DOCSLIB.ORG

بررسی فیلوژنتیکی گونه Peronia Peronii )نرمتنان:شکم پایان

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
بررسی فیلوژنتیکی گونه Peronia Peronii )نرمتنان:شکم پایان مجله تازه هاي بیوتکنولوژی سلولي- مولکولي دوره چهارم، شماره پانزدهم، تابستان 1393 بررسی فیلوژنتیکی گونه Peronia peronii )نرمتنان:شکم پایان، sea slug ( در سواحل بین جزر و مدی چابهار بر اساس توالی ژنی SrDNA 18 گیﻻن عطاران فریمان* 1 ، یاسمن موسوی پور2 ، آرش شکوری1 1 هیئت علمی دانشگاه علوم دریایی و دریانوردی چابهار ،گروه زیست شناسی ،دانشکده علوم دریایی ،دانشگاه علوم دریایی و دریانوردری چابهار ، چابهار ، ایران 2کارشناسی ارشد ،گروه زیست شناسی ، دانشکده علوم دریایی ، دانشگاه علوم دریایی و دریانوردری چابهار ، چابهار ، ایران چکیده سابقه و هدف : بررسی های فیلوژنتیکی و شناساسیی مورفولوژی و مولکولی بر روی گونه های هر منطقه میتواند پایه ی مطالعات بعدی را بنیان گزاری کند . مطالعات فیلوژنتیکی زیادی بر اساس ژنوم میتوکندریایی در دیگر نقاط ساحلی دنیا بر روی این گروه از شکم پایان تابحال انجام گرفته ، اما اطﻻعات کمی از ژنوم هسته ای این گروه ثبت شده است. بیشتر مطالعات انجام شده در ایران بر اساس بررسی های ریخت شناسی موجود انجام شده ولی گزارشی از بررسی های مولکولی گونه های ایرانی از سواحل جنوبی ثبت نشده است . در این پژوهش برای اولین بار گونه ای از sea slug های سواحل چابهار مورد بررسی فیلوژنتیکی قرار گرفت . مواد و روش ها : نمونه برداری از سواحل صخره ای تیس در چابهار انجام شد و به آزمابشگاه انتقال داده شدند و پس از بررسی های ریخت شناسی گونه ، نمونه ها در فریزر 80- درجه نگه داری شدند ، استخراج DNA با استفاده از روش CTAB صورت گرفت ، سپس واکنش زنجیره ای پلیمراز و توالی یابی و ترسیم درخت فیلوژنی انجام شدند. یافته ها : توالی نوکلئوتیدهای بدست آمده در منطقه ژنی S rDNA 18مورد آنالیزهای مولکولی قرار گرفتند . با آنالیزهای انجام شده و ترسیم درخت فیلوژنی مشخص شد که گونه ی ایرانی در کﻻد Panpulmonata قرار گرفته است ، گونه ایرانی و دیگر گونه های این کﻻد بیشترین واگرایی را نسبت به گونه های دوکﻻد دیگر دارند . نتایج : آنالیز فیلوژنتیکی MLنشان داد که گونه ی چابهار 100 درصد شبیه با Peronia cf. peronii و در یک گروه خواهری قرار گرفته اند ، بررسی خصوصیات مورفولوژیکی هم این نتایج را تایید کرد . کلمات کلیدی : 18S rDNA ، Peronia peronii ، فیلوژنی ، سواحل چابهار ، شکم پایان مقدمه Pulmonata Cu� نرم تنان یکی از بزرگترین و متنوع ترین گروههای جانوری 1931 انجام گرفت شکم پایان در سه گروه Opisthobranchia Milne Edwards vier هستند و بعد از بندپایان بزرگترین گروه را در میان بی مهرگان 1814 , ، 1848 , - و ProsobranchiaArchive Miln _ Edwards,1848 of SID تقسیم بندی شدند ، به خود اختصاص داده اند . نرم تنان در همه جای زمین در محیط های دریایی از سواحل جزر و مدی تا عمیق ترین قسمت شکم پایان یکی از گروههای تخصص یافته ی متازوآ میباشد و های اقیانوس ،آب های شیرین و در خشکی دیده میشوند .