersomyces by including clade members that previously were described as asexual species of the polyphyletic genus Candida (Knapp et al. 2011).

1. Scheffersomyces coipomoensis (C. Ramírez & A. González) Urbina & M. Blackw.

comb. nov.

MycoBank accession number: MB563714.

Basionym: Candida coipomoensis C. Ramírez & A. González, Mycopathologia

88:84, 1984.

2. Scheffersomyces insectosa (Kurtzman) Urbina & M. Blackw. comb. nov.

MycoBank accession number: MB 564799.

Basionym: Candida shehatae var. insectosa Kurtzman, Antonie van Leeuwenhoek

57:218, 1990. Synonym: Candida insectosa (Kurtzman) Kurtzman, in Kurtzman &

M. Suzuki, Mycoscience 51:10, 2010.

3. Scheffersomyces lignicola (Jindam, Limtong, Yongman, Tuntir, Potach, H. Kawas

& Nakase) Urbina & M. Blackw. comb. nov.

MycoBank accession number: MB 563803.

Basionym: Candida lignicola Jindam, Limtong, Yongman, Tuntir, Potach, H. Kawas

& Nakase, FEMS Yeast Res 7:1412, 2007.

4. Scheffersomyces lignosus (Kurtzman) Urbina & M. Blackw. comb. nov.

MycoBank accession number: MB 563801.

Basionym: Candida shehatae var. lignosa Kurtzman, Antonie van Leeuwenhoek

57:218, 1990. Synonym: Candida lignosa (Kurtzman) Kurtzman, in Kurtzman & M.

Suzuki, Mycoscience 51:10, 2010.

5. Scheffersomyces queiroziae (R.O. Santos, R.M. Cadete, Badotti, A. Mouro,

Wallheim, F.C.O. Gomes, Stambuk, Lachance & C.A. Rosa) Urbina & M. Blackw.

comb. nov.

MycoBank accession number: MB 563717.

Basionym: Candida queiroziae R.O. Santos, R.M. Cadete, Badotti, A. Mouro,

Wallheim, F.C.O. Gomes, Stambuk, Lachance & C.A. Rosa, Antonie van

Leeuwenhoek 99:639. 2011.

6. Scheffersomyces shehatae (H.R. Buckley & van Uden) Urbina & M. Blackw. comb.

nov.

MycoBank accession number: MB 563716.

Basionym: Candida shehatae H.R. Buckley & van Uden, Mycopathologia Mycol.

appl. 34:297, 1966.

2.3.4. Xylose reductase among X-F yeast members of the Sc. stipitis subclade

We amplified a ~600 bp PCR product of XYL1 from X-F and non X-F yeasts tested

(Fig. 2.5). The translated protein sequences at the N-terminal region have the conserved amino acids 49-D, 51-A, and 54-Y, described as part of the catalytic

GX3DXAX2Y domain; the LX8DX4H and the GX3GXG domains, and the amino acids 83-

K, 132-P, and 167-K that form the xylose-binding pocket previously reported (Chu and

Lee 2006) (Fig. 2.6). Conserved amino acid substitutions at positions 64, 170, 194 (I =

V); 65 (N = K); 69 (K = D); 70 (D = E); 80, 178 (I = L); 107 (L = V); 127 (N = E); 149 (L =

I), 150 (A = L), 174 (T = P), 179 (Y = L), 184 (S = G), 186 (E = T), 188 (P = K), and 204

(S = P) and the percentage of conserved substitutions usually were higher than 50% at all sites compared with the non X-F fermenting yeast Sc. ergatensis (Fig. 2.6, 2.7).

Table 2.4. Biochemical characterization of Sc. quercinus, Sc. illinoinensis, and Sc. virginianus. Abbreviations for reaction results: +, positive; -, negative; d, delayed positive; w, weak positive. T= Type culture. T T T Sc. quercinus Sc. illinoinensis Sc. virginianus Fermentation F1 D-Glucose + + +, f F2 D-Galactose + + + F3 Maltose w + + F4 α-Methyl-D-glucoside - - - F5 Sucrose - - - F6 α,α- Trehalose + + + F7 Melibose - w - F8 Lactose - - - F9 Cellobiose - - - F10 Melezitose - - - F11 Raffinose - - - F12 Inulin - - - F13 Starch - - - F14 D-Xylose + + + Assimilation C1 D-Glucose +, f +, f + C2 D-Galactose +, f +, f +, f C3 L-Sorbose +,d - W C4 D-Glucosamine w - + C5 D-Ribose +,d +,d +, d C6 D-Xylose + + + C7 L-Arabinose +,d + + C8 D-Arabinose w + W C9 L-Rhamnose - + W C10 Sucrose + + + C11 Maltose + +, f + C12 Trehalose + +, f + C13 α-Methyl-D-glucoside + + + C14 Cellobiose + + + C15 Salicin + + + C16 Arbutin + + + C17 Melibiose - + + C18 Lactose - - + C19 Raffinose - - W C20 Melezitose - + +, d C21 Inulin w w + C22 Soluble Starch + + + C23 Glycerol + + + C24 Erythritol + + + C25 Ribitol + + + C26 Xylitol +, d + W C27 L-Arabinitol +, d +,d - C28 D-Glucitol + + + C29 D-Mannitol + + + C30 Galactitiol +, f +, f W C31 myo-Inositol - - W C32 D-Glucono-1,5-lactone + + + C33 2-Keto-D-gluconate + +,f +, f C34 5-Keto-D-gluconate ? ? ? C35 D-Gluconate + +,d + C36 D-Glucuronate - - - C38 DL-Lactate + +,d -

(Table 2.4 continued) T T T Sc. quercinus Sc. illinoinensis Sc. virginianus

C39 Succinate + + + C40 Citrate +, d + + C41 Methanol - - - C42 Ethanol +, f +,f +, f C43 Propane 1,2 diol +, d w W C44 Butane 2,3 diol w - W C45 Quinic acid - - W C46 D-Glucarate - - - Temperature T1 30 °C + + + T2 35 °C +, f +,f + T3 37 °C - +,d - Osmotic pressure O1 0.01% Cycloheximide +, f +, f +, f O2 0.1% Cycloheximide +, f +, f +,f O3 1% Acetic Acid - - - O4 50% D-Glucose + + + O5 60% D-Glucose w + W O6 10% NaCl + + W O7 16% NaCl - - - Nitrogen assimilation N1 Nitrate - +, d + N2 Nitrite - +, d - N3 Ethylamine + + + N4 L-Lysine +, d - + N5 Cadaverine + w - N6 Creatine - - - N7 Creatinine - - - N8 D-Glucosamine + + + N9 Imidazole - - - N10 D-Tryptophan + + + Vitamins V1 w/o Vitamins - - - V2 w/o myo-Inositiol +, d w + V3 w/o Pantothenate + + + V4 w/o Biotin + - - V5 w/o Thiamin + + + V6 w/o Biotin and Thiamin - - W V7 w/o Pyridoxine + + + V8 w/o Pyrid. andThiam + + + V9 w/o Niacin + + + V10 w/o PABA + + +

Y-48822 (T) Y-17526 (T) Y-48827 (T) Y-27907 NN205(T) NN205 10-4 Y-48825 (T) Y-2460 8-2 SG37 Gilbson Y-981 H.T. WashH.T. 06-11-01 gut 06-8-01 6p72 BG02661-10 illinoiensis HU37 Y-27066 stipitis Gilbson naardinensis quercinus BG-02-7-13-014-3-1 NN74 NN73 BG-01-7-23-018C-2-1 passalidarum guilliermondii BG-01-7-21-006A-1-1 tannophilus tenuis tenuis intermedia jeffriesii tropicalis picachoensispimensisoregonensisoregonensisbolitotheritaliae maxii xestobiixylopsoci

PCR control 1Kb ladderCandida CandidaCandida Brettanomyces PachysolenCandidaSpathaspora Scheffersomyces MeyerozymaScheffersomyces shehataeScheffersomyces Scheffesomyces virginianusSheffersomyces CandidaCandida Candida CandidaCandida CandidaCandida Candida CandidaCandida

500 kb-

Figure 2.5. PCR amplification of the XYL1 gene (black arrow) among X-F (in bold) and non-X-F yeasts. (T) = Type cultures.

Sc. ergatensisT Sc. quercinusT Sc. virginianusT Sc. shehataeT Sc. lignosusT Sc. insectosaT Sc. stipitisT Sc. segobiensisT Sc. illinoinensisT Consensus

Sc. ergatensisT Sc. quercinusT Sc. virginianusT Sc. shehataeT Sc. lignosusT Sc. insectosaT Sc. stipitisT Sc. segobiensisT Sc. illinoinensisT Consensus Figure 2.6. Multiple sequence alignment of the N-terminal region of XR. Identical residues are indicated by dots. Arrows indicate amino acids that constitute the active sites, stars indicate amino acids that form the xylose-binding pocket, and brackets indicate conserved domains. T = Type cultures.

2.4. Discussion

2.4.1. Yeasts sampled from rotted wood

Most of the isolates from live oak and water oak were members of the

Sugiyamaella clade: Candida boreocaroliniensis, Candida lignohabitans, and Su. smithiae. The cosmopolitan genus Sugiyamaella is comprised of yeasts reported primarily from wood and frass of lignicolous beetles (Zhang et al. 2003, Kurtzman and

Robnett 2007, Houseknecht et al. 2011). It is of interest that, unlike other yeasts from

these habitats, they are unable to ferment D-xylose. We also isolated other non X-F species Candida athensensis, Trichomonascus petasosporus, and a close relative of

Candida anneliseae, ascomycete yeasts that previously were found associated with fungus-feeding beetles collected in Panama and the United States (Suh et al. 2003,

2004, Zhang et al. 2003).

Figure 2.7. Maximum likelihood consensus tree based on XYL1 and the putative XR from X-F members in the Sc. stipitis subclade. Scheffersomyces ergatensis was used as an outgroup taxon (in grey). Numbers above each branch refer to bootstrap values out of 1000 repetitions. Final ML scores -1829.90 (DNA data) and -1284.79 (amino acid data). T= Type culture.

The yeast strains isolated from pecan wood, on the contrary, were dominated by the new X-F yeast species, Sc. illinoinensis, a close relative of Sc. stipitis. Only this wood was inhabited by O. disjunctus (Passalidae, Coleoptera) in our study. (Suh et al.

2003) recognized the relationship between Sc. stipitis and the lignicolous beetle

commonly found inhabiting decayed hardwoods in the southeastern United States, so the phylogenetic placement of these closely related species is consistent with the previous findings.

Other members of the Scheffersomyces clade (Sc. ergatensis, Sc. shehatae, and

Sc. stipitis) have been reported frequently from associations with the gut of lignicolous beetles, including not only the passalid beetle O. disjunctus but also beetles in the families Cerambycidae, Lucanidae, Buprestidiae, and Tenebrionidae (Gaster 2006,

Grunwald et al. 2010). It is likely that the common gut yeasts are efficient at digesting components of the host diet, resisting toxic secondary metabolites, and adapting to the gut physiological environment (low oxygen and high carbon dioxide concentrations and extreme pH variation), characteristics that give them a greater chance to be horizontally transmitted to progeny. Consequently, in each host generation the symbiotic yeasts may be exposed to bottlenecks and positive selection driven by the host beetles, and these selective pressures increase when changes in the host diet occur. These evolutionary processes could favor rapid speciation with morphological and other traditional characters lagging behind molecular changes in the Scheffersomyces yeast members. Evidence that supports our hypothesis is: 1) Sc. shehatae, Sc. lignicola, and

Sc. insectosa, often found in association with insects, are indistinguishable by morphology and some molecular markers (e.g. SSU and D1/D2 LSU); 2) branch lengths are constrained in the phylogenetic tree (Fig. 2.2); and 3) gut morphology is modified to enhance the horizontal transmission of gut yeasts across generations, e.g. the posterior hindgut region of O. disjunctus is colonized mainly by filamentous yeasts attached by a holdfast (Lichtwardt 1957, Lichtwardt et al. 1999, Nardi et al. 2006); in addition

mycetomes occur in lignicolous cerambycid beetles colonized exclusively by the closely related species Sc. shehatae (Grunwald et al. 2010).

Kurtzman (1990) recognized Candida shehatae var. shehatae, var. insectosa, and var. lignicola based on biochemical assays, a single nucleotide difference in the

D1/D2 LSU region, and identical SSU rDNA among the varieties. He suggested that in order to understand the phylogenetic relationship between varieties of Ca. shehatae, analyses including ITS rDNA should be included. More recently, these varieties were raised to species level based on their distinctive electrokariotype profiles and the reinterpretation of the D1/D2 LSU locus (Kurtzman and Suzuki 2010). Yeast species often have been underestimated on the basis of only D1/D2 LSU and SSU rDNA data

(Rokas et al. 2003, Cadez et al. 2006, Liti et al. 2006). Therefore, the addition of more molecular markers in phylogenetic analyses has been used to increase the power of species recognition (see next section).

2.4.2. Phylogenetic study of the Scheffersomyces clade

Lachance et al. (2010) proposed a method for species delimitation in yeasts based on parsimony networks. In our experience, the results obtained by using this method are difficult to interpret for several reasons: 1) the species are plotted as isolated entities with little information on phylogenetic relationship among members; 2) the method does not allow inclusion of a model of nucleotide selection for the analysis; and 3) node support values are lacking.

Because of these disadvantages, we instead implemented a multilocus phylogenetic analysis based on ML, commonly applied to fungi. We incorporated additional loci (ITS and RPB1) in order to increase the robustness of the phylogenetic

analysis in the study of the Scheffersomyces members. We followed the recommendations of the Assembling the Fungal Tree of Life (AFTOL http://aftol.org/) research group in searching for orthologous genes in fungal genomes (Robbertse et al.

2006). In addition results obtained by Schoch et al. (2009) showed that RPB1, RNA polymerase II subunit 2 (RPB2), and elongation factor 1 alpha (TEF1) are more phylogenetically informative compared to rDNA in Ascomycota. More recently, Schoch et al. (2012) proposed the use of ITS as a barcode gene for fungi, although RPB1 had higher species discriminatory power than ITS in Saccharomycotina. Schoch et al.

(2012) also pointed out that datasets containing combinations of at least three molecular markers (SSU, LSU, ITS, or RPB1) showed the highest probability of correct identification for all Fungi.

As mentioned in the results section, the Scheffersomyces clade, including all known taxa reported in the literature, is comprised of three subclades: 1) an early diverged subclade of Sc. spartinae, the only member that lacks the ability to ferment both xylose and cellobiose, and Sc. gosingicus, a cellobiose-fermenting (C-F) yeast isolated from soil in southeastern Asia (Chang et al. 2011); 2) a C-F subclade that includes Sc. amazonensis (Cadete et al. 2012). Sc. coipomoensis, Sc. ergatensis, Sc. lignicola, and Sc. queiroziae; and 3) the X-F subclade containing Sc. lignosus, Sc. illinoinensis, Sc. insectosa, Sc. quercinus, Sc. segobiensis, Sc. stipitis, Sc. shehatae, and Sc. virginianus (Fig. 2.2).

The phylogenetic outcome also suggests that the common ancestor of the

Scheffersomyces clade may show the ability to ferment D-xylose and cellobiose. This hypothesis is supported by the phylogenetic analyses based on a multilocus dataset

that places Sc. gosingicus, a C-F species, in the earliest derived subclade, and the results of the phylogenetic study showing XR presence in all Scheffersomyces clade members studied (Fig. 2.5). Moreover, the same tree topology of the multilocus analysis was recovered by using either XYL1 or XR, suggesting that X-F ability might have played a fundamental role in the speciation process of the X-F subclade (Figs. 2.2, 2.5).

We did not include the single copy gene XYL1 in the multilocus phylogenetic analysis because the orthology of this locus has not been confirmed across several yeast taxa.

The ability to ferment both wood components (cellobiose and D-xylose) is exhibited by only a few yeasts: Ogataea polymorpha (Ryabova et al. 2003), Brettanomyces naardenensis (Kurtzman et al. 2011), and Spathaspora passalidarum (Nguyen et al.

2006), and in these species fermentative abilities are weak or delayed. On the contrary,

Scheffersomyces clade members exhibit only one or the other fermentative ability. The loss of fermentation capability could be a consequence of becoming more efficient in carrying out the fermentation of fewer sugars. In particular, the fermentation of cellobiose has an antagonistic effect against the fermentation of D-xylose, because during the extracellular fermentation of cellobiose, units of glucose are released by β- glucosidase, a sugar that has higher affinity for the pentose membrane transporter rather than D-xylose. Consequently, glucose is first incorporated into the cells to be fermented (Ryabova et al. 2003).

2.4.5. XR in the Scheffersomyces clade members

The metabolic constraint in the regeneration of the cofactor NAD+ to NADH+ has been described as a major constraint in the fermentation of D-xylose, therefore most studies have focused on the molecular characterization of the conserved domains

involved in the uptake of this cofactor that is present in the C-terminal region of the XR, but few studies have been done on the characterization of the N-terminal region.

In the study of the N-terminal region of the XR of the X-F members of the Sc. stipitis subclade we were able to identify all of the conserved domains and amino acids in both X-F and non X-F yeasts. These findings indicated that the ability to ferment xylose does not rely solely on the presence of these conserved regions. We also found several biased nucleotide mutations that maintain the same polarity as the codified amino acid, and only the mutations on the residues 174, 179, 184, 188, and 204 showed a change in amino acid polarity. These mutations were found mainly surrounding conserved domains in comparison with the amino acid sequence of the non

X-F yeast Sc. ergatensis (Fig. 2.7). The mutations could generate structural modifications that allow the fermentation of xylose in the Scheffersomyces clade members, results that could be supported by performing direct mutagenesis studies on the amino acids to characterize their individual roles in the performance of XR.

Although the X-F yeasts were dispersed throughout the Saccharomycotina, as we mentioned in the introduction, the Debaryomycetaceae includes the largest number of X-F yeasts, such as species of Scheffersomyces and Spathaspora found in association with lignicolous insects (Suh et al. 2003, Suh et al. 2006a,b). This phylogenetic placement of the X-F yeasts supports two alternatives: the X-F ability was the result of convergent evolution in ascomycete yeasts, or the X-F ability was present in the earliest common ancestor in the Saccharomycotina and has been retained mainly in the yeasts associated with lignicolous habitats. Several independent lines of evidence favor the second premise: 1) classical biochemical studies have determined that the

ability to assimilate D-xylose and xylitol is common in many yeasts; 2) several relatively early diverging yeasts, B. naardenensis, O. polymorpha, and P. tannophilus, ferment xylose (Ryabova et al. 2003, Kurtzman et al. 2011); 3) many studies characterizing yeast diversity indicate that most X-F yeasts are associated with wood and the gut of lignicolous insects (Suh et al. 2003); and 4) more recently, a report of the genome sequences of a diverse group of X-F and non X-F yeasts confirmed the presence of xylose genes in all of them (Wohlbach et al. 2011).

Yeasts as a group, are known for their biochemical versatility in utilizing a wide variety of carbon sources. Individual strains, however, may be characterized by specific physiological profiles depending on their life style and environment. Wood substrates and the gut of lignicolous insects previously were unexplored environments for the isolation of X-F yeasts.

The findings of this study further support the hypothesis that X-F yeasts and yeasts in the Sugiyamaella clade are common inhabitants of the wood substrates. The

Scheffersomyces clade is comprised mainly of cellobiose- and D-xylose-fermenting yeasts isolated from distant geographical regions and associated with wood and insects that feed on plant tissues. The amino acid modifications present in the putative XR of X-

F yeasts in the Sc. stipitis subclade, could be responsible for the enhanced rate of fermentation shown by the members of this clade.

The addition of ITS and RPB1 loci in the phylogenetic studies on the

Scheffersomyces clade dramatically increased the support of the phylogenetic relationships of the members. We used the primers for XYL1 designed for this study across several yeast species, and they could be used to help understand how these

genes have evolved in the members of Saccharomycotina. The phylogenetic reconstruction using only XYL1 or RPB1 was similar to the multilocus analysis, and these loci have potential for rapid identification of cryptic species in this clade.

CHAPTER 3: SCHEFFERSOMYCES CRYPTOPCERCUS: A NEW XYLOSE- FERMENTING YEAST ASSOCIATED WITH THE GUT OF WOOD ROACHES AND NEW COMBINATIONS IN THE SUGIYAMAELLA YEAST CLADE2

3.1. Introduction

In the last decade new information has been gained about the microbial communities inhabiting the gut of insects (Kurtzman et al. 2011). Among arthropods, the bacterial gut communities of termites, beetles, and wood roaches have been studied extensively, but the fungal community is less well known. Of the studies of gut inhabitants of wood roaches in Cryptocercus (Blattodea), all have focused on the description of bacteria, especially endosymbiontic bacteria, and protists, with little mention of fungi that were present (Sacchi et al. 1998, Clark and Kambhampati 2003,

Kitade 2004, Maekawa et al. 2005, Noda et al. 2006, Klass et al. 2008, Berlanga et al.

2009, Carpenter et al. 2009, 2010, 2011). Only the ascomycete yeasts Candida blattae

(Metschnikovia clade) and Tetrapisispora blattae (formely Kluveromyces) were isolated from the gut of cockroaches (Henninger and Windisch 1976, Kurtzman 2003, Nguyen et al. 2007, Kurtzman et al. 2011). Recently, investigations of the gut of wood-feeding beetles (Passalidae) led to the discovery of several distinct clades of ascomycete yeasts that are consistently associated with the beetles, perhaps as adaptations of the host feeding behavior and habitat (Suh et al. 2004c, 2005a, Nguyen et al. 2006, Berkov et al. 2008, Rivera et al. 2009, Grunwald et al. 2010, Hughes et al. 2011, Calderon and

Berkov 2012). In particular yeast members of the Sugiyamaella, Scheffersomyces, and

Spathaspora clades were found in association with wood-feeding beetles in the family

Passalidae (Zhang et al. 2003, Suh et al. 2004, Nguyen et al. 2006, Houseknecht et al.

2 Article in press in the journal Mycologia. This work was conducted with the collaboration of Robert Frank, who is the second author in the article. 32

2011), as well as other wood-feeding insects and woody plants (Berkov et al. 2007,

Grunwald et al. 2010, Hughes et al. 2011). Members of the Scheffersomyces and

Spathaspora clades have attracted attention because they possess the rare ability to ferment D-xylose, which gives them an economic potential in the production of bioethanol from plant waste residues (Agbogbo and Wenger 2006, 2007, Agbogbo et al.

2007, 2008). Members of these clades occupy a habitat rich in xylose, subunits of the plant cell wall carbohydrate hemicellulose.

The primary aim of this study was to investigate the possibility that yeasts are present in the gut of the wood roach Cryptocercus sp., which is often found inhabiting rotting wood in certain regions of North America. We isolated 18 yeast strains identified as Sugiyamaella palludigena, Sugiyamaella lignohabitans, and an undescribed X-F yeast, Scheffersomyces cryptocercus NRRL Y-48824T (= CBS 12658). The species described was based on a multilocus phylogenetic analysis, physiological and morphological characterization, and the nucleotide comparison of the single copy gene

XYL1 that encodes for xylose reductase (XR).

3.2. Materials and methods

3.2.1.Insect collection

Seven individuals of Cryptocercus sp. were collected along the Appalachian Trail at New Found Gap near the border between Tennessee and North Carolina, United

States. Individual roaches were superficially disinfected by washing with 70% ethanol (5 min), 5% bleach (5 min), and sterile water (10 min) prior to gut removal. Each roach was then placed on a flamed coverslip, and sterile forceps were used to separate the exoskeleton and extract the gut. The roaches were kept alive until time of dissection.

