Downloaded from J Immunol 2007; 178:7292-7301; ; Doi: 10.4049/Jimmunol.178.11.7292

Dual Binding Specificity of a Borrelia hermsii -Associated Complement Regulator-Acquiring Surface Protein for Factor H and Plasminogen Discloses a This information is current as Putative Virulence Factor of Relapsing Fever of September 29, 2021. Spirochetes Evelyn Rossmann, Peter Kraiczy, Pia Herzberger, Christine Skerka, Michael Kirschfink, Markus M. Simon, Peter F.

Zipfel and Reinhard Wallich Downloaded from J Immunol 2007; 178:7292-7301; ; doi: 10.4049/jimmunol.178.11.7292 http://www.jimmunol.org/content/178/11/7292 http://www.jimmunol.org/

References This article cites 61 articles, 34 of which you can access for free at: http://www.jimmunol.org/content/178/11/7292.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision by guest on September 29, 2021

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2007 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Dual Binding Speciﬁcity of a Borrelia hermsii-Associated Complement Regulator-Acquiring Surface Protein for Factor H and Plasminogen Discloses a Putative Virulence Factor of Relapsing Fever Spirochetes1,2

Evelyn Rossmann,3* Peter Kraiczy,3† Pia Herzberger,† Christine Skerka,‡ Michael Kirschﬁnk,* Markus M. Simon,§ Peter F. Zipfel,‡ and Reinhard Wallich4*

Tick-borne relapsing fever in North America is primarily caused by the spirochete Borrelia hermsii. The pathogen employs multiple strategies, including the acquisition of complement regulators and antigenic variation, to escape innate and humoral

immunity. In this study we identified in B. hermsii a novel member of the complement regulator-acquiring surface protein Downloaded from (CRASP) family, designated BhCRASP-1, that binds the complement regulators factor H (FH) and FH-related protein 1 (FHR-1) but not FH-like protein 1 (FHL-1). BhCRASP-1 specifically interacts with the short consensus repeat 20 of FH, thereby main- taining FH-associated cofactor activity for factor I-mediated C3b inactivation. Furthermore, ectopic expression of BhCRASP- 1 converted the serum-sensitive Borrelia burgdorferi B313 strain into an intermediate complement-resistant strain. Finally, we report for the first time that BhCRASP-1 binds plasminogen/plasmin in addition to FH via, however, distinct nonoverlapping

domains. The fact that surface-bound plasmin retains its proteolytic activity suggest that the dual binding speciﬁcity of http://www.jimmunol.org/ BhCRASP-1 for FH and plasminogen/plasmin contributes to both the dissemination/invasion of B. hermsii and its resistance to innate immunity. The Journal of Immunology, 2007, 178: 7292–7301.

orrelia hermsii and Borrelia turicatae are the main vec- spirochetal surface. Bound FH controls complement activation by tor-borne pathogens causing human relapsing fever, an accelerating the decay of the C3 convertase of the alternative path- B acute infectious disorder, in the United States (1). In case way and by inactivating newly formed C3b (7, 8) as shown for of B. hermsii, spirochetes are transmitted to humans within min- several important human pathogens, e.g., Candida albicans, Neis- utes through the bite of infected soft ticks, in particular Ornithodo- seria gonorrhoeae, Streptococcus pyogenes, and Streptococcus ros hermsii. B. hermsii has evolved multiple strategies to escape pneumoniae (9–14). FH represents the main human fluid phase by guest on September 29, 2021 innate and adaptive immune responses and to persist in the blood regulator of the alternative pathway of complement activation and (2, 3), including multiphasic antigenic variation mediated by Vmp belongs to the factor H protein family, which consists of seven proteins (4–6). structurally related proteins in humans including FH-like protein 1 A further strategy of bacteria to resist hosts’ innate immunity, (FHL-1) and the FH-related proteins (FHRs) (15). All FH protein which constitutes the first barriers to infection, is their potential to family members are composed of short consensus repeats (SCRs) acquire fluid phase complement regulators, particularly those of (15, 16). In contrast to FH and FHL-1, the precise function(s) of the alternative complement pathway such as factor H (FH),5 to the the FHR proteins is currently unknown. For B. hermsii, surface- bound FH was shown to participate as a cofactor for factor I-mediated cleavage of C3b (17–19). Furthermore, for the *Infectious Immunology Group, Institute for Immunology, University of Heidelberg, Heidelberg, Germany; †Institute of Medical Microbiology and Infection Control, Uni- closely related spirochete Borrelia burgdorferi, the causal agent versity Hospital of Frankfurt, Frankfurt, Germany; ‡Molecular Immunobiology Group of Lyme disease, a strong correlation between the serum resis- and Department of Infection Biology, Leibniz-Institute for Natural Products Re- search, Jena, Germany; and §Metschnikoff Laboratory, Max-Planck-Institute for Im- tance of a given isolate and its expression profile of FH-binding munobiology, Freiburg, Germany outer surface lipoproteins, termed complement regulator-ac- Received for publication November 20, 2006. Accepted for publication March quiring surface proteins (CRASP), was reported (20–28). 13, 2007. Moreover, it was suggested that the dominant FH binding mol- The costs of publication of this article were defrayed in part by the payment of page ecule of serum-resistant B. burgdorferi strains, BbCRASP-1, is charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. necessary to resist killing by human serum (29). Some bacteria, such as Porphyromonas gingivalis, Pseudomo- 1 We are indebted for the financial support of the Deutsche Forschungsgemeinschaft Grants Wa 533/7-1 (to R.W.) and Kr 3383/1-1 (to P.K.). This work forms part of the nas aeruginosa, and Clostridium perfringens, produce their own Ph.D. thesis of E.R. and P.H. proteolytic enzymes that digest the extracellular matrix to facilitate 2 The sequence presented in this article has been submitted to EMBL/GenBank under invasion (30). Others, like B. burgdorferi and Borrelia crocidurae, accession number AM408562. make use the hosts’ fibrinolytic system to invade tissues (31–34). 3 E.R. and P.K. contributed equally to this work. 4 Address correspondence and reprint requests to Dr. Reinhard Wallich, Infectious Immunology Group, Institute for Immunology, University of Heidelberg, Im Neuen- heimer Feld 305, Heidelberg, Germany. E-mail address: [email protected] CRASP-1; NHS, normal human serum; Osp, outer surface protein; SCR, short 5 Abbreviations used in this paper: FH, factor H; FHL-1, FH-like protein 1; FHR, consensus repeat; uPA, urokinase-type plasminogen activator. FH-related protein; CRASP-1, complement regulator-acquiring surface protein 1; BbCRASP-1, Borrelia burgdorferi CRASP-1; BhCRASP-1, Borrelia hermsii Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00 www.jimmunol.org The Journal of Immunology 7293

Table I. Oligonucleotides used in this study

Primer Sequence (5Ј to 3Ј) Used in This Study

BhBam ATTATTAAGCCTTGCTGGATCCGA Generation of fusion proteins ⌬130Bam GCTCTCCATTTACTTTGGATCCACACTTCAAG Generation of fusion proteins ⌬195Bam GATTTAGAGGGATCCAAAAAAGCTCCTGG Generation of fusion proteins Eco⌬-12 CATTATGAATTCAAAAAATTAGTCCGGATTGC Generation of fusion proteins BhR CATCAGTTTGATTTATAGGATCAAC Amplification of cspA gene of B. hermsii BhF ACAACAGATAGACTCAATTTACAG Amplification of cspA gene of B. hermsii CRASP-1 57(ϩ) CTTTAATTTGCACCGGATCCGCACCTTTTAGGAAAATC Amplification of cspA gene of B. burgdorferi CRASP-1 234(Ϫ) CTTTGTAATATGCATCAAAGTGTTTTGCCAGTATTTTCTCATTATC Amplification of cspA gene of B. burgdorferi CSPZ-1 GTAGCAATATACTTGTGCTAGAGG Amplification of cspZ gene CSPZ-2 TCTCTTTTGATAAATTGGCTTAAG Amplification of cspZ gene BbCRASP-3 79(ϩ) GATGAGCAAAGTAGTGGTGAGATAAACC Amplification of erpP gene BbCRASP-3 520(Ϫ) CTATTTTAAATTTTTTTTGGATCCTTATTATGGTATTGCATA Amplification of erpP gene BbCRASP-5 79(ϩ) GATGAGCAAAGCAATGGAGAGGTAAAGGTC Amplification of erpA gene ErpA 3nc(Ϫ) GTTTTTTTATTCATATACGGGCCCTCCTATATTTCTAAC Amplification of erpA gene OspA1 GGGAATAGGTCTAATATTAGCC Amplification of ospA gene OspA2 CTAGTGTTTTGCCATCTTCTTTGA Amplification of ospA gene Fla 6 AACACACCAGCATCGCTTTCAGGGTCT Amplification of flaB gene Fla 7 TATAGATTCAAGTCTATTTTGGAAAGCACCTA Amplification of flaB gene Downloaded from

