Human TTI2 Gene Cdna Clone Plasmid

Total Page：16

File Type：pdf, Size：1020Kb

Human TTI2 Gene cDNA clone plasmid Catalog Number: HG17080-U General Information Plasmid Resuspension protocol Gene : TELO2 interacting protein 2 1.Centrifuge at 5,000×g for 5 min. Official Symbol : TTI2 2.Carefully open the tube and add 100 l of sterile water to dissolve the DNA. Synonym : MRT39; C8orf41 3.Close the tube and incubate for 10 minutes at room temperature. 4.Briefly vortex the tube and then do a quick spin to concentrate × Source : Human the liquid at the bottom. Speed is less than 5000 g. 5.Store the plasmid at -20 ℃. cDNA Size: 1527bp The plasmid is ready for: RefSeq : NM_001102401.2 • Restriction enzyme digestion • PCR amplification Plasmid: pUC19-hTTI2 • E. coli transformation • DNA sequencing Description E.coli strains for transformation (recommended Lot : Please refer to the label on the tube but not limited) Sequence Description : Most commercially available competent cells are appropriate for the plasmid, e.g. TOP10, DH5α and TOP10F´. Identical with the Gene Bank Ref. ID sequence except for the point mutations: 188A>G(E63G); 138T>C not causing the amino acid variation. Vector : pUC19 Shipping carrier : Each tube contains approximately 10 μg of lyophilized plasmid. Storage : The lyophilized plasmid can be stored at ambient temperature for three months. Quality control : The plasmid is confirmed by full-length sequencing with primers in the sequencing primer list. Sequencing primer list : M13-47 ： 5’ GCCAGGGTTTTCCCAGTCACGAC 3’ RV-M ： 5’ GAGCGGATAACAATTTCACACAGG 3’ Other M13 primers can also be used as sequencing primers. Manufactured By Sino Biological Inc., FOR RESEARCH USE ONLY. NOT FOR USE IN HUMANS. Fax :+86-10-51029969 Tel:+86- 400-890-9989 http://www.sinobiological.com Human TTI2 Gene cDNA clone plasmid Catalog Number: HG17080-U Vector Information pUC19 is a small, high-copy number E. coli plasmid cloning vector, of which multiple cloning sites as shown below. The molecule is a small double-stranded circle, 2686 base pairs in length. pUC19 encodes the N-terminal fragment of b-galactosidase (lacZa), which allows for blue/white colony screening (i.e., a- complementation), as well as a pUC origin of replication. Physical Map of pUC19-ORF: Manufactured By Sino Biological Inc., FOR RESEARCH USE ONLY. NOT FOR USE IN HUMANS. Fax :+86-10-51029969 Tel:+86- 400-890-9989 http://www.sinobiological.com.

Copy Link

Recommended publications

A Genetic Screen Identifies the Triple T Complex Required for DNA Damage Signaling and ATM and ATR Stability
Downloaded from genesdev.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press A genetic screen identifies the Triple T complex required for DNA damage signaling and ATM and ATR stability Kristen E. Hurov, Cecilia Cotta-Ramusino, and Stephen J. Elledge1 Howard Hughes Medical Institute and Department of Genetics, Harvard Medical School, Division of Genetics, Brigham and Women’s Hospital, Boston, Massachusetts 02115, USA In response to DNA damage, cells activate a complex signal transduction network called the DNA damage response (DDR). To enhance our current understanding of the DDR network, we performed a genome-wide RNAi screen to identify genes required for resistance to ionizing radiation (IR). Along with a number of known DDR genes, we discovered a large set of novel genes whose depletion leads to cellular sensitivity to IR. Here we describe TTI1 (Tel two-interacting protein 1) and TTI2 as highly conserved regulators of the DDR in mammals. TTI1 and TTI2 protect cells from spontaneous DNA damage, and are required for the establishment of the intra-S and G2/M checkpoints. TTI1 and TTI2 exist in multiple complexes, including a 2-MDa complex with TEL2 (telomere maintenance 2), called the Triple T complex, and phosphoinositide-3-kinase-related protein kinases (PIKKs) such as ataxia telangiectasia-mutated (ATM). The components of the TTT complex are mutually dependent on each other, and act as critical regulators of PIKK abundance and checkpoint signaling. [Keywords: TTI1; TEL2; TTI2; PIKK; TTT complex; IR sensitivity] Supplemental material is available at http://www.genesdev.org. Received April 5, 2010; revised version accepted July 22, 2010.
