DOCSLIB.ORG
Recommended publications
  • LYME DISEASE Other Names: Borrelia Burgdorferi
    LYME DISEASE Other names: Borrelia burgdorferi CAUSE Lyme disease is caused by a spirochete bacteria (Borrelia burgdorferi) that is transmitted through the bite from an infected arthropod vector, the black-legged or deer tick Ixodes( scapularis). SIGNIFICANCE Lyme disease can infect people and some species of domestic animals (cats, dogs, horses, and cattle) causing mild to severe illness. Although wildlife can be infected by the bacteria, it typically does not cause illness in them. TRANSMISSION The bacteria has been observed in the blood of a number of wildlife species including several bird species but rarely appears to cause illness in these species. White-footed mice, eastern chipmunks, and shrews serve as the primary natural reservoirs for Lyme disease in eastern and central parts of North America. Other species appear to have low competencies as reservoirs for the bacteria. The transmission of Lyme disease is relatively convoluted due to the complex life cycle of the black-legged tick. This tick has multiple developmental stages and requires three hosts during its life cycle. The life cycle begins with the eggs of the ticks that are laid in the spring and from which larval ticks emerge. Larval ticks do not initially carryBorrelia burgdorferi, the bacteria must be acquired from their hosts they feed upon that are carriers of the bacteria. Through the summer the larval ticks feed on the blood of their first host, typically small mammals and birds. It is at this point where ticks may first acquireBorrelia burgdorferi. In the fall the larval ticks develop into nymphs and hibernate through the winter.
    [Show full text]
  • Comparative Phylogeny of the Genus Bordetella Using Sequence Analysis of 16S Rrna and Ompa Genes
    J Med Bacteriol. Vol. 6, No. 3, 4 (2017): pp.1-13 jmb.tums.ac.ir Comparative Phylogeny of the Genus Bordetella Using Sequence Analysis of 16S rRNA and ompA Genes Ali Badamchi 1, Moslem Papizadeh 2* 1 Children's Medical Center Hospital, Tehran University of Medical Sciences, Tehran, Iran. 2 Department of Microbiology, Pasteur Institute of Iran (IPI), Tehran, Iran. ARTICLE INFO ABSTRACT Article type: Background: The genus Bordetella harbors 16 species; three of them are well-known for their high Original Article medical importance. The phylogenetic diversity of the genus is currently not very well investigated. Methods: In this study, 16S rRNA gene sequence of 16 type strains of the Bordetella species were Article history: analyzed. Also, phylogenies conducted on the same gene of 247 isolates of Bordetella species, Received: 19 Jan 2017 comprising a wide physiological as well as ecological diversity and encompassing ex-type Revised: Jun Mar 2017 representatives of the 16 Bordetella species, were analyzed. Accepted: 11 Sep 2017 Results: It was found that the phylogenetic diversity of the genus may be very different from that is Published: 15 Oct 2017 currently assumed. Interestingly, the 16S rRNA gene signals could not resolve some species with Keywords: promising bootstrap and posterior probability values as our phylogenies, using maximum likelihood Alcaligenaceae, and Bayesian inference methods, showed. Biogeography, Bordetella Conclusion: Our results indicate a probable need for additional phylogenetic signals which can be species, Ecological provided by coding genes. Therefore, sequence data of ompA gene of Bordetella species, a critically distribution, Phylogenetic significant genomic region in pathogenesis, was here analyzed, phylogenetically.
