DOCSLIB.ORG

Genome-Wide Analysis of 944 133 Individuals Provides Insights Into the Etiology of Haemorrhoidal Disease

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genome-Wide Analysis of 944 133 Individuals Provides Insights Into the Etiology of Haemorrhoidal Disease Endoscopy Original research Genome- wide analysis of 944 133 individuals Gut: first published as 10.1136/gutjnl-2020-323868 on 22 April 2021. Downloaded from provides insights into the etiology of haemorrhoidal disease Tenghao Zheng ,1,2 David Ellinghaus ,3,4 Simonas Juzenas ,3,5 François Cossais,6 Greta Burmeister,7 Gabriele Mayr,3 Isabella Friis Jørgensen,4 Maris Teder- Laving,8 Anne Heidi Skogholt,9 Sisi Chen,10 Peter R Strege,10 Go Ito,3,11 Karina Banasik,4 Thomas Becker,12 Frank Bokelmann,13 Søren Brunak,4 Stephan Buch,14 Hartmut Clausnitzer,15 Christian Datz ,16 DBDS Consortium, Frauke Degenhardt,3 Marek Doniec,17 Christian Erikstrup,18 Tõnu Esko,8 Michael Forster ,3 Norbert Frey,19,20,21 Lars G Fritsche,22 Maiken Elvestad Gabrielsen,9 Tobias Gräßle,23,24 Andrea Gsur ,25 Justus Gross,7 Jochen Hampe ,14,26 Alexander Hendricks,7 Sebastian Hinz,7 Kristian Hveem,9 Johannes Jongen,27,28 Ralf Junker,15 Tom Hemming Karlsen,29 3 30 31 ► Additional supplemental Georg Hemmrich- Stanisak, Wolfgang Kruis, Juozas Kupcinskas, material is published online 27,28,32 3,33 34 only. To view, please visit the Tilman Laubert, Philip C Rosenstiel, Christoph Röcken , journal online (http:// dx. doi. org/ Matthias Laudes,35 Fabian H Leendertz,23,24 Wolfgang Lieb,36 Verena Limperger,15 10. 1136/ gutjnl- 2020- 323868). Nikolaos Margetis,37 Kerstin Mätz- Rensing,38 Christopher Georg Németh,12,39 For numbered affiliations see 9,40,41 15 22 end of article. Eivind Ness- Jensen , Ulrike Nowak- Göttl, Anita Pandit, Ole Birger Pedersen,42 Hans Günter Peleikis,27,28 Kenneth Peuker,14,26 Correspondence to 4 3 43 Prof Mauro D’Amato, Cristina Leal Rodriguez, Malte Christoph Rühlemann , Bodo Schniewind, Gastrointestinal Genetics Lab, 3 31 44 9,45,46,47 CIC bioGUNE - BRTA, Bizkaia Martin Schulzky, Jurgita Skieceviciene, Jürgen Tepel, Laurent Thomas, http://gut.bmj.com/ Science and Technology Park, Florian Uellendahl- Werth,3 Henrik Ullum,48 Ilka Vogel,49 Henry Volzke,50 Building 801A, 48160 Derio, 51 12 22 7 Spain; mdamato@ cicbiogune. es Lorenzo von Fersen, Witigo von Schönfels, Brett Vanderwerff, Julia Wilking, and Prof Andre Franke, Institute 3 14,26 52 22 of Clinical Molecular Biology Michael Wittig, Sebastian Zeissig, Myrko Zobel, Matthew Zawistowski, (IKMB) & University Hospital Vladimir Vacic,53 Olga Sazonova,53 Elizabeth S Noblin,53 The 23andMe Research Team, Schleswig- Holstein (UKSH), 10 10 6 27,28,54 Christian- Albrechts- University of Gianrico Farrugia , Arthur Beyder, Thilo Wedel, Volker Kahlke, on September 25, 2021 by guest. Protected copyright. Kiel (CAU), Rosalind- Franklin- Str. 7 1,2,55,56 3,33 12, D-24105 Kiel, Germany; Clemens Schafmayer, Mauro D’Amato , Andre Franke a. franke@ mucosa. de TZ, DE and SJ contributed equally. ABSTRACT Results We demonstrate modest heritability and genetic CS, MD and AF contributed Objective Haemorrhoidal disease (HEM) affects a large equally. correlation of HEM with several other diseases from the and silently suffering fraction of the population but its GI, neuroaffective and cardiovascular domains. HEM PRS Received 18 December 2020 aetiology, including suspected genetic predisposition, validated in 180 435 individuals from independent datasets Revised 19 March 2021 is poorly understood. We report the first genome- wide allowed the identification of those at risk and correlated with Accepted 30 March 2021 association study (GWAS) meta- analysis to identify younger age of onset and recurrent surgery. We identified genetic risk factors for HEM to date. 102 independent HEM risk loci harbouring genes whose Design We conducted a GWAS meta- analysis of 218 expression is enriched in blood vessels and GI tissues, and 920 patients with HEM and 725 213 controls of European © Author(s) (or their in pathways associated with smooth muscles, epithelial employer(s)) 2021. Re- use ancestry. Using GWAS summary statistics, we performed permitted under CC BY- NC. No multiple genetic correlation analyses between HEM and and endothelial development and morphogenesis. Network commercial re- use. See rights other traits as well as calculated HEM polygenic risk transcriptomic analyses highlighted HEM gene coexpression and permissions. Published modules that are relevant to the development and integrity by BMJ. scores (PRS) and evaluated their translational potential in