Rare Intronic Variants of TCF7L2 Arising by Selective Sweeps in An
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Assembly and Maintenance of Sarcomere Thin Filaments and Associated Diseases
International Journal of Molecular Sciences Review Assembly and Maintenance of Sarcomere Thin Filaments and Associated Diseases Kendal Prill and John F. Dawson * Centre for Cardiovascular Investigations, Department of Molecular and Cellular Biology, University of Guelph, Guelph, ON N1G 2W1, Canada; [email protected] * Correspondence: [email protected] Received: 17 December 2019; Accepted: 12 January 2020; Published: 15 January 2020 Abstract: Sarcomere assembly and maintenance are essential physiological processes required for cardiac and skeletal muscle function and organism mobility. Over decades of research, components of the sarcomere and factors involved in the formation and maintenance of this contractile unit have been identified. Although we have a general understanding of sarcomere assembly and maintenance, much less is known about the development of the thin filaments and associated factors within the sarcomere. In the last decade, advancements in medical intervention and genome sequencing have uncovered patients with novel mutations in sarcomere thin filaments. Pairing this sequencing with reverse genetics and the ability to generate patient avatars in model organisms has begun to deepen our understanding of sarcomere thin filament development. In this review, we provide a summary of recent findings regarding sarcomere assembly, maintenance, and disease with respect to thin filaments, building on the previous knowledge in the field. We highlight debated and unknown areas within these processes to clearly define open research questions. Keywords: sarcomere assembly; sarcomere maintenance; sarcomere thin filaments; thin filament assembly; thin filament maintenance; thin filament turnover; actin turnover; chaperone; sarcomere; myopathy 1. Introduction Striated muscle requires the coordination of hundreds of proteins not only for cellular function but also for assembly of the contractile sarcomere units within the myofibril. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Stockholm University
Stockholm University This is a published version of a paper published in Journal of Molecular Biology. Citation for the published paper: Björklund, Å., Light, S., Sagit, R., Elofsson, A. (2010) "Nebulin: A Study of Protein Repeat Evolution" Journal of Molecular Biology, 402(1): 38-51 URL: http://dx.doi.org/10.1016/j.jmb.2010.07.011 Access to the published version may require subscription. Permanent link to this version: http://urn.kb.se/resolve?urn=urn:nbn:se:su:diva-50177 http://su.diva-portal.org RGR YJMBI-62434; No. of pages: 14; 4C: 2, 5, 8, 9 doi:10.1016/j.jmb.2010.07.011 J. Mol. Biol. (2010) xx, xxx–xxx Available online at www.sciencedirect.com Nebulin: A Study of Protein Repeat Evolution Åsa K. Björklund, Sara Light†, Rauan Sagit† and Arne Elofsson⁎ Center for Biological Membrane Protein domain repeats are common in proteins that are central to the Research, Stockholm organization of a cell, in particular in eukaryotes. They are known to evolve Bioinformatics Center, through internal tandem duplications. However, the understanding of the Department of Biochemistry and underlying mechanisms is incomplete. To shed light on repeat expansion Biophysics, Stockholm mechanisms, we have studied the evolution of the muscle protein Nebulin, University, Stockholm, Sweden a protein that contains a large number of actin-binding nebulin domains. Nebulin proteins have evolved from an invertebrate precursor containing Received 30 March 2010; two nebulin domains. Repeat regions have expanded through duplications received in revised form of single domains, as well as duplications of a super repeat (SR) consisting 22 June 2010; of seven nebulins. -
Cellular and Molecular Signatures in the Disease Tissue of Early
Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of -
2020 Program Book