[Show full text]
Bayesian Hierarchical Modeling of High-Throughput Genomic Data with Applications to Cancer Bioinformatics and Stem Cell Differentiation
BAYESIAN HIERARCHICAL MODELING OF HIGH-THROUGHPUT GENOMIC DATA WITH APPLICATIONS TO CANCER BIOINFORMATICS AND STEM CELL DIFFERENTIATION by Keegan D. Korthauer A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Statistics) at the UNIVERSITY OF WISCONSIN–MADISON 2015 Date of final oral examination: 05/04/15 The dissertation is approved by the following members of the Final Oral Committee: Christina Kendziorski, Professor, Biostatistics and Medical Informatics Michael A. Newton, Professor, Statistics Sunduz Kele¸s,Professor, Biostatistics and Medical Informatics Sijian Wang, Associate Professor, Biostatistics and Medical Informatics Michael N. Gould, Professor, Oncology © Copyright by Keegan D. Korthauer 2015 All Rights Reserved i in memory of my grandparents Ma and Pa FL Grandma and John ii ACKNOWLEDGMENTS First and foremost, I am deeply grateful to my thesis advisor Christina Kendziorski for her invaluable advice, enthusiastic support, and unending patience throughout my time at UW-Madison. She has provided sound wisdom on everything from methodological principles to the intricacies of academic research. I especially appreciate that she has always encouraged me to eke out my own path and I attribute a great deal of credit to her for the successes I have achieved thus far. I also owe special thanks to my committee member Professor Michael Newton, who guided me through one of my first collaborative research experiences and has continued to provide key advice on my thesis research. I am also indebted to the other members of my thesis committee, Professor Sunduz Kele¸s,Professor Sijian Wang, and Professor Michael Gould, whose valuable comments, questions, and suggestions have greatly improved this dissertation.
[Show full text]
Modulating Mistranslation Potential of Trnaser in Saccharomyces Cerevisiae
HIGHLIGHTED ARTICLE | INVESTIGATION Modulating Mistranslation Potential of tRNASer in Saccharomyces cerevisiae Matthew D. Berg,*,1 Yanrui Zhu,* Julie Genereaux,* Bianca Y. Ruiz,† Ricard A. Rodriguez-Mias,† Tyler Allan,* Alexander Bahcheli,* Judit Villén,† and Christopher J. Brandl*,1 *Department of Biochemistry, The University of Western Ontario, London, Ontario N6A 5C1, Canada and †Department of Genome Sciences, University of Washington, Seattle, Washington 98195 ORCID IDs: 0000-0002-7924-9241 (M.D.B.); 0000-0002-1005-1739 (J.V.); 0000-0001-8015-9668 (C.J.B.) ABSTRACT Transfer RNAs (tRNAs) read the genetic code, translating nucleic acid sequence into protein. For tRNASer the anticodon does not specify its aminoacylation. For this reason, mutations in the tRNASer anticodon can result in amino acid substitutions, a process called mistranslation. Previously, we found that tRNASer with a proline anticodon was lethal to cells. However, by incorporating secondary mutations into the tRNA, mistranslation was dampened to a nonlethal level. The goal of this work was to identify second-site substitutions in tRNASer that modulate mistranslation to different levels. Targeted changes to putative identity elements led to total loss of tRNA function or signiﬁcantly impaired cell growth. However, through genetic selection, we identiﬁed 22 substi- tutions that allow nontoxic mistranslation. These secondary mutations are primarily in single-stranded regions or substitute G:U base pairs for Watson–Crick pairs. Many of the variants are more toxic at low temperature and upon impairing the rapid tRNA decay pathway. We suggest that the majority of the secondary mutations affect the stability of the tRNA in cells. The temperature sensitivity of the tRNAs allows conditional mistranslation.
