Aromatase Destabilizer: Novel Action of Exemestane, a Food and Drug Administration–Approved Aromatase Inhibitor

Priority Report

Xin Wang and Shiuan Chen

Department of Surgical Research, Beckman Research Institute of the City of Hope, Duarte, California

Abstract Food and Drug Administration (FDA)–approved AIs currently Using Western blot as the major technique, we studied the available in the United States (i.e., anastrozole, letrozole, and effects of the three Food and Drug Administration (FDA)– exemestane) are referred to as ‘third-generation inhibitors’. 4-OHA approved aromatase inhibitors (AI) on aromatase protein and current FDA-approved agents are all specific, more potent, and stability in the aromatase-overexpressing breast cancer cell offer significant safety advantages over their nonselective prede- line MCF-7aro. We have found that exemestane treatment cessors (8). Based on their structures, AIs can be grouped into significantly reduces aromatase protein level. Exemestane ‘nonsteroidal’ and ‘steroidal’ inhibitors. Nonsteroidal inhibitors induces aromatase degradation in a dose-responsive manner (e.g., anastrozole and letrozole) have the triazole functional group (25-200 nmol/L), and the effect can be seen in as early as that interact with the heme prosthetic group of aromatase and act 2 hours. Metabolic labeling with S35-methionine was used to as competitive inhibitors with respect to the androgen substrates. determine the half-life (t ) of aromatase protein. In the Steroidal inhibitors (e.g., exemestane and 4-OHA) were originally 1/2 designed as substrate analogues that compete with the substrate presence of 200 nmol/L exemestane, the t1/2 of aromatase was reduced to 12.5 hours from 28.2 hours in the untreated cells. for the aromatase enzyme. These two steroidal inhibitors are also Furthermore, exemestane-induced aromatase degradation can mechanism-based inhibitors, which require the catalytic ability of be completely blocked by 10 Mmol/L MG132, indicating that active aromatase to convert them into active intermediates. The the degradation is mediated by proteasome. We also examined intermediates then bind irreversibly to the enzyme and cause its the effect of exemestane on aromatase mRNA level using real- inactivation in a time-dependent manner. The development of AIs time reverse transcription-PCR. No significant changes in and their applications in breast cancer treatment have been mRNA level were detected after 8 hours of treatment with reviewed recently by Brueggemeier et al. (9). exemestane (200 nmol/L). This is the first report on the To facilitate the study of aromatase in breast cancer, our evaluation of three FDA-approved AIs on the stability of the laboratory developed a breast cancer cell line MCF-7aro that stably aromatase protein. We have found that exemestane, different expresses a high level of aromatase (10). In our effort to generate from letrozole and anastrozole, can destabilize the aromatase and characterize AI-resistant cells, we have noticed the decreased level of aromatase protein in exemestane-treated cells. This protein. (Cancer Res 2006; 66(21): 10281-6) observation prompted us to look into the effects of three FDA- approved AIs in aromatase protein stability. With the well- Introduction established Western blot and immunoprecipitation procedures in Aromatase, a cytochrome P450 enzyme, catalyzes three consec- our laboratory, we have examined exemestane-induced degrada- utive hydroxylation reactions, converting C19 androgens to tion of aromatase protein in MCF-7aro. We also used S35- aromatic C18 estrogenic steroids. On receiving electrons from methionine metabolic labeling to determine the half-life (t1/2)of NADPH-cytochrome P450 reductase, aromatase converts andros- aromatase in the presence of exemestane. Furthermore, our tenedione and testosterone to estrone and estradiol, respectively. experiments suggest that proteasome is a potential mediator of As the key enzyme in estrogen synthesis, aromatase plays a crucial exemestane-induced aromatase degradation. role in breast cancer development. Increasing evidence has shown that aromatase inhibitors (AI) are superior to the conventional anti-estrogen tamoxifen in treating hormone-dependent breast Materials and Methods cancer in postmenopausal women (1–4). In the past three decades, Cell culture. MCF-7aro cells were cultured in DMEM, supplemented a series of AIs have been produced. Historically, AIs have been with 10% fetal bovine serum (FBS), 110 mg/L sodium pyruvate, 100 Amol/L grouped into three generations. As the prototype of ‘first- nonessential amino acids, and 100 mg/L G418 (Invitrogen, Carlsbad, CA). generation inhibitor’ aminoglutethimide was the first drug to be Letrozole, anastrozole, and exemestane were provided by Novartis AG used as an AI (5). Its nonspecific inhibition on P450 enzymes, other (Basel, Swissland), Zeneca Pharmaceuticals (Macclesfield, United Kingdom), than aromatase, caused significant side effects. The representative and Pharmacia Italia S.p.A. (Nerviano, Italy), respectively. Proteasome of ‘second-generation inhibitor’, 4-hydroxy-4-androstene-3,17- inhibitor MG132 and protein synthesis inhibitor cycloheximide were dione (4-OHA), was the first selective AI to be used clinically and purchased from BioMol (Plymouth Meeting, PA). 4-OHA was purchased was effective and well tolerated (6). Due to the extensive first-pass from Sigma-Aldrich (St. Louis, MO). Western blot. Cells were cultured in 60-mm dishes and lysed with metabolism, 4-OHA needs to be administrated i.m. (7). The three CelLytic M (Sigma-Aldrich) supplemented with protease inhibitor tablets (Roche, Indianapolis, IN). Protein lysate (60 Ag) was loaded and separated on 10% SDS-PAGE gel. Protein transfer was done using Trans-Blot SD Requests for reprints: Shiuan Chen, Department of Surgical Research, Beckman semidry system (Bio-Rad, Hercules, CA) at 20 volt for 1hour (transfer Research Institute of the City of Hope, 1500 East Duarte Road, Duarte, CA 91010. buffer: 25 mmol/L Tris, 192 mmol/L glycine, 20% methanol). For samples to Phone: 626-359-8111, ext. 63454; Fax: 626-301-8972; E-mail: [email protected]. I2006 American Association for Cancer Research. be detected with SuperSignal West Pico chemiluminescent substrate doi:10.1158/0008-5472.CAN-06-2134 (Pierce, Rockford, IL), polyvinylidene difluoride membrane (Bio-Rad) was www.aacrjournals.org 10281 Cancer Res 2006; 66: (21). November 1, 2006