PROGRAM BOOK Note that TAGC was cancelled and held online with a different schedule and program. This document serves as a record of the original program designed for the in-person meeting. April 22–26, 2020 Gaylord National Resort & Convention Center Metro Washington, DC TABLE OF CONTENTS About the GSA ........................................................................................................................................................ 3 Conference Organizers ...........................................................................................................................................4 General Information ...............................................................................................................................................7 Mobile App ....................................................................................................................................................7 Registration, Badges, and Pre-ordered T-shirts .............................................................................................7 Oral Presenters: Speaker Ready Room - Camellia 4.......................................................................................7 Poster Sessions and Exhibits - Prince George’s Exhibition Hall ......................................................................7 GSA Central - Booth 520 ................................................................................................................................8 Internet Access ..............................................................................................................................................8 -
Cardiomyopathy Precision Panel Overview Indications
Cardiomyopathy Precision Panel Overview Cardiomyopathies are a group of conditions with a strong genetic background that structurally hinder the heart to pump out blood to the rest of the body due to weakness in the heart muscles. These diseases affect individuals of all ages and can lead to heart failure and sudden cardiac death. If there is a family history of cardiomyopathy it is strongly recommended to undergo genetic testing to be aware of the family risk, personal risk, and treatment options. Most types of cardiomyopathies are inherited in a dominant manner, which means that one altered copy of the gene is enough for the disease to present in an individual. The symptoms of cardiomyopathy are variable, and these diseases can present in different ways. There are 5 types of cardiomyopathies, the most common being hypertrophic cardiomyopathy: 1. Hypertrophic cardiomyopathy (HCM) 2. Dilated cardiomyopathy (DCM) 3. Restrictive cardiomyopathy (RCM) 4. Arrhythmogenic Right Ventricular Cardiomyopathy (ARVC) 5. Isolated Left Ventricular Non-Compaction Cardiomyopathy (LVNC). The Igenomix Cardiomyopathy Precision Panel serves as a diagnostic and tool ultimately leading to a better management and prognosis of the disease. It provides a comprehensive analysis of the genes involved in this disease using next-generation sequencing (NGS) to fully understand the spectrum of relevant genes. Indications The Igenomix Cardiomyopathy Precision Panel is indicated in those cases where there is a clinical suspicion of cardiomyopathy with or without the following manifestations: - Shortness of breath - Fatigue - Arrythmia (abnormal heart rhythm) - Family history of arrhythmia - Abnormal scans - Ventricular tachycardia - Ventricular fibrillation - Chest Pain - Dizziness - Sudden cardiac death in the family 1 Clinical Utility The clinical utility of this panel is: - The genetic and molecular diagnosis for an accurate clinical diagnosis of a patient with personal or family history of cardiomyopathy, channelopathy or sudden cardiac death. -
1 Demographic History, Cold Adaptation, and Recent NRAP Recurrent Convergent Evolution At
