THE ROLE OF CELL-SURFACE NEUTRAL METALLOENDOPEPTH)ASES IN CRANIOFACIAL DEVELOPMENT
Submitted in fulfilment of the degree of Doctor of Philosophy, University of London.
BRADLEY SPENCER-DENE BSc.
1995
Joint Department of Maxillofacial Surgery, Eastman Dental Institute for Oral Health Care Sciences and University College Hospitals, University of London
and
Developmental Biology Unit, Institute of Child Health, University of London, ProQuest Number: 10105162
All rights reserved
INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted.
In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. uest.
ProQuest 10105162
Published by ProQuest LLC(2016). Copyright of the Dissertation is held by the Author.
All rights reserved. This work is protected against unauthorized copying under Title 17, United States Code. Microform Edition © ProQuest LLC.
ProQuest LLC 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, Ml 48106-1346 ABSTRACT
It is proposed that cell-surface zinc-dependent metalloendopeptidases, by virtue of their capacity to cleave and inactivate a wide range of peptide morphogens, represent a hitherto unrecognised level of control during growth and differentiation of the mammalian head and face. The spatio-temporal distributions of two of these enzymes, neutral endopeptidase (NEP) and endopeptidase-2 (Endo-2), have been demonstrated immunohistochemically. Their presence in a wide range of craniofacial tissues in the rat, during a gestational period when these tissues are undergoing active morphogenesis, suggests that these enzymes play key roles in the development of the craniofacial region. In addition, the patterns of expression of NEP mRNA have been described using in situ hybridization. In order to investigate the roles played by NEP, the activity of the endogenous enzyme was blocked using two chemically distinct, highly selective NEP inhibitors, during whole embryo culture. At the end of the culture period, the treated embryos exhibited a characteristic asymmetric craniofacial dysmorphogenesis. Histological examination revealed a distension of the left internal carotid and first branchial arch arteries. The predominantly prosencephalic swelling was considerably exacerbated by an overgrowth of the overlying neuroepithelium. In addition, there was often incomplete closure of the cranial neural folds, and the branchial arches were of a dysmorphic appearance on the affected side. From these studies it can be concluded that both NEP and Endo-2 are present during development of the embryonic rat head and face, and that NEP appears to be essential for normal morphogenesis of the craniofacial region. ACKNOWLEDGEMENTS
First and foremost, I feel I must pay tribute to my mother, Avril, for her unwavering motivation, encouragement and ceaseless drive. She has helped to keep me focused on my work, lifted me when my spirits faltered, and nurtured my ambition and determination to succeed. Both my girlfriend, now fiancée, Tracey, and my brother, Alastair have brought and continue to bring warmth, humour and support throughout my studies. On a professional level I must thank both of my Ph.D supervisors. Professor Brian Henderson and Professor Peter Thorogood for their advice, patience, enthusiasm, guidance, and for having the foresight to propose the original hypothesis which has laid the foundations of this study. I could not have completed this thesis without the unstinting encouragement and financial support of Professor Malcolm Harris, an extremely kind and generous man. Also I wish to thank the MRC for providing the initial funding for this project. To name all of the people who have helped me over the past three and a half years would run to several pages. However, I would especially like to thank Dr John Kenny, Dr Nick Lench and all of the staff of the Maxillofacial Surgery Research Unit (IDS) and the Developmental Biology Unit (ICH). A special mention must also be made to all of my collaborators in the UK and around the world. Their generous gifts, advice and invitations to meetings have helped to make this project so successful. ABBREVIATIONS
ANP Atrial natriuretic peptide APES 3-Aminopropyltriethoxysilane ATP Adenosine triphosphate BLP Bombesin-like peptide BMP Bone Morphogenetic Protein BSA Bovine Serum Albumin CALLA Common Acute Lymphoblastic Leukemia Antigen CDIO Cluster of Differentiation 10 cDNA complementary Deoxyribonucleic acid CGRP Calcitonin Gene Related Peptide CTP Cytosine triphosphate DAB 3,3’ -Diaminobenzid ine dd dideoxy DEPC Diethylpyrocarbonate DTT Dithiothreitol ElO Embryonic/gestational day 10 EC-24.11 E.C.3.4.24.11 EC-24.18 E.C.3.4.24.18 EDTA Ethylenediaminetetraacetic acid EGF Epidermal Growth Factor Endo-2 Endopeptidase-2/E.C.3.4.24.18 FMLP f-Met-Leu-Phe GTP Guanosine triphosphate HACBO-Gly N-(2RS)-3-hydroxylaminocarbonyl-2-benzyl-l-oxopropyl-glycine IL-ljg Interleukin-1 beta IPTG Isopropyl jS-D-Thiogalactopyranoside NEP Neutral endopeptidase/E.C.3.4.24.11 NTE NaCl (sodium chloride)/Tris/EDTA PABA N-benzoyl-L-tyrosyl-p-aminobenzoic acid PBS Phosphate Buffered Saline PCR Polymerase chain reaction PFA Paraformaldehyde mRNA messenger Ribonucleic Acid RT-PCR Reverse transcriptase-PCR SDS-PAGE Sodium Dodecyl Sulphate-Polyacrylamide Gel Electrophoresis SEM Scanning Electron Microscopy SSC NaCl/sodium citrate Taq Thermus aquaticus TE Tris-EDTA TAE T r is-Acetate-EDT A TBE Tris-Borate-EDT A TEMED N,N, N ’, N’-Tetramethylethylenediamine TGFa Transforming Growth Factor alpha TGFjg Transforming Growth Factor beta Tris/Trizma Tris(hydroxymethyl)aminomethane UTP Uridine triphosphate VIP Vasoactive Intestinal Peptide X-gal 5-Bromo-4-chloro-3-indolyl-j8-D-galactoside TABLE OF CONTENTS
Abstract pg 2 Acknowledgements pg 3 Abbreviations pg 4 List of Tables pg 8 List of Figures pg 9 CHAPTER 1, INTRODUCTION pp 11-39 1.1 Background pg 12 1.2 Substrate specificity and mechanism of action of pg 12 the neutral metalloendopeptidases 1.3 Protein structures and molecular genetics pg 18 1.3.1 NEP pg 18 1.3.2 Endo-2 pg 19 1.3.3 Regulation of NEP pg 22 1.4 Distribution of NEP pg 23 1.4.1 Expression in adult tissues pg 23 Central nervous system pg 23 Peripheral organs pg 23 1.4.2 Developmental expression pg 24 1.5 Distribution of Endo-2 pg 28 1.6 Inhibition of the metalloendopeptidases pg 29 1.6.1 Inhibitors of NEP pg 29 1.6.2 Inhibitors of Endo-2 pg 31 1.7 The role of biologically active peptides and growth factors pg 31 during mammalian craniofacial development 1.8 The role played by growth factors in abnormal human pg 37 craniofacial development 1.9 HYPOTHESIS pg 39 1.10 Objectives of this study pg 39 CHAPTER 2, MATERIALS AND METHODS pp 40-83 2.1 Animals used in this study pg 40 2.1.1 Determination of embryonic stage pg 40 2.1.2 Sacrificing of animals and dissection of embryo pg 40 2.1.3 Dissection of adult rat kidneys pg 42 2.2 Preparation of microvillar membranes pg 42 2.2.1 Extraction of a membrane fraction from rat embryos pg 43 2.3 Fixation of tissues pg 44 2.3.1 Fixation of frozen sections for immunohistochemistry pg 44 2.3.2 Fixation of embryos for wax histology pg 45 2.3.3 Fixation of cultured embryos for scanning electron pg 45 microscopy 2.4 Tissue processing pg 46 2.4.1 Freezing tissue and cryosectioning pg 46 2.4.2 Wax embedding and sectioning pg 47 2.4.2.1 Black and white photography pg48 2.4.3 Scanning electron microscopy pg48 2.4.3.1 Black and white photography pg 49 2.5 Preparation of APES-coated slides pg 49 2.6 Immunohistochemistry pg 49 2.6.1 Western blotting pg 50 2.6.1.1 Controls pg 51 2.6.2 Immunohistochemical localization of NEP pg 51 2.6.3 Immunohistochemical localization of Endo-2 pg 52 2.6.4 Enhancement of DAB pg 53 2.6.5 Controls used for immunohistochemistry Pg54 2.6.6 Counterstaining Pg55 2.6.7 Colour photography Pg55 2.7 In situ hybridization Pg55 2.7.1 Preparation of p^S]-radiolabelled probes pg56 2.7.1.1 Transcription pg56 2.7.1.2 In situ riboprobe preparation using a G-50 drip column Pg57 2.7.2 Pre-treatment of frozen sections Pg58 2.7.3 Hybridization Pg59 2.7.4 Post-hybridization washes pg 60 2.7.5 Autoradiography pg 60 2.7.5.1 Preparation of ILFORD K5 emulsion pg61 2.7.5.2 Developing emulsion pg61 2.7.5.3 Colour photography pg62 2.7.6 Digestion of plasmid DNA with restriction endonucleases Pg62 2.8 Nucleic acid extraction pg63 2.8.1 Extraction protocols for plasmid DNA; standard mini-prep pg63 2.8.2 Ethidium bromide/high salt midi-prep pg 64 2.8.3 Extraction of messenger RNA pg65 2.8.4 Preparation of genomic DNA from rat kidney pg67 2.9 Synthesis of cDNA using reverse transcriptase (RT) Pg68 2.10 Polymerase chain reaction (PCR) pg 70 2.10.1 Primers pg 70 2.10.2 PCR conditions pg 71 2.10.3 PCR reaction mixture pg 71 2.10.4 Quantitative determination pg 72 2.11 Ligation of RT-PCR products into pGEM-T vector pg 73 2.12 Transformation of high efficiency competent cells pg 74 2.13 Blue/white colour screening for recombinants pg 74 2.13.1 Preparation of LB-ampicillin-XGAL-IPTG plates pg 75 2.14 Extraction of DNA from an agarose slice pg 76 2.15 Sequencing pg 77 2.15.1 Alkaline dénaturation of double stranded plasmid DNA Pg77 2.15.2 Annealing template and primer pg 78 2.15.3 Labelling reaction Pg78 2.15.4 Termination reactions Pg79 2.16 Denaturing gel electrophoresis Pg79 2.17 Gel drying and autoradiography Pg81 2.18 Whole embryo culture pg 81 2.18.1 Inhibitor treatment pg 82 2.18.2 Assessment of normality pg 83 CHAPTER 3, IMMUNOHISTOCHEMICAL LOCALIZATION pp 84-110 OF NEP AND ENDO-2 3.1 Introduction pg84 3.2 Materials and methods pg85 3.3 Results pg87 3.3.1 Western blots pg 86 3.3.2 Immunolocalization of NEP in the developing head and face pg 90 3.3.3 Immunolocalization of NEP in postcranial sites pg 101 3.3.4 Immunolocalization of Endo-2 in the developing pg 101 head and face 3.3.5 Immunolocalization of Endo-2 in postcranial sites pg 104 3.4 Discussion pg 106 CHAPTER 4, NEP GENE EXPRESSION pp 111-123 4.1 Introduction pg 111 4.2 Materials and methods pg 112 4.3 Results pg 112 4.4 Discussion pg 120 CHAPTER 5, EFFECT OF SELECTIVE INHIBITION OF NEP PP 124-144 IN WHOLE EMBRYO CULTURE 5.1 Introduction pg 124 5.2 Materials and methods pg 125 5.3 Results pg 126 5.4 Discussion pg 140 CHAPTER 6, GENERAL DISCUSSION pp 145-155 6.1 General Discussion pg 145 6.2 Future research pg 152 6.3 Conclusions pg 154 ADDENDUM pp 156-173 APPENDICES pp 174-181 Mammalian craniofacial development pg 174 The Human pg 176 First branchial arch pg 177 Second branchial arch pg 178 Third branchial arch pg 178 Fourth and sixth branchial arches pg 178 The face pg 178 Intermaxillary segment pg 180 Secondary palate pg 180 Tongue pg 180 PUBLICATIONS ARISING FROM THIS THESIS pg 184 BIBLIOGRAPHY pg 185 TABLES Table 1.1 Peptide substrates of NEP pg 16 Table 1.2 Peptide substrates of Endo-2 pg 17 Table 1.3 Growth factors in development pg 33 Table 2.1 Constituent of Hank’s buffered saline pg 41 Table 2.2 Dehydration schedule for SEM pg 48 Table 2.3 Calculation of vectoriinsert ratios for ligations pg 73 Table 3.1 Summary of immunohistochemical results pg 105 Table 5.1 Results of phosphoramidon exposure on E9.5 embryos pg 136 Table 5.2 Results of phosphoramidon exposure on E10.5 embryos pg 137 Table 5.3 Results of thiorphan exposure on E9.5 embryos pg 138 Table Al Timetable of rat development pg 174 Table A2 Development of the sense organs in the rat pg 175 FIGURES
1.1 The metallo-peptidase family pg 15 1.2 Proposed mechanism of growth regulation pg 27 3. A Western blots of adult rat kidney and E14 membrane preparations pg 89 3.B Endo-2 immunolocalization in the adult rat kidney pg 92 3.C NEP immunolocalization in the adult rat kidney pg 92 3.D Distribution of NEP mRNA in the adult rat kidney pg 92 3.E Immunolocalization of NEP in the E12 nasal processes pg 94 3.F Immunolocalization of NEP in the ElO gut pg 94 3.G Immunolocalization of NEP in the E12 mesonephric tubules pg 94 3.H Immunolocalization of NEP in the E12 notochord pg 94 3.1 Immunolocalization of NEP in the E l6 tongue pg 96 3.J Immunolocalization of NEP in the E16 palate pg 96 3.K Immunolocalization of NEP in the E16 inner ear pg 96 3.L Immunolocalization of NEP in the E l6 mandible pg 96 3.M Immunolocalization of NEP in the E l6 mandible; higher magnification pg 96 3.N Immunolocalization of NEP in the E l6 perichondrium pg 96 3.0 Immunolocalization of NEP in the E14 heart pg 98 3.P Immunolocalization of NEP in the E14 gut pg 98 3.Q Immunolocalization of NEP in the E14 notochord pg 98 3.R Immunolocalization of NEP in the E l4 lungs pg 98 3.S Immunolocalization of NEP in the E l4 perichondrium pg 98 3.T Immunolocalization of NEP in the E l4 pigmented retina pg 100 3.U Immunolocalization of NEP in the E14 choroid plexus pg 100 3. V Immunolocalization of Endo-2 in the E l4 choroid plexus pg 100 3.W Immunolocalization of Endo-2 in the E14 Rathke’s pouch pg 100 3.x Endo-2 in the E16 inner ear non-sensory epithelium. No counterstain pg 103 3.X’ Endo-2 in the E16 inner ear non-sensory epithelium. Counterstained pg 103 3.Y Endo-2 in the E l6 inner ear; low magnification pg 103 3.Z Endo-2 in the E l6 semicircular canal pg 103 3.Z’ Same as 3.Z but preabsorbed with purified antigen pg 103 4. A In situ hybridization of NEP in the E14 embryo pg 114 4.B In situ hybridization of NEP in the E14 embryo; sense control pg 114 4.C NEP mRNA in the E14 nasal mesenchyme pg 114 4.D NEP mRNA in the E14 choroid plexus pg 114 4.E NEP mRNA in the E14 craniofacial region; dark-field image. pg 116 4.F NEP mRNA in the post-cranial tissues at E l4; dark-field image. pg 116 4.0 NEP mRNA in the E l4 vertebral processes pg 118 4.H NEP mRNA in the E l2 notochord pg 118 4.1 NEP mRNA in the E14 lung pg 118 4.J NEP mRNA in the E14 mesonephric tubules pg 118 5. A SEM of an E9.5 rat embryo cultured for 48 hr in diluted serum pg 128 FIGURES contd.
5.B SEM of an B9.5 embryo cultured for 48 hr in 10 nM phosphoramidon pg 128 5.C SEM of an E9.5 embryo cultured for 48 hr in 100 nM phos. pg 128 5.D SEM of an E9.5 embryo cultured for 48 hr in 100 ^M phos. pg 130 5.E Lower magnification of Fig 7.D pg 130 5.F SEM of an E10.5 embryo cultured for 45 hr in diluted rat serum pg 132 5.G SEM of an E10.5 embryo cultured for 45 hr in 10 fiM phos. pg 132 5.H SEM of an E10.5 embryo cultured for 45 hr in 1 /xM phos. pg 132 5.1 SEM of an E10.5 embryo cultured for 45 hr in ICK) /xM phos. pg 132 5.J-M H & E histological sections of an E9.5 embryo cultured in 1 /xM phos. pg 134 7. A RT-PCR of rat embryos from E9-E14 and adult kidney pg 162 7.B Control RT-PCR reactions pg 162 A1 Development of the human head and face pg 175
10 CHAPTER 1
INTRODUCTION CHAPTER 1
INTRODUCTION
Some of the most complex interactions between cells, mediators and matrices in biology are found in the process of embryogenesis. Interference with these vastly complex interactions, through genetic defects or environmental insult, can lead to developmental abnormality. Therefore, the embryo and foetus must contain systems to switch off the multiple peptide signals involved during development. Failure to control these signals could be as serious as the failure to generate signals.
In this thesis I have examined the role played by two cell-surface metalloendopeptidases neutral endopeptidase (NEP) and endopeptidase-2 (Endo-2) during rat craniofacial development. Over the last thirty years NEP and Endo-2 have been shown to inactivate a variety of biologically active peptides including growth factors and cytokines. Furthermore, it has now been established that NEP is identical to common acute lymphoblastic leukaemia antigen (CALLA or CDIO) (Letarte et al., 1988). This finding led to speculation that NEP played a role in the growth and differentiation of both haematopoietic and epithelial cell populations in tumours, by regulating local concentrations of active peptides at the cell surface (Kenny et al., 1989).
Another finding relevant to embryonic development, with its large scale relocation of cells, was the report that phosphoramidon, a selective inhibitor of NEP, blocked the chemotaxis of human polymorphonuclear leukocytes towards the bacterial chemotactic
11 peptide f-Met-Leu-Phe (FMLP) (Painter et al., 1988). NEP is thought to cleave and inactivate the FMLP on the surface of the leukocytes thus perpetuating the cell’s response to the chemoattractant. Such a mechanism could play a role in the control of cell movement that occurs during embryogenesis. It has been reported (Rawlings and Barrett,
1993) that Endo-2 exhibits a significant degree of homology at its active site to members of the Astacin family of metallopeptidases. Almost all of the invertebrate, and a couple of the vertebrate members have subsequently been shown to have important developmental functions, as described below (see pg 21-22).
Increasingly, substrates for these peptidases, such as the bombesin-like peptides
(BLP’s) (King et al., 1993), and vasoactive intestinal peptide (VIP) (Gressens et al.,
1993), have been shown to play key roles during embryonic and foetal development.
1.1 Background
The following is a general introduction to the protein biochemistry, mechanisms of action, regulation, distribution, and inhibition of these enzymes. This is followed by an overview of craniofacial morphogenesis and the roles played by peptide growth factors during normal and abnormal development of the head and face.
1.2 Substrate specificity and mechanism of action of the neutral metalloendopeptidases
The discovery of enkephalinase (Malfroy et al., 1978), a cell-surface, zinc metalloendopeptidase capable of inactivation of the opioid peptide enkephalins, prompted a great deal of interest in the metalloendopeptidases. There followed a study demonstrating that inhibition of enkephalinase resulted in analgesic responses in mice
12 (Roques et ah, 1980). It then became apparent that enkephalinase was in fact identical
to a previously well-characterised enzyme, neutral endopeptidase (E.C.3.4.24.11),
localised on the brush border epithelium lining the proximal tubules of the kidney (Kerr
and Kenny, 1974 a,b).
It is currently believed that peptides in both nervous and peripheral sites are
degraded extracellularly by a limited number of enzymes with relatively diverse substrate
specificities. Most of these enzymes are ectoenzymes, i.e. integral membrane proteins
with active sites facing the extracellular space.
NEP and Endo-2 are both glycosylated zinc-containing metalloendopeptidases,
inhibited by non-specific metal chelators, such as ethylenediaminetetraacetic acid (EDTA)
(Kerr and Kenny, 1974a,b). These enzymes are members of a large group which also
comprises aminopeptidase N, carboxypeptidases A, B, and E, angiotensin-converting
enzyme (ACE), collagenases and the bacterial endopeptidase thermolysin (reviewed by
Vallee and Auld, 1990). As can be seen from Fig. 1.1, the metallopeptidases constitute
an extremely diverse range of enzymes, which can be subdivided into evolutionarily
conserved groups (Rawlings and Barrett, 1993).
Hydrolysis of a peptide bond by these enzymes can be broken down into three
stages:- (i) The oxygen of the substrate bond to be cleaved (the scissile bond) becomes coordinated to the zinc atom in the active site of the enzyme, (ii) A glutamate-promoted nucleophilic attack by a water molecule on the carbonyl carbon which had been polarised by the zinc atom, (iii) The protonation of the nitrogen of the scissle bond, leading to cleavage of the weakened bond between the tetrahedral carbon and the protonated nitrogen atom, with subsequent release of the two peptide fragments. When the enzyme in question is an exopeptidase, for instance an aminopeptidase or carboxypeptidase, only
13 a single amino acid is cleaved from the original substrate.
NEP specifically cleaves peptide bonds on the amino side of hydrophobic amino acid residues (Erdos and Skidgel, 1989), within a wide variety of substrates, including cyclic peptides such as atrial natriuretic peptide (ANP) (Stephenson and Kenny, 1987a) and short linear peptides such as endothelin-1 (Fagny et al., 1991), substance P and the neurokinins (Stephenson and Kenny, 1987b), peptide-YY (Medeiros and Turner, 1994), gastrin and cholecystokinin (Matsas et al., 1984), neurotensin (Checler et al., 1983), as well as longer polypeptides such as the cytokines interleukin-la (IL-la; Pierart et al.,
1988) and interleukin-18 (Delikat et ah, 1994). A full list of known NEP substrates is presented in Table 1.
Endo-2 generally cleaves peptide bonds between the carboxyl group of aromatic residues. The preference of Endo-2 is for longer peptides and even some proteins including parathyroid hormone (Yamaguchi et al., 1994) and transforming growth factor
OL (Choudry and Kenny, 1991), although some smaller peptides are also attacked including a-melanocyte stimulating hormone (personal communication from Dr R. L.
Wolz), and luteinizing-hormone-releasing-hormone (Kenny and Ingram, 1987). A full list of the known substrates for Endo-2 is presented in Table 2.
Since these enzymes are capable of hydrolysing peptides that transmit signals after binding to specific cell-surface receptors, it is possible that prolonged inhibition of these enzymes might result in decreased peptide secretion or down-regulation of the appropriate peptide receptor (Salles et a l, 1993).
14 Peptidases and Proteases
Serine peptidases Cysteine peptidases M etallo-peptidases Aspartic peptidases
HXXEH HXXE HXH HEXXH
HEXXHXXGXXH HEXXH Metzincins I Thermolysin Al.anyl am inopeptidase Serralysins Matrixins Astacins Reprolysins Peptidyl-dipeptidase A Astacin Thimet oligopeptidase Toiioid Mycolysin BMP 1 Autolysin Meprin/Endo-2 NEP PABA-peptide hydrolase Streptomyces small neutral protease SpAN Leishmanolysin UVS 2 Microbial coliageriase B P 1 0 Neurotensin cleaving enzyme HCE/LCE Endothelin converting enzyme Fig. 1.1 The Metallo-l’eptidase Family
Key; H = Histiciinc. E = Gluianiic Aciil. G = Glyciiic. .X = Aiiy amino acid
The metailo-pep(i(lnses have tradilioiially heeu suh-divicieci into dilferciil groups based upon their ealalytic domains. In die HEX XH group, the two histidine residues are zinc ligands and the glutamic acid residue is involved in catalysis. The third histidine residue shown in the active site of the metzincins is also a zinc ligand. The HEXXH enzymes listed together with NEP are all gluzincins " or elosely related enzymes. These enzymes lack a conserved glycine residue, although they do possess n glutamic acid residue (not shown here) which is C- terminal to the HEXXH motif, and this acts as a third zinc liuand TABLE 1.1
SUBSTRATES OF NEUTRAL ENDOPEPTIDASE-24.11
* Angiotensin I
*Atrial Natriuretic Peptide (ANP)
*Bombesin-like peptides (Gastrin-releasing peptide)
*Bradykinin
Calcitonin gene-related peptide (CGRP)
Cholecystokinin-8
Dynorphins
Endorphins
♦Enkephalins
♦Endothelin-1
♦fMet-Leu-Phe (fMLP)
Gastrin
Insulin B chain
Interleukin la (IL-la)
Interleukin 1/3 (IL-lj8)
Neurokinins A and B
Neurotensin
Oxytocin
Peptide-YY
♦Substance P
♦Vasoactive Intestinal Peptide (VIP)
♦Shown to be physiological substrates
16 TABLE 1.2
SUBSTRATES OF ENDOPEPTIDASE-24.18
* Angiotensin I
* Angiotensin II
Azocasein
♦Bradykinin
*Luteinizing-hormone-releasing hormone (LHRH)
Melanocyte-stimulating factor a
Neurotensin
^Neuropeptide Y
^Parathyroid hormone
♦Substance P
Transforming growth factor a (TGFa)
♦Shown to be physiological substrates
17 1.3 PROTEIN STRUCTURE AND MOLECULAR GENETICS
1.3.1 NEP
The primary sequence of rat and rabbit NEP was determined almost simultaneously by the groups led by Malfroy (Malfroy et ah, 1987), and by Crine,
(Devault et ah, 1987). The rat enzyme comprises 742 amino acids with six N- glycosylation sites and 6 disulphide bridges, and has a molecular weight of 94 kDa.
These glycosylation sites have been suggested to play a role in intracellular transportation of NEP to the cell surface (Lafrance et al., 1994). NEP is a type II integral membrane protein whose active site is exposed at the extracellular surface, i.e. it is an ectoenzyme.
It has a short (27-residue) amino terminal cytoplasmic domain, followed by a 23-residue hydrophobic domain, anchoring the enzyme in the plasma membrane, and a comparatively long (692-residue) extracellular domain containing the active site. Although
NEP does not share a great deal of sequence homology with other zinc-dependent peptidases, the active site sequence His-Glu-X-X-His is present in the active site of thermolysin, angiotensin-converting enzyme (ACE), thimet oligopeptidase
(E.G.3.4.24.15), neurotensin-degrading enzyme (E.G.3.4.24.16) and aminopeptidase A.
When the cDNA sequences of the rat and rabbit enzymes are compared, it becomes apparent that NEP is very highly conserved, being 93% homologous. This becomes even more apparent when the rat sequence is compared with that of human NEP (Malfroy et ah, 1988), with only six non-conservative changes present between the two enzymes.
Human NEP is identical to common acute lymphoblastic leukaemia antigen
(GALLA) or GDIO (Letarte et al., 1988; Shippet al., 1989). G ALLA is expressed on the blast cells of most acute lymphoblastic leukaemias and by other lymphoid malignancies with an immature phenotype, as well as being a differentiation marker for
18 B lymphocyte progenitor cells in haematopoietic tissues (Hokland et ah, 1983). Recently
CALLA has also been detected on small cell carcinomas of the lung (Shipp et al., 1991) and hepatocellular carcinomas (Dragovic et a l, 1994).
The chromosomal location of the NEP gene has been mapped to the proximal half of chromosome 3 in both mouse and man (Barker et at., 1989; Chenet at., 1992), and both gene structures have been defined using restriction and sequence analysis. It spans more than 80 kb and is composed of 24 miniexons separated by introns which vary in length from 106-13500 base pairs. Exons 1 and 2 encode 5’ untranslated sequences, exon
3 encodes the initiation site, the cytoplasmic, and transmembrane domain, exons 4-23 encode the majority of the extracellular domain and exon 24 encodes for the carboxyl- terminal 32 amino acids of the protein and includes the entire 3’ untranslated region.
To date, six alternative splice variants have been identified in humans (D’Adamio et ah, 1989; Mari et ah, 1992; lijima et ah, 1992) and one in rat (Llorens-Cortes et ah,
1990). Alternatively spliced 5’ untranslated regions on each individual messenger RNA
(mRNA) encoding the same NEP protein might affect the mRNA translation rate or stability and ultimately NEP protein expression. The substantial conservation of 5’ untranslated regions between different species and the existence of 5’ alternative splicing suggest that NEP gene expression may be differentially controlled in a tissue-specific and/or developmentally-regulated fashion.
1.3.2 Endo-2
Endo-2 was first isolated as an azocasein-degrading activity from mouse kidney
(Beynon et ah, 1981). A few years later, an ectoenzyme was isolated from the rat
19 kidney, called endopeptidase-2, which was similar both structurally and in terms of substrate specificity to meprin (Kenny and Ingram., 1987). Endo-2 is inhibited by metal chelators such as EDTA, but not by phosphoramidon, and the enzyme appears to have a preference for extended peptide substrates listed in Table 2.
Rat Endo-2 is currently thought to exist in vivo as covalently-linked heterodimers
(«2 and ajS) which associate non-covalently with (ajS) dimers to form tetramers
(Marchand et al., 1994). The a subunit is secreted in a soluble form anchored to the plasma membrane by the /? subunit (Corbeil et a l, 1993). Both subunits were originally believed to be type II integral membrane proteins with an extracellular catalytic domain, but recent studies have demonstrated that in the mouse enzyme this is true only for the
|8 subunit. The a subunit undergoes post-translational proteolytic cleavage (putatively mediated by furin, personnel communication from Prof Phillipe Crine, Montreal) resulting in the removal of the carboxy-terminal hydrophobic sequence (Marchand et a l ,
1994). Both the rata and fi subunits have been cloned and the cDNA sequenced (Corbeil et a l, 1992; Johnson and Hersh, 1992).
The chromosomal locations of the a and fi subunits of meprin are known (personal communication from Dr J.Bond). The a subunit is on the long arm of chromosome 17 in the mouse, and on the short arm of chromosome 6 in the human, whilst the fi subunit is on the longer arm of chromosome 18 of both mouse and human.
Both the rat Endo-2 subunits contain an epidermal growth factor-like domain, a
177 amino acid adhesion domain, and a domain previously identified in members of the
"astacin family" of metalloendopeptidases (Dumermuth et a l, 1991). All the enzymes in this family have a zinc-binding metalloprotease domain which shares a high degree of sequence homology with the domain found in astacin (EC 3.4.24.21), a digestive tract
20 proteinase from the crayfish Astacus fluviatilis (Shimell et ah, 1991). Other diverse metalloendopeptidases attributed to this family are; N-benzoyl-L-tyrosyl-p-aminobenzoic acid hydrolase (commonly abbreviated to ’PABA’-peptide hydrolase) (Sterchi et al.,
1982) and bone morphogenetic protein-1 (BMPl), both found in humans, an as yet unnamed protein encoded by an mRNA induced by l,25-dihydroxyvitamin-D3 in the chorioallantoic membrane of quail embryos (Elaroussi and DeLuca, 1994), Oryzias latipes hatching enzyme constituent protease (Yasumasu et at., 1992), UVS.2 (in
Xenopus) (Sato and Sargent, 1990), the tolloid gene product (in Drosophila) (Finelli et al., 1994), and 5mBMP, BP 10 and SpAN protein (in sea urchin) (Hwang et al., 1994;
Lepage et al., 1992; Reynolds et al., 1992).
Several members of the astacin family have recently been shown to be involved in developmental processes; they are highly inducible and expressed during specific developmental stages (Jiang et al., 1993). Tht Drosophila dorsal-ventral patterning gene, tolloid, is only expressed dorsally at the blastoderm stage during embryogenesis and it has been proposed that tolloid is the processing enzyme for decapentaplegic, a member of the TGFjS family of growth factors also found in Drosophila (Shimell et al., 1991), just as BMPl is the processing enzyme for BMP2, another member of the TGFj8 family.
BMPl is also inducible and is thought to be involved bone formation (Wozney et al.,
1988). The transcription of the sea urchin BPIO gene is transiently activated at the 16-32 cell stage, transcription peaks at the mid-blastula stage, and is gone by hatching, a similar expression pattern to that exhibited by spAN which is spatially restricted along the animal- vegetal axis (Lepage et al., 1992; Reynolds et al., 1992).. It has been proposed that suBMP functions during sea urchin embryogenesis by processing an as yet unknown member of the TGFjS family during formation of the spicule (skeleton) (Hwang et al.,
21 1994). TheXenopus gene UVS. 2, is expressed exclusively in the anterior neural fold of the neurula during dorsoanterior development.
1.3.3 Regulation of NEP and Endo-2
A recent study (Casey et al., 1993) has shown that in human endometrial stromal cells and foreskin fibroblasts, NEP is down-regulated by transforming growth factor beta-
1 (TGFBl) in vitro. They speculated that the role of TGFBl in these cells in vivo might be to indirectly promote the synthesis of the potent vasoconstrictor endothelin-1, a substrate of NEP, by decreasing the specific activity of NEP.
It has been suggested that the role played by NEP in adult lung fibroblasts, is to hydrolyse peptide signal molecules which may mediate replication, cell movement or the synthesis of specific proteins (Kondepudi and Johnson., 1993). In this cellular environment, NEP is thought to be up-regulated by several multifunctional cytokines, including IL-la, interleukin-6 (IL-6), TGFjS, tumour necrosis factor a (TNFa), and granulocyte macrophage colony-stimulating factor (GM-CSF) via a prostaglandin- dependent secondary messenger system.
To date, no studies have been reported describing the up- or down-regulation of
Endo-2 by growth factors, cytokines or other mediators. However, the role of furin in the proteolytic processing of the Endo-2 a subunit is currently being investigated
(personal communication from Prof P. Crine). It is also believed that Endo-2 can be autoactivated by utilizing a trypsin-like enzyme (personal communication from Dr R.
Beynon).
22 1.4 Distribution of NEP
1.4.1 Expression in adult tissues
Central nervous system
NEP has been located in the CNS using quantitative autoradiography with a tritiated inhibitor pH]HACBO-Gly (pH]-N-(2RS)-3-hydroxylaminocarbonyl-2-benzyl-l- oxopropyl-glycine). This inhibitor was shown to irreversibly bind to a variety of structures in the adult rat brain. Sites of particularly strong binding were the choroid plexus, substantia nigra, caudate putamen, globus pallidus and the olfactory tubercle
(Waksman et ah, 1985). In the rat brain, NEP was immunolocalized using a *^I- radiolabelled monoclonal antibody (Pollard et a l, 1989) and its distribution was compared with that of Leu-enkephalin and substance P. The distribution of NEP on the brush-border of the porcine choroid plexus has also been demonstrated using conventional immunohistochemistry, its presence reflecting a potential role in peptide inactivation in the cerebrospinal fluid; the peptides in question are brain natriuretic peptide (BNP) and atrial natriuretic peptide (ANP) (Bourne and Kenny, 1990). The distribution of NEP mRNA in the adult rat brain has also been studied using in situ hybridization (Wilcox et al., 1989). This study will be discussed in greater detail in chapter 4.
Peripheral organs
The distribution of NEP in peripheral organs in the rat has been investigated using immunohistochemistry (Ronco et at., 1988) and autoradiographically using the radiolabelled inhibitor pH]HACBO-Gly (Salés et al., 1991). As well as being present on the brush border epithelia lining the kidney proximal tubules and intestine, NEP has been identified on the placenta, thymus, lymph nodes, epithelial lining of the male genital tract
23 and much of the respiratory tract, and also on neutrophils, chondrocytes, exocrine glands and cultured skin fibroblasts (Salés et al., 1991). CALL A, which is 94% identical to
NEP, is expressed by most of the acute lymphoblastic leukaemias and by other lymphoid cancers exhibiting an immature phenotype. It is also expressed in the normal bone marrow pre-B lymphocyte pool and stromal cells (Delikat et al., 1994) as well as on mature granulocytes in peripheral blood (LeBien and McCormack, 1989; Arock et al.,
1989).
NEP is believed to be involved in the regulation of inflammatory responses orchestrated by neutrophils (Connelly et al., 1985). Central to these responses are the roles played by the peptides, met-enkephalin, substance P, and FMLP (a bacterial chemotactic peptide), all of which can induce the aggregation and migration of neutrophils. Inhibition of NEP, using phosphoramidon and thiorphan, was found to significantly reduce the concentration of these peptides required to activate these cells
(Shipp et al., 1991). In the adult human nasal mucosa, the localization of NEP to the serous cells of the submucosal glands and the epithelium (Ohkubo et al., 1993), may reflect the presence of neuropeptide inflammatory mediators, such as substance P, CGRP and VIP. NEP has also been localised, in vitro, on neonatal rat myocytes, where it is believed to regulate the levels of substance P, neurokinin A, CGRP and bradykinin during sensory nerve-induced coronary vasodilation (Piedimonte et al., 1994).
1.4.2 Developmental expression
Since the inception of the studies reported in this thesis, a number of reports have appeared suggesting an involvement of NEP in the foetal and post-natal rat. The foetal distribution of NEP has been demonstrated autoradiographically using pH]HACBO-Gly
24 (Outriez et ah, 1992), and the distribution of NEP in the embryonic rat central nervous system has recently been examined histochemically (Back et aL, 1993). In addition, a positive distribution of the NEP protein has been shown for a limited range of selected and unrelated tissues using an immunohistochemical approach. This include: the syncytiotrophoblast layer of the human placenta; foetal rabbit, rat and human small intestinal brush border membranes and foetal calf nuchal ligament (Johnson et al., 1984;
Lecavalier et a l, 1989; Johnson et a l, 1990). It has recently been reported that NEP expression on differentiating enterocytes in the murine foetal intestine is first observed at gestational day 17 (Landry et ah, 1994). The authors suggest that NEP could function by degrading growth factors present in the amniotic fluid swallowed by the foetus in utero.
Nep has been shown to be present on the apical surface of the neuroendocrine cells in the human foetal lung, where it is believed to regulate morphogenesis driven by the BLP’s (Sunday et a l, 1992). This followed studies which suggested that the enzyme regulates BLP-mediated growth of small cell carcinomas of the lung (as well as in other bronchial epithelial malignancies, see Ganju et a l, 1994), and that BLP’s stimulate the proliferation of human foetal lung cells in vitro and normal pulmonary neuroendocrine cells (Shipp et ah, 1991). An example of the mechanism by which NEP is thought to regulate the actions of morphogenetic peptides during development is shown in Fig. 1.2.
The same group have administered an NEP inhibitor to foetal mice in utero from gestational ages E15 to E17. They found that NEP inhibition resulted in a significant increase in lung growth and maturation, determined by pH]thymidine incorporation into nuclear DNA, pHJcholine incorporation into surfactant phospholipids, electron microscopy, and Northern blot analysis for surfactant apoproteins. These effects were
25 mediated by the potentiation of endogenous BLP’s (King et ah, 1993). A more recent study has investigated the distribution and function of NEP and the BLP’s during murine lung development, specifically during branching morphogenesis. They found that inhibition of endogenous NEP using 1 /xM phosphoramidon or thiorphan, two highly selective and chemically distinct inhibitors of NEP, caused a 20% increase in epithelial branching morphogenesis (Aguayo et al., 1994).
26 nJt.-»*" rÆ I» â^FOETALlLUNG ÏPITHEÙtriT'-, '31 niniHiiiiiiijyyiiliiiiy
Fig. 1.2. The growth and differentiation of the epithelial lining of the murine lung has been shown to be controlled by the bombesin-like peptides (BLP’s), which are cleaved by NEP in vivo. The BLP’s share the spatio-temporal distribution of NEP in the foetal lung, and it has been proposed that, during normal organogenesis, NEP regulates the level of morphogenetic signals reaching their receptors on the lung epithelia (King et al. , 1993). Removal of endogenous NEP through the use of selective inhibitors, resulted in the potentiation of BLP-mediated growth. In small cell carcinoma of the lung, the normal levels of NEP are unable to cope with the abnormally high levels of BLP’s resulting in uncontrolled growth and differentiation (Shipp et al., 1991). It is proposed in this thesis, that a similar mechanism is in operation over a wide range of embryonic tissues in sites where NEP and Endo-2 are strongly localized. ______
CD 10 was originally identified as a cell surface glycoprotein on normal and malignant lymphoid progenitors that were either uncommitted or committed to only the earliest stages of B or T cell differentiation (reviewed by LeBien and McCormack, 1989).
NEP may function to regulate B-cell ontogeny in vivo by hydrolysing peptide substrates that stimulates B-cell proliferation and/or differentiation (Salles et a l, 1993). CDIO- positive lymphoid progenitors are abundant early in foetal haematopoietic development but decline in number with subsequent foetal maturation and birth (Salles et al., 1993)
Recent studies indicate that NEP also modulates the growth of lymphoid progenitors raising the possibility that the enzyme may function in a similar capacity in different
27 organs. Since NEP is predominantly expressed by early lymphoid progenitors in foetal bone marrow and by undifferentiated epithelial cells in foetal lung, there may be common regulatory elements controlling the expression of the enzyme in different tissues during foetal development. All of the studies described above have looked at the distribution of
NEP in late gestation embryonic tissues.
At these later stages, embryos have already undergone a substantial degree of morphogenesis, and this study is the first to detail the expression of the NEP protein and the distribution of NEP mRNA from comparatively early stages of post-implantation development.
1.5 Distribution of Endo-2
Endo-2 has been localised in adult rat tissues immunohistochemically using a polyclonal rabbit anti-rat antibody (Barnes et al., 1989). In the kidney the brush border epithelia lining the proximal tubules in the cortex exhibited the strongest positive staining, the glomeruli and distal tubules were negative. In the gut, the epithelial lining of the small and large intestine were found to be positive. In addition, some glandular tissues exhibited positive staining; namely, the intestinal mucous glands, the salivary, and thyroid glands. However this study failed to find any positive tissues in the brain or spinal cord.