رده مطالعات زیادی روی آنها صورت گرفته است اما مطالعه فیلوژنی Opistho� Euthyneura ی شکم پایان بزرگترین و متنوع ترین گروه از نرم تنان هستند آنها از سال 1988 انجام شد )9( . ) pulmonates branchs ، بر اساس طبقه بندی که توسط Thiele Johannes در سال چندین خصوصیت مشترک با ششداران دارند که هردوی آنها در یک گروه بنام Euthyneura قرار گرفته آدرس نویسنده مسئول : گروه زیست شناسی ،دانشکده علوم دریایی ،دانشگاه علوم دریایی و دریانوردری چابهار ، چابهار ، ایران اند( که شامل بیشترگونه های sea slug ها ، land snail ها ، Email :[email protected] land slug تاریخ دریافت مقاله: 29/2/92 و برخی خانواده های شکم پایان دریازی که صدف تاریخ پذیرش: 20/4/93 دارند میباشند، تاکسون راسی شکم پایان محسوب میشود)9(. www.SID.ir تازه های بیو تکنولوژی سلولی - مولکولی دوره چهارم، شماره پانزدهم، تابستان 1393، بررسی... Pulmonata گروهی از شکم پایان دریازی هستند که با توانایی تعداد 5_4 نمونه این نرم تن زگیل دار از منطقه بین جزر و تنفس در معرض هوا شناخته شده اند ، بجای آبشش یک ریه مدی تیس واقع در غرب چابهار ) شکل شماره 1 ( با موقعیت تنفسی دارند ، این گروه خانواده های زیادی از شکم پایان جغرافیایی º 60 و ´ 37 شرقی و º 25 درجه و ´ 22 شمالی خشکی زی ، آب شیرین و دریازی را به خود اختصاص داده جمع اوری گردید . نمونه ها بصورت دستی گرفته شدند و اند )11(. نظریه ای وجود دارد بر این مبنا که �Opisthobran جهت عملیات آزمایشگاهی به آزمایشگاه بیوتکنولوژی دانشگاه chia پارافایلتیک هستند که شاید بدلیل وجود Pulmonata دریانوردی و علوم دریایی چابهار انتقال داده شدند ، و بﻻفاصله باشد ،البته این نظریه هنوز به اثبات نرسیده است. �Pulmon پاهای شکمی جداسازی شدند و در دمای 80- درجه سانتیگراد ata ممکن است یک گروه منوفایلتیک با Opisthobranchia نگه داری شدند )23(. باشد، از طرفیOpisthobranchia یک گروه منوفایلتیک نیست استخراج DNA ، واکنش زنجیره ای پلیمراز و توالی یابی و نمیتواند بعنوان یک تاکسون معتبر پذیرفته شود.آنها در حال در این پژوهش به منظور استخراج DNA از تکه های کوچک حاضر در زیر رده ی Orthogastropoda قرار گرفته اند )24(. جداشده از پاهای شکمی موجود و توسط بافر CTAB 2% قطعات ژنی مورد استفاده در این پژوهش قطعه ژنی CTAB( ,1.4M NaCl , 0.1% β_mercaptooethanol ,20mM 18S rRNA )18S ribosomal RNA( میباشد . 18S rRNA قسمتی از EDTA and 100mM TRIS-HCl pH8 ( به همراه پروتئیناز ژن RNA ریبوزومی است و جز ساختاری RNA ریبوزوم های mercapthonal β_ , K در یک میکروتیوب با هم ترکیب شدند یوکاریوتی سیتوپﻻسمی است و بهمین ترتیب یکی از اجزای ، پس از انکوباسیون و سانتریفیوژ، کلروفرم _ ایزوآمیل الکل اساسی در تمام سلول های یوکاریوتی بشمار میرود. این قطعه )به نسبت 24:1 ( اضافه شد ، بسته به مقدار رسوب DNA ، ژنی هومولوگ 16S rRNA در پروکاریوت ها و میتوکندری آب دیونیزه اضافه شد و DNA استخراجی برای مطالعات بعدی است. توالی ژنی 18S rRNA بطور گسترده ای در تجزیه و در فریزر20_ نگه داری شد )23( . کیفیت DNA استخراج تحلیل های مولکولی مورد استفاده قرار میگیرد. زیرواحد کوچک شده روی ژل آگارز 1% با دستگاه الکتروفورز و کمیت آن هم SSU( 18S rRNA( از ژنهایی است که اغلب در مطالعات با استفاده از دستگاه اسپکتروفوتومتر مدل RS232C مورد فیلوژنتیکی مورد استفاده قرار میگیرد و همچنین یک مارکر سنجش قرار گرفت . بررسی باند ها ی DNAبا استفاده از مهم در واکنش زنجیره ای پلی مراز( )PCR میباشد)16( .تا دستگاه ژل داک مدلE_BOX_VX2/2M بررسی گردید بحال مطالعات زیادی بر روی توالی های ژنی این گروه از شکم ..