[Show full text]
Genetic Analysis of Over One Million People Identifies 535 New Loci Associated with Blood 2 Pressure Traits
1 Genetic analysis of over one million people identifies 535 new loci associated with blood 2 pressure traits. 3 4 Table of Contents 5 SUPPLEMENTARY TABLES LEGENDS……………………………………………………………………………….…….3 6 SUPPLEMENTARY FIGURES LEGENDS ........................................................................................ 6 7 SUPPLEMENTARY METHODS ................................................................................................... 10 8 1. UK Biobank data .................................................................................................................................... 10 9 2. UKB Quality Control ............................................................................................................................... 10 10 3. Phenotypic data ..................................................................................................................................... 11 11 4. UKB analysis ........................................................................................................................................... 11 12 5. Genomic inflation and confounding ....................................................................................................... 12 13 6. International Consortium for Blood Pressure (ICBP) GWAS .................................................................... 12 14 7. Meta-analyses of discovery datasets ..................................................................................................... 13 15 8. Linkage Disequilibrium calculations ......................................................................................................
[Show full text]
Sexual Dimorphism in Brain Transcriptomes of Amami Spiny Rats (Tokudaia Osimensis): a Rodent Species Where Males Lack the Y Chromosome Madison T
Ortega et al. BMC Genomics (2019) 20:87 https://doi.org/10.1186/s12864-019-5426-6 RESEARCHARTICLE Open Access Sexual dimorphism in brain transcriptomes of Amami spiny rats (Tokudaia osimensis): a rodent species where males lack the Y chromosome Madison T. Ortega1,2, Nathan J. Bivens3, Takamichi Jogahara4, Asato Kuroiwa5, Scott A. Givan1,6,7,8 and Cheryl S. Rosenfeld1,2,8,9* Abstract Background: Brain sexual differentiation is sculpted by precise coordination of steroid hormones during development. Programming of several brain regions in males depends upon aromatase conversion of testosterone to estrogen. However, it is not clear the direct contribution that Y chromosome associated genes, especially sex- determining region Y (Sry), might exert on brain sexual differentiation in therian mammals. Two species of spiny rats: Amami spiny rat (Tokudaia osimensis) and Tokunoshima spiny rat (T. tokunoshimensis) lack a Y chromosome/Sry, and these individuals possess an XO chromosome system in both sexes. Both Tokudaia species are highly endangered. To assess the neural transcriptome profile in male and female Amami spiny rats, RNA was isolated from brain samples of adult male and female spiny rats that had died accidentally and used for RNAseq analyses. Results: RNAseq analyses confirmed that several genes and individual transcripts were differentially expressed between males and females. In males, seminal vesicle secretory protein 5 (Svs5) and cytochrome P450 1B1 (Cyp1b1) genes were significantly elevated compared to females, whereas serine (or cysteine) peptidase inhibitor, clade A, member 3 N (Serpina3n) was upregulated in females. Many individual transcripts elevated in males included those encoding for zinc finger proteins, e.g.
[Show full text]
Saccharomyces Cerevisiae Tti2 Regulates PIKK Proteins and Stress Response
INVESTIGATION Saccharomyces cerevisiae Tti2 Regulates PIKK Proteins and Stress Response Kyle S. Hoffman,* Martin L. Duennwald,† Jim Karagiannis,‡ Julie Genereaux,* Alexander S. McCarton,* and Christopher J. Brandl*,1 *Department of Biochemistry and †Department of Pathology, Schulich School of Medicine and Dentistry, and ‡Department of Biology, The University of Western Ontario, London, Ontario, N6A5C1 Canada ABSTRACT The TTT complex is composed of the three essential proteins Tel2, Tti1, and Tti2. The complex KEYWORDS is required to maintain steady state levels of phosphatidylinositol 3-kinase-related kinase (PIKK) proteins, TTT complex including mTOR, ATM/Tel1, ATR/Mec1, and TRRAP/Tra1, all of which serve as regulators of critical cell PIKK proteins signaling pathways. Due to their association with heat shock proteins, and with newly synthesized PIKK heat shock peptides, components of the TTT complex may act as cochaperones. Here, we analyze the consequences of response depleting the cellular level of Tti2 in Saccharomyces cerevisiae. We show that yeast expressing low levels of chaperone Tti2 are viable under optimal growth conditions, but the cells are sensitive to a number of stress conditions protein that involve PIKK pathways. In agreement with this, depleting Tti2 levels decreased expression of Tra1, expression Mec1, and Tor1, affected their localization and inhibited the stress responses in which these molecules are involved. Tti2 expression was not increased during heat shock, implying that it does not play a general role in the heat shock response. However, steady state levels of Hsp42 increase when Tti2 is depleted, and tti2L187P has a synthetic interaction with exon 1 of the human Huntingtin gene containing a 103 residue polyQ sequence, suggesting a general role in protein quality control.
