DOCSLIB.ORG

Supplementary Materials

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Materials Supplementary Materials 16S rRNA Gene Sequence CGAAGGGTCACCTTAGAAAAATAAAGTTGGGTGTCGGCTGGCGCCGGCCGGGCCTACAGAGCAGGTGACAAAGCCCCAT ACGCTCGAGGACCGGACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGGGAGAGGGGGACGGGGGCCCAACACAC AAGCCGTGCTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAG ACTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGA TCCGTTGTTGAAAGTTTTAACTGATTACGATAATCAACTCAGACTGCATACTTTCAGAACAGCGTTCATGTTGGGGTCTTC GGCGGGCGCGGGCCCGGGGGCGCAAGGCCTCCCCGGCGGCCGTCGAAACGGCGGGCCCGCCGAAGCAACAAGGTACGAT AGACACGGGTGGGAGGTTGGACCCAGAGGGCCCTCACTCGGTAATGATCCTTCCGCAGGTTCACCCTACGGAAG LOCUS KJ175457 550 bp DNA linear PLN 03-FEB-2014 DEFINITION Aspergillus fumigatus isolate M1103.2732 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence. ACCESSION KJ175457 VERSION KJ175457.1 GI:576867471 KEYWORDS SOURCE Aspergillus fumigatus ORGANISM Aspergillus fumigatus Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspergillaceae; Aspergillus. REFERENCE 1 (bases 1 to 550) AUTHORS De Respinis,S., Weissenhorn,S., Bosshard,P.P., Petrini,L.E., Tonolla,M. and Petrini,O. TITLE Identification of Aspergillus species in the Flavi and Fumigati Sections by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry JOURNAL Unpublished REFERENCE 2 (bases 1 to 550) AUTHORS De Respinis,S., Weissenhorn,S., Bosshard,P.P., Petrini,L.E., Tonolla,M. and Petrini,O. TITLE Direct Submission JOURNAL Submitted (23-JAN-2014) Laboratory of Applied Microbiology, University of Applied Sciences of Southern Switzerland (SUPSI), Via Mirasole 22A, Bellinzona, Ticino 6501, Switzerland S2 All Compounds Structures OCH3 OCH3 H3C OH OH O H3C CH3 OCH3 O O O O N N CH CH CH3 3 3 N N OAc H3CO N H3CO N H H O O O O CH3 CH3 H3C H3C CH3 OAc Compound 1 Compound 2 Compound 3 OH O O O OH O OH OH OH N N N N N N H3CO N H3CO N H3CO N H O O O CH3 O O CH 3 O O CH3 H3C CH3 CH3 H3C H3C CH3 CH 3 Compound 4 Compound 5 Compound 6 H C H C 3 CH3 HOOC 3 O CH 3 CH3 CH3 H3C OCH3 CH3 H3C CH3 CH 3 OAc CH3 OCH3 O OH HO O O O O CH3 OAc Compound 9 Compound 7 Compound 8 H CO 3 O O OCH3 OCH3 OCH3 O H3C OH H3C OH O OH O H3C OH O COOCH3 OH O OH H3CO Compound 11 Compound 12 Compound 10 CH O 3 O N NH O CH3 O CH3 N CH3 O CH HN O 3 O HN H N N N CH 3 CH3 H3C N CH3 CH3 Compound 14 O Compound 13 OH O Compound 15 O O NH OH H3C OCH3 O OH Compound 16 Chart 1. Structure of Compounds 1–16. S3 OCH3 OCH3 H3C OH OH O O O OCH3 O N N H3CO N H H O CH3 H3C 1 Figure S1. H-NMR (400 MHz, CDCl3) spectrum of