در واکنش زنجیره ای پلیمراز بسط و توسعه قسمتی از ژن پایان انجام شده است ، ولی مطالعاتی که بر روی این قطعه ژنی هسته ای 18S rDNA که چیزی با استفاده از آغازگرهای های صورت گرفته است نسبت به قطعه ژنوم میتوکندریایی کمتر Sa)5’_AACCTGGTTGATCCTGCCAGT_3’( 18و 18 است که از ان جمله میتوان Göbbeler و klussmann-kolb در GATCCTTCTGCAGGTTCACCTAC_3_’5( Sb’( بود سال2009 )6(و Shields در سال 20SID( 2009( اشاره کرد. of جنس )15( . هر واکنش زنجیره ای Archiveپلیمراز با استفاده از دستگاه Peronii در اغلب سواحل صخره ای جنوب شرقی ایران پراکنش ترموسایکلر ependorf مدل 5331 انجام شد . در هر واکنش دارد . در این تحقیق گونه ای از این جنس برای اولین بار در 15 نانوگرم DNA استخراج شده در حجمی 50 میکرولیتری ایران مورد آنالیز های مولکولی قرار گرفت و توالی آن با گونه بعنوان نمونه الگو استفاده گردید . در واکنش زنجیره ای پلیمراز Mgcl PCR Buffer x S rRNA های مشابه موجود در بانک ژنی در منطقه ژنی 18 5 میکرولیتر 10 , 6 میکرولیتر 2 مورد مقایسه قرار گرفت . ، 2.5 میکرولیتر dNTP ، و Taq DNA polymerase مورد مواد و روش ها استفاده قرار گرفتند . در سیکل حرارتی داده شده به دستگاه نمونه برداری PCR ، در ابتدا به مدت 4 دقیقه در دمای 95 درجه سانتی پس از بررسی منطقه و تعیین ایستگاهها در بهمن ماه 1390 گراد قرار گرفت و بدنبال آن در یک سیکل 38 تایی که شامل 31 30 www.SID.ir تازه های بیوتکنولوژی سلولی - مولکولی دوره چهارم، شماره پانردهم، گیﻻن عطاران فریمان و همکاران واسرشتگی در دمای 94 درجه سانتی گراد به مدت 1 دقیقه میباشد که صحت کار را باﻻ برده و مقایسه را راحت تر میکند . ، اتصال اغازگرها در دمای 5 .56 درجه سانتی گراد به مدت در حقیقت بکار بردن یک یا دو گونه به عنوان out group در 1 دقیقه ،بسط نهایی در دمای 72 درجه سانتی گراد به مدت ترسیم درخت، rooting را در درخت انجام می دهد . 2 دقیقه ، و در اخر با دمای 72 درجه سانتی گراد به مدت جدول شماره 1: گونه های استفاده شده در مطالعه حاضر و 10 دقیقه سیکل حرارتی پایان داده میشود . پس از اطمینان شماره ثبت آنها در بانک ژنی که در آنالیز مولکولی این پژوهش از صحت محصول PCR و تکثیر باندهای مورد نظر، به کمک استفاده شده است. الکتروفورز روی ژل آگارز 1% ، نمونه ها برای تعیین توالی ژن ها شــماره بانــک نام گونه ژنــی به کشور کانادا ارسال گردید و نتایج بدست امده از تعیین توالی Peronia peronii مطالعه حاضر محصوﻻت با استفاده از بسته های نرم افزاری مورد آنالیزهای Peronia peronii HQ659975 فیلوژنتیکی قرار گرفت Peronia cf. peronii HQ659976 Onchidium cf. tumidum HQ659973 Onchidium verrucosum AY427522 Phyllocaulis tuberculosus HQ659987 Onchidella celtica X70211 Marinula filholi HQ659944 Aplysia parvula DQ237959 Aplysia californica AY039804 Sarasinula linguaeformis HQ659989 Smeagol phillipensis FJ917210 Phyllocaulis variegates HQ659988 Vaginulus taunaisii HQ659990 تصویر شماره 1: منطقه نمونه برداری، منطقه نموبرداری در این مطالعه در Parahedyle cryptophthalma AY427518 شکل مشخص شده است . Stylocheilus longicauda DQ237963 )Acteon tornatilis)out group GQ845183 آنالیزهای فیلوژنتیک در ابتدا کروماتوگرام هاي حاصل از تعیین توالي نمونه ها ، با نتایج با بررسی مورفولوژی گونه مورد نظر مشخص گردید که دارای استفاده از نرم افزار BioEdit )7( ویرایش شده سپس توالي هاي بدنی نرم میباشد در حدود 100 میلیمتر طول متوسط دارد و مورد اشاره با استفاده از نرم افزار ClustalX7.0 )11( هم ردیف به رنگ سبز تیره مایل به قهوهای دیده میشوند، سطح پشتی گردیدند. ماتریس داده هاي هم ردیف سازي شده براي هر دو بدن با زگیل هایی )tubercles ( گرد و درشت سبز_خاکستری قطعه مورد نظر DNA مورد نظر به کمک نرم افزارMEGA 5 ) رنگ پوشیده شده است )شکل 3_الف ( ، گونه از نظر ریخت 14(به صورت جداگانه تجزیه و تحلیل SIDمیگردد .