Downloaded from cancerres.aacrjournals.org on September 24, 2021. © 2006 American Association for Cancer Research. Cancer Research used and blocked with StartingBlock blocking buffer with Tween 20 exemestane. Cells were then lysed with 1mL lysis buffer (the same buffer as (Pierce) at room temperature for 1hour. For samples to be detected with used in Western blot) at 0, 2, 4, and 8 hours time points and stored at the LI-COR Odyssey Infrared Imaging System (Lincoln, NE), nitrocellulose À80jC. After a complete set of samples was collected, lysates were spun at membrane was used and blocked with blocking buffer from LI-COR 12,000 Â g for 12 minutes at 4jC and clear supernatant was collected. For at room temperature for 1hour. Rabbit anti-aromatase (Hauptman- immunoprecipitation, 5AL rabbit anti-aromatase antibody (Hauptman- Woodward Institute, Buffalo, NY) was diluted (1:1,000) and mouse anti- Woodward Institute) and 30 AL protein A/G Plus-agarose (Santa Cruz aromatase (Serotec, Raleigh, NC) was diluted (1:300). Rabbit anti-actin Biotechnology) were added into each sample and rotated at 4jC over night. (Santa Cruz Biotechnology, Santa Cruz, CA) was diluted (1:2,000). The After washing four times with cold PBS, samples were heated at 94jC for specificity of both anti-aromatase antibodies has been shown previously 5 minutes in loading buffer [50 mmol/L Tris (pH 6.8), 2% SDS, 10% glycerol, (11, 12). Using appropriate negative (i.e., MCF-7 cells) and positive (i.e., 100 mmol/L DTT] and ran with 8% SDS-PAGE gel. Gels were dried and recombinant aromatase and human placenta microsome preparation) exposed to X-ray film over night followed by densitometry analysis. The controls, we have also confirmed the specificity of these antibodies in our results were then expressed as percentage of 0 hour control. Regression laboratory. Membranes were incubated with primary antibody at 4jC analysis was done with Microsoft Excel. overnight. HRP-conjugated goat anti-rabbit antibody was diluted (1:20,000) Real-time quantitative reverse transcription-PCR. Trizol reagent and IR dye–conjugated secondary antibodies were diluted (1:15,000; (Invitrogen) was used for total RNA isolation. SYBR Green Supermix and LI-COR). iScript cDNA Synthesis kit (Bio-Rad) were used for cDNA preparation. PCR S35-methionine metabolic labeling. Cells were cultured in 60-mm primers for aromatase were as follows: 5¶GATGATGTAATCGATGGCTAC3¶ dishes and were 90% confluent at the time of experiment. To pulse the cells and 5¶TTCATCATCACCATGGCGAT3¶; for human h actin, 5¶AGAAGGA- with S35-methionine, normal culture medium was removed and 2 mL GATCACTGCCCTGGCACC3¶ and 5¶CCTGCTTGCTGATCCACATCTGCTG3¶. methionine-free DMEM, supplemented with 10% dialyzed FBS (Invitrogen), Annealing temperature for PCR was 58jC. Results were analyzed with the was added into each dish followed by addition of 12 AL NEG-772 EASYTAG software provided with the iCycler iQ5 Real-time PCR Detection System Express protein labeling mix (2 mCi, f180 AL; Perkin-Elmer, Boston, MA). (Bio-Rad). After 80 minutes of pulsing, S35-containing medium was removed and Aromatase assay. ‘‘In-cell’’ aromatase assay was done according Zhou normal culture medium was added back, with or without 200 nmol/L et al. (10) with modifications. Briefly, cells were seeded into 96-well plates