compound 1. OCH3 OCH3 H3C OH OH O O O OCH3 O N N H3CO N H H O CH3 H3C 13 Figure S2. C-NMR (100 MHz, CDCl3) spectrum of compound 1. S4 OCH3 OCH3 H3C OH OH O O O OCH3 O N N H3CO N H H O CH3 H3C Figure S3. HSQC spectrum of compound 1. OCH3 OCH3 H3C OH OH O O O OCH3 O N N H3CO N H H O CH3 H3C Figure S4. Expanded HSQC spectrum of compound 1. S5 OCH3 OCH3 H3C OH OH O O O OCH3 O N N H3CO N H H O CH3 H3C Figure S5. HMBC spectrum of compound 1. Figure S6. Expanded HMBC spectrum of compound 1. S6 OCH3 OCH3 H3C OH H OH O O OCH3 O O H N N H3CO N H H H O CH3 H3C Figure S7. Key correlation signal of HMBC Spectrum of compound 1. OCH3 OCH3 H3C OH OH O O O OCH3 O N N H3CO N H H O CH3 H3C Figure S8. NOESY spectrum of compound 1. S7 Figure S9. Expanded NOESY spectrum of compound 1. OCH3 OCH3 H3C OH H OH O O OCH3 O O H N N H3CO N H H H O CH3 H3C Figure S10. Key NOESY spectrum of compound 1. S8 OCH3 OCH3 H H3C OH H OH O O OCH3 O O H N N H3CO N H H H O CH3 H3C Figure S11. Key NOESY spectrum of compound 1. Figure S12. HR-ESIMS of compound 1. S9 100 S 95 90 85 80 75 70 587.57 946.67 631.67 739.66 865.14 65 557.52 717.30 528.81 643.81 891.49 60 764.50 971.68 55 780.62 %T 2846.93 918.96 50 834.34 3132.03 1129.40 998.69 45 2951.87 1014.92 3431.79 40 818.09 1409.34 1155.30 35 1107.95 1436.95 30 1464.47 1291.45 1369.04 25 1318.64 1723.72 1241.01 20 1631.99 1062.87 15 1585.95 1218.47 3000 2000 1000 Wavenumbers (cm-1) Figure S13. IR spectrum of compound 1. H3C CH3 CH 3 CH3 CH3 OAc H O O H CH3 OAc 1 Figure S14. H-NMR (400 MHz, DMSO-d6) spectrum of compound 2. S10 1 Figure S15. Expanded H-NMR (400 MHz, DMSO-d6) spectrum of compound 2. H3C CH3 CH3 CH3 CH3 OAc H O O H CH3 OAc 13 Figure S16. C-NMR (100 MHz, DMSO-d6) Spectrum of compound 2. S11 H3C CH3 CH3 CH3 CH3 OAc H O O H CH3 OAc 13 Figure S17. Expanded C-NMR (100 MHz, DMSO-d6) Spectrum of compound 2. Figure S18. DEPT135 Spectrum (100 MHz, DMSO-d6) of compound 2. S12 H3C CH3 CH 3 CH3 CH3 OAc H O O H CH3 OAc Figure S19. Expanded DEPT135 Spectrum (100 MHz, DMSO-d6) of compound 2. H3C CH3 CH CH3 CH3 3 OAc H O O H CH3 OAc Figure S20. HSQC Spectrum of compound 2. S13 H3C CH3 CH 3 CH3 CH3 OAc H O O H CH3 OAc Figure S21. Expanded HSQC Spectrum of compound 2. H3C CH3 CH 3 CH3 CH3 OAc H O O H CH3 OAc Figure S22. HMBC Spectrum of compound 2. S14 Figure S23. Expanded HMBC Spectrum of compound 2. H3C CH3 CH 3 CH3 CH3 OAc H O O H CH3 OAc Figure S24. COSY Spectrum of compound 2. S15 CH3 H CH3 CH3 CH3 OAc H CH3 O O H CH3 OAc Figure S25. NOESY Spectrum of compound 2. Figure S26. HR-ESIMS of compound 2. .