Accordingly, spirochetes bind the host plasminogen that is subse- kit (PE Applied Biosystems) in accordance with the manufacturer’s quently processed via urokinase-type plasminogen activator (uPA) recommendation. to active plasmin, a broad-spectrum serine protease, leading to The gene encoding BhCRASP-1 was amplified by PCR amplification using plasmid pGEMbh, the primers BhBam and BhR (Table I), and a extracellular matrix degradation (31, 33, 35–37). B. burgdorferi Mastercycler gradient (Eppendorf). Denaturation was conducted at 94°C http://www.jimmunol.org/ organisms bind host plasminogen via a multitude of outer surface for 30s, annealing at 50°C for 30s, and extension at 68°C for 30s, respec- proteins (Osp), such as OspA and OspC, a 70-kDa protein, and tively. After digestion with BamHI and EcoRI, the amplified DNA frag- several low molecular weight proteins (33, 35, 38, 39). Thus, the ment was ligated in-frame into the vector pGEX-2T, which included the glutathione S-transferase gene at the N terminus of the recombinant pro- fact that relapsing fever spirochetes, including B. hermsii, also tein. The resulting plasmid was used to transform JM109 host cells. Ex- disseminate from the blood to many distinct organs suggests the pression of the GST-BhCRASP-1 fusion protein in E. coli JM109, affinity involvement of plasminogen-binding proteins in these processes. purification, and endoproteinase thrombin cleavage of the fusion protein By screening a B. hermsii expression library we have now identi- were performed as recommended by the manufacturer (Amersham fied a novel 21.5 kDa outer surface lipoprotein termed BhCRASP-1. Bioscience). C-terminal and N-terminal deletion mutants of BhCRASP-1 were con- We demonstrate for the first time that BhCRASP-1 displays dual structed by PCR amplification using the BhBam primer and BhR primer by guest on September 29, 2021 binding specificities both for members of the FH complement reg- in combination with the Eco⌬-12 primer and the ⌬130Bam and ulator protein family and for plasminogen/plasmin and that the two ⌬195Bam primers, respectively (Table I). The amplified DNA frag- host proteins bind to distinct, nonoverlapping BhCRASP-1 ments were digested with BamHI and ligated in-frame with the His6 tag encoding sequence into the pQE30Xa vector (Qiagen), resulting in plas- domains. mids BhCRASP-121–173, BhCRASP-151–185, and BhCRASP-176–185. These plasmids were used for transformation of the JM109 host cells. Materials and Methods Expression of the respective fusion proteins and affinity purification Bacterial strains and growth conditions were performed as recommended by the manufacturer. B. hermsii (ATCC35209) strain HS1 and YOR isolates (provided by T. Expression of recombinant proteins of FH, FHL-1, and FHR-1 Schwan, Rocky Mountain Laboratories) and the Lyme disease spirochetes B. burgdorferi isolate B31 and mutant B313 were cultivated in Barbour- Deletions constructs of FH (FH1–2, FH1–3, FH1–4, FH1–5, FH1–6, Stoenner-Kelly (BSK)-H complete medium (PAN Biotech) supplemented FH8–20, FH15–20, and FH19–20), FHL-1, and FHR-1 were expressed in with 5% rabbit serum (Cell Concept) at 30°C. B313 mutant spirochetes Spodoptera frugiperda Sf9 insect cells infected with a recombinant bacu- harbor plasmids cp32-1, cp32-2, cp32-3, cp32-4, cp26, and lp7 exclusively lovirus. The cloning, expression, and purification of various deletion con- and therefore lack expression of BbCRASP-1 to BbCRASP-4 (27). Bac- structs have been described previously (8, 41). teria were harvested by centrifugation and washed with PBS. The density of spirochetes was determined using dark-field microscopy and a Kova Construction of a shuttle vector for transformation with counting chamber (Hycor Biomedical). Escherichia coli DH5␣ and BhCRASP-1 MC1061 were grown at 37°C in 2ϫYT or Luria-Bertani medium, respectively. The BhCRASP-1-encoding cspA gene, including its native promoter region, was amplified by PCR using BhF and BhR primers containing the Cloning of BhCRASP-1, construction of expression plasmids, respective restriction sites. Highly purified DNA obtained from the B. and production of recombinant proteins hermsii strain HS1 was used as the DNA template for PCR. The resulting amplicon was digested with SacI and SphI and cloned into pKFSS1 at the A B. hermsii genomic DNA expression library was prepared and screened corresponding restriction sites yielding the shuttle vector pBH. The shuttle using recombinant FH deletion constructs as previously described (22). vector was transformed into E. coli JM109 and purified plasmids were Briefly, bacterial colonies were plated onto Luria-Bertani agar plates and subjected to nucleotide sequencing to verify that no mutations were intro- transferred to nitrocellulose filters. Membranes were incubated with super- duced during PCR. E. coli transformants were grown in Luria-Bertani natant of Sf9 cells infected with recombinant FHL-1 or various recombi- broth containing 50 ␮g of streptomycin (Sigma-Aldrich) per milliliter and nant deletion constructs of FH (FH15–20, FH8–20, FH19–20) for 12 h at the expression of BhCRASP-1 was checked by ligand affinity blot analysis 4°C. After three washings with TBS containing 0.2% Tween 20, filters of whole cell lysates (data not shown) as described (27). were incubated with antisera to SCR1–4 (8) and a mAb (VIG8) specific for SCR20 (40) in the presence of 1% MC1061 cell lysate, followed by incu- Characterization of B. burgdorferi B313 transformants bation with the appropriate peroxidase-conjugated secondary Ab. B. hermsii genomic DNA fragments cloned in pUEX1 or pGEX-2T plasmid de- The transformation of B. burgdorferi B313 and the characterization of rivatives were sequenced by using the BigDye terminator cycle sequencing transformants were previously described (27). Several clones were selected 7294 FACTOR H AND PLASMINOGEN INTERACTIONS WITH BhCRASP-1

and expanded for 7 days. The analysis of genes harbored by B313 trans- directed against the C terminus of FH and FHR-1, or the plasminogen- formants was determined by PCR using specific primers (Table I). PCR specific mAb 10-V-1. Following four washes with TBST, blot strips were was conducted for 25 cycles using following parameters: denaturation at incubated with a secondary peroxidase-conjugated anti-rabbit IgG Ab or 94°C for 1 min, annealing at 50°C for 1 min, and extension at 72°C for 1 anti-mouse IgG Ab (DakoCytomation) for 60 min at room temperature. min. The expression of the BhCRASP-1 of posttransformation B. burg- Detection of bound Abs was performed using 3,3Ј,5,5Ј-tetramethylbenzi- dorferi B313 was determined by Western blotting using mAb BH-1. dine as the substrate. For Western blot analysis, membranes were incubated for 60 min at Serum susceptibility testing for Borrelia strains room temperature with either mAb or immune sera. Following four washes The serum susceptibility of B. hermsii HS1 mutants B313 and B313 con- with TBST, membranes were incubated with a secondary peroxidase-conjugated anti-mouse IgG Ab (DakoCytomation) for 60 min at room tem- taining shuttle vector pBH was assessed using a growth inhibition assay Ј Ј (42). Briefly, cells grown to mid-logarithmic phase were harvested, perature and bound Abs were detected using 3,3 ,5,5 -tetramethylbenzidine washed, and resuspended in fresh Barbour-Stoenner-Kelly medium. Spi- as substrate. For ELISA using nondenatured recombinant proteins, the wells of mi- rochetes (1.25 ϫ 107 B. hermsii and 2.5 ϫ 107 B. burgdorferi B313 or crotiter plates (Maxisorp; Nunc) were coated for2hatroom temperature B313/pBH organisms) diluted in a final volume of 100 ml in Barbour- ␮ ␮ Stoenner-Kelly medium containing 240 ␮g/ml phenol red were incu- with BhCRASP-1 or the deletion mutants thereof (100 l; 1 g/ml). The wells were washed three times with PBS and blocked by incubation with bated with 50% normal human serum (NHS) or 50% heat-inactivated ␮ ␮ NHS in microtiter plates for 72 h at 33°C (Costar). B313 and B313/pBH PBS plus 0.1% gelatin. FH (1 g/ml) or plasminogen (10 g/ml) was were incubated with 25% NHS or 25% heat-inactivated NHS. Barbour- added to the wells and after a 2-h incubation and three washes with PBS Stoenner-Kelly medium instead of human serum was included in all a 5000-fold dilution of goat anti-FH (Calbiochem) or a 3000-fold di- assays as control. Growth of spirochetes was monitored by measuring the lution of goat anti-plasminogen (Acris) serum was added, respectively. indicator color shift of the medium at 562/630 nm in an ELISA reader For the detection of specific Abs, peroxidase-labeled rabbit anti-goat (PowerWave 200Ј Bio-Tek Instruments). For calculation of the growth IgG (Dianova) Abs (1/2000) were used as conjugates. Substrate reac- o Downloaded from curves, the MikroWin version 3.0 software (Mikrotek) was used. tion was performed with -phenyldiamine dihydrochloride (Sigma-Al- drich) at room temperature. For competition binding tests with FH and Serum adsorptions assays using intact borrelial cells plasminogen, BhCRASP-1-coated microtiter plates were used. To analyze the ability of plasminogen to inhibit the binding of FH to immobilized To determine whether B. hermsii HS1 can bind FH, FHR-1, and plasmin- BhCRASP-1 (1 ␮g/ml), FH (0.1 ␮g/ml) was mixed with different amounts ogen, a whole cell absorption assay was performed as previously described. of plasminogen (0.001–100 ␮g/ml) and these mixtures were added to Borreliae (2 ϫ 109 cells) were grown to mid-log phase, harvested by cen- the wells coated with BhCRASP-1. Bound FH was detected as de- trifugation (5000 ϫ g for 30 min at 4°C) and resuspended in 100 ␮lof scribed above. The ability of different amounts of FH (0.001–100 ␮g/ ϩ ϩ http://www.jimmunol.org/ veronal-buffered saline supplemented with 1 mM Mg2 , 0.15 mM Ca2 , ml) to inhibit the binding of plasminogen (5 ␮g/ml) to immobilized and 0.1% gelatin (pH 7.4). To inhibit complement activation, NHS was BhCRASP-1 was analyzed accordingly. incubated with 0.34 M EDTA for 15 min at room temperature. The cell suspension was then incubated in 1.5 ml NHS-EDTA for1hatroom In situ protease treatment of spirochetes temperature with gentle agitation. After three washes with PBSA (0.15 M Whole cells of B. hermsii strain HS1 were treated with proteases by mod- NaCl, 0.03 M phosphate, and 0.02% sodium azide, pH 7.2) containing ification of a method described previously (43). Briefly, freshly harvested 0.05% Tween 20, the proteins bound to the cells were eluted by incubation cells were washed twice with PBS-MgCl and, after centrifugation at 5000 with 0.1 M glycine-HCl (pH 2.0) for 15 min. Borrelial cells were removed rpm for 10 min, the sedimented spirochetes were resuspended in 100 ␮lof by centrifugation at 14,000 ϫ g for 20 min at 4°C and the supernatant was this buffer. To 5 ϫ 106 intact borrelial cells (final volume of 0.5 ml), analyzed by Western blotting and probed with mAb VIG8 for FH and proteinase K in distilled water (Sigma-Aldrich) was added to a final con-