Load more

Recommended publications
  • Universidade Federal De Juiz De Fora Pós-Graduação Em Ciências Biológicas Mestrado Em Comportamento E Biologia Animal
    UNIVERSIDADE FEDERAL DE JUIZ DE FORA PÓS-GRADUAÇÃO EM CIÊNCIAS BIOLÓGICAS MESTRADO EM COMPORTAMENTO E BIOLOGIA ANIMAL Camilla Aparecida de Oliveira Estratégia de história de vida e recaracterização morfológica Sarasinula linguaeformis (Semper, 1885) (Eupulmonata, Veronicellidae) Juiz de Fora 2019 Camilla Aparecida de Oliveira Estratégia de história de vida e recaracterização morfológica Sarasinula linguaeformis (Semper, 1885) (Eupulmonata, Veronicellidae) Dissertação apresentada ao Programa de Pós-Graduação em Ciências Biológicas, área de concentração: Comportamento e Biologia Animal da Universidade Federal de Juiz de Fora, como requisito parcial para obtenção do título de Mestre. Orientadora: Prof.ª. Drª. Sthefane D’ávila Juiz de Fora 2019 A todos que estiveram ao meu lado me apoiando e incentivando diante das dificuldades da carreira acadêmica, e incentivaram minha formação pessoal, profissional e dando-me suporte emocional. A vocês o meu eterno agradecimento! AGRADECIMENTOS Agradeço primeiramente a Deus por abençoar o meu caminho durante esse trabalho. A fé que tenho em Ti alimentou meu foco, minha força e minha disciplina. Depois aos meus amigos da Ciências Biológicas: Alexssandra Silva, Flávio Macanha, Isabel Macedo, Sue-helen Mondaini, Tayrine Carvalho, Kássia Malta e Yuri Carvalho meu eterno agradecimento, pois fizeram uma contribuição valiosa para a minha jornada acadêmica com seus conselhos, auxílio, palavras de apoio e risadas. Também agradeço a todos aqueles amigos que de forma direta ou indireta estiveram ajudando e torcendo por mim, em especial a Ana Claudia Mazetto, Ana Clara Files, Tamires Lima, Lígia Araújo, Raquel Seixas, Natália Corrêa e Carlota Augusta. Vocês foram fundamentais para minha formação. Agradeço à minha orientadora Sthefane D' ávila, que acompanhou meu percurso ao longo dos últimos anos e ofereceu uma orientação repleta de conhecimento, sabedoria e paciência.
    [Show full text]
  • Biodiversidad De Gasterópodos Terrestres (Mollusca) En El Parque Biológico Sierra De San Javier, Tucumán, Argentina
    Biodiversidad de gasterópodos terrestres (Mollusca) en el Parque Biológico Sierra de San Javier, Tucumán, Argentina María José Miranda & María Gabriela Cuezzo CONICET-Facultad de Ciencias Naturales, Universidad Nacional de Tucumán, Miguel Lillo 251, 4000 Tucumán, Argentina; [email protected], [email protected] Recibido 08-III-2009. Corregido 12-III-2010. Aceptado 08-IV-2010. Abstract: Biodiversity of land gastropods (Mollusca) in Sierra de San Javier Park, Tucumán, Argentina. Studies related to land mollusk diversity in tropical and subtropical forests are scarce. To assess this, a study on land snail diversity of subtropical cloudforest (Yungas) and dry forest (Chaco) areas of Sierra de San Javier Park, Tucumán, Argentina, was carried out. Taxonomic identifications were performed to species level and built a species per stations data matrix to analyze diversity patterns on qualitative and quantitative samples processed from 10x10m quadrates in altitudinal transects. Non parametric analysis (ICE, ACE, Chao 1 and Chao 2) were used to estimate the true diversity of the area, as well as the degree of undersampling and spatial aggregation of the data. Diversity was also calculated using Shannon, Simpson, Whittaker and Jaccard indices. The richness of the San Javier Park was estimated to be 32 species distributed into 13 families and 21 genera. From the total number of species collected, a single one belongs to Caenogastropoda, while the rest of the species are classified into Pulmonata Stylommatophora and Systellommatophora. The most representative family was the micromol- lusc Charopidae, while the most relatively abundant species was another micromollusc snail, Adelopoma tucma. Richness and diversity were slightly more elevated in dry forest areas of the Chacoan Ecoregion than in cloud forest areas of Yungas.