Figure 1. Examination of the effects of AIs on aromatase protein stability by Western analysis. A, cells treated for 20 hours with AIs at these concentrations: 200, 40, 8, and 1.6 nmol/L letrozole; 1,000, 200, 40, and 8 nmol/L anastrozole; and 1,000, 200, 40, and 8 nmol/L exemestane. Wedges, AI concentrations from high to low. B, for exemestane doses response studies, cells were treated for 8 hours. Wedge, exemestane concentrations in the range of 25, 50, 100, and 200 nmol/L. For time course studies, exemestane (200 nmol/L) was used. C, cells treated with testosterone for 20 hours. Wedge, testosterone concentrations 1,000, 100, 10,and 1 nmol/L. Total lysate (60 Ag) was used for each sample. Numbers below the aromatase Western blot are the ratio of band intensity to the DMSO control. Results are representative of at least three experiments. C, DMSO control; Aro, aromatase.

Cancer Res 2006; 66: (21). November 1, 2006 10282 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on September 24, 2021. © 2006 American Association for Cancer Research. Exemestane Destabilizes Aromatase and incubated with 100 nmol/L [1-h-3H]-4-androstene-3,17-dione in serum- free medium for various times. The reaction mixture was then extracted with dextran-coated charcoal, and the product, tritiated water, was counted with a liquid scintillation counter. Aromatase activity was expressed as pmol of tritiated water released per mg protein per hour (pmol/mg/h). For dose-responsive experiments, exemestane at various concentrations were included during the assay. For time-dependent aromatase inhibition by exemestane, cells were preincubated with 50 nmol/L exemestane for designated times. Exemestane-containing medium was then removed and the cells were washed twice with PBS and assayed for aromatase activity.