FHR-1 or 10-V-1 (Calbiochem) for plasminogen. by guest on September 29, 2021 centration of 12.5–100 ␮g/ml. Following incubation for 1 or2hatroom Immunofluorescence analysis temperature, proteinase K was inhibited by adding 5 ␮l of PMSF (Sigma- Aldrich) (50 mg/ml in isopropanol). The cells were then washed twice with Spirochetes were grown to mid-log phase, harvested by centrifugation at PBS-magnesium, resuspended in 20 ␮l of the same buffer, and lysed by 5000 ϫ g for 10 min, washed, and resuspended in 300 ␮l of 30 mM Tris, sonication five times using a Branson B-12 sonifier (Heinemann). Whole 60 mM NaCl (pH 7.4). Cells (2 ϫ 108) were incubated for 1 h with a mAb cell protein preparations (10 ␮l) were separated by using Tris/Tricine directed either against BhCRASP-1 (BH-1) or the periplasmic flagellin SDS-PAGE via 4% stacking and 10% separating gels as described pre- protein (LA21). After incubation with the Abs, spirochetes were gently viously (23). washed three times in Tris buffer containing 0.2% BSA and collected by centrifugation at 5000 ϫ g for 10 min. Pellets were then resuspended in Surface plasmon resonance analysis ␮ ␮ 100 l of Tris buffer containing 0.2% BSA. Aliquots (10 l) were spotted Protein-protein interactions were analyzed by surface plasmon resonance on coverslips and allowed to air dry for 3 h. After fixation with acetone, technique using a Biacore 3000 instrument as described earlier (22, 44). samples were dried for 15 min at room temperature and incubated for 60 Briefly, the borrelial recombinant protein BhCRASP-1 (20 ␮g/ml; dialyzed min in a humidified chamber with a 1/200 dilution of Cy3-conjugated against 10 mM acetate buffer (pH 5.5)) was coupled via a standard amine- rabbit anti-mouse IgG (Dianova) and a 1/1000 dilution of the DNA-binding coupling procedure to the flow cell of a sensor chip (CM5; Biacore) until Ј Ј dye 4 ,6 -diamidino-2-phenylindole (Roth) for counterstaining. Slides a level of resonance units Ͼ4000 was reached. A control cell was prepared were then washes four times with 0.2% BSA in Tris buffer before being in the same way but without injecting a protein. FH, FHL-1, and the deletion sealed with Mowiol mounting medium (Calbiochem) and covered with construct FH1–6 were dialyzed against running buffer (75 mM PBS (pH 7.4)). ϫ glass slides. Organisms were visualized at a magnification of 1000 using Each ligand (FH, 333 nM; FHL-1, FH8–20, and FH15–20, 1 ␮M each) was a Nikon Eclipse 90i microscope. injected separately into the flow cell coupled with BhCRASP-1 or the deletion ␮ SDS-PAGE, ligand affinity blot, Western and slot blot analyses, mutants and into a control cell using a flow rate of 5 l/min at 25°C. Each interaction was analyzed at least three times. and ELISA The binding kinetics were determined by using a lower density of the Ͻ Borrelial whole cell lysates (15 ␮g) or purified recombinant proteins (500 immobilized ligand ( 1000 resonance units) at 22°C in 75 mM PBS (pH ng) were subjected to 10% Tris/Tricine SDS-PAGE under reducing con- 7.4) and by using a natural logarithmic Langmuir 1:1 binding model and ditions and transferred to nitrocellulose as previously described (24). Al- the simultaneous Ka/Kd fitting routine of the BIAevaluation 3.1 software ternatively, recombinant proteins (1 ␮g/lane) were transferred onto nitro- (Biacore). The equilibrium constants were calculated from the rate cellulose membranes using the Bio-DOT SF blotting apparatus (Bio-Rad). constants. After the transfer of proteins onto nitrocellulose, nonspecific binding sides Functional assay for cofactor activity of FH were blocked using 5% (w/v) dried milk in TBS (50 mM Tris-HCl 200 mM NaCl, and 0.1% Tween 20) (pH 7.4), for6hatroom temperature. Subse- The cofactor activity of FH was analyzed on immobilized recombinant quently, membranes were rinsed four times in TBS and incubated at 4°C BhCRASP-1 by measuring the factor I-mediated conversion of C3b to overnight with NHS, recombinant proteins, or human plasminogen (Cell iC3b. Briefly, recombinant BhCRASP-1 (20 ␮g/ml) immobilized on a mi- Systems). After four washings with 50 mM Tris-HCl 150 mM NaCl, and crotiter plate was incubated with an excess of purified FH. After washing, 0.2% Tween 20 (TBST) (pH 7.5), membranes were incubated for 3 h with purified C3b (Calbiochem) and purified factor I (Sigma-Aldrich) were a polyclonal rabbit antiserum recognizing the N terminus (anti-SCR1–4), added and the mixture was incubated for 15 min at 37°C. iC3b generation the mAb B22 directed against the SCR5 of FH and FHL-1, the mAb VIG8 was quantified by ELISA applying a neoepitope-specific mouse monoclonal The Journal of Immunology 7295 anti-iC3b IgG (Quidel) as the capture Ab and biotinylated rabbit anti-C3c IgG (DakoCytomation) as the detector Ab. The reaction was visualized by the addition of streptavidin-peroxidase followed by o-phenylenediamine with

H2O2 as the substrate. Purified iC3b (Calbiochem) was used as a standard. Control experiments included BbCRASP-1, BbCRASP-3, or buffer instead of BhCRASP-1 as well as soluble and immobilized FH, respectively, in the identical system. Chromogenic substrate assays for plasmin and plasminogen activators Intact B. hermsii spirochetes were incubated with 10 ␮l of plasminogen (1 mg/ml; Chromogenix) with or without 50 mM tranexamic acid for 30 min at 34oC in Eppendorf tubes if not otherwise indicated. Following two washes, B. hermsii was resuspended in 50 ␮l of assay buffer (30 mM Tris, 60 mM NaCl (pH 7.4)) and transferred to microtiter plates, and 50 ␮lof uPA (2,5 ␮g/ml; Chemicon International) as well as 50 ␮l of the plasmin substrate D-Val-Leu-Lys 4-nitroanilide dihydrochloride (S-2251; Sigma-Aldrich) was added (0.4 mg/ml). Control reactions without B. hermsii consisted of buffer alone (followed by uPA) and a sham prepa- ration to control for possible residual unbound plasminogen not subsequently removed by washing (this reaction received plasminogen in buffer at the same concentration as that used in tubes with B. hermsii, followed by Downloaded from uPA). Control reactions with B. hermsii consisted of plasminogen alone (no uPA) and uPA alone (no previous plasminogen incubation) at the same concentrations as in the experimental reaction mixture. All samples received the chromogenic substrate S-2251 and were subjected to the same manipulations. The absorbance change at 405 nm was followed for several hours directly in the plates and the background FIGURE 1. Surface exposition of BhCRASP-1. A, B. hermsii after in- ϭ cubation with the BhCRASP-1-specific mAb BH-1 (upper panel) and the activity of OD450 0.1 (B. hermsii plus substrate) was subtracted. Similarly, BhCRASP-1 (0.2 ␮g/ml) was coated to microtiter plates and, flagellin-specific mAb LA21 (lower panel) followed by rabbit anti-mouse http://www.jimmunol.org/ after blocking, 10 ␮l of plasminogen (1 mg/ml) with or without 50 mM Cy3-conjugated IgG. The images were obtained by epifluorescence mi- tranexamic acid was added and incubated for 10 min at 37°C. Following croscopy using a Nikon Eclipse 90i upright automated microscope and a three washes with 200 ␮l of buffer, 50 ␮l of uPA (2.5 ␮g/ml) and 50 ␮lof Nikon DS-1 QM sensitive black and white charge-coupled device camera substrate S-2251 were added (0.4 mg/ml). The absorbance change at 405 at a resolution of 0.133 ␮m/pixel (right); for counterstaining, the DNA- nm was followed as indicated above. binding 4Ј,6Ј-diamidino-2-phenylindole was used (middle), and a differ- Nucleotide sequence deposition ential interference contrast image is also shown (left). B, Proteinase K treatment affects the surface expression of native BhCRASP-1. B. hermsii The cspA gene sequence reported in this paper has been deposited in the cells were incubated with the indicated concentration of proteinase K, lysed EMBL/GenBank databases under the accession number AM408562.