[Show full text]
2014-Platform-Abstracts.Pdf
American Society of Human Genetics 64th Annual Meeting October 18–22, 2014 San Diego, CA PLATFORM ABSTRACTS Abstract Abstract Numbers Numbers Saturday 41 Statistical Methods for Population 5:30pm–6:50pm: Session 2: Plenary Abstracts Based Studies Room 20A #198–#205 Featured Presentation I (4 abstracts) Hall B1 #1–#4 42 Genome Variation and its Impact on Autism and Brain Development Room 20BC #206–#213 Sunday 43 ELSI Issues in Genetics Room 20D #214–#221 1:30pm–3:30pm: Concurrent Platform Session A (12–21): 44 Prenatal, Perinatal, and Reproductive 12 Patterns and Determinants of Genetic Genetics Room 28 #222–#229 Variation: Recombination, Mutation, 45 Advances in Defining the Molecular and Selection Hall B1 Mechanisms of Mendelian Disorders Room 29 #230–#237 #5-#12 13 Genomic Studies of Autism Room 6AB #13–#20 46 Epigenomics of Normal Populations 14 Statistical Methods for Pedigree- and Disease States Room 30 #238–#245 Based Studies Room 6CF #21–#28 15 Prostate Cancer: Expression Tuesday Informing Risk Room 6DE #29–#36 8:00pm–8:25am: 16 Variant Calling: What Makes the 47 Plenary Abstracts Featured Difference? Room 20A #37–#44 Presentation III Hall BI #246 17 New Genes, Incidental Findings and 10:30am–12:30pm:Concurrent Platform Session D (49 – 58): Unexpected Observations Revealed 49 Detailing the Parts List Using by Exome Sequencing Room 20BC #45–#52 Genomic Studies Hall B1 #247–#254 18 Type 2 Diabetes Genetics Room 20D #53–#60 50 Statistical Methods for Multigene, 19 Genomic Methods in Clinical Practice Room 28 #61–#68 Gene Interaction
[Show full text]
Bioinformatic Pipeline for Whole Exome Sequence (WES) Analysis
SUPPLEMENT Supplement contents: Supplementary Methods Supplementary Figure 1: Bioinformatic pipeline for whole exome sequence (WES) analysis. Supplementary Figure 2: Pedigrees and HomozygosityMapper output for families with single variants identified, in addition to those shown in Figure 2. Supplementary Figure 3: Spatiotemporal expression of ID genes in human development using RNA sequencing data. Supplementary Figure 4: Developmental expression pattern of ID genes in the human prefrontal cortex. Supplementary Table 1: Family statistics Supplementary Table 2: Homozygosity-by-descent/autozygosity shared regions, as defined using HomozygosityMapper, cross-referenced with FSuite. Supplementary Table 3: Mutations identified per family. A. Single homozygous variant identified. B. Two to four variants identified. C. Dominant/de novo mutation identified. Supplementary Table 4: Pathogenic CNVs and variants of unknown significance identified by microarray analysis. Supplementary Table 5: BioGRID protein interaction and gene ontology analysis. (separate Excel file) Supplementary Table 6: Gene Ontology Pathway analysis. Supplementary Table 7: Gene List for anatomic/temporal transcription analyses. Supplementary Table 8: Top anatomical regions for ID gene expression. Supplementary Methods HBD/Autozygosity mapping Both of the below methods and the hg19 version of the genome were used to ensure a consistent and uniform genotyping. Genotyping data was uploaded to the HomozygosityMapper server to determine putative homozygous-by- descent (HBD) regions based on the allele frequencies of the markers uploaded to the server from previous studies. HBD regions were identified by manual curation and only HBD regions larger than 1 Mb shared between all affected members (and not unaffected members) of the family were chosen. These regions were extracted based on SNP RS numbers and these dbSNP identifiers were converted to a genomic position for used to represent genomic regions with NGS data.
