ORIGINAL ARTICLE SOCS2: Inhibitor of JAK2V617F-Mediated Signal Transduction

SOCS2: inhibitor of JAK2V617F-mediated signal transduction

H Quentmeier1, R Geffers2, E Jost3, RAF MacLeod1, S Nagel1,SRo¨hrs1, J Romani1, M Scherr4, M Zaborski1 and HG Drexler1

1DSMZ-German Collection of Microorganisms and Cell Cultures, Braunschweig, Germany; 2Department of Mucosal Immunity, Helmholtz Zentrum fu¨r Infektionsforschung, Braunschweig, Germany; 3Medizinische Klinik IV, Universitaetsklinikum Aachen, RWTH Aachen, Germany and 4Department of Hematology, Hemostasis, Oncology and Stem Cell Transplantation, Medical School Hannover, Hannover, Germany

Janus kinase 2 (JAK2)V617F-activating mutations (JAK2mu) cytokine receptors, the JAK2V617F protein induces cytokine- occur in myeloproliferative disorders (MPDs) and myelodys- independent activation of the JAK2/STAT5 pathway.12,13 plastic syndromes (MDSs). Cell lines MB-02, MUTZ-8, SET-2 and UKE-1 carry JAK2V617F and derive from patients with MPD/ Recently, we described four JAK2V617F mutant (JAK2mu) MDS histories. Challenging the consensus that expression of acute myeloid leukemia-derived cell lines from patients with 14 JAK2V617F is the sole precondition for cytokine independence histories of MPD or MDS. In apparent conflict with the view of in class I cytokine receptor-positive cells, two of four of the JAK2V617F as an activating mutation that should lead to JAK2mu cell lines were growth factor-dependent. These cell cytokine independency, two of the four cell lines were lines resembled JAK2wt cells regarding JAK2/STAT5 activa- cytokine-dependent. We provide cogent evidence that SOCS2 tion: cytokine deprivation effected dephosphorylation, whereas erythropoetin or granulocyte colony-stimulating factor induced is an antagonist of not only wild-type JAK2 (JAK2wt), but also of phosphorylation of JAK2 and STAT5. Cytokine independence JAK2V617F, and that epigenetic regulation of SOCS2 gene correlated with low expression and cytokine dependence with expression may be an important second step in cytokine- high expression of the JAK/STAT pathway inhibitor suppressor independent cell growth. of cytokine signaling 2 (SOCS2) suggesting a two-step mechanism for cytokine independence of MPD cells: (i) activation of the oncogene JAK2V617F and (ii) inactivation of the tumor Materials and methods suppressor gene SOCS2. Confirming that SOCS2 operates as a negative JAK2V617F regulator, SOCS2 knockdown induced constitutive STAT5 phosphorylation in JAK2mu cells. CpG Human cell lines island hypermethylation is reported to promote SOCS gene Cell lines SET-2 (ACC 608) and UT-7 (ACC 137) are supplied by silencing in malignant diseases. Accordingly, in one of two the DSMZ (German Collection of Microorganisms and Cell cytokine-independent cell lines and in two of seven MPD Cultures) cell bank. Cell lines MB-02,15 MUTZ-8,16 SKNO-117 patients, we found SOCS2 hypermethylation associated with and UKE-118 were generously provided by the original reduced promoter access to transcription factors. Our results investigators. The cell lines were cultivated according to the provide solid evidence that SOCS2 epigenetic downregulation 19 might be an important second step in the genesis of cytokine- protocols described earlier. independent MPD clones. Leukemia (2008) 22, 2169–2175; doi:10.1038/leu.2008.226; published online 4 September 2008 Human tissue samples Keywords: JAK2; MPD; SOCS2; STAT5 After informed consent was given, five bone marrow and two peripheral blood specimens were obtained during routine clinical assessment of seven adult patients with MPD in chronic phase. The collection of patient samples for analysis of genetic Introduction and epigenetic changes was approved by the local ethics committee. DNA extraction was performed from unselected 10 Expression of suppressor of cytokine signaling (SOCS) genes is cells from bone marrow or peripheral blood. induced by various cytokines. SOCS proteins, in turn, act in a negative feedback loop as regulators of cytokine-triggered cell signaling.1–3 Aberrant methylation of SOCS genes, correlated Cytokines and inhibitors with transcriptional silencing, has been described in solid Erythropoetin, granulocyte colony-stimulating factor and tumors and hematopoetic diseases.4–10 Silencing of SOCS genes granulocyte–macrophage colony-stimulating factor were may lead to both cytokine hypersensitivity and independency, purchased from R&D Systems (Wiesbaden, Germany) and thereby contributing to tumorigenesis.4,10 SOCS gene hyper- interleukin-3 from Strathmann Biotec (Hamburg, Germany). methylation and deletion has also been described in cases of JAK inhibitor I was purchased from Calbiochem/Merck myeloproliferative disorders (MPDs), carrying the Janus kinase 2 Biosciences (Schwalbach, Germany). (JAK2)V617F point mutation.10,11 JAK2V617F is frequently found in BCR/ABL1-negative MPD and in rare cases of 3 myelodysplastic syndromes (MDSs). In the presence of type I [ H]-thymidine uptake and detection of apoptotic cells Assays of [3H]-thymidine incorporation were performed as follows: 2.5 Â 104. cells (in 100 ml) were seeded in triplicate in Correspondence: Dr H Quentmeier, DSMZ, Department Human and 96-well flat-bottom microtiter plates. Cytokines were added as Animal Cell Lines, Inhoffenstr. 