Investigating Foodborne Cryptosporidium and Giardia in Clams Harvested Near Iqaluit, Nunavut

INVESTIGATING FOODBORNE CRYPTOSPORIDIUM AND GIARDIA IN CLAMS HARVESTED NEAR IQALUIT, NUNAVUT

Anna Jane Wilson Manore

A Thesis presented to The University of Guelph

In partial fulfilment of requirements for the degree of Master of Science in Population Medicine

Guelph, Ontario, Canada

ABSTRACT

INVESTIGATING FOODBORNE CRYPTOSPORIDIUM AND GIARDIA IN CLAMS HARVESTED NEAR IQALUIT, NUNAVUT

Anna Jane Wilson Manore Advisors: University of Guelph, 2018 Dr. Sherilee L. Harper Dr. Karen Shapiro

High prevalences of Cryptosporidium and Giardia were reported in enteric illness patients in

Nunavut, Canada, with a foodborne, waterborne, or animal source of parasites suspected. Clams

(Mya truncata) are a commonly consumed, culturally important, and nutritious country food in

Iqaluit, Nunavut; however, shellfish may concentrate pathogens from surrounding waters.

EcoHealth approaches were used to investigate locally-harvested clams as a potential source of

Cryptosporidium and Giardia for Iqaluit residents. Following molecular method validation, clam hemolymph (n=328) and digestive gland (n=390) samples were screened for Cryptosporidium and Giardia via PCR followed by sequence analyses. Giardia was confirmed in hemolymph from 2 clams, while Cryptosporidium was not detected. The Giardia sequences were identified as zoonotic Giardia enterica assemblage B, and may have originated from human or animal sources. Study results are intended to inform public health practice and planning.

iii

ACKNOWLEDGEMENTS

This thesis would not be what it is without my fantastic co-advisors and advisory committee. Thanks first and foremost to my amazing co-advisors – Drs. Sherilee Harper and

Karen Shapiro. Sheri, thank you so much for fostering such a welcoming, open, and encouraging space for me (and the whole lab) to work, and for always pushing me to do my best, and then do more. I have learned so much about how to do research, and be a researcher, and how to be aware of my role in the work that I do. Karen, thank you for your support while I travelled to a new place, your advice while I was attempting to set up a lab, and for your patience while I was learning and re-learning my way around the lab. I’ve learned so much from both of you.

Thank you to all my committee members, Drs. Jan Sargeant, Scott Weese, and Ashlee

Cunsolo, for your hard work in the planning of the PAWS project, and for offering your advice on my work and on my writing. Each of you brought a unique perspective to this research, and

I’m so grateful for each of your contributions.

Thanks as well to the Harper Lab (members past and present), for being such an excellent group of researchers, colleagues, friends, and people in general. I can’t imagine having done all this work without you! Thanks Carl, Viv, Jacquie, Steph, Danielle, Kate BW, Kate L, Alex, LJ,

Amy, Paola, David, Manpreet, Lindsay, Isaac, Jess, Julia, Steven and Nia - this work was infinitely improved by having you all around, and it has been wonderful being able to work alongside, learn from, travel and grow with all of you. iv

Thank you to everyone I worked with in Iqaluit for your time and energy supporting this work. At the Nunavut Research Institute: thank you Jamal Shirley, Mosha Cote, Rick Armstrong, and Mary Ellen Thomas for your interest, advice, and support during the clam collection phase of the PAWS project, and for the use of Nunavut Research Institute facilities and lab space.

Thank you Enoo – for your generosity with your time, your music, and your knowledge. Your involvement truly made this project possible. Joanna Petrasek-MacDonald, Victoria Watson, and

Anika Bychok – thank you for your friendly faces and company while in Iqaluit. Thank you to all the harvesters who gave their clams to the PAWS project. And, of course, thank you

Stephanie Masina, Danielle Julien, and Anna Bunce for your help and support on PAWS in

Iqaluit.

In Davis, thank you so much to everyone who made me feel welcome while far from home: Beatriz Aguilar, Brittany Dalley, Andrea Packham, Pat Conrad, Minji Kim, Leslie Rueda, and Tiffany D’Arcy. Thanks in particular to Beatriz and Brittany for teaching (and re-teaching) me how to process the clam samples, and for being patient while I learned the ropes. Thanks also to Alica Buck, Nene Chantavarin, and Nora Beier for showing me around the best bits of Davis.

In Guelph, thank you to Joyce Rousseau, for being so kind and helpful while I was learning my way around the CPHAZ lab. Thank you, Rebecca Fung, for being such a great student, for always being eager to learn, and of course for your help in processing clam samples.

Thank you to the funding agencies that supported my research through: ArcticNet, the

Ontario Graduate Scholarship, the Ontario Veterinary College Student Stipend; the Canadian

Institutes of Health Research Canada Graduate Scholarship, the Arthur D. Latornell Travel

Grant, the Northern Scientific Training Program, and the Michael Smith Foreign Study

Supplement.

Thank you to all my friends who have supported me during these last few years, and in particular Emily Hawkins and Shveta Kanetkar, for your messages, your support, for always being ready with the worst (best) puns, and a plan for an adventure. Thank you, of course, to my parents and my brother for all your love and support. And, last but not least, thanks to Ann and

Sandy and all the Middletons for being my family in Guelph these last few (eight) years – it has meant the world to me!

STATEMENT OF WORK

This thesis research was designed and carried out by a collaborative and interdisciplinary team of researchers, community members, and members of Northern governmental and non- governmental organizations. The use of an EcoHealth framework, in particular the participatory and interdisciplinary nature of the PAWS project, was crucial to the success of this research.

Introduction and Literature Review

The review protocol, including research question and search terms, was developed in collaboration with my advisory committee (Drs. Sherilee Harper, Karen Shapiro, Jan Sargeant,

Scott Weese, and Ashlee Cunsolo) and with a consultation with Ali Versluis, an Open Education

Resources Librarian at the University of Guelph. I conducted the final search, de-duplicated references in Mendeley© reference management software, imported references and created screening forms in DistillerSR© (Evidence Partners, Ottawa, ON, Canada) systematic review software. I reviewed titles and abstracts in DistillerSR© with Stephanie Masina (MSc Student),

Isaac Bell (BSc Student), and Jessica Purbrick (BSc Student). I downloaded PDF files for articles that proceeded to level 2 screening with Isaac Bell, Jessica Purbrick, and Rebecca Ma (BSc

Student). I screened full-text articles in DistillerSR© and exported reference information for each article that passed level 2 screening to Microsoft® Excel. I wrote this chapter under the supervision of Drs. Sherilee Harper and Karen Shapiro and with edits from my advisory committee (Drs. Jan Sargeant, Scott Weese, and Ashlee Cunsolo).

Optimization of Nucleic Acid Extraction and Detection

Brittany Dalley (Laboratory Technician) and I extracted Cryptosporidium parvum DNA using different numbers of freeze-thaw (FT) cycles and performed PCR to detect DNA under the supervision of Beatriz Aguilar (Staff Research Associate). Dr. Heather Fritz produced and

vii provided Toxoplasma gondii oocysts, and Beatriz Aguilar spiked mussel tissue and water samples, extracted oocyst DNA and performed the PCR to detect T. gondii DNA. Dr. Karen

Shapiro conceptualized and designed this study; I conducted this research under the supervision of Dr. Karen Shapiro and wrote the manuscript for this study under the supervision of Drs. Karen

Shapiro and Sherilee Harper, and with edits from Dr. Scott Weese and Beatriz Aguilar.

Cryptosporidium and Giardia in Locally-Harvested Clams in Iqaluit, Nunavut

This project is one component of the People, Animals, Water, and Sustenance (PAWS) project, which is a collaboration between researchers at the University of Guelph, the Labrador

Institute at Memorial University, the Nunavut Research Institute, and governmental and non- governmental organizations in Iqaluit, Nunavut. The PAWS Project was designed by Drs.

Sherilee Harper, Jan Sargeant, Karen Shapiro, Rebecca Guy, Scott Weese, Ashlee Cunsolo, and

Anna Bunce, alongside community partners, and aims to develop a community-based monitoring system of environmental pathogens in Iqaluit, Nunavut.

I assisted the PAWS team in the planning and management of the “Sustenance” component of this project, along with Jamal Shirley from the Nunavut Research Institute and

Enooyaq Sudlovenick (BSc Student). I travelled to Iqaluit for two weeks in July 2016 to plan the logistics of the project and four weeks in September 2016 to conduct the clam collection from local harvesters, and process clam tissue samples. I worked with Stephanie Masina, Anna Bunce

(PAWS Project Manager) and Dr. Sherilee Harper to write and submit appropriate research licenses and permits to the Nunavut Impact Review Board, the Nunavut Planning Commission, and Fisheries and Oceans Canada. I worked with Dr. Karen Shapiro to write the protocol for clam tissue processing in Iqaluit, and I sought out equipment options and ordered the needed equipment for clam sampling and clam collection. I worked with Stephanie Masina, Enooyaq

viii

Sudlovenick, Anna Bunce, Danielle Julien, Garry Akpik (Research Assistant), and Pudloo

Davidee (Research Assistant) to collect clams from local harvesters. Enooyaq Sudlovenick,

Garry Akpik, and Pudloo Davidee also worked as interpreters during clam collection. Enooyaq

Sudlovenick, Stephanie Masina, Danielle Julien and I worked together to process clam tissue samples in Iqaluit at the Nunavut Research Institute. Enooyaq Sudlovenick transferred clam collection data from handwritten sheets into Microsoft® Excel. I later cleaned and analyzed these data in Microsoft® Excel, Stata® 13.1 (StataCorp, College Station, TX, USA), and ArcGIS

10.4.1 (Esri, Redlands, CA, USA).

I investigated options and arranged shipping of clam samples to the University of

California, Davis for DNA extraction and PCR. Beatriz Aguilar provided training for these methods at UC Davis, and Brittany Dalley and I completed DNA extraction from the first 100 clam tissues. Dr. Karen Shapiro and I investigated options for and ordered supplies to replicate the methods from Davis at the Centre for Foodborne Zoonoses (CPHAZ) at the University of

Guelph. I worked with Joyce Rousseau (lab technician, CPHAZ) to arrange lab space, workflows, and protocols for the clam testing. I trained Rebecca Fung (BSc Student) on DNA extraction, PCR, and DNA extraction methods, and we completed these analyses for the remaining 300 clam tissue samples together. DNA sequencing was performed by the UCDNA

Sequencing Facility at the University of California, Davis, and the Advanced Analysis Centre at the University of Guelph, and analyses of the sequences was completed by Dr. Karen Shapiro and myself.

I wrote the manuscript for this chapter under the supervision of Drs. Sherilee Harper and

Karen Shapiro, with edits from my advisory committee (Drs. Jan Sargeant, Scott Weese, and

Ashlee Cunsolo) and Enooyaq Sudlovenick.

Stephanie Masina, Carlee Wright, Dr. Sherilee Harper, Dr. Jan Sargeant, Dr. Rebecca

Guy, and Dr. Danielle Julien and I worked with Northern research partners to develop knowledge mobilization strategies for the results of this study at a day-long meeting in Iqaluit in

November 2017. Carlee Wright, Stephanie Masina and I worked together to finalize the meeting agenda, develop handouts and name tags, and manage meeting registration. I presented the results of the “Sustenance” portion of the PAWS Project at the workshop. I also presented this project as two oral presentations and five poster presentations at local conferences in Guelph

(ON), poster presentations at three international conferences in Vancouver, (BC), Winnipeg

(MB), and Québec City (QC); three oral presentations in the United States (two in California and one in Alaska), one in Russia, and one at an international conference in Québec City (QC).

While in Iqaluit in 2016, Anna Bunce and I spoke about the PAWS project clam research with

CBC North in an online print interview, a radio interview, and a video interview.

The manuscripts which make up Chapters Two and Three of this thesis will be submitted for publication with co-authors.

Chapter Two:

Optimization of nucleic acid extraction and detection of Cryptosporidium parvum and Toxoplasma gondii oocysts from environmental matrices

Authors, in order of listing: Anna JW Manorea, Sherilee L Harpera, Beatriz Aguilarb, J Scott Weesec, Karen Shapiroa,b

Chapter Three:

Cryptosporidium and Giardia in locally-harvested clams in Iqaluit, Nunavut

Authors, in order of listing: Anna JW Manorea, Sherilee L Harpera, Jan M Sargeanta,c, J Scott Weesec, Ashlee Cunsolod, Anna Buncea, Jamal Shirleye, Enooyaq Sudlovenickf, Karen Shapiroa,b

Affiliations a. Department of Population Medicine, Ontario Veterinary College, University of Guelph, 50 Stone Rd E, Guelph ON, Canada b. Department of Pathology, Microbiology & Immunology, School of Veterinary Medicine, One Shields Ave, 4206 VM3A, University of California, Davis CA, USA c. Centre for Public Health and Zoonoses, University of Guelph, 50 Stone Rd E, Guelph ON, Canada d. Labrador Institute, Memorial University, 219 Hamilton River Rd, PO Box 490, Stn B, Happy Valley-Goose Bay NL, Canada e. Nunavut Research Institute, Nunavut Arctic College, PO Box 1720, Iqaluit NU, Canada f. Department of Integrative Biology, College of Biological Sciences, University of Guelph, 50 Stone Rd E, Guelph ON, Canada

TABLE OF CONTENTS

CHAPTER ONE: INTRODUCTION AND LITERATURE REVIEW Introduction ...... 1 Literature Review ...... 2 Search Methods ...... 2 Biology and Contamination of Shellfish in the North American Arctic ...... 3 Sociocultural Aspects of Shellfish: An Important Country Food in the Arctic ...... 6 Health Aspects of Shellfish in the North American Arctic ...... 8 Justification for Thesis Research...... 12 The People, Animals, Water, and Sustenance (PAWS) Project...... 12 Thesis Goal and Objectives ...... 13 Figures ...... 14 Tables ...... 16 References ...... 17 CHAPTER TWO: OPTIMIZATION OF NUCLEIC ACID EXTRACTION AND DETECTION OF CRYPTOSPORIDIUM PARVUM AND TOXOPLASMA GONDII OOCYSTS FROM ENVIRONMENTAL MATRICES Highlights ...... 26 Abstract ...... 26 Keywords ...... 26 Introduction ...... 27 Methods and Results ...... 28 References ...... 33 CHAPTER THREE: CRYPTOSPORIDIUM AND GIARDIA IN LOCALLY-HARVESTED CLAMS IN IQALUIT, NUNAVUT Summary ...... 35 Keywords ...... 35 Introduction ...... 356 Methods ...... 39 Study Design...... 39 Sample Acquisition and Processing ...... 39 Nucleic Acid Extraction ...... 40 Polymerase Chain Reaction (PCR)...... 41 Sequence Analysis ...... 42 Results ...... 43 Characteristics of Harvested Clams ...... 43 Estimating the Prevalence of Cryptosporidium and Giardia ...... 43

Molecular Characterization ...... 44 Discussion ...... 44 Conclusions ...... 48 Figures ...... 50 Tables ...... 52 References ...... 54 CHAPTER FOUR: SUMMARY OF RESEARCH, RECOMMENDATIONS, AND CONCLUSIONS Summary of the Thesis Research Approach and Results ...... 63 Thesis Research Strengths and Limitations ...... 65 Considerations ...... 68 Results Sharing Activities ...... 69 Recommendations ...... 69 Recommendations for Researchers ...... 70 Recommendations for Policymakers ...... 71 Conclusions ...... 73 Figures ...... 74 References ...... 78

Appendices ...... 82

xii

LIST OF TABLES

CHAPTER ONE Table 1.1: Search terms used to identify relevant references in Web of Science, CAB Direct©, and PubMed. Search strings were applied to titles and abstracts in all three databases, and to author keywords and Keywords Plus© in Web of Science, subject terms in CAB Direct©, and to MeSH terms in PubMed. Shellfish and location search strings were combined using the operator “AND”...... 16

CHAPTER TWO Table 2.1: Limit of detection (LOD) of Toxoplasma gondii oocysts extracted from water and mussel tissue homogenate, and Cryptosporidium parvum oocysts extracted from phosphate- buffered saline (PBS)...... 29

Table 2.3: Detection of Cryptosporidium parvum DNA using primer sets targeting the gp60 or 18S rRNA gene. DNA was extracted from oocysts in PBS using a single FT cycle...... 32

CHAPTER THREE Table 3.1: A summary of the number of clams harvested at each location in September 2016, and results of molecular testing for Cryptosporidium and Giardia via PCR and sequence analyses. Numbers in brackets represent suspected positive samples from digestive gland tissue. Unless otherwise indicated, all potential, sequenced, and confirmed positives were from hemolymph samples...... 52

Table 3.2: Single nucleotide polymorphisms (SNPs) at the gdh locus in G. enterica assemblage B from reference strains and clams from Iqaluit, Nunavut (2016)...... 53

xiii

LIST OF FIGURES

CHAPTER ONE Figure 1.1: Map of Inuit Nunangat, including the four settled Inuit land claim regions, Inuvialuit Settlement Region, Territory of Nunavut, Nunavik Inuit Land Claims Settlement Area, and Labrador Inuit Land Claims Settlement Area (Nunatsiavut)...... 14

Figure 1.2: The Canadian Shellfish Sanitation Program is administered by the Canadian Food Inspection Agency, Fisheries and Oceans Canada, and Environment and Climate Change Canada...... 15

CHAPTER THREE Figure 3.1: Maps of (A) Canada, (B) Frobisher Bay, and (C) Iqaluit showing the harvest locations of clams near Iqaluit. Brackets below location IDs depict number of collected clams that were harvested from each site in 2016. Stars indicate harvest locations of clams confirmed positive for Giardia...... 50

Figure 3.2: The median (black circles) and range (bars) of clam weight and length by harvest location are displayed. Location 10 represents clams whose harvest location was unknown. The red star indicates the harvest location, weight (A), and length (B) of Giardia-positive clam 10H. The yellow star indicates the harvest location, weight (A), and length (B) of Giardia-positive clam 221H...... 51

CHAPTER FOUR Figure 4.1: Posters distributed around Iqaluit prior to clam collection from harvesters. This sheet was also available in Inuktitut (Appendix B)...... 74

Figure 4.2: Clam (with attached anemone) prior to sample processing at the Nunavut Research Institute, Iqaluit, Nunavut, September 2016...... 75

Figure 4.3: Handout distributed at results sharing meeting in Iqaluit in November 2017. This handout included results presented in this thesis as well as work reported to be reported elsewhere detecting Toxoplasma gondii in the clam tissue samples. This handout was also available in French and Inuktitut (Appendix B)...... 76

Figure 4.4: Agenda (front and back pages) from November 2017 results sharing meeting in Iqaluit, Nunavut...... 77

xiv

CHAPTER ONE:

INTRODUCTION AND LITERATURE REVIEW

Introduction

Foodborne pathogens have been estimated to cause 550 million cases of acute gastrointestinal illness (AGI), and 230,000 deaths annually.1 AGI includes vomiting and/or diarrhea, which can range from short-lived and self-limiting to fatal.2 Pathogens that can cause

AGI include bacteria (e.g. Campylobacter spp., Salmonella spp., and Vibrio spp.), viruses (e.g.

Norovirus and Hepatitis A virus), and protozoan pathogens (e.g. Cryptosporidium and Giardia).1

Humans can be exposed to these pathogens by ingestion through contact with infected people or animals, or with water or food contaminated with human or animal fecal material.1 Globally,

29% of AGI cases are estimated to come from food, making food an important source of AGI in high, medium, and low-income countries.1,3

From 2005-2010, over 100 international outbreaks of foodborne illness from fish and shellfish were reported.4–6 Foodborne pathogens can accumulate in shellfish, as they filter water to feed.4,7–9 Contamination of shellfish can occur due to proximity to sewage outfalls,10 livestock, or other sources of animal or human fecal material.8 Pathogenic bacteria have been detected in shellfish at both food processing and retail locations.4–6 For instance, Vibrio, E. coli, and

Salmonella bacteria have been reported in retail shellfish in many regions (Europe, Asia,

Caribbean, North and South America),4 and protozoan pathogens, including Cryptosporidium and Giardia, have been found in shellfish in North America and Europe.9

In Canada, bacteria carrying antibiotic resistance genes have been found in shellfish in retail settings,5,6 and viral, bacterial, and protozoan pathogens have been found in shellfish harvested in Northern Quebec.11 While federal government programs such as the Canadian

Shellfish Sanitation Program monitor the microbiological quality of shellfish, these programs do not cover all geographic areas where shellfish are harvested for personal consumption, and are absent from Northern locales.12 Therefore, this literature review examines the biological, sociocultural, and health dimensions of shellfish research in Arctic North America.

Literature Review

Search Methods

A search of the scientific literature was conducted to explore the extent, range, and nature of published research on shellfish in Arctic locales of North America using an a priori developed search strategy. Search strings of shellfish and location-related terms were created for

Web of Science,™ CAB Direct,© and PubMed. The search string for shellfish was adapted from a previous scoping review investigating farmed aquatic species and seafood (Table 1.1).4 These search strings were applied to titles and abstracts in all three databases, and to author keywords and Keywords Plus© in Web of Science,™ subject terms in CAB Direct,© and to MeSH terms in

PubMed. No date restrictions were placed on the search, other than the data ranges of the included databases. The search was conducted on December 12th, 2016, and citations were de- duplicated manually and using Mendeley Desktop version 1.17.13 (Elsevier Inc., New York,

NY, USA). De-duplicated citations (n=6,155) were uploaded to DistillerSR© (Evidence

Partners, Ottawa, ON, Canada), and titles and abstracts were screened by two independent reviewers (see full screening questions in Appendix A). Citations were included if they described primary qualitative or quantitative research or systematic literature reviews that examined shellfish in a North American Arctic locale. North American Arctic locales were defined as areas in the United Stated or Canada that fell within the Arctic boundary according to the Arctic

Human Development Report (see map in Appendix A).13 Shellfish included macroscopic

(>5mm) crustaceans, molluscs, oysters, clams, shrimp, mussels, lobsters, crabs, and snails.

Following title and abstract screening, 697 references were included. Articles included at the title and abstract screening stage which related to key aspects of biological, sociocultural, and health dimensions of shellfish research were summarized. Grey literature was not included in the systematic search; however, grey literature and published articles from the author’s personal collection were included when relevant.

Biology and Contamination of Shellfish in the North American Arctic

Studies of commercially-harvested crabs from Alaska were common in the literature.