[Show full text]
Saccharomyces Cerevisiae Tti2 Regulates PIKK Proteins and Stress
G3: Genes|Genomes|Genetics Early Online, published on May 27, 2016 as doi:10.1534/g3.116.029520 1 Saccharomyces cerevisiae Tti2 regulates PIKK proteins and stress response Kyle S. Hoffman,* Martin L. Duennwald, † Jim Karagiannis,‡ Julie Genereaux,* Alexander S. McCarton,* Christopher J. Brandl*,1 *Department of Biochemistry, Schulich School of Medicine & Dentistry, The University of Western Ontario, London, Ontario, Canada N6A5C1, †Department of Pathology, Schulich School of Medicine & Dentistry, The University of Western Ontario, London, Ontario, Canada N6A5C1, ‡Department of Biology, The University of Western Ontario, London, Ontario, Canada N6A5B7 © The Author(s) 2013. Published by the Genetics Society of America. 2 Running title: Tti2 is required for stress response Key words: TTT complex, PIKK proteins, heat shock response, chaperone, protein expression Corresponding Author Information: Dr. Christopher Brandl, Department of Biochemistry, The University of Western Ontario, 1151 Richmond St., London, Ontario, Canada N6A5C1 Tel: 519-661-2111 ext. 86857 email: [email protected] 3 ABSTRACT The TTT complex is composed of the three essential proteins Tel2, Tti1 and Tti2. The complex is required to maintain the steady state levels of the phosphatidylinositol 3-kinase-related kinase (PIKK) proteins including mTOR, ATM/Tel1, ATR/Mec1, and TRRAP/Tra1, all of which serve as regulators of critical cell signaling pathways. Due to their association with heat shock proteins, and with newly synthesized PIKK peptides, components of the TTT complex may act as co-chaperones. Here, we analyze the consequences of depleting the cellular level of Tti2 in Saccharomyces cerevisiae. We show that yeast expressing low levels of Tti2 are viable under optimal growth conditions, but the cells are sensitive to a number of stress conditions that involve PIKK pathways.
[Show full text]
Clinical and Genomic Characterization of 8P Cytogenomic Disorders
www.nature.com/gim ARTICLE Clinical and genomic characterization of 8p cytogenomic disorders ✉ Volkan Okur 1,2, Laura Hamm1, Haluk Kavus1, Caroline Mebane1, Scott Robinson1, Brynn Levy3 and Wendy K. Chung1,4 PURPOSE: To provide a detailed clinical and cytogenomic summary of individuals with chromosome 8p rearrangements of invdupdel(8p), del(8p), and dup(8p). METHODS: We enrolled 97 individuals with invdupdel(8p), del(8p), and dup(8p). Clinical and molecular data were collected to delineate and compare the clinical findings and rearrangement breakpoints. We included additional 5 individuals with dup(8p) from the literature for a total of 102 individuals. RESULTS: Eighty-one individuals had recurrent rearrangements of invdupdel(8p) (n = 49), del(8p)_distal (n = 4), del(8p)_proximal (n = 9), del(8p)_proximal&distal (n = 12), and dup(8p)_proximal (n = 7). Twenty-one individuals had nonrecurrent rearrangements. While all individuals had neurodevelopmental features, the frequency and severity of clinical findings were higher in individuals with invdupdel(8p), and with larger duplications. All individuals with GATA4 deletion had structural congenital heart defects; however, the presence of structural heart defects in some individuals with normal GATA4 copy number suggests there are other potentially contributing gene(s) on 8p. CONCLUSION: Our study may inform families and health-care providers about the associated clinical findings and severity in individuals with chromosome 8p rearrangements, and guide researchers in investigating the underlying
[Show full text]
Genetic Evidence Links the ASTRA Protein Chaperone Component Tti2 to the SAGA Transcription Factor Tra1
