2213 Missouri Ave Carthage, Mo 64836 800-970-4479 A Business of ESM Technologies, LLC stratumnutrition.com
Research Summary
Research & Patent Portfolio for BLIS Oral-cavity Probiotics: BLIS K12™ & BLIS M18™
Rev. Date: Wednesday, May 13, 2020 Research & Patent Portfolio for BLIS Probiotics: BLIS K12™ & BLIS M18™ B L I S K 12 and B L I S M18 are h i gh ly ad va nce d pro bi o t i cs f o r t h e o ral ca vi t y and upper resp i rat o ry t ract . B L I S K 12 co lo ni ze s i n t h e m o ut h and h elps t o m ai nt ai n ear, no se and t h ro at ( E N T ) i m m une h ealt h , w h i le B L I S M18 su ppo rt s t o o t h and gum h ealt h . B L I S pro bi o t i cs w ere o ri gi nally d i sco ve red as sci ent i st s st ud i ed t h e o ral m i cr o bi o m e o f a ch i ld w i t h ex ce pt i o nal t h ro at h ealt h . B o t h B L I S K 12 and B L I S M18, o r S treptococcus salivarius ( S . salivarius) , w ere i so lat ed f ro m t h e m o ut h s of healthy humans and can help to establish or re-establish a healthy balance of beneficial bacteria in the oral cavity and upper resp i rat o ry t ract .
Published Research in Peer-reviewed Journals:
ENT Health 1) P as s ari ello C , D i N ard o F, P o li m eni A, D i N ard o D , T es t arelli L . ( 2 02 0) P ro bi o t i c S treptococcus salivarius red uc es s y m p- t o m s o f d ent ure s t o m at i t i s and o ral c o lo ni z at i o n by C andida albicans. Applied S ciences, 10: 3002 .
2 ) B ert uc c i o li A, R o c c h i M, Mo rgant i I , V i c i G , G erv as i M, Am at o ri S and Si s t i D . ( 2 019) S treptococcus salivarius K 12 i n ph a- ry ngo t o ns i lli t i s and ac ut e o t i t i s m ed i a – a m et a- analy s i s . N utrafoods, 2 : 80- 88.
3) Marini G, Sitzia E, Panatta ML and De Vincentiis GC. (2019) Pilot study to explore the prophylactic efficacy of oral probiot- i c S treptococcus salivarius K 12 i n prev ent i ng rec urrent ph ary ngo - t o ns i llar epi s o d es i n ped i at ri c pat i ent s . I nternational J ournal of G eneral M edicine, 12 : 2 13- 2 17 .
4) H u L , Mao Q , Z h o u P , L v X , H ua H and Y an Z . ( 2 019) E f f ec t s o f S treptococcus salivarius K 12 w i t h ny s t at i n o n o ral c and i d i - as i s – R C T . O ral D iseases 2 5( 6) : 157 3- 1580.
5) D i P i erro F, R i s s o P , P o ggi E , T i Mi t i lli A, B o llo li S, B runo M, C anev a E , C am pus R and G i annat t as i o A. ( 2 018) U s e o f S treptococcus salivarius K 12 t o red uc e t h e i nc i d enc e o f ph ary ngo - t o ns i lli t i s and ac ut e o t i t i s m ed i a i n c h i ld ren: a ret ro s pec t i v e analy s i s i n no t - rec urrent ped i at ri c s ubj ec t s . M inerva P ediatrica, 7 0( 3) : 2 40- 2 45.
6) D i P i erro F, C o lo m bo M, G i uli ani MG , D anz a ML , B as i le I , B o llani , T , C o nt i AM, Z anv i t A, and R o t t o li AS. ( 2 016) E f f ec t o f ad m i ni s t rat i o n o f S treptococcus salivarius K 12 o n t h e o c c urrenc e o f s t rept o c o c c al ph ary ngo - t o ns i lli t i s , s c arlet f ev er, and ac ut e o t i t i s m ed i a i n 3 y ears o ld c h i ld ren. European R eview for M edical and P h armacological S ciences, 2 0: 4601- 4606.
7 ) D i P i erro F, C o lo m bo M, Z anv i t A, and R o t t o li AS. ( 2 016) P o s i t i v e c li ni c al o ut c o m es d eri v ed f ro m us i ng S treptococcus sali- varius K 12 t o prev ent s t rept o c o c c al ph ary ngi t i s i n c h i ld ren: a pi lo t i nv es t i gat i o n. D rug H ealth care and P atient S afety , 8: 7 7 - 81.