    [Show full text]
  • Bartonella Apis Sp. Nov., a Honey Bee Gut Symbiont of the Class Alphaproteobacteria
    Serveur Academique´ Lausannois SERVAL serval.unil.ch Author Manuscript Faculty of Biology and Medicine Publication This paper has been peer-reviewed but does not include the final publisher proof-corrections or journal pagination. Published in final edited form as: Title: Bartonella apis sp. nov., a honey bee gut symbiont of the class Alphaproteobacteria. Authors: Keˇsnerov´aL, Moritz R, Engel P Journal: International journal of systematic and evolutionary microbiology Year: 2016 Jan Issue: 66 Volume: 1 Pages: 414-21 DOI: 10.1099/ijsem.0.000736 In the absence of a copyright statement, users should assume that standard copyright protection applies, unless the article contains an explicit statement to the contrary. In case of doubt, contact the journal publisher to verify the copyright status of an article. 1 Bartonella apis sp. nov., a honey bee gut symbiont of the 2 class Alphaproteobacteria 3 4 Lucie Kešnerová, Roxane Moritz, Philipp Engel* 5 6 Department of Fundamental Microbiology, University of Lausanne, CH-1015 7 Lausanne, Switzerland 8 9 Running title: Description of a bee gut symbiont 10 11 *Correspondence: 12 Prof. Philipp Engel 13 Department of Fundamental Microbiology 14 University of Lausanne, CH-1015 Lausanne, Switzerland 15 Tel.: +41 (0)21 692 56 12 16 e-mail: [email protected] 17 18 Category: New Taxa – Proteobacteria 19 Keywords: Apis mellifera; insect; Bartonella; gut microbiota; Alpha-1 20 21 Sequence deposition: The 16S rRNA gene sequences and protein-coding gene 22 sequences of the bacterial strains PEB0122T, PEB0149, PEB0150, BBC0104, and 23 BBC0108 from Apis mellifera, and the uncultured Rhizobiales bacterium from 24 Herpagnathos saltator are deposited in GenBank with accession numbers KP987849 25 – KP987886 and KT315729 – KT315734.
    [Show full text]
  • Phagocytosis of Borrelia Burgdorferi, the Lyme Disease Spirochete, Potentiates Innate Immune Activation and Induces Apoptosis in Human Monocytes Adriana R
    University of Connecticut OpenCommons@UConn UCHC Articles - Research University of Connecticut Health Center Research 1-2008 Phagocytosis of Borrelia burgdorferi, the Lyme Disease Spirochete, Potentiates Innate Immune Activation and Induces Apoptosis in Human Monocytes Adriana R. Cruz University of Connecticut School of Medicine and Dentistry Meagan W. Moore University of Connecticut School of Medicine and Dentistry Carson J. La Vake University of Connecticut School of Medicine and Dentistry Christian H. Eggers University of Connecticut School of Medicine and Dentistry Juan C. Salazar University of Connecticut School of Medicine and Dentistry See next page for additional authors Follow this and additional works at: https://opencommons.uconn.edu/uchcres_articles Part of the Medicine and Health Sciences Commons Recommended Citation Cruz, Adriana R.; Moore, Meagan W.; La Vake, Carson J.; Eggers, Christian H.; Salazar, Juan C.; and Radolf, Justin D., "Phagocytosis of Borrelia burgdorferi, the Lyme Disease Spirochete, Potentiates Innate Immune Activation and Induces Apoptosis in Human Monocytes" (2008). UCHC Articles - Research. 182. https://opencommons.uconn.edu/uchcres_articles/182 Authors Adriana R. Cruz, Meagan W. Moore, Carson J. La Vake, Christian H. Eggers, Juan C. Salazar, and Justin D. Radolf This article is available at OpenCommons@UConn: https://opencommons.uconn.edu/uchcres_articles/182 INFECTION AND IMMUNITY, Jan. 2008, p. 56–70 Vol. 76, No. 1 0019-9567/08/$08.00ϩ0 doi:10.1128/IAI.01039-07 Copyright © 2008, American Society for Microbiology. All Rights Reserved. Phagocytosis of Borrelia burgdorferi, the Lyme Disease Spirochete, Potentiates Innate Immune Activation and Induces Apoptosis in Human Monocytesᰔ Adriana R. Cruz,1†‡ Meagan W. Moore,1† Carson J.