3.2.2.Yeast isolation and culture

The wood roach gut was divided into three regions: foregut-midgut (F-M), anterior hindgut (AHG), and posterior hindgut (PHG). Each gut region was homogenized in 500 µL of 0.7% saline solution with 0.01% Tween 80. 100 µL of each homogenized region were plated on YPDM (0.3% yeast extract, 0.5% Bacto pectone,

1% dextrose, 0.3% malt extract, 2% agar) medium supplemented with 0.05% calcium carbonate, vitamins, and salts (Boundy-Mills 2006, Kurtzman et al. 2011). The medium was acidified with 0.6 mL of concentrated HCl per liter, and 0.35 µg/L chloramphenicol was added to reduce bacterial growth. After three days of incubation at room temperature, 18 yeast colonies were selected. The isolates were purified by multiple subcultures and stored on YPDM agar at 4 °C and YPDM broth at -80 °C in 15% glycerol.

Other culture techniques and biochemical characterization were carried out by the methods recommended by Yarrow (1998), Barnett et al. (2000), and Kurtzman et al.

(2011).

3.2.3. Amplification and sequencing of DNA

Genomic DNA was extracted using a Wizard® Genomic DNA purification kit

(Promega). The concentration, integrity, and purity of total extracted DNA were confirmed by gel electrophoresis in 0.8% agarose in 0.5 ✕ Tris-Borate-EDTA (TBE) buffer. Initial rapid identification was carried out by PCR amplification and sequencing of

~600 bp of the D1/D2 region of the large subunit (LSU) of the rRNA (rDNA) gene for use in BLAST searches (Kurtzman and Robnett 1998, Kurtzman et al. 2011). In order to increase the robustness of the phylogenetic analyses and the accuracy of species

recognition, PCR amplification of the small subunit (SSU ~1.6 Kbp) and internal transcribed spacers 1 and 2 (ITS ~500 bp) of the rDNA and RPB1 loci were carried out in addition to the D1/D2 LSU rDNA region (White et al. 1990, Hibbett 1996, Schoch et al. 2009, 2012, Urbina and Blackwell 2012).

The purified PCR products were sequenced in both directions by Beckman

Coulter Genomics (Danvers, MA). GeneBank accession numbers are indicated in the

Table 3.1 and in the phylogenetic trees.

3.2.4. RAPD-PCR fingerprinting

RAPD–PCR analysis was performed with the oligonucleotide primer CDU (5’-

GCGATCCCCA-3’) (Sullivan et al. 1995, Fadda et al. 2004, 2010, Urbina and Blackwell

2012). Aliquots of 25 µL of amplified product were analyzed by electrophoresis on 1.8% agarose gel in 1 ✕ TBE buffer with 1 ✕ SYBR® Safe DNA Gel Stain (Invitrogen, Grand

Island, NY) at 70 V for 80 min. DNA fragments were visualized by using a UV-light transilluminator and photographed using a Polaroid system.

3.2.5. Xylose reductase (XR) studies

Recently, use of the XYL1 locus was recommended for rapid identification of cryptic species in the Scheffersomyces clade (Urbina and Blackwell 2012). The ~600 bp fragment of the XYL1 was amplified by using the following degenerate primers, XYL1- forward (5’-GGTYTTYGGMTGYTGGAARSTC-3’) and XYL1-reverse (5’-

AAWGATTGWGGWCCRAAWGAWGA-3’), and the PCR protocol as recommended

(Urbina and Blackwell 2012).

Table 3.1. GenBank accession numbers of the nucleotide sequences used in this study. Sequences generated in this work are shown in boldface. T= Type culture.

Loci Species Code LSU ITS COXII MtSm T. ciferriT NRRL Y-10943 DQ442681 AY493435 DQ443088 DQ442760 Z. hellenicusT NRRL Y-7136 DQ438216 DQ911464 DQ443047 DQ442719 B. illinoisensisT NRRL YB-1343 DQ442696 DQ898169 DQ443103 DQ442775 B. malaysiensisT NRRL Y-6417 DQ442695 DQ898170 DQ443102 DQ442774 W. domercqiaeT NRRL Y-6692 DQ438240 DQ911462 DQ443084 DQ442756 Su. americanaT NRRL YB-2067 DQ438193 HM208605 DQ443051 DQ442723 Su. boreocaroliniensisT NRRL YB-1835 DQ438221 DQ911448 DQ443065 DQ442737 Su. bullrunensisT EH008 HM208602 HM208601 - - Su. castrensisT NRRL Y-17329 DQ438195 DQ911441 DQ443053 DQ442725 Su. chiloensisT NRRL Y-17643 DQ911433 - DQ911437 - Su. floridensisT NRRL YB-3827 DQ438222 DQ911442 DQ443066 DQ442738 Su. grinbergsiiT NRRL Y-27117 DQ438199 DQ911443 DQ443057 DQ442729 Su. japonicaT NRRL YB-2798 DQ438202 DQ911456 DQ443060 DQ442732 Su. lignohabitansT NRRL YB-1473 DQ438198 HM208611 DQ443056 DQ442728 Su. lignohabitans RG11-03-01-05-F5 JQ714004 JQ713960 - - Su. lignohabitans RG11-03-01-06-A4 JQ714007 JQ713963 - - Su. lignohabitans RG11-03-01-06-A2 JQ714006 JQ713962 - - Su. lignohabitans RG11-03-01-05-F2 JQ714003 JQ713959 - - Su. lignohabitans RG11-03-01-05-M4 JQ714005 JQ713961 - - Su. lignohabitans RG11-03-01-05-F1 JQ714002 JQ713958 - - Su. marilandicaT NRRL YB-1847 DQ438219 DQ911445 DQ443063 DQ442728 Su. marionensisT NRRL YB-1336 DQ438197 DQ911452 DQ443055 DQ442727 Su. neomexicanaT NRRL YB-2450 DQ438201 DQ911447 DQ443059 DQ442731 Su. novakiiT NRRL Y-27346 DQ438196 DQ911449 DQ443054 DQ442726 Su. paludigenaT NRRL Y-12697 DQ438194 DQ911451 DQ443052 DQ442724 Su. paludigena RG11-03-01-06-FM2 JQ714009 JQ713965 - - Su. paludigena RG11-03-01-05-A1 JQ714008 JQ713964 - - Su. pinicolaT NRRL YB-2263 DQ438200 DQ911453 DQ443058 DQ442730 Su. smithiaeI NRRL Y-17850 DQ438218 HM208613 DQ443062 DQ442734 Su. valdivianaT NRRL Y-7791 DQ438220 HM461646 DQ443064 DQ442736

SSU ITS LSU RPB1 XYL1

Ca. bolitotheriT NRRL Y-27587 AY242142 FJ623599 AY242249 JN804828 - Ca. maxiiT NRRL Y-27588 AY242144 - AY242253 JN804830 -

Ca. chickasawarumT NRRL Y-27566 AY242154 FJ172247 JQ025398 JN804829 -

Ca. yuchorumT NRRL Y-27569 AY242169 JN943266 AY242278 JN804832 -

Ca. terraborumT NRRL Y-27573 AY426956 FJ623596 AY309810 JN804831 -

Ca. panamericanaT NRRL Y-27567 AY426960 FJ623601 AY309872 JN804835 - L. elongisporusT NRRL YB-4239 HQ876033 HQ876042 HQ876050 AY653537 - Ca. tropicalisT NRRL Y-12968 EU348785 AB437068 U45749 - -

(Table 3.1 continued) Species Code SSU ITS LSU RPB1 XYL1 Sc. ergatensisT NRRL Y-17652 AB013524 EU343826 U45746 EU344098 JQ436926 Sc. insectosaT NRRL Y-12854 AB013583 HQ652064 FM200041 JN804842 JQ235697 Sc. lignosusT NRRL Y-12856 HQ651941 JN943262 U45772 JN804837 JQ235693 Sc. segobiensisT NRRL Y-11571 AB054288 DQ409166 U45742 EF599429 JQ436925 Sc. queiroziaeT NRRL Y-48722 - HM566445 HM566445 - - Sc. gosingicusT CBS 11433 HQ876040 HQ999978 HQ999955 - - Sc. spartinaeT NRRL Y-7322 FJ153139 HQ876044 U45764 - - Sc. stipitisT NRRL Y-7124 AB054280 JN943257 U45741 JN804841 JQ235696 Sc. amazonensisT NRRL Y-48762 - JF826438 JF826438 - - Sc. shehataeT NRRL Y-12858 AB013582 JN943264 AF178049 JQ436927 JQ235691 Sc. quercinusT NRRL Y-48825 JN940981 JN943260 JN703957 JN804838 JQ008829 Sc. virginianusT NRRL Y-48822 JN940969 JN943259 JN703958 JN804839 JQ235695 Sc. illinoinensisT NRRL Y-48827 JN940968 JN943261 JN703959 JN804840 JQ235694 Sc. cryptocercus NRRL Y-48824T; CBS JQ714001 JQ713977 JQ714021 JQ713989 JQ714031 12658; RG11-03-01-06-P1 NRRL Y-48823; RG11- JQ713994 JQ713970 JQ714014 JQ713982 JQ714026 03-01-07-FM1 NRRL Y-48826; RG11- JQ713998 JQ713974 JQ714018 JQ713986 JQ714029 03-01-05-F7 RG11-03-01-05-P2 JQ713992 JQ713968 JQ714012 JQ713980 JQ714024 RG11-03-01-05-P3 JQ713993 JQ713969 JQ714013 JQ713981 JQ714025 RG11-03-01-05-A2 JQ713991 JQ713967 JQ714011 JQ713979 JQ714023 RG11-03-01-06-FM1 JQ714000 JQ713976 JQ714020 JQ713988 JQ714022 RG11-03-01-07-P2 JQ713995 JQ713971 JQ714015 JQ713983 JQ714027 RG11-03-01-05-M1 JQ713999 JQ713975 JQ714019 JQ713987 JQ714030 RG11-03-01-05-F3 JQ713997 JQ713973 JQ714017 JQ713985 JQ714028 RG11-03-01-06-A1 JQ713996 JQ713972 JQ714016 JQ713984 -

3.2.6. Phylogenetic analyses

Contig sequences and sequencing manipulations were done using Se-AL v2.01a11 (http://tree.bio.ed.ac.uk/software/seal/) and MESQUITE v2.74 (Maddison and

Maddison, 2005). The sequences were aligned in the online interface MAFFT v6.859

(http://mafft.cbrc.jp/alignment/software/) with different advanced alignment strategies per locus: LSU, XYL1, and RPB1, global homology (G-INS-i); ITS, one conserved domain (L-INS-i); and SSU, secondary structure of RNA (Q-INS-i). In particular ITS loci were realigned using the software SATé v2.1.2 (Liu et al. 2012), and ambiguous

sequence alignment ends were eliminated in all the alignments. Maximum likelihood

(ML) phylogenic inference was performed in RAxML-VI-HPC (Stamatakis, 2006) using a partitioned multi-locus matrix (each partition for SSU, ITS1, 5.8S and ITS2, LSU and

RPB1) under a general time reversible model with a gamma distribution of site rate variation (GTRGAMMA). ML support was estimated using 1000 bootstrap replicates.

The sequences for RPB1 and XR were obtained using SEQUIN v11.9

(http://www.ncbi.nlm.nih.gov/Sequin/) with an alternative yeast nuclear codon bias

(Oham et al. 1993, Wohlbach et al. 2011). Tree editing was done with FigTree v1.3.1 software (http://tree.bio.ed.ac.uk/software/figtree/).

3.3. Results and discussion

The yeast strains were initially identified by using the ITS and LSU molecular markers in BLAST searches (Altschul et al. 1990). Sugiyamaella paludigena and Su. lignohabitans were identified as members of the gut community of Cryptocercus sp.

(Fig. 3.1). Sugiyamaella paludigena was originally isolated from high moor peat in the

Moscow region (Russia) (Golubev et al. 1981), and recently, it was reported in soil from the rhizosphere of white spruce (Lamarche et al. 2011). Sugiyamaella lignohabitans was first described from a decaying log of paper birch and associated insect frass in the

United States (Kurtzman 2007). In general Sugiyamaella species have been found in association with wood and insects, and Su. bullrunensis was described from the gut of the wood-feeding beetle Odontotaenius disjunctus (Houseknecht et al. 2011) as was previously shown by a molecular cloning study of the same beetle (Zhang et al. 2003).

Altogether, these findings suggest that Sugiyamaella species are widely distributed in wood, soil, and guts of insects.

Figure 3-1. Maximum likelihood tree based on the D1/D2 LSU and ITS using a 1208- character matrix for yeast species classified in the Sugiyamaella clade. Strains recovered from the gut of Cryptocercus sp. are shown in bold. Wickerhamiella domercqiae was used as an outgroup taxon (in grey). Numbers at branches refer to bootstrap values out of 1000 repetitions. Final ML score –6939.19.

3.3.1.Taxonomic revision of the Sugiyamaella yeast clade

We propose additional new combinations in the genus Sugiyamaella by including clade members that previously were described as asexual species of the polyphyletic genus Candida (Knapp et al. 2011).

1. Sugiyamaella boreocaroliniensis (Kurtzman) Urbina & M. Blackw. comb. nov.

MycoBank accession number: MB 564463.

Basionym: Candida boreocaroliniensis Kurtzman, FEMS Yeast Research 7: 1054,

2007.

2. Sugiyamaella bullrunensis (S.O. Suh, Houseknecht & J.J. Zhou) Urbina & M.

Blackw. comb. nov.

MycoBank accession number: MB 564464.

Basionym: Candida bullrunensis S.O. Suh, Houseknecht & J.J. Zhou. International

Journal of Systematic and Evolutionary Microbiology 61: 1752, 2011.

3. Sugiyamaella castrensis (C. Ramirez & A.E. Gonzalez) Urbina & M. Blackw. comb.

nov.

MycoBank accession number: MB 564465.

Basionym: Candida castrensis C. Ramirez & A.E. Gonzalez, Mycopathologia 87:

178, 1984.

4. Sugiyamaella floridensis (Kurtzman) Urbina & M. Blackw. comb. nov.

MycoBank accession number: MB 564466.

Basionym: Candida floridensis Kurtzman, FEMS Yeast Research 7: 1054, 2007.

5. Sugiyamaella grinbergsii (Kurtzman) Urbina & M. Blackw. comb. nov.

MycoBank accession number: MB 564467.

Basionym: Candida grinbergsii Kurtzman, FEMS Yeast Research 7: 1056, 2007.

6. Sugiyamaella marionensis (Kurtzman) Urbina & M. Blackw. comb. nov.

MycoBank accession number: MB 564470.

Basionym: Candida marionensis Kurtzman, FEMS Yeast Research 7: 1059, 2007.

7. Sugiyamaella neomexicana (Kurtzman) Urbina & M. Blackw. comb. nov.

MycoBank accession number: MB 564471.

Basionym: Candida neomexicana Kurtzman, FEMS Yeast Research 7: 1060, 2007.

8. Sugiyamaella novakii (G. Péter, Tornai-Leh. & T. Deák) Urbina & M. Blackw. comb.

nov.

MycoBank accession number: MB 564472.

Basionym: Candida novakii G. Péter, Tornai-Leh. & T. Deák, Antonie van

Leeuwenhoek 71: 376, 1997.

9. Sugiyamaella paludigena (Golubev & Blagod.) Urbina & M. Blackw. comb. nov.

MycoBank accession number: MB 564473.

Basionym: Candida paludigena Golubev & Blagod, International Journal of

Systematic Bacteriology 31: 92, 1981.

10. Sugiyamaella pinicola (Kurtzman) Urbina & M. Blackw. comb. nov.

MycoBank accession number: MB 564547.

Basionym: Candida pinicola Kurtzman, FEMS Yeast Research 7:1061, 2007

11. Sugiyamaella valdiviana (Grinb. & Yarrow) Urbina & M. Blackw. comb. nov.

MycoBank accession number: MB 564548.

Basionym: Candida valdiviana Grinb. & Yarrow, Antonie van Leeuwenhoek 36: 145,

1970.

In addition to the Sugiyamaella species isolated from wood roaches, we also obtained strains of an undescribed X-F yeast species, Scheffersomyces cryptocercus, from each of the seven roaches dissected. These isolates comprise a monophyletic group based on the multilocus phylogenetic analysis (71% bootstrap support value), morphological characterizations, and phylogenetic study using the XYL1 locus (Figs.

3.2, 3.3, 3.4). The nucleotide differences between Sc. cryptocercus strains and the close relative, Scheffersomyces shehatae, were 0 bp in LSU, 2 bp in SSU, 3 bp in ITS,

11 bp in RPB1, and 20 bp in XYL1. In addition, no major differences were found among the Sc. cryptocercus strains by using CDU RAPD-PCR fingerprinting primer (Fig. 3.3).

Figure 3.2. Molecular comparison of Scheffersomyces cryptocercus strains and related species using RAPD-PCR CDU fingerprinting primers.

Species description of Scheffersomyces cryptocercus Urbina & M. Blackw. sp. nov.

Fig. 3.5

MycoBank accession number: MB 564549.

In yeast extract (0.5%), glucose (2%) broth after 3 d at 25 °C, the cells are subglobose to ellipsoidal (6 − 8.5 ✕ 5 − 7.5 µm); asexual reproduction is by budding, and cell clusters and pseudohyphae are present. On YM agar after 7 d at 25 °C, colonies are cream and smooth with entire margins. In Dalmau plates after 12 d on cornmeal agar, well-developed true hyphae are present. Asci and ascospores not observed. Fermentation of glucose, galactose, maltose, D-glucoside, trehalose, and D- xylose are positive. Cellobiose, sucrose, melezitose, raffinose, inulin, starch, and lactose are not fermented. Assimilation of carbon compounds, positive for glucose, galactose, L-sorbose, N-acetyl-D-glucosamine, D-ribose, D-xylose, L-arabinose (weak),

D-arabinose (variable), sucrose, maltose, trehalose, α-methyl-D-glucoside, cellobiose, salicin (variable), arbutin (variable), melibiose, melezitose, soluble starch, ribitol, D- glucitol, D-mannitol, D-glucono-1,5-lactone (variable), 2-keto-D-gluconate (fast). No growth occurs on L-rhamnose, lactose, raffinose, inulin, glycerol, erythritol, xylitol, L- arabinitol, galactitiol, myo-inositol, D-gluconate, D-glucuronate, DL-lactate, succinate, citrate, methanol, ethanol, propane-1,2-diol, butane-2,3-diol, quinic acid, D-glucarate, and D-galactonate as sole carbon sources. Assimilation of nitrogen compounds positive for lysine, ethylamine-HCl, D-tryptophan, and cadaverine, and negative for imidazole, D- glucosamine, creatinine, creatine, nitrite, and nitrate. Growth is positive for myo-inositol, and negative for other vitamin tests. Growth in amino-acid-free medium is positive.

Growth at 37 °C is positive. Growth on YM agar with 10% sodium chloride is negative to

slow. Growth in 50% glucose/yeast extract (0.5%) is negative. In 100 µg/mL cycloheximide growth is positive. Diazonium Blue B reaction is negative.

Figure 3.3. Maximum likelihood tree based on a multilocus dataset (SSU, LSU, ITS and RPB1) using a 3488-character matrix for the Scheffersomyces clade. Candida tropicalis (Lodderomyces clade) was used as an outgroup taxon (in grey). C-F and X-F, cellobiose- and xylose-fermenting yeasts respectively. Numbers above branches refer to bootstrap values out of 1000 repetitions. Final ML score -14312.34.

Type strain. NRRL Y-48824T (=CBS 12658; RG11-03-

01-06-P1) is preserved as a lyophilized preparation in

the Agricultural Research Service Culture Collection

(NRRL), Peoria, Illinois, United States. The habitat is

the gut of the wood-roach Cryptocercus sp. from the

Appalachian Trail at New Found Gap near the border

between Tennessee and North Carolina, United States.

Etymology. The species name cryptocercus (N.L. gen.

n.) refers to the host genus of wood roach,

Cryptocercus, from which this species was isolated.

The ability of Sc. cryptocerus to ferment D-

glucoside and to grow at 37 °C distinguish this species

from its closet known relatives Sc. virginianus and Sc.

quercinus.

The yeast community found in the gut of the

North American wood roach, Cryptocercus sp., differed

from pervious studies focused on cockroaches Figure 3.4. Morphological characterization of collected in Panama and Blatta orientalis (Henninger Scheffersomyces cryptocercus. (a) budding and Windisch 1976, Nguyen et al. 2007), suggesting cells and (b) pseudohyphae, after 7 d at that the diversity of gut yeasts may change among 25 °C in YM broth and agar; (c,d) budding cells roach species, diets, and localities. grown on V8 agar at 17 °C; arrow indicate a cell with The isolation of an undescribed X-F yeast from multiple buds cell. Bar 10 µm. the gut of wood roaches increases the support for the

close association of wood-feeding insects and yeasts with the rare biochemical ability to ferment D-xylose (Zhang et al. 2003, Suh and Blackwell 2004, Nguyen et al. 2006,

Berkov et al. 2007, Grunwald et al. 2010, Calderon and Berkov 2012). The methodology applied in this study, including a large number of isolations from different parts of the gut of host individuals, allowed us to discover rare yeasts by overcoming the effect of the abundance of other X-F species that may overshadow the presence of rare yeasts. This finding is in agreement with other studies in which the X-F yeasts Sc. stipitis and a close relative of Sc. shehatae were the predominant ascomycete yeasts in the gut of wood- feeding beetles O. disjunctus and long-horned beetles in the family Cerambycidae (Suh et al. 2003, Nardi et al. 2006, Grunwald et al. 2010).

The phylogenetic analysis based on nucleotide sequences of the XYL1 locus alone, supports the separation of Sc. cryptocercus as a unique species as was determined by the multi-locus phylogenetic reconstruction (Fig. 3.4). This finding supports the use of the easily amplified XYL1 to recognize cryptic species in the

Scheffersomyces clade (Urbina and Blackwell 2012).

Despite the large number of nucleotide differences in XYL1 between Sc. cryptocercus strains and the type culture of Sc. shehatae, only four amino acid changes were present at the N-terminal region in the putative XR but none of these mutations changed the polarity of the amino acid (data not shown). The mutations in the protein sequences surrounded the conserved domains, and these may have a role in the performance of the enzyme as has been pointed out previously (Urbina and Blackwell

2012). The abundance of synonymous substitutions is an indication that selection may act on this locus to maintain an invariable protein sequence.

The common association between the Sugiyamaella and Scheffersomyces

yeasts and wood-feeding insects is extended by this study by the finding of the

presence of the X-F yeast Sc. cryptocercus in the gut of wood-feeding roaches, wood-

feeding insects that lack studies focusing on the characterization of their fungal

microbiota.

Figure 3.5. Maximum likelihood consensus tree based on XYL1 using a 489- character matrix of X-F members in the Scheffersomyces stipitis subclade. Scheffersomyces ergatensis was used as an outgroup taxon (in grey). Number above each branch refers to bootstrap values out of 1000 repetitions. Final ML score is -1813.42.

CHAPTER 4: DIVERSITY OF YEASTS ASSOCIATED WITH GUATEMALAN PASSALID BEETLES

4.1. Introduction

The gut of insects has been shown to be a productive habitat for the discovery of new species of yeasts. Several studies have focused on the characterization of new species from the gut of mushroom- and wood-feeding beetles (Suh et al. 2003, 2004b,

2005a, 2006a,b, Suh and Blackwell 2005, 2006, Berkov et al. 2007, Rivera et al. 2009,

Grunwald et al. 2010, Houseknecht et al. 2011, Calderon and Berkov 2012). Despite these efforts, 50% of gut-inhabiting yeast diversity from mushroom-feeding beetles at the sites and the insect families studied may remain undiscovered (Suh et al. 2005).