    [Show full text]
  • 24 Relationships Within the Ellobiidae
    Origin atld evoltctiorzai-y radiatiotz of the Mollrisca (ed. J. Taylor) pp. 285-294, Oxford University Press. O The Malacological Sociery of London 1996 R. Clarke. 24 paleozoic .ine sna~ls. RELATIONSHIPS WITHIN THE ELLOBIIDAE ANTONIO M. DE FRIAS MARTINS Departamento de Biologia, Universidade dos Aqores, P-9502 Porzta Delgada, S6o Miguel, Agores, Portugal ssification , MusCum r Curie. INTRODUCTION complex, and an assessment is made of its relevance in :eny and phylogenetic relationships. 'ulmonata: The Ellobiidae are a group of primitive pulmonate gastropods, Although not treated in this paper, conchological features (apertural dentition, inner whorl resorption and protoconch) . in press. predominantly tropical. Mostly halophilic, they live above the 28s rRNA high-tide mark on mangrove regions, salt-marshes and rolled- and radular morphology were studied also and reference to ~t limpets stone shores. One subfamily, the Carychiinae, is terrestrial, them will be made in the Discussion. inhabiting the forest leaf-litter on mountains throughout ago1 from the world. MATERIAL AND METHODS 'finities of The Ellobiidae were elevated to family rank by Lamarck (1809) under the vernacular name "Les AuriculacCes", The anatomy of 35 species representing 19 genera was ~Ctiquedu properly latinized to Auriculidae by Gray (1840). Odhner studied (Table 24.1). )llusques). (1925), in a revision of the systematics of the family, preferred For the most part the animals were immersed directly in sciences, H. and A. Adarns' name Ellobiidae (in Pfeiffer, 1854). which 70% ethanol. Some were relaxed overnight in isotonic MgCl, ochemical has been in general use since that time. and then preserved in 70% ethanol. A reduced number of Grouping of the increasingly growing number of genera in specimens of most species was fixed in Bouin's, serially Gebriider the family was based mostly on conchological characters.
    [Show full text]
  • Proceedings of the Biological Society of Washington 110(4):520-536
    PROCEEDINGS OF THE BIOLOGICAL SOCIETY OF WASHINGTON 110(4):520-536. 1997. Annotated list of Veronicellidae from the collections of the Academy of Natural Sciences of Philadelphia and the National Museum of Natural History, Smithsonian Institution, Washington, D.C., U.S.A. (Mollusca: Gastropoda: Soleolifera) Jose W. Thome, Patricia H. dos Santos, and Luciana Pedott Laboratories de Malacologia, Instituto de Biociencias, PUCRS, Av. Ipiranga, 6681, predio 12; 90619-900 Porto Alegre, RS-Brazil. Abstract.—The list of veronicellid slugs presented in this paper is restricted to species identified by criteria previously proposed by the first author. We were able to distinguish 30 species or subspecies, classified in 12 genera. In- cluded are the following: Belocaulus angustipes; Colosius propinquus; C. pulcher; Diplosolenodes occidentalism D. olivaceus; Heterovaginina peruviana; Laevicaulis alte (with new illustrations); L. natalensis brauni; L. stuhlmanni (with new illustrations); Latipes cnidicaulus; Leidyula dissimilis; L. floridana (with new data and illustration); L. goodfriendi; L. kraussi; L. moreleti; L. portoricensis; L. trichroma; Phyllocaulis gayi; P. soleiformis; Sarasinula du- bia; S. linguaeformis; S. plebeia; Simrothula columbiana; S. prismatica; Va- ginulus taunaisii; Veronicella bahamensis; V. cubensis; V. davisi; V. sloanei; V. tenax. The family Veronicellidae Gray, 1840 groups of characteristics to be analyzed. He comprises terrestrial mollusks without shell, comments on the characteristics tradition- commonly called slugs. The distribution is ally used and is of the opinion that there are pantropical and over 300 specific names not enough to determine conclusively the have been registered, most of them syn- species, and that they do not permit a con- onyms (Hoffmann 1925, Forcart 1953, sistent phylogenetic classification.
    [Show full text]
  • The Role of Phyllocaulis Variegatus (Mollusca: Veronicellidae) in the Transmission of Digenean Parasites
    Revista Mexicana de Biodiversidad ISSN: 1870-3453 [email protected] Universidad Nacional Autónoma de México México Valente, Romina; Diaz, Julia Inés; Salomón, Oscar Daniel; Navone, Graciela Teresa The role of Phyllocaulis variegatus (Mollusca: Veronicellidae)in the transmission of digenean parasites Revista Mexicana de Biodiversidad, vol. 87, núm. 1, marzo, 2016, pp. 255-257 Universidad Nacional Autónoma de México Distrito Federal, México Available in: http://www.redalyc.org/articulo.oa?id=42546734028 How to cite Complete issue Scientific Information System More information about this article Network of Scientific Journals from Latin America, the Caribbean, Spain and Portugal Journal's homepage in redalyc.org Non-profit academic project, developed under the open access initiative Available online at www.sciencedirect.com Revista Mexicana de Biodiversidad Revista Mexicana de Biodiversidad 87 (2016) 255–257 www.ib.unam.mx/revista/ Research note The role of Phyllocaulis variegatus (Mollusca: Veronicellidae) in the transmission of digenean parasites El papel de Phyllocaulis variegatus (Mollusca: Veronicellidae) en la transmisión de parásitos digéneos a,∗ b a b Romina Valente , Julia Inés Diaz , Oscar Daniel Salomón , Graciela Teresa Navone a Instituto Nacional de Medicina Tropical, Ministerio de Salud de la Nación, Jujuy s/n, 3370 Puerto Iguazú, Provincia de Misiones, Argentina b Centro de Estudios Parasitológicos y de Vectores (CCT La Plata-CONICET), Facultad de Ciencias Naturales y Museo, Universidad Nacional de La Plata, calle 120 e/61 y 62, B1900FWA La Plata, Provincia de Buenos Aires, Argentina Received 12 November 2014; accepted 14 September 2015 Available online 26 February 2016 Abstract Ninety-five veronicellid slugs identified as Phyllocaulis variegatus were collected in Puerto Iguazú, Misiones Province, Argentina.