    [Show full text]
  • Genomics 98 (2011) 370–375
    Genomics 98 (2011) 370–375 Contents lists available at ScienceDirect Genomics journal homepage: www.elsevier.com/locate/ygeno Whole-genome comparison clarifies close phylogenetic relationships between the phyla Dictyoglomi and Thermotogae Hiromi Nishida a,⁎, Teruhiko Beppu b, Kenji Ueda b a Agricultural Bioinformatics Research Unit, Graduate School of Agricultural and Life Sciences, University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan b Life Science Research Center, College of Bioresource Sciences, Nihon University, Fujisawa, Japan article info abstract Article history: The anaerobic thermophilic bacterial genus Dictyoglomus is characterized by the ability to produce useful Received 2 June 2011 enzymes such as amylase, mannanase, and xylanase. Despite the significance, the phylogenetic position of Accepted 1 August 2011 Dictyoglomus has not yet been clarified, since it exhibits ambiguous phylogenetic positions in a single gene Available online 7 August 2011 sequence comparison-based analysis. The number of substitutions at the diverging point of Dictyoglomus is insufficient to show the relationships in a single gene comparison-based analysis. Hence, we studied its Keywords: evolutionary trait based on whole-genome comparison. Both gene content and orthologous protein sequence Whole-genome comparison Dictyoglomus comparisons indicated that Dictyoglomus is most closely related to the phylum Thermotogae and it forms a Bacterial systematics monophyletic group with Coprothermobacter proteolyticus (a constituent of the phylum Firmicutes) and Coprothermobacter proteolyticus Thermotogae. Our findings indicate that C. proteolyticus does not belong to the phylum Firmicutes and that the Thermotogae phylum Dictyoglomi is not closely related to either the phylum Firmicutes or Synergistetes but to the phylum Thermotogae. © 2011 Elsevier Inc.
    [Show full text]
  • Differences in Genotype, Clinical Features, and Inflammatory
    RESEARCH Differences in Genotype, Clinical Features, and Inflammatory Potential of Borrelia burgdorferi sensu stricto Strains from Europe and the United States Tjasa Cerar,1 Franc Strle,1 Dasa Stupica, Eva Ruzic-Sabljic, Gail McHugh, Allen C. Steere, Klemen Strle Borrelia burgdorferi sensu stricto isolates from patients with B. afzelii, which usually remains localized to the skin, with erythema migrans in Europe and the United States and B. garinii, which is usually associated with nervous were compared by genotype, clinical features of infection, system involvement (1). B. burgdorferi infection is rare in and inflammatory potential. Analysis of outer surface pro- Europe; little is known about its clinical course there. In tein C and multilocus sequence typing showed that strains the United States, B. burgdorferi is the sole agent of Lyme from these 2 regions represent distinct genotypes. Clinical borreliosis; in the northeastern United States, it is particu- features of infection with B. burgdorferi in Slovenia were similar to infection with B. afzelii or B. garinii, the other 2 larly arthritogenic (1,2). For all 3 species, the first sign of Borrelia spp. that cause disease in Europe, whereas B. infection is often an erythema migrans lesion. However, B. burgdorferi strains from the United States were associ- burgdorferi infection in the United States is associated with ated with more severe disease. Moreover, B. burgdorferi a greater number of disease-associated symptoms and more strains from the United States induced peripheral blood frequent hematogenous dissemination than B. afzelii or B. mononuclear cells to secrete higher levels of cytokines garinii infection in Europe (4–7).