independent datasets. Using functional annotation of the musculoskeletal and epidermal systems, and the To cite: Zheng T, of GWAS results, we identified HEM candidate genes, organisation of the extracellular matrix. Ellinghaus D, Juzenas S, et al. Gut Epub ahead of print: which differential expression and coexpression in HEM Conclusion HEM has a genetic component that [please include Day Month tissues were evaluated employing RNA- seq analyses. The predisposes to smooth muscle, epithelial and connective Year]. doi:10.1136/ localisation of expressed proteins at selected loci was tissue dysfunction. gutjnl-2020-323868 investigated by immunohistochemistry. Zheng T, et al. Gut 2021;0:1–12. doi:10.1136/gutjnl-2020-323868 1 Endoscopy related to the large number of haemorrhoidectomies performed Significance of this study every year.4 A number of HEM risk factors have been suggested, including Gut: first published as 10.1136/gutjnl-2020-323868 on 22 April 2021. Downloaded from What is already known about this subject? human erect position. The tight anal sealing provided by the ► Human haemorrhoidal disease (HEM) is a prevalent anorectal elaborated haemorrhoidal plexus may have developed during pathology characterised by the symptomatic enlargement human evolution co- occurring with permanent bipedalism, as and distal displacement of anal cushions. shown by our histology comparison of four different mammals ► As a consequence of scarce research and of being a taboo (human, gorilla, baboon, mouse; online supplemental figure 1, topic in society, only a few HEM non- genetic risk factors online supplemental material 1). Other suggested risk factors have been suggested, thus the aetiology of the disease still are a sedentary lifestyle, obesity, reduced dietary fibre intake, remains unclear. spending excess time on the toilet, straining during defeca- ► Genetic susceptibility to HEM has been suspected but was tion, strenuous lifting, constipation, diarrhoea, pelvic floor never systematically investigated. dysfunction, pregnancy and giving natural birth, with several What are the new findings? being controversially reported. The hypothetical model shown in online supplemental figure 2 summarises the contemporary ► Here, we report the first well- powered genome- wide 5 association study (GWAS) meta- analysis with a sample size concepts regarding the pathophysiology of HEM development. of 944 133 individuals to identify genetic risk factors for HEM. Until today, HEM aetiopathogenesis is poorly investigated, and ► We describe 102 novel independent HEM risk loci that are neither the exact molecular mechanisms nor the reason(s) why functionally linked to pathways associated with smooth only some people develop HEM are known. Genetic suscepti- muscles, epithelial and endothelial development and bility may play a role in HEM development, but no large-scale, morphogenesis. genome- wide association study (GWAS) for HEM has ever been ► We show genetic correlations of HEM with several other conducted. To evaluate the contribution of genetic variation to diseases that are classified as GI, neuroaffective and the genetic architecture of HEM, we carried out a GWAS meta- cardiovascular disorders. analysis in 218 920 affected individuals and 725 213 population ► We report significance of computed HEM polygenic risk controls of European ancestry. scores, which were validated in independent population- based cohorts. METHODS ► We show significant enrichment of HEM genes in tissue coexpression modules responsible for the development of Detailed methods are provided in the online supplemental mate- musculoskeletal and epidermal systems, and the organisation rial 1 and summarised in the online supplemental figure 3. of the extracellular matrix. ► Based on our data, we outline HEM as a disorder of impaired RESULTS neuromuscular motility, smooth muscle contraction and GWAS meta-analysis and fine-mapping genomic regions http://gut.bmj.com/ extracellular matrix organisation. We conducted a GWAS meta-analysis in 944 133 individuals How might it impact on clinical practice in the foreseeable of European ancestry from five large population- based cohorts 6 7 future? (23andMe, UK Biobank (UKBB), Estonian Genome Centre 8 9 ► The results from this GWAS provide new insights on HEM at the University of Tartu, Michigan Genomics Initiative, and 10 genetic predisposition to smooth muscle, epithelial and Genetic Epidemiology Research on Aging (GERA) ) including connective tissue dysfunction. 218 920 HEM cases and 725 213 controls (online supplemental ► HEM polygenic risk scores identify individuals at risk and table 1). HEM cases had higher body mass index (BMI), were on September 25, 2021 by guest. Protected copyright. correlate with a more severe phenotype. significantly older and more often women compared with non- HEM controls; hence, age, sex, BMI (if available) and top prin- cipal components from principal component analysis (PCA) INTRODUCTION were included as covariates in individual GWAS (see ‘Methods’ Haemorrhoids are normal anal vascular cushions filled with section in online supplemental material 1, hereafter referred to blood at the junction of the rectum and the anus. It is assumed as online methods).
