Use of Dna Sequencing to Identify the Origin of Northwestern and Southwestern Pond Turtles in Captive Breeding Programs

ABSTRACT USE OF DNA SEQUENCING TO IDENTIFY THE ORIGIN OF NORTHWESTERN AND SOUTHWESTERN POND TURTLES IN CAPTIVE BREEDING PROGRAMS

Captive breeding is a critical management strategy in the recovery and preservation of certain threatened and endangered species. Programs that implement captive breeding must maintain a balance between preserving the genetic purity and genetic diversity of a population in order to build a viable group of individuals for future reintroduction. This may be difficult due to a limited number of extant wild individuals for establishment of founder populations, leading to an increased risk of inbreeding or outbreeding depression in subsequent generations. In this study, I worked in collaboration with 24 zoos, museums, and aquariums through the Western Pond Turtle Species Survival Plan Sustainability Project to aid in conservation of two threatened and endangered freshwater turtle species through captive breeding. As individuals of the two different species can appear morphologically identical, I used DNA sequencing to identify wild-bred Northwestern (Actinemys marmorata) and Southwestern Pond Turtles (Actinemys pallida) to build captive brood stock of both species. Relatively few studies have assessed conservation efforts in consideration of two genetically distinct species within the genus Actinemys as the majority of research on this clade was done before the discovery of a second species. Here, I analyzed the nicotinamide adenine dehydrogenase subunit four (ND4) mitochondrial gene to identify species and geographic origin for 133 captive pond turtles including 71 members of A. marmorata and 62 A. pallida individuals. Results of this study were used to inform captive breeding program collaborators so that husbandry is managed in consideration of species, geographic origin, and the subsequent risks of outbreeding and inbreeding depression.

Rachel L. Lopez December 2019

USE OF DNA SEQUENCING TO IDENTIFY THE ORIGIN OF NORTHWESTERN AND SOUTHWESTERN POND TURTLES IN CAPTIVE BREEDING PROGRAMS

by Rachel L. Lopez

A thesis

submitted in partial fulfillment of the requirements for the degree of Master of Science in Biology in the College of Science and Mathematics California State University, Fresno December 2019 APPROVED For the Department of Biology:

We, the undersigned, certify that the thesis of the following student meets the required standards of scholarship, format, and style of the university and the student's graduate degree program for the awarding of the master's degree.

Rachel L. Lopez Thesis Author

Joshua Reece (Chair) Biology

Rory Telemeco Biology

Rodney Olsen Biology

For the University Graduate Committee:

Dean, Division of Graduate Studies AUTHORIZATION FOR REPRODUCTION OF MASTER’S THESIS

X I grant permission for the reproduction of this thesis in part or in its entirety without further authorization from me, on the condition that the person or agency requesting reproduction absorbs the cost and provides proper acknowledgment of authorship.

Permission to reproduce this thesis in part or in its entirety must be obtained from me.

Signature of thesis author: ACKNOWLEDGMENTS I would like to sincerely thank my primary advisor, Dr. Joshua Reece, for his continuous support, instruction, and constructive criticism throughout the final year of my undergraduate program and my entire graduate program. I would like to thank Rodney Olsen as a friend, dedicated instructor, and committee member for the direction, instruction, and advice he provided me as an undergraduate student, and his continuous support and constructive comments throughout my graduate program. I would like to thank Dr. Rory Telemeco for his advice and constructive comments throughout the development and completion of this project, and his inspiration as a passionate instructor and herpetologist. I would like to thank Mark Halvorsen and Scott Barton for their contribution to the initiation and continuation of this project. Zoos and all other animal holding facilities that participated in this project were recruited through the Director of Conservation at San Francisco Zoo, Jessie Bushell, who has made an incredible contribution to conservation through her work with the Association of Zoos and Aquariums. I would like to thank collaborators and wildlife managers at each of the following animal holding facilities that participated in this project: The Fresno Chaffee Zoo, Micke Grove Zoo, the Woodland Park Zoo, the Washington Department of Fish and Wildlife, the Oregon Zoo, the High Desert Museum, the Detroit Zoological Society, the Sequoia Park Zoo, Turtle Bay Exploration Park, the Sacramento Zoo, Lindsay Wildlife Experience, the Oakland Zoo, the California Living Museum, the Aquarium of the Bay,

Randall Museum, the San Francisco Zoo, Curi Odyssey, the Palo Alto Junior Museum, the Monterey Bay Aquarium, the Santa Barbara Zoo, the California Science Center, the Santa Ana Zoo, the Living Desert, and the San Diego Zoo. Funding for this study was provided through the Graduate Net Initiative Fellowship Award, the Tokalon Alumnae Award, the Graduate Research and Creative Activity Support Award, and the Financial Support for Student Research Award through California State University Fresno. I would v v like to thank all of the students in the Reece Lab who participated in this project and supported me throughout the process. I would like to specifically thank Chris Jorgensen and Shelby Moshier for their continuous support, encouragement, and assistance throughout the development and completion of this project. My family was a crucial support in my education. I would like to thank my husband, Jakob Lopez, and my immediate family, David, Marta, and Emily Morrow for helping me to discover and pursue my passions throughout every stage of my life. I am grateful for all of the incredible professors that have helped me through my undergraduate and graduate degrees, and would like to thank Hawkins Dowis for his support and encouragement throughout the years that I have known him and had the privilege of assisting him and Rodney Olsen in instruction at Fresno City College. I would also like to thank Mark Schreiber for his assistance and advice throughout the development and completion of this project. TABLE OF CONTENTS Page

LIST OF TABLES ...... viii

LIST OF FIGURES ...... ix

INTRODUCTION ...... 1

LITERATURE REVIEW ...... 6

Species Classification ...... 6

Native Range ...... 7

Natural History and Conservation Efforts ...... 8

Conservation Status ...... 10

PROJECT DESIGN ...... 12

Sample Collection ...... 12

Mitochondrial DNA Extraction, Amplification, and Isolation ...... 12

Gene Sequencing ...... 14

Species and Geographic Origin Inference ...... 14

RESULTS ...... 16

Sample Collection ...... 16

Mitochondrial DNA Data and Clade Membership ...... 16

DISCUSSION ...... 23

CONCLUSION ...... 27

REFERENCES ...... 28

APPENDICES ...... 37 APPENDIX A: INFERRED SPECIES AND GEOGRAPHIC ORIGIN FOR INDIVIDUALS HELD IN ANIMAL HOLDING FACILITIES PARTICIPATING IN THE WESTERN POND TURTLE SSP SUSTAINABILITY PROJECT ...... 38 vii vii Page

APPENDIX B: HAPLOTYPES OF MEMBERS OF ACTINEMYS MARMORATA (BEGINNING WITH AM) AND MEMBERS OF ACTINEMYS PALLIDA (BEGINNING WITH AP) ...... 48 APPENDIX C: NUMBER OF CAPTIVE MEMBERS OF ACTINEMYS MARMORATA AND ACTINEMYS PALLIDA IN EACH COLLABORATING ANIMAL HOLDING FACILITY IN RELATION TO NATIVE DISTRIBUTION OF EACH SPECIES FROM NORTHWEST WASHINGTON TO BAJA CALIFORNIA ...... 50 APPENDIX D: ANIMAL HOLDING FACILITIES PARTICIPATING IN THE WESTERN POND TURTLE SSP SUSTAINABILITY PROJECT ...... 52

LIST OF TABLES

Page

Table 1. Primers Used for Amplification of the ND4 Gene ...... 13

LIST OF FIGURES

Page

Figure 1. Haplotype network generated from 133 captive members of Actinemys marmorata and Actinemys pallida from this study as well as 70 from a database of known individuals from specific populations and geographic locations (Spinks & Shaffer, 2005)...... 18

INTRODUCTION

Captive breeding programs function to preserve populations of threatened and endangered species by using wild brood stock to develop a viable captive population for future reintroduction into their native habitat (Conde, D. A., Flesness, N., Colchero, F., Jones, O. R., Scheuerlein, A., 2011). In these programs, zoos and animal holding facilities establish nurseries or hatcheries to maintain a stable population of individuals of a species that may be unable to persist in the wild (Rollinson et al., 2014). Captive breeding was initially used to prevent extinction of the most critically endangered species (Araki et al., 2007), but is now used as a preventative form of conservation to restore populations of declining species before they reach critically low numbers (Conde et al., 2011). Species that may benefit from ex situ (off site) conservation efforts such as captive breeding and head-starting programs can be identified through a population and habitat viability analysis (PHVA) (Fraser, 2008; Pramuk et al., 2016). Habitat assessment surveys such as the PHVA function to evaluate the status of a target species in its native habitat as well as to assess and potentially improve existing conservation efforts (Pramuk et al., 2016). These analyses are used to identify specific in situ (on site) management actions that are most likely to fulfill an established recovery plan (Canessa et al., 2016), and are instrumental in the integration of ex situ conservation efforts when necessary for species survival (Schwartz et al., 2017).

In ex situ conservation efforts such as captive breeding, managers strive to uphold a balance between preserving the original genetic lineage of a taxon (Mason et al., 1967) and maintaining its genetic diversity to increase individual and population fitness (Fleming & Gross, 1993). Ex situ programs have contributed to the persistence of numerous threatened species, but they do have a higher potential of introducing negative influences that may lead to a decrease in fitness. Increased risk of hybridization (Conde et 2 2 al., 2011), outbreeding depression, inbreeding depression (Rollinson et al., 2014), acclimatization to captivity, disease exposure (Snyder et al., 1996), and other stressors may lead to decreased viability in some captive populations (O’Brien & Evermann, 1988). This potential is reduced by the use of local wild brood stock to develop captive populations rather than using captive bred first-generation individuals that may provide less genetic diversity and decrease the fitness of future generations (Araki et al., 2007).

In situ conservation efforts may have the greatest positive impact on threatened and endangered species and are usually more cost effective than ex situ conservation (Martin et al., 2014), but this approach is increasingly difficult for species that are pressured by severe habitat loss and fragmentation (Balmford et al., 1995; Curran et al., 2004; Witzenberger & Hochkirk, 2011). Because of this, ex situ actions may be a more effective short-term resolution for species whose habitat may no longer be conducive to the persistence of a population (Bowkett, 2009; Conde et al., 2011; Hutchins et al., 2003).

For such species, the International Union for Conservation of Nature (Touch, 2002), the U.S. Endangered Species Act, and the Convention on Biological Diversity (CBD Article 9) agree that captive breeding may be the best strategy for recovery, but that it should be done concurrently with in situ conservation efforts (Conde et al., 2011) as well as phylogenetic and phylogeographic analyses (Snyder et al., 1996).