These new yeasts are important not only because they fill taxon-sampling gaps and help to understand the phylogenic relationship among members of Saccharomycotina, but also for their potential use in several fermentation processes and the production of enzymes.

Recent rising fuel costs have motivated searches for new yeasts capable of fermenting cellobiose and D-xylose, which can be applied to the production of bioethanol. These yeasts were isolated from the soil, plant tissues, and the gut of wood- feeding beetles (e.g. Cerambycidae, Passalidae, Curculionidae, Lucanidae) (Suh et al.

2003, Zhang et al. 2003, Suh and Blackwell 2004, Suh et al. 2005, Nardi et al. 2006,

Berkov et al. 2007, Cadete et al. 2009, Tanahashi et al. 2010, Santos et al. 2011,

Calderon and Berkov 2012). In general, the characterization of the yeasts associated with the gut of lignicolous insects has confirmed a consistent association between X-F yeasts and these insects, which is indicative of a symbiotic relationship between these organisms.

Passalid beetles (Passalidae, Coleoptera) generally feed on rotting wood and spend most of their lives inside dead logs (Reyes-Castillo 1970, Boucher 2005,

Schuster 2006). This insect family is comprised of approximately 960 species, which are classified in five subfamilies according to their global distribution, morphological characters, gut morphology, and biology (Boucher 2005, Fonseca et al. 2011).

The majority of members of this arthropod family share a subsocial behavior that includes parental care by feeding a mixture of digested wood and feces to larvae and juveniles. Adults also cover the larvae at the time of metamorphosis to pupae with a covering, the pupal chamber, made of frass and predigested wood that becomes the first meal for juveniles (Reyes-Castillo 1970, Tallamy and Wood 1986). This behavior suggests that horizontal transfer of microbes is required for the complete metamorphosis from larvae to adults. Apparently larvae cannot survive when fed only pulverized rotten and sterilized wood (Pearse et al. 1936, Reyes-Castillo 1970, Nardi et al. 2006, Berkov et al. 2007, Rao et al. 2007). These findings emphasize that the gut microbiota in passalids plays an important role in the digestion of the wood components in wood-feeding insects.

Among passalids, the biology, ecology and physiology are well known only for

Odontotaenius disjunctus, a beetle species commonly found in the southeastern United

States (Pearse et al. 1936, Roberts 1952, Bryan 1954, Hiznay and Krause 1955,

Ferguson and Land 1961, Robertson 1962, Collings 1966, Burnett et al. 1969, Ward

1971, Delfinado and Baker 1975, Dismukes and Mason 1975, Schuster 1975, Gibson

1977, Rains and Dimock 1978, Buchler et al. 1981, Mason et al. 1983, Tafuri and Tafuri

1983, Wit et al. 1984, Sawvel et al. 1992, MacGown and MacGown 1996, Waters and

Socha 2005, King and Fashing 2007, Punzo 2007, Jackson et al. 2009, Wicknick and

Miskelly 2009). In particular, Nardi et al. (2006) characterized the morphological and cellular transformations of the hindgut region of the digestive system from larva to adult of O. disjunctus, as the position of its gut-inhabiting flora. The adult gut is often over 10 cm, at least twice as long as the length of an individual (Nardi et al. 2006).

The digestive system of insects is divided into three regions, the foregut, midgut, and hindgut. The hindgut of O. disjunctus is subdivided into conspicuously differentiated anterior- and posterior-sections, which also differ in their physiological conditions of O2,

CO2, and pH (Ceja-Navarro et al. 2012). In addition a conspicuous pouch diverticulum exists at the anterior end of the hindgut. Bacteria, trichomycetes, amoebae, nematodes, flagellated protists, filamentous fungi, and yeasts are present in the gut, but a variety of bacteria attach to form conspicuous surface films in the anterior hindgut (Nardi et al.

2006, Ceja-Navarro et al. 2012). The posterior hindgut is colonized by filamentous yeasts attached by a holdfast, (Suh et al. 2003, Nardi et al. 2006). In the most recent taxonomic reclassification of the family Passalidae, the macro-morphology of the anterior hindgut was used to raise the five tribes to the level of subfamily

(Aulacocyclinae, Solenocyclinae, Macrolininae, Passalinae, and Proculinae). Passalinae and Proculinae are distributed exclusively in the New World (Fonseca et al. 2011), and the other families occur in Asia, Africa, and Australia.

The ascomycete yeasts in the gut of O. disjunctus were characterized by molecular and microbiological means. These studies have confirmed the predominant and constant presence of the D-xylose-fermenting (X-F) yeast Scheffersomyces stipitis, and other less abundant X-F yeasts including Scheffersomyces shehatae and Candida

maltosa (Lodderomyces clade) (Suh et al. 2008), and the cellobiose-fermenting (C-F) yeast Scheffersomyces ergatensis (Suh et al. 2003, Zhang et al. 2003, Nardi et al.

2006). The X-F yeasts Spathaspora passalidarum and Candida jeffreisii (Spathaspora clade) (Nguyen et al. 2006), the trehalose-fermenting yeast Kazachstania intestinalis

(Suh and Zhou 2011), the D-xylose-assimilating yeast Sugiyamaella bullrunensis

(Houseknecht et al. 2011), and the basidiomycete yeast Trichosporon xylopini (Gujjari et al. 2011) were all first described in association with O. disjunctus. The gut of this single passalid species is a source for isolation of at least ten recently described ascomycete and basidiomycete yeasts.

Few studies have characterized the yeasts from the gut of other passalids such as Paxillus leachi, Passalus interstitialis, Ptichopus angulatus, Verres hageni, Veturius platyrhinus, and Verres sternbergianus, which occur in Panama and Peru. Species closely related to Candida mycetangii (Wickerhamomyces clade) and Sc. stipitis, as well as other yeasts including Candida parapsilosis (Lodderomyces clade), Candida temnochilae (Yamadazyma clade), and the basidiomycete yeast Trichosporon insectorum were isolated from these beetles (Suh et al. 2003, 2005, 2008 Berkov et al.

2007, Fuentefria et al. 2008). In general, however, the diversity of yeasts associated with the gut of passalid beetles is poorly known, considering their worldwide distribution.

The principal aim of this study was to expand the knowledge of diversity of ascomycete and basidiomycete yeasts associated with the gut of passalid beetles. This was achieved through the isolation, identification, and characterization of 771 yeast isolates from the gut of 16 species of passalids collected at nine sites in Guatemala.

The presence of ascomycete yeasts was observed in the gut of all passalids studied, as

well as basidiomycete yeasts in the genera Cryptococcus and Trichosporon. The X-F yeasts Sc. shehatae and Sc. stipitis and undescribed species in the Scheffersomyces and Spathaspora clades were the most abundant yeasts in the passalid guts. These results confirm the relationship between X-F yeasts and passalids. The gut of

Guatemalan passalids provide a niche rich in several undescribed yeast species classified in the Sugiyamaella clade, and undescribed yeasts classified in the

Phaffomyces and Spencermartinsiella clades, and these results correspond with the feeding behavior and geographic distribution of the host.

4.2. Materials and methods

4.2.1. Passalid collection

A total of 47 adult specimens identified as fifteen species of passalids classified in two subfamilies, Passalinae and Proculinae, were collected at nine localities in

Guatemala (Fig. 4.1, Table 4.1, 4.2). The localities visited were selected based on the endemic passalid zones described previously (Schuster 1991, 1992, 1993, 2002, 2006,

Schuster et al. 2000, 2003). Targeted searching in passalid galleries in rotted logs was the most effective methodology for collecting beetle individuals, and only one beetle specimen was collected at light traps.

4.2.2. Beetle dissection

Five individuals per species per site were selected for dissection. Each beetle individual was surface disinfected by washing in 70% ethanol (5 min), 5% bleach (5 min), and sterile water (10 min) prior to dissection. In order to carry out the gut removal,

each specimen was placed on a recently flamed glass slide, and sterile forceps were used to remove the elytron, which allowed access to the gut (Fig. 4.2).

Figure 4.1. Map of Guatemala with the collecting sites indicated (see Table 4.1)

All dissections were performed the same day or one day following collection; in the latter case, beetles were kept alive in plastic containers with rotted wood from which they were collected. Following dissection, dissected as well as intact beetles were immediately preserved in absolute ethanol for identification and DNA extraction.

4.2.3. Yeast isolation and culture

The gut of each beetle was divided into three regions: foregut-midgut (F-M), and anterior (AHG) and posterior hindgut (PHG) (Fig. 4.2). The F-M regions were

maintained as one to preserve the head that contains morphological characters used for identification. Each gut region was homogenized in 500 µL of 0.7% saline solution with

0.01% Tween 80. Next, 100 µL of each homogenized region was superficially plated on

YPDM medium (0.3% yeast extract, 0.5% bacto peptone, 1% dextrose, 0.3% malt

extract, and 2% agar)

supplemented with 0.05% calcium

carbonate, vitamins, and salts

(Yarrow 1998).

Figure 4.2. Gut dissection of the passalids Proculus mnizechii (a) and Chondrocephalus purulensis (b), bar 1 cm.

Table 4.1. Collecting sites and passalid endemic zones (PEZ) as classified by Schuster (2006). Date of Type of Altitude Site Locality Department Latitude Longitude PEZC collection vegetation (masl) 1 Carmona Sacatepéquez 1-2 Tropical N14°32’29” W90°42’04” 1910 4a Mountain forest 2 Purulha Baja Verapaz 6-7 Cloud forest N15°12’27” W90°13’18” 950 -

3 Guatemala Guatemala 8 Secondary N14°33’23” W90°27’47” 1843 - City forest 4 Cementos El Progreso 8 Dry forest N14°48’52” W90°16’38” 1080 - El Progreso 5 Miramundo Escuintla 9-10 Secondary N14°12’17” W90°30’20” 1641 7c Mountain forest 6 Pino Dulce Jalapa 11-12 Secondary N14°57’12” W89°16’27” 1308 7b forest 7 El Tifrinio Chiquimula 14-15 Cloud forest N14°27’01” W89°23’22” 1312 6 8 Pueblo Santa Rosa 16-17 Secondary N14°13’39” W90°28’42” 1150 4b Nuevo forest Viñas 9 San Gil Izabal 18-19 Rain forest N15°38’55” W88°48’52” 389 Mountain

This medium was acidified with 0.6 mL of concentrated HCl per liter, and 0.35

µg/L chloramphenicol was added to reduce bacterial growth. After three days of incubation at room temperature, twelve yeast colonies per gut region were selected, resulting in 36 yeast strains per beetle individual whenever possible. A total of 771 yeast strains were isolated, and the following data documented: collecting date (year, month, and day), site (1-9), log sample (consecutive numbers given on each collecting day), beetle individual (consecutive numbers given on each collecting day), gut region from where each yeast strain was isolated (e.g. 1-F-M, 2-AHG, and 3-PHG), and yeast isolate (consecutive numbers given to each colony). Cultures are currently being kept in

15% glycerol at -80°C at The Louisiana State University Museum of Natural Sciences,

Department of Biological Sciences, Louisiana State University, Baton Rouge, Louisiana,

United States) and Micoteca Rubén Mayorga Peralta - MICG (Departamento de

Microbiología, Escuela de Química Biológica, Facultad de Ciencias Químicas y

Farmacia, Universidad de San Carlos de Guatemala, Guatemala City, Guatemala).

Other yeast culture techniques and physiological characterizations were carried out following the methods of Yarrow (1998), Barnett et al. (2000), and Kurtzman et al.

(2011).

4.2.4. Molecular studies

Genomic DNA was extracted using a Wizard® Genomic DNA purification kit

(Promega). The concentration, integrity, and purity of total DNA extracted was confirmed by gel electrophoresis in 0.8% agarose in 0.5 ✕ Tris–Borate–EDTA (TBE) buffer. Molecular identification was carried out by PCR amplification of the D1/D2 region

of the large subunit (LSU) of the rRNA gene (rDNA) (~ 600 bp) (Kurtzman and Robnett

1998, Kurtzman and Suzuki 2010).

Table 4.2. Passalid species collected in Guatemala. *Based on Schuster (2006); endemic species reported for Guatemala are denoted by ∆. Numbers correspond with the collecting sites noted on the map (Fig. 4.1).

Collecting sites

(1) s

Passalid species

Carnoma mountain Carnoma (2) Verapaz Baja Purulha, (3) City Guatemala (4) Progreso El Cementos (5) Viñas Nuevo Pueblo (6) mountain Miramundo (7) Tifrinio El (8) Union La (9) mountain Gil San individual of Number dissected species host of Occurrence site per x Tribe Passalinae (4 species collected) Passalus arroxiger 1 1 1 Passalus interstitialis 1 1 1 Passalus punctatostriatus 3 3 6 2 Passalus puntinger 2 2 1 Tribe Proculinae (12 species collected) Arrox agassizi 1 1 1 Chondrocephalus debilis 1 1 1 3 3 Chondrocephalus purulensis 1 1 1 3 3 Chondrocephalus sp. 1 1 1 Ogyges championi ∆ 4 4 1 Ogyges hondurensis ∆ 2 2 1 Ogyges laevissimus ∆ 1 1 1 Oileus sargi 2 1 3 1 1 8 5 Popilius eclipticus 3 3 2 Proculus mnizechii 1 1 1 Vindex sp. 4 4 1 Xylopassaloides chortii ∆ 1 1 1 Total of individuals collected per site 4 6 1 5 8 4 6 3 5 42 - Total of passalid species collected per site 3 3 1 3 5 2 2 3 2 - 24 Total passalids reported* 6 12 2 13 7 2 12 10 6 - 75

To increase the robustness of the phylogenetic analyses and the accuracy of species identification, PCR amplifications of the internal transcribed spacer 1 and 2 (ITS

~ 600 bp) and the small subunit locus (SSU~1.6 Kbp) of the rDNA were carried out in addition to the LSU locus. The SSU was amplified using the combination of primers

NS1 (forward) (5’-GTAGTCATATGCTTGTCTC-3’) and NS8 (reverse) (5’-

TCCGCAGGTTCACCTACGGA -3’); ITS-LSU loci were amplified using the combination of primers ITS1 (forward) (5’-TCCGTAGGTGAACCTGCGG-3’) and LR3 (reverse) (5’-

CCGTGTTTCAAGACGGG-3’), in a PCR reaction with 20 µg of total DNA, 0.5 mM

DTPs, 2.5 mM MgSO4, 1 ✕ PCR buffer, and 1U of Taq polymerase (Promega) in 25 µL of final volume. The PCR amplification program included 5 min of DNA pre-denaturizing at 95 °C, followed by 35 cycles of 1 min of DNA denaturizing at 95 °C, 45 s of primer annealing at 55 °C, and 2 min of extension at 72 °C, and 10 min of final PCR extension.

The purified PCR products were sequenced in both directions using an ABI PRISM

Cycle Sequencing kit (Perkin-Elmer Applied Biosystems). Sequences were deposited in

GenBank with the following accession numbers: SSU (JQ008831 − JQ008930), ITS

(JN831680 − JN831706) and LSU (JN804869 − JN805539).

4.2.5. Phylogenetic analyses

Contig sequences and sequencing manipulations were performed in Se-AL v2.01a11 (available at http://tree.bio.ed.ac.uk/software/seal/) and MESQUITE v2.74

(Maddison and Maddison, 2005). The sequence alignments were carried out using the online interface MAFFT v6.859 (http://mafft.cbrc.jp/alignment/software/) with different advanced alignment strategies per locus: LSU, global homology (G-INS-i); ITS, one conserved domain (L-INS-i); and SSU, secondary structure of RNA (Q-INS-i). ITS loci were realigned using the software SATé v2.1.2 (Liu et al. 2012), and the ambiguous sequence alignment ends were eliminated. Maximum likelihood (ML) phylogenetic inference was performed in RAxML-VI-HPC (Stamatakis 2006) using a partitioned multilocus matrix under a general time reversible model with a gamma distribution of

among site rate variation (GTRGAMMA). Maximum likelihood support was estimated using 1000 bootstrapping replicates. Tree editing was done using the software FigTree v1.3.1 (http://tree.bio.ed.ac.uk/software/figtree/).

4.3. Results and discussion

4.3.1. Diversity of xylose- and cellobiose-fermenting yeasts among Guatemalan passalids

The presence of ascomycete yeasts in the gut of Guatemalan passalids was confirmed in all individuals dissected. We isolated 771 yeast strains, which corresponded to approximately 78 yeast species based on nucleotide differences in the

SSU, LSU, and ITS molecular markers and their phylogenetic relatedness. The most abundant Saccharomycotina lineages among Guatemalan passalids were

Lodderomyces, Scheffersomyces, and Spathaspora (Debaryomycetaceae) (Fig. 4.3,

4.4).

Members of the Scheffersomyces and Spathaspora clades were the most abundant among all the Guatemalan passalids collected (560 isolates, approximately

76.5%) (Fig. 4.3). The X-F yeasts Sc. shehatae (314 isolates, 42.9%) and Sc. stipitis

(109 isolates, 14.9%) were the most common ascomycete yeasts identified. These findings are in agreement with previous studies, which reported both yeasts as common gut-inhabiting microbes in lignicolous insects (e.g. Suh et al. 2003, Zhang et al. 2003,

Berkov et al. 2007, Grunwald et al. 2010, Urbina et al. 2012). A difference in yeast species composition associated with Guatemalan passalids compared to O. disjunctus, however, was that the most common X-F gut yeast from Guatemalan beetles was Sc. shehatae. In O. disjunctus Sc. stipitis is very common and it is Sc. shehatae that is rare

(Meredith Blackwell, unpublished data). The major changes in the yeast community composition of passalids might be driven by flora composition, geographical distribution, and greater passalid diversity.

Figure 4.3. Yeast clades associated with the gut of Guatemalan passalid beetles.

The X-F yeast Sc. shehatae previously has been described as a species complex of insect-associated yeasts isolated from several families of xylophagous insects and rotted wood collected from the Netherlands, France, Canada, South Africa, Germany,

Chile (http://www.cbs.knaw.nl), and the United States (http://nrrl.ncaur.usda.gov).

Figure 4.4. Saccharomycotina yeast lineages associated with the gut of Guatemalan passalids with emphasis on the family Debaryomycetaceae where most of the known X- F yeasts are classified. Maximum likelihood phylogenetic tree based on SSU and LSU loci. Results of the cellobiose (C-F) and xylose-fermenting (X-F) assays are indicated. Outgroups are shown in gray. Final ML score: -16009.37.

Recently, species closely related to Sc. shehatae (Sc. virginianus, Sc. illinoinensis, Sc. cryptocercus, and Sc. quercinus) were discovered based on a multilocus phylogenetic analysis (Urbina and Blackwell 2012, Urbina et al. 2012).

In agreement with several studies, the use of the LSU marker solely as a barcode is insufficient for the differentiation of all species in the Scheffersomyces clade

(Kurtzman 1990, Kurtzman and Robnett 2007, Kurtzman and Suzuki 2010). The newly recommended fungal barcode, the ITS locus (Schoch et al. 2012), was used to increase the accuracy of species discrimination among the Sc. shehatae isolates from the gut of

Guatemalan passalids. Based on this characterization and the corresponding ability of most members to ferment D-xylose, at least eight undescribed species related to Sc. shehatae and Sc. stipitis were discovered.

Urbina and Blackwell (2012) distinguished three subclades of Scheffersomyces, the Sc. stipitis subclade, which is composed exclusively of X-F yeasts, the Sc. ergatensis subclade of C-F yeasts, and the Scheffersomyces spartinae subclade containing only the marine yeast Sc. spartinae and the recently described

Scheffersomyces gosingicus from soil in Taiwan (Chang et al. 2011). Yeast species and undescribed strains from subclades Sc. ergatensis and Sc. stipitis were recovered from the gut of Guatemalan passalids, but no members of the Sc. spartinae subclade were isolated. Altogether, these findings suggest that the gut of Guatemalan passalids is a good habitat for isolation of yeasts that exhibit the ability to ferment the wood components cellobiose and D-xylose.

Several undescribed species classified in the Spathaspora clade also were present in the gut of Guatemalan passalids. The Spathaspora clade is composed of the

X-F yeasts, Ca. jeffriesii, Sp. passalidadum, and Sp. arborariae, previously found in the galleries of the passalid beetle O. disjunctus, and rotted wood in Brazil (Nguyen et al.

2006, Barbosa et al. 2009); xylose-assimilating yeasts Candida insectamans, Candida xylanilytica, Candida materiae, and Candida lyxosophyla, isolated from wood in Asia, and the human pathogenic yeast Candida subhashii (van der Walt et al. 1972, 1987,

Adam et al. 2009, Barbosa et al. 2009, Cadete et al. 2009, Boonmak et al. 2011a).

None of the yeasts previously classified in this clade was recovered from the gut of

Guatemalan passalids, and therefore, all Spathaspora members isolated were undescribed species most closely related to Sp. passalidarum, Ca. materiae, and Ca. jeffriesii (Figs. 4.3, 4.4). Some of the undescribed Spathaspora yeasts also show the ability to ferment cellobiose and D-xylose, characteristics of some members of this clade (Fig. 4.4).

We isolated several Lodderomyces species from the gut of Guatemalan passalids, but, unlike Scheffersomyces or Spathaspora species, they were not consistently present among the host beetles (Fig. 4.3). The Lodderomyces clade is a monophyletic group closely related to the Spathaspora and Scheffersomyces clades

(Fig. 4.4), and it contains the opportunistic human pathogenic yeasts Candida albicans,

Candida tropicalis, and Candida dubliniensis. Candida tropicalis and Candida maltosa are the only members of this clade that can ferment D-xylose (Lohmeier-Vogel et al.

1989, Lin et al. 2010). Suh et al. (2008) showed an association between plant-feeding insects and yeasts of this clade, based on the isolation of Ca. tropicalis from a passalid species (Panama), Candida parapsilosis, from V. hageni and P. angulatus (Panama), and Candida maltosa, from O. disjunctus (United States). The gut of Guatemalan

passalids also was a source for yeasts in the Lodderomyces clade that are closely related to the X-F yeasts Ca. tropicalis and Ca. parapsilopsis (Figs. 4.3, 4.4). These findings suggest that the C-F and X-F yeasts classified in the clades Scheffersomyces,

Spathaspora, and Lodderomyces can be isolated from the gut of lignicolous insects, especially passalids.

4.3.2. Other ascomycete lineages associated with the gut of Guatemalan passalids

The gut of Guatemala passalids was a source for the isolation of several yeast strains classified in the Sugiyamaella clade (Trichomonascaceae) (Fig. 4.5), two strains related to the genus Phaffomyces (GenBank JN804920, JN804921)

(Phaffomycetaceae), and two strains in the recently described genus

Spencermartinsiella (Trichomonascaceae) (Peter et al. 2011) (GenBank JN805442,

JN805443) in the subphylum Saccharomycotina.

This study provides the first report of Phaffomyces species from the gut of wood- feeding beetles. Four yeast species in this genus were previously found in association with cactophilic Drosophila and necrotic wounds in cereoid cacti from Australia, North

America, and the Antilles (Kurtzman et al. 2011). In this clade, only Candida bromeliacearum is able to ferment glucose. The ability to grow using ethanol as a sole source of carbon is the single physiological trait shared by all Phaffomyces species, and an ability that might be associated with a natural environment rich in ethanol. Such an environment could be present in the gut of insects due to the fermentation processes carried out by symbiotic gut microbiota, but this is not known.