Load more

Recommended publications
  • PARSANA-DISSERTATION-2020.Pdf
    DECIPHERING TRANSCRIPTIONAL PATTERNS OF GENE REGULATION: A COMPUTATIONAL APPROACH by Princy Parsana A dissertation submitted to The Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland July, 2020 © 2020 Princy Parsana All rights reserved Abstract With rapid advancements in sequencing technology, we now have the ability to sequence the entire human genome, and to quantify expression of tens of thousands of genes from hundreds of individuals. This provides an extraordinary opportunity to learn phenotype relevant genomic patterns that can improve our understanding of molecular and cellular processes underlying a trait. The high dimensional nature of genomic data presents a range of computational and statistical challenges. This dissertation presents a compilation of projects that were driven by the motivation to efficiently capture gene regulatory patterns in the human transcriptome, while addressing statistical and computational challenges that accompany this data. We attempt to address two major difficulties in this domain: a) artifacts and noise in transcriptomic data, andb) limited statistical power. First, we present our work on investigating the effect of artifactual variation in gene expression data and its impact on trans-eQTL discovery. Here we performed an in-depth analysis of diverse pre-recorded covariates and latent confounders to understand their contribution to heterogeneity in gene expression measurements. Next, we discovered 673 trans-eQTLs across 16 human tissues using v6 data from the Genotype Tissue Expression (GTEx) project. Finally, we characterized two trait-associated trans-eQTLs; one in Skeletal Muscle and another in Thyroid. Second, we present a principal component based residualization method to correct gene expression measurements prior to reconstruction of co-expression networks.
    [Show full text]
  • Nuclear Organization and the Epigenetic Landscape of the Mus Musculus X-Chromosome Alicia Liu University of Connecticut - Storrs, [email protected]
    University of Connecticut OpenCommons@UConn Doctoral Dissertations University of Connecticut Graduate School 8-9-2019 Nuclear Organization and the Epigenetic Landscape of the Mus musculus X-Chromosome Alicia Liu University of Connecticut - Storrs, [email protected] Follow this and additional works at: https://opencommons.uconn.edu/dissertations Recommended Citation Liu, Alicia, "Nuclear Organization and the Epigenetic Landscape of the Mus musculus X-Chromosome" (2019). Doctoral Dissertations. 2273. https://opencommons.uconn.edu/dissertations/2273 Nuclear Organization and the Epigenetic Landscape of the Mus musculus X-Chromosome Alicia J. Liu, Ph.D. University of Connecticut, 2019 ABSTRACT X-linked imprinted genes have been hypothesized to contribute parent-of-origin influences on social cognition. A cluster of imprinted genes Xlr3b, Xlr4b, and Xlr4c, implicated in cognitive defects, are maternally expressed and paternally silent in the murine brain. These genes defy classic mechanisms of autosomal imprinting, suggesting a novel method of imprinted gene regulation. Using Xlr3b and Xlr4c as bait, this study uses 4C-Seq on neonatal whole brain of a 39,XO mouse model, to provide the first in-depth analysis of chromatin dynamics surrounding an imprinted locus on the X-chromosome. Significant differences in long-range contacts exist be- tween XM and XP monosomic samples. In addition, XM interaction profiles contact a greater number of genes linked to cognitive impairment, abnormality of the nervous system, and abnormality of higher mental function. This is not a pattern that is unique to the imprinted Xlr3/4 locus. Additional Alicia J. Liu - University of Connecticut - 2019 4C-Seq experiments show that other genes on the X-chromosome, implicated in intellectual disability and/or ASD, also produce more maternal contacts to other X-linked genes linked to cognitive impairment.