Results Aromatase inhibitors affect the stability of aromatase protein. The two nonsteroidal AIs, letrozole and anastrozole, at concentration as low as 8 nmol/L, caused an increase of aromatase protein levels. These results were expected because letrozole and anastrozole bind to aromatase with high affinities that stabilize the structure of aromatase protein. However, it was not expected that the steroidal inhibitor, exemestane, in contrast, caused a reduction of the aromatase protein (Fig. 1A). To better understand the mechanism of the exemestane-induced aromatase degradation, the following experiments were done. We found that exemestane in the range of 25 to 200 nmol/L caused aromatase degradation in a dose-responsive manner. With 200 nmol/L exemestane, the degradation could be detected as early as 2 hours (Fig. 1B). Because exemestane is an androgen analogue, we questioned if androgen also had a similar effect on aromatase. Our Western blot showed that testosterone (range, 1-1,000 nmol/L) had no effect on the stability of aromatase protein (Fig. 1C) and further indicated that exemestane-induced aromatase degradation is the unique action of exemestane. Exemestane destabilizes aromatase. Metabolic labeling using 35 35 S -methionine is a well-established method to determine protein Figure 2. Aromatase t 1/2 studies. A, autoradiograph of S -methionine-labeled aromatase. B, densitometry analysis of the autoradiograph. The aromatase band t1/2. MCF-7aro cells were pulsed with labeling mix for 80 minutes intensity of the ‘‘0 hour’’ sample is taken as 100%. Results are from three followed by incubation in DMSO vehicle control or 200 nmol/L experiments. Points, average of percentage of the ‘‘0 hour’’ samples; bars, SD. exemestane. Samples were collected at 0, 2, 4, and 8 hours. Aromatase was immunoprecipitated with rabbit anti-aromatase antibody and run on 8% SDS-PAGE gel. After being exposed degradation. With 10 Amol/L MG132, the exemestane-induced to X-ray film, densitometry analysis was done. In the control degradation was totally blocked (Fig. 3B and C). Our results clearly f setting, aromatase had a t1/2 of 28.2 hours. With the presence indicate the involvement of proteasome in aromatase protein of 200 nmol/L exemestane, aromatase t1/2 was reduced to f12.5 degradation. hours (Fig. 2). Aromatase inhibitors have no effect on aromatase mRNA. Aromatase degradation is mediated by proteasome. To The ability of MG132 to block exemestane-induced aromatase examine if the decrease in aromatase protein is caused by changes degradation is a good indication that this process is regulated by in the rate of de novo synthesis, we used an inhibitor of protein proteasome at the protein level. However, it is still important to synthesis, cycloheximide. Our results showed that, under cyclo- examine the effects of AIs on aromatase mRNA stability. Cells heximide (20 ng/mL) plus exemestane, the overall aromatase were treated with either 20 nmol/L letrozole, 20 nmol/L signal was weaker than that in cells treated with exemestane only anastrozole, or 200 nmol/L exemestane for 8 hours. Then, total due to the inhibition on overall protein synthesis by cycloheximide RNA was collected and quantitative real-time PCR was done. No (Fig. 3A). Under cycloheximide treatment, any change in significant differences were detected on mRNA level among the aromatase protein can be attributed to degradation. It is clear treatments (Fig. 3D). Clear differences on aromatase protein were that the 20 hours of incubation time with cycloheximide in this detected under similar conditions. Clearly, the exemestane- experiment is too long and caused significant protein loss, so we induced aromatase degradation is not mediated at the mRNA shortened the incubation to 8 hours in the following experiments. level. To see if exemestane alone can degrade aromatase, we incubated Exemestane inhibits aromatase in a dose-responsive and 1 Amol/L exemestane or DMSO control with purified aromatase in time-dependent manner. To confirm the inhibitory effect of a test tube for 8 hours at 37jC followed by Western blot. No exemestane in MCF-7aro cells, we did the ‘‘in-cell’’ aromatase assay. significant change of aromatase protein was detected (data not We show that exemestane inhibits aromatase dose responsively, shown). Next, we used MG132, a specific proteasome inhibitor, to with IC50 of f20 nmol/L (Fig. 4A). Next, we verified the ‘time- examine the role of proteasome in exemestane-induced aromatase dependent’ inhibition of aromatase by exemestane (Fig. 4B). www.aacrjournals.org 10283 Cancer Res 2006; 66: (21). November 1, 2006

