DOCSLIB.ORG

(12) Patent Application Publication (10) Pub. No.: US 2010/0179070 A1 Waters (43) Pub

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(12) Patent Application Publication (10) Pub. No.: US 2010/0179070 A1 Waters (43) Pub US 20100179070A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2010/0179070 A1 Waters (43) Pub. Date: Jul. 15, 2010 (54) DNA DAMAGE TESTING (30) Foreign Application Priority Data (76) Inventor: Raymond Waters, Cardiff (GB) Jun. 28, 2007 (GB) ................................... O7125842 Publication Classification Correspondence Address: (51) Int. Cl. KING & SCHICKLI, PLLC C40B 30/04 (2006.01) 247 NORTH BROADWAY < C, 3. LEXINGTON, KY 40507 (US) ( .01) (52) U.S. Cl. .................................... 506/9; 435/6; 506/16 (21) Appl. No.: 12/666,493 (57) ABSTRACT The invention relates to a method of for detecting DNA dam 1-1. age in a tissue sample. The method includes the steps of (22) PCT Filed: Jun. 27, 2008 exposing sample DNA to a tagged DNA-damage binding factor and then shearing the DNA to produce fragments. After (86). PCT No.: PCT/GB08/02248 separating damaged from undamaged DNA, the two are amplified and differentially labeled. The labeled fragments S371 (c)(1), can be immobilised on a microarray allowing the location and (2), (4) Date: Dec. 23, 2009 extent of any DNA damage to be determined. Patent Application Publication Jul. 15, 2010 Sheet 1 of 2 US 2010/0179070 A1 s 9. w S d 5 S E g oe g t C s vs S. wag E hueifsw s E C 9. w vs Ol d D Ko s És És -- | Patent Application Publication Jul. 15, 2010 Sheet 2 of 2 US 2010/0179070 A1 US 2010/0179070 A1 Jul. 15, 2010 DNA DAMAGE TESTING appreciate that location analysis is an important tool in under standing events that take place within the genome. 0007. There are a number of agents within the environ 0001. The invention relates to a method for detecting DNA ment which are thought to damage DNA. These agents are damage in a sample; a diagnostic kit for undertaking the said both chemical and physical and so comprise genotoxic mol method, including components thereof, and a screening ecules, typically, man-made, and also physical forces such as method for screening compounds to identify either whether electromagnetic radiation Such as UV rays and X-rays. they damage DNA or whether damaged DNA is affected 0008 UV rays are known to be particularly damaging to thereby. humans and are the commonest cause of skin cancer due to epidermal absorption of ultraviolet radiation. For cancer BACKGROUND OF THE INVENTION DNA is believed to be the primary target and it has been 0002 Maintenance of the structure of the eukaryotic shown that photochemical reactions involving DNA have genome involves a series of proteins such as, but not exclu been linked to mutagenesis, carcinogenesis and cell death. sively, enzymes which not only monitor DNA for alterations Damage caused by UV exposure is characterised by the for but also effect repairs to any alterations with a view to main mation of pyrimidine dimers and in particular thymine taining the integrity of the DNA for the purpose of subsequent dimers. Nature has responded by producing an enzyme, pho meiosis or mitosis. tolyase, which reactivates DNA by the direct repair of thym 0003. Different agents cause different types of DNA dam ine dimers. It binds to the damaged DNA and by absorbing age and, as a result, a different series of proteins have evolved energy restores the pyrimidine dimers to their former mono in order to repair the different types of damage. meric state. This repair mechanism is found in many forms of 0004. It follows that DNA repair is one of the fundamental eukaryotic life. processes involved in DNA metabolism and defects in any of 0009. In an analogous fashion other DNA repair proteins, the DNA repair