Another study in which the distribution of Endo-2 was determined in murine tissues
(Craig et a l, 1991) revealed a significant localization in both the kidney and salivary glands. The mRNA expression in the kidney has been demonstrated (Corbeil et al., 1992) and this has been compared with that of NEP. To date, with the exception of the main paper resulting from this work, (Spencer-Dene et a l, 1994), no studies have been published which demonstrate any expression, at either the protein or mRNA level of this
28 enzyme in the embryonic rat. Indeed, the only mammalian astacin member shown to be present during mammalian embryogenesis is BMPl (Fukagawa et al., 1994).
1.6 Inhibition of the metalloendopeptidases
Several of the physiological substrates of these enzymes are known to be intrinsically involved in debilitating and even fatal diseases, including congestive heart disease, hypertension and small cell carcinoma of the lung. In most of these diseases the precise role or roles played by the enzymes have yet to be established. One way of investigating their putative physiological roles is by use of selective inhibitors. These inhibitors may, as in the case of the ACE-inhibitors, be further developed and successfully employed therapeutically. Most metalloendopeptidase inhibitors have been designed to bind or co-ordinate the catalytic metal ion, and synthetic inhibitors often comprise an anionic group attached to the rest of the molecule which has been engineered to fit precisely into the active site cleft of the enzyme.
Several recent studies have drawn attention to the putative roles played by endogenous tissue inhibitors of metalloproteinases (TIMP’s) during murine embryogenesis
(Behrendtsen et al., 1992; Apte et al., 1994). These inhibit the matrix metalloproteinases which are believed to participate in remodelling of the extracellular matrix. However, the cell-surface endopeptidases like NEP or Endo-2 are not inhibited by TIMP’s, and to date, there have been no reports of an endogenous inhibitor for either of these enzymes.
1.6.1 Inhibitors of NEP
Several different types of NEP inhibitor have been developed which can be distinguished by the functional group acting as a ligand co-ordinating the zinc ion in the active site. These functional groups are: phosphinyl; mercapto; hydroxamate; carboxyl
29 and carboxylalkyl. The two inhibitors used in this study are phosphoramidon and thiorphan. Phosphoramidon is a specific, competitive inhibitor of thermolysin, from
Streptomyces tanashiensis (Umezawa, 1972). The active sites of thermolysin and NEP are similar and because of this phosphoramidon efficiently inhibits NEP (tQ = 2nM). The phosphinyl-leucine-tryptophan dipeptide of phosphoramidon has a hydrophobic side-chain and an anionic group which co-ordinates the zinc ion in the active site. However, the recently discovered (though not yet fully characterized) endothelin-converting enzyme has also been shown to be inhibited by phosphoramidon (Opgenorth et al., 1992).
Thiorphan was the first, highly potent synthetic inhibitor of NEP (K^ = 4nM)
(Roques et al., 1980). The zinc atom is co-ordinated by a thiol group, and the dipeptide is a phenylalanine-glycine analogue. Thiorphan and the other thiol inhibitors of NEP are relatively hydrophilic and do not readily penetrate either the gastrointestinal or blood- brain barriers. However various biochemical modifications have been made to the original structure of thiorphan in an effort to improve on the specificity and efficacy of this group of inhibitors (reviewed by Roques et al., 1993). Thiorphan does not, however, inhibit endothelin-converting enzyme. This, and the fact that its main substrate is big endothelin-
1 and not endothelin-1 suggests that this particular enzyme is different from NEP, despite its sensitivity to phosphoramidon.
Examples of other types of NEP inhibitor are HACBO-Gly, an hydroxamate derivative used as a tritiated probe in localization studies (see above), and SCH 32,615 which is a carboxyl derivative developed by Schering-Plough as a long acting inhibitor in pharmacological studies (Chipkin, 1986).
The effects of NEP inhibitors are probably due to blockade of the hydrolysis of a variety of peptides; some of these peptides lower blood pressure: ANP, kinins,
30 neurotensin, enkephalins and endorphins, whereas others may increase blood pressure, among them angiotensin and endothelin-1. The potential therapeutic applications of inhibitors of NEP have been reviewed recently (Wilkins et al., 1993).
1.6.2 Inhibitors of Endo-2
To date there have been no highly selective natural or synthetic inhibitors reported for this enzyme. It is sensitive to the non-selective metallopeptidase inhibitors EDTA and
1,10-phenanthroline which reversibly chelate the zinc ion. In fact this enzyme has been described as a phosphoramidon-insensitive endopeptidase (Kenny and Ingram, 1987). The active site of this enzyme has been mapped using a series of amino acid hydroxamates
(analogues of bradykinin, one of its substrates) which co-ordinate the zinc ion (Wolz et a l, 1991).
1.7 The role of biologically active peptides and growth factors during mammalian craniofacial development.
The prevailing paradigm is that the control of embryonic growth, differentiation and morphogenesis is largely mediated by the ever-increasing number of soluble peptide morphogens described. Particular emphasis has been placed on the functions carried out by growth factors. These polypeptides bind to specific cellular receptors, and induce multiple biological responses including cellular differentiation, changes in cell movement and proliferation (reviewed by Jessell and Melton, 1992). The majority of mammalian cells secrete a variety of growth factors and respond to these signals in an autocrine or paracrine manner. Growth factors have been placed into distinct families based on their primary sequence homology and the structural similarities of the peptides (Table 3). Each
31 family may have arisen from distinct ancestral genes by duplications and subsequent divergent evolution (Pusztai et al., 1993).
The studies described below are by no means a comprehensive guide to the roles played by growth factors throughout vertebrate development. Instead, I have confined this section to those growth factors/peptide morphogens which have been shown, or suggested, to have a role during mammalian craniofacial development. Several studies have utilised organ culture systems to investigate the roles played by defined factors in isolated tissues. Represa et al., (1988) demonstrated that bombesin, PDGF and EGF were capable of inducing and sustaining otic vesicle proliferative growth and of stimulating morphogenesis. A more recent study (Frenz et a l, 1992), which utilised both immunohistochemistry and high-density organ culture demonstrated that TGFjSi was one of several morphogenetic peptides employed by otic epithelium to induce formation of its cartilaginous otic capsule.
32 TABLE 1.3
GROWTH FACTORS INVOLVED IN CRANIOFACIAL DEVELOPMENT
Epidermal growth factor family
Epidermal growth factor (EGF) (Hu et al., 1992)
Transforming growth factor-a (TGFa) (Feng et a l, 1994)
Heparin-binding growth factor family
Basic-fibroblast growth factor (bFGF) (Gonzalez et a l, 1990)
int-2 oncoprotein (FGF-3) (Wilkinson et al., 1989)
Fibroblast growth factor -8 (FGF-8) (Heikinheimo et al., 1994)
Hepatocyte growth factor (HGF) (Sonnenberg et al., 1993)
Vascular endothelial cell growth factor (VEGF) (Breier et al., 1992)
Midkine (Mitsiadis et al., 1995)
Heparin binding-growth associated molecule (pleiotrophin) (Mitsiadis et al., 1995)
Insulin-like growth factor family
Insulin-like growth factor-I (IGF-I) (Ayer-Le Lievre et al., 1991)
Insulin-like growth factor-II (IGF-II) (Ayer-Le Lievre et al., 1991)
Nerve growth factor family
Nerve growth factor (NGF) (Crowley et al., 1994)
Brain-derived neurotrophic factor (BDNF) (Jones et al., 1994)
33 Platelet-derived growth factor
Platelet-derived growth factor ol^ (Represa et a l, 1988)
Transforming growth factor-^ family
Transforming growth factor-jSi^ (TGFjSj^) (Chai et al., 1994)
Bone morphogenetic proteins 2 and 4 (BMP-2 and -4) (Francis-West et al., 1994)
Growth factors/mitogens not classified into the above families
Endothelin-1 (Kurihara et a/., 1994)
Bombesin-like peptides/Gastrin-like peptides (Represa et ah, 1988)
Bone Morphogenetic Protein-1 (BMP-1) (Fukagawa et ah, 1994)
Vasoactive Intestinal Peptide (VIP) (Gressens et ah, 1994)
34 Several studies have suggested that TGFjSi plays a significant role in cranial neural
crest cell recognition, modification of, and adhesion to, components of the extracellular
matrix during mammalian facial development (Heine et a/., 1987; Pelton et al.y 1990;
Mahmood et al., 1992)
A wide variety of growth factors have been suggested to play key roles during
craniofacial development based upon their proten and or mRNA expression patterns.
Organ culture experiments have also been incorporated in many studies in order to
investigate the effects that these peptides have during epithelial-mesenchymal interactions.
Several growth factors have been immunolocalised during early tooth development, most
notably EGF (Hu et al., 1992), TGF/Jj (Lehnert and Akhurst, 1988) and BMP-4 (Vainio
et al., 1993). The expression patterns of BMP-2 and BMP-4 in the developing chick
facial primordia have been described, and it has been proposed that they play a role in epithelial-mesenchymal interactions (Francis-West et al., 1994). A recent study has
suggested that CGRP potentiates the putative morphogenetic effect of substance P in
foetal rat proliferating tooth epithelium (Nagata et al., 1994). In addition, both TGFa
(Wilcox and Derynck, 1988), and EGF (Kronmiller et al., 1991), have been localized in
the mandibular process of the first branchial arch of murine embryos.
The putative roles played by growth factors during mammalian palatogenesis have also been well described. A variety of growth factors, TGFa, various TGF /8 isoforms, and PDGF have been shown to be present during secondary palate cell proliferation, shelf elevation, fusion and palatal osteogenesis, and the roles played by individual growth
factors have been investigated through the use of neutralizing antibodies in palate culture experiments (Dixon and Ferguson, 1992; Sharpe et al., 1992).
There is limited evidence, based upon immunohistochemical data, that hepatocyte
35 growth factor (HGF) is involved in mesenchymal-epithelial interactions in the rat embryo.
Some of the sites where HGF was localized were the submaxillary glands and the
germinal matrix of the brain (Defrances et a i, 1992). The distribution of HGF mRNA
in the rat embryo has been described, and sites where transcripts were localized included
the mesenchymal cells of the dental papillae, nasal epithelium and generally in all tissues
which differentiate via a process of branching morphogenesis (Sonnenberg et ah, 1993;
Jung et ah, 1994).
Several members of the heparin-binding growth factor family have been implicated
during craniofacial development. For example the immunohistochemical distribution of
basic fibroblast growth factor (bFGF) has been described in the foetal rat (Gonzalez et
ah, 1990). The bFGF protein was localized in the foetal rat salivary glands, teeth, buccal
mesenchyme, and various regions of the brain including the pituitary, choroid plexus and
meninges. Other members of the fibroblast growth factor family proposed to play a role
during mammalian craniofacial morphogenesis include the proto-oncogene int-2
(Wilkinson et ah, 1989) and Fgf-8 (Heikinheimo et ah, 1994). The mRNA and protein
distribution of two heparin-binding cytokines, midkine and pleiotrophin (heparin-binding
growth associated molecule) has also been recently described in the craniofacial region
of embryonic mice (Mitsiadis et ah, 1995).
Other growth factors which have been localized by in situ hybridization in the
developing mammalian craniofacial region are vascular endothelial growth factor (VEGF)
(Breier et ah, 1992) and the insulin-like growth factors IGF-I and -II (Ayer-Le Lievre
et ah, 1991). Transcripts of VEGF were detected in the choroid plexus epithelium and
the ventricular layer of the brain where it is believed to play a key role mediating the proliferation of endothelial cells and the formation of new blood vessels. IGF-I and II
36 transcripts were differentially expressed in several regions including the choroid plexus,
Rathke’s pouch, vasculature and cochlea.
Studies utilizing the whole embryo culture technique have suggested that VIP
(Gressens et al., 1993) and the neurotransmitter serotonin (Shuey et at., 1993) are able
to act as mitogens and/or morphogens during mammalian craniofacial development. A
recent study (Gressens et al., 1994) has demonstrated that VIP is essential for normal
brain development, since blockade of VIP following the administration of specific
antagonists to pregnant mice resulted in embryos with severe microcephaly.
Other studies, employing autoradiographic peptide binding, have provided some
evidence that neuropeptides, including ANP, substance P and neurotensin may play a role
during embryonic development of the rat brain (Tong and Pelletier, 1990; Quirion and
Dam, 1986; Goedert et al., 1985). More recently, the production of "knockout" mice,
in which there has been a targeted disruption of the genes which encode particular peptides and growth factors, have provided new insights into their functions during
craniofacial morphogenesis (for examples see Kurihara et al., 1994; Jones et al., 1994).
An account of the development of the mammalian craniofacial region is provided
in the appendix.
1.8 The role played by growth factors in abnormal human craniofacial
development
The roles played by growth factors and other peptide morphogens during normal
craniofacial development has already been discussed. There have been a growing number
of recent studies describing genetic evidence for the involvement of growth factors, or their receptors, in the aetiology of several human craniofacial birth defects.
37 Cleft palate is a result of the failure of the secondary palatine shelves to fuse, and
has been estimated to affect 1:2500 births, and is more prevalent in females. It has been proposed that the causes of this defect, often associated with cleft lip, are both genetic
and environmental. However, at least two recent studies have suggested that polymorphisms associated with the gene encoding for TGFa, a substrate of Endo-2, is
a risk factor for the development of both cleft lip and palate (Shiang et al., 1993; Feng
et a l, 1994).
Three syndromes characterized by craniosynostosis, the premature fusion of the
sutures in the skull, have been linked to mutations in genes encoding the fibroblast
growth factor receptors. There are four of these receptors, and they are shared by a
family of nine fibroblast growth factors. These receptors are transmembrane tyrosine
kinases. Pfeiffer syndrome has been directly linked to a mutation in the fibroblast growth
factor receptor 1 gene on chromosome 8 (Muenke et al., 1994), whilst Jackson-Weiss and
Crouzon syndromes have been linked to mutations in the fibroblast growth factor receptor
2 gene on chromosome 10 (Jabs et al., 1994).
Another molecule (though not a growth factor) which appears to be involved in abnormal craniofacial development is Msxl. This is a murine homeobox gene homologous
to the msh gene in Drosophila, and it has recently been knocked out (Satokata and Maas,
1994). All the homozygous MsxV mice died at birth and all had cleft palates, a deficiency
in the alveolar mandible and maxilla, and a failure of tooth development. In addition,
these mice exhibited abnormalities in several elements of the craniofacial skeleton. The authors of this study concluded that this transcription factor is essential for normal craniofacial development and draw parallels with the formation of cleft palate in man. It has also been proposed (Jabs et al., 1993) that a mutation in the human MSX2 gene
38 causes autosomal dominant craniosynostosis, including those syndromes also thought to involve the fibroblast growth factor receptors as described above. Other transcription factors believed to be involved during craniofacial morphogenesis include members of the
Distal-less homeobox genes. A recent study has described the expression patterns of the
murine Dlx-2 and Dlx-3 genes in the mouse embryo (Robinson and Mahon, 1994).
1.9 Hypothesis
This thesis tests the hypothesis that, the actions of cell-surface metalloendopeptidases, constitute an essential, and previously unrecognised, level of
control during postimplantation mammalian craniofacial development.
1.10 Objectives of this study
(i) Defining the spatio-temporal pattern of distribution of both NEP and Endo-2 in embryos from gestational day 10 (ElO) to E16 using conventional immunohistochemistry
(Chapter 3).
(ii) Exploring the spatio-temporal pattern of NEP gene expression using in situ hybridization (Chapter 4).
(iii) Inhibiting the actions of endogenous NEP by culturing whole E9.5 and E10.5 embryos in the presence of highly selective inhibitors. Treated embryos were examined histologically and under scanning electron microscopy (SEM), (Chapter 5).
39 CHAPTER 2
MATERIALS AND METHODS CHAPTER 2
MATERIALS AND METHODS
2.1 Animals used in this study
All tissues and embryos used in this study came from timed-mated Wistar rats supplied by Charles River UK Ltd (UK).
2.1.1 Determination of embryonic stage
Throughout this thesis, embryos have been staged according to their gestational ages. Pairs of rats were put together overnight, and the next day the presence of a vaginal plug indicated that mating had occurred. The morning of plug discovery was designated as embryonic day 0 (EO), the following day was designated E l, the next day E2, and so on.
2.1.2 Sacrificing of animals and dissection of embryos.
The adult rat was lifted out of the carrying case and placed in a lidded plastic container measuring 35cm x 20cm x 25cm. This container was gently flooded with carbon dioxide (BOC, UK) for approximately 3 min. until the rat had lost consciousness.
The anaesthetized rat was placed face-down on a clean flat surface and a clean scalpel holder placed just behind its ears was pressed down on the spine whilst the tail was
stretched simultaneously in one smooth firm motion to dislocate the spine. The rat was turned over onto its back and its fur soaked with 70% ethanol. All instruments used for dissection had been scrupulously cleaned, dipped in 70% ethanol and flamed briefly prior to use. The fur was gripped approximately half way down the abdomen with blunt
40 forceps, a U-shaped incision made (with the ends of the U at the hind legs and the apex towards the sternum) and the skin folded towards the tail. This was repeated with the muscular peritoneum exposing the intestines and uterine horns. One end of the uterus was gripped between the ovary and the first conceptus and cut between the ovary and forceps.
The uterus was lifted out of the abdominal cavity and the fat and blood vessels trimmed off with fine scissors. A cut was made through the cervix freeing the uterus, which was severed at the other ovary. The uterus was transferred into a petri dish containing sufficient sterile explant media (Hank’s buffered saline, see Table 4).
All subsequent stages of dissection took place under a dissection microscope with transillumination. The number of embryos obtained from Wistar rats varied from six to
14, with an average litter of ten Table 2.1 Constituents of Hank’s Buffered Saline viable embryos. The muscular uterine
wall overlying the conceptuses was
HANK’S BUFFERED SALINE gently tom away, with the tips of the glL NaCl 8.00 forceps being kept close together. KCl 0.40 MgSO^.VHzO 0.20 One pair of fine forceps was slid Na2HP04.2H20 0.06 KH2PO4 0.06 between the decidua and the uterine CaCl2 0.14 Glucose 2.00 wall and the decidua teased away. NaHCOs 0.35 This step was repeated until all the
decidua had been isolated and transferred into fresh medium with a plastic pasteur pipette. The soft spongy decidua were removed by inserting the tips of two pairs of watchmaker’s forceps just below the surface and gently teasing the decidua into two halves. The extraembryonic membranes, particularly the ectoplacental cone and Reichert’s membrane, give the embryo the
41 appearance of a red spindle. The embryo tended to stick closely to one half of the split decidua and was extremely delicate at this stage, therefore further dissection was carried out with fine watchmaker’s forceps.
When all embryos had been removed from their decidua they were transferred to fresh explant media and the opaque Reichert’s membrane was removed. This normally
stood clear of the underlying yolk sac at the embryonic pole of the conceptus and was gently tom and pulled away from the rest of the extraembryonic membranes using fine forceps.
The dissection procedure described above is for the isolation of E9.5 and E10.5 embryos suitable for whole embryo culture (see below). For immunohistochemistry, in situ hybridization and reverse transcriptase-PCR, the embryos used ranged from E8-E16, and all the remaining membranes, i.e. the yolk sac and amnion were removed prior to further experimental stages. The E6 l embryos were too large to do this and therefore only the head and neck regions were used.
2.1.3 Dissection of adult rat kidneys.
Following removal of the uterus, the kidneys were exposed and dissected away from the animal by severing the renal artery. After being transferred into fresh explant media, the surrounding fat and the perinephrium were cut away and the kidneys were bisected transversely.
2.2 Preparation of microvillar membranes (largely based on the protocol first described by Kerr and Kenny, 1974ab)
Twenty adult rat kidneys were dissected out as described above, and combined
42 with 2-3 volumes of 10 mM sucrose and 10 mM Tris-HCl, pH 7.5. Kidneys were then homogenized mechanically (using an Ultra-Turrax, IKA-Werk, Germany). The volume of the homogenate was measured and magnesium chloride added to give a final concentration of 10 mM. The homogenate was placed on ice for 15 min and stirred every
5 min.
The homogenate was sedimented at 4000 rpm at 4°C in an SS-34 rotor using a refrigerated centrifuge (Sorvall RC-5B, Du Pont Instruments, UK). The supernatant was transferred into a fresh tube and sedimented at 130CX) rpm at 4°C for 12 min.
The pale pink layer on top of the pellet was carefully transferred into a fresh tube using a pasteur pipette. This layer was resuspended in 10 ml of homogenate buffer
(sucrose/Tris-HCl) and magnesium chloride was added to give a final concentration of
10 mM.
This was centrifuged at 5000 rpm at 4®C for 12 min and the supernatant was transferred into a fresh tube and spun down at 13000 rpm at 4°C for 12 min. The supernatant was discarded and the pellet resuspended in 1 ml of 10 mM sodium phosphate buffer pH6 .8, 0.1% Triton X-100 and 0.1 mM phenylmethylsulphonylfluoride
(PMSF). This was then stored at -70°C.
2.2.1 Extraction of a membrane fraction from rat embryos (largely based upon the protocol described by Johnson et aL, 1990)
Thirty E14 rat embryos were dissected from uterine horns in PBS as described above. After removal of all extraembryonic membranes, the embryos were homogenized in cold (4°C) 50 mM Tris-HCl pH 6.5, which contained 0.1 mM PMSF. The same homogenizer was used as described above.
43 The homogenate was spun down for 5 min at 3000 rpm at 4°C and the supernatant transferred to a fresh tube and centrifuged at 12000 rpm (100,000 x g) for
1 hr using an ultracentrifuge (Europa 65, Kontron Instruments, UK). The membrane fraction was resuspended in 10 mM Tris-HCl, pH 7.5, which also contained 0.1 mM
PMSF, 0.1 mM pepstatin A, 0.1 mM 1,10 phenanthroline and 0.5 % Triton X-100 (to solubilize the enzymes). This was left at 4°C overnight and any insoluble material was removed by centrifugation at 120(X) rpm for 1 hr. The supernatant was transferred to a fresh tube and stored at -70°C.
2.3 Fixation of tissues
Three types of fixative were employed in this study: (i) Bouin’s fixative for the immunohistochemical localization of metallopeptidases (ii) 4% paraformaldehyde for wax histology and for the in situ hybridization detection of mRNA in frozen sections, (iii) modified Kamovsky’s fixative for scanning electron microscopy (SEM).
2.3.1 Fixation of frozen sections for inununohistochemistry:-
Bouin’s fixative
Saturated aqueous picric acid:-75ml
Formalin (40% solution of formaldehyde) : -25 ml
Glacial acetic acid:-5ml
(i) Tissue was placed in fix for 24 hr at 4°C.
(ii) Tissue was then transferred to a 20% sucrose solution made up in ^phosphate buffered saline (PBS, pH 7.4) which acts as a cryoprotectant and left at 4°C for 12-24
44 hr depending on the size of the tissue.
*PBS was either obtained as tablets from Sigma, UK, or made up as follows:- 8.7g
NaCl, 1.82g K 2HPO4.3H2O, 0.23g KH 2PO4, made up to 1 litre with dH 20 (distilled water).
2.3.2 Fixation of embryos for wax histology and in situ hybridization: 4%
Paraformaldehyde
This was made fresh, just prior to use:- 4g of paraformaldehyde (PFA) was weighed out and added to 100 ml PBS. Then the bottle was inverted several times to mix its contents and transferred to a shaking water bath set at 65°C for 2 hr or until the cloudy solution cleared. A quicker way to clear the solution was to add a few drops of
IM NaOH. Once clear the solution should be cooled to 4°C in the fridge. A 20% PFA stock solution was often prepared and stored at 4°C, and this could be used for up to 2 months. Whole embryos were fixed for 24 hr prior to further processing (see 2.4.2). For fixation steps in the in situ hybridization protocol see below.
2.3.3 Fixation of cultured embryos for scanning electron microscopy
A modification of Kamovsky’s fixative was used to fix cultured rat embryos prior to further SEM processing (Stanisstreet, 1990). This was made fresh just prior to use, and should ideally be at room temperature :-
25% Glutaraldehyde (electron microscopy grade), 5ml
0.2M Sodium cacodylate buffer, (pH 7.2), 50ml
Water, 45ml.
45 Embryos were fixed for at least 12 hr at 4°C until further processing (see 2.4.3).
2.4 Tissue processing
This section details the protocols by which the whole fixed kidneys and embryos are converted into frozen or wax sections suitable for tissue staining, immunohistochemistry or in situ hybridization.
2.4.1 Freezing tissue and cryosectioning
A small glass beaker containing isopentane (BDH, UK) was placed in a polystyrene box packed with solid carbon dioxide pellets (Distillers, UK) until the isopropanol began to turn opaque and solidify. Kidney halves or embryos were removed from cryoprotectant with forceps and dipped into the isopropanol for approximately 10 sec., after which the tissue was removed with pre-chilled forceps, transferred to a pre chilled bijoux and stored at -70 °C if not required immediately.
Clean metal chucks were, labelled and then placed either in a plastic weighing boat filled with liquid nitrogen or into solid carbon dioxide pellets. The top surface of each chuck was covered with Tissue-Tek OCT embedding fluid (Raymond Lamb, UK).
The frozen kidney or embryos were gently pushed into the OCT, oriented so that the plane of section was transverse for the kidney, and sagittal or coronal for the embryos, as the OCT solidified. The tissue almost always cut better if it had been completely covered in OCT. The chuck was transferred into its holder in a pre-chilled cryostat with the cabinet temperature set to -2 PC and the knife angle set to 15°. The cryostat used was a Model OTF (Bright, UK).
The block was trimmed to give a good smooth surface and the anti-roll bar
46 adjusted to produce wrinkle-free sections. Sections were cut at 7 /xm and thaw-mounted onto glass slides which had been pre-coated with 3-aminopropyltriethoxysilane (APES;
Sigma, UK). The protocol for coating slides is presented below (2.5)
Sections were allowed to air-dry for 30 min and labelled with an abbreviated description of the tissue and date. Sections to be used for immunohistochemistry were usually ringed with a wax pen (DAKO, UK) and stored at -70°C until required.
2.4.2 Wax embedding and sectioning
After the fixation step, embryos were washed twice for 30 min. in PBS, then in a 1:1 mix of PBS and ethanol, again for 30 min. Embryos were then taken through an ascending ethanol gradient; 70%, 85%, 95%, 1(X)%, 100%, for 30 min each step. Next followed two 30 min washes in Histoclear and then a 20 min wash in a 1:1 mixture of
Histoclear and pastillated fibrowax (Raymond Lamb formulation) in an oven set at 60°C.
Embryos were then individually transferred into a pre-warmed solid watch glass, and were covered in three changes of molten wax (20 min. per change). During the final wax incubation, embryos were orientated and when the wax had set, glasses were labelled and stored at 4°C.
Blocks were serially sectioned using a microtome (Microm, model HM330) and ribbons of sections were placed on a meniscus of water on APES-coated slides. Slides were then gently warmed until the water evaporated. The warm water helped the sections to spread and reduce creasing. Once dry, sections were de-waxed in xylene and rehydrated through a descending ethanol range, and then stained with Mayer’s haemalum and eosin as previously described (Kieman, 1981).
47 2.4.2.1 Black and white photography
Haematoxylin and eosin stained sections were photographed using an Olympus
BH-2 photo-microscope (Olympus, UK) on TMAX-KX) black and white film (Kodak,
UK). Films were developed by hand under dark-room conditions.
2.4.3 Scanning electron microscopy (SEM)
After fixation, the embryos were rinsed for 20 min. in cacodylate buffer and then taken through the dehydration scheme shown in Table 5. Embryos were then transferred in their final acetone wash, into a critical point drier (Balzer, UK). Liquid carbon dioxide
(BOC, UK) was used as the drying agent.
After they had been critical point dried the embryos were transferred onto electron
microscope stubs using watchmaker’s Table 2.2 Dehydration Schedule for SEM forceps and very fine paint brushes
SOLVEINT TIME and oriented as desired. Embryos 20% Ethanol 15 min. 50% Ethanol 15 min. were stuck onto the stubs using 70% Ethanol 15 min. 90% Ethanol 15 min. Araldite quick-drying epoxy resin. 100% Ethanol 10 min. 100% Ethanol 10 min. The mounted specimens were then 100% Ethanol 10 min. 100% Acetone 10 min. sputter-coated (Polaron, UK) with a 100% Acetone 10 min. 60:40 gold-palladium alloy. This
metal coating disperses electric charge which would normally accumulate on the specimen and also increases the emission of secondary electrons, which form the image on the screen.
Embryos were then viewed on a Cambridge Stereoscan scanning electron microscope (Cambridge Instruments, UK)
48 2.4.3.1 Black and white photography
Embryos were photographed on Ilford FP4 black and white film (Ilford, UK) and developed by hand under dark-room conditions.
2.5 Preparation of APES-coated slides.
The procedure used for the preparation of APES-coated slides is described below:-
(i) Good quality glass slides e.g. Superfrost, (BDH, UK) were soaked in 1 % Decon at
65°C for 30 min.
(ii) Slides were rinsed in tap water for 1 hr, and if for use in in situ hybridisation rinsed in DEPC-treated water for 2 x 15 min.
(iii) Slides were rinsed in ethanol for 2 x 15 min and then in acetone for 5 min.
(iv) Slides were soaked in a solution of 2% APES (Sigma, UK) in acetone for 5 min.
(v) Slides were rinsed in acetone for 2 x 5 min.
(vi) Slides were allowed to dry in a fume-hood and stored in a dust-free environment.
2.6 Immunohlstocheinlstry
In this study a variety of immunohistochemical protocols have been used to localize the two metalloendopeptidases in adult kidney and in post-implantation rat embryos from E10-E16. These include both indirect immunofluorescence and immunoperoxidase staining. Immunohistochemistry exploits the specific recognition and binding of antibodies to cellular antigens. In this study these antigens are epitopes present on the mature translated endopeptidases. Antibodies were obtained from the following sources:
(i) Rabbit anti-human enkephalinase (RARE), polyclonal, cross-reacts with the rat
49 enzyme and was supplied by Genentech, Inc., San Francisco, California, USA.
(ii) PHM-6 , a mouse anti-human CALLA, monoclonal, previously shown to cross-react with the rat enzyme (Helene et al., 1992), supplied by Prof Robert C. Atkins, Dept, of
Nephrology, Monash Medical Centre, Victoria, Australia.
(iii) R R tlSl, a rabbit anti-rat endopeptidase-2, polyclonal, previously used in immunohistochemical studies, supplied by Dr John Kenny, Dept of Biochemistry and
Molecular Biology, Leeds University, Leeds, UK.
2.6.1 Western Blotting
Kidney microvillar membranes (7 ^g of protein), and E14 rat embryo membranes
(35 fig of protein) were separated by SDS-PAGE according to Laemmli (1970). Gels consisted of a 4% stacking gel and a 7.5 % separating gel, and were of the mini-gel format (Mini-Protean II, Bio-Rad, UK).
Transfer of the proteins to nitrocellulose membrane (0.45 /xm; Schleicher and
Schuell, Germany) was carried out according to Towbin et a l, (1979) using a TE series
Transphor Electrophoresis Unit (Biotech Instruments, UK) overnight, with the current set at 20 mA. Transfer took place in a buffer containing 190 mM glycine, 25 mM Tris, 20% methanol, buffer pH was 8.3.
Residual binding sites on the nitrocellulose were blocked by incubation in PBS containing 5% foetal calf serum for 2 hr. Blots were washed in TBST (10 mM Tris, pH
8.0, 150 mM NaCl and 0.1 % Tween-20) and then incubated with either RAHE or
RRtl51 primary antibodies (diluted LKKK) in TBST plus 0.1% BSA) for 1 hr, after which blots were rinsed with dH20 and then TBST to remove residual antibody. Blots were then incubated with secondary antibody, goat anti-rabbit peroxidase-conjugate
50 (DAKO, UK; diluted 1:500 in TBST, 5% skimmed milk, 5% rat serum) for 1 hr. Blots were then rinsed and washed as before and developed using 4-chloro-1 -napthol (Sigma,
UK) as a substrate.
2.6.1.1 Controls
To establish the specificity of antibody binding both to the embryo and kidney membrane preparations, the primary antibodies were pre-incubated overnight at 4°C with either purified Endo-2 (supplied by Dr A. J. Kenny, Leeds) or purified kidney membrane preparation prior to blotting.
2.6.2 Immunohistochemical localization of N£P on cryosections of post-implantation rat embryos and adult kidney.
Pre-cut and pre-flxed frozen sections of embryos and kidney on APES-coated slides were removed from the freezer and allowed to warm to room temperature for 30 min in a dust-free environment, washed in PBS for 10 min., then incubated for 30 min. in 1 % hydrogen peroxide in methanol to quench all endogenous peroxidase present in the sections. Sections were then washed in dHzO for 5 min. and twice in PBS. The PBS was gently tipped away and the sections covered in non-immune goat serum (DAKO,
UK) diluted 1:5 in PBS and then incubated at room temperature in a humid environment for 30 min. The primary antibody, RAHE, was diluted to 1:1000 in PBS containing 0.1% bovine serum albumin (BSA, Sigma, UK). The serum was tipped off and the sections covered in the diluted RAHE and incubated at room temperature for 1 hr (or overnight at 4°C) in a humidity chamber. Sections were then washed for 2x15 min. in PBS. During these washes the secondary antibody was made up as follows:- biotinylated goat anti
51 rabbit IgG (DAKO, UK) was diluted 1:200 in PBS + 2% rat serum + 1-2 mg of "rat powder" (homogenized and freeze-dried adult rat liver). This was mixed gently for 20 min. and centrifuged to pellet the powder.
The sections were incubated with secondary antibody for 30 min. at room temperature Meanwhile the ABC kit (Avidin-Biotin Conjugate kit, DAKO, UK) was made up according to the manufacturer’s instructions. Secondary antibody was gently drained away and the sections washed for 2x10 min. in PBS followed by a 30 min. incubation with the ABC kit. Then followed 2x10 min. PBS washes and incubation with the substrate. The substrate used regularly was DAB, made up as follows:-one 10 mg
DAB tablet (Sigma, UK) was dissolved in 40 ml PBS and filtered to remove solid debris.
To this filtrate 10 ^1 of H 2O2 (30% solution. Sigma, UK) was added immediately prior to use.
Sections were incubated in the substrate until an intense brown stain was observed, and the visualization reaction was stopped by washing the sections in dH 20 for 5 min. and the sections counterstained (see below), dehydrated through an ascending ethanol series and xylene, mounted with an organic mountant, DPX (BDH, UK).
When PHM-6 was used instead of RAHE the primary antibody dilution was
1:250, and the secondary antibody used was biotinylated goat anti-mouse IgG (DAKO,
UK).
2.6.3 Immunohistochemical localization of Endo-2 on cryosections of postimplantation rat embryos and adult kidney.
The primary antibody used was RRtl51 diluted 1:100 in PBS/0.1% BSA. The secondary antibody used was the same biotinylated goat anti-rabbit IgG and the protocol
52 was as described previously (2.6.2), However, an alternative secondary antibody, rhodamine-conjugated goat anti-rabbit IgG (DAKO, UK) was used in some experiments, with equivalent results. When an immunofluorescence strategy was implemented there was no requirement for counterstaining nor dehydration, and the mountant used was
Citifluor (Citifluor, UK).
Immunofluorescence often appeared to give greater sensitivity and the results could be observed and interpreted more rapidly than with immunoperoxidase staining, but did not give a permanent preparation due to quenching of the fluorescence.
2.6.4 Enhancement of DAB
The positive DAB stain could be intensified by the addition of nickel ions. Often this enhancement was necessary to increase contrast for photographic reasons or to improve the sensitivity of the immunoperoxidase staining. The protocol used is detailed below
Following incubation with the ABC kit sections were washed twice for 10 min in
0. IM sodium acetate (pH 6.0), then they were incubated in a glucose oxidase-DAB-nickel solution, made up as follows:
2.5g ammonium nickel sulphate was dissolved in 50 ml of 0.2M sodium acetate (pH 6 ) and 10 mg DAB-tetrahydrochloride was dissolved in 50 ml dH 20. Both solutions were filtered and mixed together immediately prior to use and then 200 mg D-glucose, 40 mg ammonium chloride and 1-1.5 mg glucose oxidase were added. Sections were incubated in this solution for 10-15 min. or until a blue/black reaction product could be seen. Then followed 2x10 min. washes in O.IM sodium acetate (pH 6 ), and sections were counterstained with a 0.5% aqueous solution of Fast Red, rinsed briefly in tap water,
53 dehydrated, and mounted in DPX.
2.6.5 Controls used for immunohistochemistry
A variety of controls were routinely incorporated into every immunohistochemistry experiment. These controls were implemented to confirm that any positive staining was due to the specific association of antibody and antigen. Controls were either positive or negative. The positive control used throughout were sections from a tissue in which the antigens of interest are highly abundant, the adult rat kidney. This control was used to establish that the antibodies and other reagents were in good working order, particularly if the staining in the experimental tissues was very weak or completely negative.
Negative controls could be divided into two types. Firstly, the substitution of one of the steps in the protocol with PBS, specifically the replacement of the primary or secondary antibody, or the hydrogen peroxide step. Positive staining with no primary antibody would indicate either non-specific binding of the secondary antibody to the rat tissue or incomplete blocking of the endogenous peroxidase present in the tissue. Positive staining in the absence of the secondary antibody would suggest non-specific insufficiently blocked endogenous peroxidase. The distribution of endogenous peroxidase in tissue sections was demonstrated by leaving out the incubation in methanolic hydrogen peroxidase. Secondly, overnight pre-incubation of the primary antibody with an excess of purified antigen. In this case the antigen should have saturated all the available antibody binding sites resulting in a negative staining pattern, strongly supporting the argument that previous positive staining patterns are genuine.
54 2.6.6 Counterstaining
Counterstaining facilitates the interpretation of positive immunostaining by providing a nuclear stain which contrasts with the chromogen used. Immunoperoxidase staining of the endopeptidases on the cell surface, visualized with brown DAB was counterstaining with haematoxylin which stains nuclei blue/black. This protocol is summarized below.
After washing sections in dHgO to stop the DAB chromogenic reaction, slides were dipped into filtered Mayer’s haemalum (BDH, UK) for 30-60 sec. The constituents of this have been described elsewhere (see Kieman, 1981).
Slides were then transferred into running tap water for 60 sec. to ’blue’ the sections. This step is dependent upon the water being slightly alkaline, and therefore in some regions, the pH of the water may have to be artificially raised by the addition of a few drops of ammonium hydroxide (Kieman, 1981). Sections were then dehydrated and mounted as described above.
2.6.7 Colour photography
Bright-field colour images from immunofluorescence and immunoperoxidase experiments were photographed using an Olympus BH-2 photo-microscope (Olympus,
UK) on Ektachrome 64T tungsten colour reversal film (Kodak, UK). Films were developed commercially (Brian Crisp Photographies, UK).
2.7 In Situ hybridization
The protocols used were based upon those described previously (Wilkinson and Green,
1990)
55 2.7.1 Preparation of p^S]-radioIabelled probes
The protocol used to generate sense and antisense riboprobes is presented below
2.7.1.1 Transcription
The following reagents were mixed in the order shown.
(i) 5 fi\ 5x transcription buffer (200 mM Tris-HCl, pH 8.25; 30 mM magnesium chloride; 10 mM spermidine). Spermidine helps to stabilize the polymerase/DNA interactions.
(ii) 1 /xl 0.2 M dithiothreitol (DTT) (Sigma, UK).
(iii) 1 /xl each of 2.5 mM GTP, ATP and CTP (guanosine, adenosine and cytosine triphosphate; all pH 8) (Promega, UK).
(iv) 2 /xl plasmid (pBLUESCRIPT containing cENK insert; from Genentech Inc., USA) linearized with restriction enzymes for either an antisense transcript (Cla 1 digest) or a sense transcript (Sac 1 digest). Initial DNA concentration was 4 /xg/ml.
(v) 1 /xl ribonuclease A inhibitor (’RNasin’, Promega, UK).
(vi) 10 /xl p^S]-UTP (uridine triphosphate) 1000-1500 Ci/mmol, 10 mCi/ml (Amersham,
UK)
(vii) 1 /xl T3 polymerase (for Cla 1 digest), or, T7 polymerase (for Sac 1 digest) (both
10 U//xl, both from Promega, UK). One unit (U), according to the suppliers, corresponds to "the amount of enzyme required to catalyze the incorporation of 1 nmol of nucleotide triphosphate into acid insoluble product in 60 min. at 37°C in a total volume of 50 /xl"
This mixture was incubated at 37°C for 1.5 hr, then the RNA was separated from the unincorporated nucleotides as described below.
56 2.7.1.2 In Situ riboprobe preparation using a G-50 drip column
Swollen Sephadex G-50 beads (Pharmacia, UK) were prepared by adding 100 ml of column buffer per 5 g of powder. The column buffer used contained 10 mM Tris-HCl
(pH 8), 1 mM EDTA (pH 7.5), 10 mM DTT and 0.1 % SDS. Stock solutions of EDTA,
DTT and SDS and all other solutions used for in situ hybridization were rendered RNase free by the incorporation of 0.05% diethylpyrocarbonate (DEPC; Sigma, UK) in the water used as a diluent and by autoclaving. Tris-HCl was made up with water that had been DEPC-treated and autoclaved. This Sephadex solution was shaken vigorously and left at 4°C overnight. A clear layer above the beads indicated that the beads were fully swollen.
A sterile short-form Pasteur pipette was filled with the slurry until a packed column of Sephadex had formed approximately 1 cm from the top. Column buffer was pipetted onto the top of the Pasteur to wash the column four times. Excess buffer was allowed to drain prior to the application of each wash.