Phylogenetic and phylogeographic studies have been primarily conducted by analysis of mitochondrial DNA (mtDNA) (Avise, 1998) for more than three decades (Avise, 2000). Mitochondrial DNA can be used for accurate representation of the genealogy of a particular gene (Arif et al., 2011), and possesses distinct advantages over other molecular markers used in phylogenetic research (Gupta et al., 2015). These favorable traits of mtDNA include a higher mutation rate than nuclear DNA (nuDNA) (Spinks & Shaffer, 2005), increased susceptibility to change through mutation rather than 3 3 recombination, small genome size (Gupta et al., 2015), and ease of collection due to the large number of copies in each cell (Arif et al., 2011). I used the mitochondrial ND4 gene to assess the ancestry of Northwestern (Actinemys marmorata) and Southwestern Pond Turtles (Actinemys pallida) in captive breeding programs organized through the Association of Zoos and Aquariums (AZA) as part of the Western Pond Turtle Species Survival Plan (SSP) Sustainability Project. My conclusions were made in consideration of previous multi-locus analyses utilizing nuDNA sequence data (Spinks & Shaffer, 2005; Spinks et al., 2014) because mtDNA alone does not detect hybrid ancestry (McCormack et al., 2012; Merz et al., 2013). While multi-locus analyses involving nuDNA and SNP data may provide a more comprehensive understanding of population structure, I used mtDNA markers in this study because genomic analyses show that hybridization between members of A. marmorata and A. pallida is rare in nature (Gray, 1995; Spinks & Shaffer, 2005; Spinks et al., 2014). Future research will incorporate the use of nuDNA and restriction site associated DNA sequencing (RAD sequencing) to confirm population structure among any individuals with disputable or unexpected results detected through mtDNA analyses in this study. This separate component of this project will indicate potential ancestral polymorphism or introgression events in populations of A. marmorata and A. pallida, and will contribute to our understanding of the historic and current phylogeographic and phylogenetic patterns observed in these species. Populations of A. marmorata and A. pallida have been reduced to relatively small numbers compared to historical records and are facing a number of natural and anthropogenic threats (Purcell et al., 2017). These charismatic reptiles are commonly collected and brought to zoos and animal holding facilities as an attempted rescue by people who find them injured or far from water. Many conservation managers have taken advantage of this high rate of capture and established ex situ conservation programs to 4 4 protect these declining species from local extirpation or extinction (Snyder et al., 1996). Implementation of ex situ conservation is a viable strategy for species such as A. marmorata and A. pallida that tend to have relatively slow life-history traits with low fecundity and long generation times (Schwartz et al., 2017; Snyder et al., 1996). In this study, I worked with zoos and other animal holding facilities through the Western Pond Turtle SSP Sustainability Project to aid in the protection and restoration of A. marmorata and A. pallida through ex situ conservation. The Western Pond Turtle SSP Sustainability Project was initiated by the AZA, which represents a collaboration of institutions dedicated to species conservation, public education, science, and recreation. This SSP project was developed with the purpose of establishing species-specific captive breeding protocols and reintroduction and population augmentation assessment plans for pond turtles in AZA accredited institutions (Bushell et al., 2017). Many pond turtles in captivity have been moved from their geographic origin and are considered not releasable due to potential disease factors and inability to determine species from collection data. Members of A. marmorata and A. pallida are often indistinguishable based on morphological characteristics. Because of this similarity, I used comprehensive genetic and phylogeographic analyses to identify SSP program animals in this study (Witzenberger & Hochkirk, 2011) so that breeding may be managed according to species (Keller & Waller, 2002) and inferred population of origin (Spinks & Shaffer, 2005).The Western Pond Turtle SSP Sustainability Project was developed conjointly with other conservation efforts dedicated to habitat mapping, shell disease control, population assessment, public engagement, and creation and implementation of range wide conservation action plans for A. marmorata and A. pallida (Bushell et al., 2017). All of these projects are being managed through the AZA program, Saving Animals from Extinction (SAFE), in response to needs or threats identified to have a major impact on populations or entire species. These priority efforts have been 5 5 implemented through collaboration between AZA SAFE and many other Western Pond Turtle conservation specialists to restore populations of A. marmorata and A. pallida to a sustainable level through a balance of in situ and ex situ conservation actions. In this project, I used phylogenetic and phylogeographic analyses to aid in the protection and restoration of members of A. marmorata and A. pallida through captive breeding. Research has been done on the genus Actinemys since members of this clade were first described as a single species in 1852, but relatively few studies have been conducted that account for the presence of two genetically distinct species within Actinemys. I addressed the management units within both A. marmorata and A. pallida so that breeding may be more efficiently managed in consideration of species, geographic origin, and the subsequent risks of outbreeding and inbreeding depression. I worked in collaboration with zoos, museums, and aquariums distributed throughout the native ranges of both A. marmorata and A. pallida, including the state of California and the western regions of Oregon and Washington. These animal holding facilities manage wild- bred individuals of both species to develop populations fit for future re-introduction. Many of the program animals that will be used for captive breeding were of unknown species and geographic origin. In this study, I assigned each individual to the most likely population of origin so that collaborating facilities may establish captive populations of

A. marmorata and A. pallida to aid in the rehabilitation and reintroduction of these turtles into their native habitat.

LITERATURE REVIEW

Species Classification The Northwestern and Southwestern Pond Turtle (Actinemys marmorata and Actinemys pallida) were first recorded as one species by Baird and Girard in 1852 in the Puget Sound, Washington (Hallock et al., 2017). These species are both designated under the family Emydidae and the order Testudines (Parham & Feldman, 2002), and were previously collectively known as the Pacific Pond Turtle (Clemmys marmorata) then subsequently the Western Pond Turtle (Emys marmorata). Further phylogenetic research revealed a genetic and morphologic distinction between the Western Pond Turtle and other members of the genus Emys, such that members of Emys may not share a monophyletic group with the Western Pond Turtle (Fritz et al., 2011). This contradiction led to the separation of the Western Pond Turtle into the genus Actinemys. Members of this genus were classified as a single species for over a century, but the taxonomy and knowledge of the phylogeny of Actinemys have changed as a result of more recent discoveries (Hallock et al., 2017). Phylogeographic and genetic analyses suggest that this taxon is composed of two divergent family lineages, A. marmorata and A. pallida, that should be treated as distinct species in conservation efforts (Spinks et al., 2014). Phylogeography can be used to discover patterns of genetic divergence and species delimitation across habitats (Dimmick et al., 1999; Mayden & Wood, 1995) as well as the processes that may have led to them (Avise, 2000; Avise et al., 1987; Pease et al., 2009; Walstrom et al., 2012). In a comprehensive analysis of the phylogeographic history of the genus Actinemys, Spinks et al. (2014) shed light on the evolutionary lineage of this clade in a comparison of genetic and morphological data. Spinks et al. (2014) used analyses of nuDNA sequence data, traditional mtDNA, and a comprehensive survey of single-nucleotide polymorphism (SNP) data to generate a more extensive geographic, 7 7 population-based, and genome-wide representation of the history and management units within the genus Actinemys. Spinks et al. (2014) conducted an analysis of five nuDNA sequences to resolve the controversies of whether this clade is composed of two (Jennings & Hayes, 1994; Seeliger, 1945) or four (Spinks & Shaffer, 2005) divergent subgroups and to discover the extent of intergradation between them. This analysis supported the hypothesis that Actinemys is composed of two genetically distinct primary groups from the northern (A. marmorata) and southern (A. pallida) regions of its native range, with limited admixture restricted to the central coast range of California (Gray, 1995; Spinks et al., 2014). These two species within the genus Actinemys are supported by a model of multispecies coalescence, and confirmed as two genetically distinct groups under the general lineage species concept (Spinks et al., 2014).

Native Range The Northwestern Pond Turtle (A. marmorata) occurs in California throughout the Great Central Valley and north of the San Francisco Bay area, with scattered populations along the western regions of Oregon and Washington (Nafis, 2016a; Spinks et al., 2014). A relict population of A. marmorata may still exist from historical associations in southwestern British Columbia (Nafis, 2016a; Stebbins, 2003), however this group has been deemed extirpated (NatureServe, 2012) and only potentially recoverable through local translocation if other relict populations are discovered in

Canada or by translocation of Northwestern Pond Turtles from the United States (Environment Canada, 2015). One isolated population of A. marmorata exists in western Nevada (Stebbins, 2003). Genetic similarity between this Nevada group and two established populations from California indicate the possibility of human introduction of pond turtles to the area (Cary, 1889; Spinks et al., 2014). 8 8

The Southwestern Pond Turtle (A. pallida) has an approximate native range from the Central Coast Ranges of California south of the San Francisco bay area to Baja California (Spinks et al., 2014). Pond turtles in Baja California are considered to be members of A. pallida, however research is being done to confirm that these are in fact Southwestern Pond Turtles and not members of a third genetically distinct species (Nafis, 2016b). One isolated population of A. pallida remains in the Mojave River near Camp

Cody and Afton Canyon (Lovich & Meyer, 2002). This group represents a remnant of a larger population that existed in this area when streams and tributaries from adjacent mountains fed into the Pacific Ocean through the Mojave Desert, and the Mojave River was active year-round (Nafis, 2016b).

Natural History and Conservation Efforts Populations of both A. marmorata and A. pallida have been observed in many different habitats from sea level to approximately 2,050 meters in elevation in California (Purcell et al., 2017) and throughout their respectful native ranges (Nafis, 2016a; Nafis, 2016b). Both species are dependent on aquatic environments for mating and foraging, but they also utilize upland environments for certain activities and life stages including nesting and overwintering (Reese & Welsh, 1997). These turtles can occupy wetlands, slow streams, lakes, and ponds (Pramuk et al., 2016) adjacent to terrestrial settings including agricultural land, urban landscaped areas, forests, grasslands, and other disturbed and natural environments (Leidy et al., 2016). The ability to fill a broad array of ecological niches is a beneficial adaptive strategy for both A. marmorata and A. pallida, but this population-level adaptability presents researchers with the challenge of developing management protocols that are site and species-specific (Pearson et al., 2014). Each habitat has unique environmental conditions that may have an impact on the persistence of a population (Ruso et al., 2017). 9 9

For instance, populations of pond turtles dependent on small, ephemeral water sources may be more heavily impacted by drought and anthropogenic land-use change compared to other populations in perennial aquatic habitats. This is a particular problem for populations that are geographically isolated and may have no alternative habitats to colonize (Purcell et al., 2017). Management and conservation protocols are recommended to incorporate how target populations of these turtles respond to primary stressors including climate change (Purcell et al., 2017), habitat loss (Hays et al., 1999; Quesnelle et al., 2014), and competition with invasive species (Spinks et al., 2003). These three stressors may be among the main influences for their decline, but other factors including disease, predation, slow growth rate, small population size, delayed sexual maturity, and temperature dependent sex determination can decrease the tolerance of A. marmorata and A. pallida populations to other external threats (Hallock et al., 2017). Another factor that may complicate development of conservation protocols is the conflict of whether management should prioritize certain communities or species (Lawler, 2009; Pearson et al., 2014) or equally consider all taxonomic groups (Tingley et al., 2013). Some researchers believe conservation efforts should be determined by the topographic diversity of an area (Tingley et al., 2013), the evolutionary potential of a taxon (Lawler, 2009), or the value assigned to a given taxon depending on the benefit it provides to humans (Justus et al., 2009).

The IUCN Red List determines risk of endangerment based upon factors including the area occupied by a species, whether that area occupied is declining, stationary, or increasing, species population sizes, and spatial dynamics between the species and the environment (Pearson et al., 2014). More recent studies have shown that endemic species with signs of endangerment according to the IUCN Red List of Threatened Species should be a primary focus of conservation (Pearson et al., 2014) as 10 10 the IUCN is one of the most universally recognized systems for assessing the extinction risk of a species (Vié et al., 2009). Other studies have used categories of vulnerability established by the Partners in Amphibian and Reptile Conservation (PARC) (Gibbons & Stangel, 1999). These categories include threats associated with habitat loss and degradation, non-native invasive species, environmental pollution, disease and parasitism, unsustainable use, and global climate change. Vulnerability assessment surveys using both IUCN Red List and PARC criteria demonstrate that many reptile and amphibian taxonomic groups are experiencing a global decline (Gibbons et al., 2000), and may have the highest risk of extinction among other threatened taxa (Urban, 2015). Buhlmann et al. (2009) recorded that 63% of all freshwater turtles and tortoises on the IUCN Red List are considered threatened, 10% are endangered, and 42% of all known turtle species are threatened. A study done on the global decline of reptiles indicated that conservation of turtle species should be a priority effort due to the sustained degree of natural and anthropogenic threats (Gibbons et al., 2000). Despite controversies regarding prioritization of certain threatened taxonomic groups, conservation efforts are necessary to protect not only the instrumental value that biodiversity has for humans in the form of ecosystem services (Justus et al., 2009), but also its unique intrinsic worth (Noss, 2007).

Conservation Status Actinemys marmorata and A. pallida are presumed to be the only species of extant freshwater turtles native to California (Stebbins, 2003), and are being managed in consideration of conservation status as well as current and potential threats to their survival (Jennings, 2004). The Desert Mud Turtle (Kinosternon sonoriense sonoriense) is also native to California but is presumed to be extinct as there has not been a verifiable record of its presence across its native range since 1962 (Stebbins & McGinnis, 2012). Actinemys marmorata was most recently assessed under the IUCN Red List of 11 11

Threatened Species in 1996 and was considered vulnerable throughout its entire native range (Tortoise & Freshwater Turtle Specialist Group, 1996). Actinemys pallida has not yet been assessed as a separate species by the IUCN Red List of Threatened Species. Actinemys marmorata was state listed as an endangered species in Washington in 1993 (WDFW, 1993) and is being considered for listing under the federal Endangered Species Act (Giese et al., 2012; Hallock et al., 2017) by the U.S. Fish and Wildlife Service

(USFWS, 2015). Actinemys marmorata is under the Red List (includes any species or subspecies considered to be extirpated, endangered, or threatened) in British Columbia (B.C. Conservation Data Centre, 2016), and is considered a sensitive-critical species in Oregon (ODFW, 2008). Actinemys marmorata and A. pallida are both currently listed as species of special concern in California (Nafis, 2016a; Nafis, 2016b), but are under review for different listing by the California Department of Fish and Wildlife due to the recent recognition of A. pallida as a separate species. Actinemys marmorata is globally ranked as G3G4 (NatureServe, 2019), with individual ranks for each state and province it is native to; it is ranked as vulnerable (S3) in California and Nevada; imperiled (S2) in Oregon; critically imperiled (S1) in Washington; and is presumed extirpated (SX) in British Columbia (Hallock et al., 2017). Actinemys pallida has not yet been assigned conservation rankings in NatureServe (2019). Most conservation rankings assigned to A. marmorata do not recognize the presence of a second species within Actinemys and may include some data that is relevant to A. pallida. This gap in our understanding of the conservation needs within Actinemys emphasizes the importance of efforts designed to preserve the genetic diversity of both species, as populations of pond turtles across the entire range of this genus are in precipitous decline (Spinks et al., 2014).