by sonication, immunoblotted, and screened with anti-BhCRASP-1 (BH-1) by guest on September 29, 2021 Statistical analysis and anti-FlaB (LA21) mAb. To determine the statistical significance of the observed absorbance values, BIAS version 8.1 software was used. Values of p Ͻ 0.05 were considered identified FHBP19/FhbA protein of B. hermsii YOR (18). A mAb, to be statistically significant. BH-1, with specificity for BhCRASP-1 was shown to be nonreac- tive with FHBP-19/FhbA and with the deletion mutant BhCRASP- Results 176–185, suggesting that the specific epitope recognized by mAb Cloning and characterization of BhCRASP-1 BH-1 includes amino acids residing in the N-terminal domain of To identify the FH binding proteins of B. hermsii, a genomic DNA BhCRASP-1 (data not shown). expression library derived from B. hermsii strain HS1 was screened for FH binding clones. The sequence of one clone that Surface exposure and protease sensitivity of BhCRASP-1 strongly bound FH revealed an open reading frame of 555 bp en- To determine whether BhCRASP-1 is surface exposed, an immu- coding a putative lipoprotein with a calculated molecular mass of nofluorescence assay was performed using the mAb BH-1, specific 21.5 kDa. The encoding gene was designated cspA. Pulse-field gel for BhCRASP-1. B. hermsii was incubated sequentially with mAb electrophoresis and hybridization analysis revealed that the cspA BH-1 and the rabbit anti-mouse Cy3-conjugated Ab (Fig. 1A, up- gene encoding BhCRASP-1 represents a single genetic locus that per panels). Epifluorescence microscopy revealed that B. hermsii maps to a plasmid of ϳ200 kb. Hybridization analyses using a expressed BhCRASP-1 on its outer surface in a patch-like manner. cspA PCR-generated probe with HaeIII- and BamHI-digested The mouse mAb LA21 directed against the periplasmic FlaB pro- DNA yielded fragments of ϳ3 and 8 kb, respectively (data not tein was used in these experiments as an internal control to confirm shown). After cleavage of the leader peptide, the predicted mo- that the fragile spirochetal outer membrane was not damaged (Fig. lecular mass of BhCRASP-1 is 19.5 kDa. The N terminus of 1A, lower panels). Controls incubated with the secondary Ab alone BhCRASP-1 shows significant homology to the signal peptides of were negative (not shown). other bacterial lipoproteins (45, 46). This motif includes two lysine To further define the surface localization of BhCRASP-1, B. residues near the N terminus, a hydrophobic region, and a se- hermsii organisms were treated with proteinase K and subjected to quence with significant similarity to the consensus signal peptidase Western blot analysis. As shown in Fig. 1B, a significant reduction

II cleavage sequence Leu(Ala, Ser)Ϫ4-Leu(Val, Phe, Ile)Ϫ3- was observed for BhCRASP-1 after2hofincubation with pro- Ն ␮ Ile(Val, Gly)Ϫ2-Ala(Ser, Gly)Ϫ1-Cysϩ1. Using LipoP for predic- teinase K at concentrations 12.5 g/ml. The band intensity ob- tion of the lipoproteins of Gram-negative bacteria (47), a unique served for FlaB was not changed, indicating that periplasmic ﬂa- cleavage side for signal peptidase II was found between aa 19 and gella are not affected by proteolytic digestion. Thus, the 20, suggesting lipidation at cysteine residue 20 of BhCRASP-1. susceptibility of BhCRASP-1 to proteolytic digestion indicates The amino acid sequence exhibited 83% identity with the recently that this protein is exposed at the outer surface of B. hermsii. 7296 FACTOR H AND PLASMINOGEN INTERACTIONS WITH BhCRASP-1

FIGURE 3. Diagrammatic representation of native and expressed recombinant BhCRASP-1 proteins. The numbers refer to amino acid residues, and nd is “not determined.” Binding of the complete and the truncated versions of BhCRASP-1 to serum proteins FH, FHL-1, and FHR-1 and to plasminogen was determined by slot blot analysis and/or ELISA.

fractions were separated by SDS-PAGE and tested for FH, FHL-1, FHR-1, and plasminogen by Western blotting. FH and FHR-1

were detected in the eluted fractions of B. hermsii. In contrast, Downloaded from FHL-1 was not found in the eluate of B. hermsii, indicating that the B. hermsii strain HS1 does not bind FHL-1 on its surface. In addition, plasminogen was also present in the eluate fractions of B. hermsii (Fig. 2C).

Localization of the FH/FHR-1 and the plasminogen-binding domains of BhCRASP-1 http://www.jimmunol.org/ To localize the binding sites for FH/FHR-1 and plasminogen on BhCRASP-1, a number of BhCRASP-1 deletion mutants with N- and C-terminal truncations were constructed (Fig. 3). Protein FIGURE 2. Binding of serum proteins FH, FHL-1, FHR-1, and plas- expression was confirmed by using Coomassie blue staining, minogen to BhCRASP-1 and native B. hermsii spirochetes. A, Purified recombinant BhCRASP-1, BbCRASP-1, OspA, OspB, and BSA were and all of the recombinant proteins exhibited the predicted size transferred to nitrocellulose membranes using Bio-Dot SF blotting appa- and reacted with the BhCRASP-1 immune serum (data not ratus. The reversible protein detection kit (Sigma-Aldrich) was applied to shown). Screening for FH/FHR-1 binding, using ELISA re- show equal loading of the proteins. Nitrocellulose membranes were incu- vealed that, of the protein preparations tested, only the full- by guest on September 29, 2021 bated with FHL-1, FHR-1, or FH and bound proteins were visualized using length form of BhCRASP-1 bound to FH and FHR-1 (Fig. 4A). antisera specific for SCR1–7 or for SCR19–20 (mAb VIG8). B, Nitrocel- No binding to FH was detected with any of the other deletion lulose membranes containing BhCRASP-1, OspA, OspB, and BSA were mutants of BhCRASP-1. Thus, the binding of FH/FHR-1 required either stained by using the reversible protein detection kit to confirm evenly determinants located in both the C- and N-terminal domains of applied samples or incubated with plasminogen and the specific mAb 10- BhCRASP-1, suggesting that long-range intramolecular interac- V-1. C, B. hermsii cells incubated in NHS-EDTA were extensively washed tions are involved in the formation and presentation of the FH/ with PBSA-Tween 20 and bound proteins were eluted using 0.1 M glycine (pH 2). Both the last wash (w) and the eluate (e) fractions obtained were FHR-1 binding pocket. separated by 10% Tris/Tricine SDS-PAGE under nonreducing conditions, The different BhCRASP-1 mutants were also analyzed for the transferred to nitrocellulose, and probed with rabbit serum anti-SCR1–4 ability to bind plasminogen. Full-length BhCRASP-1 (residues 21 for FHL-1 and FH, anti-SCR19–20 for FHR-1, and mAb 10-V-1 for de- to 185) and the truncated versions retained plasminogen binding tection of plasminogen (PLG). activity (Fig. 4B), indicating that the binding site for plasminogen is localized to the central domain of BhCRASP-1. Assuming that BhCRASP-1 contains one unique plasminogen binding site, the Interaction of BhCRASP-1 with serum proteins increased binding capacity of the truncated mutants vs the com- To test the binding of recombinant BhCRASP-1 to the serum pro- plete BhCRASP-1 for plasminogen correlates with the relative mo- teins FH, FHL-1, and FHR-1 or to plasminogen, slot blot analysis lar amounts of the respective proteins used in this assay. Together, was used. Of the three members of the factor H family analyzed, these data suggest that FH and plasminogen bind to distinct, non- FH and FHR-1 bound to BhCRASP-1 whereas no binding was overlapping domains of the BbCRASP-1 molecule. To test this observed for FHL-1 (Fig. 2A). Using BbCRASP-1 derived from B. assumption, increasing amounts of plasminogen or FH (up to 100 burgdorferi as a control, binding to FHL-1 and FH but not to ␮g/ml) together with constant amounts of FH (0.1 ␮g/ml) or plas- FHR-1 could be detected. OspA, OspB, and BSA did not bind to minogen (5 ␮g/ml), respectively, were added to immobilized any of the three proteins. Furthermore, plasminogen bound to re- BhCRASP-1. As seen in Fig. 4, plasminogen did not compete with combinant BhCRASP-1 and OspA, whereas no binding was ob- the binding of FH to BhCRASP-1 even at a 1000-fold excess and, served for the control proteins OspB and BSA (Fig. 2B). vice versa, high amounts of FH did not inhibit the binding of To assess the binding of serum proteins to the surface of bor- plasminogen to BhCRASP-1. relial cells in a more physiologic assay, intact spirochetes were incubated with NHS, a natural source for FH, FHL-1, FHR-1, and Activation of bound plasminogen by host-derived plasminogen plasminogen that was supplemented with EDTA to prevent com- activators plement activation. Serum proteins were adsorbed to spirochetes To determine whether plasminogen bound to the outer surface of and subsequently eluted by using a pH shift assay. The eluted B. hermsii was converted to its enzymatically active form, plasmin, The Journal of Immunology 7297