    [Show full text]
  • Angiostrongylus Costaricensis and The
    Revista da Sociedade Brasileira de Medicina Tropical ARTIGO 31(3):289-294, mai-jun, 1998. Angiostrongylus costaricensis and the intermediate hosts: observations on elimination of L3 in the mucus and inoculation of L1 through the tegument of mollucs Angiostrongylus costaricensis e hospedeiros intermediários: observação da eliminação de larvas de 3º estágio (L3) no muco e inoculação de L1 na cavidade tegumentar dos moluscos Vera Cristina Brandão Diniz de Oliveira Bonetti and Carlos Graeff-Teixeira Abstract Human accidental infection with Angiostrongylus costaricensis may result in abdominal disease of varied severity. Slugs from the Veronicellidae family are the main intermediate hosts for this parasitic nematode of rodents. Phyllocaulis variegatus, Phyllocaulis soleiformis and Phyllocaulis boraceiensis were experimentally infected to describe the kinetics of L3 elimination in the mucus secretions of those veronicelid species. A maximum of 2 L3/g/day was found in the mucus, while the number of L3 isolated from the fibromuscular tissues varied from 14 to 448. Productive infection was established by inoculations in the hyponotum or in the body cavity, through the tegument. Intra-cavity injection is a less complex procedure and permits a better control of inocula. A preliminary trial to titrate the infective dosis for P. variegatus indicated that inocula should range between 1000 and 5000 L1. The data also confirmed the importance of P. variegatus as an intermediate host of A. costaricensis. Key-words: Angiostrongylus costaricensis. Veronicellidae. Angiostrongylosis. Host-parasite coevolution. Resumo A infecção acidental humana por Angiostrongylus costaricensis pode resultar em doença abdominal de variada gravidade. Veronicelídeos são os principais moluscos hospedeiros intermediários do Angiostrongylus costaricensis, nematódeo parasita de roedores.
    [Show full text]
  • Pulmonata, Geomitridae)
    A peer-reviewed open-access journal ZooKeys 712:At 1–27 home (2017) at least: the taxonomic position of some north African Xerocrassa species... 1 doi: 10.3897/zookeys.712.13066 RESEARCH ARTICLE http://zookeys.pensoft.net Launched to accelerate biodiversity research At home at least: the taxonomic position of some north African Xerocrassa species (Pulmonata, Geomitridae) Issaad Kawther Ezzine1, Beat Pfarrer2, Najet Dimassi1, Khaled Said1, Eike Neubert2,3 1 LR génétique, biodiversité et valorisation des bio-ressources, Institut Supérieur de Biotechnologie de Monastir, Avenue Taher Hadded (B.P 74) Monastir 5000, Tunisia 2 Natural History Museum Bern, Bernastr. 15, CH- 3005 Bern, Switzerland 3 Institute of Ecology and Evolution, University of Bern, 3012 Bern, Switzerland Corresponding author: Issaad Kawther Ezzine ([email protected]) Academic editor: Ton de Winter | Received 4 April 2017 | Accepted 19 September 2017 | Published 26 October 2017 http://zoobank.org/4B570338-1549-4C6E-9009-F75ED683D946 Citation: Ezzine IK, Pfarrer B, Dimassi N, Said K, Neubert E (2017) At home at least: the taxonomic position of some north African Xerocrassa species (Pulmonata, Geomitridae). ZooKeys 712: 1–27. https://doi.org/10.3897/ zookeys.712.13066 Abstract In order to clarify the systematic position of Helix latastei Letourneux in Letourneux & Bourguignat, 1887, and Helix latasteopsis Letourneux & Bourguignat, 1887, a comprehensive approach using mor- phological and molecular methods is presented. The investigation of the genital organs of both species showed that they belong to the genus Xerocrassa Monterosato, 1892 with two very small dart sacs and a few tubiform glandulae mucosae. In our phylogenetic analysis using the mitochondrial markers COI, 16S and the nuclear cluster 5.8-ITS2-28S, the results of the anatomical research were confirmed.