The transcription reaction solution was loaded onto the top of the column followed by 3 X 150 /xl of column buffer, each aliquot was allowed to drain through before the addition of the next. The eluent was collected in an Eppendorf tube.
A series of Eppendorfs were set up in a rack, and 150 /xl of column buffer was loaded onto the column and collected in the first tube. This was called Fraction 1, and the process was repeated until at least seven fractions had been collected.
Radioactivity was determined by mixing 1 /xl of each fraction with 1.999 ml of scintillant (ICN FLOW, UK) and measuring in a scintillation counter (model 1209
RACKBETA, Pharmacia, UK). The first peak eluted (usually the third and fourth fractions) contained the probe, the second peak consisted of unincorporated nucleotides.
57 The fractions which contained the first radioactive peak were pooled and precipitated by adding 0.5 volumes of 6 M ammonium acetate (pH 5.2), and two volumes of absolute ethanol. Probes were then stored overnight at -20°C, and centrifuged at 15,000 x g for
20 min to pellet the probe. The ethanol was poured away and the pellet washed with cold
70% ethanol, briefly spun down and dried using a Speedvac (model AES 1000, Savant,
USA). The dried, pelleted probes were then resuspended in 100 mM DTT so that the final concentration was 2 x 10® *c.p.m.//-tl and stored at -20°C.
*counts per minute.
2.7.2 Pre-treatment of frozen sections
Tissue was prepared and sectioned as described above (see 2.4.1) and thaw- mounted onto APES-coated slides. Sections were removed from the freezer and allowed to warm up for 30 min. To prevent RNase contamination, slides, slide-racks and reagents were only handled with gloved hands and all glassware, slide-racks and containers had been soaked overnight in DEPC-treated water. In addition, all pipette tips and Eppendorfs used for in situ hybridization had been autoclaved and all reagents were made up using
DEPC-treated water and molecular biology grade chemicals from Sigma unless otherwise indicated.
Slides were transferred into a slide-rack and immersed in a 0.83% aqueous solution of NaCl for 5 min, and then PBS for 5 min. Sections were then post-fixed in freshly prepared 4% PEA (in PBS) for 20 min.
Sections were then washed in PBS twice, for 5 min and then laid out flat with the sections facing upwards. Sections were then covered with proteinase K (20 /xg/ml) made up in sterile TE (50 mM Tris-HCl, 5 mM EDTA, pH 8.0) for 5 min. Then washed for
58 5 min in PBS. Treatment with proteinase K facilitates penetration of the probes into the sections.
Sections were re-fixed in 4% PFA for 20 min and washed in DEPC-treated water for 5 min. Slides were then transferred in their rack into a glass container holding 250 ml of 0. IM triethanolamine hydrochloride (pH 8.0, BDH, UK) in a fume hood. The rack was placed on a Petri dish deep enough to accommodate a rapidly spinning magnetic stirring rod beneath the slides. Then 630 /xl of acetic anhydride (BDH, UK) was pipetted into the container, and the slides left for 10 min. This step blocks amino residues that might bind to the riboprobe in a non-specific manner.
After 5 min washes in PBS and then 0.83% NaCl, sections were dehydrated by immersion in 30%, 50%, 70%, 85%, 95%, 100% and 100% ethanol for 1 min each, except for the 70% ethanol wash which was for 5 min., which was to reduce salt deposits. Sections were air-dried and used the same day for hybridization.
2.7.3 Hybridization
The probe was diluted in sufficient hybridization mix (50% deionized formamide,
0.3 M NaCl, 20 mM Tris-HCl, 5 mM EDTA, 10 % dextran sulphate, 1 x *Denhardt’s solution, 0.5 mg/ml yeast RNA) to provide 10 /xl/section (less for sections of younger, smaller embryos) which corresponded to 1 x 10^ c.p.m./section. Prior to application to the sections the hybridization mix plus probe was heated to 80°C for 2 min. After application of an appropriate volume of probe mix, sections were gently overlaid with glass coverslips (22 x 50 mm, BDH, UK) avoiding air bubbles. Slides were then loaded horizontally into a plastic slide box containing tissues soaked in 50% formamide and 5
X SSC (20x SSC = 175.3 g of NaCl and 88.2 g of sodium citrate in 800 ml of dHgO.
59 The pH of this was adjusted to 7.0 using NaOH and the final volume adjusted to 1 litre.
This was then sterilized by autoclaving). The box was sealed and placed in an oven overnight at 50®C.
*This is diluted from a 50x concentrate (Sigma, UK) containing a 1 % solution of BSA,
Ficoll and polyvinylpyrrolidone in dHgO.
2.7.4 Post-hybridization washes
Slides were removed from the oven and transferred into coplin jars containing 5
X SSC and 10 mM DTT at 65°C for 30 min, to remove coverslips. Sections were then placed in a high stringency wash:- 50% formamide, 2 x SSC, 10 mM DTT, at 65°C for
30 min.
Sections were then washed in NTE buffer (0.5 M NaCl, 10 mM Tris-HCl, 5 mM EDTA, pH 8.0) at 37 °C for 3 x 10 min. This was drained off and replaced with NTE buffer containing 20 ^g/ml ribonuclease A at 37 °C for 30 min, followed by another wash in
NTE buffer at 37 ®C for 15 min.
The high stringency wash was repeated, the sections washed in 2 x SSC and then in 0.1 X SSC, for 15 min per wash at 37°C. The sections were then dehydrated by passing them through an ascending ethanol series:- 30%, 60%, 80% and 95% ethanol which all contained 0.3 M ammonium acetate, followed by two washes in 100% ethanol.
Slides were then air-dried and used the same day for autoradiography.
2.7.5 Autoradiography
An estimation of the exposure time required was made by closely apposing a sheet
60 of autoradiographic film (X-OMAT AR, Kodak, UK) over the sections overnight in a film holder, and the film was developed the following morning. The locations where the probe had bound appeared as black grains of silver on the film, and subsequent exposure time in emulsion was based upon the density of these grains.
2.7.5.1 Preparation of ILFORD K5 emulsion
Under appropriate safelight conditions, the emulsion shreds were melted at 43°C for 20-30 min using a waterbath. Approximately 6 ml was transferred into a slide mailer
(Raymond Lamb, UK) containing 6 ml of 2% glycerol in dHjO (this had been pre warmed to 43°C) and then the slide mailer was closed, wrapped in foil and inverted several times to mix the contents taking care not to create any air-bubbles.
Under safelight conditions, air bubbles were removed from the emulsion by repeatedly dipping a clean slide until an even layer of emulsion was evident.
Experimental slides were then dipped and the excess emulsion allowed to run back into the tube. Slides were placed in a light-tight, but not air-tight box. I often used a deep plastic tray lined with tissues and covered with a double layer of foil. Slides were left in this tray for two hours, then a sachet of desiccant (oven-dried silica) was added for a further two hours. Slides were then transferred into a light-tight slide box containing desiccant, the box was sealed with parafilm and stored at 4°C.
1.1.5.1 Developing emulsion
Under safelight conditions, the slides were allowed to warm to room temperature and then immersed in developer (Phenisol; Ilford, UK) for 2 min. and then in an aqueous solution of 1% glycerol/1% acetic acid for 1 min. Slides were then transferred into an
61 aqueous solution of 30% sodium thiosulphate for 2 min. There then followed a 30 min wash in running tap water, then sections were counterstained using Mayer’s haemalum, dehydrated and mounted in DPX as described above.
2.7.S.3 Colour photography
Bright-field and dark-field colour images from the in situ hybridization experiments were photographed using an Olympus BH-2 photo-microscope (Olympus,
UK) on Ektachrome 64T tungsten colour reversal film (Kodak, UK). Films were developed commercially (Brian Crisp Photographies, UK).
2.7.6 Digestion of plasmid DNA with restriction endonucleases
The plasmid containing the cENK insert was pBluescript II SK-I- (Strategene,
USA). The plasmid had to be linearized either side of the insert in the multiple cloning site to allow the synthesis of riboprobes for in situ hybridization. Using the published restriction map of this vector the two enzymes used to linearize the plasmid were Sac 1 and Cla 1, which permitted the generation of sense and antisense probes respectively. The protocol for digestion {Sac 1 is used here as an example) is presented below:-
The following were added to a sterile 1.5 ml Eppendorf
10 /xl plasmid DNA (4 /xg//xl)
1.5 /xl Sac 1 (Gibco, UK) at the start and 1.5 /xl after 30 min.
5 /xl *One-Phor-All Plus lOx reaction buffer (Gibco, UK)
32 /xl dH^O
*10x Reaction buffer components are:- 100 mM Tris-acetate (pH 7.5), 100 mM
62 magnesium acetate, 500 mM potassium acetate.
The reactions were transferred to a 37°C water bath for 1 hr, and then stored at 4°C.
2.8 Nucleic Acid Extraction
2.8.1 Extraction Protocols for plasmid DNA
Standard Mini-prep
A single bacterial colony containing the insert of interest was transferred using a flamed loop into 10 ml of 2 x YT (yeast/tryptone) medium containing ampicillin (final concentration 40 /xg/ml) in a 30 ml universal.. This medium was made as follows:- 16 g bacto-tryptone, 10 g bacto-yeast extract and 5 g NaCl were added to 900 ml of dH20 and the pH adjusted to 7.0 with NaOH. The volume was then made up to 1 litre with dHjO and autoclaved.
The universal was placed in a rotary shaker overnight at 37°C shaking at 2(X) revolutions per min (rpm). The following day if the medium appeared cloudy, 1.5 ml was transferred into an Eppendorf and spun at 13,(XX) rpm for 30 sec at 4°C using a microfuge. The clear supernatant was poured away and the bacterial pellet was resuspended by vortexing in 100 /xl of ice-cold Solution 1 (25 mM Tris-HCl (pH 8.0),
10 mM EDTA (pH 8.0) 50 mM glucose). The resuspended pellet was left on ice for 5 min, then 200 /xl of freshly prepared Solution II (0.2 M NaOH, 1 % SDS) was added and the solutions were gently mixed by inverting the tube several times. The tube was stored on ice for 5 min and then 150 /xl of ice-cold Solution III (60 ml of 5 M potassium acetate, 11.5 ml glacial acetic acid, 28.5 ml dH20) was added and the contents mixed
63 by inverting the tube several times The tube was kept on ice for 35 min and then spun at 13,000 rpm for 5 min at 4°C in a microfuge. The supernatant was transferred into a fresh tube and an equal volume of phenol : chloroform added. The tube was vortexed and spun at 13,000 rpm for 5 min at 4°C. The aqueous (top) layer was carefully transferred into a fresh tube into which was added 2 volumes of 100 % ethanol.
The DNA was allowed to precipitate overnight at -40°C and the tube was centrifuged at 13000 rpm for 20 min to pellet the DNA. The tube was gently inverted to pour away most of the ethanol and the pellet was washed in 500 /d of cold (-2CPC) 70 % ethanol, spun for 1 min at 13,000 rpm and the ethanol gently poured away. The remaining ethanol was removed and the pellet dried, using a speedvac (see above). The pellet was redissolved in 50 /zl of *TE (pH 8.0) and stored at -20C until required.
*TE is 10 mM Tris, pH 8.0, 1 mM EDTA, pH 8.0
2.8.2 Ethidium bromide/high-salt midi-prep plasmid DNA extraction protocol
This protocol was used to clean up DNA extracted from plasmids which contained impurities which subsequently interfered with restriction enzyme digestion.
The volume of the solution containing 10-250 fig of DNA was adjusted to 250 fi\ with dHgO, and 15 fii of ethidium bromide (10 mg/ml) and 140 /xl of 7.5 M ammonium acetate were added and the contents of the tube mixed by vortexing. To this solution, 420
/xl of a 5:1 mixture of phenol:chloroform was added, mixed well and spun at 13,000 rpm using a microfuge for 2 min. The aqueous phase was carefully removed and two volumes of 100 % ethanol were added and the tube was incubated at room temperature for 2 min and then spun at 13,(XX) rpm for 5 min to pellet the DNA. The pellet was washed in cold
70 % ethanol, dried in a speedvac and redissolved in TE as previously described.
64 2.8.3 Extraction of messenger RNA
Extraction of mRNA from adult rat kidney and whole Wistar rat embryos was carried out using a commercial kit (Micro-Fast Track™ mRNA Isolation Kit, Version
2.0, Invitrogen*, USA). The kit recommended starting with 10-2(X) mg of tissue per isolation. Six randomly selected embryos at E8, E9, ElO, E ll and one E14 embryo were dissected from the uterine horns of timed-mated Wistar rats (Charles River Ltd., UK) in sterile PBS, rapidly transferred into sterile 1.5 ml Eppendorfs and snap frozen in liquid nitrogen (BOC, UK).
Embryos were randomly selected from two pooled litters, after any embryos which were obviously too young, old or deformed had been removed. A kidney from one of the mothers was also removed and all fat and encapsulating connective tissue cut away.
The kidney was sliced up, and a piece weighing approximately 10 mg was snap frozen as described above.
Any components provided with commercial kits described henceforth are italicised. The Lysis Buffer was prepared by adding 20 /xl of Protein/RNase Degrader
(proprietary) to 1 ml of Stock Buffer per tissue sample. The components of the Stock
Buffer were:- 200 mM NaCl; 2(X) mM Tris pH 7.5; 1.5 mM MgCl 2‘, 2 % SDS. The Lysis
Buffer was pre-heated in a water bath to 45°C, and 1 ml was added to each tube. The tissue was then homogenized by repeatedly drawing up and expelling through an 18-21 gauge sterile needle (Becton Dickinson, Ireland) attached to a 1 ml sterile syringe (Becton
Dickinson, Ireland).
The homogenates were then incubated for 20 min in a slow-shaking water bath at 45°C. After this incubation some insoluble material was evident in the E14 and kidney preparations and the tubes were spun for 5 min at 13,000 rpm at room temperature using
65 a microfuge to pellet this material. The supernatants were transferred to a fresh tube.
The NaCl concentration of the lysates were adjusted to 0.5 M by the addition of
63 /xl of 5 M NaCl stock solution (supplied with the kit). The lysates were then mixed thoroughly and the DNA sheared by repeatedly drawing up and expelling through an 18-
21 gauge sterile needle as before.
One Oligo (dT)2o.3 o Cellulose Tablet was added to each lysate, the tube lids were closed and the tablets allowed to swell and break up for 2 min. The tubes were then gently shaken at room temperature for 20 min.
The oligo (dT) cellulose was then pelleted by spinning for 8 min at 13,000 rpm using a microfuge and the supernatant gently taken off. The oligo (dT) cellulose was then resuspended in 1.3 ml of Binding Buffer. The components of Binding Buffer were:-500 mM NaCl; 10 mM Tris-HCl, pH 7.5 (made up in DEPC-treated water). The oligo (dT) cellulose was then pelleted by spinning for 5 min at 13,000 rpm using a microfuge and the supernatant gently taken off. This process was repeated twice more and then the oligo
(dT) cellulose was resuspended in 300 /xl of Binding Buffer.
The samples were then pipetted into spin columns (supplied with the kit) which were then placed into sterile RNase-free microfuge tubes (supplied with the kit) and spun for 10 sec at 13,000 rpm to transfer the cellulose into the spin column. This step was repeated. The eluant in the tube was discarded and the columns washed by filling the spin column to the brim with Binding Buffer and spinning the tubes for 10 sec. This wash step was repeated three more times.
The non-polyadenylated RNA was removed by the addition of 200 /xl of Low Salt
Wash Buffer. This was gently mixed into the cellulose bed using a sterile pipette tip. The components of this buffer were:- 250 mM NaCl; 10 mM Tris-HCl pH 7.5 made up in
66 DEPC-treated water. The tubes were spun for 10 sec at 13,000 rpm, and this step was repeated once.
The spin column were then transferred into fresh tubes and 100 /d of Elution
Buffer was mixed into the bed and the tubes spun for 10 sec at 13,000 rpm. The eluant was retained in the tube and a second 100 /d of Elution Buffer was mixed into the bed and spun. The components of the Elution Buffer were:- 10 mM Tris-HCl pH 7.5 made up in DEPC-treated water. If there was less than 200 /d of eluant in the bottom of the tube the tubes were spun for 1 min at 13,000 rpm. The spin columns were then discarded.
The polyadenylated RNA was precipitated by the addition of 10 /xl of glycogen
(supplied as a 2 mg/ml stock made up in DEPC-treated water), 30 /xl of 2 M sodium acetate (supplied in the kit) and 600 /xl of 100 % ethanol. The mRNA was allowed to precipitate overnight at -20°C, then spun at 13,(XX) rpm at 4°C for 15 min, the ethanol was removed and the pellets washed in ice-cold 70 % ethanol. Finally the pellets were dried using a Speedvac, and resuspended in 10 /xl of DEPC-treated water.
2.8.4 Preparation of genomic DNA from rat kidney
This protocol was largely based upon one described previously (Towner, 1991).
A fresh adult rat kidney was cut into small pieces and placed in a glass tissue homogeniser which contained 10 ml of a solution containing 1% (w/v) SDS, 0.5 mg/ml proteinase K, 50 mM Tris-HCl, pH 9, 0.1 M EDTA and 0.2 M NaCl. The tissue was completely homogenised by repeatedly forcing the tissue between the walls of the glass tube and the pestle. This homogenate was transferred into a fresh tube and incubated at
55°C overnight with gentle shaking. Then, 0.1 volumes of phenol was added to the
67 homogenate, and the solution mixed gently for 3 hr at room temperature.
The solution was transferred into a fresh tube and centrifuged at 4000 x g for 10 min at 25°C. The top layer was retained and transferred into a fresh tube into which was added an equal volume of phenol-chloroform. The contents were mixed by inverting the tube several times and then centrifuged at 3000 x g for 10 min at room temperature. The lower layer was discarded and the upper aqueous layer transferred into a fresh tube and placed on ice for 5 min. The pellet was precipitated by adding 2.5 ml of 7.5 M ammonium acetate and 10 ml of chilled 100% ethanol. The white precipitate was carefully removed and washed in 70% ethanol. The pellet was dried using a Speedvac as before. The pellet was redissolved overnight in 200 /xl of TE (pH 8). Yield was assessed spectrophotometrically as described below (2.14).
2.9 Synthesis of cDNA using reverse transcriptase
Prior to PCR, the mRNA extracted above was converted into single stranded cDNA using a commercial kit (cDNA Cycle™ Kit, Version 3.1, Invitrogen*, USA).
The mRNA was removed from storage at 4°C, and 5 /xl was transferred into a sterile Eppendorf tube, and sterile water (supplied with the kit) was added to bring the total volume to 11.5 /xl.
Next, 1/xl ofRandom Primers (1 /xg//xl) was added and gently mixed using the end of the pipette tip. The tubes were then transferred into a water bath set to 65°C for 10 min, after which they were removed and left at room temperature for 2 min. The tubes were then spun at 4(XX) rpm using a microfuge for 10 sec to collect the reaction mixture.
68 The following reagents were then added to the tubes in the order listed
1/xl RNase Inhibitor
4/xl *5 X RT Buffer
1/xl 100 mM **dNTPs
1/xl 80 mM Sodium pyrophosphate
0.5 /xl ***AMV Reverse Transcriptase
*5x Buffer components:-500 mM Tris-HCl, pH 8.3 at 42°C, 200 mM potassium chloride,
50 mM magnesium chloride, ImM spermidine.
**This was a mixture containing 25 mM of each of the four 2’-deoxynucleoside-5’- triphosphates; dATP, dCTP, dGTP, dTTP.
***AMV reverse transcriptase is an RNA-dependent DNA polymerase isolated from avian myeloblastosis virus.
The tubes were lightly agitated to mix the contents, spun briefly as before and placed in a water bath set to 42°C for 60 min. They were then incubated at 95°C for 2 min to denature the RNA-cDNA hybrids. The tubes were then spun down briefly as before, then briefly placed on ice. The cDNA synthesis was repeated by adding 0.5 /xl Reverse
Transcriptase y mixing the tubes and spinning again and incubating at 42°C for a further
60 min, and then at 95®C for 3 min. The tubes were spun briefly to collect their contents and the tubes were then placed on ice immediately. The reaction product was then ready for PCR. However, if PCR is not to proceed immediately a phenol extraction and ethanol precipitation was necessary and this procedure is described below.
To each tube, 1/xl of 0.5 M EDTA and 20 /xl of phenol-chloroform (both reagents
69 were supplied with the kit) were added and the tubes vortexed then spun for 3 min at
4000 rpm using a microfuge. The top, aqueous layer was transferred into a fresh tube and
22 fil of 4 M Ammonium acetate and then 88 /d of 100 % ethanol was added to each tube. Tubes were then stored at -40°C overnight and then spun down, washed in 70 % ethanol, dried, reconstituted in 20 fcl of sterile water and stored at -2ŒC until required.
2.10 Polymerase Chain Reaction (PCR)
2.10.1 Primers
The cDNA prepared as described above was amplified by PCR using primers specifically designed to hybridize to regions of the published cDNA sequence of rat NEP.
These PCR primers were identical to those used in a previous RT-PCR study (Llorens-
Cortes et ah, 1990). The primer sequences are described below:-
SENSE G,„8GTCATCGGACATGAAATCACACA,84,
REVERSE C234,CTGTGAAGATCACCAAACCC232i
Nucleotides are numbered starting from the rat initiation codon. The SENSE primer sequence is that of the active site region in exon 19. The REVERSE primer sequence is on the complementary strand, in reverse orientation, in a region of exon 24.
These primers were synthesized by Mr Paul Rutland at the Institute of Child
Health, London and when reconstituted were both at a concentration of 1(X) ng/ml. A primer stock containing 15 picomoles of each primer in a total volume of 50 /xl was used for PCR.
70 2.10.2 PCR conditions
The PCR machine used was an Ericomp twinblock with a heated lid (Lazer, UK).
An initial cycle of 100°C for 3 min. then 72°C for 1 min. was followed by thirty five cycles of:-
96°C for 30 sec., dénaturation temperature
61°C for 30 sec., annealing temperature
72°C for 30 sec., extension temperature
This was then followed by a final cycle of 72°C for 1 min
2.10.3 PCR reaction mixture
The following regents were transferred into sterile, RNase-free 0.5 ml Eppendorf tubes in the order listed, using pipettes and tips used only for PCR.
4jnl cDNA (from 20 fi\ generated using the cDNA cycle kit, described above).
5^1 *10x PCR buffer (buffer supplied with the cDNA cycle kit).
2/xl Primers (from primer stock).
1/xl dNTP's (as used previously).
37.5 /xl RNase-free H2O
*Buffer components: - 5(X) mM potassium chloride, 25 mM magnesium chloride, 100 mM
Tris-HCl, pH 8.3 at 42°C, 0.01% gelatin.
After the contents of the tubes had cooled down from 1(X)°C to 72°C, 0.5 /xl Tag polymerase was pipetted into each tube and their lids closed. This so-called "hot-start"
71 technique was used to prevent non-specific primer hybridization prior to dénaturation of the cDNA. When all of the cycles had finished, the tubes were transferred to 4°C.
2.10.4 Quantitative determination
To determine the approximate size and relative amount of the PCR products, a 2
% agarose check gel was prepared as follows:-
0.75 g NuSieve low melting point agarose (Flowgen, UK)
0.25 g Ultrapure agarose (Life Technologies, Inc., USA) made up in 50 ml of 0.5 x *TBE buffer.
*From a 10 X stock:- Tris base, 108 g; boric acid, 55 g; 0.5 M EDTA, pH 8.0, 40 ml; water, to 1 litre.
The agarose was melted using a heated magnetic stirrer and 3 fil of ethidium bromide (10 mg/ml) were added and gently mixed into the gel by gently swirling the flask. The molten gel was poured, an appropriate comb positioned, and the gel, allowed to set for 1 hr in a fume hood.
When the gel had set, the comb was removed and 5 /xl of PCR reaction were removed and mixed with 1.5 /xl of agarose gel sample buffer (0.65 g sucrose; 0.5 mg bromophenol blue; in 10 ml TE). Each sample was then loaded into a well in the gel, and run for 1.5 hr at a voltage of 40-50 V on a small, horizontal gel electrophoresis apparatus
(model QSH, IBI, USA). A 1 kb DNA ladder (Gibco-BRL, UK) was run on every gel to aid quantitation of bands. After the gels had run, they were removed from their tanks and placed on an ultraviolet light transilluminator (model UVT 750-M, IBI, USA) and the image was recorded photographically (using a Quick Shooter, model OSP, IBI, USA)
72 onto Polaroid instant film or by a digital imaging system.
2.11 Ligation of RT-PCR products into pGEM-T vector
The pGEM*-T vector is approximately 3 kb in length and the range of vector to insert ratios used was liVa, 1:1, and 1:3. The equation used to calculate the vector:insert
TABLE 2.3 Calculation of vector and insert DNA ratios
ng of vector x kb size of insert x molar ratio of insert = ng of insert kb size of vector vector
ratio is shown in Table 2.3.
The ligation reaction was set up as shown below.
*T4 DNA ligase 10 x buffer 1 /xl pGEM*-T vector (50 ng) 1 fi\
PGR product (100 ng//xl) 0.87 /xl
T4 DNA ligase (1 Weiss mit/fd) 1 ^1 dH20 6.13 /xl
*10 X buffer components:- 300 mM Tris-HCl, pH 7.8, 100 mM magnesium chloride, 100 mM DTT, 5 mM ATP.
This reaction mixture was incubated at 15°C for 3 hr, and then heated to 72°C for
10 min and allowed to cool to room temperature. Ligations were then stored at -2(PC
73 until required for transformation into high efficiency competent cells.
2.12 Transformation of high efficiency competent cells
High efficiency XL 1-Blue competent cells (Stratagene, USA) were removed from storage at -70°C and allowed to gently thaw on ice. Cells were gently mixed by flicking the tube. A 40 /xl aliquot of cells was pipetted into pre-chilled 15 ml Falcon 2059 polypropylene tubes (Becton Dickinson, UK).
Then jS-mercaptoethanol was added to give a final concentration of 25 mM. The cells were swirled gently and placed on ice for 10 min, and mixed gently every 2 min.
After 10 min, 2 /xl of ligated PGR product and vector were added to the cells and the tubes left on ice for 30 min. Cells were then heat shocked by transferring the Falcon into a water bath set to 42°C for exactly 45 sec and then chilled on ice for 2 min.
Next, 450 /xl of SOC medium, which had been pre-heated to 42°C, were added to each tube. Tubes were then incubated on a rotary shaker at 37°C for 1 hr with a shaking speed of 240 rpm.
The constituents of SOC medium are:-
20 g tryptone, 5 g yeast extract, 0.5 g NaCl and dHgO to 900 ml. This was then autoclaved and allowed to cool. The following were then added to 100 ml of dHzO, filter sterilized and added to the autoclaved solution:- 2.03 g magnesium chloride, 1.2 g magnesium sulphate and 3.6 g glucose.
2.13 Blue/white colour screening for recombinants
After an hour, 150 /xl of transformation mixture was spread onto LB-ampicillin-
XGAL-IPTG plates. The preparation of these plates is described below.
74 2.13.1 Preparation of LB-ampicillin-XGAL-IPTG plates
The following were added to 1 litre of dHjO, and adjusted to pH 7.0 with NaOH:-
10 g tryptone, 5 g yeast extract, 10 g NaCl, 20 g bactoagar
This mixture was autoclaved and allowed to cool to approximately 55°C. A stock solution of ampicillin was made by adding 50 mg of ampicillin to 10 ml of 1 M magnesium sulphate and this was filter sterilized. Ampicillin was added to the cooled LB- agar and mixed by swirling the flask gently. This solution was then poured into sterile
Petri dishes and allowed to set in an aseptic environment for at least 45 min.
Stock solutions of XGAL and IPTG were prepared as follows:-
XGAL (5-bromo-4-chloro-3-indolyl jS-D-galactopyranoside; Promega, UK) was commercially available as a 50 mg/ml solution in N,N’dimethylformamide.
IPTG (Isopropyl jS-D-thiogalactopyranoside) was diluted in sterile dH20 to give a 0.1 M solution and filter sterilized.
Plates were spread with 20 /xl of XGAL stock, then once this had been absorbed into the agar, 1(X) /xl of IPTG solution was spread over the agar and allowed to absorb into the agar at 37°C for 30 min prior to plating cells.
These plates were incubated overnight at 37°C. The following day the plates were transferred to the fridge. White colonies were aseptically transferred into 10 ml of LB- broth containing 50 /xg/ml ampicillin (same constituents as LB-agar without the agar,
XGAL or IPTG) using a sterile loop. Tubes were placed in a rotary shaker at 200 rpm at 37°C overnight. Glycerol stocks were prepared from these cultures by the addition of
500 /xl of culture to 500 /xl of glycerol. After the contents of the tubes were mixed using a vortex, tubes were snap frozen by immersion in liquid nitrogen and stored at -70®C.
The standard miniprep protocol for plasmid DNA extraction was carried out on
75 3 ml of each of the overnight cultures (see 2.8.1). A double restriction enzyme digest was carried out on the DNA using enzymes which cut the multiple cloning site of the vector on either side of the insert. Positive clones gave two bands; the linearized vector and the insert, each of which was of the predicted size.
2.14 Extraction of DNA from an agarose slice
Following a double restriction digest {BamRl and Kpnl) of the RT-PCR preparations (20 p\) from embryonic and adult tissues were loaded onto a 1 % low melting point agarose gel made up in 0.5 x TAE buffer (pH 8.5) diluted from a 50x stock:- 242 g Tris base, 57.1 ml glacial acetic acid, 100 ml 0.5 M EDTA, pH 8.0, water to 1 litre.
The gel was run at 50 V for 2 hr, illuminated, photographed and the desired bands carefully excised using a sterile razor blade and transferred into a sterile Eppendorf.
Tubes were weighed and 3 x volume: weight of sterile water added to the agarose.
Tubes were placed in a heating block set at 65°C to melt the agarose. Once molten, an equal volume of phenol was added and the contents of the tubes mixed by vortexing.
Tubes were then spun at 13,0(X) rpm for 5 min at room temperature using a microfuge.
The top aqueous layer and the white precipitated agarose layer were transferred into a fresh tube and an equal volume of phenol added, mixed and spun as above. The top aqueous layer was transferred into a fresh tube and an equal volume of chloroform added, mixed and spun as above. This step was repeated twice more.
The DNA was precipitated by the addition of an equal volume of absolute ethanol and a tenth volume of 3 M sodium acetate, followed by an overnight incubation at -20°C.
The tubes were then spun at 13,000 rpm for 20 min at room temperature. The ethanol was tipped away and the pellet washed with ice-cold 70 % ethanol, briefly spun and dried
76 using a Speed vac. The pellet was redissolved in 20 /d of sterile water, and 2 /xl of this was run on a 1 % agarose check gel.
2.15 Sequencing
The dideoxy (or chain termination) method of sequencing was adopted in this study. A commercial kit (Sequenase* Version 2.0; United States Biochemical, USA) was used to sequence double-stranded DNA inserts cloned into the pGEM*-T vector (as described above, see 2.11).
Sequencing from double-stranded DNA using this kit (which was designed primarily for single-stranded plasmid DNA) required initial modifications to the protocols provided. Sequenase* is a genetically engineered form of bacteriophage T7 DNA polymerase. The full protocol used is described below.
The annealing step is immediately followed by a labelling/extension step which utilizes radiolabelled dATP and limiting concentrations of the other dNTP’s. This step was followed by a termination step in which all four dNTP’s and a specific dideoxyNTP were added to each reaction.
2.15.1 Alkaline dénaturation of double-stranded plasmid DNA
Firstly the double-stranded plasmid DNA prepared as minipreps from the positive clones (see above) was alkaline-denatured. After the concentration of DNA had been assessed spectrophotometrically, 5 /xg of DNA was mixed with 0.2 M sodium hydroxide and 0.2 mM EDTA in an Eppendorf for 30 min at 37°C. This was neutralized by the addition of 0.1 volumes of 3M sodium acetate (pH 5.0). The template was co-precipitated with 1/xl the sequencing primer (concentrations of primers were 100 ng//xl for NEP
77 primers and 3 ngZ/^l for the M13 universal primer) overnight with 2 volumes of 100 % ethanol at -70°C. The pellet was then spun down, washed in 70 % ethanol and dried in a Speedvac.
2.15.2 Annealing template and primer
The pellet was reconstituted in 7 /il of dH20 and 2 /il of 5x Sequenase* reaction buffer. Buffer components were:- 200 mM Tris-HCl, pH 7.5, 100 mM magnesium chloride, 250 mM NaCl. The tube was then warmed to 37°C for 30 min in a water bath and then placed on ice. The template:primer conjugate was used within 4 hr.
2.15.3 Labelling reaction
Prior to labelling, 2.5 /il of the dideoxyGTP (ddGTP) Termination mix were placed in an Eppendorf labelled G, and tubes labelled A, T, and C received 2.5 /il of ddATP, ddTTP and ddCTP Termination mixes respectively. The ddNTP termination mixes contain 80 /iM each of the four dNTP’s, 8/iM of the particular ddNTP, and 50 mM NaCl.
A 1:5 dilution (in dHgO) of the dGTP labelling mix was made and kept on ice.
The components of this 5x mix were:- 7.5 /iM dGTP, 7.5 /iM dCTP, 7.5 /iM dlT'P.
A 1:8 dilution of the Sequenase* enzyme in ice-cold Enzyme Dilution buffer was made < 60 min. The components of this buffer were:- 10 mM Tris-HCl, pH 7.5, 5 mM
DTT, 0.5 mg/ml BSA.
78 The following reagents were added to the annealed template:primer in the order indicated
10 fjL\ template-primer
lpt1 DTT, 0.1 M
2 ^1 diluted labelling mix
0.5 fil p^SJdATP (10 fiCi/fil)
2 /xl diluted Sequenase* enzyme
The contents of the tube were mixed thoroughly and incubated for 5 min at room temperature.
2.15.4 Termination reactions
The tubes labelled G, A, T, and C prepared prior to the labelling reaction were placed at 37°C for 2 min, and 3.5 /xl of the labelling reaction transferred into each of these four tubes, mixed and incubated at 37°C for 15 min. Next 4 /xl of *Stop solution was added to each of the termination reactions, mixed and stored on ice until ready to load onto the gel, which should be within 7 days if reactions have been stored at -20°C.
♦components of this solution:- 95 % formamide, 20 mM EDTA, 0.05 % Bromophenol
Blue, 0.05 % xylene cyanol FF.
When the gel was ready to load, the reaction mixtures were placed at 80°C for 2 min and loaded immediately onto the gel.
2.16 Denaturing gel electrophoresis
Glass plates were scrupulously cleaned with hot soapy water, dIÎ20 twice, ethanol, silane (in a fume hood) and ethanol again. Silane was only applied to one of the plates.
79 The gel apparatus employed was a 21 x 50 cm, Sequi-Gen (Bio-Rad, UK) and a 48-well shark’s tooth comb was used.
A 6% acrylamide gel solution was prepared using ready-prepared *SequaGel reagents (National Diagnostics, UK). For 50 ml of solution the following reagents were used:-
12 ml SequaGel Concentrate, 33 ml SequaGel Diluent, 5 ml SequaGel Buffer, 400 /xl of
10% (w/v) ammonium persulphate (Sigma, UK), 20 /il of TEMED (N,N,N’,N’-
Tetramethylethylenediamine; Sigma, UK).
*Constituents of SequaGel reagents:-
SequaGel Concentrate/L:- 237.5 g acrylamide, 12.5 g methylene bisacrylamide, 500 g urea.
SequaGel Diluent/L:- 500 g urea.
SequaGel Buffer:- 50 % urea (8.3 M) in 10 x TBE.
The TEMED and ammonium persulphate were added and mixed just prior to pouring the gel. The gel mixture was kept on ice to slow polymerization. The plates were assembled, and their edges double sealed with waterproof tape. The gel mixture was taken up into a 50 ml syringe (Becton Dickinson, UK), the plates held at an angle. The comb was inserted between the plates and the gel slowly poured in avoiding air bubbles.
The gel was allowed to set overnight.
The apparatus was assembled and the upper and lower buffer chambers filled with
TBE. The gel was pre-run for 30 min at 65 Watts until the gel temperature reached 50°C.
The wells were flushed out with TBE to remove urea, and then 4 /xl of each reaction mixture loaded onto the gel.
80 The gel was then run for approximately 4-6 hr or until the second dye front, the xylene cyanol, was a few centimetres from the bottom of the gel. The power supply was turned off and the apparatus dismantled.
2.17 Gel drying and autoradiography
The silanized glass plate was removed and a sheet of filter paper carefully rolled onto the gel in one smooth motion avoiding air-bubbles. Once overlying the gel, the paper was pressed down gently and then lifted off the glass plate taking the gel with it.
The gel was transferred into a pre-heated gel dryer (model 583; Bio-Rad, UK) and dried for 2 hr under vacuum. Once dry, the gel was closely apposed to a sheet of autoradiographic film (Kodak X-OMAT AR; Sigma, UK) inside an exposure cassette with an intensifying screen. This took place in a darkroom. The cassette was closed and stored away from strong light sources for 4 days. The film was developed using an automatic
X-ray film processor (model RG II, Fuji, Japan).
2.18 Whole Embryo Culture
Timed-mated Wistar rats were sacrificed and embryos dissected out as described above (2.1.2). Embryos at E9.5 and E10.5 were retained following the removal of the decidua and Reichert’s membrane, leaving their amnion, ectoplacental cone and yolk sac intact.
Embryos were then transferred into sterile universals (Sterilin, UK), which contained 1 ml per E9.5 embryo, and 2 ml per E10.5 embryo, of immediately-centrifuged rat serum diluted 3:1 with sterile Hank’s buffered saline. A maximum of five E9.5 or three E10.5 embryos were used per tube. Serum was prepared according to an established
81 protocol (Cockcroft, 1990), and supplied commercially by Harlan Olac, UK.
The universals were transferred into a temperature-controlled rotating incubator
(as described previously; Cockcroft, 1990), at 37°C, and universals were rotated at 30 revolutions per min. Embryos at B9.5 when culture commenced, received an initial gas
mixture of 5 % O2, 5% CO2 and the balance N 2. After 25 hr, the O2 concentration was increased to 20%, and after 44 hr to 40%. Embryos at E10.5 received an initial gas mixture of 20% O2. After 21 hr this was increased to 40%, and, after 29 hr, to 95%.
E9.5 embryos were cultured for 48 hr, and E10.5 embryos for 45 hr. This optimal gassing regime comes from Cockcroft, 1990.
Universals containing embryos were gassed as follows:- a sterile pipette was attached to tubing from the gas cylinder and pressure released to give a gentle flow of gas. Universals were removed from the incubator, the lids unscrewed and the tip of the pipette was held a few centimetres from the serum for 2 min, and then returned to the incubator. All gas mixtures were supplied by HOC, UK.
After culture all embryos were assessed for abnormalities and fixed for scanning electron microscopy (2.3.3, 2.4.3) or wax embedding (2.3.2, 2.4.2).
2.18.1 Inhibitor Treatment
Two highly selective inhibitors of NEP were used in these culture experiments.
The first of these was phosphoramidon (N-(L-rhamnopyranosyloxyhydroxyphosphinyl)-L- leucyl-L-tryptophan; Sigma, UK), a natural microbial product which was dissolved in dH20 to give a 1 mM stock. This stock was diluted in the serum mixture to give a final concentration range of 10 nM to 100 /xM. Control embryos were cultured in the diluted rat serum only.
82 The second inhibitor was a synthetic thiol compound, thiorphan (DL-3-mercapto-
2-benzylpropanoylglycine; Sigma, UK). This was dissolved in 3% ethanol in dH20 to give a 1 mM stock. The final inhibitor concentrations were the same as for phosphoramidon. Control embryos were cultured in diluted serum both with and without
3% ethanol.
2.18.2 Assessment of Normality
After the culture period, all embryos from each universal were examined using a dissection microscope and the following eight criteria were assessed
(i) Yolk sac diameter measured as mm ± s.d.
(ii) Crown-rump length measured as mm ± s.d.
(iii) Turning measured as percentage of embryos fully turned
(iv) Somite number ± s.d.
(v) Heart beat measured as percentage of embryos with a visibly beating heart
(vi) Yolk sac circulation measured as percentage of embryos with a visible circulation
(vii) ^Presence of a visible craniofacial defect
(viii) Severity of defect measured on a scale of - to 4-4-4-, where - equates to no visible defect, and -H -h 4- to grossly abnormal appearance, including open cranial folds, clearly discernible haematoma and dysmorphic branchial arches.
*Any embryo which did not appear to have a normal head and/or face, compared with the controls, was scored as having a craniofacial defect.
83 CHAPTER 3
IMMUNOHISTOCHEMICAL LOCALIZATION OF NEP AND ENDO-2 CHAPTER 3
IMMUNOHISTOCHEMICAL LOCALIZATION OF
NEP AND ENDO-2
3.1 INTRODUCTION
The first test of the hypothesis that cell-surface metalloendopeptidases are involved during rat craniofacial development is to determine if they are present in embryos and to establish their spatio-temporal localization.
To date there have not been any published, comprehensive immunohistochemical studies describing the distribution of, and roles played by these enzymes during embryogenesis. To date, only Dutriez et al., (1992) have examined the distribution of
NEP in the whole rat embryo during pre- and post-natal development. However, their data was based solely upon the binding of a tritiated, selective inhibitor of NEP to localise the enzyme. Whilst they argue that autoradiography is a sensitive and accurate means of localising NEP on frozen tissue sections, their interpretation of the results presented in their paper appears to be very subjective and much of the subtlety seen when a specific antibody is used, was lost. The authors suggested that the distribution of NEP reflected the progressive involvement of the enzyme in adult physiological functions but they do not address the possibility that the presence of the enzyme in mammalian embryos might reflect previously unrecognised specific developmental functions.