Some studies of crabs in Alaska described crab sampling and harvesting methods,14–19 aspects of crab survey timing and locations,20 and descriptions of crab habitats,19 and others described models for future crab harvests or reconstructions of previous crab harvests21–29 incorporating predictive variables such as crab mortality,18,24 fecundity and embryo production,28,29 climate variables,25–27 harvest rates,21–24 and timing of surveys.20 Studies of crabs in Alaska examined multiple regions, including the Aleutian Islands,26 Bristol Bay,16,20,27–31 Kodiak Island,24 the

Bering Sea,18,22,26,32,33 and the Gulf of Alaska.26 Certain jurisdictions require a survey of the crab population before commercial harvesting, and some of the studies were conducted to meet these requirements.20 For example, the Bristol Bay red king crab survey was conducted to investigate the ratio of male to female crabs before the annual harvest can begin.20 Some studies were conducted in response to a collapse of the Alaskan red king crab population in the early

1980s,21,24–26,30,31 and stated the explicit goal of rebuilding crab stocks which had been overfished.23,30

While studies of crabs were common, studies of shrimp species were also found.34,35,44,45,36–43 Research was conducted on shrimp in Alaska,34–41 the Eastern Arctic in

Canada,42 and Newfoundland and Labrador, Canada.43–45 In Alaska, research on shrimp included a population model,34 and studies on hydrocarbon contamination near Port Valdez;35 the effects of a shrimp population crash on marine mammal populations;36 the presence of a dinoflagellate parasite in shrimp harvested near Prince William Sound;37 a description of a joint United States –

U.S.S.R. research voyage which examined the sex composition of shrimp populations;38 and descriptions of farm-raised juvenile shrimp.39–41 One study from the Eastern Arctic in Canada described fairy shrimp species distribution,42 and studies from Newfoundland and Labrador described aspects of the reproductive cycle,43 size,44 extractable organohalogen (a persistent organic pollutant) concentrations45 of shrimp.

Surveys of shellfish populations have been carried out in Alaska46–48 and in Northern

Canada.49 For instance, mussels in Prince William Sound, Alaska, were surveyed in 1987 and factors related to mussel mortality accounted for mussel size differences between sample sites.47

Mussels were studied because they serve as model organisms for studies of ecological concepts including competition between species.47 Other studies examined the presence of shellfish in

Arctic freshwater lakes, including an examination of mussel densities in a lake in the Northwest

Territories, Canada,49 and a study of snails in a lake in Alaska which investigated the effects of predation by trout on snail population density.48 Further studies of bivalve shellfish included a summary of viruses and virus-like particles in wild and farmed clams in Alaska,50 and a description of the diet and physiology of a bivalve population found in the Canadian Arctic.51

As bivalve shellfish filter large volumes of seawater and accumulate contaminants from their habitats, they can serve as useful biomonitoring species for environmental contaminants.35,52–57 These contaminants can include organic or inorganic components, pathogens from fecal material,58 hydrocarbon components from oil,35,52–56 or radionuclides from

past nuclear testing.57 These contaminants may be of concern for ecosystem health as well as for the health of people who consume those shellfish.35,57,58 The Exxon Valdez oil spill in Prince

William Sound in Alaska in 1989 and resulting effects on shellfish beds were the subject of much research.52–56,59 At the time, the oil spill resulting from the wreck of the Exxon Valdez was the largest oil spill ever to have occurred in the United States,52 and field observations and laboratory tests were conducted to determine the effects of the spill on the surrounding environment. Some bivalve species increased in abundance at oiled sites compared to un-oiled sites, while other species had the opposite response.52 The presence and effects of polyaromatic hydrocarbons (PAHs) in nearby sediments and shellfish were also the subject of much research.52–54,56,59 PAHs are compounds found in crude oil, and some PAHs have been linked to an increased risk of cancer in humans as well as animals.35 The presence of PAHs in shellfish and in the environment is of concern both for human and environmental health.35

Research examining fecal contamination from cruise ship discharges and other sources was also present in the literature.58,60 Using predictive modelling, it was estimated that cruise ships discharging waste following Alaska State guidelines were unlikely to cause significant fecal bacterial contamination of bivalve shellfish.58 In a study that documented the presence of pathogenic bacteria in crabs, no fecal indicator bacteria were found, but the authors noted that the prevalence of bacteria (i.e. total heterotrophs, gram-negative enteric bacteria, and Vibrio spp.) in crab tissues increased with proximity to sources of human fecal contamination (e.g. community sewage outfalls).60

Despite extensive research into shellfish in Arctic North America, gaps remain in the published literature. Research on commercially-harvested crab species appeared to dominate the published literature, while less research was published on bivalve shellfish species, including

clams. Some published studies of bivalve shellfish investigated foodborne illness and human health, but these were predominately studies of paralytic shellfish poisoning and took place primarily in Alaska, with very few studies on bacterial, viral, or protozoan pathogens.

Sociocultural Aspects of Shellfish: An Important Country Food in the Arctic

In Inuit Nunangata (Figure 1.1), country food includes animals and plants harvested from the water and land,61–64 such as caribou, seals, birds, fish, and shellfish, among others, depending on the community and on the season.65 Promoting country food consumption for Northerners has been recommended by researchers, practitioners, and community members alike.62,64,66,67

Country foods are an important source of nutrients for Inuit,65,66,68–73 and have a higher nutritional content than a number of retail foods in Nunavut.64,65 Clams, for example, are high in iron and protein.65 Research in Nunavut has found that households that consume more country food have a more nutritionally balanced diet than households that consume less country food.68

As such, the Government of Nunavut recommends consuming country food as often as

74 possible.

Country foods also play an important role in food security. In Nunavut, for instance, the promotion of country food has been identified as a strategic area for action by the intergovernmental Nunavut Food Security Coalition, in an effort to reduce the high prevalence of food insecurity, with 68.8% of households reporting food insecurity.62,66 Shellfish, including clams, are important to food security, as they are an accessible country food for people in

Nunavut, and are harvested near a number of communities.75,76,85,86,77–84

a Inuit Nunangat includes the Inuvialuit Settlement Region, the Territory of Nunavut, the Nunavik Inuit Settlement Area, and the Labrador Inuit Land Claims (Nunatsiavut). 6

In addition to providing a source of nourishment and food security, country food contributes to building and maintaining community connections, sharing with family and community members, and respecting animals and the environment.64 For instance, sharing country food is an important cultural practice: 76% of households in Nunavut reported sharing country food,62 especially with Elders, single parents, and households without hunters.64,67

Moreover, country food harvesting is often a social activity, with families or other groups travelling on the land together to reach harvesting or hunting grounds.61 These harvesters gather clams from exposed tidal flats during low tides, while others dive underwater to harvest clams.87–

89 Some clam harvesting areas are accessible by boat from communities, while other areas are accessible on foot.75,76,85–87,89,90,77–84 During these harvesting activities, Inuit knowledge of harvesting, hunting, and gathering practices are passed down from Elders to younger generations and includes knowledge of the safe selection and preparation of country foods.64,67,91,92

While the benefits of consuming country food are clear, a dietary shift from country foods towards retail foods has been documented, particularly for young people.64 This dietary transition is attributed to a range of factors that are rooted in colonization, including forced settlement and/or relocation of Inuit into communities in recent decades; recent introduction of the wage economy; colonial attitudes towards country foods; miscommunications about country food safety; decreases in country food sharing; as well as decreased transmission of Inuit knowledge required to harvest country food.64,73,92 Furthermore, harvesting patterns for some country food species are shifting with changing climate conditions in the Canadian Arctic.67,93

More extreme and unpredictable weather conditions, changing populations, distribution, and migration patterns of harvested species, and changes in the timing of ice break-up and freeze-up are causing hunters and harvesters to alter their travel patterns on the land and water, harvest

species outside of their usual season, become unable to reach harvesting areas or not find country food species where they have been found in the past.67,69,93

In the midst of this dietary transition, there is also a blending of country and retail food.

For instance, Arctic char, turbot, and shrimp are the major marine species commercially harvested in Nunavut; however, shellfish, including clams, present an opportunity for future commercial fishery development in many communities.75 In particular, there is the potential for the development of commercial shellfish harvests in some Nunavut communities, notably clams in Qikiqtarjuaq and Igloolik, scallops and mussels near Chesterfield inlet, shrimp and whelks near Iqaluit, Grise Fiord, Arctic Bay, Resolute Bay, and Qikiqtarjuaq, and porcupine crab near the east coast of Baffin Island.75,76 Sustainable commercial fisheries are recognized as a major source of future income, jobs, and food security for Nunavumiut.66,75

Despite the accessibility and cultural importance of shellfish as a country food,75,76,85,86,77–

84 and the potential of shellfish for commercial harvest,75 less has been published on shellfish relative to other country food species in Inuit Nunangat. For example, seals,94,95 polar bear,96 and caribou97 have all been the subject of extensive study in the North.

Health Aspects of Shellfish in the North American Arctic

Shellfish commercially harvested or processed in Canada fall under the protection of the

Canadian Shellfish Sanitation Program, which is jointly administered by the Canadian Food

Inspection Agency, Environment and Climate Change Canada, and Fisheries and Oceans

Canada. The Canadian Food Inspection Agency coordinates the activities of the Canadian

Shellfish Sanitation Program and monitors commercial shellfish harvesting and handling activities, Environment and Climate Change Canada monitors the environments where shellfish are harvested in Canadian waters, and Fisheries and Oceans Canada is responsible for enacting

and enforcing shellfish harvesting area closures (Figure 1.2).12 These three organizations meet at

National and Regional Interdepartmental Shellfish Committee meetings to coordinate their activities.12

Under the Canadian Shellfish Sanitation Program, Environment and Climate Change

Canada has the authority to conduct surveys of both actual and potential shellfish growing waters as part of its Marine Water Quality Monitoring Program. These surveys vary in frequency and thoroughness depending on previous surveys in a given shellfish area.98 Surveys include assessments of nearby potential sources of pollution, tests for fecal indicator bacteria, chemical contaminants, and marine biotoxins.98 Survey results are presented at Regional Interdepartmental

Shellfish Committee meetings, where Environment and Climate Change Canada presents its recommendations to Fisheries and Oceans Canada about which classification is appropriate for each harvesting area.12 These recommendations may result in Fisheries and Oceans Canada classifying an area as approved, restricted, or prohibited from shellfish harvesting.98 Shellfish from areas with a “prohibited” classification are not permitted to be harvested for any reason, and include locations within 300 metres of a sewage system discharge or outfall, or within 125 metres of a wharf or pier.98

In the event of an outbreak of foodborne illness, public health authorities work to identify the source of the outbreak.99 If shellfish consumption is linked to an outbreak, public health authorities notify the Canadian Food Inspection Agency, which then leads a food safety investigation into the link between shellfish and the outbreak, and to determine whether the shellfish were contaminated prior to harvest or during processing.99 For norovirus contamination, the Canadian Food Inspection Agency will recommend an area closure to Fisheries and Oceans

Canada if the shellfish from that area meet certain epidemiological requirements, and

Environment and Climate Change Canada will recommend an area closure to Fisheries and

Oceans Canada if the waters in that area have been contaminated.99 Shellfish areas will re-open for harvesting after 7 to 60 days, depending on the follow-up testing performed, and the reason for the closure. Closures for E. coli only are lifted after 7 days once water samples meet microbiological criteria, and closures for norovirus are lifted after 30 days with testing, and after

60 days with no testing.99 Microbiological testing following an outbreak investigation includes tests for E. coli and norovirus.100 From published information available, the Shellfish Sanitation

Program does not appear to test for protozoan pathogens such as Cryptosporidium and Giardia.

Furthermore, the Canadian Shellfish Sanitation Program does not conduct sampling in

Nunavut.101 In the absence of local data from national surveillance programs, there is a lack of baseline knowledge about foodborne pathogens and marine biotoxins in bivalve shellfish, an important country food harvested in Nunavut.

In addition to bacterial, viral, and protozoan pathogens, health concerns related to shellfish may be caused by toxins. Paralytic shellfish poisoning (PSP) is caused by a toxin produced by dinoflagellate algae, which can experience rapid population growth, or “blooms” in warmer waters.102,103 PSP toxins can cause paralysis in people if ingested, and were the subject of much research in Alaska.103–112 Paralytic shellfish poisoning is a mandatory-reported condition to public health authorities in Alaska,106 but it is suspected that cases of PSP are underreported.103 Alaska has one of the highest reported incidences of PSP in the world.105,106 An increased number of fatal PSP cases in Alaska in recent years, potentially due to warming water temperatures associated with climate change, appeared to prompt an increase in research on

PSP.103,104,113 The literature addressing PSP in Alaska included case studies of patients with paralytic shellfish poisoning,106,107,112 investigations of outbreaks of paralytic shellfish

poisoning,105,107 and measurements of toxin concentrations in implicated shellfish.103,105–107 One paper compared methods (including mouse bioassays, high performance liquid chromatography, receptor-binding assays, a commercial antibody-based kit, and ELISA) for detecting PSP toxins in mussels, cockles, and clam species found in the Aleutian islands of Alaska.114 Another paper described a newly-implemented monitoring system in Alaska for algae that can produce PSP toxins, and for the presence of PSP toxins in seawater.103 Shellfish implicated in PSP studies from Alaska included mussels,111,112 butter clams,105,108,109 oysters, geoduck clams, and cockles.103,106 In addition to concerns about human health, PSP was also reported to cause fatalities in young seabirds that feed on fish, which can amplify PSP toxins from the environment,110 and to alter the foraging behaviours of sea otters that feed on shellfish.108

Previous studies have indicated that factors related to country food harvesting, preparation, and consumption are potential risk factors for acute gastrointestinal illness.115–117

Age and immune-compromised status may also play a role in determining the vulnerability of individuals to acute gastrointestinal illness pathogens from country food or elsewhere.115 For instance, in Alaska, outbreaks of AGI have been associated with V. parahaemolyticus in oysters.

For halophilic Vibrio species to replicate, water temperatures must be greater than 15°C; prior to

2004, water temperatures in Alaska had never exceeded this temperature and the most northerly reported outbreak of V. parahaemolyticus occurred in northern British Columbia, over 1,000 km south of Alaska. As such, distinct ocean warming trends are believed to be responsible for this new AGI-related pathogen in Alaska.

While monitoring programs in the south capture data to monitor, understand, and mitigate health risks of shellfish consumption in the south, monitoring programs are absent in Inuit

Nunangat, leading to a substantial gap in understanding in the North.11

Justification for Thesis Research

Locally-harvested clams are an important, popular, and accessible country food in

Nunavut.75,76,85,86,77–84 As clams can filter large volumes of water, they may concentrate contaminants and/or pathogens from surrounding waters.118–120 While this can make shellfish useful as indicators of coastal contamination, it can pose potential health risks for people who harvest shellfish for consumption. However, little is known about the presence and/or distribution of pathogens in shellfish in Nunavut. This is an important knowledge gap, considering country foods have been identified as a potential risk factor for AGI in people117,121–

124 and two protozoan pathogens, Cryptosporidium and Giardia, have been detected at high prevalence in the stools of AGI patients in Nunavut.125 In Iqaluit, Nunavut, clams are particularly accessible due to the presence of large tidal flats near the town centre,89,126 and community organizations and research partners identified clams as a specific country food item that should be tested for protozoan pathogens.

The People, Animals, Water, and Sustenance (PAWS) Project

In response to the detection of Cryptosporidium and Giardia in AGI patients in

Nunavut,125 the potential for clams to concentrate these protozoan pathogens,118–120 the popularity and importance of clams as a country food in Nunavut,75,76,85,86,77–84 and interest from community partners, the People, Animals, Water, and Sustenance (PAWS) project was created.

The PAWS project utilizes an EcoHealth approach to investigate dogs, surface water, and clams as potential sources of Cryptosporidium and Giardia in Iqaluit, Nunavut. This project was conceptualized by researchers at the University of Guelph in close collaboration with representatives of community and government organizations in Iqaluit. Community partners were involved in every stage of the research project, and their involvement ensured that the

research questions were of interest to community members and decision-makers in Iqaluit, that samples and data were collected in an effective and respectful manner, and that results were interpreted and communicated effectively. Accordingly, the research described in this thesis is a component of the PAWS project, and focused on the “Sustenance” component of PAWS in

Iqaluit, Nunavut.

Iqaluit (64° N, 69° W) is the capital city of the territory of Nunavut in Inuit Nunangat.

Iqaluit is the largest of 26 communities in Nunavut, with a population of 7,740 people, approximately 60% of whom identify as Inuit.127 In Iqaluit, Nunavut, clam harvesting areas on large tidal flats adjacent to the community can be accessed on foot, and clam harvesting areas further afield can be reached by boat.89 Between 1996 and 2001, the mean annual clam harvest in

Iqaluit was estimated at over 6000 clams, while the community’s population grew from 4200 to

5200 residents,63,128 demonstrating the importance of this country food in this Northern city.

Thesis Goal and Objectives

The goal of this thesis research was to investigate locally-harvested clams as a potential source of Cryptosporidium and Giardia in Iqaluit, Nunavut. Within this goal, the research objectives were to optimize the DNA extraction and PCR techniques for molecular detection of

Cryptosporidium and Giardia in clam tissues (Chapter Two), quantify the presence of

Cryptosporidium and Giardia in the clams, and to genetically characterize any Cryptosporidium or Giardia detected using PCR (Chapter Three). This research was intended to provide important information on pathogens of human health interest in country foods, specifically clams, in

Iqaluit, Nunavut, which may inform public health messaging regarding clam harvesting in the community and public health practice.

Figures

Figure 1.1: Map of Inuit Nunangat, including the four settled Inuit land claim regions, Inuvialuit Settlement Region, Territory of Nunavut, Nunavik Inuit Land Claims Settlement Area, and Labrador Inuit Land Claims Settlement Area (Nunatsiavut).

Figure 1.2: The Canadian Shellfish Sanitation Program is administered by the Canadian Food Inspection Agency, Fisheries and Oceans Canada, and Environment and Climate Change Canada.12

Tables

Table 1.1: Search terms used to identify relevant references in Web of Science, CAB Direct©, and PubMed. Search strings were applied to titles and abstracts in all three databases, and to author keywords and Keywords Plus© in Web of Science, subject terms in CAB Direct©, and to MeSH terms in PubMed. Shellfish and location search strings were combined using the operator “AND”.

Research Shellfish Terms Location Terms Question What is the extent, range, (seafood* OR shellfish* (Alaska OR Inuvialuit OR and nature of published OR bivalve* OR Yukon OR YT OR research on shellfish in crustacean* OR Northwest Territories OR Arctic locales of North mollusc* OR mollusk* "Northwest Territory" OR OR oyster* OR clam* "Northwest Territories" OR America? AND OR shrimp* OR prawn* NWT OR Nunavut OR OR mussel* OR lobster* Nunavik OR Quebec OR OR crab* OR snail* OR Nunatsiavut OR Labrador scallop* OR crayfish* OR Arctic* OR OR abalone*) Circumpolar OR Nunangat)

References

1. Foodborne Disease Burden Epidemiology Reference Group 2007-2015. WHO Estimates of the Global Burden of Foodborne Diseases. Geneva, Switzerland; 2015. 2. Kosek M, Bern C, Guerrant R. The global burden of diarrhoeal disease, as estimated from studies published between 1992-2000. Bull World Heal Organ. 2003;81(485):197-204. 3. Roy SL, Scallan E, Beach MJ. The rate of acute gastrointestinal illness in developed countries. J Water Health. 2006;4(S2):31-69. 4. Tuševljak N, Rajić A, Waddell L, et al. Prevalence of zoonotic bacteria in wild and farmed aquatic species and seafood: A scoping study, systematic review, and meta- analysis of published research. Foodborne Pathog Dis. 2012;9(6):487-497. 5. Metcalf D, Avery BP, Janecko N, Matic N, Reid-Smith R, Weese JS. Clostridium difficile in seafood and fish. Anaerobe. 2011;17(2):85-86. 6. Janecko N, Martz SL, Avery BP, et al. Carbapenem-resistant Enterobacter spp. in retail seafood imported from Southeast Asia to Canada. Emerg Infect Dis. 2016;22(9):1675- 1677. 7. Potasman I, Paz A, Odeh M. Infectious outbreaks associated with bivalve shellfish consumption: a worldwide perspective. Clin Infect Dis. 2002;35(8):921-928. 8. Robertson LJ. The potential for marine bivalve shellfish to act as transmission vehicles for outbreaks of protozoan infections in humans: A review. Int J Food Microbiol. 2007;120(3):201-216. 9. Willis JE, McClure JT, Davidson J, McClure C, Greenwood SJ. Global occurrence of Cryptosporidium and Giardia in shellfish: Should Canada take a closer look? Food Res Int. 2013;52(1):119-135. 10. Pommepuy M, Dumas F, Caprais MP, et al. Sewage impact on shellfish microbial contamination. Water Sci Technol. 2004;50(1):117-124. 11. Levesque B, Barthe C, Dixon BR, et al. Microbiological quality of blue mussels (Mytilus edulis) in Nunavik, Quebec: a pilot study. Can J Microbiol. 2010;56(11):968-977. 12. Canadian Shellfish Sanitation Progam. Chapter 1 - Canadian Shellfish Sanitation program - Manual of Operations - Food - Canadian Food Inspection Agency. http://www.inspection.gc.ca/food/fish-and-seafood/manuals/canadian-shellfish-sanitation- program/eng/1351609988326/1351610579883?chap=4. Published 2011. Accessed November 3, 2017. 13. Maps - Arctic Council. http://www.arctic-council.org/index.php/en/learn-more/maps. Accessed November 3, 2017. 14. Blackburn J, Johnson BA, Schmidt D. A comparison of trawl and pot surveys of Red King Crab populations (Paralithodes camtschatica) near Kodiak, Alaska. In: Proceedings of the International Symposium on King and Tanner Crabs. Vol 8. Lowell Wakefield Fisheries Symposia Series. 1989:517-531. 15. Somerton DA, Otto RS, Syrjala SE. Can changes in tow duration on bottom trawl surveys lead to changes in CPUE and mean size? Fish Res. 2002;55(1-3):63-70. 16. Weinberg KL, Otto RS, Somerton DA. Capture probability of a survey trawl for red king crab (Paralithodes camtschaticus). Fish Bull. 2004;102(4):740-749. 17. Somerton DA, Weinberg KL, Goodman SE. Catchability of snow crab (Chionoecetes opilio) by the eastern Bering Sea bottom trawl survey estimated using a catch comparison experiment. Can J Fish Aquat Sci. 2013;70(12):1699-1708.