Figure 4.5. Sugiyamaella species associated with the gut of Guatemalan passalids. Maximum likelihood phylogenetic tree based on LSU sequences. Outgroups are in gray. Final ML score -3362.45.

The Sugiyamaella clade is composed of 17 cosmopolitan species previously isolated mainly from soft- and hardwood and insects in the United States, Chile, and

Japan (Kurtzman 2007, Houseknecht et al. 2011, Urbina et al. 2012) (Fig. 4.5). The occurrence of members of this clade in the gut of lignicolous insects was confirmed previously by metagenomic and classical microbiological studies carried out in longhorned beetles (Cerambycidae) (Grunwald et al. 2010). Two clones of Sugiyamaella species were obtained from O. disjunctus (GenBank AY390773 and AY390774) (Zhang et al. 2003) and also isolated from wood-roaches in the genus Cryptocercus (Urbina et al. 2012). The yeast has been described as Su. bullrunensis (Houseknecht et al. 2011).

In terms of a physiological profile, the Sugiyamaella members all assimilate D- xylose and L- and D-arabinose. These species are not able to ferment xylose (Kurtzman et al. 2011). In common with other members of this clade, the undescribed species of

Sugiyamaella isolated from the gut of Guatemalan passalids did not ferment xylose

(data not shown). The Sugiyamaella yeasts found in association with the Guatemalan passalids were related to Su. americana and Su. bullrunensis, previously isolated from insect frass and hardwood in the United States and the gut of O. disjunctus, respectively

(Houseknecht et al. 2011) (Fig. 4.5). The undescribed Sugiyamaella species found in

Guatemala were associated exclusively with passalids in the subfamily Proculinae, and although we isolated more than 164 yeast strains (~21 %) from passalids classified in the subfamily Passalinae, Sugiyamaella species were not present (Fig. 4.3).

A key difference among passalids classified in Passalinae and Proculinae is their habitat. Beetles in Proculinae colonize rotted sapwood and heartwood, while members of Passalinae occupy a position just beneath the loose outer bark (Reyes-Castillo 1970,

Lobo and Castillo 1997). The habitat difference is reflected in the external morphology of the species. Proculinae possess bodies that are ovoid and Passalinae have flattened bodies in cross section (Lobo and Castillo 1997). The shift in habitat is possibly reflected in the feeding behavior that might help to explain the absence of Sugiyamaella in passalines (Fig. 4.3). Houseknecht et al. (2011) showed similar results based on the occasional presence of Su. bullrunensis in the gut of O. disjunctus, another proculinine species. According to our study, additional broad-scale sampling will be necessary to clarify the ecological relationships between Sugiyamaella and xylophagous insects.

Overall, the occasional presence of Sugiyamaella, Phaffomyces, and

Spencermartinsiella in the gut of Guatemalan passalids may be attributable to geographical variation and/or substrate preferences of the passalid hosts of the yeasts.

4.3.3. Basidiomycete yeast lineages associated with the gut of Guatemalan passalids

The basidiomycete yeasts classified in Cryptococcus and Trichosporon were consistently found in association with the gut of Guatemalan passalids (60 isolates,

0.8%) (Figs. 4.3, 4.6). These basidiomycete yeasts exhibit a typical colony morphology, which makes them easy to distinguish from other yeasts. Recent studies have focused on the description and characterization of Trichosporon species in association with insects (Middelhoven et al. 2004, Molnar et al. 2004, Nakase et al. 2006, Fuentefria et al. 2008, Pagnocca et al. 2010, Gujjari et al. 2011). Specifically, Trichosporon scarabaeorum (Middelhoven et al. 2004), T. insectorum (Fuentefria et al. 2008), and T. xylopini (Gujjari et al. 2011) were first found associated with wood-feeding insects, and

T. siamense and C. humicola were isolated from the gut of passalids (O. disjunctus, P. interstitialis, P. punctiger, and V. hageni) (Meredith Blackwell, unpublished data).

Figure 4.6. Cryptococcus and Trichosporon species isolated from the gut of Guatemalan passalids. Maximum likelihood phylogenetic tree based on LSU sequences, and using Cryptotrichosporon anacardii as an outgroup (in gray). Final ML score -3671.43.

The ability to degrade and utilize wood components (e.g. cellulose and xylan) has been reported previously in several Trichosporon species. The relationship among soil, plant debris, and the gut of lignicolous insects supports a hypothesis that

Trichosporon yeasts play a fundamental role in the decomposition and recycling of wood components in the ecosystem (Berkov et al. 2007, Gujjari et al. 2011).

Basidiomycete yeasts in Trichosporon and Cryptococcus, therefore, may be involved in the degradation of wood components.

4.3.4. Comparison of yeast diversity within gut regions

The isolation and selection of yeast strains from the three gut regions of all passalids studied indicated that most yeast species were restricted to different gut regions (e.g. Fig. 4.7). The X-F yeast Sc. shehatae, however, was exceptional because it was recovered from the three gut regions in the majority of the beetles studied.

Additionally, the abundance of Sc. shehatae in the gut of Guatemalan passalids was in contrast to the situation in the temperate North American passalid, O. disjunctus, in which Sc. stipitis was the most common gut yeast and Sc. shehatae was a rare gut species. This finding suggests that the major changes in the yeast gut community composition of passalids might be driven by flora composition, geographical distribution, and perhaps greater passalid diversity.

No significant differences were found when comparing yeast species richness among gut regions of each Guatemalan passalid species (Table 4.3). Yeast diversity tended to increase in the PHG (e.g. Fig. 4.7), but the AGH was the only region that showed a statistically significant difference in terms of lower yeast species richness

(Table. 4.4).

Many years ago gut morphology was suggested as a potential phylogenetically informative character in passalids (Reyes-Castillo 1970). More recently, a hypothesis of evolutionary relationships among passalids has been based on gut morphology

(Fonseca et al. 2011). Their study described the AHG of Aulacocyclinae members as having none or few fermentation chambers, and proposed evolutionary changes including overall enlargement of the gut and addition of several fermentation chambers in members of the subfamilies Passalinae and Proculinae. The AHG has been suggested as the gut region where fermentation of sugars and polymers from the substrate occurs, primarily by bacteria (Nardi et al. 2006, Huang et al. 2010, Ceja-

Navarro et al. 2012). The evolutionary tend of the AHG from simple to complex may have determined by the incorporation of a diversity of microbes to incremental breakdown and utilization of the polymers and sugars from wood. The hypothesis, however, has not been tested explicitly.

These results suggest that the species composition of most passalid gut yeasts is the same in all the gut compartments. The reluctance to accept that yeasts are active in all gut compartments, however, comes from observations of Sc. stipitis, in which the filamentous yeast is attached to the PHG wall by a holdfast and presumably physiologically active, but it is not known if the yeasts in the other regions are active

(Lichtwardt 1957, Lichtwardt et al. 1999, Nardi et al. 2006).

It is clear, however, that gut-inhabiting yeasts must possess adaptations that allow them to survive the journey from the different insect gut parts to colonize the PHG. In addition to the observations on the colonization of the PHG by Sc. stipitis, we know something about other xylophagous beetles that contain related X-F yeasts: 1) Sc.

Figure 4.7. Percentage of yeasts identified by gut region. Passalid species: (a) O. sargi, (b) C. debilis, and (c) C. pullurensis. shehatae and Candida rhagii arrive at mycetosomes off the gut of the xylophagous beetles, Rhagium inquisitor and Leptuca rubra (Cerambycidae) (Grunwald et al. 2010);

2) yeasts were consistently isolated from the frass of wood-feeding beetles (e.g.

Candida endomychidarum, Yamadazyma clade) from cerambycid beetles (Calderon and Berkov 2012); Candida thailandica and Sc. lignicola from an undescribed insect 70

(Jindamorakot et al. 2007)]; and 4) the behavior in which adults and larval passalids require feeding on pre-digested wood and frass coating their galleries (Reyes-Castillo

1970, Boucher 2005).

Table 4.3. Repeated measures analysis of variance. Univariate tests of hypotheses for within subject effects. Greenhouse-Geisser Epsilon (G-G)= 0.8918 and Huynh-Feldt-Lecoutre (H-F-L), Epsilon = 0.9617.

Adj Pr > F Source DF Type III SS Mean Square F Value Pr > F G - G H-F-L Gut region 2 1.17 0.59 0.24 0.79 0.76 0.78 Gut region vs 12 25.52 2.13 0.88 0.58 0.56 0.57 Host species Error(Gut region) 46 110.99 2.41

Table 4.4. Generalized linear model (GLM).

Source DF Sum of Squares Mean Square F Value Pr > F Fore-Mid Gut (F-M) Model 6 19.34 3.22 0.93 0.50 Error 23 80.02 3.48 Corrected Total 29 99.37 Anterior Hindgut (AHG)

Model 6 36.90 6.15 2.69 0.04 Error 23 52.60 2.29 Corrected Total 29 89.50 Posterior Hindgut (PHG) Model 6 62.75 10.46 1.94 0.12

Error 23 124.05 5.39 Corrected Total 29 186.80

These results indicate that symbiotic yeasts can survive various physiological conditions in the interior of the insect gut, and they are also able to resist external environmental conditions protected within the frass (Calderon and Berkov 2012).

Further studies focused on the characterization of gut-inhabiting yeasts from lignicolous insects could intensify the yeast sampling effort to include more individuals by reducing the number of gut parts to be sampled and concentrating on the PHG region colonized almost exclusively by yeasts.

4.3.5. Comparison of the gut yeast community among host species

Based on rarefaction curves the yeast sampling apparently recovered only 56% of the total species richness associated with passalids (Fig. 4.8). Approximately 150 yeast species were predicted to occur with the 22 passalids collected in Guatemala. By extrapolation based on an estimated worldwide total of 960 passalid species (Schuster

2006), the yeast species richness should approach 6,500 species. If there is any degree of host specificity these data imply that the yeast diversity of the gut of lignicolous insects remains very poorly understood. To increase the number of yeast species, an estimated 19 individual passalids per species should be expected to recover 95% of the total yeast species richness (Fig. 4.8).

Yeast species richness was strongly influenced by the distribution of the host.

Passalids with broad distributions were those with the highest yeast richness (e.g. C. debilis, P. punctatus-creatus, and O. sargi), compared to those with restricted distributions (Fig. 4.3). Differences in yeast species richness among individual beetles of the same species did occur, however, due to occasional rare species (Fig. 4.9).

Several independent studies have focused on the characterization of the yeasts present in the gut of the temperate North American passalid, O. disjunctus, yet fewer studies examined yeasts in other passalid species.

30 Gut yeast Gut species 20

0 0 5 10 15 20 25 30 35 40 45 50 Host individuals

Figure 4.8. Rarefaction curve by yeast species and beetle individuals, using a species richness matrix (a = 3.793; b = 0.029, R2=0.998).

2.5

1.5

0.5 Log 10 (%Relative abundance) Log

0 1 5 9 13 17 21 25 29 33 37 41 45 49 53 57 61 65 69 73 77 Species Rank

Figure 4.9. Whittaker rank abundance curve. Forty-seven yeasts (57% of the total yeast species richness) were recovered from a single passalid individual.

The results of this and previous studies show that the yeast clades found currently in association with O. disjunctus (Scheffersomyces, Spathaspora,

Sugiyamaella, Kazachstania, Cryptococcus, and Trichosporon) have similar associations among Guatemalan passalids. The one exception was members of the

Kazachstania clade, which were not isolated from Guatemalan passalids, and yeasts in the Phaffomyces and Spencermartinsiella clades, which were found in association with

Guatemalan passalids for the first time.

4.3.6. New perspectives

The lack of macro- and micro-morphological characters in the yeasts and yeast- like forms is well recognized. Due to this, we applied a yeast sampling methodology that allowed the isolation and identification of gut-inhabiting yeasts, through an exhaustive selection of yeast colonies using passalid individuals as sampling units. This methodology reduces differences in the yeast species composition by geographic distribution, feeding-behavior, and/or stage of development within host individuals of the same species. We isolated several undescribed species, which will inform the phylogenetic relationships of yeasts.

These yeasts may have great potential in the biotechnology industry due to their ability to ferment wood components. The application of this methodology among passalids present in Africa, Asia, and Australia, and across different families of lignicolous beetles would help to elucidate the dynamics of yeast composition associated with wood-feeding arthropods. The isolation of several strains of the same species from different hosts would provide a generic resource that can be used for the study of genetic variation among yeasts.

The consistent and dominant presence of the X-F yeasts Sc. shehatae and Sc. stipitis, and the poor colony morphology differences among yeast species, hinders the study of the total diversity of gut-inhabiting yeast by classic microbiological techniques.

The application of next-generation sequencing would increase accuracy in the estimation, comparison, and dynamics of the gut-inhabiting yeasts associated with wood-feeding beetles.

4.4. Conclusions

This work comprises the first extended survey of cultivable yeasts associated with passalid beetles in Latin America, and contributes significantly to the knowledge of yeast diversity in Guatemala. The findings of this work establishes that the gut- inhabiting yeast mycobiota from Guatemalan passalids is dominated by the X-F yeasts

Sc. shehatae and Sc. stipitis, as well as several undescribed ascomycete yeasts related to the Scheffersomyces, Spathaspora, Lodderomyces, and Sugiyamaella clades.

Variation in the yeast species richness in the gut of Guatemalan passalids was found between and among passalid species, as shown in the erratic presence of yeast members in the Sugiyamaella, Lodderomyces, Spencermartinsiella, and Phaffomyces clades; the results also support the hypothesis that these yeasts are acquired from the substrate where host beetles are feeding. The gut of Guatemalan passalids was also rich in basidiomycete yeasts in the genera Trichomonascus and Cryptococcus, known for their ability to utilize and degrade many wood components. The relationships between cellobiose- and D-xylose-fermenting yeasts and wood-feeding beetles was confirmed. The yeast mycobiota in the gut of lignicolous beetles may play an important role in the degradation of wood components during digestion through enhancing the

anaerobic conditions inside of the gut by the uptake of oxygen, and the production of alcoholic compounds and carbon dioxide necessary for anaerobic respiration. The gut- inhabiting yeasts should have adaptations that allow them to pass through the different gut compartments to finally colonize the posterior hindgut.

CHAPTER 5: DIVERSITY OF YEASTS ASSOCIATED WITH THAI PASSALID BEETLES

5.1. Introduction

All major groups of wood-feeding insects (e.g. beetles, wood roaches, and termites) lack efficient enzyme systems to degrade plant cell wall components; rather, they posses symbiotic bacteria and fungi that colonize their guts and digest the substrate (Reyes-Castillo 1970). Passalids have overlapping generations and subsocial behavior, characterized by parental care that includes feeding the larvae with a mixture of predigested wood and feces that is rich in microbes. This behavior ensures the horizontal transfer of essential gut-inhabiting microbes to the offspring. Without symbiotic microbiota the wood-feeding insects do not survive (e.g. Rao et al. 2007,

Tanahashi et al. 2010).

The family Passalidae is divided into five subfamilies. Members of two subfamilies Proculinae and Passalinae are restricted to North and South America, and members in Aulacocyclinae, Solenocylinae, and Macrolininae are widespread in Asia,

Australia, and Africa (Boucher 2005, Fonseca et al. 2011). Specifically, Kon et al. (2001) reported fourteen species of passalids classified in the genera Ceracupes, Taeniocerus

(subfamily Aulacocyclinae), Leptaulax (subfamily Solenocyclinae), Aceraius,

Macrolinus, Ophrygonius, and Pelopides (subfamily Macroliniae) from Thailand. These species spend their lives in dead trees within galleries and feed exclusively on rotting wood as their passalids relatives in the New World.

Yeasts from the gut of passalids collected in the United States, Guatemala, and

Panama have the rare ability to ferment D-xylose, a five-carbon sugar that constitutes the backbone of hemicellulose, a major component of plant cell walls. The application of

xylose-fermenting (X-F) yeasts to industrial processes have attracted interest as discussion of depletion of fossil fuels increases. The production of ethanol could be dramatically increased by the fermentation of hemicellulose, which would otherwise be discarded as waste.

The ascomycete yeast Scheffersomyces stipitis is found consistently in the larvae and adults of the passalid beetle Odontotaenius disjunctus (Suh et al. 2003). This yeast has the ability to degrade and ferment several sugar components of wood polysaccharides. The microbial degradation of cellulose provides intermediate products such as cellobiose and glucose, which can be used directly by the host insect or as a substrate for fermentation. Fermentation in the gut by yeasts may increase the nutritional quality of the insect food materials (Steinkraus 1994). In addition, CO2 produced by yeasts in alcoholic fermentations often enhances the anaerobic conditions for the bacterial communities.

Several recent studies focused on the characterization of yeast diversity in

Thailand from soil, food products, plant tissues, immunocompromised patients, and insects resulted in the discovery new yeast taxa (Am-In et al. 2008, Imanishi et al. 2008,

Jindamorakot et al. 2008, Limtong et al. 2008a,b,c, 2009, 2010a,b, 2011, 2012 a,b,c,

Nakase et al. 2008, 2009a, 2010a,b,c, 2011a,b,c,d, 2012, Boonmak et al. 2009,

2011a,b, Kishida et al. 2009, Buaban et al. 2010, Kaewwichian et al. 2010, 2012,

Tammawong et al. 2010, Burke et al. 2011, Chang et al. 2011, Koowadjanakul et al.

2011, Kurtzman 2011, Meyer et al. 2011, Nitiyon et al. 2011a,b). Until now, however, no studies have investigated the diversity of yeasts from the gut of Thai passalids.

The aim of this work is to describe the diversity of ascomycete and basidiomycete yeasts from the gut of Thai passalids and to compare it with previous studies carried out in the United States, Panama, and Guatemala. The gut of Thai passalids is rich in ascomycete and basidiomycete yeasts, in common with the results of previous studies in the New World. New X-F yeasts classified in the Spathaspora and

Scheffersomyces clades, however, were isolated from the Thai passalids. For example a close relative of Candida insectamans (Spathaspora clade), which is unable to

ferment D-xylose, dominated the

gut mycota of the Thai passalids.

Ton Nam This finding suggests a major

change occurs in gut yeast

composition among passalids from Khlong Lan distant localities. The presence of

basidiomycete yeasts in

Trichosporon and Cryptococcus Kaeng Krachan was also shown, and the gut of

Thai passalids was rich in

Trichosporon species. This study

extends the characterization and

diversity of gut-inhabiting yeasts

associated with wood-feeding !""#$%# beetles by contrasting passalids Figure 5.1. Collecting sites in Thailand. from New and Old Worlds.

5.2. Materials and methods

5.2.1. Insect collection

A total of 25 adult beetles were collected in three national parks in Thailand over a 20-day period. The major habitat type at these sites was one of tropical jungles, where the diversity of passalid species is known to be high (Kon et al. 2001, Boucher 2005)

(Fig. 5.1). The specimens collected were classified in three subfamilies, Aulacocyclinae,

Solenocylinae, and Macrolininae. Beetles were collected by directly searching the galleries located inside rotted logs and between loose bark and wood.

5.2.2.Yeast isolation and culture

The methodology for yeast isolation and culture was explained earlier (Chapter 4,

Materials and methods, yeast isolation and cultures). About 300 yeast strains were isolated and collection data recorded. Cultures are stored in 15% glycerol at -80 °C at

The Louisiana State University Museum of Natural Sciences (Department of Biological

Sciences, Louisiana State University, Louisiana, United States) and deposited in the culture collection at the National Center for Genetic Engineering and Biotechnology

(BCC).

Other yeast culture techniques and physiological characterizations were carried out by the methods recommended by Yarrow (1998), Barnett et al. (2000), and

Kurtzman et al. (2011).

5.2.3. Molecular studies and phylogenetic analyses

Molecular studies and phylogenetic analyses were carried out following the methods explained previously (Chapter 4, Materials and methods, molecular and phylogenetic analyses). Sequences were deposited in GenBank with the following

accession numbers: SSU (XXXXXX − XXXXXX), ITS (XXXXXX − XXXXXX) and LSU

(XXXXXX − XXXXXX).

5.3. Results and discussion

5.3.1. Ascomycete yeast diversity among Thai passalids

The identification of 300 yeasts strains isolated from 20 Thai passalids demonstrated the consistent presence of a new species closely related to Candida insectamans (~150 isolates, 50% of total isolates, with 25 nucleotide differences in the

D1/D2 region of the LSU locus and a multilocus phylogenetic analysis in the strains

TH522 and TH620) (Figs. 5.2, 5.3). Multiple strains of the new species, although classified in the Spathaspora clade, did not ferment xylose under the laboratory conditions. The inability to ferment glucose corresponds to its close relationship to the non X-F yeast Ca. insectamans (Table 5.1).

The biochemical characterization of the new species differs from Ca. insectamans in a number of ways, but they share the ability to ferment glucose and maltose and assimilate the wood components, D-xylose, cellobiose, and soluble starch, among others (Table 5.1). This finding is a major difference from New World passalids in which the X-F yeasts Sc. stipitis and Sc. shehatae are dominant and have constant presence (Fig. 5.2).

The gut of Thai passalids contained some yeast members in the

Scheffersomyces clade including Sc. stipitis, and undescribed species closely related to

Sc. shehatae. Strains closely related to Sp. passalidarum and Candida lignicola

(Spathaspora clade) (TH214, TH219, TH752, and TH799; Fig. 5.2) were able to ferment xylose faster than their closest relatives. Specially, TH214 showed a faster rate of

xylose fermentation than any previously isolated strain in the Spathaspora clade with evidence of appearing at day 4 of incubation rather than up to two weeks. Due to its rapid fermentation rate, this strain has potential for biotechnological applications in the production of biofuels (Fig. 5.3).

Undescribed ascomycete yeasts classified in other clades also were found in the gut of Thai passalids: Metschnikowia, Lodderomyces, Schwanniomyces, and

Sugiyamaella (Fig. 5.2). Previous studies (Zhang et al. 2003, Suh et al. 2005, Nguyen et al. 2006, Houseknecht et al. 2011) focused on characterization of yeasts from passalids in the New World demonstrated that the yeast clades Scheffersomyces, Lodderomyces, and Spathaspora in the family Debaryomycetaceae are the most common yeasts in the gut of North American passalids.

This is the first report of members of Schwanniomyces in relation with passalids.

Species of this clade previously were isolated from substrates such as soil, fermented products, and tanning fluid in several countries including Brazil, France, and South

Africa. They all share the ability to assimilate D-xylose (Kurtzman et al. 2011).

5.3.2. Diversity of basidiomycete yeasts associated with the gut of Thai passalids

Several species of basidiomycete yeasts from the gut of Thai passalids were identified as Trichosporon asahii, T. siamense, T. dermatis, T. ovoides, T. lignicola,

Cryptococcus humicola, and C. laurentii (61 isolates, 20% of the total strains identified)

(Fig. 5.4).

61!