    [Show full text]
  • Downloaded from [266]
    Patterns of DNA methylation on the human X chromosome and use in analyzing X-chromosome inactivation by Allison Marie Cotton B.Sc., The University of Guelph, 2005 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in The Faculty of Graduate Studies (Medical Genetics) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) January 2012 © Allison Marie Cotton, 2012 Abstract The process of X-chromosome inactivation achieves dosage compensation between mammalian males and females. In females one X chromosome is transcriptionally silenced through a variety of epigenetic modifications including DNA methylation. Most X-linked genes are subject to X-chromosome inactivation and only expressed from the active X chromosome. On the inactive X chromosome, the CpG island promoters of genes subject to X-chromosome inactivation are methylated in their promoter regions, while genes which escape from X- chromosome inactivation have unmethylated CpG island promoters on both the active and inactive X chromosomes. The first objective of this thesis was to determine if the DNA methylation of CpG island promoters could be used to accurately predict X chromosome inactivation status. The second objective was to use DNA methylation to predict X-chromosome inactivation status in a variety of tissues. A comparison of blood, muscle, kidney and neural tissues revealed tissue-specific X-chromosome inactivation, in which 12% of genes escaped from X-chromosome inactivation in some, but not all, tissues. X-linked DNA methylation analysis of placental tissues predicted four times higher escape from X-chromosome inactivation than in any other tissue. Despite the hypomethylation of repetitive elements on both the X chromosome and the autosomes, no changes were detected in the frequency or intensity of placental Cot-1 holes.
    [Show full text]
  • Genome-Wide Association Study Identifies Loci for Arterial Stiffness
    www.nature.com/scientificreports OPEN Genome-wide association study identifes loci for arterial stifness index in 127,121 UK Biobank Received: 1 February 2019 Accepted: 5 June 2019 participants Published: xx xx xxxx Kenneth Fung1, Julia Ramírez 2, Helen R. Warren2,3, Nay Aung 1, Aaron M. Lee1, Evan Tzanis2,3, Stefen E. Petersen 1,3 & Patricia B. Munroe2,3 Arterial stifness index (ASI) is a non-invasive measure of arterial stifness using infra-red fnger sensors (photoplethysmography). It is a well-suited measure for large populations as it is relatively inexpensive to perform, and data can be acquired within seconds. These features raise interest in using ASI as a tool to estimate cardiovascular disease risk as prior work demonstrates increased arterial stifness is associated with elevated systolic blood pressure, and ASI is predictive of cardiovascular disease and mortality. We conducted genome-wide association studies (GWASs) for ASI in 127,121 UK Biobank participants of European-ancestry. Our primary analyses identifed variants at four loci reaching genome-wide signifcance (P < 5 × 10−8): TEX41 (rs1006923; P = 5.3 × 10−12), FOXO1 (rs7331212; P = 2.2 × 10−11), C1orf21 (rs1930290, P = 1.1 × 10−8) and MRVI1 (rs10840457, P = 3.4 × 10−8). Gene- based testing revealed three signifcant genes, the most signifcant gene was COL4A2 (P = 1.41 × 10−8) encoding type IV collagen. Other candidate genes at associated loci were also involved in smooth muscle tone regulation. Our fndings provide new information for understanding the development of arterial stifness. Arterial stifness measures have been reported as independent markers of vascular ageing1,2, hypertension3,4, car- diovascular disease (CVD)5,6 and mortality6,7.