    [Show full text]
  • ID 2 | Issue No: 4.1 | Issue Date: 29.10.14 | Page: 1 of 24 © Crown Copyright 2014 Identification of Corynebacterium Species
    UK Standards for Microbiology Investigations Identification of Corynebacterium species Issued by the Standards Unit, Microbiology Services, PHE Bacteriology – Identification | ID 2 | Issue no: 4.1 | Issue date: 29.10.14 | Page: 1 of 24 © Crown copyright 2014 Identification of Corynebacterium species Acknowledgments UK Standards for Microbiology Investigations (SMIs) are developed under the auspices of Public Health England (PHE) working in partnership with the National Health Service (NHS), Public Health Wales and with the professional organisations whose logos are displayed below and listed on the website https://www.gov.uk/uk- standards-for-microbiology-investigations-smi-quality-and-consistency-in-clinical- laboratories. SMIs are developed, reviewed and revised by various working groups which are overseen by a steering committee (see https://www.gov.uk/government/groups/standards-for-microbiology-investigations- steering-committee). The contributions of many individuals in clinical, specialist and reference laboratories who have provided information and comments during the development of this document are acknowledged. We are grateful to the Medical Editors for editing the medical content. For further information please contact us at: Standards Unit Microbiology Services Public Health England 61 Colindale Avenue London NW9 5EQ E-mail: [email protected] Website: https://www.gov.uk/uk-standards-for-microbiology-investigations-smi-quality- and-consistency-in-clinical-laboratories UK Standards for Microbiology Investigations are produced in association with: Logos correct at time of publishing. Bacteriology – Identification | ID 2 | Issue no: 4.1 | Issue date: 29.10.14 | Page: 2 of 24 UK Standards for Microbiology Investigations | Issued by the Standards Unit, Public Health England Identification of Corynebacterium species Contents ACKNOWLEDGMENTS .........................................................................................................
    [Show full text]
  • View Tickborne Diseases Sample Report
    1360 Bayport Ave, Ste B. San Carlos, CA 94070 1(866) 364-0963 | [email protected] | www. vibrant-wellness.com PATIENT PROVIDER NAME: DEMO REPORT GENDER: Male PRACTICE NAME: Vibrant IT4 Practice DATE OF BIRTH: 04/14/1998 AGE: 22 PROVIDER NAME: Demo Client, DDD (999994) ADDRESS: TEST STREET, TEST CITY, KY- 42437. ACCESSION ID: 2009220006 PHLEBOTOMIST: 607 SPECIMEN COLLECTION TIME: 09-21-2020 11:14 SPECIMEN RECEIVED TIME: 09-22-2020 05:14 FINAL REPORT TIME: 09-25-2020 15:56 FASTING: FASTING Your Vibrant Wellness TickBorne 2.0 panel results are enclosed. These results are intended to aid in the diagnosis of tickborne diseases by your healthcare provider. The Vibrant Tickborne Diseases panel tests for IgG and IgM antibodies for Borreliosis/Lyme disease as well as co-infection(s) and opportunistic infections with other tick-borne illnesses along with detection of DNA of the species causing these infections. The Vibrant Immunochip test is a semiquantitative assay that detects IgG and IgM antibodies in human serum. The PCR Test is a real-time PCR Assay designed for qualitative detection of infectious group- specific DNA in clinical samples. Interpretation of Report: The test results of antibody levels to the individual antigens are calculated by comparing the average intensity of the individual antibody to that of a reference population and cut-off chosen for each protein. Reference ranges have been established using a well characterized set of more than 300 serum samples and antibodies to specific bacteria tested. The results are displayed as In Control, Moderate, or High Risk.for each antigen tested.