84 The few published immunohistochemical studies in which a distribution the NEP in embryos has been described, have focused on specific organs or tissues. These include the nuchal ligament from foetal calves, enterocyte development in the murine gut, and branching morphogenesis in murine lungs (Johnson et a l, 1990; Landry et ah, 1994;
Aguayo et al., 1994). These studies have all concentrated on individual organs and tissues from comparatively late, foetal, stages of development. The data presented in this thesis therefore, represents the first immunohistochemical demonstration of NEP distribution, in rat embryos at relatively early stages of postimplantation development.
This study described in this thesis is also the first to describe the distribution of
Endo-2, meprin or PABA-peptide hydrolase (i.e. EC 3.4.24.18), a member of the
Astacin family of peptidases, in the mammalian embryo. Almost all of the Astacins identified so far have a been shown to play a key developmental function suggesting that
Endo-2 might also have a developmental role.
3.2 MATERIALS AND METHODS
Membranes were prepared from homogenates of adult rat kidney and E14 embryos. Membranes were solubilised in SDS-PAGE sample buffer and the proteins separated by SDS-PAGE using an established method (Laemmli, 1970). Proteins were blotted onto nitrocellulose and polyclonal antibodies raised against the mature human kidney NEP and rat Endo-2 were incubated with the membrane blot, again using established protocols (Towbin et a l, 1979).
Post-implantation rat embryos at gestational stages 10, 12, 14 and 16, and adult rat kidneys, were removed from timed-mated Wistar rats as described earlier in the
Materials and Methods chapter (2.1.2,2.1.3). At least ten embryos were used from each
85 gestational stage. Tissues were fixed in paraformaldehyde, cryoprotected and sections cut from the frozen material (2.3,2.4). Sections were thaw-mounted onto APES-coated glass slides.
Prior to the immunohistochemistry, Western blotting was carried out on adult and embryonic membrane preparations (see 2.2,2.2.1 and 2.6.1). This served two purposes, firstly to test whether the antibodies would cross-react with recognise the rat enzymes (as both PHM-6 and RAHE were raised against human NEP), and to confirm that staining observed either on the blots, or subsequently on sections was due to specific antibody binding. The latter was achieved by pre-incubating the primary antibodies with membrane preparations containing NEP or with purified Endo-2 as described above. Of the two antibodies raised against NEP, only RAHE was used for the Western blotting studies, whilst both RAHE and PHM-6 were used for the immunohistochemical localizations.
The sections were taken through the immunohistochemical protocols described above
(2.6). The RRtl51 antibody was visualized using both immunofluorescence and immunoperoxidase staining, whilst PHM-6 and RAHE were visualized using an immunoperoxidase procedure. Where necessary {i.e. when using ElO and E12 embryos), the brown DAB staining was enhanced using nickel chloride.
86 3.3 RESULTS
3.3.1 Western Blots
Following overnight incubation of both primary antibodies with the kidney microvillar membrane preparation or incubation of RRtlSl with purified Endo-2, positive staining was completely abolished (data not shown).
As shown in Fig. 3A, prominent protein bands were observed with molecular weights corresponding to the previously shown values for both NEP and Endo-2; a single
94 kDa band for the former and two bands at 80 kDa and 74 kDa with the latter, respectively. These western blot experiments demonstrated that it was possible to isolate both enzymes from rat kidneys and that the embryos also contained both immunoreactive enzymes. The antibodies used in this study specifically recognised and bound to NEP and
Endo-2 in both adult kidneys and E14 embryos.
The intensity of positive signal observed for the embryo preparations appears to be weaker than that of the adult microvillar membrane preparations, despite the fact that the embryonic lanes had been loaded with five times more total protein than the kidney lanes. This is perhaps not so surprising considering that the kidney microvillar membrane is the richest source of both enzymes in the adult rat. From Fig 3A it can also be seen that the embryonic Endo-2 lane is relatively less intense than the corresponding embryonic NEP lane.
87 88 Fig. 3A. Western blot analysis of adult rat kidney microvillar membrane preparation (7 /xg total protein/lane), lanes 1 and 3, and an E14 embryo preparation (35 /xg total protein/lane), lanes 2 and 4. The antigens recognised by the primary polyclonal antibodies correspond to the previously published molecular weights for NEP (94 kDa), and Endo-2 (80 kDa, 72 kDa), respectively. The embryo-derived proteins appear to be identical in size to those in the kidney preparations, but at relatively weaker concentrations. The concentration of Endo-2 present in both the embryo and kidney membranes appears to be lower than the concentration of NEP. The two bands seen in the Endo-2 lanes represent the a and ^ subunits of this enzyme, whilst NEP is not comprised of different subunits, resulting in a single band. NEP Endo-2 1 2 3 4
9 4 -____ k_____ —80 # # -74
3A
8 9 3.3.2 Immunolocalization of NEP in the developing rat head and face
Having established that rat embryos contained both enzymes under study the next step was to establish their spatio-temporal distributions. Localization of NEP was assessed by immunoperoxidase staining of frozen sections obtained from postimplantation rat embryos at gestational ages BIO to E16. These results have been summarized in Table
3.1. All positive staining was abolished by pre-absorption of RAHE and PHM-6 with the adult kidney membrane preparation which contained NEP. Staining in adult rat kidney, the positive control tissue, was confined to the brush-border lining the luminal surface of the proximal convoluted tubules and the Bowman’s capsule (Fig. 3B).
At ElO, the craniofacial region exhibited no distinct regions of positive staining.
At E12, NEP was detected in the mesenchymal component of the medial and lateral nasal processes (Fig. 3E), throughout the notochord (Fig. 3H) and to a lesser extent on the luminal surface of the otocyst epithelium and of the branchial arch arteries. The craniofacial vasculature exhibited moderately positive staining. At E14, there was strong staining in the choroid plexus in both the mesenchyme and along the luminal/ventricular surface (Fig. 3V). The craniofacial vasculature, the pigmented retina (Fig. 3T) and the inner ear primordia also stained strongly.
At E l6, distinct patterns of positive staining were observed within the secondary palatal shelves (Fig. 3J), and the lower jaw particularly surrounding Meckel’s cartilage
(Figs. 3L and M) and in the base of the tongue (31). The choroid plexus, inner ear (Fig.
3K) and the arytenoid cartilages all exhibited strong positive NEP staining. The craniofacial vasculature, cartilage and bone were negative, however there was a distinct population of positively-stained cells in a perichondrial layer enveloping Meckel’s cartilage, nasal septum and other craniofacial skeletal elements (Figs. 3L-N).
90 91 Fig. 3B. Immunolocalization of Endo-2 in an adult rat kidney section. Counterstained with haematoxylin (blue). Positive staining (brown) is confined to the brush border of the epithelia lining the proximal convoluted tubules. Distal tubules are negative. Bar = 50 microns.
Fig. 3C. Immunolocalization of NEP in an adult rat kidney section. Counterstained with haematoxylin (blue). Positive staining (brown) is evident on the brush border of the epithelia lining the proximal convoluted tubules and on the Bowman’s capsule (arrow) surrounding the glomeruli. The distal tubules, glomeruli and blood vessels are all negative. Bar = 50 microns.
Fig. 3D. Localization of NEP mRNA in an adult rat kidney section following in situ hybridization with a radiolabelled antisense probe. NEP in evident on the proximal convoluted tubules. Bar = 50 microns. s: > * f
V-
• * f Y '
- v > . ' ; i ' c . . W-T":
t ' ' ': -'4 y î-/. jç ; \' i ►_ - ■ %,< L y : ' » s r
92 93 Fig. 3E. The lateral nasal process mesenchyme (arrow) of the E12 rat embryo, shown here in sagittal section, exhibits strong NEP localization (blue/black). The epithelia on the rostral side of the first branchial arch and the luminal surface of the first branchial arch artery demonstrate moderate NEP staining. In this parasagittal section the anterior/ventral surface of the embryo is to the left, and the dorsal surface is to the right. Counterstained with neutral red. Bar = 50 microns.
Fig. 3F. At ElO, the dorsal luminal surface of the gut (arrow), shown here in transverse section, stains positively for NEP (blue/black). Counterstained with neutral red. Bar = 50 microns.
Fig. 3G. The luminal surface of the epithelia lining the mesonephric tubules (arrows) at E12 are strongly positive for NEP (blue/black). Counterstained with neutral red. Bar = 50 microns.
Fig. 3H. The notochord (arrow) at E12, shown here in longitudinal section, is positive for NEP. The neural tube (asterisk) is negative. Counterstained with neutral red. Bar = 50 microns. ■ m .1 4 *
u_
-À V. ;
t • t ‘- Vr
LU CO e ? 95 Fig. 31. At E16, NEP (brown) is localized in the base of the tongue (asterisk). Meckel’s cartilage (m) is negative. No counterstain. Bar = 50 microns.
Fig. 3J. Central regions of the palatal shelf mesenchyme (asterisks) display positive NEP localization (brown) at E16. The nasal septum (n) is negative. No counterstain. Bar = 50 microns.
Fig. 3K. NEP (brown) is localized on the luminal surface of the inner ear epithelia (arrow) at E l6. Counterstained with haematoxylin. Bar = 50 microns.
Fig. 3L. At EI6, the perichondrium (arrowheads) around the mandibular primordium, Meckel’s cartilage (m), stains positively for NEP (brown). Counterstained with haematoxylin. Bar = 50 microns.
Fig. 3M. Higher magnification detailing the NEP perichondrial staining (brown). Counterstained with haematoxylin. Bar = 10 microns.
Fig. 3N. The perichondria around the other craniofacial skeletal elements (asterisk) exhibit strong NEP staining (brown) at E16. Counterstained with haematoxylin. Bar = 50 microns. ^ i
M m ^
^ .
* , -* *# <
-:ï ' ^ : # ' m i ' ,* ;t^'
# g : y ^
w-Bm- ' 3 ...... / h J ^
■ ••,i^ *»'Y '..;>jt;a
, ' m m
#'
96 Fig. 30. Sagittal section through the heart at E l4. NEP is localized (brown) on the septum (s) and to a lesser extent on the surface of the myocardial cells. Counterstained with haematoxylin. Bar = 50 microns.
Fig. 3P. The apical surface of the E l4 gut endoderm stains positively (brown) for NEP (arrowheads). Counterstained with haematoxylin. Bar = 10 microns.
Fig. 3Q. The notochord (arrow), is strongly positive for NEP at E14, shown here in longitudinal section. Counterstained with haematoxylin. Bar = 10 microns.
Fig. 3R. The apical surface of the E14 lung (arrowheads) exhibits strong NEP staining (brown). Counterstained with haematoxylin. Bar = 10 microns.
Fig. 3S. The perichondria (arrows) around the E14 lateral vertebral processes and the dermis (arrowheads) show strong NEP staining (brown). The dorsal root ganglia (d) are negative. Counterstained with haematoxylin. Bar = 50 microns. ■ î , s r
* ***. ' ' -
l
L- %
'if . ?:
I p
$
98 99 Fig. 3T. The pigmented retina (arrow) at E14, exhibits strong NEP staining (brown), whilst the neural retina and lens (asterisk) are negative. Counterstained with haematoxylin. Bar = 10 microns.
Fig. 3U. Positive NEP staining (brown) is evident in the mesenchymal stroma and on the apical surface of the epithelia (arrow) covering the choroid plexus at E14. Counterstained with haematoxylin. Bar = 50 microns.
Fig. 3V. At E14, the luminal surface of the choroid plexus epithelia (arrow) exhibits strongly positive Endo-2 staining (brown), and in contrast to the NEP immunoreactivity, the stroma is negative. Counterstained with haematoxylin. Bar = 50 microns.
Fig. 3W. At E14, the luminal surface of the epithelia lining Rathke’s pouch (asterisks) exhibit strong Endo-2 staining (brown). Counterstained with haematoxylin. Bar = 50 microns. t r
W-
100 3.3.3 Immunohistochemical localization of NEP in postcranial sites
NEP was localized in several other organs across the developmental period examined. At E l0, the luminal surface of the gut endoderm exhibited moderately positive staining, although this staining was only apparent following enhancement of the DAB
(Fig. 3F). By E l2, there was strong positive staining within the notochord and on the luminal surface of both the gut and the kidney primordium (Fig. 3G). In addition, the pericardium and endocardial cushions in the heart were strongly positive, whilst the myocardial cells exhibited weaker staining.
At E14, positive staining was seen in the cells enveloping the vertebral processes
(Fig. 3S), the luminal surface of the gut endoderm (Fig. 3P), kidney and bronchi (Fig.
3R). The diaphragm, notochord (Fig. 3Q), heart (Fig. 30) and the dura mater surrounding the spinal cord were also positive. No results were obtained for post-cranial sites at E l6, since only the craniofacial region was examined at this stage.
3.3.4 Immunolocalization of Endo-2 in the developing rat head and face
Localization of Endo-2 was assessed by immunofluoresence and immunoperoxidase staining of frozen sections obtained from postimplantation rat embryos at gestational ages ElO to E16. These results have been summarized in Table 3.1. All positive staining was abolished by pre-absorption of RRtl51 with purified Endo-2 (Figs.
3Z and Z’). Staining in adult rat kidney, the positive control tissue, was confined to the brush-border lining the luminal surface of the proximal convoluted tubules (Fig. 3C).
At ElO, no positive staining could be detected, but at the later embryonic stages examined, the luminal surface of the neuroepithelium exhibited strong positive localization, best exemplified by the choroid plexus (Fig. 3U) and the ependymal layer
101 102 Fig. 3X. The non-sensory epithelia (n), the vestibular membrane in the E l6 cochlear duct shows strong Endo-2 immunoreactivity (brown), whilst the sensory neuroepithelia (asterisk) is completely negative. No counterstain. Bar = 50 microns.
Fig. 3X’. A serial section, adjacent to that shown in Fig. 3X. Counterstained with haematoxylin. Bar = 50 microns.
Fig. 3Y. In the E16 inner ear, Endo-2 staining (brown) is confined to the luminal surface of the non-sensory epithelia, the vestibular membrane (arrows). The surrounding mesenchyme and cartilaginous otic capsule (oc) are negative. Counterstained with haematoxylin. Bar = 100 microns.
Fig. 3Z. Transverse section through an E l6 semicircular canal. Endo-2 is only localized on the non-sensory epithelia (brown). Counterstained with haematoxylin. Bar = 50 microns.
Fig. 3Z’. A serial section, adjacent to that shown in Fig. 3Z, which had been incubated with primary antibody that had been pre-absorbed overnight with purified Endo-2. All positive staining has been abolished. Counterstained with haematoxylin. Bar = 50 microns. V»*
V
\N'
X M m . A
i I ■ -< -i
%■ ' N
*
J" S'i
r R r ê X o CO o >
103 of the brain vesicles. The intensity of staining on the epithelial cells lining the choroid plexus decreased between E14 and E16. The E14 Rathke’s pouch (Fig. 3W) and the E16 lens and pigmented retina exhibited moderately positive staining.
The most striking pattern of Endo-2 distribution was that displayed in the developing inner ear. At E l2, there was diffuse, moderately intense positive staining on the luminal surface of the cells lining the otic vesicle. By E14, the positive staining appeared to be considerably stronger, and had become regionalized to the stria vascularis
(Figs. 3X, X’ and Y). The sensory neuroepithelium constituting the developing hair cells.
Organ of Corti and the tectorial membrane were all negative. This distribution pattern was still apparent in the inner ear at E16 (Fig. 3Z).
In some E16 sections, the epithelial lining of the oral and nasal cavities showed moderately positive staining.
3.3.5 Immunolocalization of Endo-2 in postcranial tissues
The only postcranial tissues which stained positively were the lining of the E14 bladder, ureter and gut (data not shown).
104 TABLE 3.1
Summary of immunohistochemical localization of NEP and Endo-2 in the
craniofacial region of the postimplantation rat embryo
Tissue NEP immunoreactivity Endo-2 immunoreactivity Choroid plexus Both epithelial and Epithelial component mesenchymal components positive at E14 and El 6 positive at E14 and E16 Ependymal cells Positive at E12-E16, Positive at E12-E16 strongly positive at E14 Ear Sensory and non-sensory Non-sensory epithelium epithelium positive at positive at E12-E16, E12-E16 sensory epithelium negative Eye Pigmented retina positive Pigmented retina very at E14, weakly positive at weakly positive at E14- E16 E16 Palate Secondary palatal Negative at all stages mesenchyme positive at E14-E16 Tongue Root of the tongue Negative at all stages positive at E l6 Craniofacial vasculature Positive at E12-E14, Negative at all stages negative at E l6 Perichondrium Positive at E14-E16 Negative at all stages Nasal region Nasal epithelium weakly Nasal epithelium weakly positive at E14-E16, positive at E14-E16 mesenchyme strongly positive at E12-E14, negative at E l6 Pituitary Negative at all stages Rathke’s pouch positive atE14 Notochord Positive at E12-E16 Negative at all stages
105 3.4 DISCUSSION
The spatio-temporal distribution patterns of both NEP and Endo-2 have been demonstrated across a key period in post-implantation embryonic development in the rat, with these enzymes being shown to be present in discrete locations in the craniofacial region, using conventional immunohistochemistry.
The results from the Western blotting experiments suggested that the levels of
Endo-2 protein present in homogenates of membranes from whole E14 embryos was relatively lower than that observed for NEP. When the primary antibodies were pre incubated overnight with either purified antigen (Endo-2) or an excess of the microvillar membrane preparation (NEP) all staining on the blots was abolished. This demonstrated that the primary antibodies used in subsequent immunohistochemical studies specifically recognised rat NEP and Endo-2 in both kidney and E14 embryo membrane preparations.
The adult rat kidney was used as a positive control tissue in the immunohistochemistry experiments and the strong distribution of both enzymes on the proximal convoluted tubules (Figs. 3B and C) confirmed the renal distribution patterns shown in previous studies.
The negative controls used in this study involved either the substitution of primary or secondary antibody with buffer, with the aim of testing for endogenous peroxidase activity and for non-specific secondary antibody binding respectively, or with primary antibody which had been pre-incubated with either purified antigen or the microvillar membrane preparation. The latter controls were incorporated in order to assess the specificity of the primary antibodies used. In all cases, all positive staining was abolished completely. An example of a section stained with RRtl51 which had been pre-incubated with purified Endo-2 is shown in Fig. 3Z’.
106 In general, NEP appeared to have a more widespread distribution in the embryo when compared with the distribution shown by Endo-2. The latter exhibited a very regionalized distribution, on the non-sensory otic epithelium including the stria vascularis, the choroid plexus and the anlage of the anterior pituitary gland, Rathke’s pouch. This may reflect a particularly specialized function carried out by Endo-2 in the development of these tissues. Indeed, both the non-sensory otic epithelium and the choroid plexus are tissues which are actively involved in ion exchange, during the formation of endolymph and cerebral spinal fluid respectively. The stria vascularis is a secretory epithelium which generates the high resting endocochlear potential in the endolymph and controls the high potassium, low sodium concentrations in this fluid (Steel and Brown, 1994) and perhaps the presence of Endo-2 suggests a role mediating peptide factors involved in these processes during development.
The Rathke’s pouch distribution could conceivably reflect a role for Endo-2 in the proteolytic cleavage of any or all of the factors or their precursors synthesized in this organ, including growth hormone, although to date, none of these are known substrates for Endo-2. None of the craniofacial sites where Endo-2 was localized in the embryo corresponded to the sites where this enzyme has been localized in the adult. This suggests that either nobody has looked at the adult head and face, or that the distribution of
Endo-2 in this region, reflects both a novel localization and perhaps a developmental function for this enzyme.
The range of substrates cleaved by NEP and Endo-2 are likely to vary in the embryo both spatially and temporally. Based on the distribution patterns exhibited by these enzymes, the identity of their substrates can be suggested. However, it must be stressed that the identification of these substrates goes beyond the original set of
107 objectives for this thesis, and whilst one can speculate, further research is required to support these suggestions. The distribution of NEP implies that this enzyme plays several important roles during craniofacial development in the rat, and some putative functions can be suggested based upon the distribution of the NEP substrates known to be present in the same embryonic tissues at the stages examined in this study. Two peptide substrates of NEP which have been localized in the developing craniofacial region are
ANP and the bombesin-like peptides. Receptors for ANP have been localized autoradiographically on the embryonic choroid plexus and cardiovascular system (Tong and Pelletier, 1990), and the bombesin-like peptides have been implicated in otic development (Represa et al., 1988). A recent study in which a ’knockout’ strategy was used, has strongly implicated a role for another NEP substrate, endothelin-1, in craniofacial morphogenesis in mice (Kurihara et al., 1994). The localization of NEP on the endothelium of the craniofacial vasculature may correlate with the presence of ANP and/or endothelin-1.
The epithelial and mesenchymal components of the choroid plexus were immunopositive for NEP, and this may reflect a similar developmental function as that suggested for Endo-2. The distribution in the pigmented retina correlates with the presence of substrates including substance P, VIP, enkephalins and CGRP (Stone et al.,
1987). The palatal distribution of NEP may reflect the presence of peptide growth factors. Several growth factors have been localized in the palatal shelves including TGFa, epidermal growth factor and platelet-derived growth factor (Dixon and Ferguson, 1992), but none of these is a known substrate for NEP.
Moving away from the craniofacial region, many of the derivatives of the primitive endoderm including the luminal epithelium of the gut, lungs and mesonephros
108 were all immunopositive for NEP. Indeed the presence of NEP in the gut at ElO was the earliest tissue distribution observed in this study. It has been suggested (Landry et a l,
1994) that NEP in the embryonic gut cleaves growth factors and other small peptides present in the amniotic fluid, which are swallowed by the embryo. It is further suggested that these growth factors mediate enterocyte differentiation, and that NEP cleaves and inactivates these morphogens. In the developing lung, the key substrate might be substance P or, more likely, the bombesin-like peptides. It has been reported that the hydrolysis of the bombesin-like peptides could control the rate of foetal lung maturation
(King et ah, 1993). The presence of NEP in the mesonephros might reflect a specific embryonic function mediated by biologically active peptides, such as branching morphogenesis, either in the mesonephros or in the primitive kidney.
The perichondrial distribution may reflect the presence of calcitonin, CGRP or
VIP. Human osteoblast-like cells have been shown to express a variety of membrane- bound peptidases including NEP (Howell et al., 1993), and it has been postulated that the target substrates for this enzyme in these cells include calcitonin and VIP. TGF/81 has been shown to down-regulate NEP in vitro (Casey et al., 1993), and perhaps the inactivation of peptide morphogens by NEP during chondrocyte differentiation is controlled by TGF/31, particularly as this growth factor has previously been demonstrated to regulate the expression of matrix proteins and metalloproteases (Ballock et al., 1993).
1993). This relationship might explain the distribution of NEP that was observed surrounding the developing skeletal elements most strikingly around Meckel’s cartilage and the vertebrae at E14.
The immunohistochemical data has only provided an indication of the distribution of the final translated product, it has not provided information about the sites of active
109 transcription of the mRNA. Whilst distribution does not always correlate with function, the positive immunolocalization of these enzymes in the embryonic head and face during a period of active growth and differentiation supports the original hypothesis.
The expression of mRNA provides substantially stronger evidence of synthesis in a given tissue compared to extraction of proteins or immunolocalization. Either of these might represent accumulation instead of, or in addition to, synthesis. Therefore, in order to address questions regarding expression patterns of mRNA, an in situ hybridization strategy was adopted, and this is described in detail in Chapter 4.
110 CHAPTER 4
NEP GENE EXPRESSION CHAPTER 4
NEP GENE EXPRESSION
4.1 INTRODUCTION
In the previous chapter, the distribution of both NEP and Endo-2 proteins in embryos was determined by the use of conventional immunohistochemical techniques.
The data presented in that chapter suggested that both enzymes are present during important periods in craniofacial morphogenesis, and to some extent this data complemented previously reported studies. Although the distribution patterns of NEP mRNA have been looked at in some isolated adult tissues, there have been no published studies describing the mRNA expression patterns of either of these enzymes during embryogenesis. One example of the former is the adult rat brain (Wilcox et al,, 1989), in which the distribution of both the protein and mRNA were detailed and compared in an attempt to examine potential discrepancies between sites of protein and mRNA along specific neuronal pathways. They concluded that apparent discrepancies were due to the fact that the mRNA was localized to the cell body whilst the protein could be expressed anywhere along a neuronal process.
Attempts to obtain the cDNA of Endo-2 through collaborative links have not been successful due largely to the fact that this enzyme has only recently been cloned. With
NEP, a full-length cDNA originally cloned by Malfroy et at., 1987 was generously donated by Genentech Inc., and was used in this study to visualize NEP mRNA using in situ hybridization. The results presented below were obtained using an p^S]-labelled
111 probe against the full-length NEP cDNA.
4.2 MATERIALS AND METHODS
As in the previous chapter, post-implantation rat embryos and adult rat kidneys were removed from timed-mated Wistar rats (2.1.2, 2.1.3). Tissues were fixed, cryoprotected and sectioned (2.3, 2.4).
The in situ hybridization protocol was essentially as described previously
(Wilkinson and Green, 1990) and is detailed above (2.7). Briefly, the antisense probe, labelled with p^S]UTP, was transcribed, using T3 polymerase, from the full length cDNA of rat NEP which had previously been subcloned into the pBLUESCRIPT SK-f vector.
A sense probe was also transcribed from the same cDNA using T7 polymerase and was used as a negative control. As with the immunolocalization studies, sections of adult rat kidney served as the positive control tissue. After pre-treatment, each section received
10 fi\ of the appropriate probe, equivalent to 10^ c.p.m.Z/^l overnight at 55°C. Following post-hybridization stringency washes to remove unbound probe, cells to which the probe had bound were visualized autoradiographically. Sections were viewed under both dark and bright-field illumination and photographed.
4.3 RESULTS
The expression patterns displayed by the rat NEP gene were assessed using in situ hybridization. As can clearly be seen in Fig. 4B, substitution of the antisense with the sense control abolished all positive hybridization, and this indicated that the positive localization observed when using the antisense probe was genuine.
112 113 Fig. 4A. Bright-field image of a sagittal section through an E l 4 embryo probed for NEP mRNA using in situ hybridization. The mRNA (black silver grains) is localized in several discrete locations including the lungs (asterisk), the vertebral perichondrium (small arrowheads), gut endoderm (small arrow), the choroid plexus (large arrow) and the notochord (large arrowhead). Bar = 100 microns.
Fig. 4B. Bright-field image of an adjacent sagittal section through an EI4 embryo which had been incubated with a sense probe. No positive hybridization signals are evident. Bar =100 microns.
Fig. 4C. Higher magnification of Fig. 4A showing NEP gene expression in the nasal mesenchyme. The snout is pointing down towards the caudal aspect of the embryo. Bar = 50 microns.
Fig. 4D. Higher magnification showing NEP gene expression in the E14 choroid plexus. In addition to the distribution in the mesenchyme, there seems to be some degree of heterogeneity shown by the epithelial localization of the mRNA. Bar = 50 microns. B / * 4A
114 115 Fig. 4E. Dark-field image showing the expression of NEP in the oro-nasal tissues of an B14 embryo. Positive signal (white) is localized throughout most of the nasal mesenchyme (N), in the mandible (M) and tongue. Strong positive signals are also evident in the roof of the oral cavity/secondary palate (arrow) and in the oesophagus (arrowhead). Bar = 100 microns.
Fig. 4F. Dark-field image showing the distribution of NEP mRNA (white) on the perichondrium of the E14 vertebral processes (arrows), lungs (asterisk), mesonephric tubules (m) and dermis (arrowheads). Bar = 100 microns. 116 117 Fig. 4G. Bright-field image showing the distribution of NEP mRNA on the E14 vertebral processes (arrows) and lungs (asterisk) Bar =100 microns.
Fig. 4H. At E12, the notochord exhibits very intense localization of NEP mRNA (black) shown here in transverse section in this bright-field image. Bar = 50 microns.
Fig. 41. Bright-field image showing the expression of NEP mRNA on the epithelial lining of the lung at E l4. Bar = 50 microns.
Fig. 4J. Bright-field image showing the expression of NEP mRNA in the mesonephric tubules (arrows) at El4. Bar = 50 microns. 4
•v
# " :k
S - v '
D# -.t *k. H Ar"
‘ V
'I
V \ \ Adult rat kidney was again used for a positive control tissue, and the proximal tubules were strongly positive as shown in Fig. 3D. In general, the patterns of NEP gene expression approximated closely to the distribution of the NEP protein both in terms of location and positive signal intensity in both the kidney and at both of the embryonic stages examined. At E12, the expression was most noticeable in the medial and lateral nasal process mesenchyme, and to a lesser extent on the otocyst epithelium and on the rostral half of the first branchial arch. The expression throughout the notochord was extremely intense at this stage (Fig. 4H). However, as with the immunohistochemical staining, the expression of NEP in the younger embryos (with the exception of the notochordal expression) was comparatively weaker than that observed in the older embryos.
By E14, the embryo has undergone a significant degree of differentiation and growth and this increase in morphogenesis was reflected by a widespread expression of
NEP. In the craniofacial region, the strongest expression was observed in the roof of the oral cavity, the oesophagus, the mandibular and much of the nasal mesenchyme (Fig. 4A,
C and E). Indeed upon close examination of Figs. 4C and E, sharp boundaries of expression within the oro-nasal region can be discerned. In the brain, expression was mainly confined to the ependymal cells and in both the mesenchymal and epithelial components of the choroid plexus (Fig. 40).
Several post-cranial sites exhibited particularly high levels of expression including the epithelial lining of the lungs, mesonephros and intestine (Figs. 4A, I and J) which correlates well with the protein expression. The expression pattern throughout the notochord and in the perichondrium surrounding the costal processes of the thoracic vertebrae (the primordia of the ribs), and the transverse processes of the more caudal
119 vertebrae was especially striking (Figs. 4A, F and G). The levels of expression observed in the endothelial lining of the craniofacial vasculature at both gestational stages was quite low, but above background levels (data not shown).
4.4 DISCUSSION
The results obtained following the immunohistochemical localization of NEP, described in the preceding chapter, demonstrated a diverse spatio-temporal pattern of distribution in both craniofacial and postcranial tissues. The primary aim of this chapter was to address questions concerning the expression of NEP mRNA.
Previous studies have shown that in some adult tissues, such as the lymphocytes and granulocytes, the NEP gene, synonymous with CD 10, is clearly developmentally regulated. It has also been postulated that the transcription of NEP could be controlled by alternative promoter activation. The substantial conservation of 5’ untranslated regions between different species (Chen et al.^ 1992) and the existence of 5’ alternative splicing
(D’Adamio et al., 1989) suggest that NEP gene expression may be differentially controlled in a tissue-specific and/or developmentally regulated manner. Therefore, the timing and regulation of NEP gene expression in adult tissues may be a reflection of events that have occurred during embryonic development.
The expression pattern of the mRNA closely matched the distribution patterns observed for the protein. This is perhaps not so surprising considering that NEP is a membrane-bound enzyme and therefore it might be expected that the cells which expressed the protein, also express the mRNA. However, there have been reports of discrepancies between the sites where NEP protein and mRNA have been localized in the adult rat brain (Wilcox et at., 1989).
120 The expression of NEP throughout most of the developing facial primordia at both of the embryonic stages examined, reinforces the immunohistochemical data presented in the preceding chapter. Significant gene expression is evident in the branchial arches and their mandibular derivatives, as well as in the maxilla and in the mesenchyme of the nasal processes. The expression in the ependymal cells and both the epithelial and mesenchymal components of the choroid plexus correlated well with the immunohistochemical data. The notochord expression at both B12 and E14 is especially intense, which taken together with the antibody data suggests that NEP may be playing an important role in this tissue during the early stages of organogenesis. There is a growing body of evidence which shows that the notochord is a source of morphogenetic signals which induce floorplate induction and control the development of motomeurons
(Goulding et al., 1993). Given the spatio-temporal localization of NEP in the notochord, it is possible that this metalloendopeptidase is, in some way, involved in the regulation of these inductive signals.
In a recent study (Back et at., 1993), NEP activity in the embryonic rat brain has been examined using a fluorescent histochemical method. This study focused primarily on the possible roles played by NEP in the central nervous system following the transplantation of foetal rat brain tissue into adult rat brain. The presence of NEP was demonstrated in the ventral mesencephalon, the cortical neuroepithelium, the basal telencephalon, pons, medulla and spinal cord. The results obtained from the in situ experiments described above demonstrated the presence of NEP on the ependymal cells lining the brain ventricles, the choroid plexuses and the notochord, and this data therefore complements the distribution described by Back and colleagues.
The intensity of positive signal on the craniofacial vasculature appeared to be
121 weaker than that observed in many of the other sites detailed above. However, the presence of positive signal supports the idea that NEP may play a role in the developing vasculature (and see Chapter 7), possibly through the hydrolysis of the vaso-active peptides including endothelin-1 and ANP.
Postcranially, the expression patterns of NEP were particularly striking along the developing vertebral processes, in the epithelial lining of the lungs, intestine and kidney primordia. It has been recently proposed (Monsoro-Burq et al., 1994) that the notochord controls the dorsoventral polarization of the somites, and that it is responsible for the differentiation of vertebral cartilage from the dorsal mesenchyme. It is also suggested that inductive signals are mediated by expression of the Msx2 gene, a transcription factor previously implicated during normal murine and abnormal human craniofacial development (Jowett et al., 1993; Jabs et al., 1993). Two recent studies have implicated another cell-cell signalling molecule (present in the notochord and floorplate) in the differentiation of the somitic mesoderm into vertebrae, ribs, muscle, and dermis. Sonic hedgehog (Johnson et al., 1994; Fan and Tessier-Lavigne, 1994). Based upon the localization of NEP mRNA (and protein) in the notochord and developing vertebral processes, the possibility exists that NEP may play some sort of regulatory function within theSonic hedgehog signaling pathway. Whilst there is currently no evidence to suggest that Msx2 or Sonic hedgehog are directly cleaved by NEP, one can speculate that
NEP could regulate the activity of peptides involved downstream in these differentiation pathways.
The data presented in this chapter provides strong evidence to support the immunohistochemical localization of NEP shown in the previous chapter. Taken together, the protein and mRNA distributions support the hypothesis that these enzymes are
122 developmentally regulated.
123 CHAPTER 5
EFFECT OF SELECTIVE INHIBITION OF NEP IN WHOLE EMBRYO CULTURE CHAPTER 5
EFFECT OF SELECTIVE INHIBITION OF NEP IN
WHOLE EMBRYO CULTURE
5.1 INTRODUCTION
The results from the previous chapters have provided evidence for the presence of both cell-surface metalloendopeptidases during a period in the development of the rat embryo when a considerable degree of morphogenesis is taking place in the craniofacial region. However, the presence of these enzymes does not provide any information about the roles that they play during embryogenesis. One way of investigating the possible roles played by these enzymes during post-implantation development in the rat, is to culture whole embryos in the presence of selective inhibitors. Over the past decade a range of selective inhibitors of NEP have been developed (reviewed by Wilkins et al., 1993).
The therapeutic consequences of inhibition of NEP have focused on the potentiation of physiological peptide substrates in an attempt to treat serious diseases including hypertension and congestive heart disease. The peptide substrates involved in these conditions include ANP, bradykinin and endothelin-1. It has also been proposed that the potentiation of the enkephalins and endorphins following inhibition of endogenous
NEP could form part of an effective analgesic therapy (Wilkins et al., 1993). The substrates found in the respiratory system such as substance P, have been demonstrated
124 to play a significant role in airway inflammation and asthma, and one potential therapy currently being developed involves local application of recombinant NEP (personal communication, Dr D. Brennen, Khepri Pharmaceutical, Inc., San Francisco, USA).
The finding that NEP is identical to CALLA (Shipp et al., 1989) which has been found in solid tumours (such as small cell carcinomas of the lung, Shipp et ah, 1991, and, hepatocarcinoma, Dragovié et al., 1994) as well as on the leukaemic blast cells, suggests an avenue for cancer therapy, possibly by providing a target for tumouricidal drugs.
To date no specific inhibitors directed against Endo-2 have been described. The most selective is actinonin, but as this inhibits other metallo-peptidases at low concentrations it was not used in this study.
However, advantage has been taken of the availability of two highly selective inhibitors of NEP, phosphoramidon, a natural microbial product, and the other, thiorphan a synthetic drug, to establish whether or not rat embryos cultured in the presence of these inhibitors would undergo normal development. If, as has been postulated, NEP plays an important role during normal craniofacial development, then inhibition of NEP should result in abnormal development.
5.2 MATERIALS AND METHODS
Rat embryos at E9.5 (head-fold stage) and E10.5 were dissected from pregnant
Wistar rats under a still-air hood as quickly as possible, and cultured with their yolk sac and amnion intact for 45-48 hr according to protocols described by Cockcroft, 1990. The dissection and culture procedures, including the gassing regime, are detailed above (2.1.2 and 2.18). The culture medium used was immediately-centrifuged rat serum (Cockcroft,
125 1990) diluted in sterile Hank’s buffered saline. Diluted rat serum was equilibrated with the first gas mixture prior to the start of the culture period, and warmed to the culture temperature (37°C) in the incubator. The two highly selective NEP inhibitors used in this study, phosphoramidon and thiorphan have been described previously (1.6.1 and 2.18.1).
Comparatively fewer experiments were carried out using thiorphan due to the possibility that the introduction of ethanol into the experiment might produce a vehicle effect, and therefore make the interpretation of the data more difficult. However, it was felt that some experiments with thiorphan had to be done in order to complement the phosphoramidon data, especially as it has been reported that endothelin-converting enzyme is also inhibited by high concentrations (>50 ^M) of phosphoramidon.
Endothelin-converting enzyme is not inhibited at all by thiorphan.
After culture, embryos were examined under the dissection microscope and scored using eight criteria of normality. After scoring, embryos were fixed and processed for wax histology and scanning electron microscopy as described above (1.3.2-3 and 2.4.2-
3).
5.3 RESULTS
The data presented below are the combined results from several culture experiments. The phosphoramidon cultures at both embryonic stages were each carried out on five separate occasions, and the thiorphan cultures on two separate occasions. The number of embryos cultured in each experiment was entirely dependent on the number of rats which were pregnant, the size of their litters, and the number of embryos at the correct stage at the onset of the culture period. The total number of embryos scored was
223, this number does not include any embryos that failed to develop.
126 127 Fig. 5A. S EM photograph showing a rat embryo cultured for 48 hr, from B9.5, in immediately-centrifuged rat serum diluted in sterile Hank’s buffered saline only. This control embryos does not exhibit any visible morphological abnormalities and was deemed normal according to the eight criteria of normality used to score embryos post-culture. Bar = 200 microns.
Fig. 5B. SEM photograph showing a rat embryo cultured for 48 hr, from E9.5, in serum containing 10 nM phosphoramidon; note the failure of crcuiial neural fold fusion (arrow) over the developing forebrain region. Bar =100 microns.
Fig. 5C. SEM photograph showing a rat embryo cultured for 48 hr, from E9.5, in serum containing 100 nM phosphoramidon; note the swelling (asterisk) on the left side of the prosencephalon. Bar = 100 microns. 128 129 Fig. 5D. SEM photograph showing a rat embryo cultured for 48 hr, from E9.5, in serum containing 100 juM phosphoramidon; note the open cranial neural folds (N) and the swelling (arrowheads) of the prosencephalic neuroepithelium into the lumen, caused by a subadjacent haematoma. Bar = 100 microns.
Fig. 5E. Lower magnification view of Fig. 5D. showing the disturbance to the normal looping morphogenesis of the heart (asterisk). Bar = 100 microns. a
130 131 Fig. 5F. SEM photograph showing a rat embryo cultured for 45 hr, from E10.5, in immediately-centrifuged rat serum diluted in sterile Hank’s buffered saline only. This control embryos does not exhibit any visible morphological abnormalities and was deemed normal according to the eight criteria of normality used to score embryos post-culture. Bar = 200 microns.
Fig. 5G. SEM photograph showing a rat embryo cultured for 45 hr, from E10.5, in serum containing 10 fiM phosphoramidon; note the relatively distended left side of the prosencephalon (asterisk) and the asymmetry of the first branchial arch. Bar = 100 microns.
Fig. 5H. SEM photograph showing a rat embryo cultured for 45 hr, from E10.5, in serum containing 1 /xM phosphoramidon; note the grossly abnormal left side of the head with a swollen dysmorphic maxillary prominence (asterisk), and abnormal first and second branchial arch. Bar = 200 microns.
Fig. 51. SEM photograph showing a rat embryo cultured for 45 hr, from E10.5, in serum containing 100 fxM phosphoramidon; note the large spherical bulge (asterisk) on the maxillary prominence, just caudal to the eye primordium. Bar = 100 microns. r
132 133 Figs. 5J-M. Haematoxylin and eosin stained coronal sections through a wax- embedded E9.5 rat embryo cultured for 48 hr in the presence of 1 /xM phosphoramidon. Bar = 20 microns.
Fig. 5J. Section through the forebrain. Note the greatly overgrown neuroectoderm (asterisk) on the left side of the prosencephalon.
Fig. 5K. More caudal section. Note the appearance of the left internal carotid artery (large arrow) compared to its contralateral partner (small arrow).
Fig. 5L. More caudal section. Note the now grossly dilated left internal carotid (large arrow) compared with the right (small arrow). The optic vesicle is also indicated (hollow arrow). The cranial neural folds have also failed to close.