7b, Braunschweig 38124, Germany. E-mail: [email protected] 2 Â concentrated solution in 100 ml volumes. For the last 3 h of 3 Received 6 March 2008; revised 7 July 2008; accepted 21 July 2008; the 48-h incubation period, 1 mCi [ H]-thymidine (Amersham published online 4 September 2008 Pharmacia Biotech, Freiburg, Germany) was added to each well. SOCS2 in JAK2V617F mutant cells H Quentmeier et al 2170 Immunoprecipitation and western blot analysis chromosome clones were sourced from BAC-PAC Resources Analysis of STAT5 and JAK2 phosphorylation was performed as (Children’s Hospital, Oakland, CA, USA) and chromosome described earlier.20 For cytokine starvation, cells were washed painting probes from Cambio (Cambridge, UK). The D12Z3 twice and kept overnight in medium containing 0.4% bovine chromosome 12 centromere probe (pA12H8) was kindly serum albumin instead of fetal bovine serum. Rabbit anti-JAK2 supplied by Dr LHJ Looijenga. Probe preparation and labeling antiserum, used for immunoprecipitation and western blot were as described earlier.21 Imaging and analysis were analysis, and mouse anti-phosphotyrosine antibody 4G10 were performed using an Axioscope 2 fluorescence microscope obtained from Upstate/Biomol (Hamburg, Germany). Rabbit system (Zeiss, Goettingen, Germany) and CytoVision FISH anti-STAT5B antiserum for immunoprecipitation was purchased software (Applied Imaging, Newcastle, UK). from R&D Systems. Mouse anti-STAT5A/B antibody for western blot analysis was purchased from Dianova (Hamburg, Germany). Samples were subjected to SDS electrophoresis on SOCS2 methylation analysis 8% polyacrylamide gels. Specific bands on nitrocellulose Methylation of SOCS2 50-CpG-rich areas was assessed by membranes were visualized with the biotin/streptavidin-horse- (i) bisulfide conversion plus sequencing using primers described radish peroxidase system (Amersham, Freiburg, Germany) in earlier4 and (ii) by digestion with the methylation-sensitive combination with the ‘Renaissance western Blot Chemolumi- restriction enzyme HhaI and the SYBR green-based real-time nescence Reagent’ protocol (DuPont, Bad Homburg, Germany). PCR system. (i) About 1 mg DNA of cell lines and patient samples (seven MPD patients) were bisulfide-converted according to the protocol of the supplier (Active Motif, Rixensart, Belgium). DNA microarray hybridization and analysis Products of SOCS2-specific PCR4 were cloned into the pGEM-T Quality and integrity of the total RNA isolated was controlled by easy vector system (Promega, Mannheim, Germany), a running all samples on an Agilent Technologies 2100 Bio- minimum of five clones were sequenced for each PCR product. analyzer (Agilent Technologies, Waldbronn, Germany). For (ii) DNA (400 ng) was digested for 30 min (37 1C) with restriction biotin-labeled target synthesis starting from 3 mg of total RNA, enzyme HhaI (Fermentas, St Leon-Rot, Germany), purified with reactions were performed using standard protocols supplied a commercial kit (Qiagen, Hilden, Germany) and subjected to by the manufacturer (Affymetrix, Santa Clara, CA, USA). The PCR analysis. Sequence bounded by primer pair A lacked HhaI concentration of biotin-labeled cRNA was determined by sites and was used as endogenous control. Sequence amplified ultraviolet absorbance. In all cases, 12.5 mg of each biotinylated by primer pair B contained one HhaI site. PCR products of cRNA preparation were fragmented and placed in a hybridiza- undigested DNA of each individual cell line were used as tion cocktail containing four biotinylated hybridization controls calibrator samples. DNA treated with HhaI methyltransferase (BioB, BioC, BioD and Cre) as recommended by the manufac- was used as positive control. SOCS2 A forward: 50-GC turer. Samples were hybridized to an identical lot of Affymetrix GGTGACCCTTCTCTCAT-30; SOCS2 A reverse: 50-ATTCCCGG GeneChip HG_U133 Plus 2.0 for 16 h. After hybridization, the AGGGCTCAAG-30; SOCS2 B forward: 50-CGGGAGCTCGGTC GeneChips were washed, stained with streptavidin-phyco- AGACA-30; SOCS2 B reverse: 50-CGCTTCCTAGCTGCTTCCTT-30. erythirin and read using an Affymetrix GeneChip fluidic station FS-400 and scanner GCS3000. Analysis of microarray data was performed using the Affymetrix GCOS 1.4 software. For Lentiviral constructs normalization, all array experiments were scaled to a target To generate the lentiviral plasmid S-SOCS2-IEW, MIG-SOCS2 intensity of 150, otherwise using the default values of kindly provided by J Melo (Imperial College London, GCOS 1.2. Hammersmith Hospital, London, UK) was digested with EcoRI and the resulting DNA fragment (B800 nt) was blunt end-ligated into the BamII site of the lentiviral plasmid SIEW (S ¼ SFFV, Real-time PCR analysis I ¼ IRES, E ¼ EGFP, W ¼ WPRE). Quantitative PCR was performed on a 7500 Applied Biosystems real-time PCR system using the manufacturer’s protocol (Darmstadt, Germany). For mRNA quantification, reverse Construction of SOCS2 shRNA expression cassettes transcription was performed using the SuperScript II reverse Two DNA oligonucleotides corresponding to positions 752–771 transcriptase kit (Invitrogen, Karlsruhe, Germany). TaqMan and 770–789 of the human SOCS2 gene sequence (GeneBank probes (Applied Biosystems) were used to quantify JAK2 and accession no. AF037989) were subjected to BLAST homology SOCS2 expression levels with TATA-box-binding protein (TBP) search and thereafter chemically synthesized including 50-BglII as endogenous control. SOCS2 gene amplification was deter- and a 30-SalI restriction site cloning overhangs (BioSpring, mined using the following primers in a SYBR green assay system Frankfurt, Germany). The numbering of the first nucleotide of (Applied Biosystems) with c-MYC as internal control and the shRNAs refers to the ATG start codon. The oligonucleotide CTNNA1 as deletion control: SOCS2 intron2forward:50-TGGTG sequences of the most effective shRNAs used in this study were CAGGCAGATGAAATCAA-30, SOCS2 intron 2 reverse: 50-CAAA as follows: FP752SOCS2: 50-GATCCCCGGCACTGTTCACCT CCCAATCACAACCATCCA-30; c-MYC intron 2 forward: 50-ATA TTATTTCAAGAGAATAAAGGTGAACAGTGCCGTTTTTTGGA GGAGGTGCTTGGGAATG-30, c-MYC intron 2 reverse: 50-TGGC AG-30; RP752SOCS2: 50-TCGACTTCCAAAAAACGGCACTGT ATGGACAAGAAAAGTG-30. CTNNA1 intron6forward:50-GCCA TCACCTTTATTCTCTTGAAATAAAGGTGAACAGTGCCGGGG-30; GTAGCTGCTGTCTTGA-30, CTNNA1 intron 6 reverse: 50-CTTCC FP770SOCS2: 50-GATCCCTCTGACCAAACCGCTCTACTTCAAGA CTCCTGACTCCACTT-30. GAGTAGAGCGGTTTGGTCAGA-30; RP770SOCS2: 50-TCGACT TCCAAAAAATCTGACCAAACCGCTCTACTCTCTTGAAGTAGAG CGGTTTGGTCAGAGGG-30. Cytogenetic analysis The non-complementary 9-nt loop sequences are underlined, Karyotypic analysis and fluorescence in situ hybridization were and each sense oligonucleotide harbors a poly-T stretch as polIII performed as described earlier.21 Tilepath bacterial artificial transcription termination signal. The oligonucleotides were