Load more

Recommended publications
  • Phylogeny of Chrysosporia Infecting Reptiles: Proposal of the New Family Nannizziopsiaceae and Five New Species
    CORE Metadata, citation and similar papers at core.ac.uk Provided byPersoonia Diposit Digital 31, de Documents2013: 86–100 de la UAB www.ingentaconnect.com/content/nhn/pimj RESEARCH ARTICLE http://dx.doi.org/10.3767/003158513X669698 Phylogeny of chrysosporia infecting reptiles: proposal of the new family Nannizziopsiaceae and five new species A.M. Stchigel1, D.A. Sutton2, J.F. Cano-Lira1, F.J. Cabañes3, L. Abarca3, K. Tintelnot4, B.L. Wickes5, D. García1, J. Guarro1 Key words Abstract We have performed a phenotypic and phylogenetic study of a set of fungi, mostly of veterinary origin, morphologically similar to the Chrysosporium asexual morph of Nannizziopsis vriesii (Onygenales, Eurotiomycetidae, animal infections Eurotiomycetes, Ascomycota). The analysis of sequences of the D1-D2 domains of the 28S rDNA, including rep- ascomycetes resentatives of the different families of the Onygenales, revealed that N. vriesii and relatives form a distinct lineage Chrysosporium within that order, which is proposed as the new family Nannizziopsiaceae. The members of this family show the mycoses particular characteristic of causing skin infections in reptiles and producing hyaline, thin- and smooth-walled, small, Nannizziopsiaceae mostly sessile 1-celled conidia and colonies with a pungent skunk-like odour. The phenotypic and multigene study Nannizziopsis results, based on ribosomal ITS region, actin and β-tubulin sequences, demonstrated that some of the fungi included Onygenales in this study were different from the known species of Nannizziopsis and Chrysosporium and are described here as reptiles new. They are N. chlamydospora, N. draconii, N. arthrosporioides, N. pluriseptata and Chrysosporium longisporum. Nannizziopsis chlamydospora is distinguished by producing chlamydospores and by its ability to grow at 5 °C.
    [Show full text]
  • New Xerophilic Species of Penicillium from Soil
    Journal of Fungi Article New Xerophilic Species of Penicillium from Soil Ernesto Rodríguez-Andrade, Alberto M. Stchigel * and José F. Cano-Lira Mycology Unit, Medical School and IISPV, Universitat Rovira i Virgili (URV), Sant Llorenç 21, Reus, 43201 Tarragona, Spain; [email protected] (E.R.-A.); [email protected] (J.F.C.-L.) * Correspondence: [email protected]; Tel.: +34-977-75-9341 Abstract: Soil is one of the main reservoirs of fungi. The aim of this study was to study the richness of ascomycetes in a set of soil samples from Mexico and Spain. Fungi were isolated after 2% w/v phenol treatment of samples. In that way, several strains of the genus Penicillium were recovered. A phylogenetic analysis based on internal transcribed spacer (ITS), beta-tubulin (BenA), calmodulin (CaM), and RNA polymerase II subunit 2 gene (rpb2) sequences showed that four of these strains had not been described before. Penicillium melanosporum produces monoverticillate conidiophores and brownish conidia covered by an ornate brown sheath. Penicillium michoacanense and Penicillium siccitolerans produce sclerotia, and their asexual morph is similar to species in the section Aspergilloides (despite all of them pertaining to section Lanata-Divaricata). P. michoacanense differs from P. siccitol- erans in having thick-walled peridial cells (thin-walled in P. siccitolerans). Penicillium sexuale differs from Penicillium cryptum in the section Crypta because it does not produce an asexual morph. Its ascostromata have a peridium composed of thick-walled polygonal cells, and its ascospores are broadly lenticular with two equatorial ridges widely separated by a furrow. All four new species are xerophilic.