Fig. 5M. Section at the level of the first branchial arch. Note the abnormally displaced left arch (arrow), the relatively distended first branchial arch artery (asterisk) and the open neural folds. M Immediately following the culture period the embryos were scored, and this data is presented below in tables 5.1-5.3. The control embryos from all of the culture experiments all appeared to have developed normally, an assessment based upon their gross morphological appearance both immediately post-culture and under the SEM, as well as their criteria of normality scores. A representative control embryo cultured for
48 hr from E9.5 is shown in Fig. 5A, whilst a control embryo cultured for 45 hr from
E10.5 is shown in Fig. F. Of the thiorphan controls, the embryos cultured in diluted serum plus ethanol were grossly normal, although their crown-rump lengths, somite numbers and turning scores suggests that these embryos were slightly growth retarded when compared to the serum-only controls (Table 5.3).
Following culture in the presence of both phosphoramidon and thiorphan, SEM revealed that a considerable percentage of the inhibitor-treated embryos, cultured from
E9.5 displayed an asymmetric, predominantly left-sided, facial deformity. This deformity appeared to have been caused by the presence of a haematoma-like swelling adjacent to the prosencephalon. Although subsequent histological examination revealed that the swelling was not due to a haematoma. This often appeared to have the effect of distending the left side of the head which in turn disrupted the normal positioning of the first and second branchial arches. Representative embryos are shown in Figs. B and C.
In the most severe cases (shown in Figs. 5D and E), observed at the highest concentration of inhibitor (1(X) ^M), the swelling was so great that the cranial neural folds were appeared not to have been able to close.
135 Table 5.1. Results of phosphoramidon exposure on £9.5 rat embryos in vitro
Inhibitor No. of Yolk sac Crown- % Turned Somite No. % Heart % Yolk sac % ^Severity conc. embryos diameter rump length ± s.d. beating circulation Cranio of defect mm ± s.d. mm ± s.d. facial defect
0 (Control) 25 3.19 ± 0.24 3.06 ± 0.52 84 24.80 ± 1.79 100 100 0 -
10 nM 16 2.63 ± 0.25 2.35 ± 0.18 37.5 21.75 ± 0.5 100 100 25 +
100 nM 19 3.25 ± 0.20 2.88 ± 0.63 100 24.50 ± 0.58 100 100 26.3 + +
1 fiM 22 2.88 ± 0.14 3.06 ± 0.31 72.7 22.25 ± 2.22 72.7 72.7 45.4 + +
10 16 3.13 ± 0.25 2.94 ± 0.43 75 22.75 ± 0.96 100 100 25 + + +
100 fiM 12 3.17 ± 0.29 3.08 ± 0.14 100 23.67 ± 1.15 100 100 33 + + + folds, clearly discernible haematoma and dysmorphic branchial arches).
136 Table 5.2. Results of phosphoramidon exposure on E10.5 rat embryos in vitro
Inhibitor No. of Yolk sac Crown-rump % Turned Somite No. ± % Heart % Yolk sac % Cranio ♦Severity of conc. embryos diameter mm length mm ± s.d. beating circulation facial defect defect ± s.d. s.d.
0 (Control) 11 4.43 ± 2.51 4.30 ± 2.00 100 31.16 ± 1.52 100 100 0 -
10 nM 27 4.10 ± 3.60 4.03 ± 3.78 100 27.33 ± 3.05 100 100 48.1 +
100 nM 23 4.20 ± 3.60 4.05 ± 3.01 100 28.33 ± 3.21 100 100 26 +
1 |iM 9 3.78 ± 4.91 3.36 ± 7.95 100 28.40 ± 4.39 77.7 55.5 77.7 + +
10 /*M 9 4.26 ± 0.57 4.30 ± 1.00 100 29.33 ± 1.15 100 100 33 + +
100 9 3.56 ± 8.14 3.4 ± 3.6 100 28.67 ±1.15 100 66.6 33 + + folds, clearly discernible haematoma and dysmorphic branchial arches).
137 Table 5.3. Results of thiorphan exposure on E9.5 rat embryos in vitro
Inhibitor No. of Yolk sac Crown-rump % Turned Somite No. ± % Heart % Yolk sac % Cranio ♦Severity of conc. embryos diameter mm length mm ± s.d. beating circulation facial defect defect ± s.d. s.d.
Serum only 4 3.75 ± 0.44 3.30 ± 0.54 100 29.00 ±1.15 100 100 0 - control
Serum + 3 3.80 ± 0.87 2.90 ± 0.36 33 27.00 ± 1.41 100 100 0 - ethanol control
100 nM 6 1.85 ± 0.33 1.53 ± 0.38 33 17.83 ± 1.33 100 100 0 -
1 /xM 6 3.20 ± 0.62 3.06 ± 0.64 33 24.00 ± 1.73 50 50 33 + +
10 /xM 6 1.8 ± 0.44 1.63 ± 0.20 0 17.33 ± 1.15 50 50 33 + + + folds, clearly discernible haematoma and dysmorphic branchial arches).
138 The severity of the defect, but not the incidence, generally increased as the concentration of the inhibitor was increased. In addition to these craniofacial effects, the heart appeared disproportionately swollen, in a midline position and seemed not to have undergone normal looping morphogenesis (Fig. 5E). Of the other parameters measured, there was only an extremely small decrease in crown-rump length, somite number, heart beat and yolk sac diameter, which suggests that the abnormalities observed in the inhibited embryos are specific effects of the inhibitors and not simply the result of poor culture technique.
Often inhibitor-treated embryos at the end of the culture period appeared almost normal when compared to the controls, but some of the more subtle manifestations of the characteristic defects could only be appreciated when viewed on the SEM. When E9.5 and E10.5 embryos were cultured in the presence of high concentrations (> 1 fiM) of either of the inhibitors, a few embryos completely failed to develop.
The embryos which were at E10.5 at the start of the culture period also displayed an abnormal left-sided prosencephalic swelling, the extent of the abnormality appeared to increase with an increased inhibitor concentration (Figs. 5G-I). None of the E10.5 embryos had open cranial neural folds as they had closed prior to the onset of culture, but the branchial arches were often displaced asymmetrically and of an abnormal spatulate appearance. In contrast with the embryos cultured from E9.5, the older embryos exhibited grossly normal heart morphogenesis post-culture, based solely upon their appearance under SEM and the dissection microscope, although these embryos were not examined histologically.
Subsequent histological analysis of inhibitor-treated embryos cultured from E9.5, revealed that the prosencephalic swelling was the result of both a localised overgrowth
139 of, what appeared to be, the prosencephalic neuroectoderm on the affected side (Fig. 5J) and a gross distension of the internal carotid artery on the same side (Figs. 5K and L).
However the endothelium of the vessel appeared to be intact. More caudally, this vascular disturbance extended to include the first branchial arch artery, which like the internal carotid, arises from the dorsal aorta, and displayed a considerable degree of distension. A presumed secondary effect of this, was the lateralward displacement of the first branchial arch (Fig. 5M).
A small number of embryos cultured in the presence of the highest concentrations of phosphoramidon and thiorphan completely failed to develop and died during the culture period. The possibility exists that the effects on these embryos were a direct consequence of the presence of the inhibitors, but as these conceptuses were extremely difficult to score, it was decided that, whilst this is an important finding which had to be reported, they would have to be excluded from the final analyses. This however, resulted in fewer inhibited embryos being available for post-culture scoring compared with controls.
5.4 DISCUSSION
The aim of the experiments described in this chapter was to determine if inhibition of NEP had any effect on the development of the E9.5 and E10.5 rat embryo in vitro.
Results from previous chapters have established the spatio-temporal distribution of NEP at both the protein and mRNA level in the post-implantation rat embryo across the gestational stages (i.e. from E9.5 to E12.5) used in the whole embryo culture experiments described in this chapter. Assessment of relative normality was based upon the following criteria: yolk sac diameter and circulation, crown-rump length, turning and the presence of a beating heart compared against control. These criteria were obtained
140 from similar published studies in which whole embryo culture was used to assess the effects of cysteine proteinase inhibitors on rat embryos (Ambroso and Harris, 1994).
The specific, apparently regionalised effects observed when embryos at both stages were cultured in the presence of selective inhibitors of NEP were not anticipated. The craniofacial vasculature, whilst immunohistochemically positive for NEP, was certainly not one of the strongest sites of NEP protein or mRNA distribution. Neither was the neuroectoderm in the region of the developing forebrain an especially rich source of the enzyme. Although the abnormalities in the craniofacial region were the most obvious when the cultured embryos were observed under the SEM, an adverse effect upon other developing organ systems cannot be ignored. The effects on the heart, for instance, merit further investigation in the future.
Under SEM, the open cranial neural folds, branchial arch deformities and the haematoma-like swelling were the most obvious manifestations of the consequences of inhibition. It was almost impossible to establish the physiological changes resulting in the swelling without sectioning these embryos. When the embryos were examined under the dissection microscope at the end of the culture period, many of the inhibited embryos at both stages had a clearly discernible red spherical swelling in the forebrain region which was always unilateral and almost always on the left-hand side. The appearance of this swelling indicated that it was most likely to be a localised haemorrhage (that is, a haematoma), or, a localised mass of blood vessels (a haemangioma) which had formed either de novo (vasculogenesis) or had sprouted from the established vasculature
(angiogenesis).
141 In all of the whole embryo culture experiments the inhibitor was added at the start of the culture period. No attempts were made to assess the activity of the inhibitors used
in this study at particular time points during the culture period. There are several ways
in which this important question may be addressed in future experiments. One way would
be to take an aliquot of the culture media at regular time-points and incubate it with
purified NEP and a labelled NEP substrate. Any decrease in the rate that the substrate
was broken down would indicate inhibitor activity. This approach could also be applied
to samples of the contents of the yolk sac and amnion to confirm that the inhibitor had
penetrated these extraembryonic membranes. Labelling the inhibitor with either a
radionucleotide or fluorescent tag are further means by which the uptake of the inhibitor
by the embryo may be followed.
Earlier studies in which the physiological roles played by NEP in the adult
cardiovascular system have been investigated have identified peptide substrates of NEP
which are implicitly involved in vasodilation and vasoconstriction. These include
endothelin-1, bradykinin, angiotensin 1 and ANP. Indeed, much of the interest shown by
the pharmaceutical industry in developing NEP inhibitors has centred on the control of
hypertension. However there have been no reports of NEP being involved in any way
with the formation of new blood vessels. An examination of the immunological and
cancer-based studies failed to uncover a role for NEP in angiogenesis or vasculogenesis.
Therefore, it is possible that the defects observed under the SEM, reflected a
secondary consequence of an abnormal rise in blood pressure, and not a
dysmorphogenesis. Examination of the histological sections of inhibitor-treated embryos,
however, indicated the contrary. As clearly shown in Fig. 5J, the neuroectoderm
overlying the internal carotid artery appears to have grown abnormally dense around the
142 vascular lesion, significantly increasing the size of the swelling, to the extent that the cranial neural folds were unable to fully close. The nature of the lesion itself also became apparent. It was clear that the endothelial lining of the internal carotid had remained intact, and it appears that it had become considerably stretched. The artery itself though, was greatly dilated on the affected side and was packed full of blood cells. This would appear to rule out the idea that the swelling is a localized formation of new blood vessels.
If the vessel had simply ruptured, especially if it occurred early on in the culture period, the haemorrhaging would have been more widespread, and not confined within a spherical shell of endothelium. The first branchial arch artery on the same side as the prosencephalic lesion also appeared to be disproportionately dilated compared to its contralateral partner, and was also packed full of nucleated red blood cells. It is likely that this subsequently caused the abnormal distension of the first branchial arch.
The possible effects of inhibition on the other developing organ systems in the rat embryo shown in this study to be rich in NEP at both the mRNA and protein levels, were not examined histologically in order to remain focused on the development of the craniofacial region.
The results from these experiments suggest that NEP is essential for the normal development of the craniofacial region of the postimplantation rat embryo, at least in vitro. Perturbation of endogenous NEP through the use of concentrations down to the the nanomolar range, of two chemically distinct, highly selective inhibitors of this enzyme appears to cause a characteristic craniofacial dysmorphogenesis that is always asymmetric in nature. Indeed, this abnormality was almost always restricted to the left- hand side of the forebrain.
Following histological examination of inhibited embryos it became evident that the
143 lesion was at least partially due to a massive regionalised swelling of the internal carotid artery and first branchial arch artery. This effects of this vasodilation were exacerbated by the abnormal overgrowth of the overlying tissue, most likely the neuroectoderm, in both the forebrain and first branchial arch regions.
This data suggested that the defect was not simply due to the presence of a haematoma as was first suspected upon initial examination post-culture and the appearance of the swelling when viewed under the SEM.
In the embryos cultured from E9.5, the distension appeared to have been so great, that the cranial neural folds were unable to close and fuse as normal. The appearance of the treated embryos suggested that NEP might be involved in the elevation and/or fusion of the cranial neural folds which may have been exacerbated by the presence of the prosencephalic swelling.
Although not fully examined in this study, heart morphogenesis also appears to have been sensitive to NEP inhibition. However, it is unclear whether or not this is due to a direct effect on the developing cardiac tissues, or a secondary consequence of the vascular disturbance in the craniofacial region. Future studies could perhaps examine the heart, lung, gut, and kidney primordia in rat embryos treated with NEP inhibitors.
144 CHAPTER 6
GENERAL DISCUSSION CHAPTER 6
GENERAL DISCUSSION
6.1 GENERAL DISCUSSION
During embryogenesis a plethora of peptide signalling molecules have been demonstrated to regulate growth and differentiation, and a great deal of information is known about the positive regulation of these morphogens and the mechanism by which they act. However, the means by which these peptide morphogen are switched off during normal development remains unclear. The embryo must have the capacity to inactivate these morphogenetic signals in order to control their effects.
This thesis has been a test of the hypothesis that the cell-membrane bound metalloendopeptidases, including NEP and Bndo-2, are present and perform essential functions during a key developmental period, when the craniofacial primordia are actively growing and differentiating. Many of the findings from this work have recently been published (Spencer-Dene et al., 1994).
The primary focus of this study has been the determination of the localization of these enzymes in the craniofacial region of the postimplantation rat embryo. In order to determine the protein distribution of both NEP and Endo-2, frozen sections of rat embryos from ElO to E16 were subjected to immunohistochemical staining using several antibodies, and these findings were supported by Western blotting experiments using membrane preparations. A wide range of tissues stained positively for these enzymes, with NEP having a considerably more widespread distribution than
Endo-2. NEP was first detected on the luminal surface of the gut endoderm at ElO.
145 This intestinal staining was observed at both E12 and E14, and the microvilli in the small intestine are a particularly rich source of NEP in the adult rat. NEP was detected in the craniofacial region from E12 most noticeably in the mesenchymal component of the nasal processes, the otocyst epithelia, and the notochord.
The considerable increase in differentiation and growth in the embryo that have occurred by the fourteenth day of gestation, as described in the Appendix, has been reflected by an increase in both the intensity of staining and the number of sites where staining was observed. Positive tissues in the head and face included the choroid plexus, the ependymal cell layer lining the brain ventricles, the pigmented retina and much of the major craniofacial vasculature. More caudally, NEP was observed in the gut, mesonephros, lungs, heart, and in the perichondrial layer of cells surrounding the vertebral processes. At E l6, the oldest stage examined, only the heads were analyzed, and positive tissues included the palatal mesenchyme, base of the tongue, perichondrium, choroid plexus and otic epithelium.
The expression patterns of the NEP gene have been explored using in situ hybridization. The earliest stage at which NEP was detected by in situ hybridization in the head and face was E12. The patterns of gene expression observed at E12 and
E14 neatly complemented the protein expression, with concomitant increases in both intensity and range of tissues at the older stage. In this study, all of the adult tissues known to be rich in NEP, including the kidney, intestine, lungs and choroid plexus were shown to be positive for both NEP protein and mRNA, across the developmental stages examined. It has been suggested that the presence of NEP in the primordia of these adult tissues reflects an adult function in the embryo (Landry et al., 1994). In addition, many of the tissues which have been shown to be positive for
146 NEP in the embryo, such as the notochord and palate, have not been shown to be positive in the adult. This study is the first to describe the distribution of Endo-2 in embryos, and indicate that this enzyme, a member of the developmentally important
Astacin family of proteases may also play a role during embryogenesis.
The hypothesis tested in this thesis states that NEP and Endo-2 play a role in controlling the differentiation and growth of embryonic tissues by inactivating small peptide morphogens. In order to begin to assess these putative developmental functions, embryos have been cultured in the presence of two chemically distinct, highly selective NEP inhibitors, phosphoramidon and thiorphan. The perturbation of endogenous enzyme resulted in the formation of a characteristic, asymmetric craniofacial abnormality even at the lowest inhibitor concentration used (10 nM).
The results from the embryo culture experiments are detailed in Chapter 5, and they have raised three important questions. Firstly, why is the craniofacial defect unilateral and predominantly on the left-hand side?. Secondly, why are there always some embryos cultured in the presence of inhibitors which appear to be unaffected?, and thirdly, which substrates are being affected by the perturbation of endogenous
NEP which may be causing the defect?
The asymmetry of effects may reflect an inherent sensitivity on the affected side mediated by the intrinsic asymmetry that exists within the cardiovascular system at the gestational stages used in this experiment. This sensitivity may be due to a slight difference in the degree of growth or differentiation of a particular vessel, or other structure, on the affected side, compared to the contralateral structure, at the gestational stage used for culture. The internal carotid and the first branchial arch artery stem from the first aortic arch. The stapedial artery originates from the same
147 arch, and it has been proposed that the accidental rupture of this artery, resulting in the formation of a haematoma, is the cause of hemifacial microsomia (Poswillo,
1973), a relatively common human craniofacial birth defect (Gorlin et a l, 1990).
The term hemifacial microsomia refers to unilateral defects in the development of structures derived from the first and second branchial arches. In the 1960’s, hemifacial microsomia was defined as a condition which primarily affected aural, oral, and mandibular development. The disorder varied from mild to severe, and involvement was limited to one side in many cases, but bilateral involvement was also known to occur, with one side being more severely affected.
The cause of hemifacial microsomia is currently the subject of much investigation. Despite a large body of clinical and experimental data, little is certain other than the heterogeneity of this malformation complex.
Poswillo, using an animal model, showed that early vascular disruption with expanding haematoma formation in utero resulted in destruction of differentiating tissues in the region of the ear and jaw. The severity appeared to be related to the degree of local destruction. Another possible mechanism is that disturbances in the branchial arches or various populations of neural crest cells may impede development of adjacent medial or frontonasal processes. The constellation of anomalies suggests their origin about 30-45 days of gestation. This proposed vascular aetiology for hemifacial microsomia has been supported by evidence provided by human studies
(Robinson et al., 1987)
Further experimental evidence has supported the hypothesis that the developmental pathogenesis of some unilateral craniofacial defects is disruptive in nature, secondary to interruption in embryonic blood flow (Poswillo, 1973). In these
148 studies, two compounds, triazene in pregnant rats and thalidomide in pregnant monkeys, resulted in haemorrhage and haematoma formation in the stapedial artery, within days of administration of the drug. In the animals delivered at term, asymmetric craniofacial defects in the region of the first and second branchial arches were observed in the treatment group, but not in the controls. As a result of these experiments, it was proposed that rupture of the stapedial artery was one cause of the
"first and second branchial arch syndrome". This has now been reclassified as oculo- auriculo-vertebral spectrum (Gorlin et al., 1990).
Poswillo (1973) had demonstrated that certain teratogens cause haemorrhage from the primordial stapedial artery. This is one of the three successive vessels on which the first and second branchial arch depend between the 3rd and 5th weeks of human development. Haemorrhaging was followed by haematoma formation and the obliteration of tracts of differentiating tissues between the 14th and 17th days in mouse embryos (treated with triazine) and the 32nd and 40th days in Macaca irus embryos (treated with thalidomide). Both of these initial times are equivalent to the
33rd day of human development. The resultant hemifacial microsomia-type defects led Poswillo to suggest that stapedial haemorrhaging is a causal mechanism in hemifacial microsomia pathogenesis. The extent of malformation of the affected parts varied according to the degree of initial damage to differentiating mesenchyme and the ability of the affected tissues to repair, differentiate and grow. It was reported that the causal haemorrhage was directly involved with the proximal end of Meckel’s cartilage, which precedes the formation of the mandibular body.
In hemifacial microsomia the facial skeleton on the affected side exhibits hypoplasia and malformation, especially the mandibular, auditory, maxillary and
149 zygomatic bones. Hypoplasia of the ramus and/or condyle presents as (asymmetrical) mandibular retrusion. Another proposed causal mechanism has been suggested
(Cousley and Wilson, 1992). They have postulated that an interference with the normal development of Meckel’s cartilage, and auriculofacial cartilages in general, is responsible for the pathogenesis of the hemifacial microsomia-type skeletal defects.
Such a proposal is independent of any one cause, since different causes may all act through common pathogenetic mechanisms
Several studies have suggested that asymmetries in the visceral organs, especially the vasculature result in the occurrence of unilateral defects affecting the limbs following similar perturbation experiments in both normal and mutant situs invertus mice (Brown et al., 1989; Kocher-Beckeret al., 1990; Kocher-Becker et al.,
1991).
Why then do some of the embryos cultured in the presence of an NEP inhibitor appear grossly normal? It may be that all inhibited embryos are affected, but for some reason only those worst affected result in the appearance of the haematoma.
Certainly, some subtle differences between the left and right side of the prosencephalon and/or the branchial arch morphology were only apparent when embryos were viewed under SEM. As only about half of the embryos were processed in this way, inhibited embryos classified as normal, or at least as not exhibiting the specific abnormalities immediately post-culture, may have been abnormal, but to a lesser extent than the others. This argument is supported by the general observation that as the concentration of either inhibitor was increased the extent of the deformities, but not the number of embryos which exhibited those deformities increased.
150 There is also the possibility that thenormal inhibited embryos had higher levels of endogenous NEP and that the effective concentration of the inhibitor not taken up by the abnormal embryos was too low to produce externally visible abnormalities. In addition to this, is the tendency for a small number of inhibited embryos to completely fail to develop, and this might have affected the final scores.
The possible substrates have already been briefly described. Whilst a vasodilatory effect was evident in the forebrain and first branchial arch, pointing to the possible involvement of vasodilatory peptide substrates, there was also an overgrowth in the neuroectoderm and affected side of the branchial arch suggesting a role for other peptide morphogens. However, the identification and quantification of all known and putative peptide substrates of NEP in either normal, and perhaps more pertinently, inhibited rat embryos is beyond the scope of this thesis. In this study, putative peptide substrates have been suggested based solely upon those known to be present in the affected tissues, but these suggestions have not been supported by any experimental data. Several studies (for example, Woll and Rozengurt, 1989;
Villablanca et al. y 1994) have proposed that sensory neuropeptides including the bombesin-like peptides, vasopressin, bradykinin, VIP and substance P, many of which are known to be physiological substrates for NEP, have the capacity to regulate cellular proliferation. These studies lend some support to the hypothesis that the inactivation of a regulatory enzyme such as NEP, would potentiate the mitogenic effects of these peptides during mammalian embryogenesis.
The disturbance in morphogenesis, which appears to be a consequence of inhibition of NEP during culture, strongly suggests that this enzyme plays a critical role during normal craniofacial development. This raises the possibility that cell-
151 surface metalloendopeptidases, such as NEP and Endo-2, might constitute a hitherto unrecognised level of control through the cleavage and inactivation of biologically active small peptides, growth factors and cytokines in craniofacial tissues.
6.2 FUTURE RESEARCH
All of the experiments carried out in this thesis have the potential to be extended and thus perhaps provide some answers to the outstanding questions remaining.
The immunohistochemical experiments could be extended from E l6 through to post-natal stages to determine whether the protein distribution in the head and face continues to change as older embryos are examined. Early embryos, younger than
E12, could be whole-mount immunostained with antibodies to both enzymes in an attempt to determine more subtle staining patterns. The Western blots could also be extended, with membrane preparations derived from all of the embryonic stages used for immunohistochemistry. The hypothesis tested in this thesis could be widened to include a whole host of other cell-surface metalloendopeptidases, such as the aminopeptidases, to which antibodies or cDNA’s are available.
Likewise, in situ hybridization could be carried out on stages younger and older than those examined in this study, to provide more information about the spatio- temporal distribution of the NEP mRNA. It would also be desirable to have been able to compare the patterns of NEP gene expression with those of Endo-2. Unfortunately the groups who have isolated the cDNA for meprin have not been as generous as the collaborators who have supplied me with either antibodies or the full-length cDNA of NEP. It is hoped that once these clones have been made available in situ
152 experiments can be carried out, alternatively the Endo-2 cDNA could be isolated using PCR. Again, whole-mount experiments, using a digoxigenin-labelled antisense probe might be a more suitable approach for examining younger embryos which are more difficult to section.
The use of transgenic knockout technology might determine how essential either or both of these enzymes are for normal development. However, it is often the case that the results from these knockout experiments are not as might have been predicted. A good example is the TGF-fil knockout (Shull et al. y 1992), which appeared to be anatomically normal at birth, eventually dying of a widespread inflammatory condition. The interpretation of the knockout data can often be misleading (as discussed by Hochgeschwender and Brennan, 1994). These experiments raise as many questions as they answer regarding the roles played by the knocked out gene. At present, an NEP knockout has been engineered in Craig
Gerard’s laboratory in Boston, and both hetero- and homozygotes have been bom
(personal communication from Prof. Gerard), but this group have not published any of their results. Several attempts to contact members of this group have elicited that the homozygotes do exhibit a characteristic abnormal phenotype, but frustratingly neither Gerard nor his co-workers have been willing to reveal any details. To date, there have been no studies describing an Endo-2 knockout. Gain-of-function mutations, in which a particular gene product has been inappropriately {i.e. ectopically) expressed could also be used to study the developmental roles played by these enzymes.
The development of highly selective inhibitors of Endo-2 would enable whole embryo culture experiments to be carried out to investigate the developmental
153 functions played by this enzyme, in comparison with the NEP data. Another means of testing the hypothesis that these enzymes are essential for normal embryonic development would be to administer inhibitors to pregnant rats at various stages of pregnancy and observe the appearance of the progeny. As long as the inhibitors were able to cross the placenta, embryonic exposure to the inhibitor could be varied to see if particular organ systems are especially vulnerable at particular gestational stages, also known as a period of teratogenic sensitivity. One of the main questions raised by the results obtained from the whole embryo culture, concerns the effect of inhibition on individual organs and the effects on individual peptide substrates.
Perturbation of endogenous NEP or Endo-2 could be achieved using highly selective inhibitors, antisense oligonucleotides or neutralizing antibodies.
6.3 CONCLUSIONS
The hypothesis tested in this thesis was that the cell-surface metalloendopeptidases, including NEP and Endo-2, are present during the growth and differentiation of embryonic tissues, and may play essential and previously roles during postimplantation mammalian craniofacial development.
The spatio-temporal patterns of protein distribution have been examined immunohistochemically across a period of postimplantation development in the rat, spanning ElO to E l6, when the head and face primordia are actively growing and differentiating. A wide range of craniofacial tissues were strongly positive as well as many of the organs in the body of the embryo, detailed in Chapter 3. This might reflect the widespread range of known and putative physiological substrates present in many of the NEP-positive locations. The distribution of Endo-2 was restricted to
154 discrete sites in the ear, choroid plexus and pituitary. The patterns of NEP gene expression have been examined using in situ hybridization, these experiments have demonstrated that there is an extremely good correlation between the cells which express the gene and the cells which have the mature enzymes on their cell-surface.
The roles played by NEP have been examined using whole embryo culture in the presence of two chemically distinct, highly selective NEP inhibitors. The presumed perturbation of endogenous enzyme appeared to result in a characteristic asymmetric craniofacial dysmorphogenesis. The nature of this abnormality has been elucidated following histological examination, the internal carotid artery on the affected side, almost always the left-hand side of the developing prosencephalon becomes extremely distended and packed full of blood. This is encapsulated by an abnormal overgrowth of the surrounding neuroepithelium which exaggerates the swelling. The cranial neural folds often could not close properly. The vascular disturbance was very often apparent in the first branchial arch artery on the same side as the forebrain defect, and this gave the first branchial arch a dysmorphic appearance. The defects resembled the human birth defect hemifacial microsomia.
The next stage of the work, would almost certainly be to identify the substrates cleaved by NEP and Endo-2 in vivo during embryogenesis.
155 ADDENDUM ADDENDUM
Several further experiments have been carried out over the duration of this thesis, although the results from these experiments are incomplete at present, and few conclusions could be reached from these data. However, it was felt that this work should be recorded, and included in this thesis, but should not constitute additional results chapters.
REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION
(RT-PCR) FOR NEP mRNA
INTRODUCTION
In this thesis the NEP protein was detectable as early as BIO, and the mRNA was detectable from E12. In order to determine whether or not NEP mRNA could be detected in younger embryos reverse transcriptase-polymerase chain reaction (RT-PCR) was utilised. RT-PCR has been used previously to isolate transcripts of existing genes, alternative transcripts of those genes, and completely novel genes from both embryonic and adult tissues. Several growth factors have been detected in mammalian embryonic material using this technique (Defrances et a l, 1992; Breier et a l, 1992; Shahet a l,
1994). mRNA is extracted from embryonic tissue and converted into cDNA using reverse transcriptase. This cDNA is then amplified by PCR.
The primers used were identical to those used in a previous RT-PCR study which examined alternative transcripts of adult rat NEP (Llorens-Cortes et a l, 1990).
156 MATERIALS AND METHODS
Rat embryos at E8, 9, 10, 11 and 14, and adult rat kidney, were obtained as described above (2.1.2). Kidney (10 mg) was used for the positive control, and six embryos were used for each embryonic stage, except for E14 when a single embryo was used. All extraembryonic membranes were removed and mRNA isolated using a commercially available kit (Micro-FastTrack kit: Invitrogen, USA) (2.8.3). This mRNA was then converted into cDNA using reverse transcriptase and reagents from another kit
(First Strand cDNA kit; Invitrogen, USA) (2.9). This cDNA was amplified by PCR using
Taq polymerase and primers specific for NEP (2.10). These primers had previously been shown to generate a 524 bp fragment of rat NEP reading from exon 19 to 24. The PCR reactions were diluted in loading buffer and loaded onto an agarose gel containing ethidium bromide. A 1 kb marker was loaded into an adjacent lane and the gel was run for 2 hr at 50 V. The amplified DNA was visualized and photographed under UV transillumination.
RESULTS and DISCUSSION
Following PCR using the NEP-specific primers, the kidney preparation yielded a 524 bp band, shown in Fig. 7.A., which matched the size of band that had been predicted for NEP. No other bands were seen in the kidney lane.
The embryonic preparations however, gave two bands. One band appeared to be identical in size to the kidney band, whilst the second, larger, embryo-specific band approximately 660 bp in length. Both bands were visible in all of the preparations from
E9 to E14, although the size makers have run slightly differently.
157 158 Fig. 7A. Photograph showing a 0.8% agarose gel on which the RT-PCR products derived from both adult kidney and postimplantation rat embryos had been run. The gel was illuminated under UV light and the products appear as white bands on the photograph. The two bands visible are 524 bp and 661 bp in length, compared against an adjacent 1 kb ladder (Gibco, UK), lane m in this figure (517,506 represents a DNA doublet of 506 and 517bp in the ladder). The 524 bp band corresponded to the predicted fragment of NEP (exon 19 to exon 24), whilst the 661 bp band appears to only be present in the embryos. Lanes a and b are adult rat kidney, c and h are from an E14 rat embryo, d is from a E9 embryos, e is from ElO, and f and g are from E ll embryos.
Fig. 7B. Photograph showing a 2% agarose gel. Lane a corresponds to an RT-PCR reaction carried out in the absence of any cDNA. Lane b corresponds to an RT-PCR reaction carried out with primers specific for mouse actin instead of NEP-specific primers. Lanes c and d are from an RT-PCR reaction using the cDNA extracted from an E14 rat embryo in the presence of the NEP-specific primers. The label 517,506 corresponds to a DNA doublet, of 506 and 517 bp, in the Ikb ladder (Gibco, UK). abcde f 9 hm
-1,018 -517506
7A
abed
-517506
159 Two control reactions are shown in Fig. 7B. Unfortunately, in the absence of cDNA, a strong single band was observed which strongly indicated the presence of contaminating DNA. The actin control was not successful, possibly due to discrepancies between the mouse and rat jS-actin primer sequences (Alonso et al., 1986). AU of the reactions shown in Fig. 7B. utilised conditions optimised for actin and not NEP, additionally the gel shown in Fig. 7A contained 0.8% agarose versus 2% agarose for the gel shown in Fig. 7B. Therefore the results shown in Fig. 7B cannot be used as controls for the reactions shown in Fig. 7A.
If the 524bp band corresponds to the expected fragment of rat NEP, the above data complements the earlier in situ data. Unfortunately, the presence of a band in the negative control reaction severely compromises the RT-PCR results, and no real conclusions can be made without a real negative controls and a real positive control using actin or a similar housekeeping gene.
Alternatively spliced variants of NEP have been studied in the past (D’Adamio et at., 1989; Llorens-Cortes et al. , 1990; lijima et al. , 1992) and the possibility that a novel embryo-specific gene has been discovered in the course of this study should be pursued with correct controls and optimisation of conditions.
PRELIMINARY CHARACTERISATION OF THE EMBRYO-SPECIFIC
PRODUCT: SEQUENCE ANALYSIS.
INTRODUCTION
The RT-PCR experiments may have led to the isolation of a novel transcript which appeared to be present only in the embryonic preparations. Further experiments
160 were required to establish the identity of the two RT-PCR products by direct sequencing.
The sequencing reactions described in detail in the Materials and Methods chapter
(2.15-2.17) were used to identify both bands produced by RT-PCR, from mRNA extracted from post-implantation rat embryos and adult rat kidney.
In order to check the sequence of the larger band, a collaborator at St. James’s
University Hospital in Leeds (Dr Nick Lench; Dept, of Molecular Medicine) has sequenced this product using an ABI automated sequencer, whilst at the same time I have cloned both bands independently into an appropriate vector pGEM-T and the double stranded DNA has been directly sequenced using the dideoxynucleotide method, incorporating Sequenase version 2.0 DNA polymerase, as described above (2.15-2.17).
MATERIALS AND METHODS
DNA Sequencing of the RT-PCR products
The templates used were the double-stranded DNA RT-PCR products. In order to obtain sufficient template DNA, the extracted bands were ligated into the pGEM-T vector. In order to produce sufficient quantities of DNA for sequencing, competent cells were then transformed with this ligated vector/insert, and after transformed colonies were identified by their white colour, 2.13, small-scale preparations of plasmid DNA were carried out (see 2.8.1). Colonies which contained the vector and insert were identified following restriction digestion of the plasmid DNA with BamHl and Kpn\ to confirm that the vector sequences contained the correct sized insert (524 bp for the NEP and 661 bp for the new transcript). The double stranded plasmid DNA containing the characterised insert was then used as a template for sequencing.
161 RESULTS and DISCUSSION
Sequencing the 524 bp band
The following sequence was read off the gel manually. The upper line is the sequence from the gel and the lower line is the published sequence for adult rat NEP numbered according to the corresponding bases in the full sequence. N represents a base which could not be distinguished from the three others, usually if there was a band which ran with equal density across all four lanes (a compression). These compressions were most probably caused by regions rich in G and C residues.
TAGTCTTAATACAATTTTTCTTACCNNNNNTTTTAATGAGGGA
^^TAGTCTTAATACAATTTTTCTTACCNNNNNTTTTAATGACKjGA
CCTGAACTGGAGTTAGTGTTTGTTGATAAGAAGAACTTGAAACG
CCTGAACTGGAGTTAGTGTTTGTTGATAAGAAGAACTTGAAACG
GGTCCACACCACACCTTGATGNCCGGTCTCATACGTCAGTTAAG
GGTCCACACCACACCTTGATGGCCGGTCTCATACGTCAGTTAAG
GTAATTTTGTCTACATGTGTCAGGANNNTTAAAGTCCTAGTAACC
GTAATTTTGTCTACATGTGTCAGGACCGTTAAAGTCCTAGTAACC
NNNAAACGTCNT
CTG A A ACGTCTT^^ '
162 A comparison of the two sequences reveals that they are virtually identical. The only differences are due to unreadable bases within the sequence obtained from the RT-
PCR product.
Sequencing the embryo-specific band
The consensus sequence obtained from Dr Lench and myself is presented below.
Again N represents an unreadable base. The two short stretches of sequence in bold at the beginning and end of the embryo-specific sequence are the NEP-specific primers which have their first and last base numbered according to the corresponding base in the full NEP sequence. Bases which are underlined represent a difference between the sequence obtained using an automatic sequencer, and those obtained manually.
'GTCATCGGACATGAAATCACACATTGATTACACTGGGGTGCCCAG
i818 g g t CATCGGACATGAAATCACACA‘*“‘
GAGACACGTCTGTTCACAGGGCCTGAAGAGTAGAGGTGGGGGGAT
CAGGCAGGATCCCTCGTGCTGTTTCCCCACTAGCTGCTTGACCATA
ATGACCTCTGACCCGGTTACCAGCCTAGATGAGCTAGCTCACTATA
GAACATGGGAATGTTGAAGCÇGGATAAGTCAGAATTCGAGGGCC
163 CCAGGGGCACCAGGGCTGGTAGTCAGCAGeCAGAAGGGACTGA
CTGGGTCAGTCTTGATCTGACACCCCCAGGGTCTGCTCTTAGGTG
AGGCAGGAGGCCGTGTCCTGCATGAGGTCTGCCCCTCAGGACAC
ACCATAGTGGCTGCGAGGGGNNNNNNNNNCCANGNCCCTGCTN
NNNNNNATCCAACTACTGCCTTCCCCTAGGGCTGTTCGTGCCAG
CCTAAAGTCCTCCTGTGTGCCGAGCTACGAGGGGATGAGCCCCC
ACGGAAGCGAACCAAACTGGAAAAGAGTCCTTACACTGGCCTAC
AGACAGCTTCCTCGGTGAGTCTCCAGGCCTCCGCCCTCACCTCA
GGTGGGCACCGTACATGAGATGTTGGGGATGGTACCGGGTATTA
AACCCCGGTGAACTAGCGAGGGTTTGGTGATCTTCACAGG^*
232icCCAAACCACTAGAAGTGTCC^^^^
164 The full sequence of NEP is not shown here as there was no appreciable homology between the embryo-specific product and NEP.
In order to address questions concerning the identity of the larger band and to confirm that the band common to both embryonic and adult mRNA was NEP, both DNAs were extracted from the agarose gel and cloned into an appropriate vector from which they were sequenced. The 188 bp of readable sequence from the 524 bp band in both embryos and kidney, was indeed identical to NEP as shown by a direct comparison with sequence databases. The larger, embryo-specific band was sequenced both by myself and by an independent collaborator was found to be 661 bp in length. The sequence from the embryonic band was analysed using the F AST A databank search for homologous mRNA sequences in GenBank, or translated protein sequences in SwissProt. These searches revealed that, with the exception of the regions complimentary to the NEP-specific primers, the embryonic product contained no regions with any significant homology to
NEP, or to any other sequences in the database.
The data from these experiments raise the possibility that a novel cDNA which appears to be present only in embryos, has been isolated through RT-PCR. However, until the full sequence has been determined and checked it is impossible to make any solid conclusions regarding this RT-PCR product.
165 APPENDICES APPENDIX
Mammalian craniofacial development
The most extensive studies into the development of the craniofacial region in
mammals have centred on the human and the mouse, whilst rat development has not been studied as extensively. However a developmental staging system has been proposed by Witschi which I have summarized in Tables A1 and A2. Below is a
description of the morphogenetic events that occur in the craniofacial region of the
human embryo. Of course, no study dealing with development of the head and face
can completely ignore the essential contribution provided by the neural crest cells, but as this has been covered extensively elsewhere (for examples see Le Douarin et al.,
1993; Thorogood, 1994) it will not be described here in any significant detail.
The many detailed accounts of mammalian craniofacial development have concentrated on the mouse and human, whilst the rat seems to have been largely
neglected. Many of the morphological events that occur during the development of
the rat head and face can be extrapolated from those events which contribute to the human craniofacial development as described below, which has been adapted from
Sadler, 1990 and is summarized in Fig. Al.
166 Fig. Al Development of the Human craniofacial Region adapted from "The Developing Human" (Moore, 1982)
branchial arches: stomodeum — 1st eyelid
— 2nd nostril heart prominence A lower jaw F 40 ± 1 day lens placode^
nasal placode
stomodeum lyelid
B ‘28 t 1 day medial nasal hyoid arch prominences merging with each other G nasal pit- 48 ± 1 day and the maxillory prominences e y e ~ ^ ^
nasolacrimal groove
K ey C nasolacrimal ^ groove — - nasal pit I I frontonasal prominence
medial- J-nasal prominences intermaxillary' lateral- segment H maxillary prominence nasolacrimal groove I I 10 w eeks D 33 ± 1 day first branchial groove
LSÜ m an d ib u lar p ro m in en ce
ledial nasal prominence
lateral nasal prominenci
-external ear philtrum of lip
E 35 ± 1 day 14 weeks The most extensive studies into the development of the craniofacial region in mammals have centred on the human and the mouse, whilst rat development has not been studied as extensively. However a developmental staging system has been proposed by Witschi which I have summarized in the Appendix as Tables Al and A2.
Below is a description of the morphogenetic events that occur in the craniofacial region of the human embryo. Of course, no study dealing with development of the head and face can completely ignore the essential contribution provided by the neural crest cells, but as this has been covered extensively elsewhere (for examples see Le
Douarin et al., 1993; Thorogood, 1994) it will not be described here in any significant detail.
The many detailed accounts of mammalian craniofacial development have concentrated on the mouse and human, whilst the rat seems to have been largely neglected. Many of the morphological events that occur during the development of the rat head and face can be extrapolated from those events which contribute to the human craniofacial development as described below, which has been adapted from
Sadler, 1990 and is summarized in Fig. 1.3.