    [Show full text]
  • Table S1. Primers Used for PCR Amplification
    Table S1. Primers used for PCR amplification Name Primer Sequence (5’-3’) Gene target Taxon target Reference First PCR round DGGE analysis FGPH19 TACGGCAARGGTGGNATHG nifH Diazotrophic (Simonet et al. 1991) POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) 799F AACMGGATTAGATACCCKG 16S rRNA Bacteria (Chelius and Triplett 2001) 1492R TACGGYTACCTTGTTACGACTT 16S rRNA Bacteria (Chelius and Triplett 2001) F203α CCGCATACGCCCTACGGGGGAAAGATTTAT 16S rRNA Alphaproteobacteria (Gomes et al. 2001) F948β CGCACAAGCGGTGGATGA 16S rRNA Betaproteobacteria (Gomes et al. 2001) F243HCG GGATGAGCCCGCGGCCTA 16S rRNA Actinobacteria (Heuer et al. 1997) BACF GGGAAACCGGGGCTAATACCGGAT 16S rRNA Firmicutes (Garbeva et al. 2003) Second PCR round DGGE analysis POLF-GC CGCCCGCCGCGCCCCGCGCCCGGCCCGCCCCCG nifH Diazotrophic (Poly et al. 2001) CCCCTGCGAYCCSAARGCBGACTC AQER GACGATGTAGATITCCTG nifH Diazotrophic (Poly et al. 2001) F968-GC CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGC 16S rRNA Bacteria (Heuer et al. 1999) ACGGGGGGAACGAAGAACCTTAC R1401 CGGTGTGTACAAGACCC 16S rRNA Bacteria (Heuer et al. 1997) qPCR analysis POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) POLF TGCGAYCCSAARGCBGACTC nifH Diazotrophic (Poly et al. 2001) 6S-27F AGAGTTTGATCCTGGCTCAG 16S rRNA Bacteria Bulgari et al., 2014 338R GCTGCCTCCCGTAGGAGT 16S rRNA Bacteria Bulgari et al., 2014 Table 2. Primers used for Ion Torrent pyrosequencing analysis. Primer Primer sequence (5´-3´) Reference 967F-PP CNACGCGAAGAACCTTANC (Jünemann et al. 2012) 967F-UC1 CAACGCGAAAAACCTTACC (Jünemann et al. 2012) 967F-UC2 CAACGCGCAGAACCTTACC (Jünemann et al. 2012) 967F-UC3 ATACGCGARGAACCTTACC (Jünemann et al. 2012) 967F-AQ CTAACCGANGAACCTYACC (Jünemann et al. 2012) 1046R CGACAGCCATGCANCACCT (Jünemann et al. 2012) 1046R-PP CGACAACCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ1 CGACGGCCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ2 CGACGACCATGCANCACCT (Jünemann et al. 2012) Table S3. Alpha diversity indices. Statistical analysis of the total endophytic and diazotrophic endophytic bacterial community associated with sweet sorghum cv.
    [Show full text]
  • Cryptic Inoviruses Revealed As Pervasive in Bacteria and Archaea Across Earth’S Biomes
    ARTICLES https://doi.org/10.1038/s41564-019-0510-x Corrected: Author Correction Cryptic inoviruses revealed as pervasive in bacteria and archaea across Earth’s biomes Simon Roux 1*, Mart Krupovic 2, Rebecca A. Daly3, Adair L. Borges4, Stephen Nayfach1, Frederik Schulz 1, Allison Sharrar5, Paula B. Matheus Carnevali 5, Jan-Fang Cheng1, Natalia N. Ivanova 1, Joseph Bondy-Denomy4,6, Kelly C. Wrighton3, Tanja Woyke 1, Axel Visel 1, Nikos C. Kyrpides1 and Emiley A. Eloe-Fadrosh 1* Bacteriophages from the Inoviridae family (inoviruses) are characterized by their unique morphology, genome content and infection cycle. One of the most striking features of inoviruses is their ability to establish a chronic infection whereby the viral genome resides within the cell in either an exclusively episomal state or integrated into the host chromosome and virions are continuously released without killing the host. To date, a relatively small number of inovirus isolates have been extensively studied, either for biotechnological applications, such as phage display, or because of their effect on the toxicity of known bacterial pathogens including Vibrio cholerae and Neisseria meningitidis. Here, we show that the current 56 members of the Inoviridae family represent a minute fraction of a highly diverse group of inoviruses. Using a machine learning approach lever- aging a combination of marker gene and genome features, we identified 10,295 inovirus-like sequences from microbial genomes and metagenomes. Collectively, our results call for reclassification of the current Inoviridae family into a viral order including six distinct proposed families associated with nearly all bacterial phyla across virtually every ecosystem.