8) G rego ri G , R i gh i O , R i s s o P , B o i ard i G , D em uru G , Ferz et t i A, G alli A, G h i s o ni M, L enz i ni S, Marengh i C , Mura C , Sac c h et t i R and Suz z ani L . ( 2 016) R ed uc t i o n o f gro up A bet a- h em o ly t i c s t rept o c o c c us ph ary ngo - t o ns i llar i nf ec t i o ns as s o c i at ed w i t h us e o f t h e o ral pro bi o t i c S treptococcus salivarius K 12 : a ret ro s pec t i v e o bs erv at i o nal s t ud y . T h erapeutics and C linical R isk M an- agement, 12 : 87 - 92 . stratumnutrition.com [email protected] (800) 970-4479
* T h es e s t at em ent s h av e no t been ev aluat ed by t h e Fo o d and D rug Ad m i ni s t rat i o n. T h i s pro d uc t i s no t i nt end ed t o d i agno s e, t reat , c ure, o r prev ent any d i s eas e. ENT Health, continued
9) Di Pierro F, Di Pasquale D and Di Cicco M. (2015) Oral use of Streptococcus salivarius K12 in children with secretory otitis media: preliminary results of a pilot, uncontrolled study. International Journal of General Medicine, 8:303-308.
10) Di Pierro F, Colombo M, Zanvit A, Risso P and Rottoli A. (2014) Use of Streptococcus salivarius K12 in the prevention of streptococcal and viral pharyngotonsillitis in children. Drug, Healthcare and Patient Safety, 6:15-20.
11) Di Pierro F, Adami T, Rapacioli G, Giardini N and Streitberger C. (2013) Clinical evaluation of the oral probiotic Strepto- coccus salivarius K12 in the prevention of recurrent pharyngitis and/or tonsillitis caused by Streptococcus pyogenes in adults. Expert Opinion Biological Therapy, 13(3):339-343.
12) Fiedler T, Riani C, Koczan D, Standar K, Kreikemeyer B and Podbielski A. (2013) Protective mechanisms of respiratory tract streptococci against Streptococcus pyogenes biofilm formation and epithelial cell infection. Applied and Environmental Microbiology, 79:1265-1276.
13) Di Pierro F, Donato G, Fomia F, Adami T, Careddu D, Cassandro C and Albera R. (2012) Preliminary pediatric clinical evaluation of the oral probiotic Streptococcus salivarius K12 in preventing recurrent pharyngitis and/or tonsillitis caused by Streptococcus pyogenes and recurrent acute otitis media. International Journal of General Medicine, 5:991-997.
14) Ishijima S, Hayama K, Burton J, Reid G, Okada M, Matsushita Y and Abe S. (2012) Effect of Streptococcus salivarius K12 on the in vitro growth of Candida albicans and its protective effect in an oral candidiasis model. Applied Environmental Microbiology, 78(7):2190-2199.
15) Guglielmetti S, Taverniti V, Minuzzo M, Arioli S, Stuknyte M, Karp M and Mora D. (2010) Oral bacteria as potential probi- otics for the pharyngeal mucosa. Applied and Environmental Microbiology, 76(12):3948-3958.
16) Power D, Burton J, Chilcott C, Dawes P and Tagg J. (2008) Preliminary investigations of the colonisation of upper respiratory tract tissues of infants using a paediatric formulation of the oral probiotic Streptococcus salivarius K12. European Journal of Clinical Microbiology & Infectious Diseases, 27: 1261.
17) Horz H, Meinelt A, Houben B and Conrads G. (2007) Distribution and persistence of probiotic Streptococcus salivarius K12 in the human oral cavity as determined by real-time quantitative polymerase chain reaction. Oral Microbiology and Immu- nology, 22(2):126-130.
18) Dierksen K, Moore C, Inglis M, Wescombe P and Tagg J. (2007) The effect of ingestion of milk supplemented with saliva- ricin A-producing Streptococcus salivarius on the bacteriocin-like inhibitory activity of streptococcal populations on the tongue. FEMS Microbiology Ecology, 59:584-591.
19) Hyink O, Wescombe P, Upton M, Ragland N, Burton J and Tagg J. (2007) Salivaricin A2 and the novel lantibiotic saliva- ricin B are encoded at adjacent loci on a 190-kilobase transmissible megaplasmid in the oral probiotic strain Streptococcus salivarius K12. Applied and Environmental Microbiology, 73(4):1107-1113.
20) Tagg J, Wescombe P and Burton J. (2006) Oral streptococcal BLIS: Heterogeneity of the effector molecules and poten- tial role in the prevention of streptococcal infections. International Congress Series, 1289:347-350.
21) Wescombe P, Burton J, Cadieux P, Klesse N, Hyink O, Heng N, Chilcott C, Reid G and Tagg J. (2006) Megaplasmids encode differing combinations of lantibiotics in Streptococcus salivarius. Antonie van Leeuwenhoek, 90(3):269-280.