    [Show full text]
  • S21 Konferans TIPTA ÖNEMLİ MANTARLARIN FİLOGENETİK VE
    Konferans TIPTA ÖNEMLİ MANTARLARIN FİLOGENETİK VE SİSTEMATİĞİ Ahmet ASAN Trakya Üniversitesi, Fen-Edebiyat Fakültesi Biyoloji Bölümü, Edirne, ([email protected]; [email protected]) Fungal infeksiyonlar dünyada oldukça yaygındır. Bulaşıcı özellik taşıyan yüzeyel infeksiyon- lar, dermatofitler ve Candida türleri tarafından oluşturulmaktadır. Bu tür infeksiyonların tanısı zordur ve bazen ekzama gibi diğer hastalıklarla karıştırılabilmektedir (1). Mantarların insanlarda hastalığa yol açtığı, ilk defa 1839’da gösterilmiştir. Schoenlein ve Gruby, daha sonra Trichophyton schoenleinii olarak adlandırılan ve kafa derisinde infeksiyona veya kelliğe (= favus) neden olan türü keşfetmişlerdir (2). Fakat yıllar boyunca fungal hastalıklar bakteriyal hastalıkların gölgesinde kalmıştır. Mantar hastalıklarının önemi, özellikle 1970’li yıllardan sonra artmıştır. Çünkü bu tarihden sonra, uluslararası ulaşım ve bağışıklığı bastırıcı ilaçların kullanımı artmış; ilave olarak AIDS hastalığı ortaya çıkmıştır. Bilinmeyen veya başlangıçta patojen olmadığı düşünülen mantarların neden olduğu fırsatçı infeksiyonların gittikçe arttığı da bilinmektedir. İnsanlarda infeksiyona neden olan birçok tür ve birçok yeni insan patojeni her yıl keşfedilmekte, bu durum fungal taksonomiyi önemli hale getirmektedir (3). Doğru tedavi için mantarın doğru tanınması çok önemlidir. Gelişen dünyada bağışıklık sistemi zayıf hastalarda meydana gelen ölümlerin % 5’den fazlasının sebebi patojen mantarlardır. Tıbbi tedavide artış görülmesine rağmen, fungal infeksiyonların insidansında
    [Show full text]
  • Comparative Genomic Analyses of the Human Fungal Pathogens Coccidioides and Their Relatives
    Downloaded from genome.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press Letter Comparative genomic analyses of the human fungal pathogens Coccidioides and their relatives Thomas J. Sharpton,1,11 Jason E. Stajich,1 Steven D. Rounsley,2 Malcolm J. Gardner,3 Jennifer R. Wortman,4 Vinita S. Jordar,5 Rama Maiti,5 Chinnappa D. Kodira,6 Daniel E. Neafsey,6 Qiandong Zeng,6 Chiung-Yu Hung,7 Cody McMahan,7 Anna Muszewska,8 Marcin Grynberg,8 M. Alejandra Mandel,2 Ellen M. Kellner,2 Bridget M. Barker,2 John N. Galgiani,9 Marc J. Orbach,2 Theo N. Kirkland,10 Garry T. Cole,7 Matthew R. Henn,6 Bruce W. Birren,6 and John W. Taylor1 1Department of Plant and Microbial Biology, University of California, Berkeley, Berkeley, California 94720, USA; 2Department of Plant Sciences, The University of Arizona, Tucson Arizona 85721, USA; 3Department of Global Health, Seattle Biomedical Research Institute, Seattle, Washington 98109-5219, USA; 4Institute for Genome Sciences, University of Maryland School of Medicine, Baltimore, Maryland 21201, USA; 5J. Craig Venter Institute, Rockville, Maryland 20850, USA; 6Broad Institute of MIT and Harvard, Cambridge, Massachusetts 02142, USA; 7Department of Biology, The University of Texas at San Antonio, San Antonio, Texas 78249, USA; 8Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Warsaw 02-106, Poland; 9Valley Fever Center for Excellence, The University of Arizona, Tuscon, Arizona 85721, USA ; 10Department of Pathology, University of California at San Diego, La Jolla, California 92093, USA While most Ascomycetes tend to associate principally with plants, the dimorphic fungi Coccidioides immitis and Coccidioides posadasii are primary pathogens of immunocompetent mammals, including humans.