3. fermenting yeasts are denoted by yeasts fermenting denoted are - 26569.0 Xylose

- score score

150 Final ML ML Final was used as an outgroup. aswas used an

fermenting yeasts by black stars. Number of strains blackyeasts fermenting Number stars. names. of underby identified are clade - xylose -

Yeast lineages associated with the gut of New passalidsWorld Yeast gutThai and associated blue) (inlineages with the passalids (in

! 48 Figure 5.2. Figure phylogenetic onchartreuse).likelihood based tree locus.Maxiumum LSU non anda star red pombeSchizosaccharomyces

100 Candida bolitoreri Candida terraborum Candida tropicalis 100 Lodderomyces elongisporus TH415 Candida subhashii

100 Sche!ersomyces coipomoensis Sche!ersomyces stipitis 96 97

77 She!ersomyces segobiensis Sche!esomyces shehatae 100 70 Sche!ersomyces lignosus Sche!ersomyces insectosa Spathaspora passalidarum AMERICA! TH272 Candida lyxosophila 57 TH287 TH540 ASIA! TH290 Candida insectamans TH620 84 TH522 Spathaspora arborariae

98 Candida jeffriesii 100 HU3237

96 HU2413 95 HU2467

75 72 HU381 Candida materiae HU1139 AMERICA! 75

99 HU1121 HU2619 HU2621 HU2627 HU2620 HU1124

Figure 5.3. Maximum likelihood tree based on a multilocus dataset. The molecular markers SSU, LSU, ITS, and RPB1 in a 3367-character matrix for the Spathaspora clade (in blue). The dominant species consistently present in the gut of Thai passalids are represented by the strains TH620 and TH522. Candida tropicalis (Lodderomyces clade) was used as an outgroup taxon (in black). X-F yeasts denoted by red stars and non X-F yeasts by black stars. Numbers above or below branches refer to bootstrap values out of 1000 repetitions. Final ML score –12347.41.

Table 5.1. Comparison of the biochemical characterization of some strains of the dominant yeast species isolated from the gut of Thai passalids, and their close relative Ca. insectamans. Test TH180 TH216 TH217 Ca. insectamans Fermentation F1 D-Glucose +++ +++ ++f s F2 D-Galactose - - - - F3 Maltose +++d +++d - + F4 α-Methyl-D-glucoside - - - - F5 Sucrose - - - - F6 α,α- Trehalose - - - + F7 Melibose - - - - F8 Lactose - - - - F9 Cellobiose - - - - F10 Melezitose - - - - F11 Raffinose - - - - F12 Inulin - - - - F13 Starch - - - - F14 D-Xylose - - - - Assimilation C1 D-Glucose + ++f + + C2 D-Galactose - - - - C3 L-Sorbose - - - - C4 D-Glucosamine - - + - C5 D-Ribose + - + s C6 D-Xylose + +f + + C7 L-Arabinose - - - - C8 D-Arabinose - - - - C9 L-Rhamnose - - - - C10 Sucrose + + + - C11 Maltose + + + + C12 Trehalose + + + + C13 α-Methyl-D-glucoside + + + s C14 Cellobiose + + + + C15 Salicin + + + + C16 Arbutin + + - ? C17 Melibiose + + + - C18 Lactose + + - - C19 Raffinose - - - - C20 Melezitose + + + - C21 Inulin + + + - C22 Soluble Starch + ++ + + C23 Glycerol - - + v C24 Erythritol - - - - C25 Ribitol + + + + C26 Xylitol - - - - C27 L-Arabinitol - - - ? C28 D-Glucitol + + + + C29 D-Mannitol + + + + C30 Galactitiol - - - - C31 myo-Inositol - - - - C32 D-Glucono-1,5-lactone + + - ? C33 2-Keto-D-gluconate ++ + + + C35 D-Gluconate - - - - C36 D-Glucuronate - - - - C37 D-Galacturonic acid ? C38 DL-Lactate + + - - C39 Succinate + + - + C40 Citrate + + - + C41 Methanol + - - - C42 Ethanol + - - ? 85

(Table 5.1 continued) Test TH180 TH216 TH217 Ca. insectamans C43 Propane 1,2 diol + - + ? C44 Butane 2,3 diol + - - ? C45 Quinic acid - - - ? C46 D-Glucarate - - - ? Temperature T1 25 °C + + + + T2 30 °C ++ ++ ++ + T3 35 °C - ++ +++ + T4 37 °C - + ++ + Osmotic Test O1 0.01% Cycloheximide - + - - O2 0.1% Cycloheximide - + - - O3 1% Acetic Acid - - - - O4 50% D-Glucose - + - - O5 60% D-Glucose - + - - O6 10% NaCl - - - - O7 16% NaCl - - - - Vitamins V1 w/o Vitamins + - - - V2 w/o Myo-Inositiol + + + ? V3 w/o Pantothenate + + + ? V4 w/o Biotin - - - ? V5 w/o Thiamin - - - ? V6 w/o Biotin and Thiamin + - - ? V7 w/o Pyridoxine + d + ? V8 w/o Pyrid. andThiam - - + ? V9 w/o Niacin + d + ? V10 w/o PABA + d +d ?

The characterization of Trichosporon is important because a number of species are human and animal pathogens, such as T. cutaneum, T. gracile, T. jirovecii, T. mucoides, and T. ovoides (Kurtzman et al. 2011). Trichosporon siamense was the most common basidiomycete yeast isolated from the gut of Thai passalids. This differs from the situation in Trichosporon in Guatemalan passalids in which the most common basidiomycete species was Cryptococcus musci (Fig. 4.8). Trichosporon siamense was described from insect frass in Thailand, and it is able to assimilate several wood components including D-xylose, soluble starch, and cellobiose (Nakase et al. 2006). As other studies have shown, basidiomycete yeasts in the gut of lignicolous beetles may play different roles in the degradation of wood components but also in controlling the gut mycota, perhaps by producing killer factors, and in the degradation of xenobiotic compounds (Molnar et al. 2004, Fuentefria et al. 2008, Gujjari et al. 2011). 86

Figure 5.4. Cryptococcus and Trichosporon species isolated from the gut of Thai passalids. Maximum likelihood phylogenetic tree based on LSU sequences using Cryptotrichosporon anacardii as an outgroup (in gray). Strains isolated from Thai passalid denoted with TH. Final ML score - 48783.90.

This study has expanded the characterization of gut yeasts associated with wood-feeding beetles classified in the family Passalidae by addressing a new geographical region in the Eastern Hemisphere (Thailand) and comparing it with the

Western Hemisphere (North America). Previous studies focused on the characterization of yeasts associated with the gut of North American passalids have shown that yeasts classified in the clades Spathaspora, Scheffersomyces, Lodderomyces, and

Sugiyamaella are abundant. Similar patterns were present in Thai passalids analyzed in this study. These same clades were found in Thai passalids, but as might be expected there were differences in species composition. The major difference, however, is not in the taxonomic identity of the yeasts, but rather their physiology because the dominant

Thai yeasts are unable to ferment xylose. The most common yeast, an undescribed species classified in the Spathaspora clade, is closely related to Ca. insectamans that also is unable to ferment D-xylose. The basidiomycete yeasts were abundant and may play an important role in the decomposition of wood components in the gut of Thai passalids or perhaps they are opportunistic and take advantage of the wood wastes in the passalid galleries.

CHAPTER 6: PURIFYING SELECTION MAINTAINS XYLOSE REDUCTASE ACTIVITY AMONG ASCOMYCETE YEASTS

6.1. Introduction

D-xylose is the backbone sugar of the hemicellulose component of plant cell walls and one of the most abundant renewable carbon resources on Earth. About 500 yeasts assimilate D-xylose, but only a few species of fungi, including approximately 30 described ascomycete yeasts among 1000 known species, produce ethanol through the fermentation of D-xylose (Jeffries 2006). Among yeasts this biochemical ability is restricted primarily to members of the Debaryomycetaceae, including Debaryomyces,

Lodderomyces, Meyerozyma, Scheffersomyces, Spathaspora, and Yamadazyma. Only

a few yeasts outside of D-Xylose! Debaryomycetaceae, such as

Brettanomyces naardenensis, Ogataea XYL1! NAD(P)H! Xylose reductase! XR- EC 1.1.1.21! NAD(P)+! Xylitol! siamenses, and Pachysolen tannophilus OH!

OH! have the ability to ferment D-xylose OH! OH! OH! XYL2! NAD+! (Kurtzman et al. 2011). Xylitol dehydrogenase ! XDH-EC 1.1.1.9! NADH! Xylulose! To ferment D-xylose, ascomycete

yeasts express three enzymes, xylose XYL3! Xylulose kinase! XK-EC 2.7.1.17! reductase, (XR, EC 1.1.1.21), xylitol Xylulose-5-phosphate! dehydrogenase (XDH, EC 1.1.1.9), and

xylulose kinase (XK, EC 2.7.1.17) (Fig.

Pentose Phosphate pathway! 6.1). These enzymes catalyze the

conversion of D-xylose to xylitol to D- Figure 6.1. D-xylose fermentation pathway (after Jeffries 2003).

xylulose-5-phosphate. D-xylulose-5-phosphate is then incorporated into the pentose phosphate pathway (PPP) to be catabolized to ethanol. The xylose enzymes are codified by the XYL1, XYL2, and XYL3 genes respectively.

The importance of xylose reductase (XR) is two fold, based on its ability to ferment plant biomass to ethanol and to produce xylitol, a low-calorie anticariogenic natural sweetener widely used as a sucrose substitute. The possibility of industrial use driven a great amount of research to identify species, strains, and more efficient enzymes (Batt et al. 1986, Bolen et al. 1986, van Zyl et al. 1989, Singh and Schugerl

1992, Billard et al. 1995, Habenicht et al. 1999, Hacker et al. 1999, Prathumpai et al.

2003, Park et al. 2005, Hahn-Hagerdal et al. 2007, Chen et al. 2009, de Faria et al.

2009, Kokaew et al. 2009, Sampaio et al. 2009, Mach-Aigner et al. 2010, Zou et al.

2010, Xu et al. 2011, Zhang et al. 2011, Jeon et al. 2012). Because of the promise of industrial applications of D-xylose fermentation, the fermentation rate of several species of yeasts is well characterized (Jeffries 1986, Sreenath et al. 1986, Prior et al. 1988,

Jeffries and Kurtzman 1994, Yang et al. 1994, Yang and Jeffries 1997, Jeffries and Shi

1999, Shi et al. 1999, Jeffries and Jin 2000, Shi et al. 2000, 2002, Jin et al. 2003,

Rodrigues et al. 2008, Lee et al. 2011, Wohlbach et al. 2011). Overexpression, homologous and heterologous expression, and direct mutagenesis studies of xylose genes have been used successfully to enhance the quantity of ethanol production by

Sc. stipitis and Saccharomyces cereviceae (Dahn et al. 1996, Jin and Jeffries 2003,

2004, Jin et al. 2003, Jeffries 2006, Lu and Jeffries 2007, Ni et al. 2007, Koivistoinen et al. 2012).

In particular xylose reductase (XR), an aldose reductase with 270-290 amino acids and a molecular mass of approximately 37 kDa (Chu and Lee 2006), has been most studied. This enzyme catalyzes the reduction of D-xylose through the incorporation of hydrogen obtained from the co-factor NADPH or NADP. The change in cofactor preferences is proposed to maintain the redox balance between nicotinamide cofactors under a variety of growth conditions, a physiological adaptation present in X-F yeasts (Woodyer et al. 2005). XYL1 is also present in non X-F yeasts, and the presence is attributed to the ability of the majority of fungi to assimilate this sugar (Mayr et al.

2000, 2003, Nidetzky et al. 2003). The gene is absent in yeasts that do not assimilate xylose, apparently due to the loss of selection pressure (Wohlbach et al. 2011). The

XRs have several other physiological roles: a) recognition of other aldoses such as L- arabinose, D-ribose, and D-lyxose; 2) detoxification of lignocellulosic hydrolysates; and

3) recognition of several aldehydes with non-reacting parts that represent a wide range of structural frames (Mayr et al. 2000, 2003, Mayr and Nidetzky 2002, Almeida et al.

2007, 2008).

Wohlbach et al. (2011) showed that the sugar transporters and cell-surface proteins in Sc. stipitis, Ca. tenuis, and Sp. passalidarum have been exposed to gene expansions, likely related to an environment rich in sugars, which may occur in the gut of insects (Fig. 6.2). These authors also measured the induction of genes involved in carbohydrate transport and metabolism, β-glucosidases, cellulases, and redox regeneration of NADPH. These are physiological adaptations exclusively present in the

X-F yeasts when they grow in the presence of D-xylose. These findings support a hypothesis that the fermentation ability of yeasts has included several physiological

adaptations in other catabolic and respiratory pathways (Jeffries et al. 2007, Wohlbach et al. 2011, Balagurunathan et al. 2012).

The aim of this study was to perform a phylogenetic study of xylose reductase present in several closely and distantly related species of ascomycetes to detect any signals of selection acting on this enzyme.

6.2. Materials and methods

6.2.1. Yeast isolates and cultures

This research has led to the discovery of new species of yeasts that can ferment and/or assimilate D-xylose. These yeasts were isolated from rotted wood in Louisiana,

United States (Chapter 2), from gut-inhabiting yeasts associated with wood roaches classified in Cryptocercidae collected in the Appalachian Mountains at the border of

Tennessee and North Carolina, United States (Chapter 3), and from passalid beetles

(Passalidae, Coleoptera) collected in Guatemala and Thailand (Chapters 4 and 5, respectively) (Table 6.1). All strains were identified by molecular means using traditional molecular markers (see Chapters 2, 3, and 4 for details), and confirmation of the ability to ferment D-xylose was tested using Durham tubes (Kurtzman et al. 2011) (Table 6.1).

6.2.2. DNA extraction and xylose reductase (XYL1) PCR amplification

Genomic DNA was extracted using a Wizard® Genomic DNA purification kit

(Promega). The concentration, integrity, and purity of total extracted DNA were confirmed by gel electrophoresis in 0.8% agarose in 0.5 ✕ Tris-Borate-EDTA (TBE) buffer. The ~600 bp fragment of the XYL1 was amplified using the following degenerate primers, XYL1-forward (5’-GGTYTTYGGMTGYTGGAARSTC-3’) and XYL1-reverse (5’-

AAWGATTGWGGWCCRAAWGAWGA-3’), and the PCR protocol used by Urbina and

Blackwell (2012). The purified PCR products were sequenced in both directions by

Beckman Coulter Genomics (Danvers, MA).

Table 6.1. GenBank accession numbers for the XYL1 nucleotide sequences used in this study. Sequences generated in this work are shown in boldface.

X-F Accession Identification Yeast isolate code Country ability number Ca. albicans SC5314 No - XM715658 Ca. dubliniensis CD36 No - XM2420527 Ca. parapsilosis CAB50-2638 No - EF033247 Ca. parapsilosis BG090809.6.8.4.1.11 Yes Guatemala JQ235706 Ca. parapsilosis BG090816.9.1.1.3.13 Yes Guatemala JQ235724 Ca. tenuis CBS 4435 Yes - AF074484 Ca. tropicalis IFO 0618 Yes - AB002105 Ca. tropicalis BG090819.10.1.1.2.19 Yes Guatemala JQ235725 Debaryomyces hansenii CBS 767 No - CR382138 Lodderomyces sp. BG10-6-16-3-A3 - Thailand JQ008821 Lodderomyces sp. BG10-6-16-17A-2-1 - Thailand JQ008815 Meyerozyma guilliermondii ATCC 6260 Yes - XM1486569 Neurospora crassa ATCC 10333 No AY876382 Ogataea siamensis N22 Yes - FJ763639 Penicillium marneffei ATCC 18224 No XM2150173 Rhizomucor pusillus NBRC 4578 No - AB540162 Sc. cryptocercus NRRL Y-48824 Yes USA JQ714031 Sc. cryptocercus NRRL Y-48823 Yes USA JQ714026 Sc. cryptocercus NRRL Y-48826 Yes USA JQ714029 Sc. cryptocercus RG11-03-01-05-P2 Yes USA JQ714024 Sc. cryptocercus RG11-03-01-05-P3 Yes USA JQ714025 Sc. cryptocercus RG11-03-01-05-A2 Yes USA JQ714023 Sc. cryptocercus RG11-03-01-05-M1 Yes USA JQ714030 Sc. cryptocercus RG11-03-01-05-F3 Yes USA JQ714028 Sc. cryptocercus RG11-03-01-06-FM1 Yes USA JQ714022 Sc. cryptocercus RG11-03-01-07-P2 Yes USA JQ714027 Sc. ergastensis BG090815.8.6.1.2.13 Yes Guatemala JQ235727 Sc. ergastensis BG090809.6.8.4.3.28 Yes Guatemala JQ235707 Sc. illinoinensis W07-11-15-9-2-1 Yes USA JQ235694 Sc. insectosa NRRL Y-12854 Yes - JQ235697 Sc. lignosus NRRL Y-12856 Yes - JQ235693 Sc. quercinus NRRL Y-48825 Yes USA JQ008829 Sc. shehatae NRRL Y-12858 Yes - JQ235691 Sc. shehatae NRRL YB-2264 Yes - JQ235692 Sc. shehatae BG090809.6.8.4.3.36 Yes Guatemala JQ235708 Sc. shehatae BG090816.9.10.1A.1.9 Yes Guatemala JQ235732 Sc. shehatae BG090816.9.10.1A.1.11 Yes Guatemala JQ235733 Sc. shehatae BG090815.8.3.1.1.2 Yes Guatemala JQ235713 Sc. shehatae BG090816.9.1.1.2.7 Yes Guatemala JQ235723 Sc. shehatae BG090815.8.5.1.1.9 Yes Guatemala JQ235720 Sc. shehatae BG090815.8.5.1.2.13 Yes Guatemala JQ235721 Sc. shehatae BG090908.4.1.1.3.25 Yes Guatemala JQ235730 Sc. shehatae BG090808.5.4.1.3.26 Yes Guatemala JQ235704 Sc. shehatae BG090808.5.4.1.3.27 Yes Guatemala JQ235705 Sc. stipitis NRRL Y-7124 Yes - JQ235696 Sc. stipitis BG090819.10.1.1.3.35 Yes Guatemala JQ235726 Sc. stipitis BG090908.4.1.1.3.35 Yes Guatemala JQ235731

(Table 6.1 continued) X-F Accession Identification Yeast isolate code Country ability number Sc. stipitis BG090815.8.5.1.1.5 Yes Guatemala JQ235719 Sc. stipitis BG090816.9.1.1.2.6 Yes Guatemala JQ235722 Sc. stipitis BG090908.5.1.1.1.7 Yes Guatemala JQ235736 Sc. stipitis BG090802.1.2.1.1.2 Yes Guatemala JQ235710 Sc. virginianus W07-10-04-4-6-2 Yes USA JQ235695 Scheffersomyces sp. BG090802.1.2.1.1.1 Yes Guatemala JQ235709 Scheffersomyces sp. W07-09-15-1-3-2 Yes USA JQ008829 Scheffersomyces sp. BG090802.1.2.1.1.6 Yes Guatemala JQ235711 Scheffersomyces sp. BG090809.6.7.3.1.6 Yes Guatemala JQ235698 Scheffersomyces sp. BG090809.6.7.3.1.7 Yes Guatemala JQ235699 Scheffersomyces sp. BG090809.6.7.3.1.9 Yes Guatemala JQ235700 Scheffersomyces sp. BG090802.1.2.1.2.16 Yes Guatemala JQ235712 Scheffersomyces sp. BG090815.8.3.1.3.23 Yes Guatemala JQ235716 Scheffersomyces sp. BG090815.8.3.1.3.25 Yes Guatemala JQ235717 Schwanniomyces sp. BG10-6-11-37-B8 - Thailand JQ008827 Schwanniomyces sp. BG10-6-11-29-12A-A3 No Thailand JQ008816 Spathaspora sp. BG090809.6.7.3.3.31 Yes Guatemala JQ235702 Spathaspora sp. BG10-6-11-33-M5 - Thailand JQ008822 Spathaspora sp. BG10-6-11-37-B1 - Thailand JQ008823 Spathaspora sp. BG10-6-11-37-B2 - Thailand JQ008824 Spathaspora sp. BG10-6-11-37-B11 - Thailand JQ008825 Spathaspora sp. BG10-6-11-37-B5 - Thailand JQ008826 Spathaspora sp. BG10-6-11-37-B13 No Thailand JQ008828 Spathaspora sp. BG090908.5.1.1.1.2 Yes Guatemala JQ235734 Spathaspora sp. BG10-6-16-2-A6 No Thailand JQ008820 Spathaspora sp. BG090815.8.3.1.1.3 Yes Guatemala JQ235714 Spathaspora sp. BG090908.5.1.1.1.3 Yes Guatemala JQ235735 Spathaspora sp. BG090803.1.7.9.1.5 Yes Guatemala JQ235718 Spathaspora sp. BG10-6-11-30-6P-A1 - Thailand JQ008819 Spathaspora sp. BG090815.8.3.1.2.10 Yes Guatemala JQ235715 Spathaspora sp. BG10-6-11-29-12A-A2 No Thailand JQ008814 Spathaspora sp. BG10-6-11-29-12A-M6 No Thailand JQ008817 Spathaspora sp. BG090908.4.1.1.2.19 Yes Guatemala JQ235728 Spathaspora sp. BG090908.4.1.1.2.20 Yes Guatemala JQ235729 Spathaspora sp. BG090809.6.7.3.2.23 Yes Guatemala JQ235701 Sugiyamaella sp. BG090809.6.7.3.3.34 Yes Guatemala JQ235703 Sugiyamaella sp. BG10-6-11-29-12A-M8 - Thailand JQ008818 Tetrapisispora blattae CBS 6284 No - HE806321 Torulaspora delbrueckii CBS 1146 No - XM3681621 Zygosaccharomyces rouxii CBS 732 No - CU928173

6.2.3. Phylogenetic analyses

Contig sequences and sequencing manipulations were done with Se-AL v2.01a11 (http://tree.bio.ed.ac.uk/software/seal/) and MESQUITE v2.74 (Maddison and

Maddison 2005). The sequences were aligned in the online interface MAFFT v6.859

(http://mafft.cbrc.jp/alignment/software/) under constraints of global homology (G-INS-i) as an advanced alignment strategy. Ambiguous sequence alignment ends were

eliminated in all the alignments as well as ambiguous indels. Maximum likelihood (ML) phylogenetic inference was performed in RAxML-VI-HPC (Stamatakis 2006) using a general time reversible model with a gamma distribution of site rate variation

(GTRGAMMA). Final ML support was estimated using 1000 bootstrap replicates. The sequences for XR were obtained using SEQUIN v11.9

(http://www.ncbi.nlm.nih.gov/Sequin/) with an alternative yeast nuclear codon bias

(Ohama et al. 1993, Wohlbach et al. 2011). Tree editing was done with FigTree v1.3.1 software (http://tree.bio.ed.ac.uk/software/figtree/). GenBank sequence accession numbers are indicated in Table 6.1.

6.2.4. Valuation of the rate of adaptive non-synonymous substitution to synonymous substitution (vA)

The software HyPhy v2.11 (www.hyphy.org, Kosakovsky-Pond et al. 2005) was used to evaluate the type of selection acting on XR using DNA alignments obtained in

MAFFT v6.859 and a phylogenetic tree obtained in RAxML v7.0.4 (Stamatakis 2006).

DnaSP v5.10.01 (Librado and Rozas 2009) was used to compute the statistical tests,

Tajima’s D and Fs.

6.3. Results and discussion

The XYL1 gene was successfully amplified by PCR from a variety species of yeasts that ferment or assimilate D-xylose (Chapter 2, Fig. 2.5). The yeast phylogenetic tree based exclusively on XYL1 sequences indicates that yeasts with a high rate of D- xylose fermentation belong to the sister clades Yamadazyma (represented by Candida tenuis), Scheffersomyces, and Spathaspora (Fig. 6.2). The yeasts classified in these clades are found in association with lignicolous insects and plant tissues (Fig. 6.2).

Scheffersomyces PGFYCGDG! O. siamensis Debaryomyces PGFYCGDD! S. shehatae M. guilliermondii S. stipitis S. cerevisiae

C. glabrata C. tenuis Saccharomycetaceae PGNEKEYGEG! CUG

C. maxii Spathaspora P. marneffei PGFYCGDG! WFAPX TE! Rhizomucor pusillus N. crassa C. tropicalis PG G

PGWTAXDGK!