The Human
The initial shape of the embryonic head and face is determined by several factors. The cranium forms in relation to the developing brain; the craniofacial region is formed by the chondrocranium; and the mandible forms from the first branchial arch and its derivatives.
The branchial arches consist of a core of mesenchymal tissue, covered on their external aspect by surface ectoderm, and on the inside by epithelium derived from the
168 endoderm. In addition to mesenchyme derived from the mesoderm of the paraxial and lateral neural plate, the core of each arch is infiltrated by neural crest cells, which migrate into the arches to contribute to the skeletal components of the face. The craniofacial musculature is derived from the original branchial arch mesoderm and each arch is thus characterized by its own muscular components, which in turn carry their own nerve. Wherever the muscle cells might migrate, they carry their cranial nerve component with them. In addition each arch has its own arterial component.
First Branchial Arch
The first branchial arch comprises a dorsal portion known as the maxillary process, which extends forward inferior to the eye region, and a ventral portion, the mandibular process which gives rise to Meckel’s cartilage. As the embryo develops,
Meckel’s cartilage regresses and disappears, with the exception of its dorsal end which persists and give rise to the incus and malleus. Through the process of membranous ossification, the mesenchymal component of the maxillary process subsequently forms the premaxilla, maxilla, zygomatic bone and part of the temporal bone. The mandible is similarly formed by membranous ossification of the mesenchymal tissue surrounding Meckel’s cartilage.
The first branchial arch musculature is comprised of the muscles of mastication (temporal, masseter, and pterygoids), the anterior belly of the digastric, the mylohyoid, the tensor tympani, and tensor palatini.
The muscles of the various arches do not always attach to the bony or cartilaginous components of their own arch, sometimes migrating into the surrounding regions. The nerve supply to the muscles of the first arch is provided only by the mandibular branch of the trigeminal nerve. As the first arch mesenchyme also
169 contributes to the dermis of the face, the sensory supply of the facial skin is provided
by the ophthalmic, maxillary, and mandibular branches of the trigeminal nerve.
Second Branchial Arch
The cartilage of the second or hyoid arch (Reichert’s cartilage) gives rise to
the stapes, the styloid process of the temporal bone, the stylohyoid ligament, and,
ventrally to the lesser horn and the upper part of the body of the hyoid bone. The
muscular component of the hyoid arch comprises the stapedius, the stylohyoid, the
posterior belly of the digastric, the auricular, and the muscles of facial expression,
which are all innervated by the facial nerve, the nerve of the second arch.
Third Branchial Arch
The cartilage of this arch gives rise to various components of the hyoid bone.
The musculature is limited to the stylopharyngeal muscle, which is innervated by the
glossopharyngeal nerve, the nerve of the third arch.
Fourth and Sixth Branchial Arches
The cartilaginous components of these arches fuse to form the thyroid, cricoid,
arytenoid, comiculate, and cuneiform cartilages of the larynx. The muscles of the
fourth arch (the cricothyroid, the levator palatini, and the constrictors of the pharynx)
are innervated by the superior laryngeal branch of the vagus, the nerve of the fourth
arch.
The Face
The facial prominences consist primarily of neural crest-derived mesenchyme,
and they are formed predominantly by the first branchial arch. The maxillary prominences, can be distinguished lateral and the mandibular prominences caudal to
170 the stomodeum. The frontonasal prominence, formed by proliferation of mesenchyme ventral to the brain vesicles, constitutes the upper border of the stomodeum. On either side of the frontonasal prominence are local thickenings of the surface ectoderm, the nasal (olfactory) placodes. At a later stage in development, the nasal placodes invaginate to form the nasal pits, creating a ridge of tissue that surrounds each pit, forming the nasal prominences. The prominences on the outer edge of the pits are the lateral nasal prominences, whilst those on the inner edge are the medial nasal prominences.
As the embryo gets older, the maxillary prominences continue to grow medially, compressing the medial nasal prominences toward the midline, and eventually they fuse. Therefore, the upper lip is formed by the two medial nasal prominences and the two maxillary prominences. The lower lip and jaw are formed from the mandibular prominences, which merge across the midline.
Initially, the maxillary and nasal prominences are separated by a deep furrow, the nasolacrimal groove. The ectoderm in the floor of this groove forms a solid epithelial cord, which detaches from the rest of the overlying ectoderm, ultimately forming the nasolacrimal duct. Following detachment of the cord, the maxillary and lateral nasal prominences merge with each other. The nasolacrimal duct runs from the medial comer of the eye to the inferior meatus of the nasal cavity. The maxillary prominences then enlarge to form the cheeks and maxillae.
The nose is formed from five facial prominences: the frontal prominence gives rise to the bridge; the merged nasal prominences provide the crest and tip; and the lateral nasal prominences form the sides (alae).
171 Intermaxillary Segment
As a result of the medial growth of the maxillary prominences, the two medial nasal prominences merge not only at the surface, but also at a deeper level. The structures formed by the two merged prominences are together known as the intermaxillary segment. It is composed of a labial component, which forms the philtrum of the upper lip; an upper jaw component, which carries the incisor teeth; and a palatal component which forms the triangular primary palate. Cranially, the intermaxillary segment is continuous with the rostral part of the nasal septum, which is formed by the frontal prominence.
Secondary Palate
The definitive palate is predominantly formed by two shelf-like processes which grow out from the maxillary prominences. These processes, the palatal shelves, initially grow obliquely downwards on either side of the tongue. Later, these shelves ascend enabling them to reach a horizontal position above the tongue and fuse with each other, thus forming the secondary palate.
Anteriorly, the shelves fuse with the triangular primary palate and at the same time as this fusion, the nasal septum grows down and merges with the rostral aspect of the newly formed secondary palate.
Tongue
Three swellings derived from the first branchial arch, two lateral lingual swellings and one medial swelling, the tuberculum impar, mark the initial appearance of the tongue. A second medial swelling, the copula or hypobranchial eminence, is formed by the mesoderm of the second, third and part of the fourth arch. Finally, a third medial swelling, formed by the posterior part of the fourth branch, marks the
172 development of the epiglottis. Immediately behind this swelling is the laryngeal orifice, which is flanked by the arytenoid swellings.
The lateral lingual swellings overgrow the tuberculum impar and merge with each other, thereby forming the anterior two-thirds of the body of the tongue. The mucosa covering the body of the tongue also originates from the first branchial arch, and is innervated by the mandibular branch of the trigeminal nerve.
173 TABLE Al RAT DEVELOPMENT (Based largely upon Witschi, 1962) Age days after fertilization, i.e. copulation age minus 8 hours (corresponding ages of mouse embryos of the same stage are in brackets), Size largest dimension of embryo in natural position (largest and smallest dimensions of blastocysts and chorionic vesicles are in brackets).
Standard Age (E) Size (mm) Identification of Stages Stages (Witschi)
Cleavage and Blastula
1 1 0.07 1 cell (in oviduct)
2 2 (1) 0.08 X 0.06 2 cells (in oviduct)
3 3 4 cells (in oviduct)
4 3.25 (2) 0.08 X 0.05 8-12 cells (in oviduct) 5 3.5 0.08 X 0.04 Morula (in uterus)
6 4 (0.08 X 0.03) Early blastocyst (in uterus)
7 5(4) (0.12 X 0.05) Free blastocyst (in uterus)
Gastruia
8 6 (4.5) (0.28 X 0.07) Implanting blastocyst, with trophoblastic cone and inner cell mass; outgrowth of endoderm (hypoblast)
9 6.75 (5) Diplotrophoblast; inner cell mass (pendant), covered with endoderm
10 7.25 (5.5) (0.3 X 0.1) Near complete implantation; pendant begins differentiation into embryonic and extra-embryonic parts
11 7.75 (6.5) (0.5 X 0.1) Completion of implantation; primary amniotic cyst; ectoplacental cone
Primitive Streak
12 8.5 (7) (1.04 X 0.26) Connecting ectochorionic and amniotic cavities; rudiments of amniotic folds; primitive streak; Neurula
13 9(7.5) 1.0 (1.4 X Presomite neurula; fusion of chorio-amniotic folds; chorio-amniotic stalk; neural plate; embryo 0.45) bent dorsally; bud of allantoic stalk
14 9.5 (7.75) 1.5 (1.8 X 1.1) Somites 1-4 (occipital); pendant with 3 cavities: ectochorionic cyst, exocoelom, and amniotic cavity; embryo bent dorsally
15 10 (8.0-8.5) 2 Somites 5-12 (cervical); 1st visceral arch; ectochorionic cyst fused with ectoplacenta and with allantoic stalk; regression of peripheral (distal) yolk sac and trophectoderm (diplotrophoblast); Reichert’s membrane; gonia in endoderm; embryo bent dorsally
16 10.5 (8.5- 2.4 (2.2-3.4) Somites 13-20 (upper thoracic); 2 visceral arches; disc and yolk sac placentas; appendicular 9.0) folds; embryo reverses, curves ventrally
17 11 (9.5) 3.3 Somites 21-25 (lower thoracic); yolk sac closes at level of 15th somite; primary gonia in mesentery; primitive streak disappears; tail bud becomes organized; fore and hind limb buds recognisable
Tail Bud Embryo
18 11.5(10) 3.8 Somites 26-28 (upper lumber); 3 visceral arches
| l 9 11.75 (10.25) 4.2 Somites 29-31 (lower lumber); visceral arches I-IV; cervical folds; appendicular folds;#d bJus 1 11.875 5 (4.7 X 5.2) Somites 32-33 (upper sacral) 1 12 5.1 Somites 34-35 (lower sacral); deep cervical sinuses 2 2 12.125(10.5) 5.2 Somite 36 (1st caudal); olfactory pits
23 12.25 5.6 (4.5 X 5.8) Somites 37-38 (caudal); start of umbilical herniation
24 12.375 6 Somites 39-40 (caudal)
Complete Embryo
25 12.5(11) 6.2 Somites 41-42 (caudal); occipital somites dispersing; 4 visceral arches; deep cervical sinuses, fore limb buds at somite levels 8-14; hind limb buds at somite levels 28-31; body forms a spiral of about 1 '/2 turns, the left face and trunk applied to yolk sac, the right side turned toward placenta; tail and allantoic stalk rise to placenta
Metamorphosing Embryo
26 12.75 7 Somites 43-45 (caudal); mandibular, maxillary, and frontonasal processes; cervical sinuses closing; mammary welts; differentiation of handplates; fore limb buds vascularised, brachial nerves entering; beginning of umbilical hernia
27 13 (12) 8 Somites 46-48 (caudal); prominent facial processes and clefts; nose-snout projecting; cervical sinuses closed; primordia of mammary glands; round handplates and footplates; larger umbilical hernia
28 13.5(12.5) 8.5 Somites 49-51 (caudal); 1st visceral cleft transforms into external ear duct; precartilaginous condensations in handplates
29 14 9.5 Somites 52-55 (caudal); auricular hillocks on visceral arches 1 and II
14.5 (13) 10.5 Somites 56-60 (caudal); body uncoils; mandibular precartilage; nearly round openings of external ear duct; pleuroperitoneal narrows
31 15 12 Somites 61-63 (caudal); facial clefts closed; pleuroperitoneal canal closed; complete diaphragm
32 15.5 (14.5) 14.2 (14.3 X Somite 64 (caudal); pinna turns forward; maximal size of umbilical hernia 8.0)
33 16(15) 15.5 Somite 65 (caudal); snout lifts off chest; last stage of metamorphosis
Foetus
34 17-18(16- 16-20 1st foetal stage; rapid growth of eyelids (eyes entirely covered at end of 18th day); palate 16.5) complete; pinna covers ear duct; umbilical hernia withdraws
35 antenatal 19-22 (17-19) 20-40 2nd foetal stage; sealed eyelids; foetal membranes and placentas reach peak of development; tail grows to 10 mm; birth occurs (22nd day in rat, 19th day in mice) T A B L E A 2 DEVELOPMENT OF THE SENSE ORGANS (Based largely upon Witschi, 1962)
Age = days after fertilization, i.e. copulation age minus 8 hours. Size — largest dimension of embryo in natural position
S tandard A ge (days) Size (m m ) Structural Development S tages (W itschi)
15 10 2 Optic sulci. Otic placodes 16 10.5 2 .4 Olfactory pads. Optic bulbs. Otic cups 17 11 3.3 Olfactory placodes. Optic bulbs and stalks. Closing otic cups 18 1 1.5 3 .8 Olfactory placodes. Lens placodes; optic bulbs contact epidermis; stalks short. Otic vesicles closed 19 11.75 4 .2 Olfactory saucers. Beginning invagination of optic bulbs and lens placodes. Otic vesicles with short endolymphatic duct 22 12.125 5 .2 Simple olfactory cups. Lens cups begin to close; optic bulbs with choroid fissure; nervous layer of retina thicker than pigment layer. Otic vesicles with endolymphatic duct 23 12.25 5 .6 Olfactory pits. Lens sacs with fairly large pore. Endolymphatic duct turns dorsally 24 12.375 6 Deep olfactory pits flattening. Lens sacs with closing pore; optic stalks elongate 25 12.5 6 .2 Deep olfactory pouches with median évaginations (vomeronasal organ); nerve fibres growing out from olfactory epithelia. Lens sacs closed, detach from epidermis; lenses differentiate into epithelial and fibrous parts; optic cups and stalks with deep choroid fissure; hyaloid vessels and plexus; vitreous mesenchyme; nervous layer of retina 4 times as thick as pigment layer. Otic vesicles laterally compressed, utricular and saccular parts recognisable. 26 12.75 7 Narrow olfactory pouches; elongating tube-shaped vomeronasal organs. Lenses with small round cavity. Cochlear rudiment projects from saccule 27 13 8 Bucconasal membranes; olfactory nerves approach brain; primordial welts of 2 conchae. Lens cavity slit-like; vitreous body. Semicircular primordial pouches of utricle 28 13.5 8.5 Olfactory nerves reach brain; primordial welts of 3 conchae. Lens cavity disappears, fibre part 8 times as high as epithelial cells; invasion of mesenchyme between lens and epidermis; choroid fissure closed; hyaloid canal. Endolymphatic duct projects dorsally far beyond otic vesicle; semicircular pouches project further 29 14 9.5 Bucconasal membranes of choanae rupture; precartilaginous condensations of nasal capsule and septum. Vertical diameter of lens greater than horizontal; nervous layer of retina 8 times as thick as pigment layer; optic nerve fibres grow into stalk; eyelids; condensations of ocular muscles. Anterior semicircular canals just forming; ampullary branches of vestibular nerves; opening of external ear ducts by changes from irregular visceral groove to round pore; precartilaginous condensation of otic capsules. 31 15 12 Partly cartilaginous nasal septum and capsule. Anterior eye chamber; iris folds at free border of retina; lumen of eye stalks disappearing; fibres of optic nerve reach brain; ocular muscles innervated. All semicircular ducts well differentiated, slender, with ampullae; cochlear process has accomplished 1st spiral turn; tympanic cavity from distal recess of 1st pharyngeal pouch; cartilaginous development of otic capsule and of auditory ossicles; external acoustic meatus partly covered by folding pinna 32 15.5 14 Slit-shaped choanae (1 mm long); 3 conchae as high as thick; vomeronasal organs long (0.8 mm), thick-walled tubes in septum; some periderm growth in nares; nasolacrimal duct. Cornea and sclera attain condition of mesenchyme layer around eyeball. Chondrification of otic capsule progressing; utriculosaccular duct constriction; cochlear duct 1 V a turns; starting condensation of spiral ganglion; pinna bent over outer opening of acoustic meatus. 33 16 15.5 Palatine processes meet medially, dividing each primary choana into an anterior pore (nasopalatine duct) and a longer posterior (secondary) choana. Eyelids slowly growing. Perilymphatic mesenchyme within cartilaginous otic capsules; external acoustic meatus closing, periderm fills deepest recess 34 17-18 16-20 Completion of palate (except incisive foramen) adds a long nasopharyngeal meatus to olfactory cavity of nose; secondary choanae open into this duct; nares plugged with periderm. Eyelids growing, rapidly closing; cornea and sclera are stratified epithelia; single, nucleated neuroblast layer; fibrous layer measures up to Ve thickness of nervous retina. Endolymphatic sac expanding; cochlea, 1 % turns; vestibular nerve, spiral ganglion; proximal 1st pharyngeal pouch reduced to short auditive tube; otic capsule extensively chondrified; external acoustic meatus filled with periderm, opening covered by partly attached pinna 35a ante natal 19 20-40 Progressive development of conchae; lateral nasal mucus glands; nares plugged. Eyelids closed with periderm seal; retina with outer and inner nuclear layers and innermost fibrous layer; primordial ciliary ring. Cartilage of otic capsule sharply delineated from perilymphatic loose mesenchyme; wide endolymphatic sac; endolymphatic-utricular-saccular-reunient duct system slender, essentially adult condition; cochlear duct with 2 ‘4 turns; middle ear cavities complete, with tympanic cavity, auditive tube, and nasopharyngeal ostium; cartilaginous auditory ossicles embedded in mesenchyme; external acoustic meatus solidly filled with periderm
35b neonate 22 40 Nares open, periderm sloughed off, epithelium cornified. Eyelids sealed; cornea 3 times as thick as sclera, stratified folds of ciliary body project inside, ruffling base of iris. Otic capsules partly ossified; perilymphatic duct system; external meatuses completely plugged with periderm and covered with sealed-on pinnae
35c post-natal 1-17 p o st 40-100 Rapid functional development of sense organs enables young to leave nest at stage 36, partum 17 days postpartum, with eyelids and external ear ducts open PUBLICATIONS ARISING FROM THIS THESIS PUBLICATIONS ARISING FROM THIS WORK
Spencer-Dene, B., Thorogood, P., Harris, M., Henderson, B. Does neutral endopeptidase have a role in craniofacial development? Biochem, Soc. Trans., (1993), 21, 290S.
Spencer-Dene, B., Thorogood, P., Nair, S., Kenny, A. J., Harris, M., Henderson, B. distribution of, and putative role for, the cell-surface neutral metalloendopeptidases during craniofacial development. Development, (1994), 120, 3213-3226. (This paper has been bound in with this thesis after the bibliography)
176 Development 120, 3213-3226 (1994) 3213 Printed in Great Britain © Ttie Company of Biologists Limited 1994
Distribution of, and a putative roie for, the celi-surface neutrai metallo endopeptidases during mammalian craniofacial development
Bradley Spencer-Dene^’*, Peter Thorogood^, Sean Nair\ A. John Kenny^, Malcolm Harris^ and Brian Henderson^
■'Maxillofacial Surgery Research Unit, Eastman Dental Institute and University College Hospital London, Eastman Dental Hospital, 256 Grays Inn Road, London, W C1X 8LD, UK ^Developmental Biology Unit, Institute of Child Health, 30 Guilford Street, London WC1N 1EH, UK ^Department of Biochemistry and Molecular Biology, University of Leeds, Leeds LS2 8BS, UK
‘Author for correspondence
SUMMARY
; Endopeptidase-24.11 (neutral endopeptidase, neprilysin, been detectable in the craniofacial vasculature at E12 and I ‘enkephalinase’, EC 3.4.24.11) and endopeptidase-24.18 E14, this was no longer apparent at E16. Significantly, the (endopeptidase-2, meprin, EC 3.4.24.18) are cell-surface distribution of endopeptidase-24.11 mRNA closely : zinc-dependent metallo endopeptidases able to cleave a matched the immunolocalization of the protein at all stages I variety of bioactive peptides including growth factors. We investigated. j report the first study of the cellular and tissue distribution In order to explore the functional role of these enzymes, I of both enzymes and of the mRNA for NEP during inhibition studies were carried out using two selective I embryonic development in the rat. Endopeptidase-24.11 inhibitors of endopeptidase-24.11, phosphoramidon and j protein was first detected at ElO in the lining of the gut and, thiorphan. E9.5 and E10.5 embryos exposed to either at E12, the enzyme was present on the notochord, medial inhibitor displayed a characteristic, asymmetric abnor ! and lateral nasal processes, otocyst, mesonephros, heart mality consisting of a spherical swelling, possibly associated ; and neuroepithelium. In contrast, at this time endopepti- with a baematoma, predominantly on the left side of the dase-24.18 was present only on the apical surface of the prosencephalon, and the severity of this defect appeared to I neuroepithelial cells. By E14 and E16, NEP was also be a dose-dependent phenomenon. This study suggests that : detected in a wide range of craniofacial structures, notably these enzymes play previously unrecognized roles during the palatal mesenchyme, the choroid plexus, tongue and mammalian embryonic development. perichondrium. The distribution of endopeptidase-24.18 at these stages was restricted to the inner ear, the nasal Key words: membrane metallo-endopeptidases, neutral conchae, and ependymal layer of the brain ventricles and endopeptidase-24.11, endopeptidase-24.18, craniofacial the choroid plexus. Although endopeptidase-24.11 had morphogenesis, mammal
INTRODUCTION while endopeptidase-24.18 hydrolyses bonds adjacent to aromatic residues, but the attack may be on either side of such Mammalian cells synthesize two main classes of metallo residues (Stephenson and Kenny, 1987; Wolz et al., 1991). In endopeptidases, those that are secreted and participate in recent years, these enzymes have been shown to be capable of remodelling of the extracellular matrix, such as collagenase hydrolysing a variety of neuropeptides and peptide hormones and stromelysin (Henderson and Blake, 1994) and the cell- (Erdos and Skidgel, 1989; Price et al., 1991; Choudry and surface metallo-endopeptidases which play a role in the inac Kenny, 1991), including growth factors and cytokines (Kenny tivation of biologically active peptides (Kenny et al., 1989; and Ingram, 1987; Katayama et al., 1991). Additionally, two Erdos and Skidgel, 1989). Two well-studied examples of the NEP substrates, the tachykinin, substance P, and the major latter are endopeptidase-24.11 and endopeptidase-24.18. Both bacterial chemotactic peptide formyl-Met-Leu-Phe provoke enzymes are transmembrane, zinc-containing metallo rapid changes in the migration, morphology and adhesion endopeptidases found on the outer aspect of the plasma molecule expression of human neutrophils. These changes are membrane of a variety of cells. Both are abundant on the brush potentiated when endopeptidase-24.11 is inactivated by the borders of the epithelial cells lining the adult kidney proximal selective inhibitor, phosphoramidon (Shipp et al., 1991). tubule and intestine (Ronco et al., 1988; Barnes et al., 1989; Molecular cloning and expression studies have demon Corbeil et al., 1992). Endopeptidase-24.11 cleaves peptide strated that endopeptidase-24.11 is identical to CD 10 bonds involving the amino function of hydrophobic residues. (CALLA, common acute lymphoblastic leukaemia antigen) 3214 B. Spencer-Dene and others
(Letarte et al., 1988; Chen et al., 1992). This finding, and the Detergent solubilization of a membrane preparation from observation that CD 10 is expressed by foetal haematopoietic embryos cells (Hokland et al., 1983), has led to speculation that El 4 rat embryos were removed from the uterine horns and homoge endopeptidase-24.11 may play a role in the control of growth nized in 50 mM Tris/RCl buffer (pR 6.5) containing 0.1 mM phenyl- and differentiation in both haematopoietic and epithelial cell methylsulfonylfluoride (PMSF) at 4°C. This homogenate was cen systems (Kenny et al., 1989; LeBien and McCormack, 1989), trifuged for 5 minutes (1000 g) at 4°C, and the supernatant was possibly regulating local concentrations of active peptides, retained and centrifuged at 100,000 g for 1 hour, using a Kontron such as growth factors, at the cell surface. ultracentrifuge, to collect a membrane fraction. Membranes were resuspended in 10 mM Tris-RCl (pR 7.5) containing 0.1 mM PMSF, It is apparent from the limited information available that the 0.1 nfM pepstatin A, 0.1 mM 1,10 phenanthroline and 0.5% Triton expression of various peptide growth factors and their X-100 and left at 4°C overnight to solubilize the membrane enzymes. receptors is under developmental regulation during craniofa Insoluble material was removed by centrifugation at 100,000 g for 1 cial morphogenesis (reviewed by Slavkin, 1990; Lee and Han, hour and the supernatant retained and stored at -70°C. 1991; Vainio et al., 1993). Recent evidence strongly suggests that some of these factors, such as transforming growth factors Microvillar membranes from rat kidneys a and (3, are likely to be critically important in normal growth These were prepared as described previously (Booth and Kenny, and development of the facial primordia (Wilcox and Derynck, 1974). The final pellet was resuspended in the same Tris-RCl/protease 1988; Mahmood et al., 1992; Frenz et al., 1992). Thus, inhibitor buffer as used for the embryo membranes. although their precise and respective contributions remain to Western blotting be fully defined, it is clear that regulatory growth factors have Kidney microvilli and embryo membranes were separated by SDS- pivotal roles in craniofacial morphogenesis and, presumably, PAGE according to Laemmli (1970) and were transferred to nitro dysmorphogenesis. cellulose membrane according to Towbin et al. (1979). Blots were We postulate that, given their known role in postembryonic incubated with either RARE or RRtl51 (1:1000) for 1 hour, rinsed tissues, endopeptidase-24.11, endopeptidase-24.18 and related with distilled water and Tris-buffered saline-Tween-20 (TBST), then enzymes may have a significant, but as yet unrecognised, mor incubated with goat anti-rabbit peroxidase-conjugate (DAKO, UK; phogenetic role in the growth and development of embryonic diluted 1:500 with 5% skimmed milk in TBST+5% rat serum) for 1 craniofacial tissues. Here we report, for the first time, the suc hour, rinsed and washed as above and developed with 4-chloro-1 - cessful immunolocalization of both endopeptidase-24.11 and naphthol. endopeptidase-24.18, and the in situ hybridization of endopep To establish the specificity of antibody binding both to the embryo tidase-24.11 mRNA in postimplantation rat embryos at various and kidney membrane preparations, the antibodies were preincubated with either purified endopeptidase-24.18 or purified kidney membrane critical stages of craniofacial development. We describe preparation prior to blotting. patterns of distribution of both message and gene product in the craniofacial tissues and consider possible roles of these Preparation of embryos for immunohistochemistry enzymes during craniofacial morphogenesis. Wistar rats (Charles Rivers, UK) were mated and the date of vaginal The increasing understanding of the role played by endopep plug detection designated day 0 (EO). Rats were killed by cervical dis tidase-24.11 in hydrolysing and inactivating enkephalins and location following CÜ 2 anaesthesia at ElO, 12, 14 or 16 o f gestation. natriuretic peptides has led to many synthetic inhibitors of Embryos were dissected out in PBS and fixed in 4% paraformaldehyde endopeptidase-24.11 being clinically evaluated as analgesics and in PBS overnight at 4°C. In the case of the E16 embryos, only the heads as therapeutic agents in cardiac failure (reviewed by Wilkins et were used. Embiyos were transferred into cryoprotectant (20% (w/v) al., 1993). We have taken advantage of these inhibitors to test sucrose/PBS solution) for 5-10 hours at 4°C and then each embryo was mounted and orientated in OCT (Miles Inc., USA) rapidly frozen and whether inhibition of endopeptidase-24.11 may have any stored at -70°C. The kidneys from the mothers were removed and demonstrable effects on embryogenesis and report the results of processed as above, as a positive control tissue. Cryostat sections (8 perturbation experiments using a whole embryo culture |im) cut from embryos and kidneys were thaw-mounted onto glass technique (Cockcroft, 1990) with two selective endopeptidase- slides precoated with 3-aminopropyltriethoxysilane (Sigma, UK) and 24.11 inhibitors, phosphoramidon and thiorphan. stored at -70°C. For all stages used, representative sections from indi Given that endopeptidase-24.11 and endopeptidase-24.18 vidual embryos from four separate litters were independently examined. have the ability to hydrolyse many simple biologically active peptides (and possibly some cytokines), our results suggest Immunohistochemistry possible roles for these enzymes in the control of cell growth, (I) Endopeptidase-24.11 differentiation and movement. This, we believe could consti The presence of endopeptidase-24.11 on frozen sections was localized tute a previously unrecognised level of developmental control by an immunoperoxidase staining procedure using RARE and PRM- during craniofacial morphogenesis. 6. Sections were incubated in 1% hydrogen peroxide in methanol to quench endogenous peroxidase activity. Non-specific protein binding was blocked by incubating sections with 20% non-immune goat serum for 15 minutes. The sections were subsequently incubated for MATERIALS AND METHODS 1 hour with 1° antibody (RARE diluted 1/1000, or PRM-6 at 1/250 in PBS + 0.1% BSA), and then with a goat anti-rabbit (goat anti Antibodies mouse for PRM-6) peroxidase conjugate for 30 minutes. This was RARE, a polyclonal rabbit anti-human enkephalinase, (Genentech, diluted to 1/300 in PBS plus 2% normal rat serum and preabsorbed USA); PHM-6, a monoclonal mouse anti-human CALLA, (Monash with ‘rat powder’ (Barnes et al., 1989). Sections were finally Medical Centre, Australia); RRtlSl, a polyclonal rabbit anti-rat incubated in 2.5 mg/ml of diaminobenzidine (DAB) in PBS contain endopeptidase-24.18 produced by one of the authors (A. J. K.). Both ing 0.01% hydrogen peroxide. This step was amplified with nickel RARE and PRM-6 were found to cross-react with rat NEP. chloride when necessary. All reagents used were from Sigma, UK. Peptidases in craniofacial development 3215
All steps were separated by 2x 10 minute washes of PBS (or 0.1 M homology with the active site of endopeptidase-24.11, which is itself acetate buffer for the nickel enhancement) and all incubations took unique amongst mammalian metalloproteases (Jiang and Bond, place at room temperature in a humidity chamber. Sections were 1992), and therefore phosphoramidon efficiently inihibits endopepti- counterstained with M ayer’s Hacmatoxylin or Neutral Red (both from dase-24.11 (K|=2 nM). Phosphoramidon was dissolved in distilled BDH, UK), dehydrated, cleared and mounted in DPX (BDH, UK). water at 1 mg/ml and diluted to final inhibitor concentrations of 100 To control for non-specihc binding, sections were routinely pM , 10 pM , 1 pM , 100 iiM and 10 nM in diluted rat serum. Control incubated in the absence of 1° or 2° antibodies. Controls using RAHE, embryos were cultured in diluted rat serum only. which had been incubated overnight at 4°C with 0.7 mg/ml of the Thiorphan (3-mercapto-2-benzylpropanoylglycine, Sigma, UK) kidney microvillar membrane preparation to preabsorb out endopep was the first, potent synthetic inhibitor of endopeptidase-24.11 tidase-24. 1 1, were also included. (Ki=2.5 nM ) (Roques et al., 1980). This was dissolved in 3% ethanol in water in the same concentration range as phosphoramidon. Control (II) Endopeptidase-24.18 embryos were cultured in diluted serum ± 3% ethanol. Endopeptidase-24.18 was localized on rat tissue using the same indirect immunoperoxidase technique. Sections were incubated for 1 Histology hour with RRtl51 diluted 1/100 in 0.1% BSA/PBS. Embryos were dissected from their yolk sac and amnion and fixed in In control experiments, RRtl51 or the peroxidase conjugate were formalin for 24 hours, dehydrated through an ascending ethanol series omitted and replaced with PBS. Further controls to validate specihc and em bedded in filtered histology-grade wax. Sections were cut at 5 endopeptidase-24.18-positive staining involved replacing RRtl51 pm and mounted onto APES-coated slides. Sections were then taken with preim m une rabbit serum, or with RRt 151 that had been incubated through a routine Haematoxylin and Eosin staining procedure, and overnight at 4°C with the purified enzyme (Kenny and Ingram, 1987) photographed using TMAX 100 film. or 0.7 mg/ml of the kidney microvillar membrane preparation to preabsorb out its immunoreactivity. Scanning electron microscopy All embryo sections were photographed under bright field on an Prior to fixation, extraembryonic membranes were removed and the Olympus BH2 photomicroscope using Kodak Ektachrome 64 T film. embryos washed in sterile Hanks’ saline. Embryos were fixed in 25% In situ hybridization glutaraldebyde, 0.2 M cacodylate buffer, pH 7.2 for 48 hours, rinsed in cacodylate buffer then dehydrated. Embryos were dried in a This was carried out according to the protocol described by W ilkinson and Green ( 1990). The anti sense probe, labelled witb |-^-‘'S]U TP, was critical-point drier (Balzer, UK), and then sputter coated (Polaron, transcribed from complementary DNA wbich had been subcloned into UK) with a 60:40 gold-palladium alloy. Specimens were viewed on Bluescript (Strategene, UK). Tbis cDNA corresponded to the full- a Cam bridge 90 Stereoscan scanning electron microscope (Cam bridge length sequence of rat endopeptidase-24.1 1 (M alfroy et al., 1987). A Instruments, UK). sense probe was also transcribed and used as a negative control. Each section received 10 pi of the appropriate probe, equivalent to 10^ cts/minute/pl, overnight at 55°C. Slides were dipped in Ilford K5 RESULTS emulsion (Ilford, UK), developed after 4 days, counterstained with haematoxylin, dehydrated and mounted. Western blots Whole embryo culture Protein bands with molecular weights corresponding to the pre Pregnant W istar rats (Charles Rivers, UK) were killed by cervical dis viously shown values for both endopeptidase-24.11 and location whilst under CO: anaesthesia. The E9.5 and E l0.5 concep- endopeptidase-24.18, a single 94 kDa band and two bands at tuses were dissected free from maternal decidua and Reichert’s 80 kDa and 74 kDa respectively, were detected in both the rat m embrane leaving the yolk sac, amnion and ectoplacental cone intact. kidney and EI4 embryo membrane preparations (Fig. 1 ). They were then transferred into sterile 30 ml uni versais (Sterilin, UK), containing 1 ml/embryo of immediately centrifuged rat serum (prepared according to Cockcroft (1990) and supplied by Harlan Olac, UK.) diluted 3:1 with sterile Hank’s saline. The embryos were cultured at 37°C in a temperature-controlled rotator apparatus (Cockcroft, 1990). Embryos at E9.5 when culture commenced, received an initial gas mixture comprising 5% oxygen, 5% CO: and the balance nitrogen. After 25 hours the oxygen con 1 2 3 4 centration was increased to 20%, and after 44 hours to 40%. Embryos at E l0.5 received an initial gas mixture containing 20% oxygen. After 21 hours this was increased to 40%, and to 95% after 29 hours. E9.5 Em bryos were cultured for 48 hours and E l0.5 for 45 hours. All gases were supplied by BOC, UK. 9 4 - - 8 0 -7 4 Inhibitor treatment The two inhibitors of endopeptidase-24.1 1 used in this study are phos phoram idon and thiorphan, which differ in the functional moiety that co-ordinates the zinc ion at the active site of the enzyme. Both inhibitors are highly selective for this enzym e, for reviews see W ilkins Fig. 1. W estern blot analysis of adult kidney m icrovillar membrane et al. (1993) and Roques et al. (1993). preparation (7 pg total protein/lane), lanes 1 and 3, and an E14 Phosphoramidon (N-(-L-rhamnopyranosyloxyhydroxyphosphinyl)- embryo m embrane preparation (35 pg total protein/lane), lanes 2 and L-leucyl-L-tryptophan, Sigma, UK) is a natural metabolite produced 4. The endopeptidase-24.11 and endopeptidase-24.18 present in the b y Streptomyces tcinashiensis which is a specific, competitive adult rat kidney are identical to those found in the embryo. Bands are inhibitor of the bacterial enzyme thermolysin (Umezawa, 1972). The visible at 94 kDa for endopeptidase-24.11 and at 80 kDa and 74 kDa structure of the active site of thermolysin exibits a high degree of for endopeptidase-24.18. 3216 B. Spencer-Dene and others
Table 1. Summary of immunostaining of rat embryos at E12, E14 and E16 for Endopeptidase-24.11 and Endopeptidase- 24.18 in the craniofacial region
T issu e Endopeptidase-24.11 immunoreactivity Endopeptidase-24.18 immunoreactivity
Ependymal cells Positive at all stages, strong at E l4 Positive at all stages Choroid plexus: m e se n c h y m e Positive at E l4 and E l6 Strongly positive at E14, positive at El 6 e p ith e liu m P o sitiv e a t E l 4 an d E l 6 Negative at E l4 and E16 Otocyst/Ear Positive at El 2-El 6 Positive at all stages Eye (lens and neural retina) Positive at E14 and E l6 Weakly positive at E14 and E16 2° Palate mesenchyme Positive at E l4, strong at E16 Negative at all stages T o n g u e Positive at'E14 and E16 Negative at all stages Craniofacial vasculature Positive at E12 and E14, negative at E16 Negative at all stages Perichondrium Positive at E14 and E16 Negative at all stages Nasal epithelium Weakly positive at El 4 and E16 Positive at all stages Nasal mesenchyme Strongly positive at E l2 and E14, negative at E16 Negative at all stages N o to c h o rd Positive at all stages Negative at all stages
Overnight incubation of both antibodies with the kidney luminal surface of both the gut (Fig. 2D) and mesonephric microvillar membrane preparation blocked staining of both epithelium. In addition, the pericardium and endocardial kidney and embryo membranes. Similarly, incubation of cushions in the heart were strongly positive, whilst the myocar RRtlSl with purified rat endopeptidase-24.18 completely dial cells exhibited weaker positive staining. By E14, positive abolished binding of the antibody to the endopeptidase-24.18 staining was observed in the cells enveloping the vertebrae, bands from kidney and embryo preparations (data not shown). epithelial lining of the gut, mesonephros and bronchi, These western blot experiments therefore demonstrated that diaphragm, notochord, the dura mater surrounding the spinal the antibodies used in this study recognised antigens with cord and the heart. We have no data regarding endopeptidase- identical molecular weights as observed in the adult rat kidney 24.11 localization in postcranial sites in the E16 rat embryo m em branes. since only the craniofacial region was investigated at this later stage. Immunohistochemical distribution of endopeptidase-24.11 in the craniofaciai region In situ hybridization of endopeptidase-24.11 The tissue localization of endopeptidase-24.11 was studied by Gene expression of endopeptidase-24.11 closely matched the an indirect immunoperoxidase method with nickel chloride distribution of the endopeptidase-24.11 antigen both in enhancement where necessary; the results are summarised in location and signal intensity at E12 and E14. Of particular note Table 1. All positive staining was abolished by preabsorption was the expression in the medial and lateral nasal process mes of RAHE with the rat kidney membrane preparation. Binding enchyme, and to a lesser extent on the otocyst epithelium and in the adult rat kidney was confined to the brush border of the on the first branchial arches. The expression throughout the proximal convoluted tubules and Bowman’s capsule (Fig. 2A). notochord was extremely intense at this stage (Fig. 4B). At BIO the luminal surface of the gut ectoderm exhibited At F 14, the strongest expression in the craniofacial region strong staining. At E l2, endopeptidase-24.11 was detectable was in the oral and nasal tissues (Fig. 4C), and the choroid mainly in mesenchymal component of the medial and lateral plexus was also positive (Fig. 4D). Many other postcranial sites nasal processes, the notochord and on the luminal surface of were strongly positive (Fig. 4A) including the lungs, the otocyst epithelium and the branchial arteries. The rest of mesonephros, intestine, notochord and surrounding the the craniofacial vasculature exhibited moderately strong vertebrae. The craniofacial vasculature expression at both positive staining. In E14 embryos, strong staining in the stroma and on the luminal/ventricular surface of the choroid plexus Fig. 2. (A) Immunolocalization of endopeptidase-24.11 in the adult (Fig. 2E), the ependymal lining of the brain ventricles, the rat kidney. Positive staining is confined to the brush border of the basilar and carotid arteries and the basilar sulcus in the pons. epithelia lining the proximal convoluted tubules and on the At E l6, the palate, root of the tongue, choroid plexus, Bowman’s capsule (arrow); Distal convoluted tubules are negative. ependymal lining and several discrete sites in the eye and inner (B) Immunolocalization of endopeptidase-24.18 in the adult rat ear all exhibited positive staining of various degrees of kidney. Positive staining is confined to the brush border of the intensity (see Fig. 3A,B). All the facial vasculature, cartilage epithelia lining the proximal convoluted tubules. (C) The and bone including the nasal septum and conchae and Meckel’s perichondrial layer (arrowheads) surrounding the developing hyoid cartilage were negative. However, there was a distinct popula cartilage, like all perichondria, exhibit strong endopeptidase-24.11 tion of positively staining cells in a perichondrial layer immunoreactivity at E16; differentiated chondrocytes are negative. enveloping Meckel’s cartilage and other craniofacial skeletal (D) At E12, endopeptidase-24.11 is strongly immunolocalized on the elements (Fig. 2C). luminal surface of the hind gut (G) endoderm and on the notochord (N). The immunoperoxidase staining has been amplified using a Immunolocalization of endopeptidase-24.11 in other DAB-enhancement technique. (E) Positive endopeptidase staining is tissu es evident in the mesenchymal stroma and on the apical surface of the epithelia (arrows) covering the choroid plexus at E14. (F) At E14, Endopeptidase-24.11 was localized in several other areas the luminal surface of the choroid plexus, exhibits strongly positive across the developmental period studied. At E l2 there was endopeptidase-24.18 staining, and in contrast to endopeptidase-24.11 intense positive staining within the notochord and on the immunoreactivity, the stroma is completely negative. Bars, 50 |im. Peptidases in craniofacial development 3217 3218 B. Spencer-Dene and others
NS
f A.
*
* M 3A B M
4. ;
ÀM
OC ' V.