    [Show full text]
  • Molecular Detection of Human Fungal Pathogens As (Except a Few That Have Newly Evolved As Anthropophilic Dermatophytes
    36 Microsporum* Rahul Sharma and Yvonne Gräser Contents 36.1 . Introduction...................................................................................................................................................................... 285 36.1.1. Classification,.Morphology,.Biology,.and.Epidemiology..................................................................................... 287 36.1.1.1. Classification..........................................................................................................................................287 36.1.1.2. Morphology............................................................................................................................................288 36.1.1.3. Biology.and.Epidemiology.....................................................................................................................289 36.1.2. Clinical.Features.and.Pathogenesis......................................................................................................................290 36.1.2.1. Clinical.Features....................................................................................................................................290 36.1.2.2. Pathogenesis...........................................................................................................................................290 36.1.3. Diagnosis.............................................................................................................................................................. 291 36.1.3.1.
    [Show full text]
  • Metagenome Sequence of Elaphomyces Granulatus From
    bs_bs_banner Environmental Microbiology (2015) 17(8), 2952–2968 doi:10.1111/1462-2920.12840 Metagenome sequence of Elaphomyces granulatus from sporocarp tissue reveals Ascomycota ectomycorrhizal fingerprints of genome expansion and a Proteobacteria-rich microbiome C. Alisha Quandt,1*† Annegret Kohler,2 the sequencing of sporocarp tissue, this study has Cedar N. Hesse,3 Thomas J. Sharpton,4,5 provided insights into Elaphomyces phylogenetics, Francis Martin2 and Joseph W. Spatafora1 genomics, metagenomics and the evolution of the Departments of 1Botany and Plant Pathology, ectomycorrhizal association. 4Microbiology and 5Statistics, Oregon State University, Corvallis, OR 97331, USA. Introduction 2Institut National de la Recherché Agronomique, Centre Elaphomyces Nees (Elaphomycetaceae, Eurotiales) is an de Nancy, Champenoux, France. ectomycorrhizal genus of fungi with broad host associa- 3Bioscience Division, Los Alamos National Laboratory, tions that include both angiosperms and gymnosperms Los Alamos, NM, USA. (Trappe, 1979). As the only family to include mycorrhizal taxa within class Eurotiomycetes, Elaphomycetaceae Summary represents one of the few independent origins of the mycorrhizal symbiosis in Ascomycota (Tedersoo et al., Many obligate symbiotic fungi are difficult to maintain 2010). Other ectomycorrhizal Ascomycota include several in culture, and there is a growing need for alternative genera within Pezizomycetes (e.g. Tuber, Otidea, etc.) approaches to obtaining tissue and subsequent and Cenococcum in Dothideomycetes (Tedersoo et al., genomic assemblies from such species. In this 2006; 2010). The only other genome sequence pub- study, the genome of Elaphomyces granulatus was lished from an ectomycorrhizal ascomycete is Tuber sequenced from sporocarp tissue. The genome melanosporum (Pezizales, Pezizomycetes), the black assembly remains on many contigs, but gene space perigord truffle (Martin et al., 2010).
    [Show full text]
  • Virulence Evolution of Fungal Pathogens in Social and Solitary Bees with an Emphasis on Multiple Infections
    Utah State University DigitalCommons@USU All Graduate Theses and Dissertations Graduate Studies 8-2015 Virulence Evolution of Fungal Pathogens in Social and Solitary Bees with an Emphasis on Multiple Infections Ellen G. Klinger Utah State University Follow this and additional works at: https://digitalcommons.usu.edu/etd Part of the Biology Commons Recommended Citation Klinger, Ellen G., "Virulence Evolution of Fungal Pathogens in Social and Solitary Bees with an Emphasis on Multiple Infections" (2015). All Graduate Theses and Dissertations. 4441. https://digitalcommons.usu.edu/etd/4441 This Dissertation is brought to you for free and open access by the Graduate Studies at DigitalCommons@USU. It has been accepted for inclusion in All Graduate Theses and Dissertations by an authorized administrator of DigitalCommons@USU. For more information, please contact [email protected]. VIRULENCE EVOLUTION OF FUNGAL PATHOGENS IN SOCIAL AND SOLITARY BEES WITH AN EMPHASIS ON MULTIPLE INFECTIONS by Ellen G. Klinger A dissertation submitted in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY in Biology Approved: Dennis L. Welker Rosalind R. James Major Professor Project Advisor Donald W. Roberts John R. Stevens Committee Member Committee Member Carol D. von Dohlen Mark R. McLellan Committee Member Vice President for Research and Dean of the School of Graduate Studies UTAH STATE UNIVERSITY Logan, Utah 2015 ii Disclaimer regarding products used in the dissertation: This paper reports the results of research only. The mention of a proprietary product does not constitute an endorsement or a recommendation by the USDA for its use. Disclaimer about copyrights: The dissertation was prepared by a USDA employee as part of his/her official duties.