PROJECT DESIGN

Sample Collection This study was designed to analyze as many individuals as possible, with a minimum sample size of approximately 80 Northwestern and Southwestern Pond Turtles. I prepared vials containing dimethyl sulfoxide (DMSO) buffer and marked each with individual identification numbers beginning with “WPT.” I sent these vials out to each of the zoos and animal holding facilities participating in the Western Pond Turtle SSP Project. Wildlife managers from each facility were requested to place 2-5 drops of freshly drawn blood from each turtle into the vials provided. The name assigned to each turtle by the facility and any additional information was recorded under the corresponding “WPT” number on a provided data sheet. These samples were packaged appropriately and returned to C.S.U. Fresno Department of Biology for DNA analyses and specimen identification.

Mitochondrial DNA Extraction, Amplification, and Isolation DNA extraction protocols and conditions for PCR of the ND4 gene were performed according to manufacturer’s instructions (Thermo Fisher Scientific) and protocols used by Spinks and Shaffer (2005). These protocols were chosen due to the similarity between our project and that done by Spinks and Shaffer (2005), which also used a standard set of biomedical procedures for gene isolation and species identification. DNA was extracted from all Northwestern and Southwestern Pond Turtle blood samples using an Invitrogen PureLink Genomic DNA Mini Kit for purification of blood lysate (Invitrogen 2.0). Approximately 740 bp fragments of the mitochondrial ND4 region were amplified by performing Taq-mediated PCR on all samples of purified DNA. This was done using primers for both forward and reverse sequences of the ND4 gene, specifically 13 13

Leu (Arevalo et al., 1994) and ND4672 (Engstrom et al., 2002) primers shown in Table 1. The reaction mixture used in PCR was composed of 10µL GoTaq Green Master Mix containing 2 X Green GoTaq Reaction Buffer, 400µM dATP, 400µM dGTP, 400µM dCTP, 400µM dTTP, and 3mM MgCl2 (Promega), 0.5 µL of each 10µM primer, 1 µL of DNA, and 8 µL nuclease-free water (Promega) for 20 µL reactions. Control groups consisted of the same mixture of reagents used in PCR, but with 1 µL of nuclease-free water in place of DNA for the negative control, and 1 µL of DNA from a previously analyzed sample for the positive control. The positive control groups were used as a reference for band size during gel electrophoresis. All samples were subjected to a thermal cycling process involving one period of denaturation at 95°C for 2 min, 35 cycles of annealing, denaturation, and elongation at 95°C for 30 sec, 53°C for 30 sec and 72°C for 1.5 min, and then a final cycle of elongation at 72°C for 5 min.

Table 1. Primers Used for Amplification of the ND4 Gene

Primer Sequence (5’-3’) Gene Length Source

Leu CATTACTTTTACTTGGATTTGCACCA ND4+tRNAHis 742 bp Arevalo et al.

(1994)

ND4672 TGACTACCAAAAGCTCATGTAGAAGC ND4+tRNAHis 742 bp Engstrom et al.

(2002)

Each sample of replicated DNA was examined via gel electrophoresis to isolate the ND4 target region. Gels were prepared as a 1.5% mixture of agarose and 50x TAE electrophoresis buffer, then treated with ethidium bromide so that bands could be visualized under UV illumination. mtDNA samples, control groups, and 1 kB DNA ladder were loaded into separate wells and run at 90V for 50 min. Each band observed was separated out and weighed in preparation for DNA extraction. mtDNA fragments of 14 14 the ND4 gene were extracted according to manufacturer’s protocols using an Invitrogen PureLink Quick Gel Extraction Kit (Invitrogen).

Gene Sequencing All samples of purified ND4 gene were sequenced in both directions using Sanger Sequencing methods at the University of Texas at Arlington through the Genomics Core Facility in the Biology Department, where analysts generated chromatograms of the ND4 gene target regions. I analyzed and aligned these sequence chromatograms at California State University, Fresno using the bioinformatics software Geneious (Kearse et al., 2012). Common motifs were used to align and compare these haplotype sequences with reference ND4 sequence data generated in previous studies (Spinks & Shaffer, 2005; Spinks et al., 2014). This reference database (Spinks & Shaffer, 2005) was compiled using collection data from members of both A. marmorata and A. pallida from clades across the entire native ranges of the Northwestern and Southwestern Pond Turtle. The alignment of all haplotype sequences analyzed in this study was then used for phylogenetic network estimation using statistical parsimony in TCS v1.21 (Clement et al., 2000).

Species and Geographic Origin Inference I generated a parsimony-based haplotype network using TCS v1.21 (Clement et al., 2000), which included all individuals analyzed in this study and reference subjects analyzed by Spinks and Shaffer (2005). This network was used to depict divergence of family lineages and infer phylogeographic relationships between haplotype sequences analyzed in this study and those of known A. marmorata and A. pallida individuals. These known individuals (Spinks & Shaffer, 2005) were identified by state, site, county, locality, latitude and longitude, and species. I used this information to determine the most likely population of origin for each member of A. marmorata and A. pallida included in 15 15 this analysis. Once all northern and southern males and females were identified by species and geographic origin, this information was used to inform wildlife managers at the programs we are collaborating with for future development of captive breeding protocols and reintroduction plans that are site and species-specific. Methods from this study will continue to be used for the identification of as many individuals as possible through mtDNA isolation and statistical parsimony-based analysis.

RESULTS

Sample Collection Initial work on this project in August, 2017, began with two collaborating zoos and animal holding facilities, with a proposed minimum sample size of approximately 80 turtles. As of June, 2019, the Western Pond Turtle SSP Sustainability Project has 24 zoos, aquariums, and museums working towards the goal of optimizing husbandry practices so that captive populations of Actinemys pallida and Actinemys marmorata may be established and properly managed for future conservation work and possible reintroduction. By June, 2019, I generated and analyzed species and geographic origin data from a total of 133 A. marmorata and A. pallida individuals held by collaborating animal holding facilities. All collaborating zoos, museums, and aquaria were informed of results for the development of species and population-specific captive breeding protocols.

Mitochondrial DNA Data and Clade Membership I generated mtDNA data using a 740-bp segment of the ND4 gene from a total of 203 individuals including 70 individuals with sequences published on GenBank (Spinks & Shaffer, 2005) and 133 individuals with sequences generated in this study. These data were used to create a haplotype network (Figure 1) that depicts clade membership and relatedness of individuals from this study to those of known species and geographic origin identified by Spinks and Shaffer (2005). I analyzed genetic similarity between previously studied pond turtles and individuals of unknown origin to infer the species and geographic origin of all program animals. Of a total of 133 individuals in the Western Pond Turtle SSP Sustainability Project, I identified 71 as A. marmorata and 62 as A. pallida. Genetic analyses showed that geographic origins of program animals (pond turtles of unknown origin analyzed in this study) as well as inferred population numbers are consistent with the distributions 17 17 and approximate numbers observed in the wild. I observed genetic similarity between program animals and reference individuals [wild pond turtles of known species and geographic origin identified by Spinks and Shaffer (2005)] of A. marmorata in only one locality in Washington, three in Oregon, and relatively many in central and northern California. Specific locations of A. marmorata individuals recorded in certain areas of Washington were not provided by researchers (Spinks & Shaffer, 2005) due to low population numbers and subsequent increased vulnerability to poaching and other forms of human disturbance. Permission was requested from researchers Spinks and Shaffer for localities of these particularly fragile populations to be provided to wildlife managers at the facilities holding these pond turtles. Results showed genetic similarity between program animals and reference A. pallida individuals primarily from the southwestern region of California and the San Joaquin Valley. I observed no relation between program animals and reference A. pallida individuals from Baja California. Geographic origin and frequency data observed in this study are representative of wild populations of A. marmorata and A. pallida as most severe population declines have been observed in Washington, Northern Oregon (Hays et al., 1999), Southern California, and Baja California (Bury et al., 2012; Hallock et al., 2017). Species and geographic origin of each A. marmorata and A. pallida individual from animal holding facilities participating in the Western Pond Turtle SSP Sustainability Project is given in Appendix A. Results displayed in Appendix A were determined using statistical parsimony and genetic similarity determined using the haplotype network (Figure 1) that we generated using statistical parsimony in TCS v1.21 (Clement et al., 2000). The haplotype network that I generated in this study (Figure 1) displays the genetic distinction between major groups of A. pallida and A. marmorata. This figure is characterized by four major genetically distinct groups of haplotypes, with all members of A. marmorata contained in one group centralized around the ancestral haplotype, and 18 18

Figure 1. Haplotype network generated from 133 captive members of Actinemys marmorata and Actinemys pallida from this study as well as 70 from a database of known individuals from specific populations and geographic locations (Spinks & Shaffer, 2005). Figure 1 depicts ND4 haplotypic alleles as circles, where the diameter of the circle is proportional to the number of individuals that share that specific allele. Alleles derived from individuals of A. marmorata are depicted in white and those from A. pallida individuals are shown in gray. Small black circles between allelic groups represent intermediate unsampled haplotypes and lines represent parsimony-inferred relationships such that each line connecting a haplotype is a single nucleotide mutation. Haplotypes, their frequencies among program animals and reference individuals, and accession numbers of individuals that share each haplotype are given in Appendix B. 19 19 members of A. pallida divided between the four groups with a separation of at least six point mutations between the most genetically similar alleles from each group. All captive-born pond turtles in this study share the same haplotype and are separated from the ancestral haplotype by a single mutation. These 15 captive-born individuals are not displayed in figures, tables, or appendices in order to give a more accurate representation of genetic distinction between wild-born brood stock individuals in this project.

The network given in Figure 1 revealed a total of 43 haplotypes in 203 individuals belonging to both A. marmorata and A. pallida. This total of 203 pond turtles includes reference subjects studied by Spinks and Shaffer (2005) and individuals analyzed in this study. My results showed 28 haplotypes in a total of 90 A. pallida individuals including 62 program animals and 28 reference subjects (Spinks & Shaffer, 2005). Five of these haplotypes are shared between program and reference individuals, 16 only contain reference individuals, and seven are shared exclusively by program animals. I observed

15 haplotypes in 113 A. marmorata individuals, which includes 71 program animals and 42 reference individuals (Spinks & Shaffer, 2005). Three of these haplotypes are shared between reference and program animals, 11 are shared by only reference subjects, and one contains only program animals. I observed 18 A. pallida haplotypes (three from our study set) and 11 A. marmorata haplotypes (one from our study set) each unique to only one individual. All haplotypes shared by members of A. marmorata begin with AM, all A. pallida haplotypes begin with AP. All WPT accession numbers and corresponding sequences will be published on GenBank for public access. The most common haplotype among wild-born members of A. marmorata (AM001) is shared by 37 individuals, 8 of which are reference individuals (Spinks & Shaffer, 2005) and 29 are individuals analyzed in this study. Reference individuals with haplotype AM001 do not all share the same geographic origin. Animal holding facilities with pond turtles that share a haplotype with reference subjects from different geographic 20 20 origins were informed of the possibility of their turtles being fit for multiple populations. These pond turtles that cannot be assigned to a single population using mtDNA analyses will be assessed using nuDNA and RAD sequencing to confirm geographic origin and population structure before breeding or reintroduction. AM003 is shared by 40 members of A. marmorata, 15 of these however are captive-born and are not counted in this analysis so that wild brood stock may be accurately assessed. AM002 (22 individuals) is also common and is shared exclusively by reference subjects. The majority of the remaining A. marmorata haplotypes are shared by a single reference individual. The most common haplotype among members of A. pallida (AP019) is shared by 33 individuals, all of which are individuals analyzed in this study. This group is separated by six mutational differences from the nearest reference haplotype. AP019 contains one individual (WPT 825) that is known to have been collected in Hanford, CA. Results displayed in Figure 1 infer that the individuals with haplotype AP019 and the three most closely related to it (AP020, AP021, and AP022) are most genetically similar to WPT 825, and therefore may have originated from a population in or near Hanford, CA. I observed one haplotype (AP004) that is common to 14 individuals, including two reference subjects and 12 program animals. The majority of the remaining A. pallida haplotypes are unique to only one individual. Phylogenetic network estimation using statistical parsimony in TCS v1.21 (Clement et al., 2000) revealed haplotype AM001 to be ancestral. All A. marmorata haplotypes are within five mutational differences from haplotype AM001. There are 10 mutational differences between haplotype AM001 and the central A. pallida haplotype, AP001, and three mutational differences between AM001 and the most genetically similar A. pallida haplotype, AP027. AP027 and four other A. pallida haplotypes (AP023, AP024, AP025, and AP026) are not grouped with others of the same species but appear to be more genetically similar to the ancestral haplotype, AM001. The five 21 21 reference individuals (AY905110, AY905196, AY905197, AY905195, and AY905210) that share haplotypes AP023, AP024, and AP027 were recorded by Spinks and Shaffer (2005) in San Luis Obispo County. The remaining two haplotypes (AP025 and AP026) are shared by three individuals (WPT868, WPT871, and WPT875) that have no known geographic origin. Mitochondrial DNA analyses show genetic similarity between these three program animals (WPT868, WPT871, and WPT875) and the five closely related reference subjects of known origin (AY905110, AY905196, AY905197, AY905195, and AY905210) such that these eight individuals are most likely members of the same species and may all belong to populations in or near San Luis Obispo County. Individuals that share haplotypes AP023-AP027 will be further analyzed using nuDNA and RAD sequencing due to their apparent similarity to haplotypes of A. marmorata rather than A. pallida haplotypes. A separate subgroup of three A. pallida haplotypes is located between the two main species groups, with ten mutational differences from the nearest A. marmorata haplotype and eight mutational differences from the nearest subgroup of A. pallida haplotypes. These three haplotypes (AP001, AP002, and AP003) are shared by four reference individuals (AY905137, AY905144, AY905145, and AY905146) and one individual from this study (WPT826). AY905144, AY905145, and AY905146 were recorded in drainage basins within Santa Barbara County, and AY905137 near a water source in Ventura County. WPT826 shares a haplotype with AY905146 and AY905137, and therefore may have originated from a population within or similar to those of Santa Barbara or Ventura counties. The majority of collaborating animal holding facilities with only one species of pond turtle in captivity are located within the native range of that species (Appendices C and D). Appendix D displays a pattern of more A. pallida individuals in captivity in southern California, the majority of A. marmorata individuals in captivity in northern 22 22