mechanisms have major biological conse and in particular enzymes, have evolved to repair other forms quences, including a significant impact on the well-being of of DNA damage. Examples of Such enzymes include base the relevant organism. excision repair enzymes; enzymes which are responsible for 0005. A main goal since the discovery of the structure of direct reversal of damage, repair of DNA-protein crosslinks, DNA has been to systematically determine the precise mismatch excision repair, nucleotide excision repair, molecular mechanisms that mediate DNA function. homologous recombination, non-homologous end joining or 0006 AS improved technologies allow for increasingly modulation of nucleotide pools; DNA polymerases, editing high resolution studies of DNA it is becomingly increasingly and processing nucleases, also gene products which interfere possible to undertake location analysis of DNA, i.e. analysis with the Radó pathway or which affect chromatin structure, that enables the precise location of a given event to be deter enzymes or gene products encoded by genes which are defec mined within the eukaryotic genome. When one considers tive in diseases associated with sensitivity to DNA damaging that the human cell contains 2 metres of DNA packed within agents etc. Table 1 lists examples of genes encoding these chromatin and that these 2 metres of DNA comprise more enzymes and other proteins 1 along with an indication of their than 30,000 genes or 3.2 billion base pairs but one is, never functionality and so the nature of the damage that they repair. theless, able to pinpoint the precise location of a given event Many of these enzymes are highly conserved and so homo (within a 100 base pair degree of accuracy) then one begins to logues exist in different species. TABLE 1. Genes Encoding DNA Repair Enzymes or having a DNA Repair function Gene Name Chromosome NCBI (Synonyms) Activity Location Accession No. Base excision repair DNA glycosylases: major altered base released UNG U 2q24.11 NMO80911 SMUG1 U 2d 13.13 NMO14311 MBD4 U or T opposite G at CpG 3q21.3 NMOO392S sequences TDG U, T or ethenoC opposite 2d23.3 NMOO3211 G OGG1 8-oxoG opposite C 3p25.3 NMO16821 MUTYH (MYH) A opposite 8-oxoG p34.1 NMO 12222 NTHL1 (NTH1) Ring-saturated or 6p13.3 NMOO2S28 ragmented pyrimidines MPG 3-MeA, ethenoA, 6p13.3 NMOO2434 hypoxanthine NEIL1 Removes thymine glycol 5q24.2 NMO24608 NEIL2 Romoves oxidative 8p23.1 NM 145043 products of pyrimidines Other BER Factors APEX1 AP endonuclease 14q11.2 NMOO1641 APEX2 AP endonuclease Xp11.21 NMO14481 LIG3 DNA Ligase 17q12 NMO13975 US 2010/0179070 A1 Jul. 15, 2010 TABLE 1-continued Genes Encoding DNA Repair Enzymes or having a DNA Repair function Gene Name Chromosome NCBI (Synonyms) Activity Location Accession No. Ligase accessory factor 19q13.31 NMOO6297 Converts some DNA 19q13.33 NMOO7254 breaks to ligatable ends Poly (ADP-ribose) polymerase (PARP) enzymes PARP1 (ADPRT) Protects strand 1q42.12 NMOO1618 interruptions PARP2 (ADPRTL2) PARP-like enzyme 14q11.2 NMOOS484 Direct Reversal of Damage MGMT O-meGalkyltransferase 10q26.3 NMOO2412 MGC90512 (ABH2) -meA dioxygenase 12q24.11 NMOO16SS DEPC-1 (ABH3) -meA dioxygenase 11p11.2 NM 1391.78 Repair of DNA protein cross links TDP1 Removes covalently 14q32.11 NMO18319 bound TOP1-DNA complexes Mismatch excision repair (MMR) MSH2 Mismatch and loop 2p21 recognition MSH3 Mismatch and loop 5q14.1 NMOO2439 recognition MSH6 Mismatch and loop 2p16.3 NMOOO179 recognition MSH4 MutS homologues 1p31.1 NMOO2440 specialised for meiosis MSHS MutS homologues 6p21.33 NMOO2441 specialised for meiosis PMS1 MutL homologue 2a32.2 NMOOOS34 MILE1 MutL homologues 3p22.3 NMOOO249 forming heterodimer PMS2 MutL homologues 7p22.1 NMOOOS35 forming heterodimer MLE3 MutL homologues of 14q24.3 NMO14381 unknown