Figure 3. Exemestane-induced aromatase degradation is mediated by proteasome. A, cells were treated with either exemestane (Exe) or exemestane with 20 ng/mL cycloheximide (CHX) for 20 hours. Wedge, decreasing concentrations of exemestane. Western blot was detected with enhanced chemiluminescence exposed to an X-ray film. B, cells were treated for 8 hours with either 1 Amol/L exemestane, 20 ng/mL cycloheximide, 10 Amol/L MG132, or their combinations. The Western blot was detected with Odyssey Infrared Imaging System. C, quantification of (B) using the software that provided with the Odyssey System. Aromatase band intensity was normalized over actin and expressed as average with SDs. D, cells were treated with 20 nmol/L letrozole, 20 nmol/L anastrozole, or 200 nmol/L exemestane for 8 hours. Total RNA was prepared and quantitative reverse transcription-PCR was done. Results are expressed as the ratio of aromatase over actin starting quantity. Numbers below the aromatase Western blot are the ratio of band intensity to the DMSO control. Each treatment has been done in triplicate. Representative of three experiments.

Discussion changes of aromatase mRNA levels. Therefore, exemestane is a Exemestane is known as an irreversible, mechanism-base AI. unique AI that can also destabilize aromatase protein. This compound causes a time-dependent inactivation of human There were a few reports on the effect of some earlier generations of AIs on aromatase stability. Foidart et al. (14) placental aromatase with a t1/2 of 13.9 minutes and Ki of 26 nmol/L (13). As shown in Fig. 4B, exemestane inhibited used an immunocytochemical procedure to study the immuno- aromatase in MCF-7aro cells in a time-dependent manner. Based reactive aromatase in quail brain. They reported that two on previous knowledge and our current findings, as shown in nonsteroidal inhibitors, fadrozole and vorozole, increased Scheme 1, the interaction between exemestane and aromatase can immunoreactive aromatase; whereas two steroidal inhibitors, be divided into three steps. Step 1is the reversible step when 4-OH-androstenedione and androstatrienedione, decreased that signal. This report provided only limited insight on the effect of exemestane binds to aromatase with a Ki of 26 nmol/L. At step 2, exemestane is converted into an intermediate, through a yet AI on aromatase stability due to the complexity of the in vivo unknown process, and results in an irreversible inactivation of system. Yue and Brodie (15) reported the possible role of the enzyme. The t1/2 of this process is f13.9 minutes. At step 3, 4-OHA in inducing aromatase degradation. In that study, they a degradation of aromatase by proteasome occurs after the measured aromatase activity in human choriocarcinoma-derived irreversible inactivation step. We have found that in vitro incu- JEG-3 cells, after treating the cells with cycloheximide or bation of exemestane with purified aromatase had no effect on cycloheximide plus 4-OHA for different times. They found that aromatase protein stability. Following the exemestane treatment of aromatase activity in 4-OHA plus cycloheximide–treated cells MCF-7aro cells, the t1/2 of aromatase protein is reduced by 50% were declining faster than that with cycloheximide alone. or more. We have determined that exemestane, at 200 nmol/L, Because cycloheximide has no inhibitory effect on aromatase, decreases aromatase t1/2 to 12.5 hours from 28.2 hours in untreated the results suggest that 4-OHA induces aromatase degradation. cells. In addition, exemestane treatment did not cause significant Using an ELISA method, Harada et al. (16) studied the effects

Cancer Res 2006; 66: (21). November 1, 2006 10284 www.aacrjournals.org

Figure 5. Induction of aromatase degradation by 4-OHA. Cells were treated with 4-OHA for 8 hours. Wedge, 4-OHA concentrations in the range of 200, 100, 50, and 25 nmol/L. Total lysate (60 Ag) was used for each sample. Numbers below aromatase are the ratio of band intensity to the DMSO control. Results are representative of at least three experiments.