bioRxiv preprint doi: https://doi.org/10.1101/2020.06.15.151894; this version posted June 15, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Demographic history, cold adaptation, and recent NRAP recurrent convergent evolution at 2 amino acid residue 100 in the world northernmost cattle from Russia 3 4 Laura Buggiotti1, Andrey A. Yurchenko2, Nikolay S. Yudin2, Christy J. Vander Jagt3, Hans D. 5 Daetwyler3,4, Denis M. Larkin1,2,5 6 1Royal Veterinary College, University of London, London, UK. 7 2The Federal State Budgetary Institution of Science Federal Research Center Institute of Cytology 8 and Genetics, Siberian Branch of the Russian Academy of Sciences (ICG SB RAS), Novosibirsk, 9 Russia. 10 3Agriculture Victoria, AgriBio, Centre for AgriBioscience, Bundoora, 3083, Victoria, Australia. 11 4School of Applied Systems Biology, La Trobe University, Bundoora, 3083, Victoria, Australia. 12 5Kurchatov Genomics Center, the Federal Research Center Institute of Cytology and Genetics, 13 Siberian Branch of the Russian Academy of Science, Novosibirsk, Russia. 14 15 Abstract 16 Native cattle breeds represent an important cultural heritage. They are a reservoir of genetic variation 17 useful for properly responding to agriculture needs in light of ongoing climate changes. Evolutionary 18 processes that occur in response to extreme environmental conditions could also be better understood 19 using adapted local populations. Herein, different evolutionary histories for two of the world 20 northernmost native cattle breeds from Russia were investigated. They highlighted Kholmogory as a 21 typical taurine cattle, while Yakut cattle separated from European taurines ~5,000 years ago and 22 contain numerous ancestral and some novel genetic variants allowing their adaptation to harsh 23 conditions of living above the Polar Circle. -
SNM1A (DCLRE1A) (NM 001271816) Human Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC235137 SNM1A (DCLRE1A) (NM_001271816) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: SNM1A (DCLRE1A) (NM_001271816) Human Tagged ORF Clone Tag: Myc-DDK Symbol: DCLRE1A Synonyms: PSO2; SNM1; SNM1A Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC235137 representing NM_001271816 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTAGAAGACATTTCCGAAGAAGACATTTGGGAATACAAATCTAAAAGAAAACCAAAACGAGTTGATC CAAATAATGGCTCTAAAAATATTCTAAAATCTGTTGAAAAAGCAACAGATGGAAAATACCAGTCAAAACG GAGTAGAAACAGAAAAAGAGCCGCAGAAGCTAAAGAGGTGAAGGACCATGAAGTGCCCCTTGGAAATGCA GGTTGTCAGACTTCTGTTGCTTCTAGTCAGAATTCAAGTTGTGGAGATGGTATTCAGCAGACCCAAGACA AGGAAACTACTCCAGGAAAACTCTGTAGAACTCAAAAAAGCCAACACGTGTCCCCAAAGATACGTCCAGT TTATGATGGATACTGTCCAAATTGCCAGATGCCTTTTTCCTCATTGATAGGGCAGACACCTCGATGGCAT GTTTTTGAATGTTTGGATTCTCCACCACGCTCTGAAACAGAGTGTCCTGATGGTCTTCTGTGTACCTCAA CCATTCCTTTTCATTACAAGAGATACACTCACTTCCTGCTAGCTCAAAGCAGGGCTGGTGATCATCCTTT TAGCAGCCCATCACCTGCGTCAGGTGGCAGTTTCAGTGAGACTAAGTCAGGCGTCCTTTGTAGCCTTGAG GAAAGATGGTCTTCGTATCAGAACCAAACTGATAACTCGGTTTCAAATGATCCCTTATTGATGACACAGT ATTTTAAAAAGTCTCCGTCTCTGACTGAAGCCAGTGAAAAGATTTCTACTCATATCCAAACATCCCAACA AGCTCTACAATTTACAGATTTTGTTGAGAATGACAAACTAGTGGGAGTTGCTTTGCGTCTTGCAAACAAC -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase -
Figure S1. HAEC ROS Production and ML090 NOX5-Inhibition
Figure S1. HAEC ROS production and ML090 NOX5-inhibition. (a) Extracellular H2O2 production in HAEC treated with ML090 at different concentrations and 24 h after being infected with GFP and NOX5-β adenoviruses (MOI 100). **p< 0.01, and ****p< 0.0001 vs control NOX5-β-infected cells (ML090, 0 nM). Results expressed as mean ± SEM. Fold increase vs GFP-infected cells with 0 nM of ML090. n= 6. (b) NOX5-β overexpression and DHE oxidation in HAEC. Representative images from three experiments are shown. Intracellular superoxide anion production of HAEC 24 h after infection with GFP and NOX5-β adenoviruses at different MOIs treated or not with ML090 (10 nM). MOI: Multiplicity of infection. Figure S2. Ontology analysis of HAEC infected with NOX5-β. Ontology analysis shows that the response to unfolded protein is the most relevant. Figure S3. UPR mRNA expression in heart of infarcted transgenic mice. n= 12-13. Results expressed as mean ± SEM. Table S1: Altered gene expression due to NOX5-β expression at 12 h (bold, highlighted in yellow). N12hvsG12h N18hvsG18h N24hvsG24h GeneName GeneDescription TranscriptID logFC p-value logFC p-value logFC p-value family with sequence similarity NM_052966 1.45 1.20E-17 2.44 3.27E-19 2.96 6.24E-21 FAM129A 129. member A DnaJ (Hsp40) homolog. NM_001130182 2.19 9.83E-20 2.94 2.90E-19 3.01 1.68E-19 DNAJA4 subfamily A. member 4 phorbol-12-myristate-13-acetate- NM_021127 0.93 1.84E-12 2.41 1.32E-17 2.69 1.43E-18 PMAIP1 induced protein 1 E2F7 E2F transcription factor 7 NM_203394 0.71 8.35E-11 2.20 2.21E-17 2.48 1.84E-18 DnaJ (Hsp40) homolog. -