FIGURE 4. Dose-dependent binding of FH and plasminogen by BhCRASP-1. A, Different concentrations of FH were incubated with BhCRASP-1 or the indicated BhCRASP-1 mutants and binding was detected using goat anti-FH as the detection Ab. B, Similarly, the same plates were incubated with plasminogen and binding was detected using goat anti-plasminogen as the detection Ab. C and D, Competition inhibition test with FH and plasminogen. Different amounts of plasminogen (dotted line) or FH (solid line) were used to inhibit the binding of 0.1 ␮g/ml Downloaded from FH (C)or5␮g/ml plasminogen (D)to BhCRASP-1 immobilized on microtiter plates. http://www.jimmunol.org/ by either endogenously or exogenously supplied plasminogen activator(s), B. hermsii spirochetes were incubated with plasminogen. After the transfer of extensively washed spirochetes to microtiter plates, human uPA and the chromogenic plasmin substrate S-2251 were added. As shown in Fig. 5A, degradation of the chromogenic substrate demonstrates that plasminogen bound to the surface of B. hermsii is converted to enzymatically active plasmin by guest on September 29, 2021 in the presence of exogenous uPA. No or only marginal plasmin activity was seen in the presence of tranexamic acid, indicating that the previous binding of plasmin(ogen) to the spirochete is a prerequisite for optimal cleavage by plasminogen activators. Spi- rochetes treated with plasminogen alone (without subsequent activation with uPA) or with uPA alone (without previous incubation with plasminogen) showed only marginal, if any, degradation of S-2251. No plasmin was formed in the absence of plasminogen activators, indicating that spirochetes do not express endogenous plasminogen activators. Similar ﬁndings were observed using BhCRASP- 1-coated microtiter plates. In contrast to intact spirochetes, plasmin activity bound to BhCRASP-1 was reduced by Ϸ50% in the presence of tranexamic acid (Fig. 5B).

Identification of the short consensus repeat(s) of FH that bind to BhCRASP-1 To precisely map the binding domain of FH that binds to the recombinant BhCRASP-1 of B. hermsii, various deletion constructs of FH and FHL-1 were used for ligand affinity assays. As shown in Fig. 6A, BhCRASP-1 strongly bound to FH (lane 7 from left)as well as to the deletion constructs FH8–20 (lane 8), FH15–20 (lane FIGURE 5. Effect of B. hermsii on the activation of serum-derived plas- 9), and FH19–20 (lane 10), but not to the deletion constructs minogen by uPA. B. hermsii organisms (1.2 ϫ 108)(A) or recombinant SCR1–2, SCR1–3, SCR1–4, SCR1–5, SCR1–6, FHL-1 (SCR1–7) BhCRASP-1 (0.2 ␮g/ml) (B) were mixed with plasminogen. Plasminogen (lanes 1–6), and deletion construct FH15–19 (lane 11). These was converted into plasmin by the addition of uPA and plasmin activity was determined by using the chromogenic substrate D-Val-Leu-Lys 4-ni- data indicate that SCR20 of FH is critical for interaction with troanilide dihydrochloride (S-2251). Enhanced plasmin activity was seen BhCRASP-1. In addition, FHR-1 but not FHL-1 bound to im- when plasminogen and uPA were incubated with spirochetes (f). uPA- mobilized BhCRASP-1 using ligand affinity blotting (Fig. 2A), mediated plasminogen activation was inhibited by 50 mM tranexamic acid supporting the notion that the SCR20 of FH is primarily in- (Ⅺ). When spirochetes were incubated in the absence of either uPA (‚)or volved in binding BhCRASP-1. As indicated in the schematic plasminogen (E), only weak plasmin activity was seen. This experiment representation of FH, FHL-1, and FHR-1 (Fig. 6B), domain was repeated three times with consistent results. 7298 FACTOR H AND PLASMINOGEN INTERACTIONS WITH BhCRASP-1

FIGURE 6. Complement-regulatory functions and binding domains of Downloaded from FH, FHL-1 and FHR-1. A, Purified recombinant BhCRASP-1 proteins (lanes 1–11, counting from the left) were separated by 10% Tris/Tricine SDS-PAGE and transferred to nitrocellulose. Membranes were incubated with either recombinant FHL-1 (FH1–7) or several deletion constructs of FH (FH1–2, FH1–3, FH1–4, FH1–5, FH1–6, FH8–20, FH15–20, FH19–20 and FH19–20), or with human serum (FH). Bound proteins were ␣ visualized using antisera specific for SCR1–7 ( SCR1–4), SCR19–20 http://www.jimmunol.org/ (␣FH), and the mAb (VIG8). B, Schematic representation of the FH, FHL-1, and FHR-1 proteins. The complement regulatory domains are localized to the N-terminal four domains SCR1–4 (shaded). The interaction domains for other microbial surface proteins are mainly localized to SCR6–7 and SCR19–20 (gray). SCR domains are aligned vertically ac- cording to their observed amino acid sequence similarities (%). FIGURE 7. Analysis of BhCRASP-1 for binding to FH and deletion mutants by surface plasmon resonance. A, FH, FHL-1, or the various FH SCR20 of FH displays 97% sequence similarity to the SCR5 mutants in the fluid phase were injected into a flow cell precoupled with by guest on September 29, 2021 of FHR-1 (48). BhCRASP-1 and to a control flow cell without protein (PBS). The control Applying surface plasmon resonance analyses, a more physio- was subtracted from the displayed binding curves. Binding of FH, FH8– logical assay system, FH and the deletion constructs FH8–20 and 20, FH15–20, and FHL-1 to BhCRASP-1 was measured. As compared FH15–20 bound to immobilized BhCRASP-1 with similar high with the intact FH, the binding of FH15–20 was slightly increased whereas affinities. Furthermore, quantitative analysis revealed a high bind- the binding of FH8–20 was reduced and no binding was observed with ing affinity of FH to BhCRASP-1 as demonstrated by a calculated FHL-1. B, Using mAb C18 directed against SCR20 completely abolished the binding of FH15–20 to BhCRASP-1. Kd value of 17 nM (Table II). However, FHL-1, consisting of SCR1–7, failed to bind BhCRASP-1 indicating that the C-terminal domain of FH is required for BhCRASP-1 binding (Fig. 7A). This assumption was verified by showing that the mAb C18 (49) di- efficient in mediating C3b conversion than FH bound to either rected against the most C-terminal domain SCR20, complete BbCRASP-1 or BbCRASP-3 under similar conditions (Fig. 8). As blocked the interaction of FH with BhCRASP-1 (Fig. 7B). previously shown, FH bound to BbCRASP-1 is up to 10-fold more efficient in factor I-mediated C3b conversion as compared with FH retains cofactor activity when bound to BhCRASP-1 BbCRASP-3 (21, 22). Incubation of immobilized proteins in the The cofactor activity of FH was analyzed on immobilized recombinant BhCRASP-1 protein by measuring factor I-mediated conversion of C3b to iC3b (21). Recombinant BhCRASP-1 immobilized on a microtiter plate was incubated with excess of purified FH or buffer alone. As controls, functional activity of FH bound to B. burgdorferi BbCRASP-1 or BbCRASP-3 was tested for C3b- inactivating capacity (21, 22). BhCRASP-1-bound FH was more

Table II. Quantitative analysis of the interaction between FH and immobilized BhCRASP-1 proteina FIGURE 8. Analysis of cofactor activity of FH bound to BhCRASP-1. Equilibrium Association Equilibrium Dissociation Recombinant BhCRASP-1 immobilized to microtiter plates was used to Constant (MϪ1) Constant (M) capture FH. After sequential addition of C3b and factor I, bound FH en- abled factor I-mediated cleavage of C3b to iC3b. iC3b was quantiﬁed by 7 Ϫ8 FH 1.7 ϫ 10 1.7 ϫ 10 ELISA using a neoepitope-speciﬁc anti-iC3b IgG. BbCRASP-1 and a The equilibrium constants were calculated from the association and dissociation BbCRASP-3 derived from B. burgdorferi strain ZS7 served as controls. rate constants. Data are given as mean Ϯ SD of three independent experiments. The Journal of Immunology 7299