    [Show full text]
  • Biological and Evolutionary Diversity in the Genus Aspergillus
    Sexual structures in Aspergillus -- morphology, importance and genomics David M. Geiser Department of Plant Pathology Penn State University University Park, PA Geiser mini-CV • 1989-95: PhD at University of Georgia (Bill Timberlake and Mike Arnold): Aspergillus molecular evolutionary genetics (A. nidulans) • 1995-98: postdoc at UC Berkeley (John Taylor): (A. flavus/oryzae/parasiticus, A. fumigatus, A. sydowii) • 1998-: Faculty at Penn State; Director of Fusarium Research Center -- molecular evolution of Fusarium and other fungi Chaetosartorya Petromyces Hemicarpenteles Neosartorya Fennellia Aspergillus Neocarpenteles Eurotium Warcupiella Neopetromyces Emericella Sexual structures in Aspergillus -- morphology, importance and genomics • Sexual stages associated with Aspergillus • The impact (and lack thereof) of the sexual stage on population biology • What does it mean? Characteristics of clinically important Aspergillus spp. • Ability to grow at 37C • Commonly encountered by humans • Prolific sporulators • Nothing here about sexual stages Approx. 1/3 Aspergillus species has a known sexual stage Petromyces (3) Neopetromyces (1) Neosartorya (32, 3 heterothallic) Chaetosartorya (4) Aspergillus Emericella (34, 1 heterothallic) 148 homothallic 4 heterothallic (427 names) Fennellia (3) Eurotium (69) Warcupiella (1) Hemicarpenteles (4) Neocarpenteles (1) Heterothallics rare; virtually all have a conidial stage Types of ascomata cleistothecium (no hymenium - naked passive spore dispersal) asci asci and paraphyses (hymenium) apothecium perithecium
    [Show full text]
  • Studies on Microbial Production of Lipoxygenase Inhibitor
    STUDIES ON MICROBIAL PRODUCTION OF LIPOXYGENASE INHIBITOR A thesis submitted to the UNIVERSITY OF MYSORE for the award of the degree of DOCTOR OF PHILOSOPHY IN BIOTECHNOLOGY By CHIDANANDA.C Department of Fermentation Technology and Bioengineering Central Food Technological Research Institute Council of Scientific and Industrial Research Mysore-570020, INDAI June 2008 Chidananda. C, Date: Senior Research Fellow, Fermentation Technology and Bioengineering Department, Central Food Technological Research Institute, Mysore-570 013. DECLARATION I hereby declare that the thesis entitled “STUDIES ON MICROBIAL PRODUCTION OF LIPOXYGENASE INHIBITOR” submitted to the University of Mysore for the award of the degree of DOCTOR OF PHILOSOPHY is the result of the research work carried out by me in the Discipline of Fermentation Technology and Bioengineering, Central Food Technological Research Institute, Mysore, India, under the guidance of Dr Avinash P Sattur during the period April 2005- June 2008. I further declare that the work embodied in this thesis had not been submitted for the award of degree, diploma or any other similar title. (Chidananda. C) Dr. Avinash P. Sattur, Date: Scientist, Fermentation Technology and Bioengineering Department, CERTIFICATE I hereby certify that the thesis entitled “STUDIES ON MICROBIAL PRODUCTION OF LIPOXIGENASE INHIBITOR” submitted to the University of Mysore for the award of the degree of DOCTOR OF PHILOSOPHY by Mr. CHIDANANDA.C, is the result of the research work carried out by him in the discipline of Fermentation Technology and Bioengineering, Central Food Technological Research Institute, Mysore, India, under my guidance during the period April 2005-June 2008. (Avinash P Sattur) Abstract The thesis reports isolation of several fungal cultures from forest soil and screening of the metabolites for their ability to produce inhibitors against lipoxygenase.