function PMS2L3 MutL homologues of 7q11.23 D38437 unknown function PMS2L4(PMS6) MutL homologues of 7q11.21 D38SOO unknown function Nucleotide excision (XP = xeroderma repair (NER) pigmentosum) XPC Binds damaged DNA as NMO4628 complex RAD23B (HR23B) Binds damaged DNA as NMOO2874 complex CETN2 Binds damaged DNA as NMOO4344 complex RAD23A (HR23A) Substitutes for HR23B 19p13.13 NMOOSOS3 XPA Binds damaged DNA in 9q22.33 NMOOO380 preincision complex RPA1 Binds DNA in preincision 17p13.3 NMOO2945 complex RPA2 Binds DNA in preincision 1p35.3 NMOO2946 complex RPA3 Binds DNA in preincision 7p21.3 NMOO2947 complex Catalyses unwinding in preincision complex 3' to 5' DNA helicase 2q14.3 NMOOO122 5' to 3' DNA helicase 19q13.32 NMOOO400 Core TFIIH subunit p82 11 p.15.1 NMOOS316 Core TFIIH subunit p44 5q13.2 NMOO1515 Core TFIIH subunit p34 12q24.31 NMOO1516 Core TFIIH subunit p52 6p21.33 NMOO1517 US 2010/0179070 A1 Jul. 15, 2010 TABLE 1-continued Genes Encoding DNA Repair Enzymes or having a DNA Repair function Gene Name Chromosome NCBI (Synonyms) Activity Location Accession No. GTF2H5 (TTDA) Core TFIIH subunit p8 6p25.3 NM2O7118 CDK7 Kinase subunit of TFIIH 5q13.2 NMOO1799 CCNH Kinase subunit of TFIIH 5q14.3 NMOO1239 MNAT1 Kinase subunit of TFIIH 14q23.1 NMOO2431 ERCC5 (XPG) 3' incision 13q33.1 NMOOO123 ERCC1 5'incision subunit 19q13.32 NMOO1983 ERCC4 (XPF) 5'incision subunit 16p13.12 NMOOS236 LIG1 DNA joining 19q13.32 NMOOO234 NER-related CKN1 (CSA) Cockayne syndrome; 5q12.1 NMOOOO82 needed for transcription coupled NER ERCC6 (CSB) Cockayne syndrome; Oq11.23 NMOOO124 needed for transcription coupled NER XAB2 (HCNP) Cockayne syndrome; 9p13.2 needed for transcription coupled NER DDB1 Complex defective in XP 1a12.2 NMOO1923 group E. DDB2 Complex defective in XP 1p11.2 NMOOO107 group E. MMS19L (MMS19) Transcription and NER Oa24.1 NMO22362 Homologous Recombination RADS1 Homologous pairing 5d.15.1 NMOO2875 RAD51L1 (RAD51B) RadS1 homologue 4q24.1 NMOO2877 RADS1C RadS1 homologue 723.2 NMOO2876 RAD51 L3 (RAD51D) RadS1 homologue 712 NMOO2878 DMC1 Rad51 homologue, 22d 13.1 NMOO7O68 meiosis DNA break and crosslink NMOOS431 repair DNA break and crosslink NMOOS432 repair RADS2 Accessory
Load more

Recommended publications
  • SNM1A (DCLRE1A) (NM 001271816) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC235137 SNM1A (DCLRE1A) (NM_001271816) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: SNM1A (DCLRE1A) (NM_001271816) Human Tagged ORF Clone Tag: Myc-DDK Symbol: DCLRE1A Synonyms: PSO2; SNM1; SNM1A Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC235137 representing NM_001271816 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTAGAAGACATTTCCGAAGAAGACATTTGGGAATACAAATCTAAAAGAAAACCAAAACGAGTTGATC CAAATAATGGCTCTAAAAATATTCTAAAATCTGTTGAAAAAGCAACAGATGGAAAATACCAGTCAAAACG GAGTAGAAACAGAAAAAGAGCCGCAGAAGCTAAAGAGGTGAAGGACCATGAAGTGCCCCTTGGAAATGCA GGTTGTCAGACTTCTGTTGCTTCTAGTCAGAATTCAAGTTGTGGAGATGGTATTCAGCAGACCCAAGACA AGGAAACTACTCCAGGAAAACTCTGTAGAACTCAAAAAAGCCAACACGTGTCCCCAAAGATACGTCCAGT TTATGATGGATACTGTCCAAATTGCCAGATGCCTTTTTCCTCATTGATAGGGCAGACACCTCGATGGCAT GTTTTTGAATGTTTGGATTCTCCACCACGCTCTGAAACAGAGTGTCCTGATGGTCTTCTGTGTACCTCAA CCATTCCTTTTCATTACAAGAGATACACTCACTTCCTGCTAGCTCAAAGCAGGGCTGGTGATCATCCTTT TAGCAGCCCATCACCTGCGTCAGGTGGCAGTTTCAGTGAGACTAAGTCAGGCGTCCTTTGTAGCCTTGAG GAAAGATGGTCTTCGTATCAGAACCAAACTGATAACTCGGTTTCAAATGATCCCTTATTGATGACACAGT ATTTTAAAAAGTCTCCGTCTCTGACTGAAGCCAGTGAAAAGATTTCTACTCATATCCAAACATCCCAACA AGCTCTACAATTTACAGATTTTGTTGAGAATGACAAACTAGTGGGAGTTGCTTTGCGTCTTGCAAACAAC
    [Show full text]
  • Detailed Characterization of Human Induced Pluripotent Stem Cells Manufactured for Therapeutic Applications