18. Rose CS, Hammond CF, Stoner AW, Munk JE, Gauvin JR. Quantification and reduction of unobserved mortality rates for snow, southern Tanner, and red king crabs (Chionoecetes opilio, C. bairdi, and Paralithodes camtschaticus) after encounters with trawls on the seafloor. Fish Bull. 2013;111(1):42-53. 19. Zhou SJ, Shirley TC. A submersible study of red king crab and Tanner crab distribution by habitat and depth. J Shellfish Res. 1998;17(5):1477-1479. 20. Dew CB. Red king crab mating success, sex ratio, spatial distribution, and abundance estimates as artifacts of survey timing in Bristol Bay, Alaska. North Am J Fish Manag. 2008;29(2):527-528. 21. Zheng J, Murphy MC, Kruse GH. A length-based population model and stock-recruitment relationships for red king crab, Paralithodes camtschaticus, in Bristol Bay, Alaska. Can J Fish Aquat Sci. 1995;52(6):1229-1246. 22. Zheng J, Kruse GH. Assessment and management of crab stocks under uncertainty of massive die-offs and rapid changes in survey catchability. In: Paul, AJ and Dawe, EG and Elner, R and Jamieson, GS and Kruse, GH and Otto, RS and SainteMarie, B and Shirley, TC and Woodby D, ed. Crabs in Cold Water Regions: Biology, Management, and Economics. Vol 19. Lowell Wakefield Fisheries Symposia Series. 2002:367-384. 23. Siddeek MSM, Zheng J, Morado JF, Kruse GH, Bechtol WR. Effect of bitter crab disease on rebuilding in Alaska Tanner crab stocks. ICES J Mar Sci. 2010;67(9):2027-2032. 24. Bechtol WR, Kruse GH. Reconstruction of historical abundance and recruitment of red king crab during 1960-2004 around Kodiak, Alaska. Fish Res. 2009;100(1):86-98. 25. Zheng J, Kruse GH. Recruitment variation of eastern Bering Sea crabs: Climate-forcing or top-down effects? Prog Oceanogr. 2006;68(2-4):184-204. 26. Zheng J, Kruse GH. Recruitment patterns of Alaskan crabs in relation to decadal shifts in climate and physical oceanography. ICES J Mar Sci. 2000;57(2):438-451. 27. Szuwalski C, Punt AE. Regime shifts and recruitment dynamics of snow crab, Chionoecetes opilio, in the eastern Bering Sea. Fish Oceanogr. 2013;22(5):345-354. 28. Swiney KM, Long WC. Primiparous red king crab Paralithodes camtshaticus are less fecund than multiparous crab. J Shellfish Res. 2015;34(2):493-498. 29. Swiney KM, Long WC, Eckert GL, Kruse GH. Red king crab, Paralithodes camtschaticus, size-fecundity relationship, and interannual and seasonal variability in fecundity. J Shellfish Res. 2012;31(4):925-933. 30. Kruse GH, Zheng J, Stram DL. Recovery of the Bristol Bay stock of red king crabs under a rebuilding plan. ICES J Mar Sci. 2010;67(9):1866-1874. 31. Vulstek SC, Linderoth TP, Guyon JR, Tallmon DA. Spatio-Temporal population genetic structure and mating system of red king crab (Paralithodes camtschaticus) in Alaska. J Crustac Biol. 2013;33(5):691-701. 32. Siddeek MSM, Barnard DR, Watson LJ, Gish RK. A modified catch-length analysis model for golden king crab (Lithodes aequispinus) stock assessment in the eastern Aleutian Islands. In: Kruse, GH and Gallucci, VF and Hay, DE and Perry, RI and Peterman, RM and Shirley, TC and Spencer, PD and Wilson, B and Woodby D, ed. Fisheries Assessment and Management in Data-Limited Situations. Vol 21. Lowell Wakefield Fisheries Symposia Series. 2005:783-805. 33. Zheng J, Murphy MC, Kruse GH. Abundance estimation of St. Matthew Island blue king crabs using survey and commercial catch and effort data. In: Funk, F and Quinn, TJ and Heifetz, J and Ianelli, JN and Powers, JE and Schweigert, JF and Sullivan, PJ and Zhang

C, ed. Fishery Stock Assessment Models. Vol 15. Lowell Wakefield Fisheries Symposia Series. 1998:575-589. 34. Fu CH, Quinn TJ, Adkison MD. Retrospective projection using Monte Carlo simulation: An application of a length-based model to Kachemak Bay pink shrimp. In: Ecosystem Approaches for Fisheries Management. Vol 16. Lowell Wakefield Fisheries Symposia Series. 1999:59-77. 35. Carls MG, Holland L, Pihl E, Zaleski MA, Moran J, Rice SD. Polynuclear aromatic hydrocarbons in Port Valdez shrimp and sediment. Arch Environ Contam Toxicol. 2016;71(1):48-59. 36. Hansen DJ. Shrimp fishery and capelin decline may influence decline of harbor seal (Phoca vitulina) and northern sea lion (Eumetopias jubatus) in Western Gulf of Alaska. In: Forage Fishes in Marine Ecosystems. Vol 97. Lowell Wakefield Fisheries Symposia Series. 1997:197-207. 37. Meyers TR, Lightner D V, Redman RM. A dinoflagellate-like parasite in Alaskan spot shrimp Pandalus platyceros and pink shrimp P. borealis. Dis Aquat Organ. 1994;18(1):71-76. 38. Wolotira RJ. Shrimp research aboard Soviet ship in Gulf of Alaska. Mar Fish Rev. 1972;34(9-10):45-57. 39. Haynes E. Description of larvae of a hippolytid shrimp, Lebbeus groenlandicus, reared in situ in Kachemak Bay, Alaska. Fish Bull. 1978;76(2):457-465. 40. Haynes E. Description of larvae of the northern shrimp, Pandalus borealis, reared in situ in Kachemak Bay, Alaska. Fish Bull. 1979;77(1):157-173. 41. Haynes E. Description of the larvae of humpy shrimp, Pandalus goniurus, reared in situ in Kachemak Bay, Alaska. Fish Bull. 1978;76(1):235-248. 42. Billington N, Boileau MG, Hebert PDN. Range extension of the fairy shrimp Polyartemiella hazeni (Murdoch, 1884) (Crustacea: Anostraca) to the Eastern Canadian Arctic, with notes on the distribution of other Eastern Arctic Anostraca. Can Field- Naturalist. 1989;103(3):404-405. 43. Fuentes-Yaco C, Koeller PA, Sathyendranath S, Platt T. Shrimp (Pandalus borealis) growth and timing of the spring phytoplankton bloom on the Newfoundland-Labrador Shelf. Fish Oceanogr. 2007;16(2):116-129. 44. Koeller PA, Fuentes-Yaco C, Platt T. Decreasing shrimp (Pandalus borealis) sizes off Newfoundland and Labrador - environment or fishing? Fish Oceanogr. 2007;16(2):105- 115. 45. Bottaro CS, Kiceniuk JW, Chatt A. Spatial distribution of extractable organohalogens in northern pink shrimp in the North Atlantic. Biol Trace Elem Res. 1999;71-2:149-166. 46. Vermeij GJ, Palmer AR, Lindberg D. Range limits and dispersal of mollusks in the Aleutian Islands, Alaska. Veliger. 1990;33(4):346-354. 47. VanBlaricom GR. Regulation of mussel population structure in Prince William Sound, Alaska. Natl Geogr Res. 1987;3(4):501-510. 48. Hershey AE. Snail population in Arctic lakes: competition mediated by predation? Oecologia. 1990;82(1):26-32. 49. Bailey RC, Green RH. Spatial and temporal variation in a population of freshwater mussels in Shell Lake, N.W.T. Can J Fish Aquat Sci. 1989;46(8):1392-1395.

50. Meyers TR, Burton T, Evans W, Starkey N. Detection of viruses and virus-like particles in four species of wild and farmed bivalve molluscs in Alaska, USA, from 1987 to 2009. Dis Aquat Organ. 2009;88(1):1-12. 51. Gaillard B, Meziane T, Tremblay R, et al. Dietary tracers in Bathyarca glacialis from contrasting trophic regions in the Canadian Arctic. Mar Ecol Prog Ser. 2015;536:175-186. 52. Jewett SC, Dean TA, Smith RO, Blanchard A. “Exxon Valdez” oil spill: Impacts and recovery in the soft-bottom benthic community in and adjacent to eelgrass beds. Mar Ecol Prog Ser. 1999;185:59-83. 53. Page DS, Brown JS, Boehm PD, Bence AE, Neff JM. A hierarchical approach measures the aerial extent and concentration levels of PAH-contaminated shoreline sediments at historic industrial sites in Prince William Sound, Alaska. Mar Pollut Bull. 2006;52(4):367-379. 54. Neff JM, Bence AE, Parker KR, Page DS, Brown JS, Boehm PD. Bioavailability of polycyclic aromatic hydrocarbons from buried shoreline oil residues thirteen years after the Exxon Valdez oil spill: A multispecies assessment. Environ Toxicol Chem. 2006;25(4):947-961. 55. Boehm PD, Mankiewicz PJ, Hartung R, et al. Characterization of mussel beds with residual oil and the risk to foraging wildlife 4 years after the Exxon Valdez oil spill. Environ Toxicol Chem. 1996;15(8):1289-1303. 56. Short JW, Babcock MM. Prespill and postspill concentrations of hydrocarbons in mussels and sediments in Prince William Sound. In: Rice, SD and Spies, RB and Wolfe, DA and Wright B, ed. Proceedings of the Exxon Valdez Oil Spill Symposium. Vol 18. American Fisheries Society Symposium Series. 1996:149-166. 57. Burger J, Gochfeld M, Kosson DS, Powers CW. A biomonitoring plan for assessing potential radionuclide exposure using Amchitka Island in the Aleutian chain of Alaska as a case study. J Environ Radioact. 2007;98(3):315-328. 58. McGee CD, Loehr LC. An assessment of fecal coliform bacteria in cruise ship wastewater discharge. In: Oceans 2003: Celebrating the Past...Teaming Toward the Future. 2003:733-736. 59. Downs CA, Shigenaka G, Fauth JE, Robinson CE, Huang A. Cellular physiological assessment of bivalves after chronic exposure to spilled Exxon Valdez crude oil using a novel molecular diagnostic biotechnology. Environ Sci Technol. 2002;36(13):2987-2993. 60. Faghri MA, Pennington CL, Cronholm LS, Atlas RM. Bacteria associated with crabs from cold waters with emphasis on the occurrence of potential human pathogens. Appl Environ Microbiol. 1984;47(5):1054-1061. 61. Searles EN. To sell or not to sell: Country food markets and Inuit identity in Nunavut. Food Foodways. 2016;24(3-4):194-212. 62. Rosol R, Huet C, Wood M, Lennie C, Osborne G, Egeland GM. Prevalence of affirmative responses to questions of food insecurity: International Polar Year Inuit Health Survey, 2007–2008. Int J Circumpolar Health. 2012;70(5):488-497. 63. Priest H, Usher PJ. The Nunavut Wildlife Harvest Study - Final Report. Iqaluit, Nunavut; 2004. 64. Mead E, Gittelsohn J, Kratzmann M, Roache C, Sharma S. Impact of the changing food environment on dietary practices of an Inuit population in Arctic Canada. J Hum Nutr Diet. 2010;23(Suppl. 1):18-26.

65. Caughey A, Killulark J, Webb L, et al. Inuit Traditional Foods. Nutrition Fact Sheet Series. 66. Nunavut Food Security Coalition. Nunavut Food Security Strategy and Action Plan 2014- 16. 67. Statham S, Ford J, Berrang-Ford L, Lardeau M-P, Gough W, Siewierski R. Anomalous climatic conditions during winter 2010–2011 and vulnerability of the traditional Inuit food system in Iqaluit, Nunavut. Polar Rec (Gr Brit). 2014;51(258):1-17. 68. Gagne D, Blanchet R, Lauziere J, et al. Traditional food consumption is associated with higher nutrient intakes in Inuit children attending childcare centres in Nunavik. Int J Circumpolar Health. 2012;71(1). 69. Rosol R, Powell-Hellyer S, Chan HM. Impacts of decline harvest of country food on nutrient intake among Inuit in Arctic Canada: impact of climate change and possible adaptation plan. Int J Circumpolar Health. 2016;75(1). 70. Kuhnlein H V, Receveur O. Local cultural animal food contributes high levels of nutrients for Arctic Canadian Indigenous adults and children. J Nutr. 2007;137(4):1110-1114. 71. Donaldson SG, Van Oostdam J, Tikhonov C, et al. Environmental contaminants and human health in the Canadian Arctic. Sci Total Environ. 2010;408(22):5165-5234. 72. Lambden J, Receveur O, Kuhnlein H V. Traditional food attributes must be included in studies of food security in the Canadian Arctic. Int J Circumpolar Health. 2007;66(4):308-319. 73. Pufall EL, Jones AQ, McEwen SA, Lyall C, Peregrine AS, Edge VL. Perception of the importance of traditional country foods to the physical, mental, and spiritual health of Labrador Inuit. Arctic. 2011;64(2):242-250. 74. Department of Economic Development and Transportation. 2015-16 Annual Report, Country Food Distribution Program. http://www.gov.nu.ca/edt/documents/country-food- distribution-program-2015-2016-annual-report. Published 2017. 75. Government of Nunavut Department of Environment Fisheries and Sealing Division. Nunavut Fisheries Strategy 2016-2020. 2016. 76. Government of Nunavut Department of Environment Fisheries and Sealing Division. Nunavut Coastal Resource Inventory: Iqaluit. https://www.gov.nu.ca/sites/default/files/ncri_iqaluit_en.pdf. Published 2017. Accessed May 4, 2018. 77. Government of Nunavut Department of Environment Fisheries and Sealing Division. Nunavut Coastal Resource Inventory: Cambridge Bay. https://www.gov.nu.ca/sites/default/files/ncri_cambridge_bay_en.pdf. Published 2015. Accessed May 7, 2018. 78. Government of Nunavut Department of Environment Fisheries and Sealing Division. Nunavut Coastal Resource Inventory: Clyde River. https://www.gov.nu.ca/sites/default/files/ncri_clyde_river_en.pdf. Published 2014. Accessed May 7, 2018. 79. Government of Nunavut Department of Environment Fisheries and Sealing Division. Nunavut Coastal Resource Inventory: Coral Harbour. https://www.gov.nu.ca/sites/default/files/ncri_coral_harbour_en.pdf. Published 2012. Accessed May 7, 2018. 80. Government of Nunavut Department of Environment Fisheries and Sealing Division. Nunavut Coastal Resource Inventory: Kugaaruk.

https://www.gov.nu.ca/sites/default/files/ncri_kugaaruk_en.pdf. Published 2015. Accessed May 7, 2018. 81. Government of Nunavut Department of Environment Fisheries and Sealing Division. Nunavut Coastal Resource Inventory: Kugluktuk. https://www.gov.nu.ca/sites/default/files/ncri_kugluktuk_en.pdf. Published 2010. Accessed May 7, 2018. 82. Government of Nunavut Department of Environment Fisheries and Sealing Division. Nunavut Coastal Resource Inventory: Iglulik Pilot Project. https://www.gov.nu.ca/sites/default/files/ncri_igloolik_en.pdf. Published 2008. Accessed May 7, 2018. 83. Government of Nunavut Department of Environment Fisheries and Sealing Division. Nunavut Coastal Resource Inventory: Qikiqtarjuaq. https://gov.nu.ca/sites/default/files/qikiqtarjuaq_ncri_public.pdf. Published 2010. Accessed May 4, 2018. 84. Government of Nunavut Department of Environment Fisheries and Sealing Division. Nunavut Coastal Resource Inventory: Sanikiluaq. https://gov.nu.ca/sites/default/files/sanikiluaq_ncri_public.pdf. Published 2011. Accessed May 4, 2018. 85. Government of Nunavut Department of Environment Fisheries and Sealing Division. Nunavut Coastal Resource Inventory: Gjoa Haven. https://www.gov.nu.ca/sites/default/files/ncri_gjoa_haven_en.pdf. Published 2011. Accessed May 7, 2018. 86. Government of Nunavut Department of Environment Fisheries and Sealing Division. Nunavut Coastal Resource Inventory: Grise Fiord. https://gov.nu.ca/sites/default/files/grise_fiord_ncri_public.pdf. Published 2013. Accessed May 4, 2018. 87. Rideout D. Qikiqtarjuak looks to cash in on clams. Nunatsiaq News Online. http://www.nunatsiaqonline.ca/archives/nunavut010331/nvt10316_05.html. Published March 16, 2001. Accessed February 1, 2018. 88. Murphy K. Qikiqtarjuaq clam fishery almost back in business - Testing scheme means DFO licence just around the corner. Nunatsiaq News OnlineOnline. http://www.nunatsiaqonline.ca/stories/article/qikiqtarjuaq_clam_fishery_almost_back_in_ business/. Published July 4, 2003. Accessed January 1, 2018. 89. Dale JE, Leech S, McCann SB, Samuelson G. Sedimentary characteristics, biological zonation and physical processes of the tidal flats of Iqaluit, Nunavut. In: Hewitt K, Byrne M-L, English M, Young G, eds. Landscapes of transition : Landform assemblages and transformations in cold regions. Kluwer Academic; 2002:205-234. 90. Murphy K. Qikiqtarjuaq shellfish business clamming up. Nunatsiaq News. http://www.nunatsiaqonline.ca/archives/30613/news/features/30613_01.html. Published June 13, 2003. Accessed February 2, 2018. 91. Messier V, Lévesque B, Proulx JF, et al. Seroprevalence of seven zoonotic infections in Nunavik, Quebec (Canada). Zoonoses Public Health. 2012;59(2):107-117. 92. Poirier S, Brooke L. Inuit perceptions of contaminants and environmental knowledge in Salluit, Nunavik. Arctic Anthropol. 2000;37(2):78-91. 93. Guo Y, Berrang-Ford L, Ford J, et al. Seasonal prevalence and determinants of food insecurity in Iqaluit, Nunavut. Int J Circumpolar Health. 2015;74:27284.

94. Dewailly E, Ayotte P, Bruneau S, Lebel G, Levallois P, Weber JP. Exposure of the Inuit population of Nunavik (Arctic Quebec) to lead and mercury. Arch Environ Health. 2001;56(4):350-357. 95. Dixon BR, Parrington LJ, Parenteau M, Leclair D, Santín M, Fayer R. Giardia duodenalis and Cryptosporidium spp. in the intestinal contents of ringed seals (Phoca hispida) and bearded seals (Erignathus barbatus) in Nunavik, Quebec, Canada. J Parasitol. 2008;94(5):1161-1163. 96. Peacock E, Derocher AE, Thiemann GW, Stirling I. Conservation and management of Canada’s polar bears (Ursus maritimus) in a changing Arctic. Can J Zool. 2011;89:371- 385. 97. Festa-Bienchet M, Ray JC, Boutin S, Côté SD, Gunn A. Conservation of caribou (Rangifer tarandus) in Canada: an uncertain future. Can J Zool. 2011;89:419-434. 98. Canadian Shellfish Sanitation Progam. Chapter 2 - Shellfish Area Survey and Classification - Canadian Shellfish Sanitation - Program Manual of Operations. http://www.inspection.gc.ca/DAM/DAM-food-aliments/STAGING/text- texte/fish_man_shellfish_chap2_1363877586009_eng.pdf. Published 2015. Accessed May 2, 2018. 99. Canadian Shellfish Sanitation Program; Government of Canada; Chapter 13 - Canadian Shellfish Sanitation program - Manual of Operations - Food - Canadian Food Inspection Agency. http://www.inspection.gc.ca/food/fish-and-seafood/manuals/canadian-shellfish- sanitation-program/eng/1351609988326/1351610579883?chap=15. Published 2018. Accessed May 3, 2018. 100. Canadian Food Inspection Agency. Appendices - Standards and Methods Manual - Food - Canadian Food Inspection Agency. Appendix 2 - Bacteriological Guidelines for Fish and Fish Products (end product). http://www.inspection.gc.ca/food/fish-and- seafood/manuals/standards-and- methods/eng/1348608971859/1348609209602?chap=7#s19c7. Published 2017. Accessed November 3, 2017. 101. Fisheries and Oceans Canada. Shellfish Sanitation Assessment (Solicitation No. F5211- 170574). https://buyandsell.gc.ca/procurement-data/tender-notice/PW-17-00804319. Published 2017. Accessed January 29, 2018. 102. Canadian Shellfish Sanitation Progam. Chapter 11 - Control of Marine Biotoxins - Canadian Shellfish Sanitation Program - Manual of Operations. http://www.inspection.gc.ca/DAM/DAM-food-aliments/STAGING/text- texte/fish_man_shellfish_chap11_1363878080206_eng.pdf. Published 2014. Accessed May 2, 2018. 103. Trainer VL, Sullivan K, Le Eberhart B-T, et al. Enhancing shellfish safety in Alaska through monitoring of harmful algae and their toxins. J Shellfish Res. 2014;33(2):531-539. 104. RaLonde R. Expanding knowledge of occurence and distribution of paralytic shellfish poison and domoic acid toxins along the coast of Alasaka. J Shellfish Res. 2012;31(1):335. 105. Gessner BD, Schloss M. A population-based study of paralytic shell fish poisoning in Alaska. Alaska Med. 1996;38(2):54-58,68. 106. Knaack JS, Porter KA, Jacob JT, et al. Case diagnosis and characterization of suspected paralytic shellfish poisoning in Alaska. Harmful Algae. 2016;57(B, SI):45-50. 107. Porter K, Fearey D, Esposito T. Paralytic shellfish poisoning --- southeast Alaska, May-- June 2011. MMWR Morb Mortal Wkly Rep. 2011;60(45):1554-1556.