,4, % % ■ V 4L — D #
. .ak/' \ % - r . m # # E - Peptidases in craniofacial development 3219
Table 2. Results of phosphoramidon exposure on E9.5 rat embryos in vitro
Y o lk sac C ro w n -ru m p % C ra n io In h ib ito r N o . o f d ia m e te r le n g th % S o m ite % H e a rt % Y o lk sac facial * Severity c o n c . e m b ry o s m m ± s.d . m m ± s.d . T u rn e d no. ± s.d . b e a tin g circulation d e fe c t o f d e fe c t
0 (Control) 25 3 .1 9 ± 0 .2 4 3.06±0.52 85.7 2 4 .8 ± 1 .7 9 100 100 0 - 10 n M 16 2 .6 3 + 0 .2 5 2.35±0.18 35 21.75±0.5 100 100 25 + 100 nM 19 3.25±0.2 2.88±0.63 100 24.5±0.58 100 100 25 + + 1 |iM 22 2.88±0.14 3.06±0.31 75 2 2 .2 5 ± 2 .2 2 75 75 4 2 .5 + + 10 g M 16 3.13±0.25 2.94+0.43 75 22.75±0.96 100 100 25 + + + 100 g M 12 3 .1 7 ± 0 .2 9 3 .0 8 + 0 .1 4 100 23.67±1.15 100 100 33 + + +
* Severity of the defect is measured on a scale from - (normal appearance) to +++ (grossly abnormal appearance, including open cranial folds, clearly discernible baematoma and dysmorphic branchial arches).
Table 3. Results of phosphoramidon exposure on E10.5 rat embryos in vitro
Yolk sac Crown-rump In h ib ito r N o . o f d ia m e te r le n g th % S o m ite % H e a rt % Yolk sac % C ra n io ^ S e v e rity co n c . em b ry o s m m ± s.d . m m + s.d . T u rn e d n o . ± s.d . b e a tin g circulation facial defect o f d e fe c t
0 (Control) 11 4.43±2.51 4.3+2.0 100 3 1 .1 6 ± 1 .5 2 100 100 0 - 10 n M 27 4.1±3.6 4.03±3.78 100 27.33±3.05 100 100 46 + 100 n M 23 4.2+3.Ô 4.05±3.01 100 28.33±3.21 100 100 25 + 1 [iM 9 3.78±4.91 3.36±7.95 100 28.4+4.39 72 54 7 2 + + 10 |0,M 9 4.26±0.57 4.3±1.0 100 29.33±1.15 100 100 33 + + 100 p M 9 3.56±8.14 3.4±3.6 100 28.67±1.15 100 67 33 + +
*Severity of the defect is measured on a scale from - (normal appearance) to +++ (grossly abnormal appearance, including open cranial folds, clearly discernible baematoma and dysmorphic branchial arches).
stages was not appreciably intense. The sense control gave no displayed no detectable staining for this enzyme. In older positive signal and extremely low background. embryos, the luminal surface of the neuroepithelium demon strated a particularly striking pattern of distribution, and this Distribution of endopeptidase-24.18 in the was best exemplified by the choroid plexus and the ependymal craniofaciai region lining of the developing brain ventricles (Fig. 2F). The The tissue distribution localization of this enzyme was studied intensity of staining on the epithelial cells lining the choroid by both indirect immunoperoxidase and immunofluorescence. plexus decreased between E14 and E l6. The developing lens When sections of adult rat renal cortex were stained (as a and pigmented layer of the retina exhibited moderately positive positive control), staining was restricted to the brush border of staining at E l6, but earlier embryos displayed only negligible the proximal convoluted tubules (Fig. 2B). staining at these locations. Immunolocalization of endopeptidase-24.18 in the develop The most striking pattern of endopeptidase-24.18 distribution ing head and face was confined to discrete sites with a distri was that displayed in the developing inner ear. At E l2, there was bution which seems to be temporally regulated; this is sum a diffuse and moderately intense positive stain on the apical marised in Table 1. All positive staining disappeared when surface of the cells lining the otic vesicle. By E14 the positive RRtl51 was preabsorbed with either rat kidney microvilli or staining appeared considerably stronger, specifically locahzed to purified endopeptidase-24.18 (Fig. 2E,F). ElO embryos the stria vascularis and not detectable on the developing hair cells. Organ of Corti or the tectorial membrane. This distribution Fig. 3. (A) Central regions of the palatal shelf mesenchyme pattern is still apparent in the cochlea at E16 (Fig. 3C-F). In some (asterisks) display positive endopeptidase-24.11 immunoreactivity at E l6 embryos, the epitheha lining the oral and nasal cavities E16; nasal septum (NS) is negative, (no counterstain). Bar, 50 pm. showed a variable distribution of endopeptidase-24.18. A few (B) At E16 endopeptidase-24.11 is localized on the genioglossus other postcranial sites in the E14 embryos stained positively for muscle (asterisks) in the root of the tongue; Meckel’s cartilage (M) is endopeptidase-24.18, notably in the bladder, ureter and gut. negative, (no counterstain). Bar, 50 pm. (C) In the E16 inner ear, endopeptidase-24.18 is confined to the luminal surface of the stria vascularis and Reissner’s membrane, within the cochlear duct Perturbation studies (arrows); otic capsule (OC) is negative. Bar, 100 pm. (D) Higher The results of the perturbation studies are summarized in magnification of part of C to show positive immunoreactivity on stria Tables 2, 3 and 4. Following culture with two inhibitors of vascularis (SV) and the adjacent part of Reissner’s membrane (RM); endopeptidase-24.11, SEM revealed that a proportion of the the region from where the sensory epithelium (asterisk) will inhibitor-treated E9.5 embryos displayed an asymmetric, pre differentiate remains negative. Bar, 50 pm. (E,F) Transverse section through an E l6 semicircular canal. (F) Endopeptidase-24.18 is only dominantly left-sided, facial deformity which appeared to be localized on the surface of the non-sensory cells. (E) An adjacent due to the presence of a haematoma-like swelling adjacent to section incubated with RRtl51 which was preabsorbed overnight the prosencephalon. This often had the effect of distending the with purified endopeptidase-24.18 shows that all positive staining left side of the head which in turn disrupted the normal posi has been extinguished. Bar, 50 pm. tioning of the first and second branchial arches. In the most 3220 B. Spencer-Dene and others
severe cases, observed at the highest inhibitor concentrations, proportionately swollen, in a midline position and seemed not the swelling was so great that the anterior neural folds could to have undergone normal looping morphogenesis. not close. Cultured E9.5 embryos are shown in Fig. 5A-D. The El0.5 embryos also displayed an inhibitor dose- Control embryos, cultured in diluted serum only, developed dependent abnormal left-sided prosencephalic swelling (Fig normally. The severity of the defect, but not the incidence, 6A-D). None of the E l0.5 embryos had open anterior neural generally increased as inhibitor concentration increased. In folds but the branchial arches were often displaced asymmet addition to these craniofacial effects, the heart appeared dis rically and of abnormal appearance, whilst after exposure at
# 4 -
Fig. 4. (A) Bright-held image of a sagittal section through an E14 embryo probed for endopeptidase-24.11 mRNA using in situ hybridization. The mRNA is localized in several discrete locations including the lining of the lungs (asterisk), the cells enveloping the vertebrae (small arrowheads), the lining of the intestine (small arrow), within the choroid plexus (large arrow) and in the notochord, shown here caudally in oblique section (large arrow head). Bar, 100 pm. (B) Bright-held image of a transverse section through the notochord (arrow) of an E 12 embryo probed for endopeptidase-24.11 mRNA. Bar, 50 pm. (C) Dark-held image showing the oral and nasal tissues at a higher magnihcation. The silver grains (white) are intensely localized throughout most of the nasal mesenchyme (N), throughout the lower jaw (M) and tongue (asterisk). Also in the roof of the oral cavity/ secondary palate (arrow) and in the oesophagus (arrow head). Bar, 100 pm. (D) Higher magnihcation bright-held image of the E 14 choroid plexus. In addition to the mesenchymal distribution, there appears to be some degree of heterogeneity shown by the epithelial localization of the mRNA. Bar, 50 pm. Peptidases in craniofacial development 3221 this later stage, the heart morphogenesis appeared grossly developmentally regulated manner. We have therefore studied normal. Our assessment of relative normality was based upon the distribution of endopeptidase-24.11 mRNA using a radio the following criteria; yolk sac diameter and circulation, labelled full-length complementary RNA probe, containing crown-rump length, turning and presence of a beating heart sequences common to all known transcripts, to assess the pos compared with the control embryos. sibility of transcriptional control occurring during embryoge Subsequently, histological analysis of embryos treated at nesis. In situ hybridisation reveals the regional presence of E9.5 revealed that the swelling was typically the result of both message as early as E l2, and reverse transcriptase-PCR a localised overgrowth of the prosencephalic neurectoderm on analysis has enabled the detection of message as early as E8 the left side (Fig. 7A) and a gross distension of the internal and indicates the existence of a novel, embryo-specific spliced carotid artery on the same side (Fig. 7B). More caudally, this variant (work in progress). vascular disturbance extended to include the first branchial The present investigation substantiates the previous work of artery, which like the internal carotid arises from the dorsal others, in which the various locations of endopeptidase-24.11 aorta, and displayed distension. A presumed secondary effect in the adult rat central and peripheral nervous systems are of this was the lateralward displacement of the first branchial described employing both immunocytochemical (Ronco et al., arch (Fig. 1C) as seen in the SEM. 1988) and autoradiographic techniques (Waksman et al., 1986). Of the few related studies, endopeptidase-24.11 distri bution in the foetal and postnatal rat has been localized indi- DISCUSSION
Protein and mRNA distributions This study is the first report describ ing the localization of both endopep tidase-24. 11 and endopeptidase- 2 4.18 im m unohistochem ically during mammalian embryogenesis, and to demonstrate a functional role for one of these endopeptidases during craniofacial development. Using immunohistochemistry, we have established that both endopep tidase-24. 11 and 24.18 are present in discrete locations in the rat embryo during a period of active craniofa cial morphogenesis. Certain regions within the adult rat brain, for example the globus pallidus, have been shown to display different distributions of NEP protein compared to mRNA (Wilcox et al., 1989). In addition, at least five alternative splice variants of NEP have been identified ê (D’Adamio et al., 1989; Llorens- Cortes et al., 1990; lijima et al., 1992). Given that the NEP gene is constitutively expressed in some tissues and is developmentally regulated in other cell types (i.e. lymphocytes and granulocytes), it is possible that the transcription of endopeptidase-24.11 is controlled by alternative promoter activation. Fig, 5. (A) E9.5 rat embryos cultured in control serum for 48 hours; frontal view. Bar, 200 pm. The substantial conservation of (B) E9.5 embryo cultured for 48 hours in serum containing 10 nM phosphoramidon; note the failure of neural fold fusion over forebrain (arrow) Bar, 200 pm. (C) E9.5 embryo cultured for 48 5' untranslated regions between hours in serum containing 100 nM phosphoramidon. Note complete failure of cephalic neural folds different species and the existence closure and lateral distension of the left side of the head (arrow). Bar, 100 pm . (D) E9.5 em bryo of 5' alternative splicing suggest cultured for 48 hours in serum containing 100 pM phosphoramidon; note open neural tube, a that endopeptidase-24.11 gene general asymm etry to the head and the swelling (arrow) of the telencephalic neuroepithelium into expression may be differentially the lumen, caused by a subadjacent baematoma. The normal looping morphogenesis of the heart eontrolled in a tissue-specific and/or (asterisk) has also clearly been disturbed. Bar, 100 pm . 3222 B. Spencer-Dene and others rectly by the binding of a selective tritiated inhibitor of murine foetal lung maturation (King et al., 1993). The palatal endopeptidase-24.11, [^H]HACBO-Gly, (Dutriez et al., 1992). localization of endopeptidase-24.11 might reflect the presence A limited range of selected and unrelated tissues have been of TGFa or epidermal growth factor in the palatal mesenchyme studied, namely microvilli from human placental syncytiotro- (Dixon et al., 1991), although cleavage of either of these growth phoblast; foetal rabbit, rat and human small intestinal brush factors by endopeptidase-24.11 has yet to be demonstrated. border membranes; and nuchal ligaments from late-stage fetal However, TGFa is a known substrate of endopeptidase-24.18 calves (Johnson et al., 1984, 1990; Lecavalier et al., 1989). The (Choudry and Kenny, 1991). A recent study demonstrated that distribution patterns described here extends significantly the TGFpi could down-regulate endopeptidase-24.11 activity via a onset of endopeptidase-24.11 expression back into much reduction in the levels of the transcribed gene or possibly by earlier development and demonstrates, for the first time, an decreasing endopeptidase-24.11 mRNA stability (Caseyet al., embryonic presence of endopeptidase-24.18. 1993). Indeed, it has been proposed that the role of TGFjJl
Candidate substrates for endopeptidase-24.11 and endopeptidase-24.18 The hypothesis that these enzymes are involved in early developmental processes is based on the proposition that expression implies function and that the main function of these enzymes in the embryo is to deactivate peptide signals. The present work does not attempt to identify specific peptide sub strates within the various embryonic tissues in which the enzymes are found. However, some likely candidate sub strates can be recognised. In the adult, the roles of endopepti dase-24.11 include pain modulation via enkephalin degradation at central and spinal levels, osmoregulation via atrial natriuretic peptide (ANP) and degrada tion in the kidney and other peripheral sites. We have found that both endopep tidase-24.11 and 24.18 are expressed during eye development, and this corre lates with the presence of their putative substrates such as substance P, vasoac tive intestinal peptide, enkephalins, cal- citonin-gene-related peptide and Neu ropeptide Y in the adult eye (Stone et al., 1987). In the choroid plexus (which is involved in the production of cere brospinal fluid), ependymal lining of the brain ventricles and developing cardio vascular system, the substrate could possibly be ANP (Kenny and Stephen son, 1988). High densities of ANP receptors have been localized autoradi- ographically at these sites (Tong and Pelletier, 1990), which closely matches Fig. 6. (A) E l0.5 rat em bryo cultured for 45 hr in serum containing 10 nM phosphoramidon. the distribution of both endopeptidase- Embryo appears morphologically normal; lateral view. Bar, 200 pm . (B) E l0.5 rat embryo 24.11 and 24.18. cultured for 45 hours in serum containing 100 nM phosphoramidon. Note the swollen In the developing lung, the endopepti position of the anterior part of the side of the head (asterisk) and lateral distension of the left side of the head (large arrow). This asymm etry is associated with a lateral/ventral dase-24. 11 substrate may be substance P displacem ent of the left mandibular arch (arrowhead). Frontal view. Bar, 100 pm. (C) E l0.5 (Shepherd et al., 1988) or, more likely, rat embryo cultured for 45 hours in serum containing 1 pM phosphoramidon; note the grossly the bombesin-like peptides (Shipp et al., abnormal left side to the head with a swollen dysmorphic first arch and a distorted second 1991). Indeed, it has recently been arch. Lateral view. Bar, 200 pm. (D) E l0.5 rat embryo cultured for 45 hours in serum reported that the hydrolysis of the containing 10 pM phosphoramidon; Note the relatively distended left side of the bombesin-like peptides by endopepti prosencephalon (asterisk) and the asymm etry of the first branchial arch, similar to B. Frontal dase-24. 11 could control the rate of view. Bar, 100 pm. Peptidases in craniofacial development 3223
Table 4. Results of thiorphan exposure on E9.5 rat embryos in vitro
Y olk sac C ro w n -ru m p Inhibitor N o. o f diam eter length % Som ite % H eart % Yolk sac % C ran io *S everity conc. em b ry o s m m ± s.d. m m ± s.d. T u rn ed no. ±s.d. beating circulation facial defect o f defect
Serum only control 4 3.75±0.44 3.3±0.54 100 29±1.15 100 100 0 Serum + ethanol control 3 3.8±0.87 2.9±0.36 33 27±1.41 100 100 0 - 100 nM 6 1.85±0.33 1.53±0.38 33 17.83±1.33 100 100 0 + 1 p M 6 3.2± 0.62 3.06+ 0.64 33 24±1.73 50 50 33 4-4- 10 pM 6 1.8±0.44 1.63±0.20 0 17.3±1.15 50 50 33 4-4-4-
*Severity of the defect is measured on a scale from - (normal appearance) to +++ (grossly abnormal appearance, including open cranial folds, clearly discernible baematoma and dysmorphic branchial arches).
during chondrocyte differentiation is to regulate the expression is an oligomeric tetramer of subunits linked by disulphide of the matrix proteins and metalloproteases (Ballock et al., bonds. Initial research on the cloning and sequencing of the 1993). Such a relationship might explain the distribution of amino terminus of endopeptidase-24.18 identified it as a endopeptidase-24.11 that we have observed surrounding the member of the ‘astacin family’ of metallo-endopeptidases developing skeletal elements in the older embryos. (Dumermuth et al., 1991). All the enzymes in this family have Many of the regions where we have immunolocalized a zinc-binding metalloprotease domain which shares a high endopeptidase-24.18 in the rat embryo, particularly on the degree of homolgy with the domain found in astacin (EC choroid plexus and in the inner ear, are sites of ion trans 3.4.24.21), a protease from the crayfish Astacus fluviatilis portation. This enzyme may, therefore, have an important role (Shimell et al., 1991). Other enzymes attributed to this family in the production of cerebrospinal fluid and endolymph respec are ‘PABA-peptide hydrolase’ (Sterchi et al., 1982) and BMP- tively during mammalian craniofacial development. In the 1, bone morphogenetic protein-1 (both in humans), UVS.2 (in adult rat, comparison of the distribution patterns of these two Xenopus), the tolloid gene product (in Drosophila) (Finelli et neutral metallo-endopeptidases reveals a considerable differ al., 1994), and suBMP, blastula protein 10 and SpAN proteins ence, in terms of the number and variety of organs where these (in sea urchin) (Lepage et al., 1992; Reynolds et al., 1992; enzymes have been detected (Ronco et al., 1988; Barnes et al., Hwang et al., 1994). Since the members of the astacin gene 1989). This correlates with the comparative paucity of family are present in a wide variety of organisms and are endopeptidase-24.18 distribution in the embryo compared to conserved, they are likely to have similar functions. The con the relatively greater distribution of endopeptidase-24.11. clusion that they are involved in controlling the activity of growth factors, and thus are vital for specifying cell determi Endopeptidase-24.18 and the astacin family nation, developmental and differentiation events (Dumermuth Endopeptidase-24.18 is an unconventional peptidase in that it et al., 1991), therefore strengthens our contention that the cell-
S isiS v*
Fig 7. Haematoxylin and Eosin stained frontal section through an E9.5 rat embryo cultured for 48 hours in the presence of 1 pM phosphoramidon. Bar, 20 pm . (A) Section through the forebrain region. Note the greatly overgrown neurectoderm (asterisk) on the left side of the prosencephalon. (B) Slightly more caudal section. Note the grossly dilated left internal carotid artery (large arrow) com pared to its contralateral partner (small arrow). The optic vesicle is also indicated (hollow arrow). (C) Section at the level of the first branchial arch. Note the abnorm ally displaced left arch (arrow) and the relatively dilated first branchial artery (asterisk). 3224 B. Spencer-Dene and others
surface metallo-endopeptidases play a major role in embryo CONCLUSION genesis. The disturbance in morphogenesis, which appears to be a con Endopeptidase-24.11 and craniofaciai development sequence of endopeptidase-24.11 inhibition during culture Here we have successfully shown the localization of both leads us to believe that this enzyme plays a critical role during endopeptidase-24.11 and 24.18 protein in postimplantation rat normal craniofacial development. This raises the possibility embryos. Both enzymes appear to be developmentally that cell-surface metallo-endopeptidases, such as endopepti regulated at several discrete loci and the patterns of distribu dase-24.11, may constitute a hitherto unrecognised level of tion of these enzymes and their putative substrates strongly eontrol through the cleavage and inactivation of biologically suggest that they play a significant role during craniofacial active small peptides, growth factors and cytokines in cranio development in the rat. In order to explore a possible functional facial tissues. role, we have carried out inhibition studies. The use of two different selective inhibitors of endopeptidase-24.11 phospho We would especially like to thank the Collaborations Dept, at ramidon and thiorphan, in whole embryo culture consistently Genentech Inc. California, USA for their generous gift of rabbit anti human enkephalinase antibody and the rat endopeptidase-24.11 resulted in the formation of an asymmetric facial lesion in a cDNA, Professor R. C. Atkins, Director of Nephrology at the Monash proportion of embryos. Significantly, the specific anomalies Medical Centre for generously sending us the PHM-6 antibody, Nicky observed resemble those found in the human birth defect hemi Mordan for her technical help and advice with the SEM, Dr Andrew facial microsomia or ‘oculo-auriculo-vertebral spectrum’ Copp for advice on embryo culture. Dr Nick Lench for advice on (Gorlin et al., 1990). Hemifacial microsomia is asymmetric, probe preparation and Ms Monique Doherty for technical assistance. 70% of cases exhibit unilateral deformities in the facial This work was supported by a grant from the Medical Research skeleton, presenting as hypoplasia and malformation, particu Council to B. H. and P. T. larly in the mandibular, auditory, maxillary and zygomatic bones. Possible causes of this defect include haemorrhaging from the primordial stapedial artery following teratogen insult REFERENCES (Poswillo, 1973) and perturbation of auriculofaeial chondro- genesis (Cousley and Wilson, 1992). Children bom with hemi Ballock, R. T., Heydemann, A., Wakefield, L, M., Flanders, K. C,, Roberts facial microsomia are also highly likely to suffer from skeletal a n d A , B., S p o m , M . B. (1993). TGF-pi prevents hypertrophy of epiphyseal abnormalities, various forms of heart disease, pulmonary and chondrocytes: Regulation of gene expression for cartilage matrix proteins and metaUoproteases. Dev. Biol. 158, 414-429. renal anomalies. Significantly, all of these locations are sites Barnes, K., Ingram, J. and Kenny, A . J. (1989). Proteins of the kidney of intense endopeptidase-24.11 immunolocalization in the microvillar membrane. Biochem. J. 264,335-346. embryonic and neonatal rat. Furthermore, the histological Booth, A . G . and Kenny, A . J. (1974). A rapid method for the preparation of findings demonstrating a vascular disturbance involving the microvilli from rabbit kidney. Biochem. J. 142,575-581. Brent, R. L. and Beckman, D, A. (1991). Angiotensin-converting enzyme internal carotid and first branchial arch arteries argue strongly inhibitors, an embryopathic class of drugs with unique properties: for a similar aetiology in this system. The involvement of a information for clinical teratology counselors. Teratology 4 3 ,543-6. substrate which is a vaso-active peptide is an interesting pos Casey, M. L., Smith, J. W., Nagai, K. and MacDonald, P. C. (1993). sibility and the asymmetry of effect may well reflect an Transforming growth factor-pi inhibits enkephalinase (EC 3.4.24.11) gene expression in human endometrial stromal cells and sex skin fibroblasts in inherent asymmetry in the development of the head vascula culture. J. Clin. Endocrinol. Metab. 7 7 , 144-150. ture. Therefore, rat embryos cultured in the presence of Chen, C.-Y., Salles, G,, Seldin, M. F., Kister, A. E., Reinherz, E. L. and endopeptidase-24.11 inhibitors may be a possible animal Shipp, M. A. (1992). M urine common acute lymphoblastic leukemia antigen model not only for hemifacial microsomia, but also for analysis (CDIO neutral endopeptidase 24.11). 7. Immunol. 148, 2817-2825. Choudry, Y. and Kenny, A. J. (1991). Hydrolysis of transforming growth of branchial arch morphogenesis and arterial arch development factor-alpha by cell-surface peptidases in vitro. Biochem. J. 280, 57-60. in particular.. Cockcroft, D. L. (1990). Dissection and culture of post-implantation embryos. Endopeptidase-24.11 shares several substrates, notably In Postimplantation Mammalian Embryos (ed. Copp, A.J. and Cockcroft, D. angiotensin I and bradykinin, with a related enzyme L.) pp. 15-40 Oxford, UK. ‘angiotensin-converting enzyme’, also known as peptidyl Corheil, D., Gaudoux, F., Wainwright, S., Ingram, J., Kenny A. J., Boileau, G. and Crine, P. (1992). Molecular cloning of the a-subunit of rat dipeptidase-A. Recently it has become apparent that the use of endopeptidase-24.18 (endopeptidase-2) and co-localization with angiotensin-converting enzyme inhibitors to treat hypertension endopeptidase-24.11 in rat kidney by in situ hybridization. FEBS lett. 309, during pregnancy can result in significantly increased 203-8. incidence of foetal abnormalities and mortality (Mehta and Cousley, R. R. J. and Wison, D. J. (1992). Hemifacial microsomia: developmental consequence of perturbation of the auriculofaeial cartilage Modi, 1989; Hanssens et al., 1991; Brent and Beckman, 1991). model? Am. J. Med. Genet. 4 2 ,4 6 1 -6 . Moreover, the fact that secretion of one endopeptidase-24.11 D’Adamio, L,, Shipp, M. A., Masteller, E . L. and Reinherz, E . L. (1989). substrate, atrial natriuretic peptide, is stimulated by the endo Organization of the gene encoding common acute lymphoblastic leukemia thelial vasoconstrictor endothelin-1 (Fukada et al., 1988), and antigen (neutral endopeptidase 24.11): Multiple miniexons and separate 5 untranslated regions. Proc. Natl. Acad. Sci. USA 86, 7103-7. that the endothelin-1 knock-out mouse displays craniofacial Dixon, M. J., Garner, J. and Ferguson, M. W. J. (1991).Immunolocalisation and cardiovascular abnormalities (Kurihara et al., 1994), furher of epidermal growth factor (EOF), EOF receptor and transforming growth implicates endopeptidase-24.11 function as a key component factor alpha (TGFa) during murine palatogenesis in vivo and in vitro. Anal of normal development. Clearly, it is appropriate now to re Embryol. 184, 83-91. Dumermuth, E., Sterchi, E. E., Jiang, W., Wolz, R. L., Bond, J S., evaluate the possible teratogenicity of pharmaceutical Flannery, A. V. and Beynon, R. J. (1991). The astacin family o endopeptidase-24.11 inhibitors being developed as analgesics metalloendopeptidases. J. Biol. Chem. 266,21381-21385. and anti-hypertensive agents. Dutriez, I., Sales, N., Fournie-Zaluski, M. C. and Roques, B, P. (1992).Pte- Peptidases in craniofacial development 3225
and post-natal ontogeny of neutral endopeptidase 24-11 (‘enkephalinase’) expression during sea urchin embryogenesis of a gene encoding for a studied by in vitro autoradiography in the rat. Experientia 4 8 , 290-300. protease homologous to the human protein BMP-1 and to the product of the E rd o s, E. G , and Skidgel, R. A. (1989). Neutral endopeptidase 24.11 Drosophila dorsal-ventral patterning gene tolloid. Development 114, 147- (enkephahnase) and related regulators of peptide hormones. FASEB 3, 145- 164. 51. Letarte, M., Vera, S., Tran, R., Addis, J. B. L., Onizuka, R, J., Quakenbush F in elli, A. L., Bessie, C. A., Xie, T. and Padgett, R. W. (1994). Mutational E. J., Jongeneel, C. V. and Mclnnes, R. R. (1988). Common acute analysis of the Drosophila tolloid gene, a human BMP-1 homolog. lymphoblastic leukemia antigen is identical to neutral endopeptidase. J. Exp. Development 120, 861-870. Med. 168, 1247-54. Frenz, D. A., Galinovic-Schwartz, V., Liu, W., Flanders, K. C, and Van de Llorens-Cortes, C., Giros, B. and Schwartz, J.-C. (1990).A novel potential Water, T. R. (1992). Transforming growth factor pi is an epithelial-derived metallopeptidase derived from the enkephalinase gene by alternative signal peptide that influences otic capsule formation. Dev. Biol. 153, 324- sphcing. J. Neurochem. 5 5 ,2146-2148. 336. Mahmood, R., Flanders, K. C, and Morriss-Kay, G. M. (1992). Interactions Fukuda, Y., Hirata, Y., Yoshimi, H., Kojima, T., Kobayashi, Y. between retinoids and TGF ps in mouse morphogenesis. Development 115, Yanagisawa, M. and Masaki, T. (1988). Endothelin is a potent 67-74. secretagogue for atrial natriuretic peptide in cultured rat atrial myocytes. Malfroy, B,, Schofield, P. R, Kuang, W-J,, Seeburg, P. H., Mason, A. J, and Biochem. Biophys. Res. Commun. 155,167-172. Henzel, W. J. (1987). Molecular cloning and amino acid sequence of rat Gorlin, R. J., Cohen, M. M. jr and Levin, L. S. (1990). Syndromes of the enkephalinase. Biochem. Biophys. Res. Commun. 144,59-66. Head and Neck. pp. 641-652 Oxford, U.K. Mehta, N. and Modi, N. (1989). ACE inhibitors in pregnancy. Lancet, Ju ly 8, Hanssens, M., Keirse, M. J. N. €., Vankelecom, F. and Van Assche, F. A. 96. (1991). Fetal and neonatal effects of treatment with angiotensin-converting Poswillo, D. (1973). The pathogenesis of the first and second branchial arch enzyme inhibitors in pregnancy. Obstet Gynecol. 78,128-135. syndrom e. Oral Surg. 3 5 ,3 02-328. Henderson, B. and Blake, S. (1994). Connective tissue destruction in Price, J. S., Kenny, A. J., Huskisson, N. S. and Brown, M. J. (1991). rheumatoid arthritis: therapeutic potential of selective metalloproteinase Neuropeptide Y (NPY) metabolism by endopeptidase-2 hinders inhibitors. In Immunopharmacology of Joints and Connective Tissue.{ed.). characterization of NPY receptors in rat kidney. Br. J. Pharmacol. 104,321- pp 199-223, Academic Press, UK. 6. Hokland, P., Rosenthal, P., Griffin, J, D., Nadler, L, M., Daley, J., Hokland, Reynolds, S. D., Angerer, L. M., Palis, J., Nasir, A. and Angerer, R, C. M ., Schlossman, S. F . and Ritz, J. (1983). Purification and characterization (1992). Early mRNAs, spatially restricted along the animal-vegetal axis of of fetal hematopoietic cells that express the common acute lymphoblastic sea urchin embryos, include one encoding for a protein related to tolloid and leukemia antigen (CALLA). J. Exp. Med. 157, 114-129. B M P -1 . Development 114,769-786. Hwang, S. -P. L., Partin, J. S. and Lennarz, W. J. (1994).Characterization of Ronco, P., Pollard, H., Galceran, M., Delauche, M., Schwartz, J. S. and a homolog of bone morphogenetic protein 1 in the embryo of the sea urchin, Verroust, P. (1988). Distribution of enkephalinase (membrane Strongylocentrotus purpuratus. Development 120,559-568. metalloendopeptidase, E C. 3.4.24.11) in rat organs. Lab. Invest. 5 8 , 210-7. lijima, H., Gerard, N. P., Squassoni, C., Ewig, J., Face, D., Drazen, J. M., Roques, B. P., Fournie-Zaluski, M. -C., Soroca, E., Lecomte, J, M,, Kim, Y-A,, Shriver, B., Hersh, L. B. and Gerard, C. (1992). Exon 16 del: Malfroy, B., Llorens, C. and Schwartz, J. C. (1980). The enkephalinase a novel form of human neutral endopeptidase (CALLA). Am. J. Physiol. 262, inhibitor thiorphan shows antinociceptive activity in mice. Nature 288, 286- L 725-9. 8 . Jiang, W. and Bond, J. S. (1992).Families of metalloendopeptidases and their Roques, B. P., Noble, F., Daugé, V., Fournie-Zaluski, M. -C. and relationships. FEBS Lett. 3 1 2 ,110-114. Beaumont, A. (1993). Neutral endopeptidase 24.11: Structure, Inhibition, Johnson, A. R., Gray, L. D., Youngblood, E. and Sullivan, J. (1990).N eutral and experimental and clinical pharmacology. Phamacol. Rev. 45, 87-146. endopeptidase from nuchal ligament of fetal calves. J. Cell Biol. 43,243-254. Shepherd, D., Thompson, J. E., Scypinski, L., Dusser, D., Nadel, J. A. and Johnson, A. R., Skidgel, R. A., Gafford, J. T. and Erdos, E. G. (1984). Borson, D. B. (1988). Toluene diisocyanate increases airway responsiveness Enzymes in placental microvilli: angiotensin I converting enzyme, to substance P and decreases airway neutral endopeptidase. J. Clin. Invest. angiotensinase A, carboxypeptidase, and neutral endopeptidase 8 1 ,1 1 1 1 -5 . ( ‘en k ep h alin ase’). Peptides 5,789-796. Shimell, M. J,, Ferguson, E. L., Childs, S. R. and O’Conner, M. B. (1991). Katayama, M., Nadel, J. A., Bunnett, N. W., Di Maria, G.U ., Haxhiu, M. T he Drosophila dorsal-ventral patterning gene tolloid is related to human and Borson, D. B. (1991). Catabolism of calcitonin gene-related peptide and b o n e m orphogenetic protein 1. Cell 67, 469-481. substance P by neutral endopeptidase. Peptides 12,563-7. Shipp, M. A., Tarr, G. E., Chen, C-. Y., Switzer, S. R., Hersh, L. B., Stein, Kenny, A. J. and Ingram, J. (1987). Proteins of the kidney microvillar H., Sunday, M. E. and Reinherz, E. L. (1991). CD 10/neutral endopeptidase m em brane. Biochem. J. 2 4 5 ,515-524. 24.11 hydrolyzes bombesin-like peptides and regulates the growth of small Kenny, A. J., O’Hare, M. J. and Gusterson, B. A. (1989). Cell-surface cell carcinomas of the lung. Proc. Natl. Acad. Sci. USA 88,10662-10666. peptidases as modulators of growth and differentiation. Lancet ii, 785-7. Slavkin, H. C. (1990). Regulatory issues during early craniofacial Kenny, A. J. and Stephenson, S. L. (1988). Role of endopeptidase-24.11 in development: a summary. Cleft Palate J. 2 7 , 101-9. the inactivation of atrial natriuretic peptide. FEBS Lett. 232 1-8. Stephenson, S. L. and Kenny, A. J. (1987). The hydrolysis of «-human atrial King, K. A., Hua, J., Torday, J, S., Drazen, J. M. Graham, S. A., Shipp, M. natriuretic peptide by pig kidney microvillar membranes is initiated by A. and Sunday, M. E. (1993). CD 10/Neutral endopeptidase 24.11 regulates e n d o p e p tid ase-2 4 .1 1. Biochem. J. 24 3 ,183-7. fetal lung growth and maturation in utero by potentiating endogenous Sterchi, E, E., Green, J. R. and Lentze, M. J. (1982). Non-pancreatic bombesin-like peptides. J. Clin. Invest. 9 1 ,1969-1973. hydrolysis of N-benzoyl-L-tyrosyl-p-aminobenzoic acid (PABA peptide) in Kurihara, Y., Kurihara, H,, Suzuki, H., Kodama, T., Maemura, K., Nagai, the human small intestine. Clin. Sci. 6 2 ,557-560. R., Oda, H., Kuwaki, T., Cao, W.-H., Kamada, N., Jishage, K., Ouchi, Y., Stone, R. A,, Kuwayama, Y. and Laties, A, M.(1987). Regulatory peptides in Azuma, S., Toyada, Y., Ishikawa, T., Kumada, M. and Yazaki, Y. ( 1994). the eye. Experientia 4 3 ,791-800. Elevated blood pressure and craniofacial abnormalities in mice deficient in Tong, Y., Pelletier, G. (1990). Ontogeny of Atrial Natriuretic Factor (ANF) en d o th elin -1. N am re 368, 7 03-710. binding in various areas of the rat brain. Neuropeptides 16,63-68. Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of To whin, J., Staehelin, T. and Gordon, J. (1979). Electrophoretic transfer of the h ead o f bac terio p h a g e T 4. Nature 277,680-688. proteins from polyacrylamide gels to nitrocellulose sheets: Procedure and LeBien, T. and McCormack, R. T. (1989). The common acute lymphoblastic some applications. Proc. Natl. Acad. Sci. USA 76, 350-4. leukemia antigen (CD 10)-Emancipation from a functional enigma. Blood 73, Umezawa, S. (1972). A new microbial metabolite phosphoramidon (isolation 625-635. and structure). Tett. Lett. 1 ,97-100. Lecavalier, H ., Crine, P . and Male, C. (1989). Presence of endopeptidase Vainio, S., Karavanova, L, Jowett, A. and Thesleff, I. (1993).Identification 24.11 during the ontogeny of the small intestine in different species. Biol. of BMP-4 as a signal mediating secondary induction between epithelial and ■ Neonate 56,342-350. mesenchymal tissues during early tooth development. Cell 7 5, 45-58. Lee, D. C., Han, V. K. M. (1991). Expression of growth factors and their Waksman, G., Hamel, E., Fournie-Zaluski, M. C. and Roques, B. P.(1986). receptors in development. In Peptide Growth Factors and Their Receptors Autoradiographic comparison of the distribution of the neutral (ii) (ed. Spom, M. B. and Roberts, A. B.), pp.611-643. New York: USA. endopeptidase ‘enkephalinase’ and of p, and Ô opioid receptors in rat brain. Lepage, T., Ghiglione, C. and Gache, C. (1992). Spatial and temporal Proc. Natl. Acad. Sci. USA 8 3 , 1523-7. 3226 B. Spencer-Dene and others
Wilcox, J. N . and Derynck, R. (1988). Developmental expression of Wilkinson, D, G. and Green, J. (1990). In situ hybridization and the three- transforming growth factors alpha and beta in mouse fetus. Mol. Cell. Biol. 8, dimensional reconstructions of serial sections. In Postimplantation 3 4 1 5 -3 4 2 2 . Mammalian Embryos (ed. Copp, A. J. and Cockcroft, D. L.) pp.155-171. Wilcox, J. N., Pollard, H., Moreau, J., Schwartz, J. C. and Malfroy, B. Oxford, UK. (1989). Localization of enkephalinase mRNA in rat brain by in situ Wolz, R . L., Harris, R . B. and Bond, J. S. (1991). Mapping the active site of hybridization: comparison with immunohistochemical localization of the meprin-A with peptide substrates and inhibitors. Biochemistry 30, 8488- p ro te in . Neuropeptides 14, 7 7 -8 3 . 8493. Wilkins, M. R ., Unwin, R . J. and Kenny, A. J. (1993). Endopeptidase-24. 11 and its inhibitors: Potential therapeutic agents for edematous disorders and hypertension. Kidney Int. 4 3 ,2 7 3 -2 8 5 . (Accepted 9 August 1994) BIBLIOGRAPHY BIBLIOGRAPHY
Aguayo, S. M., Schuyler, W. E., Murtagh., J. J., Roman, J. Regulation of lung branching morphogenesis by bombesin-like peptides and neutral endopeptidase. Am. J. Respir. Cell Mol. Biol. (1994), 10, 635-642.
Alonso, S., Minty, A., Bourlet, Y., Buckingham, M. Comparison of three actin-coding sequences in the mouse; evolutionary relationships between the actin genes of warm blooded vertebrates. J. Mol. EvoL, (1986), 23, 11-22.
Ambrose, J. L., Harris, C. In vitro embryotoxicity of the cysteine proteinase inhibitors benzyloxycarbonyl-phenylalanine-alanine-diazomethane (Z-Phe-Ala-CHN 2) benzyloxycarbonyl-phenylalanine-phenylalanine-diazomethane (Z-Phe-Phe-CHN 2). Teratology, (1994), 50, 214-228.
Apte, S. S., Hayashi, K., Seldin, M. F., Mattei, M.-G., Hayashi, M., Olsen, B. R. Gene encoding a novel murine tissue inhibitor of metalloproteinases (TIMP), TIMP-3, is expressed in developing mouse epithelia, cartilage, and muscle, and is located on mouse chromosome 10. Dev. Dynamics, (1994), 200, 177-197.
Arock, M., Gros, C., Devillier, P., Guillosson, J. J., Schwartz, J.-C. Characterisation of enkephalinase (EC3.4.24.11) activity on various leukemic cells expressing the common acute lymphoblastic leukemia antigen (CALLA). FEBS Lett., (1989), 248, 123-126.
Ayer-Le Lievre, C., Stâhlbom, P. -A., Sara, V. R. Expression of IGF-I and -II mRNA in the brain and craniofacial region of the rat fetus. Development, (1991), 111, 105-115.
Back, S. A., Colon, M., Fallon, J. H., Meyskens Jr., F. L., Loughlin, S E. Ventral mesencephalic and cortical transplants into the rat striatum display enhanced activity for neutral endopeptidase 24.11 (’enkephalinase’; CALLA). Brain Res., (1993), 612, 85-95.
Ballock, R. T., Heydemann, A., Wakefield, L. M., Flanders, K. C., Roberts, A. B., Spom, M. B. TGF-jSl prevents hypertrophy of epiphyseal chondrocytes: Regulation of gene expression for cartilage matrix proteins and metalloproteases. Dev. Biol, (1993), 158, 414-429.
Barnes, K., Ingram, J., Kenny, A. J. Proteins of the kidney microvillar membrane: Structural and immunochemical properties of rat endopeptidase-2 and its immunohistochemical localization in tissues of rat and mouse. Biochem. J ., (1989), 264, 335-346.
Barker, P. E., Shipp, M. A., D’Adamio, L., Masteller, E. L., Reinherz, E. L. The common acute lymphoblastic leukemia antigen gene maps to chromosomal region 3 (q21- 27). J. Immunol, (1989), 142, 283-287.
Behrendtsen, O., Alexander, C. M., Werb, Z. Metalloproteinases mediate extracellular matrix degradation by cells from mouse blastocyst outgrowths. Development, (1992),
177 114, 447-456.