    Stem Cell Rev and Rep DOI 10.1007/s12015-016-9662-8 Detailed Characterization of Human Induced Pluripotent Stem Cells Manufactured for Therapeutic Applications Behnam Ahmadian Baghbaderani 1 & Adhikarla Syama2 & Renuka Sivapatham3 & Ying Pei4 & Odity Mukherjee2 & Thomas Fellner1 & Xianmin Zeng3,4 & Mahendra S. Rao5,6 # The Author(s) 2016. This article is published with open access at Springerlink.com Abstract We have recently described manufacturing of hu- help determine which set of tests will be most useful in mon- man induced pluripotent stem cells (iPSC) master cell banks itoring the cells and establishing criteria for discarding a line. (MCB) generated by a clinically compliant process using cord blood as a starting material (Baghbaderani et al. in Stem Cell Keywords Induced pluripotent stem cells . Embryonic stem Reports, 5(4), 647–659, 2015). In this manuscript, we de- cells . Manufacturing . cGMP . Consent . Markers scribe the detailed characterization of the two iPSC clones generated using this process, including whole genome se- quencing (WGS), microarray, and comparative genomic hy- Introduction bridization (aCGH) single nucleotide polymorphism (SNP) analysis. We compare their profiles with a proposed calibra- Induced pluripotent stem cells (iPSCs) are akin to embryonic tion material and with a reporter subclone and lines made by a stem cells (ESC) [2] in their developmental potential, but dif- similar process from different donors. We believe that iPSCs fer from ESC in the starting cell used and the requirement of a are likely to be used to make multiple clinical products. We set of proteins to induce pluripotency [3]. Although function- further believe that the lines used as input material will be used ally identical, iPSCs may differ from ESC in subtle ways, at different sites and, given their immortal status, will be used including in their epigenetic profile, exposure to the environ- for many years or even decades.
    [Show full text]
  • Persistent Transcription-Blocking DNA Lesions Trigger Somatic Growth Attenuation Associated with Longevity
    ARTICLES Persistent transcription-blocking DNA lesions trigger somatic growth attenuation associated with longevity George A. Garinis1,2, Lieneke M. Uittenboogaard1, Heike Stachelscheid3,4, Maria Fousteri5, Wilfred van Ijcken6, Timo M. Breit7, Harry van Steeg8, Leon H. F. Mullenders5, Gijsbertus T. J. van der Horst1, Jens C. Brüning4,9, Carien M. Niessen3,9,10, Jan H. J. Hoeijmakers1 and Björn Schumacher1,9,11 The accumulation of stochastic DNA damage throughout an organism’s lifespan is thought to contribute to ageing. Conversely, ageing seems to be phenotypically reproducible and regulated through genetic pathways such as the insulin-like growth factor-1 (IGF-1) and growth hormone (GH) receptors, which are central mediators of the somatic growth axis. Here we report that persistent DNA damage in primary cells from mice elicits changes in global gene expression similar to those occurring in various organs of naturally aged animals. We show that, as in ageing animals, the expression of IGF-1 receptor and GH receptor is attenuated, resulting in cellular resistance to IGF-1. This cell-autonomous attenuation is specifically induced by persistent lesions leading to stalling of RNA polymerase II in proliferating, quiescent and terminally differentiated cells; it is exacerbated and prolonged in cells from progeroid mice and confers resistance to oxidative stress. Our findings suggest that the accumulation of DNA damage in transcribed genes in most if not all tissues contributes to the ageing-associated shift from growth to somatic maintenance that triggers stress resistance and is thought to promote longevity. Ageing represents the progressive functional decline that is exempted levels as a result of pituitary dysfunction (Snell and Ames mice) — have an from evolutionary selection because it largely occurs after reproduc- extended lifespan17–20.