108. Kvitek R, Bretz C. Harmful algal bloom toxins protect bivalve populations from sea otter predation. Mar Ecol Prog Ser. 2004;271:233-243. 109. Schantz EJ, Magnusson HW. Observations on the origin of the paralytic poison in Alaska butter clams. J Protozool. 1964;11(2):239. 110. Shearn-Bochsler V, Lance EW, Corcoran R, et al. Fatal paralytic shellfish poisoning in Kittlitz’s Murrelet (Brachyramphus brevirostris) nestlings, Alaska, USA. J Wildl Dis. 2014;50(4):933-937. 111. Meyers HF, Hilliard DK. Shellfish poisoning episode in False Pass, Alaska. Public Health Rep. 1955;70(4):419-420. 112. Gessner BD, Bell P, Doucette GJ, et al. Hypertension and identification of toxin in human urine and serum following a cluster of mussel-associated paralytic shellfish poisoning outbreaks. Toxicon. 1997;35(5):711-722. 113. James KJ, Carey B, O’Halloran J, van Pelt FNAM, Škrabáková Z. Shellfish toxicity: human health implications of marine algal toxins. Epidemiol Infect. 2010;138(07):927- 940. 114. Costa PR, Baugh KA, Wright B, et al. Comparative determination of paralytic shellfish toxins (PSTs) using five different toxin detection methods in shellfish species collected in the Aleutian Islands, Alaska. TOXICON. 2009;54(3):313-320. 115. Jung J, Skinner K. Foodborne and waterborne illness among Canadian Indigenous populations: A scoping review. Canada Commun Dis Rep. 2017;43(1):7-13. 116. Harper SL, Edge VL, Schuster-Wallace CJ, Berke O, McEwen SA. Weather, water quality and infectious gastrointestinal illness in two Inuit communities in Nunatsiavut, Canada: potential implications for climate change. Ecohealth. 2011;8(1):93-108. 117. Harper SL, Edge VL, Ford J, et al. Acute gastrointestinal illness in two Inuit communities: burden of illness in Rigolet and Iqaluit, Canada. Epidemiol Infect. 2015;143(14):1-16. 118. Shapiro K, Vanwormer E, Aguilar B, Conrad PA. Surveillance for Toxoplasma gondii in California mussels (Mytilus californianus) reveals transmission of atypical genotypes from land to sea. Environ Microbiol. 2015;17(11):4177-4188. 119. Miller WA, Atwill ER, Gardner IA, et al. Clams (Corbicula fluminea) as bioindicators of fecal contamination with Cryptosporidium and Giardia spp. in freshwater ecosystems in California. Int J Parasitol. 2005;35(6):673-684. 120. Gomez-Couso H, Freire-Santos F, Martinez-Urtaza J, Garcia-Martin O, Ares-Mazas ME. Contamination of bivalve molluscs by Cryptosporidium oocysts: the need for new quality control standards. Int J Food Microbiol. 2003;87(1-2):97-105. 121. Goyette S, Cao Z, Libman M, Ndao M, Ward BJ. Seroprevalence of parasitic zoonoses and their relationship with social factors among the Canadian Inuit in Arctic regions. Diagn Microbiol Infect Dis. 2014;78(4):404-410. 122. Messier V, Lévesque B, Proulx J-F, et al. Seroprevalence of Toxoplasma gondii among Nunavik Inuit (Canada). Zoonoses Public Health. 2009;56(4):188-197. 123. Pardhan-Ali A, Berke O, Wilson J, et al. A spatial and temporal analysis of notifiable gastrointestinal illness in the Northwest Territories, Canada, 1991-2008. Int J Health Geogr. 2012;11(1):17. 124. Pardhan-Ali A, Wilson J, Edge VL, et al. A descriptive analysis of notifiable gastrointestinal illness in the Northwest Territories, Canada, 1991-2008. BMJ Open. 2012;2(4):e000732.

125. Iqbal A, Goldfarb DM, Slinger R, Dixon BR. Prevalence and molecular characterization of Cryptosporidium, spp. and Giardia duodenalis in diarrhoeic patients in the Qikiqtani Region, Nunavut, Canada. Int J Circumpolar Health. 2015;74(1). 126. Krumhansl KA, Krkosek WH, Greenwood M, et al. Assessment of Arctic community wastewater impacts on marine benthic invertebrates. Environ Sci Technol. 2015;49(2):760-766. 127. Statistics Canada. Iqaluit, Nunavut (Code 6204003) and Cape Dorset, Nunavut (Code 6204007) (table). Census Profile. 2011 Census Stat Canada Cat no 98-316-XWE. 2012. 128. Statistics Canada. Population and Dwelling Counts, for Canada, Provinces and Territories, and Census Subdivisions (Municipalities), 2001 and 1996 Censuses - 100% Data. 2001 Census.

CHAPTER TWO:

OPTIMIZATION OF NUCLEIC ACID EXTRACTION AND DETECTION OF CRYPTOSPORIDIUM PARVUM AND TOXOPLASMA GONDII OOCYSTS FROM ENVIRONMENTAL MATRICES

Highlights

• Increasing freeze-thaw cycles did not enhance parasite DNA detection.

• T. gondii was detected in mussel tissue and water following one FT cycle.

• Highest sensitivity of C. parvum was obtained with primers targeting the 18S gene.

Abstract

Freeze-thaw extraction methods and PCR primers were compared to optimize detection of Cryptosporidium parvum and Toxoplasma gondii oocysts in different matrices. Increasing FT cycles did not increase parasite DNA detection, and primers targeting the 18S rRNA gene yielded the lowest limit of detection for C. parvum oocysts.

Keywords

Cryptosporidium parvum; Toxoplasma gondii; Detection; DNA Extraction; Freeze-Thaw; PCR

Introduction

Cryptosporidium spp. and Toxoplasma gondii are ubiquitous zoonotic parasites with worldwide distribution, and are important pathogens among high, medium, and low income countries.1,2 Exposure may occur by ingestion of oocysts that can survive in the environment for weeks to years,1,3 posing risk of infection to people and animals through contaminated water or food, including shellfish.3–5 Oocysts are resistant to chemical disinfectants and require additional steps for inactivation or physical removal.4

Detection methods for oocysts include microscopy,6,7 antibody-based methods (e.g., immunomagnetic separation, direct and indirect fluorescent antibody techniques),8–10 and molecular methods (e.g., conventional and quantitative PCR).7,8,11,12 PCR can further facilitate molecular characterisation of pathogens needed for investigating transmission across environmental matrices and hosts.8,10

The robust nature of protozoan parasite oocysts poses challenges for nucleic acid extraction needed in molecular assays.10 Freeze-thaw (FT) cycles are commonly used to disrupt oocyst walls prior to DNA extraction using commercial kits.8,10,13–17 However, standard recommendations for oocyst DNA extraction using freeze-thaw (FT) cycles are not available. To achieve deep freezing, storage at -80°C,7,8,14,16,18 or immersion in liquid nitrogen11,12,15 or a dry ice/ethanol slurry19 have been reported. Duration of these freeze cycles ranged from 3 -

60min.7,13,14 Reported approaches for thawing include incubation at room temperature,18 55°C,19

70°C,12 80°C,15,16 95°C,7 or in boiling water8,11 for durations of 3-15min.7,13,14,16 The number of

FT cycles also varies, with studies reporting 1 cycle,11 3 cycles,14–16,19 5 cycles,12,17,20 or 6 cycles.7 No prior studies have reported a comparison of the efficacy of different FT cycles for

DNA extraction from oocysts. Utility of FT may also differ for different environmental matrices,

including water and foods.8,14,21 Therefore, it is important to investigate the efficacy of extraction in matrices that can serve as exposure routes for infection.

To address discrepancies in molecular testing for protozoan parasites, we present a comparison of molecular approaches for oocyst detection. Specifically, the efficiency of oocyst

DNA extraction following various numbers of FT cycles was evaluated for a simplex matrix

(water or PBS), or whole mussel homogenate (Mytilus californianus). We further evaluated the limits of detection of C. parvum in water using PCR assays and primer sets, following similar spiking experiments previously reported for T. gondii.22

Methods and Results

Type II T. gondii (M4 strain23) oocysts were produced in experimentally-infected cats at the University of California, Davis, as previously described.24 C. parvum (Iowa isolate) oocysts were obtained from experimentally-infected calves at the Cryptosporidium Production

Laboratory, University of Arizona, Tucson, AZ, USA.25 Parasite stock solutions were enumerated using a hemocytometer chamber under light microscopy. For T. gondii, triplicate serial dilutions of 0, 1, 10, 100, and 1,000 oocysts were prepared in either 100 µL of DI water or mussel homogenate samples. Mussel homogenates were prepared by blending entire mussel tissue with equal volume of peptone water.11 Because results for T. gondii suggested similar

DNA extraction efficiency from these two matrices (Kruskal-Wallis test (Table 2.1)), FT cycles were compared for C. parvum in 100 µL phosphate-buffered saline (PBS), with triplicate dilutions of 0, 10, 100, 1,000, and 10,000 oocysts. The relevant matrix (PBS, water, or mussel homogenate) not spiked with oocysts, and a negative control containing only extraction reagents, served as negative controls. Spiked samples and negative controls were then subjected to one, three, or six FT cycles consisting of 4 min in liquid nitrogen followed by 4 min in boiling water.

The remainder of the DNA extraction process utilized the Qiagen DNeasy® Blood & Tissue Kit

(QIAGEN Inc., Toronto, ON, Canada).11

Extracted T. gondii and C. parvum DNA was amplified via PCR using nested primer sets targeting the B122,26 and gp60 genes,27 respectively (Table 2.2). DNA extracted from T. gondii tachyzoites (RH strain) and from 10,000 C. parvum oocysts served as positive controls for PCR.

Table 2.1: Limit of detection (LOD) of Toxoplasma gondii oocysts extracted from water and mussel tissue homogenate, and Cryptosporidium parvum oocysts extracted from phosphate- buffered saline (PBS) using 1, 3, or 6 freeze-thaw (FT) cycles. DNA detection did not differ among numbers of FT cycles (Kruskal-Wallis test P > 0.05). # Detected/ # Tested FT Cycles b Protozoan # Oocysts # Oocysts Matrix 1 3 6 parasite per 100 µL per reactiona matrix T. gondii 0 0 Deionized 0/3 0/3 0/3 1 0.1 water 0/3 0/3 0/3 10 1 1/3 0/3 0/3 100 10 3/3 3/3 3/3 1,000 100 3/3 3/3 3/3 1 3 6 T. gondii 0 0 Mussel tissue 0/3 0/3 0/3 1 0.1 homogenate 1/3 0/3 0/3 10 1 2/3 0/3 2/3 100 10 3/3 3/3 3/3 1,000 100 3/3 3/3 3/3 1 3 6 C. parvum 0 0 Phosphate 0/3 0/3 0/3 10 1 buffered 1/3 0/3 2/3 100 10 saline (PBS) 3/3 2/3 3/3 1,000 100 3/3 3/3 2/3 10,000 1,000 3/3 3/3 3/3 a All PCR reactions used 5 µL template representing 1/10th of the extract; thus, LOD per reaction are 1/10th of spiked oocyst numbers. b Numbers in bold represent the lowest limit of detection of oocyst DNA when tested in triplicate for a given matrix and number of FT cycles.

A single FT cycle yielded the lowest limit of detection (LOD) of T. gondii spiked in water at 1 oocyst/reaction, with a LOD of 10 oocysts/reaction following 3 or 6 FT cycles. When extracted from mussel tissue homogenate, the LOD was 0.1 oocysts/reaction following 1 FT cycle, 10 oocysts/reaction following 3 FT cycles, and 1 oocysts/reaction following 6 FT cycles

(Table 2.1). For C. parvum, both 1 and 6 FT cycles yielded a LOD of 1 oocyst/reaction in PBS, with a LOD of 10 oocysts/reaction following 3 FT cycles. All replicates extracted from 10 or more oocysts using 1 FT cycles tested positive, while one replicate with 100 oocysts extracted with 6 FT cycles did not amplify (Table 2.1). All negative controls tested negative by PCR for both parasites.

To compare different primer sets and PCR methods for detection of C. parvum DNA following 1 FT cycle, three assays were compared; one targeting the gp60 gene,27 and two targeting the 18S gene: commonly used primers designed by Xiao et al.,28 and a recently- designed primer set termed m18S (Table 2.2), intended for multiplex PCR for simultaneous detection of various parasites. DNA extracted from 10,000 oocysts served as a positive control for PCR.

Table 2.2: Mastermix components, thermocycler conditions, and primer sequences used for detection of Toxoplasma gondii and Cryptosporidium parvum. All reactions were carried out in a 50 µL volume. Negative controls for PCR consisted of reactions containing PCR-grade water instead of DNA template as well as no template controls. Parasite Locus Master Mix Thermocycler Primers Reference(s) T. gondii B1 1X PCR Buffer (Mg2+), Pre-PCR 3 min at 94°C; 35 External forward: 22,26 300 µM of each dNTP, cycles of: denaturation at TGTTCTGTCCTATCGCAACG 500 nM of each primer, 95°C for 40s, annealing at External reverse: ACGGATGCAGTTCCTTTCTG 0.4 µg/µl BSA, 1.5 U Taq 58°C (external) or 59°C Internal forward: TCTTCCCAGACGTGGATTTC polymerase, and 5 µL (internal), extension at 72°C Internal reverse: CTCGACAATACGCTGCTTGA (external) or 2 µL for 90s; post-PCR at 72°C (internal) DNA template. for 4 min. C. parvum gp60 1X PCR Buffer (Mg2+), Pre-PCR 5 min at 94°C; 40 External Forward: 27 200 µM of each dNTP, cycles of: denaturation at ATGAGATTGTCGCTCATTATC 500 nM of each primer, 94°C for 30s, annealing at External Reverse: 0.4 µg/µl BSA, 1.5U Taq 55°C for 45s, extension at TTACAACACGAATAAGGCTGC polymerase and 5 µL 72°C for 60s (external) or Internal Forward: (external) or 2 µL 45s (internal); post-PCR at GCCGTTCCACTCAGAGGAAC (internal) DNA template. 72°C for 10 min. Internal Reverse: CCACATTACAAATGAAGTGCC C. parvum 18S rRNA 1X PCR Buffer (Mg2+), Pre-PCR 3 min at 94°C; 35 External Forward: 28 200 µM of each dNTP, cycles of: denaturation at TTCTAGAGCTAATACATGCG 500 nM of each primer, 95°C for 40s, annealing at External Reverse: 0.4 µg/µl BSA, 1.5U Taq 58°C (external) or 59°C CCCATTTCCTTCGAAACAGGA polymerase and 5 µL (internal) for 40s, extension Internal Forward: (external) or 2 µL at 72°C for 90s; post-PCR at GGAAGGGTTGTATTTATTAGATAAAG (external) DNA template. 72°C for 4 min. Internal Reverse: AAGGAGTAAGGAACAACCTCCA C. parvum 18S rRNA 1X PCR Buffer (Mg2+), Pre-PCR 3 min at 94°C; 35 External forward (358-F): Present study 200 µM of each dNTP, cycles of: denaturation at CGGGTAACGGGGAATTAGGG 200nM of each primer, 0.4 95°C for 40s, annealing at External reverse (1141-R): µg/µl BSA, 1.5U Taq 58°C (external) or 60°C TCAGCCTTGCGACCATACTC polymerase and either (internal) for 40s, extension Internal forward (153-F): 5 µL (external) or 2 µL at 72°C for 90s; post-PCR at TGGAATGAGTTAAGTATAAACCCCT (internal) DNA template. 72°C for 4 min. Internal reverse (695-R): GCTGAAGGAGTAAGGAACAACC

Highest assay sensitivity for C. parvum DNA was observed with the 18S primer set published by Xiao et al.,28 with 1 oocyst/reaction detected in 2/3 replicates (Table 2.3). The gp60 assay resulted in 1/3 replicates amplifying at 1 oocyst/reaction, while the m18S assay detected oocysts at 10 oocysts/reaction. All replicates containing 100 or more oocysts/reaction tested positive using all primer sets, while all negative controls tested negative (Table 2.3).

Table 2.3: Detection of Cryptosporidium parvum DNA using primer sets targeting the gp60 or 18S rRNA gene. DNA was extracted from oocysts in PBS using a single FT cycle.

# Detected/ # Tested Primers # Oocysts per # Oocysts per gp60 Xiao 18S m18S 100 µL PBS reactiona 0 0 0/3 0/3 0/3 10 1 1/3b 2/3 0/3 100 10 3/3 3/3 2/3 1000 100 3/3 3/3 3/3 10,000 10,000 3/3 3/3 3/3 a All PCR reactions used 5 µL template representing 1/10th of the extract; thus, LOD per reaction are 1/10th of spiked oocyst numbers. b Numbers in bold represent the lowest limit of detection of oocyst DNA for a given primer set when tested in triplicate

This study is the first to systematically compare the efficacy of different FT cycles for extraction of DNA from T. gondii and C. parvum oocysts in diverse matrices. Increasing numbers of FT cycles did not enhance oocyst DNA detection and may have resulted in decreased sensitivity due to degradation of DNA with repeated FT cycles. The validation of a single FT cycle for efficient extraction of oocyst DNA should aid surveillance studies that aim to screen large number of environmental samples with minimal cost and personnel time. For C. parvum, nested PCR primers designed by Xiao et al.28 targeting the 18S rRNA gene yielded the lowest limit of detection, validating its use for screening environmental samples that typically harbor low (but epidemiologically significant) concentrations of parasites.

References

1. Bahia-Oliveira L, Gomez-Marin J, Shapiro K. Toxoplasma gondii. In: Rose JB, Jiménez- Cisneros B, Fayer R, Jakubowski W, eds. Global Water Pathogens Project. East Lansing, MI: UNESCO; 2017. 2. Thompson RCA, Koh WH, Clode PL. Cryptosporidium — What is it? Food Waterborne Parasitol. 2016;4:54-61. 3. Robertson LJ. The potential for marine bivalve shellfish to act as transmission vehicles for outbreaks of protozoan infections in humans: A review. Int J Food Microbiol. 2007;120(3):201-216. 4. Willis JE, McClure JT, Davidson J, McClure C, Greenwood SJ. Global occurrence of Cryptosporidium and Giardia in shellfish: Should Canada take a closer look? Food Res Int. 2013;52(1):119-135. 5. Elmore SA, Jenkins EJ, Huyvaert KP, Polley L, Root JJ, Moore CG. Toxoplasma gondii in circumpolar people and wildlife. Vector-Borne Zoonotic Dis. 2012;12(1):1-9. 6. Mosteo R, Goni P, Miguel N, Abadias J, Valero P, Ormad MP. Bioaccumulation of pathogenic bacteria and amoeba by zebra mussels and their presence in watercourses. Environ Sci Pollut Res. 2016;23(2):1833-1840. 7. Bigot-Clivot A, Ladeiro MP, Lepoutre A, et al. Bioaccumulation of Toxoplasma and Cryptosporidium by the freshwater crustacean Gammarus fossarum: Involvement in biomonitoring surveys and trophic transfer. Ecotoxicol Environ Saf. 2016;133:188-194. 8. Miller WA, Atwill ER, Gardner IA, et al. Clams (Corbicula fluminea) as bioindicators of fecal contamination with Cryptosporidium and Giardia spp. in freshwater ecosystems in California. Int J Parasitol. 2005;35(6):673-684. 9. Miller WA, Gardner IA, Atwill ER, et al. Evaluation of methods for improved detection of Cryptosporidium spp. in mussels (Mytilus californianus). J Microbiol Methods. 2006;65(3):367-379. 10. Hohweyer J, Dumetre A, Aubert D, Azas N, Villena I. Tools and methods for detecting and characterizing Giardia, Cryptosporidium, and Toxoplasma parasites in marine mollusks. J Food Prot. 2013;76(9):1649-1657. 11. Adell AD, Smith WA, Shapiro K, Melli A, Conrad PA. Molecular epidemiology of Cryptosporidium spp. and Giardia spp. in mussels (Mytilus californianus) and California sea lions (Zalophus californianus) from Central California. Appl Environ Microbiol. 2014;80(24):7732-7740. 12. Staggs SE, Keely SP, Ware MW, et al. The development and implementation of a method using blue mussels (Mytilus spp.) as biosentinels of Cryptosporidium spp. and Toxoplasma gondii contamination in marine aquatic environments. Parasitol Res. 2015;114(12):4655-4667. 13. Miller WA, Miller MA, Gardner IA, et al. New genotypes and factors associated with Cryptosporidium detection in mussels (Mytilus spp.) along the California coast. Int J Parasitol. 2005;35(10):1103-1113. 14. Molini U, Traversa D, Ceschia G, et al. Temporal occurrence of Cryptosporidium in the Manila clam Ruditapes philippinarum in northern Adriatic Italian lagoons. J Food Prot. 2007;70(2):494-499.

15. Giangaspero A, Molini U, Iorio R, Traversa D, Paoletti B, Giansante C. Cryptosporidium parvum oocysts in seawater clams (Chamelea gallina) in Italy. Prev Vet Med. 2005;69(3- 4):203-212. 16. Giangaspero A, Papini R, Marangi M, Koehler A V, Gasser RB. Cryptosporidium parvum genotype IIa and Giardia duodenalis assemblage A in Mytilus galloprovincialis on sale at local food markets. Int J Food Microbiol. 2014;171:62-67. 17. Fayer R, Trout JM, Lewis EJ, et al. Contamination of Atlantic coast commercial shellfish with Cryptosporidium. Parasitol Res. 2003;89(2):141-145. 18. Villena I, Aubert D, Gomis P, et al. Evaluation of a strategy for Toxoplasma gondii oocyst detection in water. Appl Environ Microbiol. 2004;70(7):4035-4039. 19. Schwab KJ, Mcdevitt JJ. Development of a PCR-enzyme immunoassay oligoprobe detection method for Toxoplasma gondii oocysts, incorporating PCR controls. Appl Environ Microbiol. 2003;69(10):5819-5825. 20. Fayer R, Trout JM, Lewis EJ, et al. Temporal variability of Cryptosporidium in the Chesapeake Bay. Parasitol Res. 2002;88(11):998-1003. 21. Krusor C, Smith WA, Tinker MT, Silver M, Conrad PA, Shapiro K. Concentration and retention of Toxoplasma gondii oocysts by marine snails demonstrate a novel mechanism for transmission of terrestrial zoonotic pathogens in coastal ecosystems. Environ Microbiol. 2015;17(11, SI):4527-4537. 22. Shapiro K, Vanwormer E, Aguilar B, Conrad PA. Surveillance for Toxoplasma gondii in California mussels (Mytilus californianus) reveals transmission of atypical genotypes from land to sea. Environ Microbiol. 2015;17(11):4177-4188. 23. Gutierrez J, O’Donovan J, Williams E, et al. Detection and quantification of Toxoplasma gondii in ovine maternal and foetal tissues from experimentally infected pregnant ewes using real-time PCR. Vet Parasitol. 2010;172(1-2):8-15. 24. Fritz H, Barr B, Packham A, Melli A, Conrad PA. Methods to produce and safely work with large numbers of Toxoplasma gondii oocysts and bradyzoite cysts. J Microbiol Methods. 2012;88(1):47-52. 25. University of Arizona Cryptosporidium Production Laboratory. University of Arizona Cryptosporidium Production Laboratory. 26. Grigg ME, Boothroyd JC. Rapid identification of virulent type I strains of the protozoan pathogen Toxoplasma gondii by PCR-restriction fragment length polymorphism analysis at the B1 gene. J Clin Microbiol. 2001;39(1):398-400. 27. Iqbal A, Lim YAL, Surin J, Sim BLH. High diversity of Cryptosporidium subgenotypes identified in Malaysian HIV/AIDS individuals targeting gp60 gene. PLoS One. 2012;7(2). 28. Xiao L, Alderisio K, Limor J, Royer M, Lal AA. Identification of species and sources of Cryptosporidium oocysts in storm waters with a small-subunit rRNA-based diagnostic and genotyping tool. Appl Environ Microbiol. 2000;66(12):5492-5498.