As the first AI approved in Europe and Canada, 4-OHA is structurally very similar to exemestane and is also a mechanism- based AI. For that reason, we also examined 4-OHA for its effect on aromatase protein. Our results show that 4-OHA can also induce aromatase degradation (Fig. 5). In addition to exemestane and 4-OHA, several additional mechanism-based AIs have been synthesized. These inhibitors have been discussed recently in a review by Brueggemeier et al. (9). Briefly, the first mechanism-based inhibitor was 10-propargyl-4-estrene-3,17-dione (MDL 18,962; refs. 17–19). The other two extensively studied mechanism-based inhibitors are 7a-(4¶-aminophenyl)-thioandrosta-1,4-diene-3,17- a a Figure 4. Inhibition of aromatase activity in MCF-7aro cells by exemestane. dione (7 -APTADD) and 7 -phenethyl-androsta-1,4-diene-3,17- A, aromatase assays were carried out by incubation of cells for 1hour with the dione (7a-PEADD; ref. 20). The exact nature of the interaction of androgen substrate and exemestane at various concentrations (0.064, 0.32, these mechanism-based inhibitors with aromatase protein and 1.6, 8, 40, and 200 nmol/L). B, exemestane (50 nmol/L) was preincubated with cells for various times. Cells were then washed twice with PBS and assayed amino acids involved are yet to be elucidated. Although we do not for aromatase activity. Aromatase activity was expressed as percentage of yet know whether MDL18,962, 7a-APTADD, and 7a-PEADD can the DMSO control. induce aromatase degradation, the ability of exemestane and 4-OHA to induce enzyme degradation could explain why it has been difficult for the identification of amino acids/peptides of several AIs on aromatase expression and protein levels participated in the mechanism-based inhibition of aromatase. in JEG-3 cells. They reported a time-dependent increase of In conclusion, our present study provides direct evidences that aromatase protein with three nonsteroidal inhibitors ( fadrozole, among three third-generation AIs, exemestane is different from vorozole, and pentrozole) and a steroidal inhibitor (atames- letrozole and anastrozole that it can also destabilize the target, tane), whereas aromatase mRNA levels were not affected. aromatase protein, and point out the role of proteasome in Harada et al. (16) did not find any inhibitors that could induce mediating this degradation. Our finding will have an important aromatase degradation. effect in the use of exemestane in breast cancer treatment. In addition, previous studies from this and other laboratories have mainly focused on the transcriptional regulation of aromatase expression (21, 22). This study will draw attention to the area of protein stability as an important aspect of aromatase regulation. Knowledge gained from these studies should be helpful in designing a new line of drugs to treat hormone-dependent breast cancer.

Acknowledgments Received 6/9/2006; revised 9/1/2006; accepted 9/12/2006. Grant support: NIH grants CA44735 (S. Chen) and ES08258 (S. Chen) and the Beckman Fellowship of the City of Hope (X. Wang). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. We thank Yanyan Hong for sharing her purified aromatase preparation as the Scheme 1. Mechanism of aromatase inhibition by exemestane. positive control of our Western blot analysis. www.aacrjournals.org 10285 Cancer Res 2006; 66: (21). November 1, 2006