California, Oregon, and Washington, and most of the facilities holding both species disbursed near the species border. Nine participating animal holding facilities had both A. marmorata and A. pallida individuals in captivity at the time of this study. Four of these facilities are within the native range of A. marmorata, two are in the native range of A. pallida, three are within the area that is suspected to be native to A. marmorata but requires further study (Nafis, 2016a), and one is not in the historical range of either species of pond turtle. Seven facilities have only members of A. pallida and no A. marmorata individuals in captivity. One of these facilities is located on the central coast of California in the geographic range suspected to be native to A. marmorata (Nafis, 2016a), one is located on the southern border of the established native range of A. marmorata, and five are within the native range of A. pallida. Eight facilities are holding exclusively A. marmorata individuals and no A. pallida individuals. Five of these facilities are located within the range of A. marmorata, one is in the range of A. pallida, and two are located in the suspected native range of A. marmorata. Although many program animals are being held within their native range, I observed minimal patterns showing a correlation between animal holding facility and specific inferred geographic origin of each pond turtle. These results are significant as they demonstrate the complexity of dynamics in wild populations and captive individuals and indicate the crucial role of genetic analyses in ex situ conservation.

DISCUSSION

The results of my study agree with previous work that recorded four well- differentiated mitochondrial clades within the genus Actinemys (Spinks & Shaffer, 2005; Spinks et al., 2010). These clades are supported by current phylogenetic studies based upon mtDNA, but are now known to represent intraspecific phylogeographic variation rather than the presence of four distinct species within Actinemys (Spinks et al., 2014).

The Southern and Santa Barbara clades are within the species range of A. pallida and extend from Santa Barbara County into Baja California. The Northern clade extends from Central California into Oregon, Washington, Nevada, and historically British Columbia, and is intermingled with the San Joaquin Valley clade along the Sierra Nevada Mountains and central Coast Ranges of California. Although the Northern clade is mostly congruent with the distribution of what is now known as A. marmorata (Spinks et al.,

2014), its southwestern border extends beyond the species range near the San Francisco Bay area, and into San Luis Obispo County (Spinks & Shaffer, 2005). Analyses based upon mtDNA identify pond turtles from this coastal region as genetically similar to members of the Northern and San Joaquin Valley clades, but as A. pallida individuals (Spinks & Shaffer, 2005; Spinks et al., 2014). Results of my study shown in Figure 1 display a group of five haplotypes (AP023-AP027) that are shared by members of A. pallida but have fewer mutational differences from the northern ancestral haplotype

(AM001) than they do from other haplotypes of the same species. This is similar to results found by Spinks and Shaffer (2005) as this group of five haplotypes is shared by members of A. pallida originating from populations in San Luis Obispo County, and is therefore similar to members of the Northern and San Joaquin Valley clades. This slight discrepancy regarding mitochondrial clade membership and species delimitation among members of Actinemys is recorded in more recent studies that used 24 24 nuDNA, SNP data, and mtDNA analyses for individual identification and phylogenetic research (Spinks et al., 2010, 2014). nuDNA analyses from Spinks et al. (2014) revealed that pond turtle populations in this coastal region extending south from the San Francisco Bay area to San Luis Obispo County are composed of A. pallida individuals intermingled with admixed individuals. Previous studies found evidence for two historical phylogeographic events that have influenced the distribution and genetic composition of populations of Actinemys range wide (Seeliger, 1945; Spinks & Shaffer, 2005; Spinks et al., 2010). The first of these two events was an ancient, deep ancestral genetic divergence between populations, resulting in a separation that is consistent with the geographic border between A. marmorata and A. pallida; this divergence was followed by a more recent occurrence of further population subdivision in southern California and Baja California (Spinks et al., 2014). Spinks et al. (2010) hypothesized that pond turtle populations in the Central Coast Ranges of California were initially composed of only members of A. pallida until extensive population subdivision introduced genetic material from A. marmorata individuals after the recession of an ancient inland seaway (Spinks et al., 2010, 2014). This hypothesis is supported by a recent study combining analyses of nuclear SNP, mtDNA, and nuDNA data that also indicates mitochondrial and limited nuclear introgression from the San Joaquin Valley area and north of the San Francisco Bay area into the Central Coast Ranges of California (Spinks et al., 2014). This extensive ancestral subdivision in pond turtle populations in central California and Baja California is indicated in several additional studies that observed a relatively high genetic variability of many A. pallida populations compared to A. marmorata populations (Gray, 1995). Previous studies recorded a lack of genetic variability in populations of what was known as the northern subspecies of the Western Pond Turtle, Emys marmorata marmorata (Gray, 1995; Janzen et al., 1997; Spinks & Shaffer, 2005), even though members of this group were found to be distributed over a larger geographic range than 25 25 members of the southern subspecies, Emys marmorata pallida (Seeliger, 1945). This lack of genetic diversity in northern populations has been observed in multiple other species that inhabit a similar geographic region as A. marmorata (Matocq, 2002; Rodríquez- Robles, Denardo, & Staub, 1999). Researchers suspect this may be due to a northward expansion from more diverse populations in the central and southern parts of these species’ native ranges (Spinks & Shaffer, 2005), potentially following the most recent glacial period (Guyton, 1998). Spinks and Shaffer (2005) used both nuDNA and mtDNA as a means of assessing the phylogeography and genetic variation of populations of Actinemys across their entire native range. Their work revealed the existence of 81 unique haplotypes using mtDNA analyses, with two haplotypes that were prevalent among individuals sampled from central California through Northwestern Washington. Although the nuDNA sequences displayed very low variation in general in this analysis by Spinks and Shaffer (2005), it also reflected the same genetic homogeneity in members of A. marmorata as the mtDNA sequences. My results may also indicate a lack of genetic variation among the A. marmorata individuals in my study set. I analyzed a smaller number of A. pallida individuals than A. marmorata individuals, yet observed a larger number of A. pallida haplotypes than A. marmorata haplotypes with and without regards to reference subjects. Among the haplotypes I observed in members of A. marmorata, three of 15 are shared by over 20 individuals, with the most prevalent haplotype (AM001) being shared by 37 individuals. Of these 37 individuals, the eight reference individuals do not all share a common geographic origin. Furthermore, some of these reference individuals in AM001 were recorded from counties in opposite ends of the expected range of A. marmorata. I observed this in members of A. pallida as well, but with reference subjects from three different geographic origins in the same or neighboring counties. This may indicate homogeneity among A. marmorata individuals and populations, as many members of this 26 26 species that share a common haplotype originate from opposite ends of the species range. Pond turtles that share a haplotype with reference individuals from multiple geographic origins will be further analyzed using nuDNA and RAD Sequencing to indicate population structure and optimal reintroduction location for potential subsequent generations. Results of this study indicate little correlation between location of animal holding facility and most likely geographic origin of A. marmorata and A. pallida individuals held in each facility. Research has shown that ex situ conservation may be most effective when done within the native range of the target species in order to replicate natural environmental conditions (Conde et al., 2011). My data will be used by conservation managers at the San Diego Zoo to facilitate the movement of pond turtles so that each animal holding facility will have members of a single species in captivity. Program animals will be relocated to animal holding facilities within their native range, in an area as close as possible to their most likely geographic origin. These efforts will be done in order to build viable captive populations of A. marmorata and A. pallida fit for future reintroduction (Bushell et al., 2017).

CONCLUSION

Genetic analyses are a crucial component of captive husbandry studies such as the Western Pond Turtle SSP Sustainability Project because of the risk of incorrect species and population identification. Many pond turtles in captivity are introduced to holding facilities from an unknown source and may be indistinguishable due to morphological similarities between members of the two different species, Actinemys marmorata and

Actinemys pallida. I used mtDNA analyses to identify program animals as members of A. marmorata or A. pallida and recommended a suitable reintroduction location for subsequent generations based upon relatedness of wild-born brood stock of unknown origin to pond turtles of known species and geographic origin (Spinks & Shaffer, 2005). Individuals with multiple potential geographic origins according to mtDNA analyses will be further tested utilizing nuDNA and RAD sequencing so that captive breeding protocols may be developed according to species and inferred population of origin. Nuclear DNA data will also be generated from pond turtles that are closely related to reference individuals from the Central Coast Ranges of California to clarify species and population structure. Results of this study are significant as I observed that most captive pond turtles are not being held in close proximity to their inferred population of origin. The majority of animal holding facilities participating in the Western Pond Turtle SSP Sustainability Project were unaware of which species of pond turtle they had. Nine of 24 animal holding facilities had both A. marmorata and A. pallida in captivity. Now that program animals have been identified, members of each species will be separated to avoid the potential effects of cross-breeding and will be relocated to a facility that is within their native range. Our goal is to expand this project throughout the entire native ranges of both species, to include all captive rearing facilities in California, Oregon, and Washington.

REFERENCES

REFERENCES

Araki, H., Cooper, B., & Blouin, M. S. (2007). Genetic effects of captive breeding cause a rapid, cumulative fitness decline in the wild. Science, 318(5847), 100-103.

Arevalo, E., Davis, S. K., & Sites Jr, J. W. (1994). Mitochondrial DNA sequence divergence and phylogenetic relationships among eight chromosome races of the Sceloporus grammicuscomplex (Phrynosomatidae) in Central Mexico. Systematic Biology, 43(3), 387-418.

Arif, I. A., Khan, H. A., Bahkali, A. H., Al Homaidan, A. A., Al Farhan, A. H., Al Sadoon, M., & Shobrak, M. (2011). DNA marker technology for wildlife conservation. Saudi Journal of Biological Sciences, 18(3), 219-225.

Avise, J. C., Arnold, J., Ball, R. M., Bermingham, E., Lamb, T., Neigel, J. E., ... & Saunders, N. C. (1987). Intraspecific phylogeography: The mitochondrial DNA bridge between population genetics and systematics. Annual Review of Ecology and Systematics, 18(1), 489-522.

Avise, J. C. (1998). The history and purview of phylogeography: A personal reflection. Molecular Ecology, 7(4), 371-379.

Avise, J. C. (2000).Phylogeography: The history and formation of species. Cambridge, MA. Harvard University Press.

B.C. Conservation Data Centre. (2016). BC Species and Ecosystems Explorer. B.C. Ministry ofEnvironment, Victoria, British Columbia. Retrieved from http://a100.gov.bc.ca/pub/eswp/ Accessed June 10, 2019.

Baird, S. F., & Girard, C. (1852). Description of new species of reptiles, collected by the US Exploring Expedition under the Command of Capt. Charles Wilkes, USN Part 1. Proceedings of the Academy of Natural Sciences of Philadelphia.

Balmford, A., Leader-Williams, N., & Green, M. J. B. (1995). Parks or arks: Where to conserve threatened mammals? Biodiversity & Conservation, 4(6), 595-607.

Bowkett, A. E. (2009). Recent captive‐breeding proposals and the return of the ark concept to global species conservation. Conservation Biology, 23(3), 773-776.

Buhlmann, K. A., Akre, T. S., Iverson, J. B., Karapatakis, D., Mittermeier, R. A., Georges, A., ... & Gibbons, J. W. (2009). A global analysis of tortoise and freshwater turtle distributions with identification of priority conservation areas.Chelonian Conservation and Biology, 8(2), 116-149. 30 30 Bury, R. B., Ashton, D. T., Welsh Jr, H. H., Reese, D. A., & Germano, D. J. (2012). Synopsis of biology. Western Pond Turtle−biology, sampling techniques, inventory and monitoring, conservation and management: northwest fauna. Olympia, WA: The Society for Northwestern VertebrateBiology, 9-19.