    [Show full text]
  • First Detection of the Larval Chalkbrood Disease Pathogen Ascosphaera Apis (Ascomycota: Eurotiomycetes: Ascosphaerales) in Adult Bumble Bees
    First Detection of the Larval Chalkbrood Disease Pathogen Ascosphaera apis (Ascomycota: Eurotiomycetes: Ascosphaerales) in Adult Bumble Bees Maxfield-Taylor, S.A., Mujic, A.B., Rao, S. (2015) First Detection of the Larval Chalkbrood Disease Pathogen Ascosphaera apis (Ascomycota: Eurotiomycetes: Ascosphaerales) in Adult Bumble Bees. PLoS ONE 10(4). doi:10.1371/journal.pone.0124868 10.1371/journal.pone.0124868 Public Library of Science Version of Record http://cdss.library.oregonstate.edu/sa-termsofuse RESEARCH ARTICLE First Detection of the Larval Chalkbrood Disease Pathogen Ascosphaera apis (Ascomycota: Eurotiomycetes: Ascosphaerales) in Adult Bumble Bees Sarah A. Maxfield-Taylor1, Alija B. Mujic2, Sujaya Rao1* 1 Department of Crop and Soil Science, Oregon State University, Corvallis, Oregon, United States of America, 2 Department of Botany and Plant Pathology, Oregon State University, Corvallis, Oregon, United States of America * [email protected] Abstract OPEN ACCESS Fungi in the genus Ascosphaera (Ascomycota: Eurotiomycetes: Ascosphaerales) cause Citation: Maxfield-Taylor SA, Mujic AB, Rao S (2015) chalkbrood disease in larvae of bees. Here, we report the first-ever detection of the fungus First Detection of the Larval Chalkbrood Disease in adult bumble bees that were raised in captivity for studies on colony development. Wild Pathogen Ascosphaera apis (Ascomycota: queens of Bombus griseocollis, B. nevadensis and B. vosnesenskii were collected and Eurotiomycetes: Ascosphaerales) in Adult Bumble maintained for establishment of nests. Queens that died during rearing or that did not lay Bees. PLoS ONE 10(4): e0124868. doi:10.1371/ journal.pone.0124868 eggs within one month of capture were dissected, and tissues were examined microscopi- cally for the presence of pathogens.