Leukemia SOCS2 in JAK2V617F mutant cells H Quentmeier et al 2171 annealed and inserted 30 of the H1-RNA promoter into the BglII/ Table 1 Cytokine response profiles of JAK2mu and JAK2wt cell SalI-digested pBlueScript-derived pH1 plasmid to generate pH1- lines SOCS2-752 and pH1-SOCS2-770 as described earlier.22 The isolated clones were verified by DNA sequencing. The plasmid Cell lines JAK2 Cytokine- Epo G-CSF IGF-I TPO pH1-GL4 (control) has been described earlier.22 status dependent MB-02 mu Yes ++ ÀÀ MUTZ-8 mu Yes À ++ À Construction of lentiviral vectors SET-2 mu/wt No ÀÀ ÀÀ pdc-SR were used to generate lentiviral transgenic plasmids SKNO-1 wt Yes À +++ ÀÀ containing H1-shRNA expression cassettes located in the U3 UKE-1 mu No ÀÀ ÀÀ region of the D30-LTR.22.To generate the lentiviral plasmids UT-7 wt Yes +++ + ÀÀ pdcH1-SOCS2-752-SR and pdcH1-SOCS2-770-SR, the plas- Abbreviations: Epo, erythropoietin; G-CSF, granulocyte colony-stimu- mids pH1-SOCS2-752 and pH1-SOCS2-770 were digested with lating factor; IGF-I, insulin-like growth factor-I; TPO, thrombopoietin. SmaI and HincII, and the resulting DNA fragments (360 nt) were Stimulation index (SI) comparing the cytokine-exposed cells directly blunt end-ligated into the SnaBI site of the pdc-SR. The lentiviral with the respective control cells (grown without the specific cytokine). Stimulatory effects: À,SIo2; +,SI2o5; ++, SI 5–10; +++,SI410. plasmids encode RFPEXPRESS as reporter gene. Proliferation was assessed by [3H]-thymidine incorporation, 48 h after onset of stimulation with cytokines (Epo 10 U/ml; G-CSF 10 ng/ml; IGF-I 100 ng/ml and TPO 10 ng/ml). Preparation of recombinant lentiviral supernatants and lentiviral transduction VSV.G-pseudotyped lentiviral particles were generated by MUTZ-8 SKNO-1 calcium phosphate cotransfection of 293T cells. Viral super- JAK2 mu JAK2 wt natants were concentrated by low-speed centrifugation. dcH1- shRNA-SR lentiviral preparations were titrated in triplicate by 5 Nil Nil G-CSF serial dilutions of the concentrated vector stocks on 1 Â 10 G-CSF K-562 cells in 24-well plates. The number of RFP-positive cells WB α pJAK2 was analyzed 72 h post-transduction by flow cytometry analysis (FACS-Calibur, Becton-Dickinson, Heidelberg, Germany), and WB α JAK2 the titers were averaged and typically ranged between 1 and α 5 Â 108 IU/ml. Lentiviral supernatants were used to transduce WB pSTAT5 MB-02 and UT-7 cells for silencing of SOCS2 with a multiplicity α of infection between 2 and 4 as described earlier.23 Lentiviral WB STAT5 supernatants were also used to transduce SET-2 cells for the overexpression of SOCS-2. SET-2 UT-7 JAK2mu JAK2 wt