Detailed Characterization of Human Induced Pluripotent Stem Cells Manufactured for Therapeutic Applications
Stem Cell Rev and Rep DOI 10.1007/s12015-016-9662-8 Detailed Characterization of Human Induced Pluripotent Stem Cells Manufactured for Therapeutic Applications Behnam Ahmadian Baghbaderani 1 & Adhikarla Syama2 & Renuka Sivapatham3 & Ying Pei4 & Odity Mukherjee2 & Thomas Fellner1 & Xianmin Zeng3,4 & Mahendra S. Rao5,6 # The Author(s) 2016. This article is published with open access at Springerlink.com Abstract We have recently described manufacturing of hu- help determine which set of tests will be most useful in mon- man induced pluripotent stem cells (iPSC) master cell banks itoring the cells and establishing criteria for discarding a line. (MCB) generated by a clinically compliant process using cord blood as a starting material (Baghbaderani et al. in Stem Cell Keywords Induced pluripotent stem cells . Embryonic stem Reports, 5(4), 647–659, 2015). In this manuscript, we de- cells . Manufacturing . cGMP . Consent . Markers scribe the detailed characterization of the two iPSC clones generated using this process, including whole genome se- quencing (WGS), microarray, and comparative genomic hy- Introduction bridization (aCGH) single nucleotide polymorphism (SNP) analysis. We compare their profiles with a proposed calibra- Induced pluripotent stem cells (iPSCs) are akin to embryonic tion material and with a reporter subclone and lines made by a stem cells (ESC) [2] in their developmental potential, but dif- similar process from different donors. We believe that iPSCs fer from ESC in the starting cell used and the requirement of a are likely to be used to make multiple clinical products. We set of proteins to induce pluripotency [3]. Although function- further believe that the lines used as input material will be used ally identical, iPSCs may differ from ESC in subtle ways, at different sites and, given their immortal status, will be used including in their epigenetic profile, exposure to the environ- for many years or even decades. -
Persistent Transcription-Blocking DNA Lesions Trigger Somatic Growth Attenuation Associated with Longevity
ARTICLES Persistent transcription-blocking DNA lesions trigger somatic growth attenuation associated with longevity George A. Garinis1,2, Lieneke M. Uittenboogaard1, Heike Stachelscheid3,4, Maria Fousteri5, Wilfred van Ijcken6, Timo M. Breit7, Harry van Steeg8, Leon H. F. Mullenders5, Gijsbertus T. J. van der Horst1, Jens C. Brüning4,9, Carien M. Niessen3,9,10, Jan H. J. Hoeijmakers1 and Björn Schumacher1,9,11 The accumulation of stochastic DNA damage throughout an organism’s lifespan is thought to contribute to ageing. Conversely, ageing seems to be phenotypically reproducible and regulated through genetic pathways such as the insulin-like growth factor-1 (IGF-1) and growth hormone (GH) receptors, which are central mediators of the somatic growth axis. Here we report that persistent DNA damage in primary cells from mice elicits changes in global gene expression similar to those occurring in various organs of naturally aged animals. We show that, as in ageing animals, the expression of IGF-1 receptor and GH receptor is attenuated, resulting in cellular resistance to IGF-1. This cell-autonomous attenuation is specifically induced by persistent lesions leading to stalling of RNA polymerase II in proliferating, quiescent and terminally differentiated cells; it is exacerbated and prolonged in cells from progeroid mice and confers resistance to oxidative stress. Our findings suggest that the accumulation of DNA damage in transcribed genes in most if not all tissues contributes to the ageing-associated shift from growth to somatic maintenance that triggers stress resistance and is thought to promote longevity. Ageing represents the progressive functional decline that is exempted levels as a result of pituitary dysfunction (Snell and Ames mice) — have an from evolutionary selection because it largely occurs after reproduc- extended lifespan17–20.