Beynon, R. J., Shannon, J. D., Bond, J. S. Purification and characterization of a metalloendoproteinase from mouse kidney. Biochem. J., (1981), 199, 591-598.
Bourne, A., Kenny, A. J. The hydrolysis of brain and atrial natriuretic peptides by porcine choroid plexus is attributable to endopeptidase-24.11. Biochem. J ., (1990), 271, 381-385.
Breier, G., Albrecht, U., Sterrer, S., Rlsau, W. Expression of vascular endothelial growth factor during embryonic angiogenesis and endothelial cell differentiation. Development, (1992), 114, 521-532.
Brown, N. A., Hoyle, C. I., McCarthy, A., Wolpert, L. The development of asymmetry: The sidedness of drug-induced limb abnormalities is reversed in situs inversus mice. Development, (1989), 107, 637-642.
Casey, M. L., Smith, J. W., Nagai, K., MacDonald, P. C. Transforming growth factor-jSl inhibits enkephalinase (E.C. 3.4.24.11) gene expression in human endometrial stromal cells and sex skin fibroblasts in culture. J. Clin. Endocrinol. Metab., (1993), 77, 144-150.
Chai, Y., Mah, A., Crohin, C., Groff, S., Bringas Jr., P., Le, T., Santos, V., Slavkin, H. C. Specific transforming growth factor-6 subtypes regulate embryonic mouse meekers cartilage and tooth development. Dev. Biol., (1994), 162, 85-103.
Checler, F., Vincent, J. P., Kitabgi, P. Degradation of neurotensin by rat brain synaptic membranes: involvement of a thermolysin-like metalloendopeptidase (enkephalinase), angiotensin converting enzyme, and other unidentified peptidases. J. Neurochem., (1983), 41, 375-384.
Chen, C. -¥., Salles, G., Seldin, M. F., Kister, A. E., Reinherz, E. L., Shipp, M. A. Murine common acute lymphoblastic leukemia antigen (CDIO neutral endopeptidase 24.11). J. Immunol, (1992), 148, 2817-2825.
Chipkin, R. E. Inhibitors of enkephalinase: The next generation of analgesics. Drugs of the Future, (1986), 11, 593-606.
Choudry, ¥ ., Kenny, A. J. Hydrolysis of transforming growth factor-a by cell-surface peptidases in vitro. Biochem. J., (1991), 280, 57-60.
Cockcroft, D. L. (1990). Dissection and culture of post-implantation mammalian embryos In Postimplantation Mammalian Embryos (ed. Copp, A. J., and Cockcroft, D. L.) pp 15-40. Oxford: IRL Press.
Connelly, J. C., Skidgel, R. A., Schulz, W. W., Johnson, A. R., Erdos, E. G. Neutral endopeptidase 24.11 in human neutrophils: cleavage of chemotactic peptide.
178 Proc. Natl Acad. Sci USA, (1985), 82, 8737-8741.
Corbeil, D., Gaudoux, F., Wainwright, S., Ingram, J., Kenny, A. J., Boileau, G., Crine, P. Molecular cloning of the a-subunit of rat endopeptidase-24.18 (endopeptidase- 2) and co-localization with endopeptidase-24.11 in rat kidney by in situ hybridization. FEBS Lett,. (1992), 309, 203-208.
Corbeil, D., Milhiet, P. -E., Simon, V., Ingram, J., Kenny, A. J., Boileau, G., Crine, P. Rat endopeptidase-24.18 a subunit is secreted into the culture medium as a zymogen when expressed by COS-1 cells. FEBS lett., (1993), 335, 361-366.
Craig, S. S., Mader, C., Bond, J. S. immunohistochemical localization of the metalloproteinase meprin in salivary glands of male and female mice. J. Histochem. Cytochem., (1991), 39, 123-129.
Crowley, C., Spencer, S. D., Nishimura, M. C., Chen, K. S., Pitts-Meek, S., Armanini, M. P., Ling, L. H., McMahon, S. B., Shelton, D. L., Levinson, A. D., Phillips, H. S. Mice lacking nerve growth factor display perinatal loss of sensory and sympathetic neurons yet develop basal forebrain cholinergic neurons. Cell, (1994), 76, 1001- 1011.
D’Adamio, L., Shipp, M. A., Masteller, E. L., Reinherz, E. L. Organization of the gene encoding common acute lymphoblastic leukemia antigen (neutral endopeptidase 24.11): Multiple miniexons and separate 5’ untranslated regions. Proc. Natl. Acad. Sci. USA, (1989), 86, 7103-7107.
Defranees, M. C., Wolf, H. K., Michalopoulos, G. K., Zamegar, R. The presence of hepatocyte growth factor in the developing rat. Development, (1992), 116, 387-395.
Delikat, S. E., Galvani, D. W., Zuzel, M. A function of CDIO on bone marrow stroma. Br. J. Haem., (1994), 87, 655-657.
Devault, A., Lazure, C., Nault, C., Le Moual, H., Seidah, N. G., Chretien, M., Kahn, P., Powell, J., Mallet, J., Beaumont, A., Roques, B. P., Crine, P., Boileau., G. Amino acid sequence of rabbit kidney neutral endopeptidase 24.11 (enkephalinase) deduced from a complementary DNA. EMBO J., (1987), 6, 1317-1322.
Dixon, M. J., Ferguson, M. W. J. The effects of epidermal growth factor, transforming growth factors alpha and beta and platelet-derived growth factor on murine palatal shelves in organ culture. Archs. oral Biol, (1992), 37, 395-410.
Dragovic, T., Deddish, P. A., Tan, F., Weber, G., Erdos, E. G. Increased expression of neprilysin (neutral endopeptidase 24.11) in rat and human hepatocellular carcinomas. Lab. Invest., (1994), 70, 107-113.
Dumermuth, E., Sterchi, E. E., Jiang, W., Wolz, R. L., Bond, J. S., Flannery, A. V., Beynon, R. J. The Astacin family of metalloendopeptidases. J. Biol. Chem., (1991),
179 266, 21381-21385.
Dutriez, I., Salés, N., Foumié-Zaluski, M. -C., Roques, B. Pre- and post-natal ontogeny of neutral endopeptidase 24-11 (’enkephalinase’) studied by in vitro autoradiography in the rat. Experientia, (1992), 48, 290-300.
Echelard, Y., Epstein, D. J., St. -Jacques, B., Shen, L., Mohler, J., McMahon, J. A., McMahon, A. Sonic hedgehog, a member of a family of putative signalling molecules, is implicated in the regulation of CNS polarity. Cell, (1993), 75, 1417-1430.
Elaroussi, M. A., DeLuca, H. F. A new member to the astasin {sic) family of metalloendopeptidases: A novel 1,25-dihydroxyvitamin D-3-stimulated mRNA from chorioallantoic membrane of quail. Biochimica et Biophysica Acta, (1994), 1217, 1-8.
Erdos, E. G., Skidgel, R. A. Neutral endopeptidase 24-11 (’enkephalinase’) and related regulators of peptide hormones. FASEB J., (1989), 3, 145-151.
Fagny, C., Michel, A., Leonard, I., Berkenboom, G., Fontaine, J., Deschodt- Lanckman, M. In vitro degradation of endothelin-1 by endopeptidase 24.11 (enkephalinase). Peptides, (1991), 12, 773-778.
Fan, C. -M., Tessier-Lavigne, M. Patterning of mammalian somites by surface ectoderm and notochord: Evidence for sclerotome induction by a hedgehog homologue. Cell, (1994), 79, 1175-1186.
Feng, H., Sassani, R., Bartlett, S. P., Lee, A., Hecht, T., Malcolm, S., Winter, R. M., Vintiner, G. M., Buetow, K. H., Gasser, D. L. Evidence from family studies, for linkage disequilibrium between TGFA and a gene for non-syndromic cleft lip with or without cleft palate. Am. J. Hum. Genet., (1994), 55, 932-936.
Finelli, A. L., Bossie, C. A., Xie, T., Padgett, R. W. Mutational analysis of the Drosophila tolloid gene, a human BMP-1 homolog. Development, (1994), 120, 861-870.
Francis-West, P. H., Tatla, T., Brickell, P. M. Expression patterns of the bone morphogenetic protein genes Bmp-4 and Bmp-2 in the developing chick face suggest a role in outgrowth of the primordia. Dev. Dynamics, (1994), 201, 168-178.
Frenz, D. A., Galinovic-Schwartz, V., Liu, W., Flanders, K. C., Van de Water, T. R. Transforming growth factor is an epithelial-derived signal peptide that influences otic capsule formation. Dev. Biol, (1992), 153, 324-336.
Fukagawa, M., Suzuki, N., Hogan, B. L. M., Jones, C. M. Embryonic expression of mouse bone morphogenetic protein-1 (BMP-1), which is related to the Drosophila dorsoventral gene tolloid and encodes a putative astacin metalloendopeptidase. Dev. Biol., (1994), 163, 175-183.
Ganju, R. K., Sunday, M., Tsarwhas, D. G., Card, A., Shipp, M. A. CDIO/NEP
180 in non-small cell lung carcinomas. J. Clin. Invest., (1994), 94, 1784-1791.
Goedert, M., Hunt, S. P., Mantyl, P. W., Emson, P. C. The ontogenetic development of neurotensin-like immunoreactivity and neurotensin receptors in the rat striatum. Dev. Brain Res., (1985), 20, 121-131.
Gonzalez, A. -M., Buscaglia, M., Ong, M., Baird, A. Distribution of basic fibroblast growth factor in the 18-day rat fetus: localization in the basement membranes of diverse tissues. J. Cell Biol, (1990), 110, 753-765.
Gorlin, R. J., Cohen, M. M., Levin, L. S. Branchial arch and oro-acral disorders, in "Syndromes of the Head and Neck". (1990), Oxford University Press, pp 641-652.
Goulding, M. D., Lumsden, A., Gross, P. Signals from the notochord and floor plate regulate the region-specific expression of two Pax genes in the developing spinal cord. Development, (1993), 117, 1001-1016.
Gressens, P., Hill, J. M., Gozes, I., Fridkin, M., Brenneman, D. E. Growth factor function of vasoactive intestinal peptide in whole cultured mouse embryos. Nature, (1993), 362, 155-158.
Gressens, P., Hill, J. M., Paindaveine, B., Gozes, I., Fridkin, M., Brenneman, D. E. Severe microcephaly induced by blockade of vasoactive intestinal peptide function in the primitive neuroepithelium of the mouse. J. Clin. Invest., (1994), 94, 2020-2027.
Heikinheimo, M., Lawshé, A., Shackleford, G. M., Wilson, D. B., MacAithur, C. A. Fgf-8 expression in the post-gastrulation mouse suggests roles in the development of the face, limbs and central nervous system. Mech. Dev., (1994), 48, 129-138.
Heine, U. I., Munoz, E. F., Flanders, K. C., Filings worth, L. R., Lam, H. -Y. P., Thompson, N. L., Roberts, A. B., Spom, M. B. Role of transforming growth factor jS in the development of the mouse embryo. J. Cell. Biol, (1987), 105, 2861-2876.
Helene, A., Milhiet, P.-E., Haouas, H., Boucheix, C., Beaumont, A., Roques, B. P. Effects of monoclonal antibodies raised against the common acute lymphoblastic leukemia antigen on endopeptidase-24.11 activity. Biochem. Pharmacol. (1992), 43, 809-814.
Hochgeschwender, U., Brennen, M. B. Redundant genes? Nat. Genet., (1994), 8, 219- 220.
Hokland, P., Rosenthal, P., Griffin, J. D., Nadler, L. M., Daley, J., Hokland, M., Schlossman, S. F., Ritz, J. Purification and characterization of fetal hematopoietic cells that express the common acute lymphoblastic leukemia antigen (CALLA). J. Exp. Med., (1983), 157, 114-129.
Howell, S., Caswell, A. M., Kenny, A. J., Turner, A. J. Membrane peptidases on human osteoblast-like cells in culture: hydrolysis of calcitonin and hormonal regulation
181 of endopeptidase-24.11. Biochem. J., (1993), 290, 159-164.
Hu, C.-C., Sakakura, Y., Sasano, ¥., Shum, L., Bringas, Jr., P., Werb, Z., Slavkin, H. C. Endogenous epidermal growth factor regulates the timing and pattern of embryonic mouse molar tooth morphogenesis. Int. J. Dev. Biol., (1992), 36, 505-516.
Hwang, S.-P. L., Partin, J. S., Lennarz, W. J. Characterization of a homolog of human bone morphogenetic protein 1 in the embryo of the sea urchin, Strongylocentrotus purpuratus. Development, (1994), 120, 559-568.
mima, H., Gerard, N. P., Squassoni, €., Ewig, J., Face, D., Drazen, J. M., Kim, Y. -A., Shriver, B., Hersh,. L. B., Gerard, C. Exon 16 del: a novel form of human neutral endopeptidase (CALLA). Am. J. Physiol., (1992), 262, L725-L729.
Jabs, E. W., Müller, U., Li, X., Ma, L., Luo, W., Haworth, I. S., Klisak, L, Sparkes, R., Warman, M. L., Mulliken, J. B., Snead, M. L., Maxson, R. A mutation in the homeodomain of the human MSX2 gene in a family affected with autosomal dominant craniosynostosis. Cell, (1993), 75, 443-450.
Jabs, E. W., Li, X., Scott, A. F., Meyers, G., Chen, W., Eccles, M., Mao, I. -J., Chamas, L. R., Jackson, C. E., Jaye, M. Jackson-Weiss and Crouzon syndromes are allelic with mutations in fibroblast growth factor receptor 2. Nat. Genet., (1994), 8, 275- 279.
Jessell, T. M., Melton, D. A. Diffusible factors in vertebrate embryonic induction. Cell, (1992), 68, 257-270.
Jiang, W., Bond, J. S. Families of metalloendopeptidases and their relationships. FEBS Lett., (1992), 312, 110-114.
Jiang, W., Sadler, P. M., Jenkins, N. A., Gilbert, D. J., Copeland, N. G., Bond, J. S. Tissue-specific expression and chromosomal localization of the a subunit of mouse meprin A. J. Biol. Chem., (1993), 14, 10380-10385.
Johnson, A. R., Skidgel, R. A., Gafford, J. T., Erdos, E. G. Enzymes in placental microvilli: angiotensin I converting enzyme, angiotensinase A, carboxypeptidase, and neutral endopeptidase ("enkephalinase"). Peptides, (1984), 5, 789-796.
Johnson, A. R., Gray, L. D., Youngblood, E., Sullivan, J. Neutral endopeptidase from nuchal ligament of fetal calves. J. Cell. Biol., (1990), 43, 243-254.
Johnson, G. D., Hersh, L. B. Cloning a rat meprin cDNA reveals the enzyme is a heterodimer. J. Biol. Chem., (1992), 267, 13505-13512.
Johnson, R. L., Laufer, E., Riddle, R. D., Tabin, C. Ectopic expression of Sonic hedgehog alters dorsal-ventral patterning of somites. Cell, (1994), 79, 1165-1173.
182 Jones, K. R., Farinas, I., Backus, C., Reichardt, L. F. Targeted disruption of the BDNF gene perturbs brain and sensory neuron development but not motor neuron development. Cell, (1994), 76, 989-999.
Jowett, A. K., Vainio, S., Ferguson, M. W. J., Sharpe, P. T., Thesleff, I. Epithelial-mesenchymal interactions are required for msx 1 and msx 2 gene expression in the developing murine molar tooth. Development, (1993), 117, 461-470.
Jung, W., Castren, E., Odenthal, M., Vande Woude, G. F., Ishii, T., Dienes, H. - P., Lindhohn, D., Schirmacher, P. Expression and functional interaction of hepatocyte growth factor-scatter factor and its receptor c-met in mammalian brain. J. Cell Biol, (1994), 126, 485-494.
Kenny, A. J., Ingram, J. Proteins of the kidney microvillar membrane. Biochem. J., (1987), 245, 515-524.
Kenny, A. J., O’Hare, M. J., Gusterson, B. A. Cell-surface peptidases as modulators of growth and differentiation. Lancet, (1989), ii, 785-787.
Kerr, M. A., Kenny, A. J. The purification and specificity of a neutral endopeptidase from rabbit kidney brush border. Biochem. J., (1974a), 137, 477-488.
Kerr, M. A., Kenny, A. J. The molecular weight and properties of a neutral metallo endopeptidase from rabbit kidney brush border. Biochem. J., (1974b), 137, 489-495.
Kieman, J. A. (1981) Histological staining in one or two colours. In Histological and Histochemical Methods: Theory and Practice. Kieman, J.A. (Ed.), pp81-82, Pergamon Press,Oxford, UK.
King, K. A., Hua, J., Torday, J. S., Drazen, J. M., Graham, S. A., Shipp, M. A. CD 10/Neutral endopeptidase 24.11 regulates fetal lung growth and maturation in utero by potentiating endogenous bombesin-like peptides. J. Clin. Invest., (1993), 91, 1969- 1973.
Kocher-Becker, U., Loppnow-Blinde, B., Kocher, W. Asymmetric limb defects due to asymmetry of the circulatory system. Teratology, (1990), 42, 22A.
Kocher-Becker, U., Vollmer, E., Kocher, W. Correlation of asymmetries of mutant polydactyly and mutant situs. Teratology, (1991), 44, 26A.
Kondepudi, A., Johnson, A. Cytokines increase neutral endopeptidase activity in lung fibroblasts. Am. J. Respir. Cell Mol. Biol., (1993), 8, 43-49.
Kronmiller, J. E., Upholt, W. B., Kollar, E. J. Expression of epidermal growth factor mRNA in the developing mouse mandibular process. Archs. oral Biol., (1991), 36, 405- 410.
183 Kurihara, Y., Kurihara, H., Suzuki, H., Kodama, T., Maemura, K., Nagai, R., Oda, H., Kuwaki, T., Cao, W. -H., Kamada, N., Jishage, K., Ouchi, Y., Azuma, S., Toyada, Y., Ishikawa, T., Kumada, M., Yazaki, Y. Elevated blood pressure and craniofaciai abnormalities in mice deficient in endothelin-1. Nature^ (1994), 368, 703- 710.
Laemmli, U. K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, (1970), 277, 680-8.
Lafrance, M. -H., Vézina, C., Wang, Q., Boileau, G., Crine, P., Lemay, G. Role of glycosylation in transport and enzymic activity of neutral endopeptidase-24.11. Biochem. J., (1994), 302, 451-454.
Landry, C., Huet, C., Mangeat, P., Sahuquet, A., Louvard, D., Crine, P. Comparative analysis of neutral endopeptidase (NEP) and villin gene expression during mouse embryogenesis and enterocyte maturation. Differentiation, (1994), 56, 55-65.
LeBien, T. W., McCormack, R. T. The common acute lymphoblastic leukemia antigen (CDIO)-Emancipation from a functional enigma. Blood, (1989), 73, 625-635.
Lecavallier, H., Crine, P., Malo, C. Presence of endopeptidase 24.11 during the ontogeny of the small intestine in different species. Biol. Neonate, (1989), 56, 342-350.
Le Douarin, N. M., Ziller, C., Couly, G. F. Patterning of neural crest derivatives in the avian embryo: in vivo and in vitro studies. Dev. Biol., (1993), 159, 24-49.
Lehnert, S. A., Akhurst, R. J. Embryonic expression pattern of TGF jS type-1 RNA suggests both paracrine and autocrine mechanisms of action. Development, (1988), 104, 263-273.
Lepage, T., Ghiglione, C., Gache, C. Spatial and temporal expression pattern during sea urchin embryogenesis of a gene coding for a protease homologous to the human protein BMP-1 and to the product of the Drosophila dorsal-ventral patterning gene tolloid. Development, (1992), 114, 147-164.
Letarte, M., Vera, S., Tran, R., Addis, J. B. L., Onizuka, R. J., Quackenbush, E. J., Jongeneel, C. V., Mclnnes, R. R. Common acute lymphoblastic leukemia antigen is identical to neutral endopeptidase. J. Exp. Med. (1988), 168, 1247-1253.
Llorens-Cortes, C., Giros, B., Schwartz, J. C. A novel potential metallopeptidase derived from the enkephalinase gene by alternative splicing. J. Neurochem., (1990), 55, 2146-2148.
Mahmood, R., Flanders, K. C., Morriss-Kay, G. M. Interactions between retinoids and TGEjSs in mouse morphogenesis. Development, (1992), 115, 67-74.
184 Malfroy, B., Swerts, J. P., Guy on, A., Roques, B. P., Schwartz, J. C. Regional distribution of a high-affinity enkephalin-degrading peptidase in mouse brain and its enhanced activity following morphine. Nature, (1978), 276, 523-526.
Malfroy, B., Schofield, P. R., Kuang, W-J,, Seeburg, P. H., Mason, A. J., Henzel, W. J. Molecular cloning and amino acid sequence of rat sequence of rat enkephalinase. Biochem. Biophys. Res. Commun., (1987), 144, 59-66.
Malfroy, B., Kuang, W-J., Seeburg, P. H., Mason, A. J., Schofield, P. R. Molecular cloning and amino acid sequence of human enkephalinase (neutral endopeptidase). FEBS Lett., (1988), 229, 206-210.
Marchand, P., Tang, J., Bond, J. S. Membrane association and oligomeric organization of the a and subunits of mouse meprin A. J. Biol. Chem., (1994), 269, 15388-15393.
Mari, B., Checler, F., Ponzio, G., Peyron, J. F., Manie, S., Farahifar, D., Rossi, B., Anberger, P. Jurkat T cells express a functional neutral endopeptidase activity (CALLA) involved in T cell activation. EMBO J.,(1992), 11, 3875-3885.
Matsas, R., Turner, A. J., Kenny, A. J. Endopeptidase 24-11 and an aminopeptidase activity in brain synaptic membranes are jointly responsible for the hydrolysis of cholecystokinin octapeptide CCKg, FEBS Lett.,{\9%A), 175, 124-128.
Medeiros, M. S., Turner, A. J. Processing and metabolism of peptide-YY: pivotal roles of dipeptidyIpeptidase-IV, aminopeptidase-P, and endopeptidase-24.11. Endocrinology, (1994), 134, 2088-2094.
Mitsiadis, T. A., Salmivirta, M., Muramatsu, T., Muramatsu, H., Rauvala, H., Lehtonen, E., Jalkanen, M., Thesleff, I. Expression of the heparin-binding cytokines, midkine (MK) and HB-GAM (pleiotrophin) is associated with epithelial-mesenchymal interactions during fetal development and organogenesis. Development, (1995), 121, 37- 51.
Monsoro-Burq, A. -H., Bontoux, M., Teillet, M. -A., Le Douarin, N. M. Heterogeneity in the development of the vertebra. Proc. Natl. Acad. Sci. USA, (1994), 91, 10435-10439.
Moore, K. L. The developing human, third edition (1982) W. B. Saunders Company, UK.
Muenke, M., Schell, U., Hehr, A., Robin, N. H., Losken, H. W., Schinzel, A., Pulleyn, L. J., Rutland, P., Reardon, W., Malcolm, S., Winter, R. M. A common mutation in the fibroblast growth factor receptor 1 gene in Pfeiffer syndrome. Nat. Genet. (1994), 8, 269-274.
185 Nagata, E., Kondo, T., Kiyoshima, T., Nakata, M., Tanaka, T. Immunohistochemical evidence for the presence of nerve fibres with substance P- or calcitonin gene-related peptide-like immunoreactivity in the proliferating epithelium in the developing teeth of rats. Archs. oral Biol, (1994), 39, 197-203.
Ohkubo, K., Baraniuk, J. N., Hohman, R. J., Kaulbach, H. C., Hausfeld, J. N., Merida, M., Kaliner, M. A. Human nasal mucosal neutral endopeptidase (NEP): Location, quantitation, and secretion. Am. J. Respir. Cell Mol. Biol. (1993), 9, 557-567.
Opgenorth, T. J., Wu-Wong, J. R., Shiosaki, K. Endothelin-converting enzymes. FASEB J. (1992), 6, 2653-2659.
Painter, R. G., Dukes, R., Sullivan, J., Carter, R., Erdos, E. G., Johnson, A. R. Function of neutral endopeptidase on the cell membrane of human neutrophils. J. Biol. Chem., (1988), 19, 9456-9461.
Pearson, W. R., Lipman, D. 3% Improved tools for biological sequence comparison. Proc. Natl. Acad. Sci. USA, (1988), 85, 2444-2448.
Pelton, R. W., Saxena, B., Jones, M., Moses, H. L., Gold, L. I. Immunohistochemical localization of TOP /31, TOP |82 and TOP j83 in the mouse embryo: expression patterns suggest multiple roles during embryonic development. J. Cell. Biol. (1991), 115, 1091-1105.
Piedimonte, G., Nadel, J. A., Long, C. S., Hoffman, J. I. E. Neutral endopeptidase in the heart: Neutral endopeptidase inhibition prevents isoproterenol-induced myocardial hypoperfusion in rats by reducing bradykinin degradation. Circ. Res., (1994), 75, 770- 779.
Pierart, M. E., Najidovski, T., Appelboom, T. E., Deschodt-Lanckman, M. M. Effect of human endopeptidase 24.11 ("enkephalinase”) on IL-1-induced thymocyte proliferation activity. J. Immunol., (1988), 140, 3808-3811.
Pollard, M., Bouthenet, M. L., Moreau, J., Souil, H., Verroust, P., Ronco, P., Schwartz, J. C. Detailed immunoautoradiographic mapping system comparison with enkephalins and SP. Neuroscience., (1989), 30, 339-376.
Poswillo, D. The pathogenesis of the first and second branchial arch syndrome. Oral surgery (1973), 35: 302-328.
Pusztai, L., Lewis, C. E., Lorenzen, J., McGee, J. O’D. Growth factors: regulation of normal and neoplastic growth. J. Pathol., (1993), 169, 191-201.
Quirion, R., Dam, T. V. Ontogeny of substance P receptor binding sites in rat brain. J. Neuroscience., (1986), 6, 2181-2199.
186 Rawlings, N. D., Barrett, A. J. Evolutionary families of peptidases. Biochem. J., (1993), 290, 205-218.
Represa, J. J., Miner, C., Barbosa, E., Giraldez, F. Bombesin and other growth factors activate cell proliferation in chick embryo otic vesicles in culture. Development, (1988), 102, 87-96.
Reynolds, S. D., Angerer, L. M., Palis, J., Nasir, A., Angerer, R. C. Early mRNAs, spatially restricted along the animal-vegetal axis of sea urchin embryos, include one encoding a protein related to tolloid and BMP-1. Development, (1992), 114, 769-786.
Robinson, G. W., and Mahon, K. A. Differential and overlapping expression domains of Dlx-2 and Dlx-3 suggest distinct roles for Distal-less homeobox genes in craniofacial development. Mech. Devel, (1994), 48, 199-215.
Robinson, L. K., Hoyme, H. E., Edwards, D. K., Jones, K. L. Vascular pathogenesis of unilateral craniofacial defects. J. Pediatr., (1987), 111:236-9.
Ronco, P., Pollard, H., Galceran, M., Delauche, M., Schwartz, J. C., Verroust, P. Distribution of enkephalinase (membrane metalloendopeptidase, E.C.3.4.24.11) in rat organs. Detection using a monoclonal antibody. Lab. Invest., (1988), 58, 210-217.
Roques, B. P., Noble, F., Daugé, V., Foumie-Zaluski, M. C., Beaumont, A. Neutral endopeptidase 24.11: Structure, inhibition, and experimental and clinical pharmacology. Pharmacol. Rev., (1993), 45, 87-146.
Roques, B. P., Foumié-Zaluski, M. C., Soroca, E., Lecomte, J. M., Malfroy, B., Llorens, C., Schwartz, J. C. The enkephalinase inhibitor thiorphan shows antinociceptive activity in mice. Nature, (1980), 288, 286-288.
Sadler, T. W. Langman’s medical embryology, sixth edition, (1990) Williams & Williams, Baltimore, USA.
Salés, N., Dutriez, I., Maziere, B., Ottavianl, M., Roques, B. P. Neutral endopeptidase 24.11 in rat peripheral tissues: comparative localization by "ex vivo" and "in vitro" autoradiography. Regul. Pept., (1991), 33, 209-222.
Salles, G., Rodewald, H. -R., Chin, B. S., Reinherz, E. L., Shipp, M. A. Inhibition of CD 10/neutral endopeptidase 24.11 promotes B-cell reconstitution and maturation in vivo. Proc. Natl. Acad. Sci. USA., (1993), 90, 7618-7622.
Sambrook, J., Fritsch, E. F., Maniatis, T. (1989) Analysis and cloning of eukaryotic genomic DNA. In Molecular Cloning:-A Laboratory Manual, second edition, pp 931-962. Cold Spring Harbour Laboratory Press, USA.
Sato, S. M., Sargent, T. D. Molecular approach to dorsoanterior development in Xenopus laevis. Dev. Biol, (1989), 137, 135-141.
187 Satokata, I., Maas, M. Msxl deficient mice exhibit cleft palate and abnormalities of craniofacial and tooth development. Nat. Genet., (1994), 6, 348-355.
Shah, N. M., Marchioimi, M. A., Isaacs, I., Stroobant, P., Anderson, D. J. Glial growth factor restricts mammalian neural crest stem cells to a glial fate. Cell, (1994), 77, 349-360.
Sharpe, P. M., Foreman, D. M., Carette, M. J. M., Schor, S. L., Ferguson, M. W. J. The effects of transforming growth factor-jSi on protein production by mouse embryonic palate mesenchymal cells in the presence or absence of serum. Archs. oral 5/0/.,(1992), 37, 39-48.
Shiang, R., Lidral, A. C., Ardinger, H. H., Buetow, K. H., Romitti, P. A., Monger, R. G., Murray, J. C. Association of transforming growth-factor alpha gene polymorphisms with nonsyndromic cleft palate only (CFO). Am. J. Hum. Genet., (1993), 53, 836-843.
Shimell, M. J., Ferguson, E. L., Childs, S. R., O’Conner, M. B. The Drosophila dorsal-ventral patterning gene tolloid is related to human bone morphogenetic protein 1. Cell, (1991), 67, 469-481.
Shipp, M. A., Stefano, G. B., Switzer, S. N., Griffin, J. D., Reinherz, E. L. CDIO (CALLA)Zneutral endopeptidase 24.11 modulates inflammatory peptide-induced changes in neutrophil morphology, migration, and adhesion proteins and is itself regulated by neutrophil activation. Blood, (1991), 78, 1834-1841.
Shipp, M. A., Tarr, G., Chen, C.-Y., Switzer, S. N., Hersh, L. B., Stein, H., Sunday, M. E., Reinherz, E. L. CDlO/neutral endopeptidase 24.11 hydrolyzes bombesin-like peptides and regulates the growth of small cell carcinomas of the lung. Proc. Natl. Acad. Sci. USA, (1991), 88, 10662-10666.
Shipp, M. A., Vÿayaraghavan, J., Schmidt, E. V., Masteller, E. L., D’Adamio, L., Hersh, L. B., Reinherz, E. L. Common acute lymphoblastic leukemia antigen (CALLA) is active neutral endopeptidase 24.11 ("enkephMinase"): Direct evidence by cDNA transfection analysis. Proc. Natl. Acad. Sci. USA, (1989), 86, 297-301.
Shuey, D. L., Sadler, T. W., Tamir, H., Lauder, J. M. Serotonin and morphogenesis: transient expression of serotonin uptake and binding protein during craniofacial morphogenesis in the mouse. Anat. Embryol, (1993), 187, 75-85.
Shull, M. M., Ormsby, I., Kier, A. B., Pawlowski, S., Diebold, R. J., Yin, M., Allen, R., Sidman, C., Proetzel, G., Calvin, D., Annunziata, N., Doetschman, T. Targeted disruption of the mouse transforming growth factor-81 gene results in multifocal inflammatory disease. Nature, (1992), 359, 693-699.
Sonnenberg, E., Meyer, D., Weidner, K. M., Birchmeier, C. Scatter factor/Hepatocyte growth factor and its receptor, the c-met tyrosine kinase, can mediate
188 a signal exchange between mesenchyme and epithelia during mouse development. J. Cell B iol, (1993), 123, 223-235.
Spencer-Dene, B., Thorogood, P., Nair, S., Kenny, A. J., Harris, M., Henderson, B. Distribution of, and a putative role for, the cell-surface neutral metalloendopeptidases during craniofacial development. Development, (1994), 120, 3213-3226.
Stanisstreet, M. Scanning electron microscopy and morphometry. In Postimplantation Mammalian Embryos (ed. Copp, A. J., and Cockcroft, D. L.) (1990) ppl09-126. Oxford: IRL Press.
Steel, K. P., Brown, D. M. Genes and deafness. Trends Genet., (1994), 10, 428-435.
Sterchi, E. E., Green, J. R., Lentze, M. J. Non-pancreatic hydrolysis of N-benzoyl-L- tyrosyl-p-aminobenzoic acid (PABA peptide) in the human small intestine. Clin. Sci., (1982), 62, 557-560.
Stephenson, S. L., Kenny, A. J. The hydrolysis of a human atrial natriuretic peptide by pig kidney microvillar membranes is initiated by endopeptidase 24.11. Biochem. J. (1987a), 243, 183-187.
Stephenson, S. L., Kenny, A. J. Metabolism of neuropeptides: hydrolysis of the angiotensins, bradykinin, substance P and oxytocin by pig kidney microvillar membranes. Biochem. J. (1987b), 241, 237-247.
Stone, R. A., Kuwayama, Y., Laties, A. M. Regulatory peptides in the eye. Experientia, (1987), 43, 791-800.
Sunday, M. E., Hua, J., Torday, J. S., Reyes, B., Shipp, M. A. CD 10/Neutral endopeptidase 24.11 in developing human fetal lung: patterns of expression and modulation of peptide-mediated proliferation. J. Clin. Invest., (1992), 90, 2517-2525.
Thorogood, P. (1994). Craniofacial development and the neural crest. In Early Fetal Growth and Development (ed. Ward, R. H. T., Smith, S. K., Donnai, D.), pp 111-120. RCOG Press, London.
Tong, ¥ ,, Pelletier, G. Ontogeny of atrial natriuretic factor (ANF) binding in various areas of the rat brain. Neuropeptides, (1990), 16, 63-68.
Towbin, J., Staehelin, T., Gordon, J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: Procedure and some applications. Proc. Natl Acad. Sci USA, (1979), 76, 350-4.
Towner, P. (1991). Purification of DNA. In Essential Molecular Biology, Volume 1, (ed. Brown, T. A.), pp 47-68. Oxford University Press, Oxford.
Umezawa, S. A new microbial metabolite phosphoramidon (isolation and structure).
189 Tetra. Lett., (1972), 1, 97-100.
Vainio, S., Karavanova, I., Jewett, A., Thesleff, I. Identification of BMP-4 as a signal mediating secondary induction between epithelial and mesenchymal tissues during early tooth development. Cell, (1993), 75, 45-58.
Vallee, B. L., Auld, D. S. Zinc coordination, function, and structure of zinc enzymes and other proteins. Biochemistry, (1990), 29, 5647-5659.
Villablanca, A. C., Murphy, C. J., Reid, T. W. Growth-promoting effects of substance P on endothelial cells in vitro. Circ. Res., (1994), 75, 1113-1120.
Waksman, G., Bouboutou, R., Devin, J., Besselievre, R., Foumie-Zaluski, M. C., Roques, B. P. Binding of the bidentate inhibitor pH]HACBO-Gly to the rat brain neutral endopeptidase "enkephalinase". Biochem. Biophys. Res. Commun., (1985), 131,262-268.
Wilcox, J. N., Derynck, R. Developmental expression of transforming growth factors alpha and beta in mouse fetus. Mol. Cell. Biol., (1988), 8, 3415-3422.
Wilcox, J. N., Pollard, H., Moreau, J., Schwartz, J. C., Malfroy, B. Localization of enkephalinase mRNA in rat brain by in situ hybridization: comparison with immunohistochemical localization of the protein. Neuropeptides, (1989), 14, 77-83.
Wilkins, M. R., Unwin, R. J., Kenny A. J. Endopeptidase-24.11 and its inhibitors: Potential therapeutic agents for edematous disorders and hypertension. Kidney Int., (1993), 43, 273-285.
Wilkinson, D, G., Green, J. In situ hybridization and the three dimensional reconstruction of serial sections. In Postimplantation Mammalian Embryos (ed. Copp, A. J., and Cockcroft, D. L.) (1990) pp 155-171. Oxford, UK.
Wilkinson, D. G., Bhatt, S., McMahon, A. P. Expression pattern of the FGF-related proto-oncogene int-2 suggests multiple roles in fetal development. Development, (1989), 105, 131-136.
Witschi, E. Pre-natal vertebrate development. In Growth VII (ed. P. L. Altman and D. S. Dittmer) (1962) pp304-313. Biological Handbooks of the Federation of American Societies for Experimental Biology, Washington, DC, USA.
Woll, P. J., Rozengurt, E. Neuropeptides as growth regulators. Br. Med. Bull., (1989), 45, 492-505.
Wolz, R. L., Harris, R. B., Bond, J. S. Mapping the active site of meprin-A with peptide substrates and inhibitors. Biochemistry, (1991), 30, 8488-8493.
Wozney, J. M., Rosen, V., Celeste, A. J., Mitsock, L. M., Whitters, M. J., Kriz, R. W., Hewick, R. M., Wang, E. A. Novel regulators of bone formation: Molecular
190 clones and activities. Science, (1988), 242, 1528-1534.
Yamaguchi, T., Fukase, M., Kido, H., Sugimoto, T., Katunuma, N., Chihara, K. Meprin is predominantly involved in parathyroid hormone degradation by the microvillar membranes of rat kidney. Life Sci., (1994), 54 (5), 381-6.
Yasumasu, S., Katow, S., Hamazaki, T. S., luchi, L, Yamagami, K. Two constituent proteases of a teleostean hatching enzyme: concurrent syntheses and packaging in the same secretory granules in discrete arrangement. Dev. Biol, (1992), 149, 349-356.
191 mi. N eurula 9(7.5) 1.0 (1.4 X Presomite neurula; ftision of chorio-amniotic folds; chorio-amniotic stalk; neural plate; embryo 0.45) bent dorsally; bud of allantoic stalk
9.5 (7.75) 1.5 (1 .8 x 1 . Somites 1-4 (occipital); pendant with 3 cavities: ectochorionic cyst, exocoelom, and amniotic cavity; embryo bent dorsally 10 (8.0-8.5) Somites 5-12 (cervical); 1st visceral arch; ectochorionic cyst fused with ectoplacenta and with allantoic stalk; regression of peripheral (distal) yolk sac and trophectoderm (diplotrophoblast); Reichert’s membrane; gonia in endoderm; embryo bent dorsally 10.5 (8.5- 2.4 (2.2-3.4) Somites 13-20 (upper thoracic); 2 visceral arches; disc and yolk sac placentas; appendicular folds; embryo reverses, curves ventrally II (9.5) 3.3 Somites 21-25 (lower thoracic); yolk sac closes at level of 15th somite; primary gonia in mesentery; primitive streak disappears; tail bud becomes organized; fore and hind limb buds recognisable Tail Bud Embryo
11.^ (10) 3.8 Somites 26-28 (upper lumber); 3 visceral arches 19 11.75 (10.25) 4.2 Somites 29-31 (lower lumber); visceral arches I-IV; cervical folds; appendicular fo ld s;# oJus
20 11.875 5 (4.7 X 5.2) Somites 32-33 (upper sacral)
21 12 5.1 Somites 34-35 (lower sacral); deep cervical sinuses
22 12.125(10.5) 5.2 Somite 36 (1st caudal); olfactory pits 23 12.25 5.6 (4.5 X 5.8) Somites 37-38 (caudal); start of umbilical herniation 24 12.375 6 Somites 39-40 (caudal) Complete Embryo
25 12.5 (1 6,2 Somites 41-42 (caudal); occipital somites dispersing; 4 visceral arches; deep cervical sinuses, fore limb buds at somite levels 8-14; hind limb buds at somite levels 28-31; body forms a spiral of about 1 'A turns, the left face and trunk applied to yolk sac, the right side turned toward placenta; tail and allantoic stalk rise to placenta Metamorphosing Embryo 26 12.75 Somites 43-45 (caudal); mandibular, maxillary, and frontonasal processes; cervical sinuses closing; mammary welts; differentiation of handplates; fore limb buds vascularised, brachial nerves entering; beginning of umbilical hernia 27 13(12) Somites 46-48 (caudal); prominent facial processes and clefts; nose-snout projecting; cerxdcal sinuses closed; primordia of mammary glands; round handplates and footplates; larger umbilical hernia 28 13.5 (12.5) 8.5 Somites 49-51 (caudal); 1st visceral cleft transforms into external ear duct; precartilaginous condensations in handplates 29 14 9.5 Somites 52-55 (caudal); auricular hillocks on visceral arches I and II 30 14.5 (13) 10.5 Somites 56-60 (caudal); body uncoils; mandibular precartilage; nearly round openings of external ear duct; pleuroperitoneal narrows
31 15 12 Somites 61-63 (caudal); facial clefts closed; pleuroperitoneal canal closed; complete diaphragm
32 15.5 (14.5) 14.2 (14.3 X Somite 64 (caudal); pinna turns forward; maximal size of umbilical hernia
33 16(15) 15.5 Somite 65 (caudal); snout lifts off chest; last stage of metamorphosis
Foetus
34 17-18(16- 16-20 1st foetal stage; rapid growth of eyelids (eyes entirely covered at end of 18th day); palate 16.5) complete; pinna covers ear duct; umbilical hernia withdraws 35 antenatal 19-22 (17-19) 20-40 2nd foetal stage; sealed eyelids; foetal membranes and placentas reach peak of development; tail grows to 10 mm; birth occurs (22nd day in rat, 19th day in mice)