    [Show full text]
  • Cell-Deposited Matrix Improves Retinal Pigment Epithelium Survival on Aged Submacular Human Bruch’S Membrane
    Retinal Cell Biology Cell-Deposited Matrix Improves Retinal Pigment Epithelium Survival on Aged Submacular Human Bruch’s Membrane Ilene K. Sugino,1 Vamsi K. Gullapalli,1 Qian Sun,1 Jianqiu Wang,1 Celia F. Nunes,1 Noounanong Cheewatrakoolpong,1 Adam C. Johnson,1 Benjamin C. Degner,1 Jianyuan Hua,1 Tong Liu,2 Wei Chen,2 Hong Li,2 and Marco A. Zarbin1 PURPOSE. To determine whether resurfacing submacular human most, as cell survival is the worst on submacular Bruch’s Bruch’s membrane with a cell-deposited extracellular matrix membrane in these eyes. (Invest Ophthalmol Vis Sci. 2011;52: (ECM) improves retinal pigment epithelial (RPE) survival. 1345–1358) DOI:10.1167/iovs.10-6112 METHODS. Bovine corneal endothelial (BCE) cells were seeded onto the inner collagenous layer of submacular Bruch’s mem- brane explants of human donor eyes to allow ECM deposition. here is no fully effective therapy for the late complications of age-related macular degeneration (AMD), the leading Control explants from fellow eyes were cultured in medium T cause of blindness in the United States. The prevalence of only. The deposited ECM was exposed by removing BCE. Fetal AMD-associated choroidal new vessels (CNVs) and/or geo- RPE cells were then cultured on these explants for 1, 14, or 21 graphic atrophy (GA) in the U.S. population 40 years and older days. The explants were analyzed quantitatively by light micros- is estimated to be 1.47%, with 1.75 million citizens having copy and scanning electron microscopy. Surviving RPE cells from advanced AMD, approximately 100,000 of whom are African explants cultured for 21 days were harvested to compare bestro- American.1 The prevalence of AMD increases dramatically with phin and RPE65 mRNA expression.
    [Show full text]
  • A System for Enhancing Genome-Wide Coexpression Dynamics Study
    A system for enhancing genome-wide coexpression dynamics study Ker-Chau Li†‡, Ching-Ti Liu, Wei Sun, Shinsheng Yuan†, and Tianwei Yu Department of Statistics, 8125 Mathematical Sciences Building, University of California, Los Angeles, CA 90095-1554 Edited by Michael S. Waterman, University of Southern California, Los Angeles, CA, and approved August 30, 2004 (received for review April 28, 2004) Statistical similarity analysis has been instrumental in elucidation mRNA level. Yet a third possibility can be described in terms of LA. of the voluminous microarray data. Genes with correlated expres- This more advanced concept of statistical association originates sion profiles tend to be functionally associated. However, the from the need to describe a situation as schematized in Fig. 1 Left, majority of functionally associated genes turn out to be uncorre- wherein two opposing trends between X and Y are displayed. The lated. One conceivable reason is that the expression of a gene can positive and negative correlations cancel each other out, rendering be sensitively dependent on the often-varying cellular state. The the overall correlation insignificant. It would be valuable to learn intrinsic state change has to be plastically accommodated by why and how the change of trend occurs. But for real data, such gene-regulatory mechanisms. To capture such dynamic coexpres- hidden trends are not easy to detect directly from the scatterplot of sion between genes, a concept termed ‘‘liquid association’’ (LA) has X and Y. To alleviate the difficulty, we look for additional variables been introduced recently. LA offers a scoring system to guide a that may be associated with the change of the trend.