Results and discussion

Cell lines with JAK2V617F mutations The V617F mutation in the JH2 domain of the JAK2 gene Nil JAK inhbitor Nil Epo JAK inhibitor + Epo disrupts inhibition of the enzyme’s catalytic domain, creating a constitutively activated kinase thatFin the presence of WB: α pJAK2 dimerized type I cytokine receptorsFallows cytokine-independent cell growth. 12,13 Recently, we described four cell lines WB: α JAK2 with a history of MPD or MDS carrying the JAK2V617F WB: α pSTAT5 mutation: MB-02, MUTZ-8, SET-2 and UKE-1.14 Confirming that JAK2V617F acts as an oncogene, the JAK2mu cell lines WB: α STAT5A/B displayed higher sensitivities to JAK inhibitorsFassessed by growth inhibition and induction of apoptosisFthan JAK2wt cell Figure 1 JAK2/STAT5 phosphorylation in JAK2mu and JAK2wt cell lines.14,24 lines. (a) JAK2 and STAT5 phosphorylation is cytokine-dependent in We show here that the activity of JAK2V617F may be JAK2mu (MUTZ-8) and JAK2wt (SKNO-1) cell lines. The cell lines regulated by SOCS molecules. Starting point for this study were cytokine-starved for 18 h and subsequently stimulated for 4 min m was the observation that two JAK2mu cell lines (MB-02 and with G-CSF (10 ng/ml). (b) JAK inhibitor I (1.25 M; 18 h) inhibits the constitutive JAK2/STAT5 phosphorylation in JAK2mu cell line SET-2 MUTZ-8) were cytokine-dependent although homozygous for 14 and prevents Epo-induced (10 U/ml) phosphorylation in the JAK2wt the JAK2 mutation. Assessing cell growth, we verified that cell cell line UT-7. Epo, erythropoetin; G-CSF, granulocyte colony- lines MB-02 and MUTZ-8 expressed class I cytokine receptors stimulating factor. (Table 1). Both cell lines expressed the JAK2mu protein, but behaved like JAK2wt cell lines, as cytokines significantly increased JAK2 and STAT5 phosphorylation (Figure 1a; Supplementary Figure 1). Constitutive JAK2 and STAT5 SOCS2: high expression in cytokine-dependent cell phosphorylation levels were higher in the cytokine-independent lines cell lines SET-2 and UKE-1 than in the dependent cell lines, and Gene expression profiling of the four MPD/MDS-derived reducible by JAK inhibitors at concentrations that led to the JAK2mu cell lines showed that SOCS2 was one of the genes inhibition of cell growth and to the induction of apoptosis most differentially expressed between cytokine-dependent and (Figure 1b; Supplementary Figure 1). cytokine-independent cell lines (data not shown). Quantitative