Western blotting with the specific mAb (BH-1). As shown in Fig. 9B, B. hermsii HS1 and the transformant B313/pBH, but not the mutant strain B313, showed a specific band. Furthermore, a growth inhibition assay (42) was used to compare the susceptibility of B. hermsii HS1, B313, and B313/pBH to human serum. Resistance to complement-mediated killing was indicated by a continuous growth of spirochetes in the presence of human serum and a subsequent reduction of A562/A630 ratios, whereas the inhibition of sensitive cells was indicated by lack of changes in absorbance. As shown in Fig. 9C, the growth of B. burgdorferi mutant B313 was signifi- cantly inhibited as compared with growth of B313/pBH in the presence of 25% NHS ( p Ͻ 0.05). B313 containing the shuttle vector alone showed similar growth properties as the nontransformed B. burgdorferi mutant B313 (data not shown). This finding indicates that complement resistance can be increased when BhCRASP-1 is expressed in a heterologous B. burgdorferi strain. Heat inactivation of human serum before assaying the borrelial cells did not influence the growth of any strain (data not shown). Downloaded from Discussion In this study we have identified and characterized BhCRASP-1, a novel member of the CRASP family in B. hermsii. BhCRASP-1 binds human FH, FHR-1, and, in addition, plasminogen/plasmin via distinct, nonoverlapping domains. Both FH and plasmin

retain their biological activities when bound to B. hermsii or http://www.jimmunol.org/ BhCRASP-1, suggesting that BhCRASP-1 is a critical virulence factor of the pathogen. The previous findings that the relapsing fever spirochete B. hermsii expresses a receptor for FH, FhbA, and that surface-bound FH facilitates factor I-mediated cleavage of C3b suggest a suitable strategy of the pathogen to evade the first-line host defense via the complement system (18). FH binding has been reported for a num- FIGURE 9. Characterization and serum susceptibility analysis of B. ber of bacterial species such as S. pyogenes (group A streptococ- hermsii and B. burgdorferi strains. A, B. burgdorferi B31, mutant B313, cus) (50), Neisseria gonorrhoeae (10, 51), S. pneumoniae (11, 13, by guest on September 29, 2021 and B313/pBH were characterized by PCR amplification of the cspA, cspZ, 52), B. burgdorferi (24), Borrelia afzelii (25), Borrelia recurrentis erpP, erpA, ospA, and flaB genes using the primers listed in Table I. B, (53), Borrelia duttonii (53), Borrelia parkeri (17), and B. hermsii Expression of B. hermsii BhCRASP-1 by recombinant B. burgdorferi B313 (18, 19). Moreover, for B. hermsii YOR it was found that it spe- was assessed using Western blot. Whole cell lysates of the indicated bor- cifically binds both FH and FHL-1 via FhbA and that FH and ϫ 8 reliae (1 10 ) were separated by SDS-PAGE and transferred to nitro- FHL-1 interact with FhbA through the SCR domains 1–7 and cellulose. BhCRASP-1 was detected using mAb BH-1. M, Marker pro- SCR16–20 (19). In contrast, the presented plasma adsorption ex- teins; lane 1, B. hermsii; lane 2, B313; lane 3, B313/pBH. C, Growth inhibition assay. B. burgdorferi B313 and B313/pBH cells were examined periments and surface plasmon resonance analyses clearly showed for sensitivity to human serum. Spirochetes were seeded in microtiter that FH binding to BhCRASP-1 of B. hermsii HS1 is exclusively plates and incubated in NHS over a cultivation period of 3 days at 33°C. associated with SCR20. This is further substantiated by the fact Data are shown as mean Ϯ SD of three independent experiments. Color that BhCRASP-1 also bound FHR-1, another member of the factor changes were monitored by measurement of the absorbance at 562/630 nm. H family, exhibiting a C-terminal domain that is almost identical to the C terminus of FH but different to FHL-1, which consists of SCR1–7 (48). Thus, BhCRASP-1 and FhbA clearly express dis- absence of FH served as negative controls and had no effect on tinct biological activities in that both show similar binding potential C3b conversion (data not shown). for FH but different capacities to interact with FHL-1 and FHR-1. Although the actual function of FHR-1 is yet to be disclosed, it was BhCRASP-1 increases resistance to complement-mediated killing suggested to be involved in the adhesion processes of the pathogen to Preliminary experiments indicated that the B. hermsii strain HS1 neutrophils (54). The interaction of BhCRASP-1 with FH may be an was not suitable for genetic manipulation. We thus transformed the important mechanism by which B. hermsii spirochetes control C3b serum-sensitive B. burgdorferi mutant strain B313 lacking the FH/ deposition on their surface and escape opsonophagocytosis. In ad- FHL-1 binding proteins BbCRASP-1 to BbCRASP-4 with the dition, FH may function in adherence due to its binding to surface shuttle vector pBH containing the entire cspA gene to assess the glycosaminoglycans and host cell membrane receptors. In this con- role of BhCRASP-1 for complement resistance. Transformants text it is noteworthy that the C-terminal part of FH has previously were selected by limiting dilution and characterized for the pres- been implicated in the binding to other bacterial surface structures, ence of the cspA gene of B. hermsii by PCR analysis (Fig. 9A). e.g., the sialylated lipooligosaccharide of N. gonorrhoeae and sev- B313/pBH, but not parental strain B313, showed the expected am- eral lipoproteins of B. burgdorferi, including CRASP-3, -4, and -5 plicon product. Lack of plasmids lp54, lp28-3, and cp32-9 harbor- (10, 21, 22, 44). ing ospA and cspA (BbCRASP-1), cspZ (BbCRASP-2), and erpP Our results show that FH associated with BhCRASP-1 maintains (BbCRASP-3) in B313 was confirmed by PCR, respectively (Fig. its regulatory activity and controls C3b deposition and C3-convertase 9A). Next, the expression of BhCRASP-1 was determined by activity. Thus, the acquisition of FH molecules to surface-exposed 7300 FACTOR H AND PLASMINOGEN INTERACTIONS WITH BhCRASP-1