    [Show full text]
  • Identification of Novel DNA-Damage Tolerance Genes Reveals Regulation
    ARTICLE Received 22 Apr 2014 | Accepted 1 Oct 2014 | Published 25 Nov 2014 DOI: 10.1038/ncomms6437 OPEN Identification of novel DNA-damage tolerance genes reveals regulation of translesion DNA synthesis by nucleophosmin Omer Ziv1, Amit Zeisel2, Nataly Mirlas-Neisberg1, Umakanta Swain1, Reinat Nevo1, Nir Ben-Chetrit3, Maria Paola Martelli4, Roberta Rossi4, Stefan Schiesser5, Christine E. Canman6, Thomas Carell5, Nicholas E. Geacintov7, Brunangelo Falini4, Eytan Domany2 & Zvi Livneh1 Cells cope with replication-blocking lesions via translesion DNA synthesis (TLS). TLS is carried out by low-fidelity DNA polymerases that replicate across lesions, thereby pre- venting genome instability at the cost of increased point mutations. Here we perform a two- stage siRNA-based functional screen for mammalian TLS genes and identify 17 validated TLS genes. One of the genes, NPM1, is frequently mutated in acute myeloid leukaemia (AML). We show that NPM1 (nucleophosmin) regulates TLS via interaction with the catalytic core of DNA polymerase-Z (polZ), and that NPM1 deficiency causes a TLS defect due to protea- somal degradation of polZ. Moreover, the prevalent NPM1c þ mutation that causes NPM1 mislocalization in B30% of AML patients results in excessive degradation of polZ. These results establish the role of NPM1 as a key TLS regulator, and suggest a mechanism for the better prognosis of AML patients carrying mutations in NPM1. 1 Department of Biological Chemistry, Weizmann Institute of Science, Rehovot 76100, Israel. 2 Department of Physics of Complex Systems, Weizmann Institute of Science, Rehovot 76100, Israel. 3 Department of Biological Regulation, Weizmann Institute of Science, Rehovot 76100, Israel. 4 Institute of Hematology, University of Perugia, Perugia 06100, Italy.
    [Show full text]
  • Differential Mechanisms of Tolerance to Extreme Environmental
    www.nature.com/scientificreports OPEN Diferential mechanisms of tolerance to extreme environmental conditions in tardigrades Dido Carrero*, José G. Pérez-Silva , Víctor Quesada & Carlos López-Otín * Tardigrades, also known as water bears, are small aquatic animals that inhabit marine, fresh water or limno-terrestrial environments. While all tardigrades require surrounding water to grow and reproduce, species living in limno-terrestrial environments (e.g. Ramazzottius varieornatus) are able to undergo almost complete dehydration by entering an arrested state known as anhydrobiosis, which allows them to tolerate ionic radiation, extreme temperatures and intense pressure. Previous studies based on comparison of the genomes of R. varieornatus and Hypsibius dujardini - a less tolerant tardigrade - have pointed to potential mechanisms that may partially contribute to their remarkable ability to resist extreme physical conditions. In this work, we have further annotated the genomes of both tardigrades using a guided approach in search for novel mechanisms underlying the extremotolerance of R. varieornatus. We have found specifc amplifcations of several genes, including MRE11 and XPC, and numerous missense variants exclusive of R. varieornatus in CHEK1, POLK, UNG and TERT, all of them involved in important pathways for DNA repair and telomere maintenance. Taken collectively, these results point to genomic features that may contribute to the enhanced ability to resist extreme environmental conditions shown by R. varieornatus. Tardigrades are small
    [Show full text]
  • Identification of a Panel of MYC and Tip60 Co-Regulated Genes Functioning Primarily in Cell Cycle and DNA Replication
    www.Genes&Cancer.com Genes & Cancer, Vol. 9 (3-4), March 2018 Identification of a panel of MYC and Tip60 co-regulated genes functioning primarily in cell cycle and DNA replication Ling-Jun Zhao1, Paul M. Loewenstein1 and Maurice Green1 1 Department of Microbiology and Molecular Immunology, Saint Louis University School of Medicine, Doisy Research Center, St. Louis, Missouri, USA Correspondence to: Paul M. Loewenstein, email: [email protected] Keywords: MYC; NuA4 complex; Tip60; p300; cancer Received: May 16, 2018 Accepted: July 22, 2018 Published: July 29, 2018 Copyright: Zhao et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License 3.0 (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT We recently reported that adenovirus E1A enhances MYC association with the NuA4/Tip60 histone acetyltransferase (HAT) complex to activate a panel of genes enriched for DNA replication and cell cycle. Genes from this panel are highly expressed in examined cancer cell lines when compared to normal fibroblasts. To further understand gene regulation in cancer by MYC and the NuA4 complex, we performed RNA-seq analysis of MD-MB231 breast cancer cells following knockdown of MYC or Tip60 - the HAT enzyme of the NuA4 complex. We identify here a panel of 424 genes, referred to as MYC-Tip60 co-regulated panel (MTcoR), that are dependent on both MYC and Tip60 for expression and likely co-regulated by MYC and the NuA4 complex. The MTcoR panel is most significantly enriched in genes involved in cell cycle and/ or DNA replication.