Leukemia SOCS2 in JAK2V617F mutant cells H Quentmeier et al 2172 real-time PCR confirmed these results: SOCS2 transcript levels SOCS2 inhibited constitutive STAT5 phoshorylation in the were distinctly higher in the cytokine-dependent than in the cytokine-independent JAK2mu cell line SET-2 (Supplementary cytokine-independent cell lines (Figure 2a). Figure 2). SOCS2-transfected SET-2 cells did not grow compar- ably well as untransfected cells or cells transfected with a control plasmid, suggesting that by regulating JAK2mu, SOCS2 SOCS2: a negative regulator for JAK2V617F had an impact on viability and cell growth. SOCS proteins are negative regulators of the JAK/STAT pathway.1–3 SOCS1 and SOCS3 inhibit the JAK/STAT pathway by direct interaction with JAK proteins, whereas SOCS2 SOCS2: epigenetic gene silencing presumably binds to cytokine receptors.25 In polycythemia Recently, epigenetic inactivation of SOCS1 has been proposed vera, low-level expression of SOCS2 in insulin-like growth as a mechanism complementary to the JAK2V617F mutation in factor-I-treated BFU-E colonies contributes to IGF-I hypersensi- the pathogenesis of MPD.10.Consistent with such a model is the tivity and to erythroid overgrowth.26 These observations suggest report of the case of an MPD patient with concurrent that the oncogenic effect of the JAK2V617F mutation may be JAK2V617F mutation and deletion at 12q22 including SOCS2.11 amplified by downregulation of SOCS2. The exact mode of According to this notion, downregulation of SOCS gene action underlying SOCS2 inhibition of JAK2V617F signaling expression, by deletion or gene silencing would be the remains elusive. SOCS2 is not only reported to inhibit contact second step that besides the JAK2V617F mutation leads to between class I cytokine receptors and JAK2,25 but is also the emergence of cytokine-hyperresponsive or cytokine- reported to accelerate proteasome-dependent turnover of independent MPD clones. Therefore, we tested whether SOCS2 SOCS3.27 In the latter scenario, expression of SOCS2 would was deleted or methylated in the cytokine-independent JAK2mu lead to silencing of JAK2V617F through its SOCS3-degrading cell lines. effect. SOCS3, a well-known inhibitor of wild-type JAK2, The SOCS2 gene is located on the long arm of chromosome potentiates the activity of JAK2V617F.28 Thus a priori, one 12 (12q22). Results of fluorescence in situ hybridization analysis would expect that enforced downregulation of SOCS2 would with bacterial artificial chromosome clones adjoining the lead to higher constitutive activation of the JAK2/STAT5 path- SOCS2 locus excluded deletion of chromosome 12 or parts of way in JAK2mu cells. To test this, we suppressed SOCS2 in chromosome 12 containing SOCS2 (Figure 4; shown for cell cytokine-dependent JAK2mu cells by RNAi. Downregulation of lines MUTZ-8 and SET-2 only). Furthermore, quantitative SOCS2 led to an increase of STAT5 phosphorylation in cytokine- genomic PCR confirmed that the low expression of SOCS2 in starved MB-02 cells, confirming that SOCS2 acts as an the cytokine-independent cell lines was not due to a micro- antagonist of JAK2V617F and that regulation of SOCS2 deletion of SOCS2 (Figure 2b). expression may be of importance for cell signaling in JAK2mu To test the methylation of SOCS2, we digested the DNA of MPD cells (Figure 3). Consequently, the overexpression of cytokine-dependent and cytokine-independent JAK2mu cell lines with a methylation-specific restriction enzyme and assessed the extent of methylation by quantitative PCR analysis. Our results confirmed that gene methylation might explain low SOCS2 levels, as cell line UKE-1 (one out of two cytokine- MB-02 MUTZ-8 SET-2 UKE-1 Cytokine-dependent ++– – 12 MB-02 UT-7 10 (JAK2mu) (JAK2 wt)

8 1 Control 6 SOCS2 mRNA RNAi Control 0.75 4 SOCS2 RNAi

Expression 0.5 2

0.25

0 SOCS2

3 0

RNAi: no Control SOCS2 Epo: – + – + – + 2

pSTAT5 SOCS2 gene MB-02 (JAK2mu) 1 STAT5A/B Copy number (N) Gene expression

pSTAT5 0 UT-7 (JAK2wt) Figure 2 SOCS2 mRNA level and gene copy number in JAK2mu cell STAT5A/B lines. (a) SOCS2 mRNA expression in JAK2mu cell lines according to quantitative real-time PCR. Data confirm the results of gene expression Figure 3 SOCS2: suppressor of JAK2V617F cell signaling. (a) SOCS2 profiling with higher SOCS2 levels in cytokine-dependent than in mRNA was downregulated by RNAi in JAK2mu (MB-02) and JAK2wt cytokine-independent JAK2mu cell lines. (b) SOCS2 gene amplifica- (UT-7) cell lines. (b) Western blot analysis demonstrating that tion status in JAK2mu cell lines. All four cell lines tested are diploid for cytokine-independent STAT5 phosphorylation is inversely correlated SOCS2. with expression levels of SOCS2 in JAK2mu, but not in JAK2wt cells.