    [Show full text]
  • Supplementary Materials
    Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
    [Show full text]
  • Datasheet: AHP2236 Product Details
    Datasheet: AHP2236 Description: RABBIT ANTI SRPX1 Specificity: SRPX1 Format: Purified Product Type: Polyclonal Antibody Isotype: Polyclonal IgG Quantity: 0.1 mg Product Details Applications This product has been reported to work in the following applications. This information is derived from testing within our laboratories, peer-reviewed publications or personal communications from the originators. Please refer to references indicated for further information. For general protocol recommendations, please visit www.bio- rad-antibodies.com/protocols. Yes No Not Determined Suggested Dilution Immunohistology - Paraffin 5ug/ml (1) ELISA Western Blotting 0.25ug/ml Where this product has not been tested for use in a particular technique this does not necessarily exclude its use in such procedures. Suggested working dilutions are given as a guide only. It is recommended that the user titrates the product for use in their own system using appropriate negative/positive controls. (1)This product requires antigen retrieval using heat treatment prior to staining of paraffin sections.Sodium citrate buffer pH 6.0 is recommended for this purpose. Target Species Human Species Cross Reacts with: Mouse, Rat Reactivity N.B. Antibody reactivity and working conditions may vary between species. Cross reactivity is derived from testing within our laboratories, peer-reviewed publications or personal communications from the originators. Please refer to references indicated for further information. Product Form Purified IgG - liquid Preparation Purified IgG prepared from whole serum by affinity chromatography Buffer Solution Phosphate buffered saline. Preservative 0.02% Sodium Azide (NaN3) Page 1 of 3 Stabilisers Approx. Protein IgG concentration 1.0mg/ml Concentrations Immunogen A synthetic peptide corresponding to 13 amino acid sequence from near the amino terminus of human SRPX1.
    [Show full text]
  • Impaired Iloprost-Induced Platelet Inhibition and Phosphoproteome Changes in Patients with Confirmed Pseudohypoparathyroidism Ty
    www.nature.com/scientificreports OPEN Impaired iloprost‑induced platelet inhibition and phosphoproteome changes in patients with confrmed pseudohypoparathyroidism type Ia, linked to genetic mutations in GNAS Frauke Swieringa1,2, Fiorella A. Solari1,9, Oliver Pagel1,9, Florian Beck1, Jingnan Huang1,2, Marion A. H. Feijge2, Kerstin Jurk4, Irene M. L. W. Körver‑Keularts5, Nadine J. A. Mattheij2, Jörg Faber3, Joachim Pohlenz3, Alexandra Russo3, Connie T. R. M. Stumpel5,6, Dirk E. Schrander7, Barbara Zieger8, Paola E. J. van der Meijden2, René P. Zahedi1, Albert Sickmann1 & Johan W. M. Heemskerk2* Patients diagnosed with pseudohypoparathyroidism type Ia (PHP Ia) sufer from hormonal resistance and abnormal postural features, in a condition classifed as Albright hereditary osteodystrophy (AHO) syndrome. This syndrome is linked to a maternally inherited mutation in the GNAS complex locus, encoding for the GTPase subunit Gsα. Here, we investigated how platelet phenotype and omics analysis can assist in the often difcult diagnosis. By coupling to the IP receptor, Gsα induces platelet inhibition via adenylyl cyclase and cAMP-dependent protein kinase A (PKA). In platelets from seven patients with suspected AHO, one of the largest cohorts examined, we studied the PKA-induced phenotypic changes. Five patients with a confrmed GNAS mutation, displayed impairments in Gsα- dependent VASP phosphorylation, aggregation, and microfuidic thrombus formation. Analysis of the platelet phosphoproteome revealed 2,516 phosphorylation sites, of which 453 were regulated by Gsα-PKA. Common changes in the patients were: (1) a joint panel of upregulated and downregulated phosphopeptides; (2) overall PKA dependency of the upregulated phosphopeptides; (3) links to key platelet function pathways. In one patient with GNAS mutation, diagnosed as non‑AHO, the changes in platelet phosphoproteome were reversed.