S. ergatensis

Lodderomyces PGFYCGED! P. tannophilus

Figure 6.2. Phylogenetic reconstruction of the xylose reductase gene performed in RAxML-HLP under a general time reversible model with a gamma distribution of site rate variation (GTRGAMMA). Maximum likelihood support was estimated using 1000 bootstrap replicates (final ML score -11442.13). Rhizomucor pusillus was used as an outgroup (shown in bold). Xylose-fermenting yeasts are denoted by blue branches. The majority of X-F yeasts are classified In the CUG clade (alternative decoding of the CUG codon as serine instead of leucine). Conserved amino acids shown in blue.

These results are consistent with previous multilocus phylogenetic studies that found trees with similar topology among X-F yeasts (Wohlbach et al. 2011). The XRs at the N-terminal region have the conserved amino acids 49-aspartic acid (D), 51-alanine

(A), and 54-tyrosine (Y), part of the catalytic domain glycine (G)X3DXAX2Y. The leucine

(L)X8DX4-histidine (H), and the GX3GXG domains are highly conserved across ascomycetes. The amino acids 83-lysine (K), 132-proline (P), and 167-K form part of

the xylose-binding pocket and are also conserved (Fig. 6.3). The region at the C- terminal region of XRs is mainly implicated in the coenzyme binding to the IPKS domain and 279-arginige (R) (Chu and Lee 2006). Due to the evidence that XRs present in yeasts can utilize both NADP and NADPH cofactors, selection pressure may have been acting primarily on the N-terminal region.

At the C-terminal region of the XR a conserved domain, L-glutamine-

(Q)XHHPYLQQ, was also identified. This domain is highly conserved among ascomycetes, and it contains five amino acids with very strong evidence of purifying selection (Fig.6.3). Detailed studies focused on the characterization of this conserved region were not found in the literature, although Lee et al. (2003) mentioned the region briefly. No significant mutations were observed in the XR domains besides the

GX3GXG.

Direct mutagenesis studies have confirmed that this motif neither participates directly in the reaction catalyzed by XR nor coenzyme binding. This domain provides support for the proposed enzyme structure because deletions in this region result in poorly folded proteins, and the third glycine appears to be crucial in providing space for a close interaction between the coenzyme-binding domain and coenzyme (Chu and Lee

2006).

The evolution of the GX3GXG domain in ascomycetes shows a tendency toward reduction of the number of amino acids from 5 to 3 and fixation of the amino acids phenylalanine (F), tyrosine (Y), and cysteine (C) between 134-G and 138-G (Figs. 6.2 and 6.3). This motif was also the only domain that lacked amino acids undergoing

purifying selection (Fig. 6.3), so it may have been free of selection constraints, making it an excellent target for studies of direct mutagenesis.

The HyPhy software provides a unified platform to perform likelihood-based analyses on molecular evolutionary data sets. The analyses describe the molecular evolutionary process, including studies of rates and patterns of the changes of DNA sequences (Kosakovsky-Pond et al. 2005). The substitution model MG94xHKY85 for amino acid evolution allows the estimation of the rate synonymous (α) and non- synonymous (β) substitutions per site. In order to compute selective pressure and functional constrains, each site (s) in the alignment follows neutral evolution, then it infers βs ≈ αs. For sites subjected to functional constraints, non-synonymous mutations are almost certain to be extremely deleterious or lethal, leading to purifying selection; in this case βs < αs. On the contrary if βs > αs a particular s is evolving under positive selective pressure or undergoing adaptive evolution (Kosakovsky-Pond et al. 2005).

This ration is expressed software using Bayes factor per site, with the interpretation <20 indicates no evidence of selection; >20, strong support for purifying selection; and >150, very strong evidence of selection.

Synonymous rates were always greater than non-synonymous rates, suggesting that non-synonymous mutations are highly deleterious or lethal leading to purifying selection acting on XR (Table 6.2; Fig. 6.3). These results were obtained using both species and XYL1 phylogenetic trees. The D statistic suggests that XRs in ascomycetes have been exposed to either population expansion or purifying selection. However, a more powerful statistic Fs suggests that XRs in X-F yeasts has been exposed to a recent population bottleneck or overdominant selection (heterozygote advance). These

results agree with the study of Wohlbach et al. (2011) in which no signal of selection acting on any amino acid was detected on the xylose genes.

The phylogenetic reconstruction using the XR gene placed the yeast clades

Scheffersomyces and Spathaspora as sister groups, in which the X-F yeasts that achieve the highest fermentation rates are classified. During the evolutionary history of the XRs in ascomycetes, a reduction in the number of amino acids present in the

GX3GXG motif was found. This motif was the only conserved region that lacked selective pressure acting on its amino acids, and it may have played a role in the third configuration of the enzyme.

Table 6.2. Summary of nucleotide diversity. Parameters Ascomycetes X-F Yeasts Number of sequences 95 63 Length of sequenced region 531 510 Number of segregating sites 109 188 Tajima’s D -0.722 -0.282 p value for Tajima’s D >0.10 >0.10

Fu’s Fs -4.935 2.556

p value for Fu’s Fs 0.003 0.046 Nucleotide diversity 0.238 0.156 Synonymous rate (α) 3.376 2.818 Non-synonymous rate (β) 1.217 1.434 DN/DS ratio 0.144 0.157 TV/TS ratio 0.952 0.588 # of AA under purifying selection 32 2

! by

202 blue blue

192 the sites with the !

yeastsat F only - All 182

! 172

conserved acids amino !

162

! 152

! 142

forodel nucleotide evolution. ! site with very strong evidence of selectionsite strong withevidence of very 132

! r purifying selection. r purifying Legend: 122

70 majority indicates consensus .acidbar amino Pink % !

! 112 Sites

in brackets ! 102

! 92 20), > by triangles red (BF !

! 72 , conserved domains , conserved

! 62

. ! 52 Comparison ofX ComparisonBayes factor andbetween ascomycetesother ascomycetes) and (yeasts , site under purifying selection , site

. !

42 6.3

! ure 32 ! ! ! ! ! angles (Bayesangles factor >150) 0

30 20 10

~~ ! Bayes Factor Bayes Fig sitelikelihood each under MG94xHKY85x3_4x2maximum criteria and m considered werefo a with Bayes 20 strong factor over support arrows blue tri ascomycetesacross N

100

Therefore, this motif is an excellent candidate for induced mutagenesis studies, as well as an uncharacterized domain at the C-terminal region LQXHHPYLQQ. Signals of purifying selection acting on the N-terminal region of the XRs present in several distantly related species of ascomycetes were found. Upon repetition of the same analysis using only yeasts associated with insects capable of fermenting or assimilating

D-xylose, results of a population bottleneck may be explained by the biology of the gut- inhabiting yeasts.

Population bottlenecks have been detected in genetic analyses of symbiotic bacteria associated with the gut of insects. Bottlenecks occur when the symbionts are transmitted horizontally or vertically to the progeny due to a reduction of the overall microbial populations that lead to an increase in genetic drift and accumulation of deleterious mutations (Kaltenpoth et al. 2010, Sachs et al. 2011).

The results presented here will help to drive new strategies for mutagenesis studies that seek for increments in the enzymatic activity of the xylose reductase present in yeasts by targeting the GX3GXG domain. The characterization of the

LQXHHPYLQQ domain will increase our understanding of the enzymatic properties of xylose reductase. The lack of selection acting on the N-terminal region of xylose reductase allow the use of this molecular marker for rapid identification of cryptic X-F fermenting yeasts.

101

CHAPTER 7. CONCLUSIONS

The diversity of yeasts associated with rotted wood and lignicolous insects has been investigated in order to discover new yeasts that can carry out the fermentation of wood components such as cellobiose, D-arabinose, and D-xylose. This dissertation has focused on the isolation, identification, description, and molecular, morphological, and physiological characterization of ascomycete and basidiomycete yeasts associated with rotted wood (Chapter 2), the gut of lignicolous insects classified in Cryptocercidae

(Blattoidea) (Chapter 3) and Passalidae (Coleoptera) (Chapter 4 and 5), and a molecular and phylogenetic study of the N-terminal region of the xylose reductase in ascomycete yeasts (Chapter 6). Prior to this investigation, few studies were focused specifically on the characterization of yeasts systematically and intensively in one group of insect hosts.

In this dissertation, four new species of X-F yeasts were proposed in the

Scheffersomyces clade: Sc. illinoinensis, Sc. virginianus, Sc. quercinus, and Sc. cryptocercus, based on multilocus phylogenetic analyses, differential RAPD fingerprinting gel band patterns, and morphological and biochemical characterization.

Also, new combinations for yeast species classified in the paraphyletic genus Candida were proposed in Scheffersomyces (Chapter 2) and Sugiyamaella (Chapter 3), based on Article 59 of the revised International Code of Nomenclature for algae, fungi, and plants.

The use of the orthologous gene XYL1, which codifies a xylose reductase (XR), was shown to be effective as a molecular marker for rapid identification of cryptic yeast species that can ferment or assimilate D-xylose, because traditional molecular markers

102

used in barcoding do not always resolve at the species level (e.g. Scheffersomyces clade members) (Chapter 2, 3 and 6). XRs were exposed to purifying selection in ascomycetes, a signal of a population bottleneck or overdominant selection in yeasts associated with insects. The GX3GXG domain was proposed as an ideal target for induced mutagenesis studies. An uncharacterized LQXHHPYLQQ conserved region, was discovered that should receive further investigation (Chapter 6).

The diversity of yeasts from the gut of passalid beetles collected in Guatemala

(Chapter 4) and Thailand (Chapter 5) was described. The gut of Guatemalan passalids was dominated by the X-F yeasts Sc. shehatae and Sc. stipitis, but an undescribed yeast closely related to Ca. insectamans (Spathaspora clade) was dominant in gut yeasts of Thai passalids. A major distinction between North American and Thai yeasts was that few Thai yeasts were able to ferment D-xylose.

A number of undescribed yeasts in the Scheffersomyces, Spathaspora,

Lodderomyces, and Sugiyamaella clades, and some rare yeast species in the

Phaffomyces and Spencermartinsiella clades from the gut of Guatemalan and Thai passalids were isolated, characterized, and identified (Chapters 4 and 5). Several basidiomycete yeasts in Trichosporon and Cryptococcus also were isolated from the gut of passalids in North American and Thailand (Chapter 4 and 5). These basidiomycete yeasts may play an important role in the deterioration and/or detoxification of woody substrates. No basidiomycete yeasts were isolated from Appalachian Mountains wood- roaches (Blattodea), suggesting that the relationship between basidiomycete yeasts and lignicolous insects may be restricted to certain insect groups. It is likely, however, that

103

the absence of basidiomycete yeasts may be an artifact of sampling few individuals from one locality.

The methodology designed for yeast isolation and selection applied in this study

(Chapters 3, 4 and 5) facilitated a better understanding of the relationship between yeasts and lignicolous insects. These methods also allowed collection of multiple strains of the same yeast species, which can be used to expand the knowledge of genetic variation and species delimitation among them (Chapter 3, 4 and 5). This study confirmed that yeasts in association with the gut of lignicolous insects have the ability to survive movement across gut regions of varying physiological conditions. Yeasts from the guts of passalids across distant regions are abundant and easy to isolate (Chapter

3, 4 and 5). The gut of lignicolous insects, especially passalids, is a largely unexplored habitat that is a profitable environment for the isolation of new ascomycete and basidiomycete yeasts, especially yeasts that carry out the fermentation of D-xylose.

Passalids are considered the most efficient among all insects in the degradation of decayed wood, which is likely directly related to their symbiotic association with microbes. The yeast diversity described in this work has contributed to a better understanding of the phylogenetic relationships among fungi and has increased our appreciation of the relationships between yeasts and lignicolous insects. These findings can be applied in a broader sense to the production of industrial goods and biofuels due primarily to the biochemical abilities of the X-F species. The fermentation of D-xylose has been proposed as a method for increasing ethanol production from plant waste, which will help in the development of novel biofuel technologies, thereby contributing to the conservation of valuable natural resources. Ultimately, the discovery of new yeasts

104

across distant regions will contribute meaningfully to our understanding of fungal diversity and insect ecology, and may have important applied functions in biotechnology.

Chapters 2 and 3 of this dissertation are available as open access publications in the journals PLoS ONE and Mycologia. Other chapters planed for publication include 4,

5, and 6. Chapter 4 will include Jack Shuster (Universidad del Valle de Guatemala,

Guatemala City, Guatemala) as a coauthor, Chapter 5 with Janet Jennifer Luangsa-ard

(Mycology Laboratory, BIOTECH, Bangkok, Thailand) and S.O. Suh (ATCC, United

States) as coauthors, and Chapter 6, with Jeremy Brown (Department of Biological

Sciences, LSU). Material presented at meetings as oral or poster presentations include annual meeting of the Mycological Society of America (MSA) (two oral presentations and three posters, in the years 2009, 2011, and 2012), VII Latin American Mycological

Congress, San José - Costa Rica (one invited oral presentation, 2011), and 13th

International Congress on Yeasts (IYC), Madison, Wisconsin (one oral presentation and one poster, 2012). Awards were given for Chapter 2 (Best Poster Award, MSA,

Snowbird, Utah, July 2009) and Chapter 6 (Best Poster Award, IYC, August 2012).

105

REFERENCES

Adam H, Groenewald M, Mohan S, et al. 2009. Identification of a new species, Candida subhashii, as a cause of peritonitis. Med Mycol 47: 305-311.

Agbogbo FK and Wenger KS. 2006. Effect of pretreatment chemicals on xylose fermentation by Pichia stipitis. Biotechnol Lett 28: 2065-2069.

Agbogbo FK and Wenger KS. 2007. Production of ethanol from corn stover hemicellulose hydrolyzate using Pichia stipitis. J Ind Microbiol Biotechnol 34: 723- 727.

Agbogbo FK, Haagensen FD, Milam D and Wenger KS. 2008. Fermentation of acid- pretreated corn stover to ethanol without detoxification using Pichia stipitis. Appl Biochem Biotechnol 145: 53-58.

Agbogbo FK, Coward-Kelly G, Torry-Smith M, Wenger K and Jeffries TW. 2007. The effect of initial cell concentration on xylose fermentation by Pichia stipitis. Appl Biochem Biotechnol 137-140: 653-662.

Aime MC, Matheny PB, Henk DA, et al. 2006. An overview of the higher level classification of Pucciniomycotina based on combined analyses of nuclear large and small subunit rDNA sequences. Mycologia 98: 896-905.

Alexander MA, Chapman TW and Jeffries TW. 1987. Continuous ethanol production from D-xylose by Candida shehatae. Biotechnol Bioeng 30: 685-691.

Alexander MA, Chapman TW and Jeffries TW. 1988a. Continuous xylose fermentation by Candida shehatae in a 2-stage reactor. Appl Biochem Biotechnol 17: 221-229.

Alexander MA, Chapman TW and Jeffries TW. 1988b. Xylose metabolism by Candida shehatae in continuous culture. Appl Microbiol Biotechnol 28: 478-486.

Alexander MA, Chapman TW and Jeffries TW. 1989. Continuous-culture responses of Candida shehatae to shifts in temperature and aeration: Implications for ethanol inhibition. Appl Environ Microbiol 55: 2152-2154.

Alexopoulos CJ, Mims CW and Blackwell M. 1996. Introductory Mycology. Wiley, New York.

106

Almeida JR, Modig T, Roder A, Liden G and Gorwa-Grauslund MF. 2008. Pichia stipitis xylose reductase helps detoxifying lignocellulosic hydrolysate by reducing 5- hydroxymethyl-furfural (HMF). Biotechnol Biofuels 1: 12.

Almeida JRM, Modig T, Petersson A, Hahn-Hagerdal B, Liden G and Gorwa-Grauslund MF. 2007. Increased tolerance and conversion of inhibitors in lignocellulosic hydrolysates by Saccharomyces cerevisiae. J Chem Technol Biotechnol 82: 340- 349.

Altschul SF, Gish W, Miller W, Myers EW and Lipman DJ. 1990. Basic local alignment search tool. J Mol Biol 215: 403-410.

Am-In S, Yongmanitchai W and Limtong S. 2008. Kluyveromyces siamensis sp. nov., an ascomycetous yeast isolated from water in a mangrove forest in Ranong Province, Thailand. FEMS Yeast Res 8: 823-828.

Barbosa AC, Cadete RM, Gomes FC, Lachance MA and Rosa CA. 2009. Candida materiae sp. nov, a yeast species isolated from rotting wood in the Atlantic Rain Forest. Int J Syst Evol Micr 59: 2104-2106.

Barnett JA, Payne RW and Yarrow D. 2000. Yeasts: Characteristics and identification. Cambridge University Press, Cambridge.

Batt CA, Caryallo S, Easson DD, Akedo M and Sinskey AJ. 1986. Direct evidence for a xylose metabolic pathway in Saccharomyces cerevisiae. Biotechnol Bioeng 28: 549-553.

Berkov A, Feinstein J, Small J and Nkamany M. 2007. Yeast isolated form neotropical wood-boring beetles in SE Peru. Biotropica 39: 530-538.

Berlanga M, Paster BJ and Guerrero R. 2009. The taxophysiological paradox: changes in the intestinal microbiota of the xylophagous cockroach Cryptocercus punctulatus depending on the physiological state of the host. Int Microbiol 12: 227-236.

Billard P, Menart S, Fleer R and Bolotin-Fukuhara M. 1995. Isolation and characterization of the gene encoding xylose reductase from Kluyveromyces lactis. Gene 162: 93-97.

Bolen PL, Roth KA and Freer SN. 1986. Affinity purifications of aldose reductase and xylitol dehydrogenase from the xylose-fermenting yeast Pachysolen tannophilus. Appl Environ Microbiol 52: 660-664.

107

Boonmak C, Jindamorakot S. Kawasaki H, et al. 2009. Candida siamensis sp. nov., an anamorphic yeast species in the Saturnispora clade isolated in Thailand. FEMS Yeast Res 9: 668-672.

Boonmak C, Limtong S, Jindamorakot S, et al. 2011a. Candida xylanilytica sp. nov., a xylan-degrading yeast species isolated from Thailand. J Syst Evol Microbiol 61: 1230-1234.

Boucher S. 2005. Évolution et phylogénie des Coléoptères Passalidae. Scarabaeoidea). Ann Soc Entomol Fr 41: 239-604.

Bryan JH. 1954. Cytological and cytochemical studies of oogenesis of Popilius disjunctus Illiger (Coleoptera, Polyphaga). Biol Bull 107: 64-79.

Buaban B, Inoue H, Yano S, et al. 2010. Bioethanol production from ball milled bagasse using an on-site produced fungal enzyme cocktail and xylose-fermenting Pichia stipitis. J Biosci Bioeng 110: 18-25.

Buchler ER, Wright TB and Brown ED. 1981. On the functions of stridulation by the passalid beetle Odontotaenius disjunctus (Coleoptera, Passalidae). Anim Behav 29: 483-486.

Burnett AM, Mason WH and Rhodes ST. 1969. Reingestion of feces and excretion rates of Zn-65 in Popilius disjunctus versus Cryptocercus punctulatus. Ecology 50: 1094-1096.

Cadete RM, Melo A, Lopes M, et al. 2012. Candida amazonensis sp. nov., an ascomycetous yeast isolated from rotting wood in the Amazonian forest. Int J Syst Evol Microbiol 62: 1438-1440.

Cadete RM, Santos RO, Melo MA, et al. 2009. Spathaspora arborariae sp. nov, a D- xylose-fermenting yeast species isolated from rotting wood in Brazil. FEMS Yeast Res 9: 1338-1342.

Cadez N, Raspor P and Smith MT. 2006. Phylogenetic placement of Hanseniaspora- Kloeckera species using multigene sequence analysis with taxonomic implications: descriptions of Hanseniaspora pseudoguilliermondii sp. nov. and Hanseniaspora occidentalis var. citrica var. nov. Int J Syst Evol Micr 56: 1157- 1165.

Calderon O and Berkov A. 2012. Midgut and fat body bacteriocytes in neotropical cerambycid beetles (Coleoptera: Cerambycidae). Environ Entomol 41: 108-117.

108

Carpenter KJ, Chow L and Keeling PJ. 2009. Morphology, phylogeny, and diversity of Trichonympha (Parabasalia: Hypermastigida) of the wood-feeding cockroach Cryptocercus punctulatus. J Eukaryot Microbiol 56: 305-313.

Carpenter KJ, Horak A and Keeling PJ. 2010. Phylogenetic position and morphology of Spirotrichosomidae (Parabasalia): New evidence from Leptospironympha of Cryptocercus punctulatus. Protist 161: 122-132.

Carpenter KJ, Horak A, Chow L and Keeling PJ. 2011. Symbiosis, morphology, and phylogeny of Hoplonymphidae (Parabasalia) of the wood-feeding roach Cryptocercus punctulatus. J Eukaryot Microbiol 58: 426-436.

Ceja-Navarro JA, Weber PK, et al. 2012. Characterization of H2 producing microbial communities of the wood-feeding beetle Odontotaenius disjunctus by multi-scale measurement of metabolic function. Genomic Science Awardee Meeting, Bethesda, Maryland, 26-29 February.

Chang CF, Yao CH, Young SS, Limtong S, Kaewwichian R, Srisuk N and Lee CF. 2011. Candida gosingica sp. nov, an anamorphic ascomycetous yeast closely related to Scheffersomyces spartinae. Int J Syst Evol Micr 61: 690-694.

Chen LC, Huang SC, Chuankhayan P, et al. 2009. Purification, crystallization and preliminary X-ray crystallographic analysis of xylose reductase from Candida tropicalis. Acta Cryst F 65: 419-421.

Chu BC and Lee H. 2006. Investigation of the role of a conserved glycine motif in the Saccharomyces cerevisiae xylose reductase. Curr Microbiol 53: 118-123.

Clark JW and Kambhampati S. 2003. Phylogenetic analysis of Blattabacterium, endosymbiotic bacteria from the wood roach, Cryptocercus (Blattodea: Cryptocercidae), including a description of three new species. Mol Phylogenet Evol 26: 82-88.

Collings SB. 1966. An improved ringer solution for heart of Passalus beetle Popilius disjunctus (Coleoptera: Passalidae). Ann Entomol Soc Am 59: 972-974.

Dahn KM, Davis BP, Pittman PE, Kenealy WR and Jeffries TW. 1996. Increased xylose reductase activity in the xylose-fermenting yeast Pichia stipitis by overexpression of XYL1. Appl Biochem Biotechnol 57-58: 267-276. de Faria JT, Sampaio FC, Converti A, Passos FM, Minim VP and Minim LA. 2009. Use of response surface methodology to evaluate the extraction of Debaryomyces

109

hansenii xylose reductase by aqueous two-phase system. J Chromatogr B Analyt Technol Biomed Life Sci 877: 3031-3037. de Vega C, Guzman B, Lachance MA, Steenhuisen SL, Johnson SD and Herrera CM. 2012. Metschnikowia proteae sp. nov., a nectarivorous insect-associated yeast species from Africa. Int J Syst Evol Micr 62: 2538-2545.

Delfinado MD and Baker EW. 1975. Mites (Acarina) Associated with Popilius disjunctus (Illiger) (Coleoptera: Passalidae) in Eastern United-States. J N Y Entomol Soc 83: 49-59.

Delgenes JP, Moletta R and Navarro JM. 1986. The effect of aeration on D-xylose fermentation by Pachysolen tannophilus, Pichia stipitis, Kluyveromyces marxianus and Candida shehatae. Biotechnol Lett 8: 897-900.