Leukemia SOCS2 in JAK2V617F mutant cells H Quentmeier et al 2173 SET-2 MUTZ-8

SOCS2

cen 12 (PA12H8) Chr. 12 202g11 74k11

Figure 4 SOCS2: cytogenetic analysis. FISH analysis with BAC clones covering chromosome 12 centromere (PA12H8, yellow) and JAK2 flanking loci (202g11, red; 74k11, green). Neither JAK2mu cytokine-independent (SET-2) nor cytokine-dependent cell lines (MUTZ-8) show cytogenetic alterations of SOCS2. BAC, bacterial artificial chromosome; FISH, fluorescence in situ hybridization.

MB-02 MUTZ-8 SET-2 UKE-1 MUTZ-8 UT-7 120 4.5

3 w/o Cytokines Cytokines

80 Expression JAK Inhibitor I 1.5 + Cytokines SOCS2 Methylatin (%) 40 0 SET-2 UKE-1 UT-7 SOCS2 2

0 1.5 Control JAK Inhibitor I No digestion 1 w/o Cytokines HhaI digestion Expression 0.5

Figure 5 SOCS2 methylation status in JAK2mu cell lines. Methylation SOCS2 of SOCS2 50-region was assessed by DNA digestion with methylation- speciﬁc restriction enzyme HhaI and quantitative real-time PCR. 0 Hundred percentage SOCS2 methylation was observed in the DNA of carcinoma cell line MCF-7 and in DNAs of MPD-derived cell lines Figure 6 SOCS2: a JAK2/STAT5 downstream target in unmethylated treated with HhaI methyltransferase (not shown). MPD, myelo- cell lines. SOCS2 mRNA expression was assessed by quantitative real- proliferative disorder. time PCR. (a) JAK2mu (MUTZ-8) and JAK2wt (UT-7) cell lines were cytokine-starved for 24 h, stimulated for 5 h with cytokines (MUTZ-8: IL-3 and GM-CSF, 10 ng/ml; UT-7: Epo, 10 U/ml) or pretreated for 90 min with JAK inhibitor I (1.25 mM) before stimulation. (b)The independent cell lines) showed high values for SOCS2 cytokine-independent JAK2mu cell lines, SET-2 and UKE-1, were treated methylation (Figure 5). Sequencing PCR products of bisulﬁde- for 24 h with JAK inhibitor I (1.25 mM). Withdrawal of cytokines (24 h) converted DNA showed the same results: in cell line UKE-1, 25 from the medium of JAK2wt cell line UT-7 had the same effect on of 34 CpGs in the SOCS2 exon2/intron2 region tested were SOCS2 expression as JAK inhibitor I in JAK2mu cell line SET-2. Note the extended half-life of SOCS2 mRNA when compared to mRNAs of other methylated and no methylation was found in the remaining SOCS family members.25Epo, erythropoetin; GM-CSF, granulocyte– three cell lines. macrophage colony-stimulating factor; IL-3, interleukin-3. STAT5 is known as a transcription factor for SOCS2.29 Accordingly, SOCS2 expression in the JAK2wt (UT-7) and (Figures 1a, b and 6a). In the cytokine-independent cell line JAK2mu cell lines (MUTZ-8) was cytokine-dependent SET-2, experiments with JAK inhibitors revealed a similar and correlated with phosphorylation of JAK2 and STAT5 positive correlation between activation of the JAK2/STAT5