    [Show full text]
  • Microarray and Pattern Miner Analysis of AXL and VIM Gene Networks in MDA‑MB‑231 Cells
    MOLECULAR MEDICINE REPORTS 18: 4147-4155, 2018 Microarray and pattern miner analysis of AXL and VIM gene networks in MDA‑MB‑231 cells SUDHAKAR NATARAJAN1, VENIL N SUMANTRAN2, MOHAN RANGANATHAN1 and SURESH MADHESWARAN1 1Department of Biotechnology, Faculty of Engineering and Technology; 2Dr. A.P.J. Abdul Kalam Centre for Excellence in Innovation and Entrepreneurship, Dr. M.G.R. Educational and Research Institute, Tamil Nadu, Chennai 600095, India Received March 20, 2018; Accepted August 2, 2018 DOI: 10.3892/mmr.2018.9404 Abstract. MDA-MB-231 cells represent malignant triple-nega- migration, metastasis and chemoresistance, whereas the VIM tive breast cancer, which overexpress epidermal growth factor gene network regulates novel tumorigenic processes, such as receptor (EGFR) and two genes (AXL and VIM) associated lipogenesis, senescence and autophagy. Notably, these two with poor prognosis. The present study aimed to identify novel networks contain 12 genes not reported for TNBC. therapeutic targets and elucidate the functional networks for the AXL and VIM genes in MDA-MB-231 cells. We identi- Introduction fied 71 genes upregulated in MDA-MB-231 vs. MCF7 cells using BRB-Array tool to re-analyse microarray data from six Triple negative breast cancers (TNBC) lack expression of three GEO datasets. Gene ontology and STRING analysis showed important receptors (ER, PR, and HER2). These cancers account that 43/71 genes upregulated in MDA-MB-231 compared with for 10-15% of breast cancers, and are characterized by overex- MCF7 cells, regulate cell survival and migration. Another pression of epidermal growth factor receptor (EGFR), high 19 novel genes regulate migration, metastases, senescence, proliferative rate, and mutations in the p53 and BRCA1 tumour autophagy and chemoresistance.
    [Show full text]
  • A Widespread Peroxiredoxin-Like Domain Present in Tumor Suppression
    Pawłowski et al. BMC Genomics 2010, 11:590 http://www.biomedcentral.com/1471-2164/11/590 RESEARCH ARTICLE Open Access A widespread peroxiredoxin-like domain present in tumor suppression- and progression-implicated proteins Krzysztof Pawłowski2,4*, Anna Muszewska1, Anna Lenart2, Teresa Szczepińska2, Adam Godzik3, Marcin Grynberg1* Abstract Background: Peroxide turnover and signalling are involved in many biological phenomena relevant to human diseases. Yet, all the players and mechanisms involved in peroxide perception are not known. Elucidating very remote evolutionary relationships between proteins is an approach that allows the discovery of novel protein functions. Here, we start with three human proteins, SRPX, SRPX2 and CCDC80, involved in tumor suppression and progression, which possess a conserved region of similarity. Structure and function prediction allowed the definition of P-DUDES, a phylogenetically widespread, possibly ancient protein structural domain, common to vertebrates and many bacterial species. Results: We show, using bioinformatics approaches, that the P-DUDES domain, surprisingly, adopts the thioredoxin-like (Thx-like) fold. A tentative, more detailed prediction of function is made, namely, that of a 2-Cys peroxiredoxin. Incidentally, consistent overexpression of all three human P-DUDES genes in two public glioblastoma microarray gene expression datasets was discovered. This finding is discussed in the context of the tumor suppressor role that has been ascribed to P-DUDES proteins in several studies. Majority of non-redundant P- DUDES proteins are found in marine metagenome, and among the bacterial species possessing this domain a trend for a higher proportion of aquatic species is observed. Conclusions: The new protein structural domain, now with a broad enzymatic function predicted, may become a drug target once its detailed molecular mechanism of action is understood in detail.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name protein MRVI1 isoform b Gene Symbol Mrvi1 Organism Rat Gene Summary This gene is similar to a putative mouse tumor suppressor gene that is frequently disrupted by mouse AIDS-related virus (MRV). The encoded protein, which is found in the membrane of the endoplasmic reticulum, is similar to Jaw1, a lymphoid-restricted protein whose expression is down-regulated during lymphoid differentiation. Studies in mouse suggest that MRV integration at the homologous mouse gene induces myeloid leukemia by altering the expression of a gene important for myeloid cell growth and/or differentiation, and thus this gene may function as a myeloid leukemia tumor suppressor gene. Alternatively spliced transcript variants have been found for this gene. Gene Aliases Not Available RefSeq Accession No. Not Available UniGene ID Rn.33889 Ensembl Gene ID ENSRNOG00000017767 Entrez Gene ID 308899 Assay Information Unique Assay ID qRnoCIP0031443 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000024060 Amplicon Context Sequence TCTCGTACGTTCTCTTCAGATTCTCCACATACTGCATCATCACTTCCGTGGCCTTT GACATGCGCTTTTCCTGGCGCACAGCACCCACCACTTCAGCCCGGCTGGAGAG GCGTGCAGCCAGACGATGCAAGACTGCGATGTCTTCCAGA Amplicon Length (bp) 119 Chromosome Location 1:182696811-182699799 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 95 R2 0.9982 cDNA Cq 24.54 Page 1/5 PrimePCR™Assay Validation Report cDNA Tm (Celsius) 88 gDNA Cq Specificity