    [Show full text]
  • Pedipedinae (Gastropoda: Ellobiidae) from Hong Kong
    The marine flora and fauna of Hong Kong and southern China III (ed. B. Morton). Proceedings of the Fourth International Marine Biological Workshop: The Marine Flora and Fauna of Hong Kong and Southern China, Hong Kong, 11-29 April 1989. Hong Kong: Hong Kong University Press, 1992. PEDIPEDINAE (GASTROPODA: ELLOBIIDAE) FROM HONG KONG Ant6nio M. de Frias Martins Departamento de Biologia, Universidade dos A~ores,P-9502 Ponta Delgada, Siio Miguel, A~ores,Portugal ABSTRACT Two species of Pedipedinae are recorded for the first time from Hong Kong and are here provisionally referred to as Pedipes jouani Montrouzier, 1862 and Microtralia alba (Gassies, 1865), described from New Caledonia. A descriptive study of the reproductive and nervous systems was conducted and confirms previous studies that both genera are consubfamilial. The distribution and dispersal of the species is discussed. INTRODUCTION The Indo-Pacific Ellobiidae are particularly well represented by conspicuous, mangrove- dwelling, macroscopic species, relatively few of which have been studied anatomically. Koslowsky (1933) presented a detailed description of Melampus boholensis 'H. and A. Adams' Pfeiffer, 1856. Morton (1955) described the anatomy of Pythia Roding, 1798, Ellobium Roding, 1798 [E.aurisjudae (L. 1758)l and of the small pedipedinian Marinula King, 1832 [M.filholi Hutton, 18781. Knipper and Meyer (1956) provided good illus- trations of the nervous systems of Ellobium (Auriculodes) gaziensis (Preston, 1913), Cassidula labrella (Deshayes, 1830) and Melampus semisulcatus Mousson, 1869. Cassidula Fhssac, 1821, Ellobium and Pythia were discussed by Beny et al. (1967) and Sumikawa and Miura (1978) studied in detail the reproductive system of Ellobium chinense (Pfeiffer, 1854).
    [Show full text]
  • Snail and Slug Dissection Tutorial: Many Terrestrial Gastropods Cannot Be
    IDENTIFICATION OF AGRICULTURALLY IMPORTANT MOLLUSCS TO THE U.S. AND OBSERVATIONS ON SELECT FLORIDA SPECIES By JODI WHITE-MCLEAN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2012 1 © 2012 Jodi White-McLean 2 To my wonderful husband Steve whose love and support helped me to complete this work. I also dedicate this work to my beautiful daughter Sidni who remains the sunshine in my life. 3 ACKNOWLEDGMENTS I would like to express my sincere gratitude to my committee chairman, Dr. John Capinera for his endless support and guidance. His invaluable effort to encourage critical thinking is greatly appreciated. I would also like to thank my supervisory committee (Dr. Amanda Hodges, Dr. Catharine Mannion, Dr. Gustav Paulay and John Slapcinsky) for their guidance in completing this work. I would like to thank Terrence Walters, Matthew Trice and Amanda Redford form the United States Department of Agriculture - Animal and Plant Health Inspection Service - Plant Protection and Quarantine (USDA-APHIS-PPQ) for providing me with financial and technical assistance. This degree would not have been possible without their help. I also would like to thank John Slapcinsky and the staff as the Florida Museum of Natural History for making their collections and services available and accessible. I also would like to thank Dr. Jennifer Gillett-Kaufman for her assistance in the collection of the fungi used in this dissertation. I am truly grateful for the time that both Dr. Gillett-Kaufman and Dr.
    [Show full text]
  • The Role of Phyllocaulis Variegatus (Mollusca: Veronicellidae)
    Available online at www.sciencedirect.com Revista Mexicana de Biodiversidad Revista Mexicana de Biodiversidad 87 (2016) 255–257 www.ib.unam.mx/revista/ Research note The role of Phyllocaulis variegatus (Mollusca: Veronicellidae) in the transmission of digenean parasites El papel de Phyllocaulis variegatus (Mollusca: Veronicellidae) en la transmisión de parásitos digéneos a,∗ b a b Romina Valente , Julia Inés Diaz , Oscar Daniel Salomón , Graciela Teresa Navone a Instituto Nacional de Medicina Tropical, Ministerio de Salud de la Nación, Jujuy s/n, 3370 Puerto Iguazú, Provincia de Misiones, Argentina b Centro de Estudios Parasitológicos y de Vectores (CCT La Plata-CONICET), Facultad de Ciencias Naturales y Museo, Universidad Nacional de La Plata, calle 120 e/61 y 62, B1900FWA La Plata, Provincia de Buenos Aires, Argentina Received 12 November 2014; accepted 14 September 2015 Available online 26 February 2016 Abstract Ninety-five veronicellid slugs identified as Phyllocaulis variegatus were collected in Puerto Iguazú, Misiones Province, Argentina. Specimens were examined for parasites. Metacercariae of the genus Brachylaima (Brachylaimidae) were recovered from the body cavity near the female genital pore. The results establish the capability of P. variegatus to act as an intermediate host of Brachylaima sp. in the area. This study represents the first record of metacercariae of Brachylaima sp. in Argentina. All Rights Reserved © 2015 Universidad Nacional Autónoma de México, Instituto de Biología. This is an open access item distributed under the Creative Commons CC License BY-NC-ND 4.0. Keywords: Brachylaima sp.; Metacercariae; Phyllocaulis variegatus; Intermediate host; Argentina Resumen Noventa y cinco babosas terrestres de la familia Veronicellidae identificadas como Phyllocaulis variegatus fueron recolectadas en Puerto Iguazú, provincia de Misiones, Argentina para ser examinadas en busca de parásitos.