    [Show full text]
  • Cystic Fibrosis Mice Develop Spontaneouschronic Bordetella
    ISSN 2470-3176 SciO p Forschene n HUB for Sc i e n t i f i c R e s e a r c h Journal of Infectious Pulmonary Diseases Research Article Volume: 3.2 Open Access Received date: 11 Oct 2017; Accepted date: 28 Cystic Fibrosis Mice Develop Spontaneous Oct 2017; Published date: 02 Nov 2017. Chronic Bordetella Airway Infections Citation: Darrah R, Bonfield T, LiPuma JJ, Litman P, Hodges CA, et al. (2017) Cystic Fibrosis Mice Darrah R1*, Bonfield T2, LiPuma JJ3, Litman P1, Hodges CA4, Jacono F5 and Develop Spontaneous Chronic Bordetella Airway Drumm M6 Infections. J Infect Pulm Dis 3(2): doi http://dx.doi. org/10.16966/2470-3176.128 1Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA 2Department of Pediatrics, Case Western Reserve University, Cleveland Ohio, USA Copyright: © 2017 Darrah R, et al. This is an 3Department of Pediatrics and Communicable Diseases, University of Michigan Medical School, Ann open-access article distributed under the terms Arbor, Michigan, USA of the Creative Commons Attribution License, 4Departments of Radiology, Biomedical Engineering, and Pediatrics, Case Western Reserve University, which permits unrestricted use, distribution, and Cleveland Ohio, USA reproduction in any medium, provided the original 5Department of Medicine, Case Western Reserve University, and Louis Stokes VA Cleveland Medical author and source are credited. Center, USA 6Departments of Pediatrics and Genetics Genome Sciences, Case Western Reserve University, Cleveland Ohio, USA *Corresponding author: Rebecca Darrah, Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA, Tel: 216-368-4911; E-mail: [email protected] Abstract Chronic pulmonary disease and infection is the primary cause of morbidity and mortality in people with cystic fibrosis (CF).
    [Show full text]
  • Bordetella Petrii Clinical Isolate Isolates of This Species Have Been Previously Reported from 4
    routine laboratory protocols. Initial susceptibility testing Bordetella petrii using disk diffusion indicated apparent susceptibility of the isolate to erythromycin, gentamicin, ceftriaxone, and Clinical Isolate piperacillin/tazobactam. The isolate was resistant to amox- icillin, co-amoxiclav, tetracycline, clindamycin, ciproflo- Norman K. Fry,* John Duncan,* Henry Malnick,* xacin, and metronidazole. After initial sensitivity results, a Marina Warner,* Andrew J. Smith,† 6-week course of oral clarithromycin (500 mg, 8 hourly) Margaret S. Jackson,† and Ashraf Ayoub† was begun. We describe the first clinical isolate of Bordetella petrii At follow-up appointments 3 months and 6 months from a patient with mandibular osteomyelitis. The only pre- after antimicrobial drug therapy ceased, clinical and radi- viously documented isolation of B. petrii occurred after the ographic findings were not unusual, and the infected area initial culture of a single strain from an environmental healed successfully. Despite the successful clinical out- source. come, the isolate was subsequently shown to be resistant to clarithromycin in vitro (Table). Improvement of the 67-year-old man visited an emergency dental clinic, osteomyelitis may also have been facilitated by the biopsy Awhere he complained of toothache in the lower right procedure, during which a sequestrum of bone was mandibular quadrant. Examination showed a root-filled removed. lower right canine tooth that was mobile and tender to per- The gram-negative bacillus (designated strain cussion. The tooth was extracted uneventfully under local GDH030510) was submitted to the Health Protection anesthesia. The patient returned after several days with Agency, Centre for Infections, London, for identification. pain at the extraction site. A localized alveolar osteitis was Preliminary tests results were consistent with those diagnosed, and local debridement measures were institut- described for members of the genus Bordetella.
    [Show full text]