Leukemia SOCS2 in JAK2V617F mutant cells H Quentmeier et al 2174 Table 2 SOCS2 CpG methylation in primary MPD cells Hypermethylation of SOCS2 in MPD patients To find out whether SOCS2 hypermethylation occurs in primary Patient Diagnosis JAK2 Clone CpGs CpG MPD cells, we performed bisulfide conversion of DNA no. status no. methylated/ methylation from seven MPD patients, from which SOCS2-specific PCR CpGs (%) products were cloned and sequenced. Not knowing the exact sequenced percentages of healthy bystander cells in the samples, we 1 0/13 0 expected unmethylated clones, plus a few highly methylated 2 0/34 0 clones as indicators of SOCS2 silencing in primary MPD cells. 938 ET wt 3 0/33 0 Accordingly, we found SOCS2 hypermethylation in two of 4 0/34 0 seven MPD patients (470% CpGs methylated in 2/5 and 1/6 5 0/34 0 clones, respectively; Table 2). JAK2mu-specific PCR, performed as described previously,10 showed that four of the seven patients 1 1/34 3 2 0/34 0 carried the JAK2V617F mutation, one of them displaying 959 MMM wt 3 1/30 3 SOCS2 hypermethylation (Table 2). High-throughput techniques 4 1/25 4 like pyrosequencing will be necessary to reassess the correlation 5 1/34 3 between occurrence of the JAK2V617F mutation and hypermethylation of SOCS2 in a larger cohort of MPD patients. 1 0/24 0 Our data provide first evidence that both events may occur in 2 0/34 0 F F 966 PV mu 3 0/34 0 the same cell and as described for cell lines induce cytokine 4 0/34 0 independence. 5 0/34 0 6 0/34 0 Conclusion 1 0/34 0 2 0/34 0 We present cogent evidence that SOCS2 is an antagonist not 985 MMM mu 3 29/34 85 only of wild-type JAK2 but also of JAK2V617F. Methylation of 4 0/34 0 5 29/34 85 SOCS2 associated with low-level expression of SOCS2 in one out of two MPD-derived cell lines was also found in two of 1 0/34 0 seven MPD patient samples. We conclude that downregulation 2 0/34 0 of SOCS2 gene expression might be an important second step 986 PV mu 3 0/34 0 for the rise of cytokine-independent MPD clones. 4 1/34 3 5 0/34 0 References 1 0/34 0 2 25/34 74 1 Starr R, Willson TA, Viney EM, Murray LJL, Rayner JR, Jenkins BJ 1006 ET wt 3 0/34 0 et al. A family of cytokine-inducible inhibitors of signalling. Nature 4 0/34 0 1997; 387: 917–921. 5 0/24 0 2 Endo TA, Masuhara M, Yokouchi M, Suzuki R, Sakamoto H, 6 0/34 0 Mitsui K et al. A new protein containing an SH2 domain that inhibits JAK kinases. Nature 1997; 387: 921–924. 1 0/34 0 3 Naka T, Narazaki M, Hirata M, Matsumoto T, Minamoto S, Aono A 2 1/34 3 et al. Structure and function of a new STAT-induced STAT 1015 ET mu 3 0/34 0 inhibitor. Nature 1997; 387: 924–929. 4 0/34 0 4 Sutherland KD, Lindeman GJ, Choong DYH, Wittlin S, Brentzell L, 5 0/34 0 Phillips W et al. Differential hypermethylation of SOCS genes in Abbreviations: ET, essential thrombocythemia; MPD, myeloproliferative ovarian and breast carcinomas. Oncogene 2004; 23: 7726–7733. disorder; MMM, myelofibrosis with myeloid metaplasia; PV, poly- 5 Galm O, Wilop S, Reichelt J, Jost E, Gehbauer G, Herman JG et al. cythemia vera. DNA methylation changes in multiple myeloma. Leukemia 2004; DNA from MPD patients was bisulfide-converted, the SOCS2 CpG- 18: 1687–1692. rich area amplified as described4 and PCR products were cloned. At 6 Marini A, Mirmohammadsadegh A, Nambiar S, Gustrau A, least five clones were sequenced for each sample. The full-length PCR Ruzicka T, Hengge UR. Epigenetic inactivation of tumor suppres- product contained 34 CpG sites. JAK2 mutational status was sor genes in serum of patients with cutaneous melanoma. J Invest assessed by PCR.10 Dermatol 2006; 126: 422–431. 7 Lee TL, Yeh J, van Waes C, Chen Z. Epigenetic modification of SOCS-1 differentially regulates STAT3 activation in response to pathway and the expression of SOCS2 (Figure 1b, 6b). In interleukin-6 receptor and epidermal growth factor receptor contrast, JAK inhibition failed to cause downregulation of signaling through JAK and/or MEK in head and neck squamous SOCS2 in cell line UKE-1 (Figure 6b). According to the widely cell carcinomas. Mol Cancer Ther 2006; 5: 8–19. held view, promoter methylation impedes binding of transcrip- 8 Niwa Y, Kanda H, Shikauchi Y, Saiura Y, Matsubara K, Kitagawa T 30 et al. Methylation silencing of SOCS-3 promotes cell growth and tion factors to their DNA-binding sites. Thus, the results of migration by enhancing JAK/STAT and FAK signalings in human SOCS2 expression support the data of the direct methylation hepatocellular carcinoma. Oncogene 2006; 24: 6404–6417. analyses: of the four JAK2mu cell lines, only the cytokine- 9 Brakensiek K, La¨nger F, Schlegelberger B, Kreipe H, Lehmann U. independent cell line UKE-1 carries a methylated SOCS2 Hypermethylation of the suppressor of cytokine signalling-1 promoter. Our results do not explain why the second (SOCS-1) in myelodysplastic syndrome. Br J Haematol 2005; cytokine-independent cell line (SET-2) expresses low levels of 130: 209–217. 10 Jost E, do O´ N, Dahl E, Maintz CE, Jousten P, Habets L et al. SOCS2, but confirm that DNA methylation is a plausible cause Epigenetic alterations complement mutation of JAK2 tyrosine for low expression levels of SOCS2, and may thus contribute to kinase in patients with BCR/ABL1-negative myeloproliferative cytokine independence of the affected cells. disorders. Leukemia 2007; 21: 505–510.