Bushell, J., Moore, J., Pramuk, J., Koontz, F., & Shepherdson, D. (2017). SAFE Western Pond Turtle conservation project. Retrieved fromhttps://www.aza.org/SAFE- western-pond-turtle-conservation-projects

Canessa, S., Converse, S. J., West, M., Clemann, N., Gillespie, G., McFadden, M., ... & McCarthy, M. A. (2016). Planning for ex situ conservation in the face of uncertainty.Conservation Biology, 30(3), 599-609.

Cary, W. (1889). Biennial report of the Fish Commissioner of the State of Nevada 1887- 1888. Carson City, NV, 3-7.

Clement, M., Posada, D. C. K. A., & Crandall, K. A. (2000). TCS: A computer program to estimate gene genealogies. Molecular Ecology, 9(10), 1657-1659.

Conde, D. A., Flesness, N., Colchero, F., Jones, O. R., & Scheuerlein, A. (2011). An emerging role of zoos to conserve biodiversity. Science, 331(6023), 1390-1391.

Convention on Biological Diversity, Article 9, United Nations—Treaty Series, pp. 149 and 150 (1993).

Curran, L. M., Trigg, S. N., McDonald, A. K., Astiani, D., Hardiono, Y. M., Siregar, P., ... & Kasischke, E. (2004). Lowland forest loss in protected areas of Indonesian Borneo. Science, 303(5660), 1000-1003.

Dimmick, W. W., Ghedotti, M. J., Grose, M. J., Maglia, A. M., Meinhardt, D. J., & Pennock, D. S. (1999). The importance of systematic biology in defining units of conservation. Conservation Biology, 13(3), 653-660.

Engstrom, T. N., Shaffer, H. B., & McCord, W. P. (2002). Phylogenetic diversity of endangered and critically endangered Southeast Asian Softshell Turtles (Trionychidae: Chitra). Biological Conservation, 104(2), 173-179.

Environment Canada (2015). Recovery strategy for the Pacific Pond Turtle (Actinemysmarmorata) in Canada [Proposed]. Species at Risk Act Recovery Strategy Series. Environment Canada, Ottawa. v + Appendix.

Fleming, I. A., & Gross, M. R. (1993). Breeding success of hatchery and wild Coho salmon (Oncorhynchus kisutch) in competition. Ecological Applications, 3(2), 230- 245.

Fraser, D. J. (2008). How well can captive breeding programs conserve biodiversity? A review of salmonids. Evolutionary Applications, 1(4), 535-586. 31 31 Fritz, U., Schmidt, C., & Ernst, C. H. (2011). Competing generic concepts for Blanding’s, Pacific and European Pond Turtles (Emydoidea, Actinemys, and Emys)—Which is best? Zootaxa, 2791(1), 41-53.

Gibbons J.W., &Stangel P.W. (1999). Conserving amphibians and reptiles in the new millennium. Proceedings of the Partners in Amphibian and Reptile Conservation (PARC) Conference; 2–4 June 1999; Atlanta (GA). Aiken (SC): Savannah River Ecology Laboratory. Herp Outreach Publication #2.

Gibbons, J. W., Scott, D. E., Ryan, T. J., Buhlmann, K. A., Tuberville, T. D., Metts, B. S., ... & Winne, C. T. (2000). The global decline of reptiles, déjà vu amphibians: Reptile species are declining on a global scale. Six significant threats to reptile populations are habitat loss and degradation, introduced invasive species, environmental pollution, disease, unsustainable use, and global climate change. BioScience, 50(8), 653-666.

Giese, C. L. A., Greenwald, D. N., & Curry, T. (2012). Petition tolist 53 amphibians and reptiles in the United States as threatened or endangered species under the Endangered Species Act. Petition to the Secretary of the Interior of the United States. Tucson, AZ: Center for Biological Diversity.

Gray, E. M. (1995). DNA fingerprinting reveals a lack of genetic variation in northern populations of the Western Pond Turtle (Clemmys marmorata). Conservation Biology, 9(5), 1244-1255.

Gupta, A., Bhardwaj, A., Sharma, P., & Pal, Y. (2015). Mitochondrial DNA-a tool for phylogenetic and biodiversity search in equines. Journal of Biodiversity & Endangered Species, 01. doi:10.4172/2332-2543.S1-006.

Guyton, B. (1998).Glaciers of California: Modern glaciers, Ice Age glaciers, the origin of Yosemite Valley, and a glacier tour in the Sierra Nevada (Vol. 59). Los Angeles, CA: University of California Press.

Hallock, L. A., McMillan, A., & Wiles, G. J. (2017). Periodic status review for the Western Pond Turtle in Washington. Olympia, WA. Washington Department of Fish and Wildlife, Wildlife Program.

Hays, D. W., McAllister, K. R., Richardson, S. A., & Stinson, D. W. (1999). Washington State recovery plan for the Western Pond Turtle. Olympia, WA: Washington Department of Fish and Wildlife.

Hutchins, M., Smith, B., & Allard, R. (2003). In defense of zoos and aquariums: The ethical basis for keeping wild animals in captivity. Journal of the American Veterinary Medical Association, 223(7), 958-966. 32 32 Janzen, F. J., Hoover, S. L., & Bradley Shaffer, H. (1997). Molecular phylogeography of the Western Pond Turtle (Clemmys marmorata): Preliminary results. Chelonian Conservation and Biology, 2, 623-626.

Jennings, M. R., & Hayes, M. P. (1994). Amphibian and reptile species of special concern in California. Rancho Cordova, CA: California Department of Fish and Game, Inland Fisheries Division.

Jennings, M.R. (2004). An annotated check list of the amphibians and reptiles of California and adjacent waters. California Fish and Game, 90(4), 161-213.

Justus, J., Colyvan, M., Regan, H., & Maguire, L. (2009). Buying into conservation: intrinsic versus instrumental value. Trends in Ecology & Evolution, 24(4), 187-191.

Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., ... & Thierer, T. (2012). Geneious basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics, 28(12), 1647-1649.

Keller, L. F., & Waller, D. M. (2002). Inbreeding effects in wild populations. Trends in Ecology & Evolution, 17(5), 230-241.

Lawler, J. J. (2009). Climate change adaptation strategies for resource management and conservation planning. Annals of the New York Academy of Sciences, 1162(1), 79- 98.

Leidy, R. A., Bogan, M. T., Neuhaus, L., Rosetti, L., & Carlson, S. M. (2016). Summer die-off of Western Pond Turtle (Actinemys marmorata) along an intermittent coast range stream in central California. The Southwestern Naturalist, 61(1), 71-74.

Lovich, J., & Meyer, K. (2002). The Western Pond Turtle (Clemmys marmorata) in the Mojave River, California, USA: Highly adapted survivor or tenuous relict? Journal of Zoology, 256(4), 537-545.

Martin, T. E., Lurbiecki, H., Joy, J. B., & Mooers, A. O. (2014). Mammal and bird species held in zoos are less endemic and less threatened than their close relatives not held in zoos. Animal Conservation, 17(2), 89-96.

Mason, J. W., Brynildson, O. M., & Degurse, P. E. (1967). Comparative survival of wild and domestic strains of brook trout in streams. Transactions of the American Fisheries Society, 96(3), 313-319.

Matocq, M. D. (2002). Phylogeographical structure and regional history of the Dusky‐ Footed Woodrat, Neotoma fuscipes. Molecular Ecology, 11(2), 229-242. 33 33 Mayden, R. L., & Wood, R. M. (1995). Systematics, species concepts, and the evolutionarily significant unit in biodiversity and conservation biology. Evolution and the Aquatic Ecosystem: Defining Unique Units in Population Conservation. pp. 58-113, American Fisheries Society Symposium [AM. FISH. SOC. SYMP.], vol. 17.

McCormack, J. E., Maley, J. M., Hird, S. M., Derryberry, E. P., Graves, G. R., & Brumfield, R. T. (2012). Next-generation sequencing reveals phylogeographic structure and a species tree for recent bird divergences. Molecular Phylogenetics and Evolution, 62(1), 397-406.

Merz, C., Catchen, J. M., Hanson-Smith, V., Emerson, K. J., Bradshaw, W. E., & Holzapfel, C. M. (2013). Replicate phylogenies and post-glacial range expansion of the Pitcher-Plant Mosquito, Wyeomyia smithii, in North America. PloS one, 8(9), e72262.

Nafis, G. (2016a). Northwestern Pond Turtle - Actinemys marmorata. A guide to the amphibians and reptiles of California. Retrieved from http://www.californiaherps.com/turtles/pages/a.marmorata.html#status.

Nafis, G. (2016b). Southwestern Pond Turtle - Actinemys pallida. A guide to the amphibians and reptiles of California. Retrieved from http://www.californiaherps.com/turtles/pages/a.pallida.html#description.

NatureServe. (2012). NatureServe Explorer: An online encyclopedia of life [web application]. Version 7.1. NatureServe, Arlington, VA. Retrieved from http://www.natureserve.org/explorer/.

NatureServe. (2019). NatureServe Explorer: An online encyclopedia of life [web application]. Version 7.1. NatureServe, Arlington, VA. Retrieved from http://explorer.natureserve.org. Accessed: August 22, 2019.

Noss, R. F. (2007). Values are a good thing in conservation biology. Conservation Biology, 21(1), 18-20.

O'Brien, S. J., & Evermann, J. F. (1988). Interactive influence of infectious disease and genetic diversity in natural populations. Trends in Ecology & Evolution, 3(10), 254- 259.

ODFW (Oregon Department of Fish and Wildlife) (2008). Sensitive species list. Salem, OR: Oregon Department of Fish and Wildlife.

Parham, J. F., & Feldman, C. R. (2002). Generic revisions of emydine Turtles. Turtle and Tortoise Newsletter, 6, 28-30. 34 34 Pearson, R. G., Stanton, J. C., Shoemaker, K. T., Aiello-Lammens, M. E., Ersts, P. J., Horning, N., ... & Akçakaya, H. R. (2014). Life history and spatial traits predict extinction risk due to climate change. Nature Climate Change, 4(3), 217-221.

Pease, K. M., Freedman, A. H., Pollinger, J. P., McCormack, J. E., Buermann, W., Rodzen, J., ... & Jones, K. (2009). Landscape genetics of California Mule Deer (Odocoileus hemionus): The roles of ecological and historical factors in generating differentiation. Molecular Ecology, 18(9), 1848-1862.

Purcell, K. L., McGregor, E. L., & Calderala, K. (2017). Effects of drought on Western Pond Turtle survival and movement patterns. Journal of Fish and Wildlife Management, 8(1), 15-27.

Pramuk, J., Koontz, F., Tirhi, M., Zeigler, S., Schwartz, K., & Miller, P. (2016). The Western Pond Turtle in Washington: A population and habitat viability assessment. IUCN/SSC Conservation Breeding Specialist Group. Apple Valley, MN.

Quesnelle, P. E., Lindsay, K. E., & Fahrig, L. (2014). Low reproductive rate predicts species sensitivity to habitat loss: A meta-analysis of wetland vertebrates. PLoS One, 9(3), e90926.

Reese, D. A., & Welsh, H. H. (1997). Use of terrestrial habitat by Western Pond Turtles (Clemmys marmorata): Implications for management. In Proceedings: conservation, restoration, and management of turtles and tortoises. An international conference (pp. 352-357). New York Turtle and Tortoise Society.

Rodríguez‐Robles, J. A., Denardo, D. F., & Staub, R. E. (1999). Phylogeography of the California Mountain Kingsnake, Lampropeltis zonata (Colubridae). Molecular Ecology, 8(11), 1923-1934.

Rollinson, N., Keith, D. M., Houde, A. L. S., Debes, P. V., Mcbride, M. C., & Hutchings, J. A. (2014). Risk assessment of inbreeding and outbreeding depression in a captive‐breeding program. Conservation Biology, 28(2), 529-540.

Ruso, G. E., Meyer, E., & Das, A. J. (2017). Seasonal and diel environmental conditions predict Western Pond Turtle (Emys marmorata) behavior at a perennial and an ephemeral stream in Sequoia National Park, California. Chelonian Conservation and Biology, 16(1), 20-28.

Seeliger, L. M. (1945). Variation in the Pacific Mud Turtle. Copeia, 1945(3), 150-159.

Schwartz, K. R., Parsons, E. C. M., Rockwood, L., & Wood, T. C. (2017). Integrating in- situ and ex-situ data management processes for biodiversity conservation. Frontiers in Ecology and Evolution, 5 (120). doi:10.3389/fevo.2017.00120. 35 35 Snyder, N. F., Derrickson, S. R., Beissinger, S. R., Wiley, J. W., Smith, T. B., Toone, W. D., & Miller, B. (1996). Limitations of captive breeding in endangered species recovery. Conservation Biology, 10(2), 338-348.

Spinks, P. Q., Pauly, G. B., Crayon, J. J., & Shaffer, H. B. (2003). Survival of the Western Pond Turtle (Emys marmorata) In an urban California environment. Biological Conservation, 113(2), 257-267.