References 7. Wiseman LR, Goa KL. Formestane. A review of its 15. Yue W, Brodie A. Mechanisms of the actions of pharmacological properties and clinical efficacy in the aromatase inhibitors 4-hydroxyandrostenedione, fadro- 1. Goss PE, Ingle JN, Martino S, et al. A randomized trial treatment of postmenopausal breast cancer. Drugs zole, and aminoglutethimide on aromatase in JEG-3 cell of letrozole in postmenopausal women after five years Aging 1996;9:292–306. culture. J Steroid Biochem Mol Biol 1997;63:317–28. of tamoxifen therapy for early-stage breast cancer. 8. Lake DE, Hudis C. Aromatase inhibitors in breast 16. Harada N, Honda S-I, Hatano O. Aromatase inhib- N Engl J Med 2003;349:1793–802. cancer: an update. Cancer Control 2002;9:490–8. itors and enzyme stability. Endocr Relat Cancer 1999;6: 2. Coombes RC, Hall E, Gibson LJ, et al. Intergroup 9. Brueggemeier RW, Hackett JC, Diaz-Cruz ES. Aroma- 211–8. exemestane study: a randomized trial of exemestane tase inhibitors in the treatment of breast cancer. Endocr 17. Metcalf BW, Wright CL, Burkhart JP, Johnston JO. after two to 3 years of tamoxifen therapy in postmen- Rev 2005;26:331–45. Substrate-induced inactivation of aromatase by allenic opausal women with primary breast cancer. N Engl J 10. Zhou DJ, Pompon D, Chen SA. Stable expression of and acetylenic steroids. J Am Chem Soc 1981;103: Med 2004;350:1081–92. human aromatase complementary DNA in mammalian 3221–2. 3. Jakesz R, Kaufmann M, Gnant M, et al. Benefits of cells: a useful system for aromatase inhibitor screening. 18. Covey DF, Hood WF, Parikh VD. 10h-Propynyl- switching postmenopausal women with hormone- Cancer Res 1990;50:6949–54. substituted steroids. Mechanism-based enzyme-activated sensitive early breast cancer to anastrozole after 2 years 11. Turner KJ, Macpherson S, Millar MR, et al. Develop- irreversible inhibitors of estrogen biosynthesis. J Biol adjuvant tamoxifen: combined results from 3123 women ment and validation of a new monoclonal antibody to Chem 1981;256:1076–9. enrolled in the ABCSG trial 8 and the ARNO 95 trial. mammalian aromatase. J Endocrinol 2002;172:21–30. 19. Marcotte PA, Robinson CH. Synthesis and evaluation Breast Cancer Res Treat 2004;88 (Suppl 1:Abs 2). 12. Rago V, Romeo F, Aquila S, Montanaro D, Ando of 10h-substituted 4-estrene-3,17-diones as inhibitors of 4. Howell A, Cuzick J, Baum M, et al. Results of the ATAC S, Carpino A. Cytochrome P450 aromatase expres- human placental microsomal aromatase. Steroids 1982; (Arimidex, tamoxifen, alone or in combination) trial sion in human seminoma. Reprod Biol Endocrinol 39:325–44. after completion of 5 years’ adjuvant treatment for 2005;3:72. 20. Snider CE, Brueggemeier RW. Potent enzyme-acti- breast cancer. Lancet 2005;365:60–2. 13. Giudici D, Ornati G, Briatico G, Buzzetti F, Lombardi vated inhibition of aromatase by a 7a-substituted C19 5. Cocconi G. First generation aromatase inhibitors— P, Di Sale E. 6-Methylenandrosta-1,4-diene-3,17-dione steroid. J Biol Chem 1987;262:8685–9. aminoglutethimide and testolactone. Breast Cancer Res (FCE 24304): a new irreversible aromatase inhibitor. 21. Simpson ER, Clyne C, Rubin G, et al. Aromatase—a Treat 1994;30:57–80. J Steroid Biochem 1988;30:391–4. brief overview. Annu Rev Physiol 2002;64:93–127. 6. Coombes RC, Goss P, Dowsett M, Gazet JC, Brodie A. 14. Foidart A, Tlemcani O, Harada N, Abe-Dohmae S, 22. Chen S, Ye J, Kijima I, Kinoshita Y, Zhou D. Positive 4-Hydroxyandrostenedione in treatment of postmeno- Balthazart J. Pre- and post-translational regulation of and negative transcriptional regulation of aromatase pausal patients with advanced breast cancer. Lancet aromatase by steroidal and non-steroidal aromatase expression in human breast cancer tissue. J Steroid 1984;2:1237–9. inhibitors. Brain Res 1995;701:267–78. Biochem Mol Biol 2005;95:17–23.

Cancer Res 2006; 66: (21). November 1, 2006 10286 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on September 24, 2021. © 2006 American Association for Cancer Research. Aromatase Destabilizer: Novel Action of Exemestane, a Food and Drug Administration −Approved Aromatase Inhibitor

Xin Wang and Shiuan Chen

Cancer Res 2006;66:10281-10286.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/66/21/10281

Cited articles This article cites 21 articles, 5 of which you can access for free at: http://cancerres.aacrjournals.org/content/66/21/10281.full#ref-list-1

Citing articles This article has been cited by 6 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/66/21/10281.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/66/21/10281. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.