Delgenes JP, Moletta R and Navarro JM. 1989. Fermentation of D-xylose, D-glucose, L- arabinose mixture by Pichia stipitis: Effect of the oxygen transfer rate on fermentation performance. Biotechnol Bioeng 34: 398-402.

Dismukes JF and Mason WH. 1975. Effects of carbaryl and methyl parathion poisoning on bioelimination of Zn-65 and Mn-54 in Popilius disjunctus Coleoptera- Passalidae. Environ Entomol 4: 221-224.

Fadda ME, Mossa V, Pisano MB, Deplano M and Cosentino S. 2004. Occurrence and characterization of yeasts isolated from artisanal Fiore Sardo cheese. Int J Food Microbiol 95: 51-59.

Fadda ME, Viale S, Deplano M, Pisano MB and Cosentino S. 2010. Characterization of yeast population and molecular fingerprinting of Candida zeylanoides isolated from goat's milk collected in Sardinia. Int J Food Microbiol 136: 376-380.

Fadda ME, Podda GS, Pisano MB, Deplano M, Viale S, Corda A and Cosentino S. 2010. [Phenotypic and molecular characterization of Candida species in ICU]. Ann Ig 22: 9-17.

Ferguson DE and Land JD. 1961. Some temperature studies on beetle, Popilius disjunctus. Ecology 42: 195-197.

Fonseca CRV, Barbosa MLL and Fernandez MFS. 2011. A hypothetical evolutionary history of passalid beetles narrated by the comparative anatomy of the hindgut (Coleoptera: Passalidae). Zootaxa 3012: 1-20.

110

Fuentefria AM, Suh SO, Landell MF, et al. 2008. Trichosporon insectorum sp. nov, a new anamorphic basidiomycetous killer yeast. Mycol Res 112: 93-99.

Gaster PF. 2006. Yeast and invertebrate associations. Biodiversity and ecophysiology of yeasts,(Rosa CA and Gabor P, eds.), Chapter 14, pp. 303-370. Springer- Verlag, Berlin.

Gibson GE. 1977. Seasonal distribution of mites associated with Popilius disjunctus (Illiger) (Coleoptera-Passalidae) in Hardin County, Texas. Tex J Sci 28: 109-112.

Golubev WI, Blagodatskaya M, Suetin SO and Trotsenko R. 1981. Pichia inositovora and Candida paludigena, two new species of yeasts isolated from peat. Int J Syst Bacteriol 31: 91-96.

Grunwald S, Pilhofer M and Holl W. 2010. Microbial associations in gut systems of wood- and bark-inhabiting longhorned beetles (Coleoptera: Cerambycidae). Syst Appl Microbiol 33: 25-34.

Gujjari P, Suh SO, Lee CF and Zhou JLJ. 2011. Trichosporon xylopini sp. nov., a hemicellulose-degrading yeast isolated from the wood-inhabiting beetle Xylopinus saperdioides. Int J Syst Evol Micr 61: 2538-2542.

Habenicht A, Motejadded H, Kiess M, Wegerer A and Mattes R. 1999. Xylose utilisation: cloning and characterisation of the xylitol dehydrogenase from Galactocandida mastotermitis. Biol Chem 380: 1405-1411.

Hacker B, Habenicht A, Kiess M and Mattes R. 1999. Xylose utilisation: cloning and characterisation of the xylose reductase from Candida tenuis. Biol Chem 380: 1395-1403.

Hahn-Hagerdal B, Karhumaa K, Jeppsson M and Gorwa-Grauslund MF. 2007a. Metabolic engeniring for pentose utilization in Saccharomyces cerevisiae. Adv Biochem Eng/Biotechnol 108: 147-177.

Hahn-Hagerdal B, Karhumaa K, Fonseca C, Spencer-Martins I and Gorwa-Grauslund MF. 2007b. Towards industrial pentose-fermenting yeast strains. Appl Microbiol Biotechnol 74: 937-953.

Hamacher T, Becker J, Gardonyi M, Hahn-Hagerdal B and Boles E. 2002. Characterization of the xylose-transporting properties of yeast hexose transporters and their influence on xylose utilization. Microbiology 148: 2783- 2788.

111

Hector RE, Qureshi N, Hughes SR and Cotta MA. 2008. Expression of a heterologous xylose transporter in a Saccharomyces cerevisiae strain engineered to utilize xylose improves aerobic xylose consumption. Appl Microbiol Biotechnol 80: 675- 684.

Henninger W and Windisch S. 1976. [Kluyveromyces blattae sp. nov., a new multispored yeast for Blatta orientalis. author's transl)]. Arch Microbiol 109: 153- 156.

Hibbett DS. 1996. Phylogenetic evidence for horizontal transmission of group I introns in the nuclear ribosomal DNA of mushroom-forming fungi. Mol Biol Evol 13: 903- 917.

Hibbett DS, Binder M, Bischoff JF, et al. 2007. A higher-level phylogenetic classification of the Fungi. Mycol Res 111: 509-547.

Hiznay PA and Krause JB. 1955. The structure and musculature of the larval head and mouthparts of the horned Passalus beetle, Popilius disjunctus Illiger. J Morphology 97: 55-75.

Houseknecht JL, Hart EL, Suh SO and Zhou JJ. 2011. Yeasts in the Sugiyamaella clade associated with wood-ingesting beetles and the proposal of Candida bullrunensis sp. nov. Int J Syst Evol Micr 61: 1751-1756.

Huang SW, Zhang HY, Marshall S, et al. 2010. The scarab gut: A potential bioreactor for bio-fuel production. Insect Sci 17: 175-183.

Hughes GL, Allsopp PG, Webb RI, et al. 2011. Identification of yeast associated with the planthopper, Perkinsiella saccharicida: potential applications for Fiji leaf gall control. Curr Microbiol 63: 392-401.

Hughes SR, Gibbons WR, Bang SS, et al. 2012. Random UV-C mutagenesis of Scheffersomyces. formerly Pichia. stipitis NRRL Y-7124 to improve anaerobic growth on lignocellulosic sugars. J Ind Microbiol Biotechnol 39: 163-173.

Imanishi Y, Jindamorakot S, Mikata K, et al. 2008. Two new ascomycetous anamorphic yeast species related to Candida friedrichii -- Candida jaroonii sp. nov., and Candida songkhlaensis sp. nov.--isolated in Thailand. Antonie van Leeuwenhoek 94: 267-276.

Jackson HB, Baum KA, Robert T and Cronin JT. 2009. Habitat-specific movement and edge-mediated behavior of the saproxylic insect Odontotaenius disjunctus (Coleoptera: Passalidae). Environ Entomol 38: 1411-1422.

112

Jeffries TW. 1983. Utilization of xylose by bacteria, yeasts, and fungi. Adv Biochem Eng/Biotechnol 27: 1-32.

Jeffries TW. 1986. Regulation of the xylose fermentation in Candida shehatae and Pachysolen tannophilus. Abstr Pap Am Chem S 192: 51-BTEC.

Jeffries TW. 2006. Engineering yeasts for xylose metabolism. Curr Opin Biotechnol 17: 320-326.

Jeffries TW and Kurtzman CP. 1994. Strain selection, taxonomy, and genetics of xylose-fermenting yeasts. Enzyme Microb Technol 16: 922-932.

Jeffries TW and Shi NQ. 1999. Genetic engineering for improved xylose fermentation by yeasts. Adv Biochem Eng/Biotechnol 65: 117-161.

Jeffries TW and Jin YS. 2000. Ethanol and thermotolerance in the bioconversion of xylose by yeasts. Adv Appl Microbiol 47: 221-268.

Jeffries TW, Grigoriev IV, Grimwood J, et al. 2007. Genome sequence of the lignocellulose-bioconverting and xylose-fermenting yeast Pichia stipitis. Nat Biotechnol 25: 319-326.

Jeon WY, Yoon BH, Ko BS, Shim WY and Kim JH. 2012. Xylitol production is increased by expression of codon-optimized Neurospora crassa xylose reductase gene in Candida tropicalis. Bioprocess Biosyst Eng 35: 191-198.

Jin YS and Jeffries TW. 2003. Changing flux of xylose metabolites by altering expression of xylose reductase and xylitol dehydrogenase in recombinant Saccharomyces cerevisiae. Appl Biochem Biotechnol 105 -108: 277-286.

Jin YS and Jeffries TW. 2004. Stoichiometric network constraints on xylose metabolism by recombinant Saccharomyces cerevisiae. Metab Eng 6: 229-238.

Jin YS, Ni H, Laplaza JM and Jeffries TW. 2003. Optimal growth and ethanol production from xylose by recombinant Saccharomyces cerevisiae require moderate D- xylulokinase activity. Appl Environ Microbiol 69: 495-503.

Jindamorakot S, Limtong S, Yongmanitchai W, et al. 2007. Two new anamorphic yeasts, Candida thailandica sp. nov. and Candida lignicola sp. nov., isolated from insect frass in Thailand. FEMS Yeast Res 7:1409-1414.

113

Jindamorakot S, Limtong S, Yongmanitchai W, et al. 2008. Candida ratchasimensis sp. nov. and Candida khaoyaiensis sp. nov., two anamorphic yeast species isolated from flowers in Thailand. FEMS Yeast Res 8: 955-960.

Kaltenpoth M, Goettler W, Koehler S and Strohm E. 2010. Life cycle and population dynamics of a protective insect symbiont reveal severe bottlenecks during vertical transmission. Evol Ecol 24: 463-477.

Kaewwichian R, Yongmanitchai W, Kawasaki H. and Limtong S. 2012. Metschnikowia saccharicola sp. nov. and Metschnikowia lopburiensis sp. nov., two novel yeast species isolated from phylloplane in Thailand. Antonie van Leeuwenhoek. Online doi: 10.1007/s10482-012-9774-3

Kaewwichian R, Yongmanitchai W, Srisuk N, Fujiyama N and Limtong S. 2010. Geotrichum siamensis sp. nov. and Geotrichum phurueaensis sp. nov., two asexual arthroconidial yeast species isolated in Thailand. FEMS Yeast Res 10: 214-220.

Karhumaa K, Fromanger R, Hahn-Hagerdal B and Gorwa-Grauslund MF. 2007a. High activity of xylose reductase and xylitol dehydrogenase improves xylose fermentation by recombinant Saccharomyces cerevisiae. Appl Microbiol Biotechnol 73: 1039-1046.

Karhumaa K, Garcia Sanchez R, Hahn-Hagerdal B and Gorwa-Grauslund MF. 2007b. Comparison of the xylose reductase-xylitol dehydrogenase and the xylose isomerase pathways for xylose fermentation by recombinant Saccharomyces cerevisiae. Microb Cell Fact 6: 5.

Karhumaa K, Fromanger R, Hahn-Hagerdal B and Gorwa-Grauslund MF. 2007c. High activity of xylose reductase and xylitol dehydrogenase improves xylose fermentation by recombinant Saccharomyces cerevisiae. Appl Microbiol Biotechnol 73: 1039-1046.

King A and Fashing N. 2007. Infanticidal behavior in the subsocial beetle Odontotaenius disjunctus (Illiger) (Coleoptera: Passalidae). J Insect Behav 20: 527-536.

Kishida M, Seike Y and Kawasaki H. 2009. Identification and characterization of a psychrophilic yeast strain newly isolated from the fermentative starter (Loog-pang) of a traditional drink in Thailand. Biocontrol Sci 14: 119-122.

Kitade O. 2004. Comparison of symbiotic flagellate faune between termites and wood- feeding cockroach of the genus Cryptocercus. Microb Environ 19: 215-220.

114

Klass KD, Nalepa C and Lo N. 2008. Wood-feeding cockroaches as models for termite evolution (Insecta: Dictyoptera): Cryptocercus vs. Parasphaeria boleiriana. Mol Phylogenet Evol 46: 809-817.

Knapp S, McNeill J and Turland NJ. 2011. Changes to publication requirements made at the XVIII International Botanical Congress in Melbourne: What does e- publication mean for you? Taxon 60: 1498-1501.

Koivistoinen OM, Arvas M, Headman JR, Andberg M, Penttila M, Jeffries TW and Richard P. 2012. Characterisation of the gene cluster for L-rhamnose catabolism in the yeast Scheffersomyces. Pichia. stipitis. Gene 492: 177-185.

Kokaew K, Srisuk N and Limtong S. 2009. Cloning and nucleotide sequence analysis of xylose reductase. XR. gene from thermotolerant methylotrophic yeast Ogataea siamensis N22. Tha J Genet 2: 66-71.

Kon M, Araya K and Johki Y. 2001. Synopsis of Thai Passalidae (Insecta: Coleoptera). The Natural History Journal of Chulalongkorn University 1:61-67.

Koowadjanakul N, Jindamorakot S, Yongmanitchai W and Limtong S. 2011. Ogataea phyllophila sp. nov., Candida chumphonensis sp. nov. and Candida mattranensis sp. nov., three methylotrophic yeast species from phylloplane in Thailand. Antonie van Leeuwenhoek 100: 207-217.

Kreger-van Rij NJW. 1970. Pichia Hansen. The Yeasts, A taxonomic study, (Lodder J, eds.), pp. 455-554. North-Holland, Amsterdam.

Kumar S and Gummadi SN. 2011. Metabolism of glucose and xylose as single and mixed feed in Debaryomyces nepalensis NCYC 3413: production of industrially important metabolites. Appl Microbiol Biotechnol 89: 1405-1415.

Kurtzman CP. 1990. Candida shehatae, genetic diversity and phylogenetic relationships with other xylose-fermenting yeasts. Antonie van Leeuwenhoek 57: 215-222.

Kurtzman CP. 2003. Phylogenetic circumscription of Saccharomyces, Kluyveromyces and other members of the Saccharomycetaceae, and the proposal of the new genera Lachancea, Nakaseomyces, Naumovia, Vanderwaltozyma and Zygotorulaspora. FEMS Yeast Res 4: 233-245.

Kurtzman CP. 2007. Eleven new species of Sugiyamaella and Candida from forest habitats. FEMS Yeast Res 7: 1046-1063.

115

Kurtzman CP. 2012. Citeromyces hawaiiensis sp. nov., a new ascosporic yeast associated with Myoporum sandwicense in Hawaii. Int J Syst Evol Microbiol 62: 1215-1219.

Kurtzman CP and Robnett CJ. 1998. Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences. Antonie van Leeuwenhoek 73: 331-371.

Kurtzman CP and Robnett CJ. 2007. Multigene phylogenetic analysis of the Trichomonascus, Wickerhamiella and Zygoascus yeast clades, and the proposal of Sugiyamaella gen. nov. and 14 new species combinations. FEMS Yeast Res 7: 141-151.

Kurtzman CP and Suzuki M. 2010. Phylogenetic analysis of ascomycete yeasts that form coenzyme Q-9 and the proposal of the new genera Babjeviella, Meyerozyma, Millerozyma, Priceomyces, and Scheffersomyces. Mycoscience 51: 2-14.

Kurtzman CP, Fell JW and Boekhout T. 2011. The yeasts, a taxonomy study, Editors. pp. xxii + 1-289, xv + 290-1335, xvi + 1336-2080. Elseveir Amsterdam.

Lachance MA, Bowles JM and Starmer WT. 2003. Geography and niche occupancy as determinants of yeast biodiversity: the yeast-insect-morning glory ecosystem of Kipuka Puaulu, Hawai'i. FEMS Yeast Res 4: 105-111.

Lachance MA, Dobson J, Wijayanayaka DN and Smith AM. 2010. The use of parsimony network analysis for the formal delineation of phylogenetic species of yeasts: Candida apicola, Candida azyma, and Candida parazyma sp. nov., cosmopolitan yeasts associated with floricolous insects. Antonie van Leeuwenhoek 97: 155- 170.

Lamarche J, Stefani FO, Seguin A and Hamelin RC. 2011. Impact of endochitinase- transformed white spruce on soil fungal communities under greenhouse conditions. FEMS Microbiol Ecol 76: 199-208.

Laplace JM, Delgenes JP, Moletta R and Navarro JM. 1992. Alcoholic glucose and xylose fermentations by the coculture process: compatibility and typing of associated strains. Can J Microbiol 38: 654-658.

Lee JW, Zhu JY, Scordia D and Jeffries TW. 2011. Evaluation of ethanol production from corncob using Scheffersomyces (Pichia) stipitis CBS 6054 by volumetric scale-up. Appl Biochem Biotechnol 165: 814-822.

116

Lichtwardt RW. 1957. Enterobryus attenuatus from the passalid beetle. Mycologia 49: 463-474.

Lichtwardt RW, White MM, Cafaro MJ and Misra JK. 1999. Fungi associated with passalid beetles and their mites. Mycologia 91: 694-702.

Limtong S, Jindamorakot S, Am-In S, et al. 2011. Candida uthaithanina sp. nov., an anamorphic yeast species in Nakaseomyces clade isolated in Thailand. Antonie van Leeuwenhoek 99: 865-871.

Limtong S, Kaewwichian R, Am-In S, et al. 2010a. Three anamorphic yeast species Candida sanitii sp. nov., Candida sekii sp. nov. and Candida suwanaritii, three novel yeasts in the Saturnispora clade isolated in Thailand. FEMS Yeast Res 10: 114-122.

Limtong S, Kaewwichian R, Am-In S, et al. 2010b. Candida asiatica sp. nov., an anamorphic ascomycetous yeast species isolated from natural samples from Thailand, Taiwan, and Japan. Antonie van Leeuwenhoek 98: 475-481.

Limtong S, Kaewwichian R, Jindamorakot S, et al. 2012a. Candida wangnamkhiaoensis sp. nov., an anamorphic yeast species in the Hyphopichia clade isolated in Thailand. Antonie van Leeuwenhoek 102: 23-28.

Limtong S, Koowadjanakul N, Jindamorakot S, Yongmanitchai W and Nakase T. 2012b. Candida sirachaensis sp. nov. and Candida sakaeoensis sp. nov. two anamorphic yeast species from phylloplane in Thailand. Antonie van Leeuwenhoek 102: 221- 229.

Limtong S, Imanishi Y, Jindamorakot S, Ninomiya S, et al. 2008a. Torulaspora maleeae sp. nov., a novel ascomycetous yeast species from Japan and Thailand. FEMS Yeast Res 8: 337-343.

Limtong S, Srisuk N, Yongmanitchai W, Yurimoto H and Nakase T. 2008b. Ogataea chonburiensis sp. nov. and Ogataea nakhonphanomensis sp. nov., thermotolerant, methylotrophic yeast species isolated in Thailand, and transfer of Pichia siamensis and Pichia thermomethanolica to the genus Ogataea. Int J Syst Evol Microbiol 58: 302-307.

Limtong S. Nitiyon S, Kaewwichian R, et al. 2012c. Wickerhamomyces xylosica sp. nov. and Candida phayaonensis sp. nov., two novel xylose-assimilating yeast species isolated in Thailand. Int J Syst Evol Microbiol Online doi: 10.1099/ijs.0.039818-0

117

Limtong S, Youngmanitchai W, Kawasaki H and Seki T. 2008c. Candida phangngensis sp. nov., an anamorphic yeast species in the Yarrowia clade, isolated from water in mangrove forests in Phang-Nga Province, Thailand. Int J Syst Evol Microbiol 58: 515-519.

Limtong S, Yongmanitchai W, Kawasaki H and Fujiyama K. 2009. Wickerhamomyces edaphicus sp. nov. and Pichia jaroonii sp. nov., two ascomycetous yeast species isolated from forest soil in Thailand. FEMS Yeast Res 9: 504-510.

Lin Y, He P, Wang Q, Lu D, Li Z, Wu C and Jiang N. 2010. The alcohol dehydrogenase system in the xylose-fermenting yeast Candida maltosa. PloS ONE 5: e11752.

Liti G, Barton DB and Louis EJ. 2006. Sequence diversity, reproductive isolation and species concepts in Saccharomyces. Genetics 174: 839-850.

Liu K, Warnow TJ, Holder MT, Nelesen SM, Yu J, Stamatakis AP and Linder CR. 2012. SATe-II: Very fast and accurate simultaneous estimation of multiple sequence alignments and phylogenetic trees. Syst Biol 61: 90-106.

Lobo J and Castillo ML. 1997. The relationship between ecological capacity and morphometry in a neotropical community of Passalidae (Coleoptera). Coleopts Bull 51: 147-153.

Lohmeier-Vogel E, Skoog K, Vogel H and Hahn-Hagerdal B. 1989. 31P nuclear magnetic resonance study of the effect of azide on xylose fermentation by Candida tropicalis. Appl Environ Microbiol 55: 1974-1980.

Lu C and Jeffries T. 2007. Shuffling of promoters for multiple genes to optimize xylose fermentation in an engineered Saccharomyces cerevisiae strain. Appl Environ Microbiol 73: 6072-6077.

MacGown J and MacGown M. 1996. Observation of a nuptial flight of the horned passalus beetle, Odontotaenius disjunctus (Illiger) (Coleoptera: Passalidae). Coleopts Bull 50 :201-203.

Mach-Aigner AR, Pucher ME and Mach RL. 2010. D-Xylose as a repressor or inducer of xylanase expression in Hypocrea jecorina (Trichoderma reesei). Appl Environ Microbiol 76: 1770-1776.

Maddison W and Maddison D. 2005. MESQUITE: A modular system for evolutionary analysis. Evolution 62: 1103-1118.

118

Maekawa K, Park YC and Lo N. 2005. Phylogeny of endosymbiont bacteria harbored by the woodroach Cryptocercus spp. (Cryptocercidae: Blattaria): Molecular clock evidence for a late Cretaceous-early Tertiary split of Asian and American lineages. Mol Phylogenet Evol 36: 728-733.

Mason WH, Wit LC and Blackmore MS. 1983. Bioelimination of Zn-65 in Popilius disjunctus after a dietary zinc supplement. J GA Entomol Soc 18: 246-251.

Mayr P and Nidetzky B. 2002. Catalytic reaction profile for NADH-dependent reduction of aromatic aldehydes by xylose reductase from Candida tenuis. Biochem J 366: 889-899.

Mayr P, Petschacher B and Nidetzky B. 2003. Xylose reductase from the Basidiomycete fungus Cryptococcus flavus: purification, steady-state kinetic characterization, and detailed analysis of the substrate binding pocket using structure-activity relationships. J. Biochem 133: 553-562.

Mayr P, Bruggler K, Kulbe KD and Nidetzky B. 2000. D-Xylose metabolism by Candida intermedia: isolation and characterisation of two forms of aldose reductase with different coenzyme specificities. J Chromatogr B Biomed Sci App 737: 195-202.

Middelhoven WJ, Scorzetti G and Fell JW. 2004. Systematics of the anamorphic basidiomycetous yeast genus Trichosporon Behrend with the description of five novel species: Trichosporon vadense, T. smithiae, T. dehoogii, T. scarabaeorum and T. gamsii. Int J Syst Evol Micr 54: 975-986.

Milan EP, de Laet Sant' Ana P, de Azevedo Melo AS, et al. 2001. Multicenter prospective surveillance of oral Candida dubliniensis among adult Brazilian human immunodeficiency virus-positive and AIDS patients. Diagn Micr Infec Dis 41: 29-35.

Molnar O, Schatzmayr G, Fuchs E and Prillinger H. 2004. Trichosporon mycotoxinivorans sp. nov., a new yeast species useful in biological detoxification of various mycotoxins. Syst Appl Microbiol 27: 661-671.

Muller T and Vingron M. 2000. Modeling amino acid replacement. J Comput Biol 7: 761- 776.