    [Show full text]
  • Original Article Bioinformatic Analysis of the Role of MNAT1 in the Progression of Lung Cancer and Its Correlation with the Prognosis of Patients
    Int J Clin Exp Med 2019;12(7):8098-8106 www.ijcem.com /ISSN:1940-5901/IJCEM0090087 Original Article Bioinformatic analysis of the role of MNAT1 in the progression of lung cancer and its correlation with the prognosis of patients Lifei Wang1, Furong Tan1, Yali Qiu1, Gang Chen2 1Department of Respiration, The Third Hospital of Changzhou, Changzhou, China; 2Department of Respiration, The Third Hospital of Hebei Medical University, Shijiazhaung, China Received December 18, 2018; Accepted April 9, 2019; Epub July 15, 2019; Published July 30, 2019 Abstract: Objective: The objective of the present study was to analyse the effects of MNAT1 on the progression of lung cancer and its role in predicting the prognosis of patients with lung cancer. Methods: Gene expression array data of lung cancer patients and non-lung cancer patients was downloaded from a public database (GEO) for bio- informatics analysis. DAVID and STRING databases were used to screen differentially expressed genes, which were then subjected to GO enrichment analysis, signal pathway analysis and protein interaction analysis. In addition, the clinical data of the lung cancer patients was obtained from the Oncomine database and used to analyse the effect of MNAT1 expression levels on overall survival. Results: A total of 178 differentially expressed genes were obtained from the matrix database, among which 14 genes were expressed at a high level, including MNAT1, and 164 were expressed at a low level. GO enrichment analysis showed that the differentially expressed genes were mainly locat- ed in the nucleus and cytoplasm and were involved in cell cycle regulation and DNA repair.
    [Show full text]
  • International Journal of Case Reports (ISSN
    Raja Nandyal et al., IJCR, 2019 4:106 Case Report IJCR (2019) 4:106 International Journal of Case Reports (ISSN:2572-8776) Neonate with 10q Interstitial Deletion within the Long Arm of Chromosome 10- A Case Report and Literature Review Raja Nandyal1, Sara Hagan2 and Tavleen Sandhu3 1department of Pediatrics (Neonatology section), Oklahoma University Health Sciences Center, Oklahoma, USA; 2OU Medicine, Oklahoma University Health Sciences Center, Oklahoma, USA; 3department of Pediatrics (Neonatology section), Oklahoma University Health Sciences Center, Oklahoma, USA. ABSTRACT Introduction: Partial deletion of distal chromosome 10q was first Keywords: Chromosome 10 q reported in 1978 by Lewandowski1. Interstitial deletions within deletions, Interstitial deletions, Cleft bands 10q25e10q26.3 are rare. Seven such cases were report- lip and Cleft palate anomalies ed so far2. Patient Information: A term AGA male newborn was delivered at our perinatal center with antenatal diagnosis of *Correspondence to Author: unbalanced translocation of chromosomes 10 and 12, and fetal Raja Nandyal, MD: Professor of cleft lip and cleft palate. Blood was sent for chromosome analy- Pediatrics; Neonatology Section- sis using GTG banding method. Baby had facial dysmorphism, Department of Pediatrics, OUHSC; left cleft lip, bilateral cleft of soft and hard palate, intact nasal Women and Children’s Pavilion, septum, normal ears and micrognathus. Abdominal ultrasound Neonatology Offices, 1200 Everett showed absence of right testis in inguinal canal and abdomen Tower, 7th Floor, Oklahoma City, (anorchia). Hospital course was unremarkable except for feeding OK 73104, USA problems requiring feeding team, plastic surgery planned at 2- 3 months of age, and taping of the cleft lip. He went home on day 7.