    [Show full text]
  • Mrvil, a Common MRV Integration Site in BXH2 Myeloid Leukemias, Encodes a Protein with Homology to a Lymphoid-Restricted Membrane Protein Jaw1
    Oncogene (1999) 18, 2069 ± 2084 ã 1999 Stockton Press All rights reserved 0950 ± 9232/99 $12.00 http://www.stockton-press.co.uk/onc Mrvil, a common MRV integration site in BXH2 myeloid leukemias, encodes a protein with homology to a lymphoid-restricted membrane protein Jaw1 John D Shaughnessy Jr*,1, David A Largaespada2, Erming Tian1, Colin F Fletcher3, Brian C Cho4, Paresh Vyas5, Nancy A Jenkins3 and Neal G Copeland3 1Division of Hematology and Oncology, Department of Medicine, University of Arkansas for Medical Sciences, Little Rock, Arkansas, AR 72205, USA; 2Department of Laboratory Medicine and Pathology, University of Minnesota Cancer Center, Minneapolis, Minnesota, MN 55455, USA; 3Mammalian Genetics Laboratory, ABL-Basic Research Program, NCI-Frederick Cancer Research and Development Center, Frederick, Maryland, MD 21702, USA; 4Department of Microbiology and Immunology, Thomas Jeerson University Cancer Institute, Philadelphia, Pennsylvania, PA 19107, USA; 5Department of Hematology and Oncology, Children's Hospital, Boston, Massachusetts, USA Ecotropic MuLVs induce myeloid leukemia in BXH2 Introduction mice by insertional mutagenesis of cellular proto- oncogenes or tumor suppressor genes. Disease genes BXH2 mice represent an important model for the can thus be identi®ed by viral tagging as common sites of identi®cation of myeloid leukemia disease genes. Not viral integration in BXH2 leukemias. Previous studies only do these mice have the highest spontaneous showed that a frequent common integration site in BXH2 incidence of myeloid leukemia of any known inbred leukemias is the Nf1 tumor suppressor gene. Unexpect- mouse strain, but the leukemias in these mice are edly, about half of the viral integrations at Nf1 retrovirally-induced and the proviruses in the tumors represented a previously undiscovered defective none- can thus be used as insertional tags to identify the cotropic virus, termed MRV.
    [Show full text]
  • Description: Uniprot:Q13976 Alternative Names： Specificity
    TD2677 PRKG1 Antibody Order 021-34695924 [email protected] Support 400-6123-828 50ul [email protected] 100 uL √ √ Web www.ab-mart.com.cn Description: Serine/threonine protein kinase that acts as key mediator of the nitric oxide (NO)/cGMP signaling pathway. GMP binding activates PRKG1, which phosphorylates serines and threonines on many cellular proteins. Numerous protein targets for PRKG1 phosphorylation are implicated in modulating cellular calcium, but the contribution of each of these targets may vary substantially among cell types. Proteins that are phosphorylated by PRKG1 regulate platelet activation and adhesion, smooth muscle contraction, cardiac function, gene expression, feedback of the NO-signaling pathway, and other processes involved in several aspects of the CNS like axon guidance, hippocampal and cerebellar learning, circadian rhythm and nociception. Smooth muscle relaxation is mediated through lowering of intracellular free calcium, by desensitization of contractile proteins to calcium, and by decrease in the contractile state of smooth muscle or in platelet activation. Regulates intracellular calcium levels via several pathways: phosphorylates MRVI1/IRAG and inhibits IP3-induced Ca(2+) release from intracellular stores, phosphorylation of KCNMA1 (BKCa) channels decreases intracellular Ca(2+) levels, which leads to increased opening of this channel. PRKG1 phosphorylates the canonical transient receptor potential channel (TRPC) family which inactivates the associated inward calcium current. Another mode of action of NO/cGMP/PKGI signaling involves PKGI-mediated inactivation of the Ras homolog gene family member A (RhoA). Phosphorylation of RHOA by PRKG1 blocks the action of this protein in myriad processes: regulation of RHOA translocation; decreasing contraction; controlling vesicle trafficking, reduction of myosin light chain phosphorylation resulting in vasorelaxation.
    [Show full text]