INVESTIGATION Genetic Evidence Links the ASTRA Protein Chaperone Component Tti2 to the SAGA Transcription Factor Tra1 Julie Genereaux,* Stephanie Kvas,* Dominik Dobransky,* Jim Karagiannis,† Gregory B. Gloor,* and Christopher J. Brandl*,1 *Department of Biochemistry, Schulich School of Medicine and Dentistry, University of Western Ontario, London, Ontario, Canada N6A5C1 and †Department of Biology, University of Western Ontario, London, Ontario, Canada N6A 5B7 ABSTRACT Tra1 is a 3744-residue component of the Saccharomyces cerevisiae SAGA, NuA4, and ASTRA complexes. Tra1 contains essential C-terminal PI3K and FATC domains, but unlike other PIKK (phosphoinositide three-kinase–related kinase) family members, lacks kinase activity. To analyze functions of the FATC domain, we selected for suppressors of tra1-F3744A, an allele that results in slow growth under numerous conditions of stress. Two alleles of TTI2, tti2-F328S and tti2-I336F, acted in a partially dominant fashion to suppress the growth-related phenotypes associated with tra1-F3744A as well as its resulting defects in transcription. tti2-F328S suppressed an additional FATC domain mutation (tra1-L3733A), but not a mutation in the PI3K domain or deletions of SAGA or NuA4 components. We ﬁnd eGFP-tagged Tti2 distributed throughout the cell. Tti2 is a component of the ASTRA complex, and in mammalian cells associates with molecular chaperones in complex with Tti1 and Tel2. Consistent with this ﬁnding, Tra1 levels are reduced in a strain with a temperature-sensitive allele of tel2. Further agreeing with a possible role for Tti2 in the folding or stabilization of Tra1, tra1-F3744A was mislocalized to the cytoplasm, particularly under conditions of stress.
[Show full text]
Molecular Sciences High-Resolution Chromosome Ideogram Representation of Currently Recognized Genes for Autism Spectrum Disorder
Int. J. Mol. Sci. 2015, 16, 6464-6495; doi:10.3390/ijms16036464 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Article High-Resolution Chromosome Ideogram Representation of Currently Recognized Genes for Autism Spectrum Disorders Merlin G. Butler *, Syed K. Rafi † and Ann M. Manzardo † Departments of Psychiatry & Behavioral Sciences and Pediatrics, University of Kansas Medical Center, Kansas City, KS 66160, USA; E-Mails: [email protected] (S.K.R.); [email protected] (A.M.M.) † These authors contributed to this work equally. * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +1-913-588-1873; Fax: +1-913-588-1305. Academic Editor: William Chi-shing Cho Received: 23 January 2015 / Accepted: 16 March 2015 / Published: 20 March 2015 Abstract: Recently, autism-related research has focused on the identification of various genes and disturbed pathways causing the genetically heterogeneous group of autism spectrum disorders (ASD). The list of autism-related genes has significantly increased due to better awareness with advances in genetic technology and expanding searchable genomic databases. We compiled a master list of known and clinically relevant autism spectrum disorder genes identified with supporting evidence from peer-reviewed medical literature sources by searching key words related to autism and genetics and from authoritative autism-related public access websites, such as the Simons Foundation Autism Research Institute autism genomic database dedicated to gene discovery and characterization. Our list consists of 792 genes arranged in alphabetical order in tabular form with gene symbols placed on high-resolution human chromosome ideograms, thereby enabling clinical and laboratory geneticists and genetic counsellors to access convenient visual images of the location and distribution of ASD genes.
[Show full text]