CHAPTER THREE:

CRYPTOSPORIDIUM AND GIARDIA IN LOCALLY-HARVESTED CLAMS IN IQALUIT, NUNAVUT

Summary

High prevalences of Cryptosporidium and Giardia were recently found in enteric illness patients in the Qikiqtaaluk region of Nunavut, Canada, with a foodborne, waterborne, or animal source of parasites suspected. Clams (Mya truncata) are a commonly consumed, culturally important, and nutritious country food in Iqaluit; however, shellfish may concentrate protozoan pathogens from contaminated waters. The goal of this work was to investigate clams as a potential source of Cryptosporidium and Giardia infection in residents in Iqaluit, Nunavut. The objectives were to estimate the prevalence and genetically characterize Cryptosporidium and

Giardia in locally harvested clams. Clams (n=404) were collected from Iqaluit harvesters in

September 2016. Hemolymph (n=328) and digestive gland (n=390) samples were screened for

Cryptosporidium and Giardia via PCR, and amplified products were further processed for sequence analyses for definitive confirmation. Giardia DNA was found in hemolymph from 2 clams, while Cryptosporidium was not detected. The two Giardia sequences were identified as zoonotic Giardia enterica assemblage B. The presence of Giardia DNA in clams suggests human or animal fecal contamination of coastal habitat around Iqaluit in shellfish harvesting waters. Results from this study are intended to inform public health practice and planning in Inuit

Nunangat.

Keywords

Country Food, Cryptosporidium, EcoHealth approaches, Giardia, Inuit health, Nunavut

Introduction

The incidence of enteric illness (e.g. vomiting and diarrhea) is high among residents in

Inuit Nunangat (Harper et al., 2015b). Recent work identified high prevalences of two parasites,

Cryptosporidium and Giardia (15.7% and 4.6%, respectively), in the stools of enteric illness patients in Nunavut, and molecular characterization of these parasites suggested a potential environmental, animal or foodborne source of exposure (Iqbal et al., 2015). Similarly, studies in the Northwest Territories indicated potential environmental or foodborne exposures to parasites which can cause enteric illness (Pardhan-Ali et al., 2012b, 2013). However, the route of parasite transmission in Inuit Nunangat is largely unknown and generally understudied (Harper et al.,

2015a, 2015b; Iqbal et al., 2015; Pardhan-Ali et al., 2012b, 2013).

Country foodsa are commonly consumed in Inuit Nunangat (Priest & Usher, 2004; Rosol et al., 2012; Searles, 2016), and are preferred over store-bought foods by many Inuit for reasons including connections to important cultural practices (Collings et al., 1998; Donaldson et al.,

2010; Lambden et al., 2007; Pufall et al., 2011; Searles, 2016), nutritional benefits (Donaldson et al., 2010; Gagne et al., 2012; Kuhnlein & Receveur, 2007; Lambden et al., 2007; Pufall et al.,

2011; Rosol et al., 2016), cost (Ford et al., 2013; Galloway, 2014; Mead et al., 2010; Pufall et al.,

2011), and taste preferences (Donaldson et al., 2010; Lambden et al., 2007; Pufall et al., 2011).

While the consumption of country foods is culturally important and critical for nutrition and wellbeing, it has been suggested as a possible risk factor for enteric illness (Goyette et al., 2014;

Harper et al., 2015b; Messier et al., 2009; Pardhan-Ali et al., 2012a, 2012b).

aCountry foods include food hunted, trapped, and gathered from the land and waters surrounding communities (e.g. terrestrial and marine mammals, fish, berries, and shellfish).

Clams (Mya truncata) are an easily accessible and important country food in many communities in Inuit Nunangat, and are typically harvested during the summer and fall (Caughey et al., 2013; CBC News, 2013c; Harrison & Loring, 2016; Priest & Usher, 2004; Rideout, 2001;

Samuelson, 1999). In Iqaluit, Nunavut, clam harvesting areas on large tidal flats adjacent to the community can be accessed on foot, and clam harvesting areas further afield can be reached by boat (Dale et al., 2002). Clam harvesting is often a social activity, with large family or friend groups gathering clams together. Clams can be consumed fried, boiled, steamed, or raw, and are high in iron and omega-3 fatty acids (Caughey et al., 2013; Gagne et al., 2012). Clams are commonly consumed in many communities; for instance, between 1996 and 2001 in Iqaluit, the mean annual clam harvest was estimated at over 6000 clams, while the community’s population grew from 4200 to 5200 residents (Priest & Usher, 2004; Statistics Canada, 2001).

Zoonotic genotypes of Cryptosporidium and Giardia have been detected in marine and terrestrial wildlife in the Arctic, including seals, which consume bivalve shellfish (e.g. clams and mussels) as part of their diet (Dixon et al., 2008; Jenkins et al., 2013; Levesque et al., 2010).

Filter feeding clams and other bivalves can concentrate pathogens from surrounding water, including Cryptosporidium and Giardia (oo)cysts (Gomez-Couso et al., 2003; Miller et al., 2005;

Shapiro et al., 2015). As such, Cryptosporidium and Giardia (oo)cysts can accumulate in shellfish following contamination of surrounding waters with fecal matter from humans or animals (Gomez-Bautista et al., 2000; Gomez-Couso et al., 2005; Miller et al., 2005), and ingestion of shellfish contaminated with (oo)cysts can result in enteric illness (Robertson, 2007).

Contamination of shellfish has been a concern for some communities, and health advisories for potential clam contamination in some Nunavut communities have been issued (CBC News,

2013a, 2013b, 2013c, 2015; Murphy, 2003a; Rideout, 2001). A sewage lagoon used as a backup

for municipal wastewater treatment has also raised health concerns in Iqaluit (George, 1999;

Krumhansl et al., 2015; The Municipal Corporation of the City of Iqaluit, 2014). While federal government programs, such as the Canadian Shellfish Sanitation Program, provide information on foodborne and environmental pathogens in other areas of Canada, these monitoring programs do not operate regularly in Nunavut (Canadian Food Inspection Agency, 2017a, 2017b, Fisheries and Oceans Canada, 2017a, 2017b; Government of Canada & Canadian National Enteric

Pathogen Surveillance System (FoodNet Canada), 2015; Sauvé, 2010). In areas where the

Canadian Shellfish Sanitation Program monitors shellfish harvesting areas, the focus is on bacterial pathogens and paralytic shellfish poisoning, rather than on protozoan pathogens

(Canadian Food Inspection Agency, 2017a).

Previous environmental studies of protozoan pathogens in bivalve shellfish have focused on commercial harvesting areas, or on environments in non-Arctic locations (Robertson, 2007;

Willis et al., 2013). Indeed, studies of protozoan pathogens in bivalve shellfish in Inuit Nunangat are scarce, and do not cover all the species that are harvested by residents of these regions

(Jenkins et al., 2013; Levesque et al., 2010). Given the importance of clams in Inuit Nunangat, and the high rates of cryptosporidiosis and giardiasis among Nunavut residents (Iqbal et al.,

2015), it is important to understand whether clams could be a source of protozoan pathogens.

Therefore, the goal of this study was to investigate clams as a potential source of exposure to

Cryptosporidium and Giardia for residents in Iqaluit, Nunavut. The specific objectives were to

(i) estimate the prevalence of Cryptosporidium and Giardia in clams harvested in Iqaluit, and (ii) genetically characterize protozoan parasites detected in the harvested clams. The results of this study are intended to be useful for informing public health practice, planning, and decision- making.

Methods

Study Design

Clams were collected in Iqaluit (64° N, 69° W), the capital city of the territory of

Nunavut in Inuit Nunangat, the Inuit homeland in Canada. Iqaluit is the largest of 26 communities in Nunavut, with a population of 7,740 people, approximately 60% of whom identify as Inuit (Statistics Canada, 2012). An EcoHealth approach guided this study, which was premised on principles of systems thinking, transdisciplinarity, participation, sustainability, social equity, and knowledge to action (Charron, 2012). University researchers, the Nunavut

Research Institute, and community organizations worked closely together to identify research questions, secure funding, develop the study methods and design, and interpret the results. This collaboration was achieved through stakeholder and community engagement events including a series of meetings and workshops, held in Iqaluit from 2014-2016 and attended by community members and representatives of Government and non-governmental organizations. These local partners and stakeholders selected clams as a country food of interest for this study due to observed increases in enteric illness coinciding with shellfish harvesting season, and

Cryptosporidium and Giardia were selected as pathogens of interest. This research was licensed by Fisheries and Oceans Canada (Licence to Fish for Scientific Purposes #S-16/17-1047-NU), the Nunavut Impact Review Board (NIRB File #16YN057), and the Nunavut Planning

Commission (NPC File #148338).

Sample Acquisition and Processing

Clams were collected from harvesters to obtain shellfish that were representative of those consumed by Iqaluit residents. In early September 2016, print ads were placed in offices and businesses around Iqaluit, and posts were made on local social media groups to inform clam

harvesters in the community of the upcoming sample collection. Clams were collected from harvesters in Iqaluit between September 16-22, 2016 during a peak clam harvest period of extreme low tides. Each individual harvester could provide up to 10 clams per day in return for a small gift as an expression of appreciation and compensation. Harvesters were asked to identify clam harvest locations on maps of Iqaluit and the surrounding area, which included Inuktitut and

English place names (Inuit Heritage Trust Inc., 2009a, 2009b). Clam surface temperatures were recorded with an infrared thermometer at the time of collection from harvesters.

Clams were stored live in open plastic bags at 4°C between collection and sample processing. Sample processing occurred at the Nunavut Research Institute in Iqaluit within four days of clam collection. Clam weight and length was recorded, and hemolymph was aspirated from the abductor muscle using a sterile 22-gauge syringe (Miller et al., 2005). Hemolymph was centrifuged at 14,000 rpm (Eppendorf MiniSpin Plus Microcentrifuge) for 4 minutes, and approximately 100µL of pellet was retained (Miller et al., 2006). After removal of hemolymph, the clams were opened by cutting the abductor muscle and the digestive gland was excised and stored in a 1.5 mL microcentrifuge tube (see detailed lab procedure in Appendix C). Hemolymph pellets and digestive gland samples were frozen at -20°C for 10-14 days at the Nunavut Research

Institute in Iqaluit, and then transported on ice to the University of Guelph where they were stored at -80°C until DNA extraction.

Nucleic Acid Extraction

DNA extraction from hemolymph was performed using the Qiagen DNeasy Blood &

Tissue Kit (QIAGEN Inc., Toronto, ON, Canada) as described by Adell et al. (2014). For digestive gland tissue, approximately 0.1g of sample was suspended in 180µL ATL buffer and subjected to one freeze-thaw (FT) cycle (4 min liquid nitrogen, followed by 4 min boiling water),

with the remainder of the extraction process previously described by Adell et al., (2014). One FT cycle was used according to findings that increased numbers of FT cycles do not lead to improved detection of protozoan DNA (Manore et al., 2018). Final nucleic acid elution was performed using 50µL 10% AE Buffer suspended in UltraPure™ DNase/RNase-Free Distilled

Water (Life Technologies Inc., Burlington, ON, Canada). Eluted DNA was stored at -20°C until further analysis via PCR. Negative controls for each batch of DNA extraction consisted of extraction reagents with no added clam samples.

Polymerase Chain Reaction (PCR)

DNA amplification for detection of Cryptosporidium and Giardia was performed via nested PCR assays targeting the 18S rRNA gene (Xiao et al., 2000) and the glutamate hydrogenase (gdh) gene (Read et al., 2004), respectively. Additional characterization of samples confirmed positive for Giardia was attempted using nested PCR assays targeting the β-giardin gene (Lalle et al., 2005) and the 18S rRNA gene (Appelbee et al., 2003; Hopkins et al., 1997).

All PCR master-mix reagents and thermocycler conditions are detailed in Table S1. The limits of detection of both the 18S rRNA and gdh primer sets were 10 (oo)cysts following DNA extraction from phosphate-buffered saline (Supplementary Information, Manore et al., 2018). A negative control for PCR included a no-template sample containing only PCR reagents. Positive controls consisted of DNA obtained from 10,000 C. parvum oocysts (Iowa isolate) from experimentally-infected calves (University of Arizona Cryptosporidium Production Laboratory,

Tucson, USA) or 10,000 G. enterica cysts (isolate H3) from experimentally-infected gerbils

(Waterborne Inc., New Orleans, USA).

PCR products were visualized by agarose gel electrophoresis. Agarose gels (2%) were initially stained with ethidium bromide for nucleic acid visualization, followed with transition to

RedSafe™ (Froggabio, Toronto, ON, Canada) to reduce toxicity risk associated with ethidium bromide exposure. Comparison of the sensitivity of these two dyes for visualizing DNA was performed using dilutions of Giardia DNA (Supplementary Information, Manore et al., 2018).

Amplicons that were consistent in size with positive control amplicons were considered suspect positive samples for Cryptosporidium or Giardia. Suspect positive DNA products were excised from the gel and purified using the Qiagen QIAquick Gel Extraction Kit (QIAGEN Inc.,

Toronto, ON, Canada) for submission for sequence analysis.

Sequence Analysis

Purified DNA from suspect positive samples were submitted for sequencing using the corresponding internal PCR primers at the Advanced Analysis Centre at the University of

Guelph. Sequencing was carried out using a 3730 DNA Analyzer (Applied Biosystems Inc,

Foster City, CA, USA). If enough DNA could not be purified from a potential positive band, gel extraction was attempted once more from multiple bands combined into one DNA purification filter-column tube before sequencing was classified as unsuccessful. Sequences were analyzed with Geneious version 11.0.4 (Biomatters Inc., Newark, USA). Forward and reverse sequences were aligned using a global alignment with free end gaps, the ends were trimmed, and the consensus sequence was used to search GenBank using BLAST

(https://blast.ncbi.nlm.nih.gov/Blast.cgi).

Results

Characteristics of Harvested Clams

Of 404 clams obtained from local harvesters, 390 were alive at the time of processing and were used for pathogen detection analyses. Clams were harvested from a variety of locations, ranging from within town limits to 30km away (Figure 3.1, Table 3.1). On average, clams were

6.0cm long (2.5 – 10.0cm) and weighed an average of 49.8g (3.8 – 166.8g) (Figure 3.2). Average temperature of the clams at time of collection was 7.0°C (-3.2°C – 17.4°C).

Estimating the Prevalence of Cryptosporidium and Giardia

Hemolymph was successfully obtained from 328 clams, and digestive gland was sampled from all 390 live-collected clams. Following PCR for target parasites, five hemolymph samples

(1.5%) yielded amplicon products consistent with Cryptosporidium on gel electrophoresis; three of these could not be sequenced due to low DNA concentration, and the other two produced sequences that did not match Cryptosporidium in GenBank. Twenty-one hemolymph samples

(6.4%) had amplicons consistent with Giardia; 17 of these could not be sequenced due to low

DNA concentration, and two produced sequences that did not match Giardia in GenBank. Two of the 328 hemolymph samples (0.6%; 95% CI 0.2%, 2.4%) were confirmed positive for Giardia via sequence analysis. PCR of digestive gland samples yielded six samples (1.5%) with DNA products consistent in size with Giardia. Five of these DNA products were not sequenced due to low DNA concentration; one of these DNA products was sequenced, and the resulting sequence did not match Giardia in GenBank. Cryptosporidium was not amplified in any digestive gland sample (Table 3.1).

Of the two clams confirmed positive for Giardia, one (10H) was harvested in Apex

(Site #1), a popular harvesting site which is accessible on foot from the Iqaluit town centre. Of

the 158 clams harvested at Apex, hemolymph was obtained from 138, resulting in a Giardia site prevalence estimate of 0.7% (95% CI: 0.1%, 5.1%). The other clam confirmed positive for

Giardia (221H), was harvested from Kitturiaqanngittut Islands (Site #9), approximately 17km from Iqaluit (Figure 3.1). Of the 33 clams harvested at Kitturiaqanngittut Islands, hemolymph was obtained from 29 and PCR targeting gdh was performed on 28, resulting in a Giardia site prevalence estimate of 3.6% (95% CI: 0.4% 23.7%) (Table 3.1).

Molecular Characterization

The DNA sequences from both hemolymph samples confirmed positive for Giardia were consistent with G. enterica assemblage B (>99.5% identity, 100% coverage), and a representative sequence (GenBank: KM190708.1) was used as a reference strain for further comparison of single nucleotide polymorphisms. Compared with the reference strain, each clam sequence contained two unique single nucleotide polymorphisms (SNPs) (Table 3.2). Further characterization of these confirmed positive samples via PCR targeting two additional loci (β- giardin and 18S rRNA) was attempted, but DNA amplification was unsuccessful.

Discussion

The results of this study demonstrate the presence of Giardia DNA in clams in Nunavut.

The existing literature on protozoan pathogens in shellfish has predominantly focused on commercial shellfish harvested in southern areas (Robertson, 2007; Willis et al., 2013), or on the use of filter-feeding shellfish as bioindicators (Adell et al., 2014; Graczyk et al., 1997, 2003;

Levesque et al., 2010; Lucy et al., 2008; Miller et al., 2005; Palos Ladeiro et al., 2014). The study design employed herein is unique as it directly tested presence of parasites in shellfish to be consumed as a food source by residents of Inuit Nunangat (Priest & Usher, 2004). Few studies or government programs have investigated bivalve shellfish as sources of foodborne pathogens

in the Canadian Arctic (Canadian Food Inspection Agency, 2017a, 2017b, Fisheries and Oceans

Canada, 2017a, 2017b; Government of Canada & Canadian National Enteric Pathogen

Surveillance System (FoodNet Canada), 2015; Jenkins et al., 2013; Levesque et al., 2010;

Robertson, 2007; Sauvé, 2010), despite their importance as a commonly consumed country food

(Batal et al., 2005; Caughey et al., 2013; CBC News, 2013c; Harrison & Loring, 2016; Kuhnlein

& Receveur, 2007; Lambden et al., 2007; Priest & Usher, 2004; Rideout, 2001; Samuelson,

1999). Our study results are also relevant to the potential development of a commercial clam harvest in Iqaluit. Other communities in Nunavut have worked to establish commercial clam harvesting programs (Rideout, 2001), and have faced challenges due to the distance to the nearest Canadian Shellfish Sanitation Program-approved laboratories (Murphy, 2003a, 2003b).

While the overall prevalence of Giardia in clams was low (0.6%) compared to other studies in southern Canada and elsewhere (Willis et al., 2013), the confirmed presence of Giardia DNA in clams indicates fecal contamination of coastal waters near Iqaluit from which clams are harvested.

Several methodological factors may have affected the detection of Cryptosporidium or

Giardia DNA. Protozoan (oo)cysts may occur in clam organs that were not sampled, or in a portion of the digestive gland that was not processed for DNA extraction. Additionally, the PCR primers used to detect Cryptosporidium and Giardia in this study have limits of detection of 10

(oo)cysts following extraction from PBS (Supplementary Information, Manore et al., 2018).

Although these limits of detection have not been confirmed in tissues from M. truncata, these primer sets have detected as few as one Cryptosporidium or Giardia (oo)cysts in hemolymph and

10 Cryptosporidium oocysts in digestive gland samples of other bivalve shellfish species (Adell

et al., 2014; Miller et al., 2005). These limitations in tissue sampling and PCR limits of detection may have resulted in an underestimation of the true prevalence of Cryptosporidium and Giardia.

While the presence of Cryptosporidium DNA was not confirmed in any clams, this protozoan parasite has been found in both terrestrial and marine wildlife in Inuit Nunangat

(Jenkins et al., 2013). G. enterica assemblage B, as detected here in clams, has been previously detected in humans and in animals such as dogs and seals (Iqbal et al., 2015; Jenkins et al.,

2013). Detection of this genotype in clams could be due to either human and/or animal sources of the parasite. Contamination of coastal water with human sewage or animal fecal matter has been linked with Giardia presence in shellfish in prior investigations in southern regions

(Gomez-Couso et al., 2005; Graczyk et al., 1998, 1999, 2004; Levesque et al., 2010; Miller et al.,

2005). As the two positive clams were harvested over 10 km apart, and the two Giardia sequences contain unique SNPs, there are likely to be multiple sources of fecal contamination.

Potential sources of Giardia in Iqaluit include terrestrial and marine wildlife (Dixon et al., 2008;

Jenkins et al., 2013), domestic animals including dogs (Himsworth et al., 2010; Jenkins et al.,

2013; Salb et al., 2008; Schurer et al., 2012), and the sewage lagoon and wastewater treatment plant located near the town centre (The Municipal Corporation of the City of Iqaluit, 2014).

Only one prior investigation has reported the presence of protozoan pathogens in shellfish from Northern Canada, where Levesque et al. (2010) collected mussels (Mytilus edulis) from sites in Nunavik (Northern Quebec), and tested batches of homogenized mussel tissue for

Cryptosporidium and Giardia. Because the present study employed a different shellfish testing approach (using hemolymph and digestive gland from individual clams), a direct comparison between these two investigations is challenging. The Nunavik study detected Giardia at 18.2% of tested sites (Levesque et al., 2010), which appears similar to the 20% site prevalence in the

present study. However, in the Nunavik study, Cryptosporidium was found at 72.7% of tested sites (Levesque et al., 2010), while no clams tested positive in the current investigation. This variation between detected prevalences of Cryptosporidium may be attributed to the differences in location, shellfish species, and sampling and detection methods between the two studies.

Proximity to potential sources of human sewage contamination did not appear to predict the presence or absence of Cryptosporidium or Giardia in shellfish collected in the Nunavik study, which may indicate an alternate source of fecal pollution (Levesque et al., 2010). Additionally, the present study collected clams directly from harvesters to obtain a sample representative of clams that Iqaluit residents harvested for their own consumption. While collecting clams from harvesters enabled the research team to sample clams from many harvest locations near Iqaluit, it is possible that clams that were harvested for consumption accumulated less Cryptosporidium and Giardia compared to clams that were not harvested due to community and Inuit knowledge of preferable harvesting areas (Pufall et al., 2011).

The research team collected clams from harvesters over a five-day period in September

2016. While this period occurred over a peak clam harvest weekend, the Iqaluit clam harvest occurs over approximately 12 weeks in late summer and early fall. The clams collected during our study period, therefore, represent a single point in time and would not reflect or represent any temporal or seasonal effects on the prevalence of Cryptosporidium and Giardia. Additionally, and to avoid compromising food security, harvesters generally chose which clams to give to the research team. Thus, the most recently harvested clams (at the top of the bucket) were most often provided. Although each harvester was limited to giving the research team up to 10 clams per day, there were some harvesters who gave clams to the research team on multiple days. This sampling method, while culturally respectful, may have resulted in some harvesting areas being

overrepresented. Harvesting areas near town may also be overrepresented, as those harvesting clams close to town might have been more likely to find the research team to exchange their clams.

While the results presented herein demonstrate, for the first time, the presence of Giardia

DNA in Iqaluit shellfish, the relative human health risks from Cryptosporidium and Giardia in clams harvested near Iqaluit remain unclear. PCR assays were chosen for Cryptosporidium and

Giardia detection based on prior investigations that successfully detected protozoan DNA in shellfish (Adell et al., 2014; Manore et al., 2018; Miller et al., 2005), however these molecular methods do not provide information on the viability or infectivity of Giardia to humans

(Robertson, 2007). The detection of Giardia DNA in the clams thus indicates fecal contamination of the waters from which they were harvested but cannot confirm that consumption of clams poses a risk for contracting giardiasis to Iqaluit residents. Additionally, sampled clam tissues which contained fewer than 10 (oo)cysts may have failed to yield sufficient

DNA for amplification, thus resulting in false negatives for either Giardia or Cryptosporidium.