BhCRASP-1 results in enhanced complement-regulatory activity, a against serum-derived nonspecific and specific antimicrobial com- process that would allow relapsing fever spirochetes to evade clear- pounds such as specific Abs. It has become evident that Staphy- ance by the innate immune system. The biological significance of lococcus aureus resists human innate immune defenses by activat- BhCRASP-1 interaction with FH was further examined by using a ing human plasminogen into plasmin at the bacterial surface and B. burgdorferi strain as an amenable host to express a heterologous that this in turn leads to degradation of surface-bound IgG and C3b outer surface lipoprotein for studying complement resistance. In (62). Similarly, BhCRASP-1-bound serine protease activity may fact, B. burgdorferi was shown previously to successfully display act in concert with FH and factor I to strengthen the resistance of surface-exposed lipoproteins, e.g., Vsp1 and Vsp2 of relapsing B. hermsii to human serum by promoting C3b inactivation. There- fever borreliae (55). In addition, the complementation of fore, BhCRASP-1 bound plasmin must be considered as another BbCRASP-1 or BbCRASP-2 expression in serum-sensitive borre- escape mechanism of B. hermsii during early infection. lial cells imparts resistance to human serum (27, 29). Here we To our knowledge, this is the first study showing the simul- demonstrate that expression of the BhCRASP-1 of relapsing fever taneous and noncompetitive binding of FH and plasminogen to borreliae in the serum-sensitive Lyme disease spirochete B. burg- an outer surface protein of B. hermsii. This finding is of general dorferi B313 results in an increased resistance of the mutant strain importance and deserves further investigations to better under- to complement-mediated killing, suggesting the involvement of stand the molecular interactions of FH and plasminogen with BhCRASP-1 in the immune evasion of B. hermsii. BhCRASP-1 as well as their roles in the virulence and patho- To localize the peptide binding domain(s) of BhCRASP-1 for genesis of B. hermsii in humans. Our findings may have broad FH binding, BhCRASP-1 proteins with N- and C-terminal trun- implications for the invasive potential of human pathogens and cations were generated and used for functional analyses. Dele- support the concept of their exploitation of host factors as a Downloaded from tions of either the N terminus (fragment spanning residues 51– suitable survival strategy. 185) or the C terminus (fragment spanning residues 21–173) portion of BhCRASP-1 completely abrogated FH binding, sug- Acknowledgments gesting that the FH binding site of BhCRASP-1 consists of a con- We thank Christiane Brenner, Steffi Ha¨lbich, Christa Hanssen-Hu¨bner, and formational rather than a contiguous linear peptide structure. Sim- Ju¨ri Habicht for excellent technical assistance. We also thank D. Scott ilar features have been previously reported for B. burgdorferi Samuels for providing pKFSS1. http://www.jimmunol.org/ BbCRASP-1 and BbCRASP-3 (21, 22). However, Hovis and col- leagues proposed that although determinants of the C-terminal do- Disclosures main of FhbA are important in FH/FHL-1 binding, the 10-aa C- The authors have no financial conflict of interest. terminal tail is dispensable (19). In this context the recent identification of two genetically distinct groups of B. hermsii is of interest (56). Together with the proposition of two clusters of FH References 1. Barbour, A. G. 2005. Relapsing fever. In Tick-Borne Diseases of Humans. binding proteins found in the B. hermsii genome, the combined L. Jesse, D. T. D. Goodman, and D. E. Sonenshine, eds. American Society for studies thus suggest a differential association of FhbA and Microbiology Press, Washington, D.C., p. 268–291. BhCRASP-1 with the two subgroups (57). However, further 2. Barbour, A. G., and B. I. Restrepo. 2000. Antigenic variation in vector-borne by guest on September 29, 2021 pathogens. Emerg. Infect. Dis. 6: 449–457. studies are required to settle this issue. 3. Hornef, M. W., M. J. Wick, M. Rhen, and S. Normark. 2002. Bacterial strategies Several independent investigations have proposed that the bind- for overcoming host innate and adaptive immune responses. Nat. Immunol. 3: ing of plasminogen to the surface of bacteria is of importance for 1033–1040. 4. Barbour, A. G. 1991. Molecular biology of antigenic variation in Lyme borre- the invasive capacity of a number of Borrelia species (32, 33, 35, liosis and relapsing fever: a comparative analysis. Scand. J. Infect. Dis. 58–60). We have shown now that B. hermsii binds plasminogen to 23(Suppl.) 77: 88–93. its outer surface and that bound plasminogen can, in turn, be con- 5. Barbour, A. G., S. L. Tessier, and H. G. Stoenner. 1982. Variable major proteins of Borrelia hermsii. J. Exp. Med. 156: 1312–1324. verted to enzymatically active plasmin in the presence of exoge- 6. Dai, Q., B. I. Restrepo, S. F. Porcella, S. J. Raffel, T. G. Schwan, and nous human uPA as measured by the cleavage of the chromogenic A. G. Barbour. 2006. Antigenic variation by Borrelia hermsii occurs through recombination between extragenic repetitive elements on linear plasmids. Mol. plasmin substrate S-2251. The interaction of plasminogen with Microbiol. 60: 1329–1343. exponentially grown B. hermsii was first examined by the incuba- 7. Pangburn, M. K., R. D. Schreiber, and H. J. Muller-Eberhard. 1977. Human tion of intact spirochetes with NHS, a natural source for plasmin- complement C3b inactivator: isolation, characterization, and demonstration of an absolute requirement for the serum protein ␤1H for cleavage of C3b and C4b in ogen and FH, and both proteins, FH and plasminogen, were eluted solution. J. Exp. Med. 146: 257–270. from the spirochetal surface. To elucidate the putative plasminogen- 8. Kuhn, S., C. Skerka, and P. F. Zipfel. 1995. Mapping of the complement regu- binding capacity of the BhCRASP-1, ligand affinity blotting was used. latory domains in the human factor H-like protein 1 and in factor H1. J. Immunol. 155: 5663–5670. As with FH, plasminogen binds to immobilized BhCRASP-1. Thus, 9. Meri, T., A. Hartmann, D. Lenk, R. Eck, R. Wurzner, J. Hellwage, S. Meri, and plasmin-coated organisms could bind to the recently described plas- P. F. Zipfel. 2002. The yeast Candida albicans binds complement regulators minogen receptors on endothelium cells as a means of initial anchor- factor H and FHL-1. Infect. Immun. 70: 5185–5192. 10. Ram, S., D. P. McQuillen, S. Gulati, C. Elkins, M. K. Pangburn, and P. A. Rice. ing (61) and may use their enhanced proteolytic capacity to breach 1998. Binding of complement factor H to loop 5 of porin protein 1A: a molecular tight junctions of endothelium, cross basement membranes, and ini- mechanism of serum resistance of nonsialylated Neisseria gonorrhoeae. J. Exp. tiate pathophysiological processes in the affected organs (60). It is also Med. 188: 671–680. 11. Janulczyk, R., F. Iannelli, A. G. Sjoholm, G. Pozzi, and L. Bjorck. 2000. Hic, a known that, similar to Lyme disease, Borrelia relapsing fever species novel surface protein of Streptococcus pneumoniae that interferes with comple- disseminate from the blood to many distant organs, including the ment function. J. Biol. Chem. 275: 37257–37263. brain (57). Our results show that plasminogen does not compete 12. Jarva, H., R. Janulczyk, J. Hellwage, P. F. Zipfel, L. Bjorck, and S. Meri. 2002. Streptococcus pneumoniae evades complement attack and opsonophagocytosis with FH for binding of immobilized BhCRASP-1 and vice versa. by expressing the pspC locus-encoded Hic protein that binds to short consensus The efficient simultaneous binding of FH and plasminogen sug- repeats 8–11 of factor H. J. Immunol. 168: 1886–1894. 13. Dave, S., M. K. Pangburn, C. Pruitt, and L. S. McDaniel. 2004. Interaction of gests that the two host proteins are bound to BhCRASP-1 of B. human factor H with PspC of Streptococcus pneumoniae. Indian J. Med. Res. 119 hermsii via distinct domains. In line with this observation it was (Suppl): 66–73. found that BhCRASP-1 proteins with N- or C-terminal truncations 14. Duthy, T. G., R. J. Ormsby, E. Giannakis, A. D. Ogunniyi, U. H. Stroeher, J. C. Paton, and D. L. Gordon. 2002. The human complement regulator factor H exhibited a loss of binding to FH but not to plasminogen. Further- binds pneumococcal surface protein PspC via short consensus repeats 13 to 15. more, the acquired proteolytic activity may also protect spirochetes Infect. Immun. 70: 5604–5611. The Journal of Immunology 7301

15. Zipfel, P. F., and C. Skerka. 1994. Complement factor H and related proteins: 38. Hu, L. T., G. Perides, R. Noring, and M. S. Klempner. 1995. Binding of human an expanding family of complement-regulatory proteins? Immunol. Today 15: plasminogen to Borrelia burgdorferi. Infect. Immun. 63: 3491–3496. 121–126. 39. Lagal, V., D. Portnoi, G. Faure, D. Postic, and G. Baranton. 2006. Borrelia 16. Skerka, C., R. D. Horstmann, and P. F. Zipfel. 1991. Molecular cloning of a burgdorferi sensu stricto invasiveness is correlated with OspC-plasminogen af- human serum protein structurally related to complement factor H. J. Biol. Chem. finity. Microbes Infect. 8: 645–652. 266: 12015–12020. 40. Prodinger, W. M., J. Hellwage, M. Spruth, M. P. Dierich, and P. F. Zipfel. 1998. 17. McDowell, J. V., E. Tran, D. Hamilton, J. Wolfgang, K. Miller, and The C terminus of factor H: monoclonal antibodies inhibit heparin binding and R. T. Marconi. 2003. Analysis of the ability of spirochete species associated with identify epitopes common to factor H and factor H-related proteins. Biochem. J. relapsing Fever, avian borreliosis, and epizootic bovine abortion to bind factor H 331: 41–47. and cleave c3b. J. Clin. Microbiol. 41: 3905–3910. 41. Kuhn, S., and P. F. Zipfel. 1995. The baculovirus expression vector pBSV-8His 18. Hovis, K. M., J. V. McDowell, L. Griffin, and R. T. Marconi. 2004. Identification directs secretion of histidine-tagged proteins. Gene 162: 225–229. and characterization of a linear-plasmid-encoded factor H-binding protein (FhbA) 42. Kraiczy, P., K. P. Hunfeld, S. Breitner-Ruddock, R. Wurzner, G. Acker, and of the relapsing fever spirochete Borrelia hermsii. J. Bacteriol. 186: 2612–2618. V. Brade. 2000. Comparison of two laboratory methods for the determination of 19. Hovis, K. M., J. P. Jones, T. Sadlon, G. Raval, D. L. Gordon, and R. T. Marconi. serum resistance in Borrelia burgdorferi isolates. Immunobiology 201: 406–419. 2006. Molecular analyses of the interaction of Borrelia hermsii FhbA with the 43. Bunikis, J., C. J. Luke, E. Bunikiene, S. Bergstrom, and A. G. Barbour. 1998. A complement regulatory proteins factor H and factor H-like protein 1. Infect. Im- surface-exposed region of a novel outer membrane protein (P66) of Borrelia spp. mun. 74: 2007–2014. is variable in size and sequence. J. Bacteriol. 180: 1618–1623. 20. Kraiczy, P., K. Hartmann, J. Hellwage, C. Skerka, M. Kirschfink, V. Brade, 44. Hellwage, J., T. Meri, T. Heikkila, A. Alitalo, J. Panelius, P. Lahdenne, P. F. Zipfel, R. Wallich, and B. Stevenson. 2004. Immunological characterization I. J. Seppala, and S. Meri. 2001. The complement regulator factor H binds to the of the complement regulator factor H-binding CRASP and Erp proteins of Bor- surface protein OspE of Borrelia burgdorferi. J. Biol. Chem. 276: 8427–8435. relia burgdorferi. Int. J. Med. Microbiol. 293(Suppl. 37): 152–157. 21. Kraiczy, P., J. Hellwage, C. Skerka, H. Becker, M. Kirschfink, M. M. Simon, 45. Haake, D. A. 2000. Spirochaetal lipoproteins and pathogenesis. Microbiology V. Brade, P. F. Zipfel, and R. Wallich. 2004. Complement resistance of Borrelia 146: 1491–1504. burgdorferi correlates with the expression of BbCRASP-1, a novel linear plas- 46. Schulze, R. J., and W. R. Zuckert. 2006. Borrelia burgdorferi lipoproteins are mid-encoded surface protein that interacts with human factor H and FHL-1 and secreted to the outer surface by default. Mol. Microbiol. 59: 1473–1484. is unrelated to Erp proteins. J. Biol. Chem. 279: 2421–2429. 47. Juncker, A. S., H. Willenbrock, G. Von Heijne, S. Brunak, H. Nielsen, and Downloaded from 22. Kraiczy, P., J. Hellwage, C. Skerka, M. Kirschfink, V. Brade, P. F. Zipfel, and A. Krogh. 2003. Prediction of lipoprotein signal peptides in Gram-negative bac- R. Wallich. 2003. Immune evasion of Borrelia burgdorferi: mapping of a com- teria. Protein Sci. 12: 1652–1662. plement-inhibitor factor H-binding site of BbCRASP-3, a novel member of the 48. Zipfel, P. F., C. Skerka, J. Hellwage, S. T. Jokiranta, S. Meri, V. Brade, Erp protein family. Eur. J. Immunol. 33: 697–707. P. Kraiczy, M. Noris, and G. Remuzzi. 2002. Factor H family proteins: on com- 23. Kraiczy, P., C. Skerka, V. Brade, and P. F. Zipfel. 2001. Further characterization plement, microbes and human diseases. Biochem. Soc. Trans. 30: 971–978. of complement regulator-acquiring surface proteins of Borrelia burgdorferi. In- 49. Oppermann, M., T. Manuelian, M. Jozsi, E. Brandt, T. S. Jokiranta, S. Heinen, fect. Immun. 69: 7800–7809. S. Meri, C. Skerka, O. Gotze, and P. F. Zipfel. 2006. The C terminus of com-