Spinks, P. Q., & Shaffer, H. B. (2005). Range‐wide molecular analysis of the Western Pond Turtle (Emys marmorata): Cryptic variation, isolation by distance, and their conservation implications. Molecular Ecology, 14(7), 2047-2064.

Spinks, P. Q., Thomson, R. C., & Bradley Shaffer, H. (2010). Nuclear gene phylogeography reveals the historical legacy of an ancient inland sea on lineages of the Western Pond Turtle, Emys Marmorata in California. Molecular Ecology, 19(3), 542-556.

Spinks, P. Q., Thomson, R. C., & Shaffer, H. B. (2014). The advantages of going large: Genome‐wide SNP S clarify the complex population history and systematics of the threatened Western Pond Turtle. Molecular Ecology, 23(9), 2228-2241.

Stebbins, R. C. (2003). A field guide to western reptiles and amphibians. Boston, MA: Houghton Mifflin.

Stebbins, R.C., & McGinnis, S.M. (2012).Field guide to amphibians and reptiles of California: Revised Edition (California Natural History Guides). University of California Press, Berkeley and Los Angeles, CA.

Thermo Fisher Scientific (n.d.). Invitrogen 2.0, Life Technologies PureLink Genomic DNA Kits. Carlsbad, CA: Life Technologies.

Tingley, M. W., Estes, L. D., & Wilcove, D. S. (2013). Ecosystems: Climate change must not blow conservation off course. Nature, 500(7462), 271-272. doi:10.1038/500271a

Tortoise & Freshwater Turtle Specialist Group (1996). Actinemys marmorata (errata version published in 2016).The IUCN Red List of Threatened Species1996: e.T4969A97292542.Retrieved from http://dx.doi.org/10.2305/ IUCN.UK.1996.RLTS.T4969A11104202.en.Downloaded on 08 July 2019.

Touch, G. (2002). IUCN technical guidelines on the management of ex-situ populations for conservation. Approved at the 14th meeting of the Programme Committee of Council, Gland, Switzerland, 10 December 2002.

Urban, M. C. (2015). Accelerating extinction risk from climate change. Science, 348(6234), 571-573. 36 36 USFWS (U.S. Fish and Wildlife Service). (2015). Endangered and threatened wildlife and plants; 90-day findings on 10 petitions. Federal Register80 (April 10):19259– 19263.

Vié, J. C., Hilton-Taylor, C., Pollock, C., Ragle, J., Smart, J., Stuart, S. N., & Tong, R. (2009). The IUCN Red List: a key conservation tool. Wildlife in a changing world– An analysis of the 2008 IUCN Red List of Threatened Species, 1.

Walstrom, V. W., Klicka, J., & Spellman, G. M. (2012). Speciation in the White‐Breasted Nuthatch (Sitta carolinensis): A multilocus perspective. Molecular Ecology, 21(4), 907-920.

Witzenberger, K. A., & Hochkirch, A. (2011). Ex situ conservation genetics: A review of molecular studies on the genetic consequences of captive breeding programmes for endangered animal species. Biodiversity and Conservation, 20(9), 1843-1861.

WDFW (Washington Department of Fish and Wildlife)(1993). Status of the Western Pond Turtle (Clemmys marmorata) in Washington. Olympia: Washington Department of Fish and Wildlife.

APPENDICES

APPENDIX A: INFERRED SPECIES AND GEOGRAPHIC ORIGIN FOR INDIVIDUALS HELD IN ANIMAL HOLDING FACILITIES PARTICIPATING IN THE WESTERN POND TURTLE SSP SUSTAINABILITY PROJECT

Inferred species and geographic origin for individuals held in animal holding facilities participating in the Western Pond Turtle SSP Sustainability Project. Identification numbers beginning with WPT were assigned to pond turtles by C.S.U. Fresno, corresponding specimen identification numbers were assigned by collaborating animal holding facilities. Species, geographic origin, and county of origin were inferred through analyses comparing genetic similarity between pond turtles of unknown origin and previously studied pond turtles of known species and geographic origin (Spinks & Shaffer 2005). Mitochondrial DNA analyses showed multiple possible geographic origins for Actinemys marmorata individuals with haplotypes AM001 or AM007, and Actinemys pallida individuals with haplotypes AP001, AP004, AP026, or AP027 (Appendix B). Possible geographic origins and counties of origin are numbered one through eight. Refer to superscripts and corresponding footnotes for information on specific individuals. C.S.U. Fresno ID Specimen ID Animal Holding Facility Species Geographic Origin County of Origin

WPT 805 932041 Micke Grove Zoo A. pallida Hanford Kings, CA WPT 806 972082 Micke Grove Zoo A. marmorata 40.3956°N, 122.5260°W, Cottonwood Creek Shasta, CA WPT 807 308528 Micke Grove Zoo A. marmorata 40.3956°N, 122.5260°W, Cottonwood Creek Shasta, CA WPT 8081 992108 Micke Grove Zoo A. marmorata 1-3) 2; 4) 42.1378°N, 121.3041°W, Lost River; 1-3) Klickitat, WA; 4) Klamath,

5) 40.5539°N, 123.2181°W, Middle Hayford Creek; OR; 5) Trinity, CA; 6) Humboldt, 6) 40.4909°N, 123.6048°W, Van Duzon River; CA; 7, 8) Trinity, CA 7, 8) 40.4503°N, 123.5049°W, Mad River WPT 809 308529 Micke Grove Zoo A. marmorata 40.3956°N, 122.5260°W, Cottonwood Creek Shasta, CA WPT 810 311613 Micke Grove Zoo A. marmorata 40.3956°N, 122.5260°W, Cottonwood Creek Shasta, CA WPT 811 H12501 Micke Grove Zoo A. pallida Hanford Kings, CA WPT 8121 NH0102 Micke Grove Zoo A. marmorata 1-3) 2; 4) 42.1378°N, 121.3041°W, Lost River; 1-3) Klickitat, WA; 4) Klamath,

5) 40.5539°N, 123.2181°W, Middle Hayford Creek; OR; 5) Trinity, CA; 6) Humboldt, 6) 40.4909°N, 123.6048°W, Van Duzon River; CA; 7, 8) Trinity, CA 7, 8) 40.4503°N, 123.5049°W, Mad River WPT 813 NH0103 Micke Grove Zoo A. pallida Hanford Kings, CA WPT 814 NH0104 Micke Grove Zoo A. pallida Hanford Kings, CA WPT 815 H14032 Micke Grove Zoo A. pallida Hanford Kings, CA WPT 816 H14034 Micke Grove Zoo A. pallida Hanford Kings, CA WPT 817 H14031 Micke Grove Zoo A. marmorata 40.3956°N, 122.5260°W, Cottonwood Creek Shasta, CA WPT 818 H14312 Micke Grove Zoo A. pallida Hanford Kings, CA WPT 819 H14310 Micke Grove Zoo A. marmorata 40.3956°N, 122.5260°W, Cottonwood Creek Shasta, CA

39

C.S.U. Fresno ID Specimen ID Animal Holding Facility Species Geographic Origin County of Origin WPT 820 H14039 Micke Grove Zoo A. marmorata 40.3956°N, 122.5260°W, Cottonwood Creek Shasta, CA WPT 821 H14038 Micke Grove Zoo A. marmorata 40.3956°N, 122.5260°W, Cottonwood Creek Shasta, CA WPT 822 H14037 Micke Grove Zoo A. marmorata 40.3956°N, 122.5260°W, Cottonwood Creek Shasta, CA WPT 823 H14036 Micke Grove Zoo A. pallida Hanford Kings, CA WPT 824 H14035 Micke Grove Zoo A. marmorata 40.3956°N, 122.5260°W, Cottonwood Creek Shasta, CA WPT 825 280242 Fresno Chaffee Zoo A. pallida Hanford Kings, CA WPT 8261 207086 Fresno Chaffee Zoo A. pallida 1) 34.4089°N, 119.0825°W, Santa Paula Creek; 1) Ventura, CA; 2) Santa Barbara,

2) 34.5036°N, 120.4045°W, Jalama Creek CA

WPT 830 293 The Living Desert Zoo and A. pallida Hanford Kings, CA

Gardens WPT 8351 Westie Palo Alto Junior Museum and A. marmorata 1-3) 2; 4) 42.1378°N, 121.3041°W, Lost River; 1-3) Klickitat, WA; 4) Klamath,

Zoo 5) 40.5539°N, 123.2181°W, Middle Hayford Creek; OR; 5) Trinity, CA; 6) Humboldt, 6) 40.4909°N, 123.6048°W, Van Duzon River; CA; 7, 8) Trinity, CA 7, 8) 40.4503°N, 123.5049°W, Mad River WPT 8381 6 Curi Odyssey A. marmorata 1-3) 2; 4) 42.1378°N, 121.3041°W, Lost River; 1-3) Klickitat, WA; 4) Klamath,

5) 40.5539°N, 123.2181°W, Middle Hayford Creek; OR; 5) Trinity, CA; 6) Humboldt, 6) 40.4909°N, 123.6048°W, Van Duzon River; CA; 7, 8) Trinity, CA 7, 8) 40.4503°N, 123.5049°W, Mad River WPT 839 7 Curi Odyssey A. pallida Hanford Kings, CA WPT 8431 2057 Turtle Bay Exploration Park A. marmorata 1-3) 2; 4) 42.1378°N, 121.3041°W, Lost River; 1-3) Klickitat, WA; 4) Klamath,

5) 40.5539°N, 123.2181°W, Middle Hayford Creek; OR; 5) Trinity, CA; 6) Humboldt, 6) 40.4909°N, 123.6048°W, Van Duzon River; CA; 7, 8) Trinity, CA 7, 8) 40.4503°N, 123.5049°W, Mad River WPT 8441 2038 Turtle Bay Exploration Park A. marmorata 1-3) 2; 4) 42.1378°N, 121.3041°W, Lost River; 1-3) Klickitat, WA; 4) Klamath,

5) 40.5539°N, 123.2181°W, Middle Hayford Creek; OR; 5) Trinity, CA; 6) Humboldt, 6) 40.4909°N, 123.6048°W, Van Duzon River; CA; 7, 8) Trinity, CA

40

C.S.U. Fresno ID Specimen ID Animal Holding Facility Species Geographic Origin County of Origin

7, 8) 40.4503°N, 123.5049°W, Mad River WPT 8451 2059 Turtle Bay Exploration Park A. marmorata 1-3) 2; 4) 42.1378°N, 121.3041°W, Lost River; 1-3) Klickitat, WA; 4) Klamath,

5) 40.5539°N, 123.2181°W, Middle Hayford Creek; OR; 5) Trinity, CA; 6) Humboldt, 6) 40.4909°N, 123.6048°W, Van Duzon River; CA; 7, 8) Trinity, CA 7, 8) 40.4503°N, 123.5049°W, Mad River WPT 846 2042 Turtle Bay Exploration Park A. pallida Hanford Kings, CA WPT 847 2039 Turtle Bay Exploration Park A. pallida Hanford Kings, CA WPT 848 2037 Turtle Bay Exploration Park A. marmorata 40.3956°N, 122.5260°W, Cottonwood Creek Shasta, CA WPT 8531 503 Aquarium of the Bay A. marmorata 1-3) 2; 4) 42.1378°N, 121.3041°W, Lost River; 1-3) Klickitat, WA; 4) Klamath,

5) 40.5539°N, 123.2181°W, Middle Hayford Creek; OR; 5) Trinity, CA; 6) Humboldt, 6) 40.4909°N, 123.6048°W, Van Duzon River; CA; 7, 8) Trinity, CA

7, 8) 40.4503°N, 123.5049°W, Mad River WPT 8541 504 Aquarium of the Bay A. marmorata 1-3) 2; 4) 42.1378°N, 121.3041°W, Lost River; 1-3) Klickitat, WA; 4) Klamath,

5) 40.5539°N, 123.2181°W, Middle Hayford Creek; OR; 5) Trinity, CA; 6) Humboldt, 6) 40.4909°N, 123.6048°W, Van Duzon River; CA; 7, 8) Trinity, CA 7, 8) 40.4503°N, 123.5049°W, Mad River WPT 8551 506 Aquarium of the Bay A. marmorata 1-3) 2; 4) 42.1378°N, 121.3041°W, Lost River; 1-3) Klickitat, WA; 4) Klamath,

5) 40.5539°N, 123.2181°W, Middle Hayford Creek; OR; 5) Trinity, CA; 6) Humboldt, 6) 40.4909°N, 123.6048°W, Van Duzon River; CA; 7, 8) Trinity, CA 7, 8) 40.4503°N, 123.5049°W, Mad River WPT 8571 318004 San Francisco Zoo A. marmorata 1-3) 2; 4) 42.1378°N, 121.3041°W, Lost River; 1-3) Klickitat, WA; 4) Klamath,