Nakase T, Jindamorakot S, Am-In S, Lee CF, Imanishi Y and Limtong S. 2011a. Three novel species of the anamorphic yeast genus Candida in the Candida intermedia clade found in Japan, Thailand and Taiwan. J Gen Appl Microbiol 57: 73-81.

119

Nakase T, Jindamorakot S, Am-In S, Lee CF and Limtong S. 2011b. Four novel species of the anamorphic yeast genus Candida found in Thailand and Taiwan. J Gen Appl Microbiol 57: 231-242.

Nakase T, Jindamorakot S, Am-In S, Ninomiya S and Kawasaki H. 2011c. Candida loeiensis sp. nov., a novel anamorphic yeast species found in Thailand. J Gen Appl Microbiol 57: 387-391.

Nakase T, Jindamorakot S, Am-In S, Ninomiya S, Kawasaki H and Limtong S. 2011d. Candida maleeae sp. nov., a novel anamorphic yeast species in the Ambrosiozyma clade found in Thailand. J Gen Appl Microbiol 57: 253-258.

Nakase T, Jindamorakot S, Am-In S, Ninomiya S and Kawasaki H. 2010a. Candida tanticharoeniae sp. nov., a novel anamorphic yeast species found in Thailand. J Gen Appl Microbiol 56: 89-92.

Nakase T, Jindamorakot S, Am-In S, Imanishi S, Ninomiya S, Kawasaki H and Limtong S. 2010b. Candida potacharoeniae sp. nov. and Candida spenceri sp. nov., two novel galactose-containing ascomycetous anamorphic yeast species isolated in Thailand. J Gen Appl Microbiol 56: 287-295.

Nakase, T., S. Jindamorakot, K. Tanaka, S. Ninomiya, H. Kawasaki, S. Limtong, and C. F. Lee. 2010c. Vanderwaltozyma tropicalis sp. nov., a novel ascomycetous yeast species found in Thailand. J Gen Appl Microbiol 56: 31-36.

Nakase T, Jindamorakot S, Am-In S, Ninomiya S and Kawasaki H. 2012. Wickerhamomyces tratensis sp. nov. and Candida namnaoensis sp. nov., two novel ascomycetous yeast species in the Wickerhamomyces clade found in Thailand. J Gen Appl Microbiol 58: 145-152.

Nakase T, Jindamorakot S, Am-In S, Ninomiya S, Kawasaki H and Limtong S. 2009a. Candida nonsorbophila sp. nov., a new ascomycetous yeast species isolated in Thailand. FEMS Yeast Res 9: 663-667.

Nakase T, Jindamorakot S, Ninomiya S, Imanishi Y and Kawasaki H. 2009b. Candida wancherniae sp. nov. and Candida morakotiae sp. nov., two novel ascomycetous anamorphic yeast species found in Thailand. J Gen Appl Microbiol 55: 93-100.

Nakase T, Jindamorakot S, Ninomiya S, Imanishi Y, Kawasaki and Potacharoen HW. 2008. Candida kanchanaburiensis sp. nov., a new ascomycetous yeast species related to Pichia nakazawae isolated in Thailand. J Gen Appl Microbiol 54: 259- 265.

120

Nakase T, Jindamorakot S, Sugita T, Am-In S, et al. 2006. Trichosporon siamense sp. nov. isolated from insect frass in Thailand. Mycoscience 47: 106-109.

Nardi JB, Bee CM, Miller LA, Nguyen NH, Suh SO and Blackwell M. 2006. Communities of microbes that inhabit the changing hindgut landscape of a subsocial beetle. Arthropod Struct Dev 35: 57-68.

Nguyen NH, Suh SO and Blackwell M. 2007. Five novel Candida species in insect- associated yeast clades isolated from Neuroptera and other insects. Mycologia 99: 842-858.

Nguyen NH, Suh SO, Marshall CJ and Blackwell M. 2006. Morphological and ecological similarities: wood-boring beetles associated with novel xylose-fermenting yeasts, Spathaspora passalidarum gen. sp. nov. and Candida jeffriesii sp. nov. Mycol Res 110: 1232-1241.

Ni H, Laplaza JM and Jeffries TW. 2007. Transposon mutagenesis to improve the growth of recombinant Saccharomyces cerevisiae on D-xylose. Appl Environ Microbiol 73: 2061-2066.

Nidetzky B, Bruggler K, Kratzer R and Mayr P. 2003. Multiple forms of xylose reductase in Candida intermedia: comparison of their functional properties using quantitative structure-activity relationships, steady-state kinetic analysis, and pH studies. J Agric Food Chem 51: 7930-7935.

Nitiyon S, Boonmak C, Am-In S, et al. 2011a. Candida saraburiensis sp. nov. and Candida prachuapensis sp. nov., xylose-utilizing yeast species isolated in Thailand. Int J Syst Evol Microbiol 61:462-468.

Noda S, Inoue T, Hongoh Y, et al. 2006. Identiﬁcation and characterization of ectosymbionts of distinct lineages in Bacteroidales attached to ﬂagellated protists in the gut of termites and a wood-feeding cockroach. Environm Microbiol 8: 11-20.

Ohama T, Suzuki T, Mori M, et al. 1993. Non-universal decoding of the leucine codon CUG in several Candida species. Nucleic Acids Res 21: 4039-4045.

Pagnocca FC, Legaspe MF, Rodrigues A, et al. 2010. Yeasts isolated from a fungus- growing ant nest, including the description of Trichosporon chiarellii sp. nov, an anamorphic basidiomycetous yeast. Int J Syst Evol Micr 60: 1454-1459.

Park SM, Sang BI, Park DW and Park DH. 2005. Electrochemical reduction of xylose to xylitol by whole cells or crude enzyme of Candida peltata. J Microbiol 43: 451-455.

121

Passoth V, Hansen M, Klinner U and Emeis CC. 1992. The electrophoretic banding pattern of the chromosomes of Pichia stipitis and Candida shehatae. Curr Gen 22: 429-431.

Pearse AS, Patterson MT, Rankin JS and Warton GW. 1936. The ecology of Passalus cornutus Fabricius, a beetle which lives in rotting logs. Ecol Monogr 6: 455-490.

Peter G, Dlauchy D, Tornai-Lehoczki J, Suzuki M and Kurtzman CP. 2011. Spencermartinsiella europaea gen. nov, sp. nov, a new member of the family Trichomonascaceae. Int J Syst Evol Micr 61: 993-1000.

Prathumpai W, Gabelgaard JB, Wanchanthuek P, et al. 2003. Metabolic control analysis of xylose catabolism in Aspergillus. Biotechnol Prog 19: 1136-1141.

Prior BA, Alexander MA, Yang V and Jeffries TW. 1988. The role of alcohol- dehydrogenase in the fermentation of D-xylose by Candida shehatae ATCC- 22984. Biotechnol Lett 10: 37-42.

Punzo F. 2007. Social facilitation and digging behavior in the beetle Odontotaenius floridanus Schuster (Coleoptera: Passalidae). J Entomol Sci 42: 525-532.

Rains TD and Dimock RV. 1978. Seasonal-variation in cold hardiness of beetle Popilius disjunctus. J Insect Physiol 24: 551-554.

Rao RS, Bhadra B and Shivaji S. 2007. Isolation and characterization of xylitol- producing yeasts from the gut of colleopteran insects. Curr Microbiol 55: 441-446.

Reyes-Castillo P. 1970. Coleoptera: Passalidae; morfologia y division en grandes grupos; generos americanos. Folia Entomol Mex 20-22: 1-240.

Rivera FN, Gonzalez E, Gomez Z, et al. 2009. Gut-associated yeast in bark beetles of the genus Dendroctonus Erichson (Coleoptera: Curculionidae: Scolytinae). Biol J Linn Soc 98: 325-342.

Robbertse B, Reeves JB, Schoch CL and Spatafora JW. 2006. A phylogenomic analysis of the Ascomycota. Fungal Genet Biol 43: 715-725.

Roberts HS. 1952. The meiotic spindle of Popilius disjunctus. Anat Rec 113: 538-539.

Robertson CH. 1962. The anatomy of the respiratory system of the Passalus beetles, Popilius disjunctus (Illiger). Am Midl Nat 68: 376-393.

122

Rodrigues RC, Lu C, Lin B and Jeffries TW. 2008. Fermentation kinetics for xylitol production by a Pichia stipitis D: -xylulokinase mutant previously grown in spent sulfite liquor. Appl Biochem Biotechnol 148: 199-209.

Rokas A, Williams BL, King N and Carroll SB. 2003. Genome-scale approaches to resolving incongruence in molecular phylogenies. Nature 425: 798-804.

Ryabova OB, Chmil OM and Sibirny AA. 2003. Xylose and cellobiose fermentation to ethanol by the thermotolerant methylotrophic yeast Hansenula polymorpha. FEMS Yeast Res 4: 157-164.

Sacchi L, Nalepa CA, Bigliardi E, et al. 1998. Ultrastructural studies of the fat body and bacterial endosymbionts of Cryptocercus punctulatus Scudder (Blattaria: Cryptocercidae). Symbiosis 25: 251-269.

Sachs JL, Skophammer RG and Regus JU. 2011. Evolutionary transitions in bacterial symbiosis. Proc Nat Acad Sci USA 108: 10800-10807.

Sampaio FC, de Faria JT, Passos FM, Converti A and Minin LA. 2009. Optimal activity and thermostability of xylose reductase from Debaryomyces hansenii UFV-170. J Ind Microbiol Biotechnol 36: 293-300.

Santos RO, Cadete RM, Badotti F, et al. 2011. Candida queiroziae sp. nov, a cellobiose-fermenting yeast species isolated from rotting wood in Atlantic Rain Forest. Antonie van Leeuwenhoek 99: 635-642.

Sawvel JW, Gunderson S, Schiavone RC and Nelson EV. 1992. A method for thin sectioning heavily sclerotized cuticle of Odontotaenius disjunctus. Biotechnic and Histochemistry 67: 309-312.

Schoch CL, Seifert KA, Huhndorf S, et al. 2012. The internal transcribed spacer as a universal DNA barcode marker for Fungi. Fungal Barcoding Consortium. Proc Nat Acad Sci USA 109: 6241-6246.

Schoch CL, Sung GH, Lopez-Giraldez F, et al. 2009. The Ascomycota tree of life: a phylum-wide phylogeny clarifies the origin and evolution of fundamental reproductive and ecological traits. Syst Biol 58: 224-239.

Schuster J. 1975. A comparative study of copulation in Passalidae (Coleoptera): New positions for beetles. Coleopt Bull 29: 75-81.

Schuster J. 1991. Heliscus and Verres (Coleoptera:Passalidae): New species records from Guatemala and Panama. Fla Entomol 74: 475-476.

123

Schuster J. 1992a. Insect collections and biodiversity in Guatemala. Association Systematics Collections Newsletter 20: 90-91.

Schuster J. 1992b. Arthropod collecting and forest conservation in Guatemala. Insect Collection News 8: 15-16.

Schuster J. 1993. Xylopassaloides (Coleoptera: Passalidae) in Mesoamerica: Relations, distribution and new species. Fla Entomol 76: 114-119.

Schuster J. 2002. Passalidae Leach 1815. Bess beetle family. American Beetles. Polyphaga: Scarabaeoidea through Curculionoidea, Vol. 2. (Arnett RH, Thomas MC, P.E. S and J.H. F, eds.), pp. 12-14. CRC Press, Boca Ratón.

Schuster J. 2006. Passalidae. Coleoptera. de Mesoamerica: Diversidad y biogeografia. Biodiversidad de Guatemala, (Cano E, ed.), pp. 379-401. Universididad del Valle de Guatemala.

Schuster J, Cano E and Cardona C. 2000. Un método sencillo para priorizar la conservación de los bosques nubosos de Guatemala usando Passalidae (Coleoptera) como organismos indicadores. Acta Zoologica Mexicana 80: 197- 209.

Schuster J, Cano E and Reyes-Castillo P. 2003. Proculus, giant Latin-American Passalids: revision, phylogeny and biogeography. Acta Zoologica Mexicana 90: 281-306.

Shi NQ, Cruz J, Sherman F and Jeffries TW. 2002. SHAM-sensitive alternative respiration in the xylose-metabolizing yeast Pichia stipitis. Yeast 19: 1203-1220.

Shi NQ, Davis B, Sherman F, Cruz J and Jeffries TW. 1999. Disruption of the cytochrome c gene in xylose-utilizing yeast Pichia stipitis. leads to higher ethanol production. Yeast 15: 1021-1030.

Shi NQ, Prahl K, Hendrick J, et al. 2000. Characterization and complementation of a Pichia stipitis mutant unable to grow on D-xylose or L-arabinose. Appl Biochem Biotechnol 84-86: 201-216.

Singh A and Schugerl K. 1992. Induction and regulation of D-xylose catabolizing enzymes in Fusarium oxysporum. Biochem Int 28: 481-488.

Sreenath HK, Chapman TW and Jeffries TW. 1986. Ethanol production from D-xylose in batch fermentations with Candida shehatae: Process variables. Appl Microbiol Biotechnol 24: 294-299.

124

Stamatakis A. 2006. RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22: 2688-2690.

Steinkraus KH. 1994. Nutritional significance of fermented foods. Food Res Inter 27: 259-267.

Suh SO and Blackwell M. 2004. Three new beetle-associated yeast species in the Pichia guilliermondii clade. FEMS Yeast Res 5: 87-95.

Suh SO and Blackwell M. 2005. Four new yeasts in the Candida mesenterica clade associated with basidiocarp-feeding beetles. Mycologia 97: 167-177.

Suh SO and Blackwell M. 2006. Three new asexual arthroconidial yeasts, Geotrichum carabidarum sp. nov., Geotrichum histeridarum sp. nov., and Geotrichum cucujoidarum sp. nov., isolated from the gut of insects. Mycol Res 110: 220-228.

Suh SO and Zhou J. 2010. Yeasts associated with the curculionid beetle Xyloterinus politus: Candida xyloterini sp. nov., Candida palmyrensis sp. nov., and three common ambrosia yeasts. Int J Syst Evol Micr 60: 1702-1708.

Suh SO and Zhou JJ. 2011. Kazachstania intestinalis sp nov, an ascosporogenous yeast from the gut of passalid beetle Odontotaenius disjunctus. Antonie van Leeuwenhoek 100: 109-115.

Suh SO, Noda H and Blackwell M. 2001. Insect symbiosis: derivation of yeast-like endosymbionts within an entomopathogenic filamentous lineage. Mol Biol Evol 18: 995-1000.

Suh SO, Gibson CM and Blackwell M. 2004a. Metschnikowia chrysoperlae sp. nov, Candida picachoensis sp. nov. and Candida pimensis sp. nov, isolated from the green lacewings Chrysoperla comanche and Chrysoperla carnea (Neuroptera: Chrysopidae) Int J Syst Evol Micr 54: 1883-1890.

Suh SO, McHugh JV and Blackwell M. 2004b. Expansion of the Candida tanzawaensis yeast clade: 16 novel Candida species from basidiocarp-feeding beetles. Int J Syst Evol Micr 54: 2409-2429.

Suh SO, Nguyen NH and Blackwell M. 2005. Nine new Candida species near C. membranifaciens isolated from insects. Mycol Res 109: 1045-1056.

Suh SO, Blackwell M, Kurtzman CP and Lachance MA. 2006a. Phylogenetics of Saccharomycetales, the ascomycete yeasts. Mycologia 98: 1006-1017.

125

Suh SO, Nguyen NH and Blackwell M. 2006b. A yeast clade near Candida kruisii uncovered: nine novel Candida species associated with basidioma-feeding beetles. Mycol Res 110: 1379-1394.

Suh SO, Nguyen NH and Blackwell M. 2008. Yeasts isolated from plant-associated beetles and other insects: seven novel Candida species near Candida albicans. FEMS Yeast Res 8: 88-102.

Suh SO, Marshall CJ, McHugh JV and Blackwell M. 2003. Wood ingestion by passalid beetles in the presence of xylose-fermenting gut yeasts. Molecular ecology 12: 3137-3145.

Suh SO, White MM, Nguyen NH and Blackwell M. 2004. The status and characterization of Enteroramus dimorphus: a xylose-fermenting yeast attached to the gut of beetles. Mycologia 96: 756-760.

Suh SO, McHugh JV, Pollock DD and Blackwell M. 2005. The beetle gut: a hyperdiverse source of novel yeasts. Mycol Res 109: 261-265.

Sullivan DJ, Westerneng TJ, Haynes KA, Bennett DE and Coleman DC. 1995. Candida dubliniensis sp. nov.: phenotypic and molecular characterization of a novel species associated with oral candidosis in HIV-infected individuals. Microbiology 141: 1507-1521.

Tafuri JF and Tafuri FX. 1983. Sex determination of Popilius disjunctus Illiger from body and horn dimensions. Ohio J Sci 83: 2.

Tallamy DW and Wood TK. 1986. Convergence patterns in subsocial insects. Annu Rev Entomol 31: 369-390.

Tammawong S, Ninomiya S, Kawasaki H, Boonchird C and Sumpradit T. 2010. Millerozyma phetchabunensis sp. nov., a novel ascomycetous yeast species isolated from Nam Nao forest soil in Thailand, and the transfer of Pichia koratensis to the genus Millerozyma. J Gen Appl Microbiol 56: 37-42.

Tanabe Y, Saikawa M, Watanabe MM and Sugiyama J. 2004. Molecular phylogeny of Zygomycota based on EF-1 alpha and RPB1 sequences: limitations and utility of alternative markers to rDNA. Mol Phylogenet Evol 30: 438-449.

Tanahashi M, Kubota K, Matsushita N and Togashi K. 2010. Discovery of mycangia and the associated xylose-fermenting yeasts in stag beetles (Coleoptera: Lucanidae). Die Naturwissenschaften 97: 311-317.

126

Toivola A, Yarrow D, van den Bosch E, van Dijken JP and Scheffers WA. 1984. Alcoholic fermentation of D-xylose by yeasts. Appl Environ Microbiol 47: 1221- 1223.

Urbina H and Blackwell M. 2012. Multilocus phylogenetic study of the Scheffersomyces yeast clade and molecular characterization of the N-terminal region of xylose reductase PloS ONE 7: e39128.

Urbina H, Frank R and Blackwell M. 2012. Scheffersomyces cryptocercus: A new xylose-fermerting yeast associated with the gut of the wood roach and taxonomyc revision of the Sugiyamaella yeast clade. Mycologia In Press. van der Walt JP, Ferreira NP and Steyn RL. 1987. Candida lyxosophila sp. nov., a new D-xylose fermenting yeast from southern Africa. Antonie van Leeuwenhoek 53: 93-97. van der Walt JP, Scott DB and van der Klift WC. 1972. Six new Candida species form South Africa insect sources. Mycopathologia 47: 221-236. van Vleet JH, Jeffries TW and Olsson L. 2008. Deleting the para-nitrophenyl phosphatase (pNPPase), PHO13, in recombinant Saccharomyces cerevisiae improves growth and ethanol production on D-xylose. Metab Eng 10: 360-369. van Zyl C, Prior BA, Kilian SG and Kock JL. 1989. D-xylose utilization by Saccharomyces cerevisiae. J Gen Microbiol 135: 2791-2798.

Vaughan-Martini A. 1984. Comparazione dei genomi del lievito Pichia stipitis e di alcune specie imperfette affini. Ann Fac Agrar Univ Perugia 38: 331-335.

Vega FE and Dowd PF. 2005. The role of yeasts as insect endosymbionts. Insect- fungal associations, ecology and evolution, (Vega FE and Blackwell M, eds.), pp. 211-243. Oxford University Press, New York.

Ward SC. 1971. Carbon dioxide anesthesia of heart of horned Passalus beetle, Popilius disjunctus Coleoptera-Passalidae. Ann Entomol Soc Am 64: 430.

Waters JS and Socha JJ. 2005. Mechanics of tracheal compression in the bessbug, Popilius disjunctus. ICB 45: 1209-1209.

White TJ, Bruns TD, Lee S and Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols, a guide to methods and applications, (Innis MA, Gelfand DH, Sninsky JJ and White TJ, eds.), pp. 315-322. Academic Press, San Diego.

127

Wicknick JA and Miskelly SA. 2009. Behavioral interactions between non-cohabiting bess beetles, Odontotaenius disjunctus (Illiger) (Coleoptera: Passalidae). Coleopts Bull 63: 108-116.

Wit LC, Mason WH and Blackmore MS. 1984. The effects of crowding on the bioelimination of Zn-65 in Popilius disjunctus. J GA Entomol Soc 19: 8-14.

Wohlbach DJ, Kuo A, Sato TK, et al. 2011. Comparative genomics of xylose-fermenting fungi for enhanced biofuel production. Proc Nat Acad Sci USA 108: 13212-13217.

Woodyer R, Simurdiak M, van der Donk WA and Zhao H. 2005. Heterologous expression, purification, and characterization of a highly active xylose reductase from Neurospora crassa. Appl Environ Microbiol 71: 1642-1647.

Xu P, Bura R and Doty SL. 2011. Genetic analysis of D-xylose metabolism by endophytic yeast strains of Rhodotorula graminis and Rhodotorula mucilaginosa. Genet Mol Biol 34: 471-478.

Yang VW and Jeffries TW. 1997. Regulation of phosphotransferases in glucose- and xylose-fermenting yeasts. Appl Biochem Biotechnol 63-65: 97-108.

Yang VW, Marks JA, Davis BP and Jeffries TW. 1994. High-efficiency transformation of Pichia stipitis based on its URA3 gene and a homologous autonomous replication sequence, ARS2. Appl Environ Microbiol 60: 4245-4254.

Yarrow D. 1998. Methods for the isolation, maintenance and identification of yeasts. The Yeasts, A taxonomic study,(Kurtzman CP and Fell JW, eds.), pp. 77-100. Elsevier, Amsterdam.

Zhang B, Zhang L, Wang D, Gao X and Hong J. 2011. Identification of a xylose reductase gene in the xylose metabolic pathway of Kluyveromyces marxianus NBRC1777. J Ind Microbiol Biotechnol 38: 2001-2010.

Zhang N, Suh SO and Blackwell M. 2003. Microorganisms in the gut of beetles: evidence from molecular cloning. J Inverteb Pathol 84: 226-233.

Zou YZ, Qi K, Chen X, Miao XL and Zhong JJ. 2010. Favorable effect of very low initial K(L)a value on xylitol production from xylose by a self-isolated strain of Pichia guilliermondii. J Biosci Bioeng 109: 149-152.

128

VITA

Hector Raul Urbina-Yanez was born in 1977 in Caracas, Capital District,

Venezuela to Lilia Yanes and Hector Urbina. Hector attended the Universidad Simón

Bolívar and received his Bachelor of Science degree in Biology in 1999 and Master of

Science degree in 2001. During his college years, he worked in the laboratory of Teresa

Iturriaga who introduced him to the study of fungi and with whom he did the research for both his BS and MS theses. Upon graduating with an MS, Hector obtained a position as research assistant in the Laboratorio de Biotecnología del Petróleo (Oil Biotechnology

Laboratory), Fundación IDEA (IDEA Foundation), Caracas, Venezuela, where he worked for two and a half years and published three scientific articles and one patent on oil decay fungi. Hector enrolled in an English course at the University of New Orleans in

2008, where he worked hard during four months to improve his English skills. In August of the same year, Hector began his doctoral degree studies under the guidance of

Meredith Blackwell, Department of Biological Sciences, Louisiana State University,

Baton Rouge, Louisiana, where he studied the diversity of yeasts associated with

Guatemalan, Thai, and Australia passalid beetles.

129