Leukemia SOCS2 in JAK2V617F mutant cells H Quentmeier et al 2175 11 Etienne A, Carbuccia N, Adelaide J, Bekhouche I, Remy V, Sohn C lymphopoietin (TSLP) and signaling mechanisms leading to et al. Rearrangements involving 12q in myeloproliferative dis- proliferation. Leukemia 2001; 15: 1286–1292. orders: possible role of HMGA2 and SOCS2 genes. Cancer Genet 21 MacLeod RAF, Kaufmann M, Drexler HG. Cytogenetic harvesting Cytogenet 2007; 176: 80–88. of commonly used tumor cell lines. Nat Protoc 2007; 2: 372–382. 12 Lu X, Levine R, Tong W, Wernig G, Pikman Y, Zarnegar S et al. 22 Scherr M, Battmer K, Ganser A, Eder M. Modulation of gene Expression of a homodimeric type I cytokine receptor is required expression by lentiviral-mediated delivery of small interfering for JAK2V617F-mediated transformation. Proc Natl Acad Sci USA RNA. Cell Cycle 2003; 3: 251–257. 2005; 102: 18962–18967. 23 Scherr M, Battmer K, Blo¨mer U, Schiedlmeier B, Ganser A, Grez M 13 Lu X, Huang LJS, Lodish HF. Dimerization by a cytokine receptor is et al. Lentiviral gene transfer into peripheral blood-derived CD34+ necessary for constitutive activation of JAK2V617F. J Biol Chem NOD/SCID-repopulating cells. Blood 2002; 99: 709–712. 2008; 283: 5258–5266. 24 Levine RL, Madleigh M, Cools J, Ebert BL, Wernig G, Huntly BJP 14 Quentmeier H, MacLeod RAF, Zaborski M, Drexler HG. et al. Activating mutation in the tyrosine kinase JAK2 in JAK2V617F tyrosine kinase mutation in cell lines derived from polycythemia vera, essential thrombocythemia, and myeloid myeloproliferative disorders. Leukemia 2006; 20: 471–476. metaplasia with myeloﬁbrosis. Cancer Cell 2005; 7: 387–397. 15 Morgan DA, Gumucio DL, Brodsky I. Granulocyte-macrophage 25 Larsen L, Ro¨pke C. Suppressors of cytokine signalling: SOCS. Acta colony-stimulating factor-dependent growth and erythropoietin- Pathol Microbiol Immunol Scand 2002; 110: 833–844. induced differentiation of a human cell line MB-02. Blood 1991; 26 Usenko T, Eskinazi D, Correa PN, Amato D, Ben-David Y, 78: 2860–2871. Axelrad AA. Overexpression of SOCS-2 and SOCS-3 16 Hu ZB, MacLeod RAF, Meyer C, Quentmeier H, Drexler HG. genes reverses erythorid overgrowth and IGF-I hypersensitivity of New acute myeloid leukemia-derived cell line: MUTZ-8 with primary polycythemia vera (PV) cells. Leuk Lymphoma 2007; 48: 5q-. Leukemia 2002; 16: 1556–1561. 134–146. 17 Matozaki S, Nakagawa T, Kawaguchi R, Aozaki R, Tsutsumi M, 27 Tannahill GM, Elliott J, Barry AC, Hibbert L, Cacalano NA, Murayama T et al. Establishment of a myeloid leukaemic cell line Johnston JA. SOCS2 can enhance interleukin-2 (IL-2) and IL-3 (SKNO-1) from a patient with t(8;21) who acquired monosomy 17 signaling by accelerating SOCS3 degradation. Mol Cell Biol 2005; during disease progression. Br J Haematol 1995; 89: 805–811. 25: 9115–9126. 18 Fiedler W, Henke RP, Ergu¨n S, Schumacher U, Gehling UM, 28 Hookham MB, Elliott J, Suessmuth Y, Staerk J, Ward AC, Vohwinkel G et al. Derivation of a new hematopoietic cell line Vainchenker W et al. The myeloproliferative disorder-associated with endothelial features from a patient with transformed JAK2 V617F mutant escapes negative regulation by suppressor of myeloproliferative syndrome. Cancer 2000; 88: 344–351. cytokine signaling 3. Blood 2007; 109: 4924–4929. 19 Drexler HG. The Leukemia-Lymphoma Cell Line Factsbook. 29 Jegalian AG, Wu H. Differential roles of SOCS family members in Academic Press: San Diego, CA, 2000. EpoR signal transduction. J Interferon Cytokine Res 2002; 22: 853–860. 20 Quentmeier H, Drexler HG, Fleckenstein D, Zaborski M, 30 Rice KL, Hormaeche I, Licht JD. Epigenetic regulation of normal Armstrong A, Sims JE et al. Cloning of human thymic stromal and malignant hematopoiesis. Oncogene 2007; 26: 6697–6714.

Supplementary Information accompanies the paper on the Leukemia website (http://www.nature.com/leu)

Leukemia