24. Kraiczy, P., C. Skerka, M. Kirschfink, V. Brade, and P. F. Zipfel. 2001. Immune plement regulator Factor H mediates target recognition: evidence for a compact http://www.jimmunol.org/ evasion of Borrelia burgdorferi by acquisition of human complement regulators conformation of the native protein. Clin. Exp. Immunol. 144: 342–352. FHL-1/reconectin and Factor H. Eur. J. Immunol. 31: 1674–1684. 50. Horstmann, R. D., H. J. Sievertsen, J. Knobloch, and V. A. Fischetti. 1988. 25. Kraiczy, P., C. Skerka, M. Kirschfink, P. F. Zipfel, and V. Brade. 2001. Mech- Antiphagocytic activity of streptococcal M protein: selective binding of comple- anism of complement resistance of pathogenic Borrelia burgdorferi isolates. Int. ment control protein factor H. Proc. Natl. Acad. Sci. USA 85: 1657–1661. Immunopharmacol. 1: 393–401. 51. Ram, S., F. G. Mackinnon, S. Gulati, D. P. McQuillen, U. Vogel, M. Frosch, 26. Kraiczy, P., C. Skerka, P. F. Zipfel, and V. Brade. 2002. Complement regulator- C. Elkins, H. K. Guttormsen, L. M. Wetzler, M. Oppermann, et al. 1999. The acquiring surface proteins of Borrelia burgdorferi: a new protein family involved contrasting mechanisms of serum resistance of Neisseria gonorrhoeae and group in complement resistance. Wien. Klin. Wochenschr. 114: 568–573. B Neisseria meningitidis. Mol. Immunol. 36: 915–928. 27. Hartmann, K., C. Corvey, C. Skerka, M. Kirschfink, M. Karas, V. Brade, 52. Neeleman, C., S. P. Geelen, P. C. Aerts, M. R. Daha, T. E. Mollnes, J. J. Roord, J. C. Miller, B. Stevenson, R. Wallich, P. F. Zipfel, and P. Kraiczy. 2006. Func- G. Posthuma, H. van Dijk, and A. Fleer. 1999. Resistance to both complement tional characterization of BbCRASP-2, a distinct outer membrane protein of Bor- activation and phagocytosis in type 3 pneumococci is mediated by the binding of

relia burgdorferi that binds host complement regulators factor H and FHL-1. complement regulatory protein factor H. Infect. Immun. 67: 4517–4524. by guest on September 29, 2021 Mol. Microbiol. 61: 1220–1236. 53. Meri, T., S. J. Cutler, A. M. Blom, S. Meri, and T. S. Jokiranta. 2006. Relapsing 28. Wallich, R., J. Pattathu, V. Kitiratschky, C. Brenner, P. F. Zipfel, V. Brade, fever spirochetes Borrelia recurrentis and B. duttonii acquire complement reg- M. M. Simon, and P. Kraiczy. 2005. Identification and functional characterization ulators C4b-binding protein and factor H. Infect. Immun. 74: 4157–4163. of complement regulator-acquiring surface protein 1 of the Lyme disease spiro- 54. Park, C. T., and S. D. Wright. 1996. Plasma lipopolysaccharide-binding protein chetes Borrelia afzelii and Borrelia garinii. Infect. Immun. 73: 2351–2359. is found associated with a particle containing apolipoprotein A-I, phospholipid, 29. Brooks, C. S., S. R. Vuppala, A. M. Jett, A. Alitalo, S. Meri, and D. R. Akins. and factor H-related proteins. J. Biol. Chem. 271: 18054–18060. 2005. Complement regulator-acquiring surface protein 1 imparts resistance to 55. Zuckert, W. R., J. E. Lloyd, P. E. Stewart, P. A. Rosa, and A. G. Barbour. 2004. human serum in Borrelia burgdorferi. J. Immunol. 175: 3299–3308. Cross-species surface display of functional spirochetal lipoproteins by recombi- 30. Travis, J., J. Potempa, and H. Maeda. 1995. Are bacterial proteinases pathogenic nant Borrelia burgdorferi. Infect. Immun. 72: 1463–1469. factors? Trends Microbiol. 3: 405–407. 56. Porcella, S. F., S. J. Raffel, D. E. Anderson, Jr., S. D. Gilk, J. L. Bono, 31. Coleman, J. L., J. A. Gebbia, J. Piesman, J. L. Degen, T. H. Bugge, and M. E. Schrumpf, and T. G. Schwan. 2005. Variable tick protein in two genomic J. L. Benach. 1997. Plasminogen is required for efficient dissemination of B. groups of the relapsing fever spirochete Borrelia hermsii in western North Amer- burgdorferi in ticks and for enhancement of spirochetemia in mice. Cell 89: ica. Infect. Immun. 73: 6647–6658. 1111–1119. 32. Fuchs, H., M. M. Simon, R. Wallich, M. Bechtel, and M. D. Kramer. 1996. 57. Hovis, K. M., M. E. Schriefer, S. Bahlani, and R. T. Marconi. 2006. Immuno- Borrelia burgdorferi induces secretion of pro-urokinase-type plasminogen acti- logical and molecular analyses of the Borrelia hermsii factor H and factor H-like vator by human monocytes. Infect. Immun. 64: 4307–4312. protein 1 binding protein, FhbA: demonstration of its utility as a diagnostic 33. Fuchs, H., R. Wallich, M. M. Simon, and M. D. Kramer. 1994. The outer surface marker and epidemiological tool for tick-borne relapsing fever. Infect. Immun. protein A of the spirochete Borrelia burgdorferi is a plasmin(ogen) receptor. 74: 4519–4529. Proc. Natl. Acad. Sci. USA 91: 12594–12598. 58. Anda, P., P. B. Backenson, J. L. Coleman, and J. L. Benach. 1994. Epitopes 34. Nordstrand, A., A. Shamaei-Tousi, A. Ny, and S. Bergstrom. 2001. Delayed shared by unrelated antigens of Borrelia burgdorferi. Infect. Immun. 62: invasion of the kidney and brain by Borrelia crocidurae in plasminogen-deficient 1070–1078. mice. Infect. Immun. 69: 5832–5839. 59. Klempner, M. S., R. Noring, M. P. Epstein, B. McCloud, and R. A. Rogers. 1996. 35. Coleman, J. L., T. J. Sellati, J. E. Testa, R. R. Kew, M. B. Furie, and J. L. Benach. Binding of human urokinase type plasminogen activator and plasminogen to Bor- 1995. Borrelia burgdorferi binds plasminogen, resulting in enhanced penetration relia species. J. Infect. Dis. 174: 97–104. of endothelial monolayers. Infect. Immun. 63: 2478–2484. 60. Gebbia, J. A., J. C. Monco, J. L. Degen, T. H. Bugge, and J. L. Benach. 1999. The 36. Klempner, M. S., R. Noring, M. P. Epstein, B. McCloud, R. Hu, S. A. Limentani, plasminogen activation system enhances brain and heart invasion in murine re- and R. A. Rogers. 1995. Binding of human plasminogen and urokinase-type lapsing fever borreliosis. J. Clin. Invest. 103: 81–87. plasminogen activator to the Lyme disease spirochete, Borrelia burgdorferi. 61. Hajjar, K. A., A. T. Jacovina, and J. Chacko. 1994. An endothelial cell receptor J. Infect. Dis. 171: 1258–1265. for plasminogen/tissue plasminogen activator. I. Identity with annexin II. J. Biol. 37. Grab, D. J., G. Perides, J. S. Dumler, K. J. Kim, J. Park, Y. V. Kim, Chem. 269: 21191–21197. O. Nikolskaia, K. S. Choi, M. F. Stins, and K. S. Kim. 2005. Borrelia burgdor- 62. Rooijakkers, S. H. M., W. J. B. van Wamel, M. Ruyken, K. P. M. van Kessel, and feri, host-derived proteases, and the blood-brain barrier. Infect. Immun. 73: J. A. G. van Strijp. 2005. Anti-opsonic properties of staphylokinase. Microbes 1014–1022. Infect. 7: 476–484.