    [Show full text]
  • Redalyc.Familia Ellobiidae (Gastropoda: Archaeopulmonata
    Revista Peruana de Biología ISSN: 1561-0837 [email protected] Universidad Nacional Mayor de San Marcos Perú Paredes, Carlos; Indacochea, Aldo; Cardoso, Franz; Ortega, Kelly Familia Ellobiidae (Gastropoda: Archaeopulmonata) en el litoral peruano Revista Peruana de Biología, vol. 12, núm. 1, 2005, pp. 69-76 Universidad Nacional Mayor de San Marcos Lima, Perú Disponible en: http://www.redalyc.org/articulo.oa?id=195018466004 Cómo citar el artículo Número completo Sistema de Información Científica Más información del artículo Red de Revistas Científicas de América Latina, el Caribe, España y Portugal Página de la revista en redalyc.org Proyecto académico sin fines de lucro, desarrollado bajo la iniciativa de acceso abierto Rev. peru. biol. 12(1): 69-76 (2005) © Facultad de Ciencias Biológicas UNMSM VersiónFamilia Online Ellobiidae ISSN 1727-9933 en el Perú Familia Ellobiidae (Gastropoda: Archaeopulmonata) en el litoral peruano Family Ellobiidae (Gastropoda: Archaeopulmonata) in the Peruvian coast Carlos Paredes1, Aldo Indacochea2 , Franz Cardoso1 y Kelly Ortega2 Presentado: 12/07/2005 Aceptado: 01/08/2005 Resumen Se reportan 8 especies de Ellobiidae para la Costa Peruana, pertenecientes a las subfamilias Ellobiinae: Ellobium stagnale (Orbigny, 1835) y Sarnia frumentum Petit, 1842; Melampodinae: Melampus carolianus (Lesson, 1842), Melampus olivaceus Carpenter, 1857 y Detracia graminea Morrison, 1846; y Pedipedinae: Marinula acuta (Orbigny, 1835), Marinula concinna (C.B Adams, 1852) y Marinula pepita King, 1831. Seis especies viven asociadas al bosque de manglar en el departamento de Tumbes, y dos en las playas de canto rodado en los límites de la Provincia Peruana. Cuatro especies tropicales se registran por primera vez para el mar peruano: E.
    [Show full text]
  • Mollusca: Gastropoda: Veronicellidae)
    BIOMETRIA DA RÁDULA E PADRÃO DOS FRAGMENTOS DE RESTRIÇÃO DO DNA DE ESPÉCIES DO GÊNERO Phyllocaulis (MOLLUSCA: GASTROPODA: VERONICELLIDAE) Georgina Gonçalves Mansur PONTIFÍCIA UNIVERSIDADE CATÓLICA DO RIO GRANDE DO SUL FACULDADE DE BIOCIÊNCIAS PROGRAMA DE PÓS-GRADUAÇÃO EM BIOCIÊNCIAS - ZOOLOGIA BIOMETRIA DA RÁDULA E PADRÃO DOS FRAGMENTOS DE RESTRIÇÃO DO DNA DE ESPÉCIES DO GÊNERO Phyllocaulis (MOLLUSCA: GASTROPODA: VERONICELLIDAE) Georgina Gonçalves Mansur Prof. Dr. Jarbas Rodrigues de Oliveira Prof. Dr. José Willibaldo Thomé TESE DE DOUTORADO PORTO ALEGRE - RS - BRASIL 2001 SUMÁRIO Agradecimentos .......................................................................... iii Resumo Geral .............................................................................. iv Abstract ....................................................................................... v 1. Apresentação ........................................................................... vi 2. Artigo 1: Biometria da rádula no gênero Phyllocaulis (Mollusca: Gastropoda: Veronicellidae) 2.1. Resumo ......................................................................... 01 2.2. Abstract ........................................................................ 02 2.3. Introdução ..................................................................... 03 2.4. Materiais e Métodos ...................................................... 06 2.5. Resultados e Discussão ................................................. 11 2.6. Referências ...................................................................
    [Show full text]