As ingestion of as few as 10 Giardia cysts may cause illness (Ortega & Adam, 1997; Rendtorff,

1954; Stelma & McCabe, 1992), an individual may ingest a sufficient number of cysts from

PCR-negative clams to cause illness, especially if multiple clams are consumed.

Conclusions

Giardia DNA was found in 2 of 328 hemolymph samples from clams that were harvested near Iqaluit. Cryptosporidium was not detected in any hemolymph or digestive gland samples.

The two clams that were confirmed positive for Giardia DNA were harvested from two different locations approximately 4 and 17km from the Iqaluit town centre, and both were genotyped as zoonotic Giardia enterica assemblage B at the gdh locus. The distance between the harvest

locations of the two positive clams, as well as unique SNPs that distinguished them from each other, suggests the presence of at least two different sources of fecal pollution to coastal waters around Iqaluit where clams are harvested. Further genetic characterization of the Giardia found in the clams and concurrent investigation of Giardia strains in terrestrial animals and Iqaluit residents are needed to determine the source attribution of these parasites. Additional investigations targeting protozoa presence in shellfish in this region, especially using methods capable of discriminating viability and infectivity of detected parasites, will further clarify the human health risks from Cryptosporidium and Giardia in clams harvested near Iqaluit.

Figures

Figure 3.1: Maps of (A) Canada, (B) Frobisher Bay, and (C) Iqaluit showing the harvest locations of clams near Iqaluit. Brackets below location IDs depict number of collected clams that were harvested from each site in 2016. Stars indicate harvest locations of clams confirmed positive for Giardia.

Tables

Table 3.1: A summary of the number of clams harvested at each location in September 2016, and results of molecular testing for Cryptosporidium and Giardia via PCR and sequence analyses. Numbers in brackets represent suspected positive samples from digestive gland tissue. Unless otherwise indicated, all potential, sequenced, and confirmed positives were from hemolymph samples. Cryptosporidium Giardia Location Location name Clams Hemolymph Digestive Average Suspected Suspected Sequence Suspected Suspected Sequence number collected samples gland clam weight positive, positive, confirmed c positive, positive, confirmed c tested samples (g) sequencing sequencing sequencing sequencing tested not negative b not negative b successful a successful a 1 Apex 158 138 157 41.99 3 2 0 3 1 1 10H d 2 Causeway 10 7 10 35.38 0 0 0 0 0 0 3 Red Island 103 81 100 59.42 0 0 0 7 (3) 0 (1) 0 4 Ukaliqturliq 19 16 19 36.91 0 0 0 1 (1) 0 0 Island 5 Tundra Valley 10 7 10 52.13 0 0 0 0 0 0 6 Arnaqquaksaaq 10 9 10 41.04 0 0 0 3 0 0 7 Palauga 28 16 22 34.72 0 0 0 1 0 0 8 Jane's Inlet 10 10 10 126.96 0 0 0 1 0 0 9 Kitturiaqanngittut 33 29 33 45.57 0 0 0 1 0 1 221H d Islands Unknown Unknown 23 15 19 74.22 0 0 0 2 (1) 1 0 Total 404 328 390 49.80 3 2 0 19 (5) 2 (1) 2 a. Samples that produced a band on agarose gel consistent with a positive control, but for which sequencing was not successful. b. Samples for which a sequence was obtained but did not match a Cryptosporidium or Giardia sequence in GenBank. c. Samples that were successfully sequenced, and whose sequence matched a Giardia sequence in GenBank. d. Identification numbers of clams confirmed positive for Giardia.

Table 3.2: Single nucleotide polymorphisms (SNPs) at the gdh locus in G. enterica assemblage B from reference strains and clams from Iqaluit, Nunavut (2016).

Nucleotide position 249 359 535 601 Sample type GenBank accession # Consensus A G G G Water sample, Vancouver, Canada KM190708.1 - - - - Positive control a EF507647.1 - - - - Clam 10H Pending - - A A Clam 221H Pending T A - - a Positive control DNA was extracted from Giardia enterica isolate H3 (obtained from Waterborne Inc).

References

Adell, A. D., Smith, W. A., Shapiro, K., Melli, A., & Conrad, P. A. (2014). Molecular epidemiology of Cryptosporidium spp. and Giardia spp. in mussels (Mytilus californianus) and California sea lions (Zalophus californianus) from Central California. Applied and Environmental Microbiology, 80(24), 7732–7740. https://doi.org/10.1128/AEM.02922-14 Appelbee, A. J., Frederick, L. M., Heitman, T. L., & Olson, M. E. (2003). Prevalence and genotyping of Giardia duodenalis from beef calves in Alberta, Canada. Veterinary Parasitology, 112(4), 289–294. https://doi.org/10.1016/S0304-4017(02)00422-3 Batal, M., Gray-Donald, K., Kuhnlein, H. V, & Receveur, O. (2005). Estimation of traditional food intake in indigenous communities in Denendeh and the Yukon. International Journal of Circumpolar Health, 64(1), 46–54. Caccio, S. M., Giacomo, M. De, & Pozio, E. (2002). Sequence analysis of the β-giardin gene and development of a polymerase chain reaction – restriction fragment length polymorphism assay to genotype Giardia duodenalis cysts from human faecal samples. International Journal for Parasitology, 32, 1023–1030. Canadian Food Inspection Agency. (2017a). Appendices - Canadian Shellfish Sanitation program - Manual of Operations - Food - Canadian Food Inspection Agency. Retrieved November 3, 2017, from http://www.inspection.gc.ca/food/fish-and- seafood/manuals/canadian-shellfish-sanitation- program/eng/1351609988326/1351610579883?chap=15#s9c15 Canadian Food Inspection Agency. (2017b). Chapter 1 - Canadian Shellfish Sanitation program - Manual of Operations - Food - Canadian Food Inspection Agency. Retrieved November 3, 2017, from http://www.inspection.gc.ca/food/fish-and-seafood/manuals/canadian-shellfish- sanitation-program/eng/1351609988326/1351610579883?chap=4 Caughey, A., Killulark, J., Webb, L., Kilabuk, P., Ogina, J., Guyot, M., & Hamilton, S. (2013). Inuit Traditional Foods. Retrieved June 16, 2017, from http://www.livehealthy.gov.nu.ca/sites/default/files/NutritionFactsheetsEnglish11-13-13- low res_0.pdf CBC News. (2013a, July 20). Don’t eat Pangnirtung clams, say Nunavut health officials. CBC News North. Retrieved from http://www.cbc.ca/news/canada/north/don-t-eat-pangnirtung- clams-say-nunavut-health-officials-1.1329830 CBC News. (2013b, July 26). Nunavut health officials probe clam-related illness. CBC News North. Retrieved from http://www.cbc.ca/news/canada/north/nunavut-health-officials- probe-clam-related-illness-1.1329829 CBC News. (2013c, August 7). Pangnirtung clams OK to eat, say health officials. CBC News North. Retrieved from http://www.cbc.ca/news/canada/north/pangnirtung-clams-ok-to-eat- say-health-officials-1.1364028 CBC News. (2015, September 28). Pangnirtung, Nunavut under health advisory following

sewage spill. CBC News North. Retrieved from http://www.cbc.ca/news/canada/north/pangnirtung-nunavut-under-health-advisory- following-sewage-spill-1.3246491 Charron, D. F. (2012). Ecohealth Research in Practice: Innovative Applications of an Ecosystem Approach to Health. Springer, IDRC (Vol. 53). https://doi.org/10.1017/CBO9781107415324.004 Collings, P., Wenzel, G., & Condon, R. G. (1998). Modern food sharing networks and community integration in the Central Canadian Arctic. Arctic, 51(4), 301–314. Retrieved from http://www.jstor.org/stable/40511848 Dale, J. E., Leech, S., McCann, S. B., & Samuelson, G. (2002). Sedimentary characteristics, biological zonation and physical processes of the tidal flats of Iqaluit, Nunavut. In K. Hewitt, M.-L. Byrne, M. English, & G. Young (Eds.), Landscapes of transition : landform assemblages and transformations in cold regions (pp. 205–234). Kluwer Academic. Dixon, B. R., Parrington, L. J., Parenteau, M., Leclair, D., Santín, M., & Fayer, R. (2008). Giardia duodenalis and Cryptosporidium spp. in the intestinal contents of ringed seals (Phoca hispida) and bearded seals (Erignathus barbatus) in Nunavik, Quebec, Canada. Journal of Parasitology, 94(5), 1161–1163. https://doi.org/10.1645/GE-1485.1 Donaldson, S. G., Van Oostdam, J., Tikhonov, C., Feeley, M., Armstrong, B., Ayotte, P., … Shearer, R. G. (2010). Environmental contaminants and human health in the Canadian Arctic. Science of The Total Environment, 408(22), 5165–5234. https://doi.org/10.1016/j.scitotenv.2010.04.059 Fisheries and Oceans Canada. (2017a). Shellfish harvesting closures. Retrieved November 3, 2017, from http://www.dfo-mpo.gc.ca/shellfish-mollusques/index-eng.htm Fisheries and Oceans Canada. (2017b). Shellfish Sanitation Assessment (Solicitation No. F5211- 170574). Retrieved January 29, 2018, from https://buyandsell.gc.ca/procurement- data/tender-notice/PW-17-00804319 Ford, J. D., Lardeau, M.-P., Blackett, H., Chatwood, S., & Kurszewski, D. (2013). Community food program use in Inuvik, Northwest Territories. BMC Public Health, 13(1), 970. https://doi.org/10.1186/1471-2458-13-970 Gagne, D., Blanchet, R., Lauziere, J., Vaissiere, E., Vezina, C., Ayotte, P., … O’Brien, H. T. (2012). Traditional food consumption is associated with higher nutrient intakes in Inuit children attending childcare centres in Nunavik. International Journal of Circumpolar Health, 71(1). https://doi.org/10.3402/ijch.v71i0.18401 Galloway, T. (2014). Is the Nutrition North Canada retail subsidy program meeting the goal of making nutritious and perishable food more accessible and affordable in the North? Canadian Journal of Public Health, 105(5), 395–397. George, J. (1999, September 17). Current sewage lagoon poisoning Koojessee Inlet. NunatsiaqOnline. Retrieved from http://www.nunatsiaqonline.ca/stories/article/current_sewage_lagoon_poisoning_koojessee 55

_inlet/ Gomez-Bautista, M., Ortega-Mora, L. M., Tabares, E., Lopez-Rodas, V., & Costas, E. (2000). Detection of infectious Cryptosporidium parvum oocysts in mussels (Mytilus galloprovincialis) and cockles (Cerastoderma edule). Applied and Environmental Microbiology, 66(5), 1866–1870. https://doi.org/10.1128/AEM.66.5.1866-1870.2000 Gomez-Couso, H., Freire-Santos, F., Martinez-Urtaza, J., Garcia-Martin, O., & Ares-Mazas, M. E. (2003). Contamination of bivalve molluscs by Cryptosporidium oocysts: the need for new quality control standards. International Journal of Food Microbiology, 87(1–2), 97– 105. https://doi.org/10.1016/S0168-1605(03)00057-6 Gomez-Couso, H., Mendez-Hermida, F., Castro-Hermida, J. A., & Ares-Mazas, E. (2005). Occurrence of Giardia cysts in mussels (Mytilus galloprovincialis) destined for human consumption. Journal of Food Protection, 68(8), 1702–1705. Government of Canada, & Canadian National Enteric Pathogen Surveillance System (FoodNet Canada). (2015). Foodnet Canada Biennial Report 2011–2012. Guelph, ON: Public Health Agency of Canada. Goyette, S., Cao, Z., Libman, M., Ndao, M., & Ward, B. J. (2014). Seroprevalence of parasitic zoonoses and their relationship with social factors among the Canadian Inuit in Arctic regions. Diagnostic Microbiology and Infectious Disease, 78(4), 404–10. https://doi.org/10.1016/j.diagmicrobio.2013.08.026 Graczyk, T. K., Conn, D. B., Lucy, F., Minchin, D., Tamang, L., Moura, L. N. S., & DaSilva, A. J. (2004). Human waterborne parasites in zebra mussels (Dreissena polymorpha) from the Shannon River drainage area, Ireland. Parasitology Research, 93(5), 385–391. https://doi.org/10.1007/s00436-004-1142-4 Graczyk, T. K., Conn, D. B., Marcogliese, D. J., Graczyk, H., & de Lafontaine, Y. (2003). Accumulation of human waterborne parasites by zebra mussels (Dreissena polymorpha) and Asian freshwater clams (Corbicula fluminea). Parasitology Research, 89(2), 107–112. https://doi.org/10.1007/s00436-002-0729-x Graczyk, T. K., Cranfield, M. R., & Conn, D. B. (1997). In vitro phagocytosis of Giardia duodenalis cysts by hemocytes of the Asian freshwater clam Corbicula fluminea. Parasitology Research, 83(8), 743–745. https://doi.org/10.1007/s004360050333 Graczyk, T. K., Farley, C. A., Fayer, R., Lewis, E. J., & Trout, J. M. (1998). Detection of Cryptosporidium oocysts and Giardia cysts in the tissues of eastern oysters (Crassostrea virginica) carrying principal oyster infectious diseases. Journal Of Parasitology, 84(5), 1039–1042. https://doi.org/10.2307/3284641 Graczyk, T. K., Thompson, R. C. A., Fayer, R., Adams, P., Morgan, U. M., & Lewis, E. J. (1999). Giardia duodenalis cysts of Genotype A recovered from clams in the Chesapeake Bay subestuary, Rhode River. American Journal Of Tropical Medicine And Hygiene, 61(4), 526–529. Harper, S. L., Edge, V. L., Ford, J., Thomas, M. K., & McEwen, S. A. (2015a). Lived experience 56

of acute gastrointestinal illness in Rigolet, Nunatsiavut: “just suffer through it”. Social Science & Medicine, 126, 86–98. https://doi.org/10.1016/j.socscimed.2014.12.011 Harper, S. L., Edge, V. L., Ford, J., Thomas, M. K., Pearl, D. L., Shirley, J., & McEwen, S. a. (2015b). Acute gastrointestinal illness in two Inuit communities: burden of illness in Rigolet and Iqaluit, Canada. Epidemiology and Infection, 143(14), 1–16. https://doi.org/10.1017/S0950268814003744 Harrison, H. L., & Loring, P. A. (2016). Urban harvests: food security and local fish and shellfish in Southcentral Alaska. Agriculture & Food Security, 5(1), 16. https://doi.org/10.1186/s40066-016-0065-5 Himsworth, C. G., Skinner, S., Chaban, B., Jenkins, E., Wagner, B. A., Harms, N. J., … Hill, J. E. (2010). Short report: Multiple zoonotic pathogens identified in canine feces collected from a remote Canadian indigenous community. American Journal of Tropical Medicine and Hygiene, 83(2), 338–341. https://doi.org/10.4269/ajtmh.2010.10-0137 Hopkins, R. M., Meloni, B. P., Groth, D. M., Wetherall, J. D., Reynoldson, J. A., & Thompson, R. C. (1997). Ribosomal RNA sequencing reveals differences between the genotypes of Giardia isolates recovered from humans and dogs living in the same locality. The Journal of Parasitology, 83(1), 44–51. https://doi.org/10.2307/3284315 iNtRON Biotechnology Inc. (2008). RedSafe: Nucleic Acid Staining Solution. Retrieved January 16, 2018, from https://www.froggabio.com/media/import/intronbio/redsafe1description.pdf iNtRON Biotechnology Inc. (2014). RedSafeTM Nucleic Acid Staining Solution. Retrieved January 16, 2018, from https://www.froggabio.com/media/import/intronbio/redsafe1MSDS.pdf Inuit Heritage Trust Inc. (2009a). 25N - Tasiujarjuaq. Retrieved August 10, 2016, from http://ihti.ca/eng/place-names/NU25N_Tasiujarjuaq_Sept22.pdf Inuit Heritage Trust Inc. (2009b). 25O - Qairuliktuut. Retrieved August 10, 2016, from http://ihti.ca/eng/place-names/NU25O_Qairuliktuut_Dec8_2011.pdf Iqbal, A., Goldfarb, D. M., Slinger, R., & Dixon, B. R. (2015). Prevalence and molecular characterization of Cryptosporidium, spp. and Giardia duodenalis in diarrhoeic patients in the Qikiqtani Region, Nunavut, Canada. International Journal of Circumpolar Health, 74(1). https://doi.org/10.1016/B978-0-12-415846-7.00019-6 Jenkins, E. J., Castrodale, L. J., de Rosemond, S. J. C., Dixon, B. R., Elmore, S. A., Gesy, K. M., Thompson, R. C. A. (2013). Tradition and transition: parasitic zoonoses of people and animals in Alaska, Northern Canada, and Greenland. In Advances in Parasitology (Vol. 82, pp. 33–204). https://doi.org/10.1016/B978-0-12-407706-5.00002-2 Krumhansl, K. A., Krkosek, W. H., Greenwood, M., Ragush, C., Schmidt, J., Grant, J., … Jamieson, R. C. (2015). Assessment of arctic community wastewater impacts on marine benthic invertebrates. Environmental Science and Technology, 49(2), 760–766. https://doi.org/10.1021/es503330n

Kuhnlein, H. V, & Receveur, O. (2007). Local cultural animal food contributes high levels of nutrients for Arctic Canadian Indigenous adults and children. The Journal of Nutrition, 137(4), 1110–1114. https://doi.org/137/4/1110 [pii] Lalle, M., Pozio, E., Capelli, G., Bruschi, F., Crotti, D., & Cacci, S. M. (2005). Genetic heterogeneity at the b-giardin locus among human and animal isolates of Giardia duodenalis and identification of potentially zoonotic subgenotypes. International Journal for Parasitology, 35(2), 207–213. https://doi.org/10.1016/j.ijpara.2004.10.022 Lambden, J., Receveur, O., & Kuhnlein, H. V. (2007). Traditional food attributes must be included in studies of food security in the Canadian Arctic. International Journal of Circumpolar Health, 66(4), 308–319. https://doi.org/10.3402/ijch.v66i4.18272 Levesque, B., Barthe, C., Dixon, B. R., Parrington, L. J., Martin, D., Doidge, B., … Murphy, D. (2010). Microbiological quality of blue mussels (Mytilus edulis) in Nunavik, Quebec: a pilot study. Canadian Journal of Microbiology, 56(11), 968–977. https://doi.org/10.1139/w10- 078 Lucy, F. E., Graczyk, T. K., Tamang, L., Miraflor, A., & Minchin, D. (2008). Biomonitoring of surface and coastal water for Cryptosporidium, Giardia, and human-virulent microsporidia using molluscan shellfish. Parasitology Research, 103(6), 1369–1375. https://doi.org/10.1007/s00436-008-1143-9 Manore, A. J., Harper, S. L., Aguilar, B., Sargeant, J. M., Weese, J. S., & Shapiro, K. (2018). Optimization of nucleic acid extraction and detection of Cryptosporidium parvum and Toxoplasma gondii oocysts from environmental matrices. University of Guelph. Mead, E., Gittelsohn, J., Kratzmann, M., Roache, C., & Sharma, S. (2010). Impact of the changing food environment on dietary practices of an Inuit population in Arctic Canada. Journal of Human Nutrition and Dietetics, 23(Suppl. 1), 18–26. https://doi.org/10.1111/j.1365-277X.2010.01102.x Messier, V., Lévesque, B., Proulx, J.-F., Rochette, L., Libman, M. D., Ward, B. J., … Dixon, B. (2009). Seroprevalence of Toxoplasma gondii among Nunavik Inuit (Canada). Zoonoses and Public Health, 56(4), 188–97. https://doi.org/10.1111/j.1863-2378.2008.01177.x Miller, W. A., Atwill, E. R., Gardner, I. A., Miller, M. A., Fritz, H. M., Hedrick, R. P., … Conrad, P. A. (2005). Clams (Corbicula fluminea) as bioindicators of fecal contamination with Cryptosporidium and Giardia spp. in freshwater ecosystems in California. International Journal for Parasitology, 35(6), 673–684. https://doi.org/10.1016/j.ijpara.2005.01.002 Miller, W. A., Gardner, I. A., Atwill, E. R., Leutenegger, C. M., Miller, M. A., Hedrick, R. P., … Conrad, P. A. (2006). Evaluation of methods for improved detection of Cryptosporidium spp. in mussels (Mytilus californianus). Journal of Microbiological Methods, 65(3), 367– 379. https://doi.org/10.1016/j.mimet.2005.08.011 Murphy, K. (2003a, June 13). Qikiqtarjuaq shellfish business clamming up. Nunatsiaq News. Retrieved from

http://www.nunatsiaqonline.ca/archives/30613/news/features/30613_01.html Murphy, K. (2003b, July 4). Qikiqtarjuaq clam fishery almost back in business - Testing scheme means DFO licence just around the corner. Nunatsiaq News OnlineOnline. Retrieved from http://www.nunatsiaqonline.ca/stories/article/qikiqtarjuaq_clam_fishery_almost_back_in_b usiness/ Ortega, Y. R., & Adam, R. D. (1997). Giardia: Overview and Update. Clinical Infectious Diseases, 25(3), 545–550. https://doi.org/doi: 10.1086/513745 Palos Ladeiro, M., Aubert, D., Villena, I., Geffard, A., & Bigot, A. (2014). Bioaccumulation of human waterborne protozoa by zebra mussel (Dreissena polymorpha): Interest for water biomonitoring. Water Research, 48(1), 148–155. https://doi.org/10.1016/j.watres.2013.09.017 Pardhan-Ali, A., Berke, O., Wilson, J., Edge, V. L., Furgal, C., Reid-Smith, R., … McEwen, S. A. (2012a). A spatial and temporal analysis of notifiable gastrointestinal illness in the Northwest Territories, Canada, 1991-2008. International Journal of Health Geographics, 11(1), 17. https://doi.org/10.1186/1476-072X-11-17 Pardhan-Ali, A., Wilson, J., Edge, V. L., Furgal, C., Reid-Smith, R., Santos, M., & McEwen, S. A. (2012b). A descriptive analysis of notifiable gastrointestinal illness in the Northwest Territories, Canada, 1991-2008. BMJ Open, 2(4), e000732. https://doi.org/10.1136/ bmjopen-2011-000732 Pardhan-Ali, A., Wilson, J., Edge, V. L., Furgal, C., Reid-Smith, R., Santos, M., & McEwen, S. A. (2013). Community-level risk factors for notifiable gastrointestinal illness in the Northwest Territories, Canada, 1991-2008. BMC Public Health, 13(1), 63. https://doi.org/10.1186/1471-2458-13-63 Priest, H., & Usher, P. J. (2004). The Nunavut Wildlife Harvest Study - Final Report. Iqaluit, Nunavut. Retrieved from https://www.nwmb.com/en/resources/publications Pufall, E. L., Jones, A. Q., McEwen, S. A., Lyall, C., Peregrine, A. S., & Edge, V. L. (2011). Perception of the importance of traditional country foods to the physical, mental, and spiritual health of Labrador Inuit. Arctic, 64(2), 242–250. Read, C. M., Monis, P. T., & Thompson, R. C. A. (2004). Discrimination of all genotypes of Giardia duodenalis at the glutamate dehydrogenase locus using PCR-RFLP. Infection, Genetics and Evolution, 4, 125–130. https://doi.org/10.1016/j.meegid.2004.02.001 Rendtorff, R. C. (1954). The experimental transmission of human intestinal protozoan parasites II. Giardia lamblia cysts given in capsules. American Journal of Hygiene, 59(2), 209–220. Rideout, D. (2001, March 16). Qikiqtarjuak looks to cash in on clams. Nunatsiaq News Online. Retrieved from http://www.nunatsiaqonline.ca/archives/nunavut010331/nvt10316_05.html Robertson, L. J. (2007). The potential for marine bivalve shellfish to act as transmission vehicles for outbreaks of protozoan infections in humans: A review. International Journal of Food Microbiology, 120(3), 201–216. https://doi.org/10.1016/j.ijfoodmicro.2007.07.058