    [Show full text]
  • End-40-75 (Endode-Endope) Mohammed AL- Hamdany
    الموسوعة العربية ﻷمراض النبات والفطريات Arabic Encyclopedia of Plant Pathology &Fungi إعداد الدكتور محمد عبد الخالق الحمداني Mohammed AL- Hamdany End-40-75 (Endode-Endope) Contents Codes Page No. Table of contents 1 Endod… Endodermophyton End-40 2 Endodesmia (Broomeola) End-41 4 Endodesmidium Canter 1949 End-42 5 Endodothella ( Phyllachora ) End-43 6 Endodothiora Petr., 1929. End-44 19 Endodromia ( Echinostelium) End-45 21 Endog Endogenospora R.F. Castañeda, O. Morillo & Minter, 2010. End-46 22 Endogenous Inoculum End-47 24 Endogloea (Phomopsis) End-48 25 Endogonaceae End-49 34 Endogonales End-50 35 Endogone Link, 1809. End-51 36 Endogonella (Claziella) End-52 39 Endogonomycetes End-53 41 Endogonopsidaceae End-54 41 Endogonopsis R. Heim, 1966. End-55 42 Endoh… Endohormidium ( Corynelia) End-56 43 Endohyalina Marbach, 2000. End-57 46 Endol… Endolepiotula Singer, 1963. End-58 49 Endolpidium (Olipdium ) End-59 52 Endom…. 1 Endomelanconiopsidaceae End-60 55 Endomelanconiopsis E.I. Rojas & Samuels,2008 End-61 56 Endomelanconium Petr., 1940. End-62 58 Endomeliola S. Hughes & Piroz.,. 1994. End-63 60 Endomyces Reess, Bot. 1870 End-64 62 Endomycetaceae End-65 64 Endomycetales End-66 66 Endomycodes Delitsch, 1943 End-67 67 Endomycopsella End-68 68 Endomycopsis (Saccharomycopsis) End-69 70 Endomycorrhizae End-70 73 Endon… Endonema ( Pascherinema) End-71 75 Endonevrum (Mycenastrum) End-72 77 Endopa-Endope Endoparasites End-73 79 Endoparasitic Nematodes End-74 80 Endoperplexa P. Roberts,1993 End-75 82 References 85 End-40. الجنس الكيسي المختلف عليهEndodermophyton أقرت قانونية إسم الجنس الكيسي Endodermophyton Castell., 1910 وأنواعه الثمانية بضمنها النوع اﻷصلي Endodermophyton castellanii (Perry) Castell.
    [Show full text]
  • Contaminação Bacteriana E Fúngica Dos Tubos Endotraqueais E Traqueias Respiratórias
    ANA FERNANDES MORENO FERREIRA DE LEMOS Contaminação Bacteriana e Fúngica dos Tubos Endotraqueais e Traqueias Respiratórias Orientador: Professor Doutor Pedro Faísca Universidade Lusófona de Humanidades e Tecnologias Faculdade de Medicina Veterinária Lisboa 2016 ANA FERNANDES MORENO FERREIRA DE LEMOS - Contaminação Bacteriana e Fúngica dos Tubos Endotraqueais e Traqueias Respiratórias ANA FERNANDES MORENO FERREIRA DE LEMOS Contaminação Bacteriana e Fúngica dos Tubos Endotraqueais e Traqueias Respiratórias Dissertação defendida em provas públicas para a obtenção do Grau de Mestre em Medicina Veterinária no curso de Mestrado Integrado em Medicina Veterinária conferido pela Universidade Lusófona de Humanidades e Tecnologias no dia 31 de Outubro com a seuinte composição de Júri: Presidente: Professor Doutor João Requicha Arguente: Professora Doutora Margarida Simões Orientador: Prodessor Doutor Pedro Faísca Orientador: Professor Doutor Pedro Faísca Co-Orientador: Dr. António Martinho Universidade Lusófona de Humanidades e Tecnologias Faculdade de Medicina Veterinária Lisboa 2016 Universidade Lusófona de Humanidades e Tecnologias,Faculdade de Medicina Veterinária2 ANA FERNANDES MORENO FERREIRA DE LEMOS - Contaminação Bacteriana e Fúngica dos Tubos Endotraqueais e Traqueias Respiratórias Dedicatória À minha família que sempre acreditou em mim. Universidade Lusófona de Humanidades e Tecnologias,Faculdade de Medicina Veterinária3 ANA FERNANDES MORENO FERREIRA DE LEMOS - Contaminação Bacteriana e Fúngica dos Tubos Endotraqueais e Traqueias Respiratórias Agradecimentos No âmbito da realização da dissertação gostaria de agradecer ao professor Dr. António Martinho pela paciência, dedicação e amizade, não só durante este período, mas também ao longo destes 6 anos. Aos Professores Doutores Nuno Cardoso e Rui Onça por todos os conhecimentos transmitidos, ajuda, disponibilidade e boa disposição. À Dra. Mariana Garcez pelo apoio fundamental e orientação em toda a parte experimental deste trabalho.
    [Show full text]