    [Show full text]
  • The Role of Double Strand Break Repair, Translesion Synthesis and Interstrand Crosslinks in Colorectal Cancer Progression – Clinicopathological Data and Survival
    The role of Double Strand Break Repair, Translesion Synthesis and Interstrand Crosslinks in Colorectal Cancer progression – clinicopathological data and survival. Gustavo Andreazza Laporte ( [email protected] ) Irmandade da Santa Casa de Misericordia de Sao Paulo https://orcid.org/0000-0002-5363-1055 Natalia Meirelles Leguisamo Instituto de Cardiologia Helena de Castro e Glória Universidade Federal de Ciencias da Saude de Porto Alegre Daniel de Barcellos Azambuja Santa Casa de Misericordia de Porto Alegre Antonio Nocchi Kalil Universidade Federal de Ciencias da Saude de Porto Alegre Jenifer Sa Universidade Federal de Ciencias da Saude de Porto Alegre Research article Keywords: colorectal cancer, DNA damage response, prognostic biomarkers Posted Date: June 24th, 2019 DOI: https://doi.org/10.21203/rs.2.10554/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Version of Record: A version of this preprint was published at Journal of Surgical Oncology on October 25th, 2019. See the published version at https://doi.org/10.1002/jso.25737. Page 1/18 Abstract Abstract Aim: To evaluate the prognostic value of molecular modulation of double strand break (DSBR) - XRCC2 and XRCC5 - core components; DNA damage tolerance/translesion synthesis (DDT/TLS) - POLH, POLK and POLQ – and, nally, of interstrand crosslink repair (ICLR) -DCLRE1A – pathways in sporadic colorectal cancer (CRC) progression. Method: Tumour specimens and matched health mucosal tissues from 47 patients with CRC who underwent surgery were assessed for gene expression of XRCC2, XRCC5, POLH, POLK, POLQ and DCLRE1A by qRT-PCR; protein expression of Polk, Ku80, p53, Ki67 and mismatch repair MLH1 and MSH2 components were assessed by immunohistochemistry (IHC); CpG island promoter methylation of XRCC5, POLH, POLK, POLQ and DCLRE1A was performed.
    [Show full text]
  • The Role of ADP-Ribosylation in Regulating DNA Interstrand Crosslink Repair Alasdair R
    © 2016. Published by The Company of Biologists Ltd | Journal of Cell Science (2016) 129, 3845-3858 doi:10.1242/jcs.193375 RESEARCH ARTICLE The role of ADP-ribosylation in regulating DNA interstrand crosslink repair Alasdair R. Gunn1,‡, Benito Banos-Pinero2,‡, Peggy Paschke1,*, Luis Sanchez-Pulido3, Antonio Ariza2, Joseph Day1, Mehera Emrich1, David Leys4, Chris P. Ponting3, Ivan Ahel2,§ and Nicholas D. Lakin1,§ ABSTRACT genes containing predicted ART domains being identified in ADP-ribosylation by ADP-ribosyltransferases (ARTs) has a well- humans (Hottiger et al., 2010). PARP1 and PARP2, the founder established role in DNA strand break repair by promoting enrichment members of the ART family, in addition to PARP5a and PARP5b of repair factors at damage sites through ADP-ribose interaction (also known as TNKS and TNKS2, respectively) are poly-ARTs. domains. Here, we exploit the simple eukaryote Dictyostelium to All other active ARTs catalyse MARylation (Vyas et al., 2014). uncover a role for ADP-ribosylation in regulating DNA interstrand ADP-ribosylation has been implicated in a wide variety of cellular crosslink repair and redundancy of this pathway with non- processes including cell growth and differentiation, transcriptional homologous end-joining (NHEJ). In silico searches were used to regulation and programmed cell death (Hottiger et al., 2010; identify a protein that contains a permutated macrodomain (which we Messner and Hottiger, 2011; Quenet et al., 2009). call aprataxin/APLF-and-PNKP-like protein; APL). Structural analysis The best defined role of ARTs is in DNA repair, particularly of reveals that this permutated macrodomain retains features DNA strand breaks. PARP1 is recruited to and activated by DNA associated with ADP-ribose interactions and that APL is capable of single-strand breaks (SSBs) and modifies a variety of substrates, binding poly(ADP-ribose) through this macrodomain.
    [Show full text]