Rosol, R., Huet, C., Wood, M., Lennie, C., Osborne, G., & Egeland, G. M. (2012). Prevalence of affirmative responses to questions of food insecurity: International Polar Year Inuit Health Survey, 2007–2008. International Journal of Circumpolar Health, 70(5), 488–497. https://doi.org/10.3402/ijch.v70i5.17862 Rosol, R., Powell-Hellyer, S., & Chan, H. M. (2016). Impacts of decline harvest of country food on nutrient intake among Inuit in Arctic Canada: impact of climate change and possible adaptation plan. International Journal of Circumpolar Health, 75(1). Salb, A. L., Barkema, H. W., Elkin, B. T., Thompson, R. C. A., Whiteside, D. P., Black, S. R., Kutz, S. J. (2008). Dogs as sources and sentinels of parasites in humans and wildlife, Northern Canada. Emerging Infectious Diseases, 14(1), 60–63. https://doi.org/10.3201/eid1401.071113 Samuelson, G. M. (1999). Water and Waste Management Issues in the Canadian Arctic: Iqaluit, Baffin Island. Canadian Water Resources Journal, 23(4), 327–338. https://doi.org/10.4296/cwrj2304327 Sauvé, G. (2010). Official control monitoring programmes for live bivalve molluscs – legislative and regulatory approaches : Canada. In G. Rees, K. Pond, D. Kay, J. Bartram, & J. Santo Domingo (Eds.), Safe Management of Shellfish and Harvest Waters (pp. 217–231). London: IWA Publishing. Retrieved from http://www.who.int/water_sanitation_health/emerging/official_control_canada.pdf Schurer, J. M., Hill, J. E., Fernando, C., & Jenkins, E. J. (2012). Sentinel surveillance for zoonotic parasites in companion animals in indigenous communities of Saskatchewan. American Journal of Tropical Medicine and Hygiene, 87(3), 495–498. https://doi.org/10.4269/ajtmh.2012.12-0273 Searles, E. N. (2016). To sell or not to sell: Country food markets and Inuit identity in Nunavut. Food and Foodways, 24(3–4), 194–212. https://doi.org/10.1080/07409710.2016.1210899 Shapiro, K., Vanwormer, E., Aguilar, B., & Conrad, P. A. (2015). Surveillance for Toxoplasma gondii in California mussels (Mytilus californianus) reveals transmission of atypical genotypes from land to sea. Environmental Microbiology, 17(11), 4177–4188. https://doi.org/10.1111/1462-2920.12685 Statistics Canada. (2001). Population and Dwelling Counts, for Canada, Provinces and Territories, and Census Subdivisions (Municipalities), 2001 and 1996 Censuses - 100% Data. Retrieved November 17, 2017, from http://www12.statcan.ca/english/census01/products/standard/popdwell/Table-CSD- P.cfm?PR=62 Statistics Canada. (2012). Iqaluit, Nunavut (Code 6204003) and Cape Dorset, Nunavut (Code 6204007) (table). Census Profile. 2011 Census. Statistics Canada Catalogue No. 98-316- XWE. Ottawa.: Statistics Canada. Retrieved from http://www12.statcan.gc.ca/census- recensement/2011/dp-pd/prof/index.cfm?Lang=E Stelma, G. N., & McCabe, L. J. (1992). Nonpoint pollution from animal sources and shellfish

sanitation. Journal of Food Protection, 55(8), 649–656. The Municipal Corporation of the City of Iqaluit. (2014). Iqaluit Sustainable Community Plan. Iqaluit, Nunavut. Retrieved from https://www.city.iqaluit.nu.ca/sites/default/files/iqaluit_sustainable_community_plan.pdf University of Arizona Cryptosporidium Production Laboratory. (n.d.). University of Arizona Cryptosporidium Production Laboratory. Tucson, AZ, USA. Retrieved from https://acbs.cals.arizona.edu/crypto Willis, J. E., McClure, J. T., Davidson, J., McClure, C., & Greenwood, S. J. (2013). Global occurrence of Cryptosporidium and Giardia in shellfish: Should Canada take a closer look? Food Research International, 52(1), 119–135. https://doi.org/10.1016/j.foodres.2013.02.020 Xiao, L., Alderisio, K., Limor, J., Royer, M., & Lal, A. A. (2000). Identification of species and sources of Cryptosporidium oocysts in storm waters with a small-subunit rRNA-based diagnostic and genotyping tool. Applied and Environmental Microbiology, 66(12), 5492– 5498. https://doi.org/10.1128/AEM.66.12.5492-5498.2000

CHAPTER FOUR:

SUMMARY OF RESEARCH, RECOMMENDATIONS, AND CONCLUSIONS

Research has documented a high incidence of enteric illness (e.g. vomiting and diarrhea) among residents in Inuit Nunangat, the Inuit homeland in Canada.1 Risk factors associated with enteric illness in Inuit Nunangat may differ from factors associated with enteric illness in other regions of Canada,1 and may include, for example, the consumption of country foods.1–5

Furthermore, high prevalences of two enteric illness pathogens, Cryptosporidium and Giardia, were found in the stools of enteric illness patients in the Qikiqtaaluk region of Nunavut, Canada, and a foodborne source of infection was speculated; however, the source of these parasitic infections was unknown.6 Indeed, research examining enteric illness transmission routes in the

North is extremely limited, and the role that country foods may or may not play in enteric illness is largely unknown and under-researched.

Locally harvested clams (Mya truncata) are a commonly consumed country food in many communities in Inuit Nunangat,7 and can be eaten boiled, steamed, fried, or raw.8 Clam harvesting is often a social activity, with large family or friend groups gathering clams together.

For instance, in Iqaluit, which has a population of 7,740 people,9 there was a reported mean annual clam harvest of over 6,000 clams, demonstrating the important role that clam harvesting plays in culture continuity and food security.7

Clams, as they filter water to feed, can accumulate pathogens or contaminants from surrounding waters.10–12 While the consumption of clams has been studied as a risk factor for enteric illness elsewhere,10–15 less is known about the potential for clams to be contaminated with protozoan pathogens, and thus be a risk factor for enteric illness, in Inuit Nunangat. To explore the role that clams may or may not play in enteric illness in Inuit Nunangat, we used a case study

in Iqaluit, Nunavut in this thesis research, which involved three interconnected studies: a review of the literature on biological, sociocultural, and health dimensions of shellfish research in Arctic

North America (Chapter One); the optimization of methods for DNA extraction and PCR for the detection of protozoan parasites in water and shellfish tissues (Chapter Two); and the investigation of locally harvested clams in Iqaluit, Nunavut as a potential source of

Cryptosporidium and Giardia (Chapter Three).

Summary of the Thesis Research Approach and Results

The three interconnected studies presented in this thesis followed an EcoHealth

16,17 approach. A team of interdisciplinary university researchers, the Nunavut Research Institute, and Northern organizations worked closely together to identify research questions, secure funding, develop the study methods and design, and interpret and communicate results. Through this iterative and collaborative process, local partners and Northern organizations considered various potential country foods of interest, and selected clams as the study foci; additionally, they considered various foodborne bacteria and parasites, and selected Cryptosporidium and

Giardia as pathogens of interest. This collaboration guided the People, Animals, Water, and

Sustenance (PAWS) Project, the larger research program within which this thesis project fit, which investigated clams and other environmental matrices (i.e. surface water and dog feces) as potential sources of Cryptosporidium and Giardia for Iqaluit residents.18

The literature on shellfish in Arctic North America was searched and critically reviewed.

Research on commercially harvested shellfish species, notably crab fisheries in Alaska, was common among the reviewed literature. The search also revealed several studies surveying beaches and shellfish beds for effects of the Exxon Valdez oil spill. Compared to the quantity of studies on commercially harvested shellfish species, there was a relative lack of information on

shellfish harvested for food by local residents, as well as a lack of information on protozoan pathogens in Arctic North America.

My thesis research began to address this lack of information on the presence of protozoan pathogens in shellfish from Arctic Regions of North America, by investigating Cryptosporidium and Giardia in locally-harvested clams in Iqaluit, Nunavut (Chapter Three). Prior to testing the

Iqaluit clams, we first needed to optimize and validate the methods to be used (Chapter Two).

These optimized methods included freeze-thaw (FT) cycles prior to (oo)cyst DNA extraction and nested PCR for (oo)cyst DNA detection. Freeze-thaw (FT) cycles are commonly used to disrupt oocyst walls prior to DNA extraction using commercial kits,11,19–24 but reported FT DNA extraction methodologies vary widely. As such, Chapter Two presented a comparison of molecular approaches for Toxoplasma gondii and C. parvum oocyst detection in water, PBS, and mussel tissues, including DNA extraction and PCR. T. gondii was included in methods optimization due to the high prevalence of seropositivity of this pathogen reported in Inuit

Nunangat,2,3 the consumption of country food identified as a potential risk factor for T. gondii seropositivity in past research,2 and findings of T. gondii oocysts in shellfish in southern locales.10,25 For both T. gondii and C. parvum, increasing numbers of FT cycles did not increase detection of oocyst DNA relative to 1 FT cycle. The limits of detection of C. parvum in water were further evaluated among three assays, and a set of nested PCR primers designed by Xiao et al.26 were the most sensitive among those tested. The results of this study are intended to be useful for future studies that target detection of protozoan pathogens in environmental matrices and allowed us to validate the methods that we then used to test the Iqaluit clam samples

(Chapter Three).

Using the methods validated in Chapter Two, we investigated the protozoan pathogens

Cryptosporidium and Giardia in locally-harvested clams in Iqaluit, Nunavut in Chapter Three. In

September 2016, 404 clams were collected from harvesters in Iqaluit, and hemolymph (n=328) and digestive gland (n=390) were tested for Cryptosporidium and Giardia DNA using PCR and

DNA sequencing. Giardia DNA was detected in two hemolymph samples. DNA sequencing of the two Giardia samples at the gdh locus revealed that the detected DNA was consistent with the zoonotic Giardia enterica assemblage B, which may have originated from human or animal fecal contamination. While the presence of Giardia DNA in clams harvested near Iqaluit indicates fecal contamination of coastal waters, samples did not yield adequate DNA material for multilocus sequence genotyping. Furthermore, a lack of sequence data across the same loci from people and animals in Iqaluit precludes direct genetic comparisons that are required for source attribution. Potential sources of fecal contamination around Iqaluit include the city wastewater treatment plant and backup sewage lagoon,27,28 as well as wildlife29–31 and domestic animals.30,32–34

Thesis Research Strengths and Limitations

There are several strengths and limitations to consider when interpreting the results of this thesis research. The use of EcoHealth methods, and in particular the involvement of

Northern organizations throughout the research process, helped ensure that the information gathered in this study was of interest to and useful for community members and decision-makers in Iqaluit, and that data were collected in a way that was both informative and respectful. The involvement of community research partners further ensured that information about the clam collection was widely distributed in Iqaluit during data collection, that the research team was

successful in contacting harvesters to donate their clams, and that the results were interpreted and communicated appropriately (Figure 4.1, Figure 4.2).

Studies of marine biology or shellfish contamination frequently employ a transect walk strategy to randomly sample shellfish from a given area.35–40 However, a random sample of shellfish around Iqaluit was not the goal of Chapter Three; and clams were collected from local harvesters to sample clams which were representative of those consumed by Iqaluit residents.

However, harvesters generally chose which clams to give to the research team; this generally included clams from the top of the bucket, and potentially clams which were less desirable for consumption. It is also possible that clams harvested from areas closer to Iqaluit were overrepresented in this study, and clams harvested from areas further from Iqaluit were likewise underrepresented, since harvesters working closer to town may have been more likely to encounter the research team. However, clam harvesting areas closer to town may also be more accessible in general for Iqaluit residents and clams from these areas may represent a larger proportion of the total clam harvest. Potential strategies for collecting more clams from areas further from town include meeting harvesters at harvesting areas rather than in town, or pre- arranging with harvesters to exchange clams upon their return. In this study, we collected clams from harvesters over a five-day period in September 2016. While this period occurred over a peak clam harvest weekend, the Iqaluit clam harvest occurs over approximately 12 weeks in late summer and early fall. The clams collected during our study period, therefore, represent a single period in time; as such, any temporal and/or seasonal effects on the prevalence of

Cryptosporidium and Giardia in clams were not tested. Collecting clams at multiple peak harvesting times – periods of extreme tides – over the season might allow for the testing of temporal or seasonal changes in the prevalence of these pathogens. Nevertheless, the finding of

Giardia in the harvested clams identified pathogen contamination as an area of potential future study for shellfish in Inuit Nunangat.

While the results of Chapter Three could inform public health practice and messaging surrounding clam harvesting, the extent and nature of the human health risk from

Cryptosporidium and Giardia in clams harvested near Iqaluit remains unclear. While the DNA extraction and PCR protocols used to test the clams were validated in Chapter Two, these methods do not discriminate parasite viability. Viability assays (such as reverse transcriptase

(RT) qPCR assays) would have provided information on whether the detected DNA was obtained from parasites that are infectious and able to cause illness in people who consume shellfish, or whether the parasites were non-viable, and thus do not pose a risk to clam harvesters.41,42 Due to logistical challenges in this project, clam tissues had to be frozen before

PCR analysis, reducing or eliminating the viability of any (oo)cysts present.

Additionally, laboratory factors including imperfect clam dissection during digestive gland sampling, limits of PCR detection, and lack of sufficient DNA concentration for sequence confirmation may have affected the detection of Cryptosporidium or Giardia. This may have resulted in an underestimation of the true prevalence of these protozoan pathogens in Iqaluit clams. Furthermore, while the presence of Giardia DNA indicates fecal contamination of coastal waters around Iqaluit, (oo)cysts can persist in the environment for weeks or months,43 and PCR can amplify DNA from (oo)cysts which are degraded and not able to cause infection.

G. enterica assemblage B was identified in clams sampled in this study, as well as in other matrices sampled as part of the PAWS project, and in animals including dogs and wildlife in other studies.6,30 However, it is not possible to directly compare DNA sequences from the

Giardia found in the Iqaluit clams to Giardia found in other matrices sampled as part of the

PAWS project because differences in PCR assays targeting different genes were used to test water, dog feces and clams. Additional loci were attempted for amplification of Giardia DNA in clams in an attempt to yield sequence data that was available for Giardia detected in dog feces, however these assays failed to produce any visible amplification products on gel electrophoresis.

Considerations

When interpreting and applying the findings presented in Chapter Three in a public health context, the following should be considered:

• The clams tested in the present study represent a small fraction and non-random

sample of the yearly clam harvest in Iqaluit. The present study tested 390 clams for

Cryptosporidium and Giardia, out of an estimated yearly clam harvest of over 6,000

clams.7

• Higher resolution molecular data are needed to compare the Giardia from the clams to

Giardia found in other environmental matrices tested in the PAWS project.

Specifically, amplification and sequencing of the 18S rRNA gene and other

polymorphic loci would allow for direct comparison between the Giardia found in

clams and the Giardia found in human isolates or dog feces in Iqaluit. While the

assemblages of Giardia can be compared between the clams and other matrices tested

under the PAWS project, source attribution could not be determined with the results

presented in this thesis.

• The viability or infectivity of the detected Giardia is unknown, as the PCR methods

used only detect the presence of Giardia DNA, regardless of the cyst viability status.

Further studies using methods that provide information on protozoan parasite viability

would provide insight on whether parasites detected in shellfish can cause illness in

people.

Results Sharing Activities

The presence of Giardia DNA in clams harvested in Nunavut reported in Chapter

Three is of interest for public health practitioners and decision makers, as well as Iqaluit residents who harvest local clams, and for communities in Inuit Nunangat who may be interested in developing a commercial shellfish harvest. As such, results of this work were shared with

Northern partners in Iqaluit in November 2017. A meeting was held at the Nunavut Research

Institute in Iqaluit and included brief presentations for each component of the PAWS project, with breakout sessions to discuss the interpretations and implications of the research findings and discussions on how to most effectively share research results with the larger Iqaluit community.

Infographic-style handouts were provided to meeting attendees in English, French, and Inuktitut

(Figure 4.3, Figure 4.4, Appendix B). Attendees of the results sharing meeting in November

2017 included representatives of territorial and federal government departments and agencies, and representatives from non-governmental organizations. At this meeting, attendees indicated interest in continued contact with the PAWS research team, and we are currently assembling a communication plan for sharing the results of the PAWS project with the broader Iqaluit community.

Recommendations

Based on the results of the three studies presented in this thesis, the following section outlines recommendations for researchers and policy-makers regarding the optimization of DNA extraction and PCR methodologies for the detection of protozoan oocyst DNA in environmental

matrices (Chapter Two), and the detection of Giardia DNA in locally-harvested clams in Iqaluit,

Nunavut (Chapter Three).

Recommendations for Researchers

Test more clams, and over a longer time period: The research presented in this thesis involved testing 390 clams, which represent a small fraction of the estimated 6000 clams harvested in Iqaluit in a given season.7 If the 0.6% of hemolymph samples which were confirmed positive for Giardia DNA is an accurate estimate of Giardia DNA prevalence in clams harvested near Iqaluit, approximately 36 clams in a 6000-clam harvest may contain Giardia DNA. A larger sample size in future studies would increase precision of estimates of pathogen prevalence, and allow for comparisons between harvesting areas. A random sample of clams from popular harvesting areas would allow a more accurate estimate of the true prevalence of pathogens in clams near Iqaluit. Furthermore, the clams tested here were collected over a 5-day period, while the Iqaluit clam harvest occurs over approximately 12 weeks. Testing over a longer time period would allow assessment of temporal and seasonal effects on the presence or absence of pathogens, including potential changes in pathogen prevalence throughout the harvesting season, and the potential effects of weather conditions and high impact weather events.

Test pathogens in clams for viability and infectivity: The detection of Giardia DNA in clams in this thesis research indicated fecal contamination of the waters from which the clams were harvested but cannot confirm that consumption of clams poses a risk for giardiasis infection in Iqaluit residents. While the PCR assays employed here were chosen for Cryptosporidium and

Giardia detection based on prior investigations that successfully detected protozoan DNA in shellfish,11,44,45 these assays only detect the presence of protozoan DNA; they do not provide information on the viability or infectivity of any detected pathogens.15 Additional investigations

targeting protozoa presence in shellfish in this region, especially using methods capable of discriminating viability and infectivity of detected parasites, will further clarify the human health risks from Cryptosporidium and Giardia in clams harvested near Iqaluit. In this investigation, logistical constraints required freezing samples in Nunavut prior to nucleic acid extraction at the

University of Guelph, a process which diminishes or eliminates parasite viability. In addition, the protozoan DNA screening assays performed were determined to be more sensitive for parasite detection as compared with viability assays such as real-time reverse transcriptase PCR (RT- qPCR) or propidium monoazide (PMA)-PCR.

Prioritize community-based approaches: The work presented in this thesis research was developed using EcoHealth approaches and in close collaboration with Northern

Organizations; in particular the Nunavut Research Institute.16 The success of future studies will likewise depend on the development of close relationships with local research partners. For instance, without community engagement, the research team may not have identified clams as a country food of interest; we would not have been successful in obtaining clams from harvesters, or in collecting clams from as many locations as we did, and we would not have been able to interpret our results accurately without the insights gained at the results sharing meetings in

November 2017. Furthermore, and more specifically, close collaboration with the Nunavut

Research Institute, including project conception and planning, advice and guidance on research licensing, and the use of laboratory facilities, equipment, and meeting spaces was essential for this project.

Recommendations for Policymakers

Consider developing and supporting shellfish testing capacity in Nunavut: Locally- harvested shellfish are a commonly consumed food in Iqaluit, and across Nunavut.7 Clams were

investigated in this thesis due to community interest in the potential presence of protozoan pathogens in this popular and accessible country food. The Canadian Shellfish Sanitation

Program (CSSP) does not operate on a regular basis in Nunavut, and thus little information is available for residents on risk of pathogens in shellfish. Currently, there are no CSSP-approved laboratories in Nunavut, which has proven a challenge to communities hoping to establish commercial clam fisheries.46,47 While the Government of Nunavut Department of Health, in conjunction with Health Canada and Hunters’ and Trappers’ Associations, has published guidelines on general shellfish harvesting safety tips,48 the results of regular shellfish testing could supplement these guidelines, and further inform clam harvesters in regards to harvesting decisions. Given that Giardia DNA was found in clams harvested near Iqaluit, governments should consider monitoring for protozoan pathogens in addition to fecal indicators, toxins, or viral and bacterial pathogens.

Continue to work closely with local organizations and residents: Local harvesters and

Hunters’ and Trappers’ Associations are critical partners for understanding shellfish harvesting in a given community, establishing interest in research questions or topics, and developing culturally-appropriate methods of sampling harvested country foods. Engagement with community research partners was essential for the success of this thesis research and the accurate interpretation and effective communication of the results. Furthermore, many of the harvesters who gave clams for this study expressed interest in hearing about the results of the study.

Governments should therefore continue to engage community partners and residents at all stages of policy development, which is essential to ensure policies and interventions are locally relevant and culturally appropriate.49,50

Conclusions

In conclusion, this thesis reviewed the published scientific literature on shellfish in Arctic

North America, identifying a gap in the area of protozoan pathogen contamination of bivalve shellfish. This thesis added to this area of the literature by investigating locally-harvested clams as a potential source of Cryptosporidium and Giardia in Inuit Nunangat, finding Giardia DNA in two clams. The methods used for detecting protozoan pathogen DNA in environmental matrices were optimized to achieve the lowest limit of detection. Although the Giardia DNA found in clams harvested near Iqaluit, Nunavut was consistent with the zoonotic assemblage B, the health risk to those consuming these clams remains unclear. This work could not have been done without the contributions of community partners in Iqaluit, and serves as an example of how community needs, interests, and contributions can drive research and generate knowledge that is beneficial to all communities.