5) 40.5539°N, 123.2181°W, Middle Hayford Creek; OR; 5) Trinity, CA; 6) Humboldt, 6) 40.4909°N, 123.6048°W, Van Duzon River; CA; 7, 8) Trinity, CA 7, 8) 40.4503°N, 123.5049°W, Mad River WPT 858 318003 San Francisco Zoo A. pallida Hanford Kings, CA WPT 8591 318005 San Francisco Zoo A. marmorata 1-3) 2; 4) 42.1378°N, 121.3041°W, Lost River; 1-3) Klickitat, WA; 4) Klamath,

41

C.S.U. Fresno ID Specimen ID Animal Holding Facility Species Geographic Origin County of Origin

5) 40.5539°N, 123.2181°W, Middle Hayford Creek; OR; 5) Trinity, CA; 6) Humboldt, 6) 40.4909°N, 123.6048°W, Van Duzon River; CA; 7, 8) Trinity, CA 7, 8) 40.4503°N, 123.5049°W, Mad River WPT 860 317016 San Francisco Zoo A. pallida Hanford Kings, CA WPT 861 318002 San Francisco Zoo A. pallida Hanford Kings County, CA WPT 862 318012 San Francisco Zoo A. marmorata 40.3956°N, 122.5260°W, Cottonwood Creek Shasta, CA WPT 863 318013 San Francisco Zoo A. marmorata 40.3956°N, 122.5260°W, Cottonwood Creek Shasta, CA WPT 864 389002 San Francisco Zoo A. marmorata 40.3956°N, 122.5260°W, Cottonwood Creek Shasta, CA WPT 865 317002 San Francisco Zoo A. pallida Hanford Kings, CA WPT 867 RM3131/"One" Randall Museum A. pallida Hanford Kings, CA WPT 8681 RM3101/"CCEM" Randall Museum A. pallida 1) 35.1780°N, 119.9802°W, Barrett Creek; San Luis Obispo , CA

2) 35.0754°N, 120.2740°W, Lower Alamo Creek; 3) 35.2237°N, 120.2091°W, Upper Alamo Creek WPT 8701 960009 Monterey Bay Aquarium A. marmorata 1-3) 2; 4) 42.1378°N, 121.3041°W, Lost River; 1-3) Klickitat, WA; 4) Klamath,

5) 40.5539°N, 123.2181°W, Middle Hayford Creek; OR; 5) Trinity, CA; 6) Humboldt, 6) 40.4909°N, 123.6048°W, Van Duzon River; CA; 7, 8) Trinity, CA 7, 8) 40.4503°N, 123.5049°W, Mad River WPT 8711 131569 Monterey Bay Aquarium A. pallida 1) 35.1780°N, 119.9802°W, Barrett Creek; San Luis Obispo , CA

2) 35.0754°N, 120.2740°W, Lower Alamo Creek ; 3) 35.2237°N, 120.2091°W; Upper Alamo Creek WPT 8721 160811 Monterey Bay Aquarium A. marmorata 1-3) 2; 4) 42.1378°N, 121.3041°W, Lost River; 1-3) Klickitat, WA; 4) Klamath,

5) 40.5539°N, 123.2181°W, Middle Hayford Creek; OR; 5) Trinity, CA; 6) Humboldt, 6) 40.4909°N, 123.6048°W, Van Duzon River; CA; 7, 8) Trinity, CA 7, 8) 40.4503°N, 123.5049°W, Mad River WPT 875 4027 Fresno Chaffee Zoo A. pallida 35.2009°N, 120.0946°W; Barrett Creek San Luis Obispo , CA WPT 876 23 Fresno Chaffee Zoo A. pallida Hanford Kings, CA WPT 877 24 Fresno Chaffee Zoo A. pallida Hanford Kings, CA

42

C.S.U. Fresno ID Specimen ID Animal Holding Facility Species Geographic Origin County of Origin WPT 8781 26 Fresno Chaffee Zoo A. marmorata 1-3) 2; 4) 42.1378°N, 121.3041°W, Lost River; 1-3) Klickitat, WA; 4) Klamath,

5) 40.5539°N, 123.2181°W, Middle Hayford Creek; OR; 5) Trinity, CA; 6) Humboldt, 6) 40.4909°N, 123.6048°W, Van Duzon River; CA; 7, 8) Trinity, CA 7, 8) 40.4503°N, 123.5049°W, Mad River WPT 8791 201573 Woodland Park Zoo A. marmorata 1-3) 2; 4) 42.1378°N, 121.3041°W, Lost River; 1-3) Klickitat, WA; 4) Klamath,

5) 40.5539°N, 123.2181°W, Middle Hayford Creek; OR; 5) Trinity, CA; 6) Humboldt, 6) 40.4909°N, 123.6048°W, Van Duzon River; CA; 7, 8) Trinity, CA 7, 8) 40.4503°N, 123.5049°W, Mad River WPT 8801 205948 Woodland Park Zoo A. marmorata 1-3) 2; 4) 42.1378°N, 121.3041°W, Lost River; 1-3) Klickitat, WA; 4) Klamath,

5) 40.5539°N, 123.2181°W, Middle Hayford Creek; OR; 5) Trinity, CA; 6) Humboldt, 6) 40.4909°N, 123.6048°W, Van Duzon River; CA; 7, 8) Trinity, CA 7, 8) 40.4503°N, 123.5049°W, Mad River WPT 881 300990 Sacramento Zoo A. marmorata 40.3956°N, 122.5260°W, Cottonwood Creek Shasta, CA WPT 882 30306 Sacramento Zoo A. marmorata 40.3956°N, 122.5260°W, Cottonwood Creek Shasta, CA WPT 883 301026 Sacramento Zoo A. marmorata 40.3956°N, 122.5260°W, Cottonwood Creek Shasta, CA WPT 8841 301662 Sacramento Zoo A. marmorata 1-3) 2; 4) 42.1378°N, 121.3041°W, Lost River; 1-3) Klickitat, WA; 4) Klamath,

5) 40.5539°N, 123.2181°W, Middle Hayford Creek; OR; 5) Trinity, CA; 6) Humboldt, 6) 40.4909°N, 123.6048°W, Van Duzon River; CA; 7, 8) Trinity, CA 7, 8) 40.4503°N, 123.5049°W, Mad River WPT 8851 301660 Sacramento Zoo A. marmorata 1-3) 2; 4) 42.1378°N, 121.3041°W, Lost River; 1-3) Klickitat, WA; 4) Klamath,

5) 40.5539°N, 123.2181°W, Middle Hayford Creek; OR; 5) Trinity, CA; 6) Humboldt, 6) 40.4909°N, 123.6048°W, Van Duzon River; CA; 7, 8) Trinity, CA 7, 8) 40.4503°N, 123.5049°W, Mad River WPT 886 301655 Sacramento Zoo A. marmorata 40.3956°N, 122.5260°W, Cottonwood Creek Shasta, CA WPT 897 301318 Sacramento Zoo A. marmorata 40.3956°N, 122.5260°W, Cottonwood Creek Shasta, CA WPT 898 301320 Sacramento Zoo A. marmorata 40.3956°N, 122.5260°W, Cottonwood Creek Shasta, CA WPT 8993 301668 Sacramento Zoo A. pallida Hanford Kings, CA

43

C.S.U. Fresno ID Specimen ID Animal Holding Facility Species Geographic Origin County of Origin WPT 9061 Dilbert 2500 Oakland Zoo A. marmorata 1-3) 2; 4) 42.1378°N, 121.3041°W, Lost River; 1-3) Klickitat, WA; 4) Klamath,

5) 40.5539°N, 123.2181°W, Middle Hayford Creek; OR; 5) Trinity, CA; 6) Humboldt, 6) 40.4909°N, 123.6048°W, Van Duzon River; CA; 7, 8) Trinity, CA 7, 8) 40.4503°N, 123.5049°W, Mad River WPT 913 Emmy 2002-06 Lindsay Wildlife Experience A. pallida Hanford Kings, CA WPT 914 Stebbins 1983-01 Lindsay Wildlife Experience A. marmorata 40.3956°N, 122.5260°W, Cottonwood Creek Shasta, CA WPT 9151 2018-4464 Lindsay Wildlife Experience A. marmorata 1-3) 2; 4) 42.1378°N, 121.3041°W, Lost River; 1-3) Klickitat, WA; 4) Klamath,

5) 40.5539°N, 123.2181°W, Middle Hayford Creek; OR; 5) Trinity, CA; 6) Humboldt, 6) 40.4909°N, 123.6048°W, Van Duzon River; CA; 7, 8) Trinity, CA 7, 8) 40.4503°N, 123.5049°W, Mad River WPT 917 13514 Detroit Zoological Society A. pallida Hanford Kings, CA WPT 9181 13618 Detroit Zoological Society A. marmorata 1-3) 2; 4) 42.1378°N, 121.3041°W, Lost River; 1-3) Klickitat, WA; 4) Klamath,

5) 40.5539°N, 123.2181°W, Middle Hayford Creek; OR; 5) Trinity, CA; 6) Humboldt, 6) 40.4909°N, 123.6048°W, Van Duzon River; CA; 7, 8) Trinity, CA 7, 8) 40.4503°N, 123.5049°W, Mad River WPT 919 13584 Detroit Zoological Society A. marmorata 40.3956°N, 122.5260°W, Cottonwood Creek Shasta, CA WPT 9201 B60155 Oregon Zoo A. marmorata 1-3) 2; 4) 42.1378°N, 121.3041°W, Lost River; 1-3) Klickitat, WA; 4) Klamath,

5) 40.5539°N, 123.2181°W, Middle Hayford Creek; OR; 5) Trinity, CA; 6) Humboldt, 6) 40.4909°N, 123.6048°W, Van Duzon River; CA; 7, 8) Trinity, CA 7, 8) 40.4503°N, 123.5049°W, Mad River WPT 921 A70153 Oregon Zoo A. marmorata 40.3956°N, 122.5260°W, Cottonwood Creek Shasta, CA WPT 924 H00318 California Science Center A. pallida Hanford Kings, CA WPT 925 H00319 California Science Center A. pallida Hanford Kings, CA WPT 9261 R15013 Santa Ana Zoo A. pallida 1) 33.2515°N, 117.4276°W, Cockleburr Creek; 1, 2) San Diego, CA

2) 32.8205°N, 116.5601°W, Pine Valley Creek WPT 9271 R15014 Santa Ana Zoo A. pallida 1) 33.2515°N, 117.4276°W, Cockleburr Creek; 1, 2) San Diego, CA

2) 32.8205°N, 116.5601°W, Pine Valley Creek

44

C.S.U. Fresno ID Specimen ID Animal Holding Facility Species Geographic Origin County of Origin WPT 9281 R17008 Santa Ana Zoo A. pallida 1) 33.2515°N, 117.4276°W, Cockleburr Creek; 1, 2) San Diego, CA

2) 32.8205°N, 116.5601°W, Pine Valley Creek WPT 9291 JQG19 - 00127 High Desert Museum A. marmorata 1-3) 2; 4) 42.1378°N, 121.3041°W, Lost River; 1-3) Klickitat, WA; 4) Klamath,

5) 40.5539°N, 123.2181°W, Middle Hayford Creek; OR; 5) Trinity, CA; 6) Humboldt, 6) 40.4909°N, 123.6048°W, Van Duzon River; CA; 7, 8) Trinity, CA 7, 8) 40.4503°N, 123.5049°W, Mad River WPT 9301 SMT13-00530 High Desert Museum A. marmorata 1-3) 2; 4) 42.1378°N, 121.3041°W, Lost River; 1-3) Klickitat, WA; 4) Klamath,

5) 40.5539°N, 123.2181°W, Middle Hayford Creek; OR; 5) Trinity, CA; 6) Humboldt, 6) 40.4909°N, 123.6048°W, Van Duzon River; CA; 7, 8) Trinity, CA 7, 8) 40.4503°N, 123.5049°W, Mad River WPT 9311 JQG17 - 00077 High Desert Museum A. marmorata 1-3) 2; 4) 42.1378°N, 121.3041°W, Lost River; 1-3) Klickitat, WA; 4) Klamath,

5) 40.5539°N, 123.2181°W, Middle Hayford Creek; OR; 5) Trinity, CA; 6) Humboldt, 6) 40.4909°N, 123.6048°W, Van Duzon River; CA; 7, 8) Trinity, CA 7, 8) 40.4503°N, 123.5049°W, Mad River WPT 9331 JQG18 - 00110 High Desert Museum A. marmorata 1-3) 2; 4) 42.1378°N, 121.3041°W, Lost River; 1-3) Klickitat, WA; 4) Klamath,

5) 40.5539°N, 123.2181°W, Middle Hayford Creek; OR; 5) Trinity, CA; 6) Humboldt, 6) 40.4909°N, 123.6048°W, Van Duzon River; CA; 7, 8) Trinity, CA 7, 8) 40.4503°N, 123.5049°W, Mad River WPT 9341 50519/Alphie Sequoia Park Zoo A. marmorata 1-3) 2; 4) 42.1378°N, 121.3041°W, Lost River; 1-3) Klickitat, WA; 4) Klamath,