Figures

Figure 4.1: Posters distributed around Iqaluit prior to clam collection from harvesters. This sheet was also available in Inuktitut (Appendix B).

Figure 4.2: Clam (with attached anemone) prior to sample processing at the Nunavut Research Institute, Iqaluit, Nunavut, September 2016.

Figure 4.4: Agenda (front and back pages) from November 2017 results sharing meeting in Iqaluit, Nunavut.

References

1. Harper SL, Edge VL, Ford J, et al. Acute gastrointestinal illness in two Inuit communities: burden of illness in Rigolet and Iqaluit, Canada. Epidemiol Infect. 2015;143(14):1-16. 2. Goyette S, Cao Z, Libman M, Ndao M, Ward BJ. Seroprevalence of parasitic zoonoses and their relationship with social factors among the Canadian Inuit in Arctic regions. Diagn Microbiol Infect Dis. 2014;78(4):404-410. 3. Messier V, Lévesque B, Proulx J-F, et al. Seroprevalence of Toxoplasma gondii among Nunavik Inuit (Canada). Zoonoses Public Health. 2009;56(4):188-197. 4. Pardhan-Ali A, Berke O, Wilson J, et al. A spatial and temporal analysis of notifiable gastrointestinal illness in the Northwest Territories, Canada, 1991-2008. Int J Health Geogr. 2012;11(1):17. 5. Pardhan-Ali A, Wilson J, Edge VL, et al. A descriptive analysis of notifiable gastrointestinal illness in the Northwest Territories, Canada, 1991-2008. BMJ Open. 2012;2(4):e000732. 6. Iqbal A, Goldfarb DM, Slinger R, Dixon BR. Prevalence and molecular characterization of Cryptosporidium, spp. and Giardia duodenalis in diarrhoeic patients in the Qikiqtani Region, Nunavut, Canada. Int J Circumpolar Health. 2015;74(1). 7. Priest H, Usher PJ. The Nunavut Wildlife Harvest Study - Final Report. Iqaluit, Nunavut; 2004. 8. Caughey A, Killulark J, Webb L, et al. Inuit Traditional Foods. Nutrition Fact Sheet Series. 9. Statistics Canada. Census Profile, 2016 Census - Iqaluit, City [Census Subdivision], Nunavut and Nunavut [Territory]. Ottawa, Canada; 2017. 10. Shapiro K, Vanwormer E, Aguilar B, Conrad PA. Surveillance for Toxoplasma gondii in California mussels (Mytilus californianus) reveals transmission of atypical genotypes from land to sea. Environ Microbiol. 2015;17(11):4177-4188. 11. Miller WA, Atwill ER, Gardner IA, et al. Clams (Corbicula fluminea) as bioindicators of fecal contamination with Cryptosporidium and Giardia spp. in freshwater ecosystems in California. Int J Parasitol. 2005;35(6):673-684. 12. Gomez-Couso H, Freire-Santos F, Martinez-Urtaza J, Garcia-Martin O, Ares-Mazas ME. Contamination of bivalve molluscs by Cryptosporidium oocysts: the need for new quality control standards. Int J Food Microbiol. 2003;87(1-2):97-105. 13. Gomez-Bautista M, Ortega-Mora LM, Tabares E, Lopez-Rodas V, Costas E. Detection of infectious Cryptosporidium parvum oocysts in mussels (Mytilus galloprovincialis) and cockles (Cerastoderma edule). Appl Environ Microbiol. 2000;66(5):1866-1870. 14. Gomez-Couso H, Mendez-Hermida F, Castro-Hermida JA, Ares-Mazas E. Occurrence of Giardia cysts in mussels (Mytilus galloprovincialis) destined for human consumption. J Food Prot. 2005;68(8):1702-1705. 15. Robertson LJ. The potential for marine bivalve shellfish to act as transmission vehicles for outbreaks of protozoan infections in humans: A review. Int J Food Microbiol. 2007;120(3):201-216. 16. Charron DF. Ecohealth Research in Practice: Innovative Applications of an Ecosystem Approach to Health. Vol 53.; 2012. 17. Waltner-Toews D. Food, global environmental change and health: EcoHealth to the rescue? McGill J Med. 2009;12(1):85-89.

18. Harper SL, Cunsolo A. Foodborne, waterborne, and zoonotic disease in the Canadian North. Open Access Government. https://www.openaccessgovernment.org/foodborne- waterborne-zoonotic-disease-canadian-north/29518/. Published October 31, 2016. 19. Miller WA, Miller MA, Gardner IA, et al. New genotypes and factors associated with Cryptosporidium detection in mussels (Mytilus spp.) along the California coast. Int J Parasitol. 2005;35(10):1103-1113. 20. Molini U, Traversa D, Ceschia G, et al. Temporal occurrence of Cryptosporidium in the Manila clam Ruditapes philippinarum in northern Adriatic Italian lagoons. J Food Prot. 2007;70(2):494-499. 21. Giangaspero A, Molini U, Iorio R, Traversa D, Paoletti B, Giansante C. Cryptosporidium parvum oocysts in seawater clams (Chamelea gallina) in Italy. Prev Vet Med. 2005;69(3- 4):203-212. 22. Giangaspero A, Papini R, Marangi M, Koehler A V, Gasser RB. Cryptosporidium parvum genotype IIa and Giardia duodenalis assemblage A in Mytilus galloprovincialis on sale at local food markets. Int J Food Microbiol. 2014;171:62-67. 23. Fayer R, Trout JM, Lewis EJ, et al. Contamination of Atlantic coast commercial shellfish with Cryptosporidium. Parasitol Res. 2003;89(2):141-145. 24. Hohweyer J, Dumetre A, Aubert D, Azas N, Villena I. Tools and methods for detecting and characterizing Giardia, Cryptosporidium, and Toxoplasma parasites in marine mollusks. J Food Prot. 2013;76(9):1649-1657. 25. Krusor C, Smith WA, Tinker MT, Silver M, Conrad PA, Shapiro K. Concentration and retention of Toxoplasma gondii oocysts by marine snails demonstrate a novel mechanism for transmission of terrestrial zoonotic pathogens in coastal ecosystems. Environ Microbiol. 2015;17(11, SI):4527-4537. 26. Xiao L, Alderisio K, Limor J, Royer M, Lal AA. Identification of species and sources of Cryptosporidium oocysts in storm waters with a small-subunit rRNA-based diagnostic and genotyping tool. Appl Environ Microbiol. 2000;66(12):5492-5498. 27. The Municipal Corporation of the City of Iqaluit. Iqaluit Sustainable Community Plan. Iqaluit, Nunavut; 2014. 28. Krumhansl KA, Krkosek WH, Greenwood M, et al. Assessment of Arctic community wastewater impacts on marine benthic invertebrates. Environ Sci Technol. 2015;49(2):760-766. 29. Levesque B, Barthe C, Dixon BR, et al. Microbiological quality of blue mussels (Mytilus edulis) in Nunavik, Quebec: a pilot study. Can J Microbiol. 2010;56(11):968-977. 30. Jenkins EJ, Castrodale LJ, de Rosemond SJC, et al. Tradition and transition: parasitic zoonoses of people and animals in Alaska, northern Canada, and Greenland. In: Advances in Parasitology. Vol 82. Elsevier; 2013:33-204. 31. Dixon BR, Parrington LJ, Parenteau M, Leclair D, Santín M, Fayer R. Giardia duodenalis and Cryptosporidium spp. in the intestinal contents of ringed seals (Phoca hispida) and bearded seals (Erignathus barbatus) in Nunavik, Quebec, Canada. J Parasitol. 2008;94(5):1161-1163. 32. Himsworth CG, Skinner S, Chaban B, et al. Short report: Multiple zoonotic pathogens identified in canine feces collected from a remote Canadian indigenous community. Am J Trop Med Hyg. 2010;83(2):338-341. 33. Salb AL, Barkema HW, Elkin BT, et al. Dogs as sources and sentinels of parasites in humans and wildlife, Northern Canada. Emerg Infect Dis. 2008;14(1):60-63.

34. Schurer JM, Hill JE, Fernando C, Jenkins EJ. Sentinel surveillance for zoonotic parasites in companion animals in indigenous communities of Saskatchewan. Am J Trop Med Hyg. 2012;87(3):495-498. 35. Boehm PD, DS P, Brown JS, Neff JM, Bence AE. Comparison of mussels and semi- permeable membrane devices as intertidal monitors of polycyclic aromatic hydrocarbons at oil spill sites. Mar Pollut Bull. 2005;50(7):740-750. 36. Boehm PD, Mankiewicz PJ, Hartung R, et al. Characterization of mussel beds with residual oil and the risk to foraging wildlife 4 years after the Exxon Valdez oil spill. Environ Toxicol Chem. 1996;15(8):1289-1303. 37. Thomton JD, Tamone SL, Atkinson S. Circulating ecdysteroid concentrations in Alaskan dungeness crab (Cancer magister). J Crustac Biol. 2006;26(2):176-181. 38. Samuelson GM. Polychaetes as indicators of environmental disturbance on subarctic tidal flats, Iqaluit, Baffin Island, Nunavut Territory. Mar Pollut Bull. 2001;42(9):733-741. 39. Aranda CP, Yévenes M, Rodriguez-Benito C, Godoy FA, Ruiz M, Cachicas V. Distribution and growth of Vibrio parahaemolyticus in southern Chilean clams (Venus antiqua) and blue mussels (Mytilus chilensi). Foodborne Pathog Dis. 2015;12(1):1-7. 40. Neff JM, Bence AE, Parker KR, Page DS, Brown JS, Boehm PD. Bioavailability of polycyclic aromatic hydrocarbons from buried shoreline oil residues thirteen years after the Exxon Valdez oil spill: A multispecies assessment. Environ Toxicol Chem. 2006;25(4):947-961. 41. Boarato-David É, Guimarães S, Cacciò S. Giardia duodenalis. Rose JB, Jiménez-Cisneros B, Fayer R, Jakubowski W, eds. Global Water Pathogens Project. 2016. 42. Health Canada. Guidelines for Canadian Drinking Water Quality: Guideline Technical Document - Enteric Viruses - March 2011. 43. Wu J, Long SC, Das D, Dorner SM. Are microbial indicators and pathogens correlated? A statistical analysis of 40 years of research. J Water Health. 2011;9(2):265-278. 44. Manore AJ, Harper SL, Aguilar B, Sargeant JM, Weese JS, Shapiro K. Optimization of nucleic acid extraction and detection of Cryptosporidium parvum and Toxoplasma gondii oocysts from environmental matrices. 2018. 45. Adell AD, Smith WA, Shapiro K, Melli A, Conrad PA. Molecular epidemiology of Cryptosporidium spp. and Giardia spp. in mussels (Mytilus californianus) and California sea lions (Zalophus californianus) from Central California. Appl Environ Microbiol. 2014;80(24):7732-7740. 46. Murphy K. Qikiqtarjuaq clam fishery almost back in business - Testing scheme means DFO licence just around the corner. Nunatsiaq News OnlineOnline. http://www.nunatsiaqonline.ca/stories/article/qikiqtarjuaq_clam_fishery_almost_back_in_ business/. Published July 4, 2003. Accessed January 1, 2018. 47. Murphy K. Qikiqtarjuaq shellfish business clamming up. Nunatsiaq News. http://www.nunatsiaqonline.ca/archives/30613/news/features/30613_01.html. Published June 13, 2003. Accessed February 2, 2018. 48. Government of Nunavut Department of Health. Clam Harvesting Safety Tips. Public Service Announcement. https://www.gov.nu.ca/health/news/clam-harvesting-safety-tips. Published July 20, 2017. Accessed March 14, 2018. 49. Ford JD. Indigenous health and climate change. Am J Public Health. 2012;102(7):1260- 1266.

50. Stephens C, Porter J, Nettleton C, Willis R. Disappearing, displaced, and undervalued: a call to action for Indigenous health worldwide. Lancet. 2006;367(9527):2019-2028.

APPENDICES

Supplementary Information (Chapter Three)

Studies attempting to detect protozoan pathogens from environmental sources differ with respect to the primers and gene targets used to detect oocysts via PCR. One such gene target for detection of Giardia is gdh (Miller et al., 2005; Read et al., 2004).

The limit of detection of Giardia DNA via PCR was assessed using nested PCR primers targeting a region of the gdh gene.(Read et al., 2004) Cysts of G. lamblia (Isolate H3) were obtained from Waterborne Inc. and DNA was extracted from 10,000 cysts suspended in 100µL

PBS. DNA extraction was carried out using 1 freeze-thaw (FT) cycle and the Qiagen DNeasy

Blood & Tissue Kit as previously reported (Adell et al., 2014). Triplicate serial dilutions were prepared from the extracted DNA, at concentrations equivalent to 1, 10, 100, 1,000, and 10,000 cysts. PCR conditions are described in Table S1. PCR amplicons were visualized and compared following gel electrophoresis in 2% agarose gel stained with ethidium bromide (EtBr).

Visualization of DNA amplified by conventional PCR is typically performed using agarose gel electrophoresis. However, the dye traditionally used to visualize DNA in a gel, EtBr, is potentially mutagenic and poses a safety hazard for research personnel (Sigma-Aldrich, 2018).

Alternative gel dyes, such as RedSafe™, have been shown to yield similar sensitivities for visualizing low concentrations of DNA with reduced risk to the health of lab personnel (iNtRON

Biotechnology Inc., 2008, 2014). A systematic comparison for visualizing protozoan parasite

DNA, however, has not been previously published in the literature

RedSafe™ (Froggabio, Toronto, ON, Canada) was compared with EtBr as an alternative stain for the visualization of DNA on agarose gels. Amplified DNA obtained from PCR targeting the gdh gene of G. lamblia was pooled for 10 reactions, and the concentration of the pooled

DNA was measured using a NanoDrop® ND-1000 (Thermo Scientific, Waltham, MA, USA).

Serial dilutions were prepared using PBS to create aliquots containing 500, 50, 5, 0.5, or 0.05ng of DNA which were subsequently loaded onto a 2% agarose gel. Gels were stained with 2.5µL of EtBr or RedSafe™ and run at 100V for 60 minutes prior to imaging with a BioRad Gel Doc™

EZ Imager.

The limit of detection for the nested PCR assay targeting a region of the gdh gene of G. lamblia was 10 cysts (2 of 3 replicates detected) (Table S2, Figure S1). Negative control replicates that were not spiked with cysts tested negative by PCR. Aliquots containing 500 and

50 ng of DNA were clearly visible using both RedSafe™ and EtBr-stained gels. Bands containing 5ng of DNA were faintly visible on both gels, while bands containing 0.5 and 0.05ng of DNA were not visible on either gel (Figure S1).

References

Supplementary Figures and Tables

Figure S1: Visualization of DNA bands on agarose gels stained with 2.5µL EtBr (A) or RedSafe™ (B). DNA amounts are labelled in ng. Each well contains DNA amplicons from PCR targeting the gdh gene of Giardia.

Table S1: PCR master mix components, thermocycler conditions, and primer sequences for nested PCR targeting the 18S locus of Cryptosporidium and the gdh, β-giardin and 18S loci of Giardia are described. All reactions were carried out in a 50µL total volume. (Manore et al., 2018)

Locus Master Mix Thermocycler Primers Reference(s) Parasite Cryptosporidium 18S 1X PCR Buffer (Mg2+), Pre-PCR 3 min at 94°C; 35 External Forward: (Xiao et al., 2000) 200µM of each dNTP, cycles of: denaturation at TTCTAGAGCTAATACATGCG 500nM of each primer, 95°C for 40s, annealing at External Reverse: 0.4µg/µl BSA, 1.5U Taq 58°C (external) or 59°C CCCATTTCCTTCGAAACAGGA polymerase and 5 µL (internal) for 40s, extension Internal Forward: (external) or 2 µL at 72°C for 90s; post-PCR GGAAGGGTTGTATTTATTAGATAAAG (internal) DNA template. 4min at 72°C. Internal Reverse: AAGGAGTAAGGAACAACCTCCA Giardia gdh 1X PCR Buffer (Mg2+), Pre-PCR 3 min at 94°C; 35 External Forward (gdh1): (Read et al., 2004) 200µM of each dNTP, cycles of: denaturation at TTCCGTRTYCAGTACAACTC 500nM of each primer, 95°C for 40s, annealing at External Reverse (ggdh2): 0.4µg/µl BSA, 1.5U Taq 58°C (external) or 59°C ACCTCGTTCTGRGTGGCGCA polymerase and 5 µL (internal) for 40s, extension Internal Forward (gdh3): (external) or 2 µL at 72°C for 90s; post-PCR ATGACYGAGCTYCAGAGGCACGT (internal) DNA template. 4min at 72°C. Internal Reverse (gdh4): GTGGCGCARGGCATGATGCA Giardia -giardin 1X PCR Buffer (Mg2+), Pre-PCR 15 min at 95°C; 35 External Forward (g7): (Caccio et al., 2002; 200µM of each dNTP, cycles of: denaturation at AAGCCCGACGACCTCACCCGCAGTGC Lalle et al., 2005) 200nM of each primer, 95°C for 30s, annealing at External Reverse (g759): 0.4µg/µl BSA, 1.25U Taq 65°C (external) or 55°C GAGGCCGCCCTGGATCTTCGAGACGAC polymerase and 3 µL (internal) for 30s, extension Internal Forward (F-Lalle): (external) or 1 µL at 72°C for 60s; post-PCR GAACGAGATCGAGGTCCG (internal) DNA template. for 7 min at 72°C. Internal Reverse (R-Lalle): CTCGACGAGCTTCGTGTT Giardia 18S 1X PCR Buffer (Mg2+), Pre-PCR 5 min at 96°C; 35 External Forward (Gia2029): (Appelbee et al., 2003; 200µM of each dNTP, cycles of: denaturation at AAGTGTGGTGCAGACGGACTC Hopkins et al., 1997) 125nM of each primer, 95°C for 45s, annealing at External Reverse (Gia2150c): 0.8µg/µl BSA, 2.5U Taq 55°C (external) or 59°C CTGCTGCCGTCCTTGGATGT polymerase, 5% DMSO (internal) for 30s, extension Internal Forward (RH11): and 5 µL (external) or at 72°C for 45s; post-PCR CATCCGGTCGATCCTGCC 2 µL (internal) DNA for 5 min at 72°C. Internal Reverse (RH4): template. AGTCGAACCCTGATTCTCCGCCAGG

Table S2: Limit of detection for primers targeting the gdh gene to detect Giardia DNA. Amplicon products were stained with either EtBr or RedSafe with identical results. # Oocysts Detections/Replicates - EtBr Detections/Replicates - RedSafeTM 0 0/1 0/1 1 0/3 0/3 10 2/3 2/3 100 2/3 2/3 1,000 3/3 3/3 10,000 3/3 3/3

Appendix A: Location Criteria and Screening Questions used in Chapter One Location Criteria:

Figure 1: Map of Arctic boundaries according to the Arctic Monitoring and Assessment Program (AMAP) and the Arctic Human Development Report (AHDR). This map was compiled by Winfried K. Dallmann of the Norwegian Polar Institute. “Arctic locales” in this study were those which fell in the United States or Canada and within the Arctic boundary according to AHDR. (http://www.arctic- council.org/images/PDF_attachments/Maps/boundaries.pdf; retrieved April 30th, 2018)

Appendix B: Literature Review Search Criteria Title/Abstract Screening Questions: 1. Does the article discuss shellfish? (yes/no/unsure) 2. Does the article focus on a North American Arctic locale? (yes/no/unsure) Full Text Screening Questions: 1. Is the full text written in English? (yes/no) 2. Is the piece a published primary research study, a systematic review of published research studies, or a post-secondary institutional thesis/dissertation? (yes/no) 3. In this article, were data1 collected on shellfish2? (yes/no) 1 “Data collected” defined as the collection of quantitative or qualitative data from or about shellfish (including systematic reviews on shellfish). 2 “Shellfish” defined as any macroscopic (>5mm), non-fossil mollusc or crustacean with a shell (ex. oyster, clam, shrimp, prawn, mussel, lobster, crab, snail, scallop, crayfish, abalone would be included, but “zooplankton” or “benthic invertebrates” would not, without specific mention of any of the previous species). 4. Does the article focus on a North American Arctic1 locale? (yes/no) 1 “North American Arctic” defined as any area (land or marine) in Canada or the United States which falls within the Arctic boundary as defined by AHDR.

Appendix C: Advertising and Results Sharing Materials from Chapter Three

Figure 1: Inuktitut poster distributed around Iqaluit prior to clam collection from harvesters in September 2016.

Figure 2: CBC News article describing the PAWS project prior to clam collection in Iqaluit. This article was accompanied by television and radio interviews.

Figure 3: Poster distributed prior to the November 2017 PAWS results sharing meetings in Iqaluit.

Figure 4: French handout distributed at the November 2017 PAWS results sharing meeting in Iqaluit.

Figure 5: Inuktitut handout distributed at the November 2017 PAWS results sharing meeting in Iqaluit.

Appendix D: Lab Procedures used in Chapter Three PAWS PROJECT CLAM TESTING SOP

1. Lay out bench cover paper, tape down edges

2. Scrub outside of clam shell with clean scrub brush to remove sand/debris

3. File small notch in clam shell

4. Remove hemolymph using a syringe, place in labelled 1.5 mL tube(s)

5. Centrifuge hemolymph for 4 min at 14 000 rpm

6. Discard supernatant (leaving 100-200µL)

7. Combine pellets from each clam into one tube for freezing (will need to combine pellets and re- spin to remove supernatant such that only 100-200 uL left total for each clam)

8. Open clam using shucking knife

9. Use razor blade to remove digestive gland, place gland in labelled 1.5 mL tube

10. Store tubes containing hemolymph pellets and digestive glands in -20C freezer

11. Remove lab bench cover paper when finished for the day

Equipment Cleaning:

Clean all instruments in soap and water to remove any organic/mineral debris

Scrub Brushes: soak in 10% bleach for 30 minutes (if possible) between batches

Files: soak in 10% bleach for 30 minutes (if possible) between clams

Razor blades: spray with alcohol, wipe off before using on clam

Rinse bleach off of equipment in clean water (DI if available, if not then clean fresh drinking water)

Waste:

Syringes, razor blades, and tips go in yellow biohazard containers after one use

Lab bench cover paper goes in regular garbage after being sprayed liberally with alcohol

Remaining clam tissues to be disposed of in regular garbage

Notes:

• Keep clams live as long as possible, but refrigerate for ≤7 days if necessary.