5) 40.5539°N, 123.2181°W, Middle Hayford Creek; OR; 5) Trinity, CA; 6) Humboldt, 6) 40.4909°N, 123.6048°W, Van Duzon River; CA; 7, 8) Trinity, CA 7, 8) 40.4503°N, 123.5049°W, Mad River WPT 935 50730/Mini Sequoia Park Zoo A. marmorata 41.8569°N, 122.7728°W, Klamath River Siskiyou, CA WPT 9361 60518/Bibi Sequoia Park Zoo A. marmorata 1-3) 2; 4) 42.1378°N, 121.3041°W, Lost River; 1-3) Klickitat, WA; 4) Klamath,

5) 40.5539°N, 123.2181°W, Middle Hayford Creek; OR; 5) Trinity, CA; 6) Humboldt, 6) 40.4909°N, 123.6048°W, Van Duzon River; CA; 7, 8) Trinity, CA 7, 8) 40.4503°N, 123.5049°W, Mad River

45

C.S.U. Fresno ID Specimen ID Animal Holding Facility Species Geographic Origin County of Origin WPT 9371 50521/Gwen Sequoia Park Zoo A. marmorata 1-3) 2; 4) 42.1378°N, 121.3041°W, Lost River; 1-3) Klickitat, WA; 4) Klamath,

5) 40.5539°N, 123.2181°W, Middle Hayford Creek; OR; 5) Trinity, CA; 6) Humboldt, 6) 40.4909°N, 123.6048°W, Van Duzon River; CA; 7, 8) Trinity, CA 7, 8) 40.4503°N, 123.5049°W, Mad River WPT 938 88251 California Living Museum A. pallida Hanford Kings, CA WPT 939 88455 California Living Museum A. pallida Hanford Kings, CA WPT 940 88250 California Living Museum A. pallida Hanford Kings, CA WPT 941 701142 Santa Barbara Zoo A. pallida 33.1733°N, 116.7872°W, Scholder Creek San Diego, CA WPT 9421 700922 Santa Barbara Zoo A. pallida 1) 33.2515°N, 117.4276°W, Cockleburr Creek; 1, 2) San Diego, CA

2) 32.8205°N, 116.5601°W, Pine Valley Creek WPT 943 700471 Santa Barbara Zoo A. pallida Hanford Kings, CA WPT 944 701141 Santa Barbara Zoo A. pallida 33.1733°N, 116.7872°W, Scholder Creek San Diego, CA WPT 945 701143 Santa Barbara Zoo A. pallida 33.1733°N, 116.7872°W, Scholder Creek San Diego, CA WPT 9461 917172 San Diego Zoo A. pallida 1) 33.2515°N, 117.4276°W, Cockleburr Creek; 1, 2) San Diego, CA

2) 32.8205°N, 116.5601°W, Pine Valley Creek WPT 947 914071 San Diego Zoo A. pallida Hanford Kings, CA WPT 948 914005 San Diego Zoo A. pallida Hanford Kings, CA WPT 9491 908112 San Diego Zoo A. pallida 1) 33.2515°N, 117.4276°W, Cockleburr Creek; 1, 2) San Diego, CA

2) 32.8205°N, 116.5601°W, Pine Valley Creek WPT 9501 915041 San Diego Zoo A. pallida 1) 33.2515°N, 117.4276°W, Cockleburr Creek; 1, 2) San Diego, CA

2) 32.8205°N, 116.5601°W, Pine Valley Creek WPT 951 915085 San Diego Zoo A. pallida Hanford Kings, CA WPT 9521 914028 San Diego Zoo A. pallida 1) 33.2515°N, 117.4276°W, Cockleburr Creek; 1, 2) San Diego, CA

2) 32.8205°N, 116.5601°W, Pine Valley Creek WPT 953 914029 San Diego Zoo A. pallida Hanford Kings, CA WPT 954 908110 San Diego Zoo A. pallida 33.9669°N, 117.7534°W, Gordon Ranch San Bernadino, CA WPT 9551 914585 San Diego Zoo A. pallida 1) 33.2515°N, 117.4276°W, Cockleburr Creek; 1, 2) San Diego, CA

46

C.S.U. Fresno ID Specimen ID Animal Holding Facility Species Geographic Origin County of Origin

2) 32.8205°N, 116.5601°W, Pine Valley Creek WPT 956 914586 San Diego Zoo A. pallida Hanford Kings, CA WPT 9571 914066 San Diego Zoo A. pallida 1) 33.2515°N, 117.4276°W, Cockleburr Creek; 1, 2) San Diego, CA

2) 32.8205°N, 116.5601°W, Pine Valley Creek WPT 963 909163 San Diego Zoo A. pallida Hanford Kings, CA WPT 964 909346 San Diego Zoo A. pallida Hanford Kings, CA WPT 9651 908113 San Diego Zoo A. pallida 1) 33.2515°N, 117.4276°W, Cockleburr Creek; 1, 2) San Diego, CA

2) 32.8205°N, 116.5601°W, Pine Valley Creek WPT 966 910526 San Diego Zoo A. pallida Hanford Kings, CA WPT 967 910522 San Diego Zoo A. pallida Hanford Kings, CA WPT 968 910614 San Diego Zoo A. pallida Hanford Kings, CA WPT 969 914074 San Diego Zoo A. pallida Hanford Kings, CA WPT 970 915043 San Diego Zoo A. pallida Hanford Kings, CA WPT 9711 914067 San Diego Zoo A. pallida 1) 33.2515°N, 117.4276°W, Cockleburr Creek; 1, 2) San Diego, CA

2) 32.8205°N, 116.5601°W, Pine Valley Creek WPT 9721 909423 San Diego Zoo A. pallida 1) 35.1780°N, 119.9803°W, Barrett Creek; 1-3) San Luis Obispo, CA

2, 3) 35.2237°N, 120.2091°W, Upper Alamo Creek WPT 973 WA WPT Q W.D.F.W. A. marmorata 41.8569°N, 122.7728°W, Klamath River Siskiyou, CA

1Multiple potential geographic origins were detected for this program animal. Inferred localities and counties are numbered from one through eight. 2Specific localities for these samples were not provided because these populations are extremely fragile and susceptible to poaching and other human disturbances (Spinks et al., 2014). Permission was requested from Spinks and Shaffer for detailed geographic origin data to be sent to corresponding animal holding facilities to aid in the development of species and population specific captive breeding protocols. 3All program animals held at Sacramento Zoo are A. marmorata individuals, with the exception of one A. pallida individual. Wildlife managers that collected this A. pallida individual from McKinley Park Pond suspect that it was introduced to the area by humans because of the central location of the pond in a large residential area in Sacramento.

47

APPENDIX B: HAPLOTYPES OF MEMBERS OF ACTINEMYS MARMORATA (BEGINNING WITH AM) AND MEMBERS OF ACTINEMYS PALLIDA (BEGINNING WITH AP)

Haplotypes of members of Actinemys marmorata (beginning with AM) and members of Actinemys pallida (beginning with AP). Frequency refers to the number of individuals that share each haplotype. Reference individuals (Spinks and Shaffer 2005) begin with AY, individuals from this study begin with WPT. Frequency refers to the number of individuals that share each haplotype. Reference individuals (Spinks & Shaffer, 2005) begin with AY, individuals from this study begin with WPT. Haplotype Frequency AY Accession Number (Spinks and Shaffer 2005) WPT Accession Number AM001 37 905078, 905118, 905164, 905165, 905171, 905174, 905187, 905207 812, 835, 838, 843-845, 853-855, 857, 859, 870, 872, 878-880, 884, 885, 906, 915, 918, 920, 929-931, 933, 934, 936, 937 AM002 22 905076, 905077, 905079-905092, 905154, 905155, 905186, 905188, 905204, 905206 - AM003 24 905098 806, 807, 809, 810, 817, 819, 820-822, 824, 848, 862-864, 881-883, 886-898, 900-905, 914, 919, 921 AM004 3 905158 935, 973 AM005 1 905167 - AM006 1 905202 - AM007 1 - 808 AM008 1 905203 - AM009 1 905209 - AM010 1 905201 - AM011 1 905119 - AM012 1 905117 - AM013 1 905116 - AM014 1 905205 - AM015 1 905156 - AP001 3 905137, 905146 826 AP002 1 905144 - AP003 1 905145 - AP004 14 905107, 905138 926-928, 942, 946, 949, 950, 952, 955, 957, 965, 971 AP005 2 905159 954 AP006 1 905193 - AP007 1 905108 - AP008 1 905109 - AP009 1 905139 - AP010 3 905135 941, 945 AP011 1 905136 - AP012 4 905134, 905182, 905183, 905194 - AP013 1 905143 - AP014 1 905142 - AP015 1 905184 - AP016 1 905133 - AP017 1 905141 - AP018 1 905140 - AP019 33 - 811, 813-816, 823, 825, 830, 839, 846, 858, 861, 865, 867, 877, 899, 913, 917, 924, 925, 943, 947, 948, 951, 953, 956, 963, 964, 966-970 AP020 3 - 805, 818, 876 AP021 4 - 847, 860, 938, 940 AP022 1 - 939 AP023 1 905195 - AP024 1 905210 - AP025 1 - 875 AP026 2 - 868, 871 AP027 4 905110, 905196, 905197 972 AP028 1 - 944

49

APPENDIX C: NUMBER OF CAPTIVE MEMBERS OF ACTINEMYS MARMORATA AND ACTINEMYS PALLIDA IN EACH COLLABORATING ANIMAL HOLDING FACILITY IN RELATION TO NATIVE DISTRIBUTION OF EACH SPECIES FROM NORTHWEST WASHINGTON TO BAJA CALIFORNIA

Number of captive members of Actinemys marmorata and Actinemys pallida in each collaborating animal holding facility in relation to native distribution of each species from Northwest Washington to Baja California. Facilities within the range of each species are depicted in brackets, with the Woodland Park Zoo and the California Living Museum being within the farthest Northwest and Southeast corners of the expected range of A. marmorata, and CuriOdyssey and the San Diego Zoo being along the Northwest and Southeast borders of the expected range of A. pallida. The Aquarium of the Bay, Randall Museum, and the San Francisco Zoo are in an area that is suspected to be within the native range of A. marmorata, but needs further sampling to confirm as no pond turtles have been recorded in this area (Nafis 2016). Captive-born individuals are not displayed in Appendix C to give an accurate representation of wild-born individuals in captivity, and their distribution relative to native range. Detroit Zoological Society is not within the native range of A. pallida or A.

51 marmorata, but is holding members of both species and is contributing to the Western Pond Turtle SSP Sustainability Project.

APPENDIX D: ANIMAL HOLDING FACILITIES PARTICIPATING IN THE WESTERN POND TURTLE SSP SUSTAINABILITY PROJECT

Animal holding facilities participating in the Western Pond Turtle SSP Sustainability Project. Diameter of location point corresponds to number of individuals in each holding facility. This figure displays a pattern of more Actinemys pallida individuals in captivity in southern California, the majority of Actinemys marmorata individuals in captivity in northern California, Oregon, and Washington, and most of the facilities holding both species disbursed near the species border. 53

Fresno State Non-exclusive Distribution License (Keep for your records) (to archive your thesis/dissertation electronically via the Fresno State Digital Repository)

By submitting this license, you (the author or copyright holder) grant to the Fresno State Digital Repository the non-exclusive right to reproduce, translate (as defined in the next paragraph), and/or distribute your submission (including the abstract) worldwide in print and electronic format and in any medium, including but not limited to audio or video.

You agree that Fresno State may, without changing the content, translate the submission to any medium or format for the purpose of preservation.

You also agree that the submission is your original work, and that you have the right to grant the rights contained in this license. You also represent that your submission does not, to the best of your knowledge, infringe upon anyone’s copyright.

If the submission reproduces material for which you do not hold copyright and that would not be considered fair use outside the copyright law, you represent that you have obtained the unrestricted permission of the copyright owner to grant Fresno State the rights required by this license, and that such third-party material is clearly identified and acknowledged within the text or content of the submission.

If the submission is based upon work that has been sponsored or supported by an agency or organization other than Fresno State, you represent that you have fulfilled any right of review or other obligations required by such contract or agreement.

Fresno State will clearly identify your name as the author or owner of the submission and will not make any alteration, other than as allowed by this license, to your submission. By typing your name and date in the fields below, you indicate your agreement to the terms of this use. Publish/embargo options (type X in one of the boxes).

Make my thesis or dissertation available to the Fresno State Digital Repository immediately upon submission.

Embargo my thesis or dissertation for a period of 2 years from date of graduation. After 2 years, I understand that my work will automatically become part of the university’s public institutional repository unless I choose to renew this embargo here: [email protected]

Embargo my thesis or dissertation for a period of 5 years from date of graduation. After 5 years, I understand that my work will automatically become part of the university’s public institutional repository unless I choose to renew this embargo here: [email protected]

Type full name as it appears on submission

Date