22) Wescombe P, Upton M, Dierksen K, Ragland N, Sivabalan S, Wirawan R, Inglis M, Moore C, Walker G, Chilcott C, Jenkinson H and Tagg J. (2006) Production of the lantibiotic salivaricin A and its variants by oral Streptococci and use of a specific induction assay to detect their presence in human saliva. Applied Environmental Microbiology, 72(2):1459-1466. stratumnutrition.com [email protected] (800) 970-4479
*These statements have not been evaluated by the Food and Drug Administration. This product is not intended to diagnose, treat, cure, or prevent any disease. ENT Health, continued
23) Tagg J. (2004) Prevention of streptococcal pharyngitis by anti-Streptococcus pyogenes bacteriocin-like inhibitory sub- stances (BLIS) produced by Streptococcus salivarius. Indian Journal of Medical Research, 119:13-16.
24) Dierksen K and Tagg J. (1999) The influence of indigenous bacteriocin-producing Streptococcus Salivarius on the ac- quisition of Streptococcus Pyogenes by primary school children in Dunedin, New Zealand. Proceedings of the XIV Lancefield International Symposium on Streptococci and Streptococcal Diseases, 81-85, New Zealand.
25) Fantinato V, Jorge A and Shimizu M. (1999) Production of bacteriocin-like inhibitory substances (BLIS) by Streptococ- cus Salivarius strains isolated from the tongue and throat of children with and without sore throat. Revista de Microbiologia, 30(4):332-334.
Halitosis 26) Jamali Z, Aminabadi N A, Samiei M, Deljavan A S, Shokravi M and Shirazi S. (2016) Impact of chlorhexidine pretreat- ment followed by probiotic Streptococcus salivarius strain K12 on halitosis in children: A randomised controlled clinical trial. Oral Health & Preventive Dentistry, 14(4):305-313.
27) Masdea L, Kulik E, Hauser-Gerspach I, Ramseier A, Filippi A and Waltimo T. (2012) Antimicrobial activity of Streptococ- cus salivarius K12 on bacteria involved in oral malodour. Archives of Oral Biology, 57(8):1041-1047.
28) Burton J, Chilcott C, Moore C, Speiser G and Tagg J. (2006) A preliminary study of the effect of probiotic Streptococcus salivarius K12 on oral malodour parameters. Journal of Applied Microbiology, 100(4):754-764.
29) Kazor C, Mitchell P, Lee A, Stokes L, Loesche W, Dewhirst F and Paster B. (2003) Diversity of bacterial populations on the tongue dorsa of patients with halitosis and healthy patients. Journal of Clinical Microbiology, 41(2):558-563.
Safety 30) Barretto C, Alvarez-Martin P, Foata F, Renault P and Berger B. (2012) Genome sequence of the lantibiotic bacteriocin producer Streptococcus salivarius strain K12. Journal of Bacteriology, 1194(21):5959-5960.
31) Burton J, Cowley S, Simon R, McKinney J, Wescombe P and Tagg J. (2011) Evaluation of safety and human tolerance of the oral probiotic Streptococcus salivarius K12: A randomized, placebo-controlled, double-blind study. Food and Chemical Toxicology, 49:2356-2364.
32) Burton J, Chilcott C, Wescombe P and Tagg J. (2010) Extended safety data for the oral cavity probiotic Streptococcus salivarius K12. Probiotics and Antimicrobial Proteins, 2:135-144.
33) Burton J, Wescombe P, Moore C, Chilcott C and Tagg J. (2006) Safety assessment of the oral cavity probiotic Strepto- coccus salivarius K12. Applied and Environmental Microbiology, 72(4)3050-3053.
Immune Modulating Effects and Mode-of-Action 34) Cosseau C, Devine D, Dullaghan E, Gardy J, Chikatamarla A, Gellatly S, Yu L, Pistolic J, Falsafi R, Tagg J and Hancock R. (2008) The commensal Streptococcus salivarius K12 downregulates the innate immune responses of human epithelial cells and promotes host-microbe homeostasis. Infection and Immunity, 76(9):4163-4175.
35) Chilcott C, Crowley L, Kulkarni V, Jack R, McLellan A and Tagg J. (2005) Elevated levels of interferon gamma in human saliva following ingestion of Streptococcus salivarius K12. Joint meeting of New Zealand Microbiological Society and New Zealand Biochemistry and Molecular Biology, Dunedin.
Patent Portfolio:
US 8,057,790 “Treatment of malodour” (2011). This invention relates to methods for inhibiting growth of anaerobic bacteria, particularly halitosis causing bacteria. The methods use BLIS-producing Streptococcus salivarius strains, extracts thereof, and compositions comprising same in the prevention or treatment of halitosis. stratumnutrition.com [email protected] (800) 970-4479
*These statements have not been evaluated by the Food and Drug Administration. This product is not intended to diagnose, treat, cure, or prevent any disease. US 7,595,041 “Treatment of Malodour (2009). This invention relates to methods for inhibiting growth of anaerobic bacteria, particularly halitosis causing bacteria. The methods use BLIS-producing Streptococcus salivarius strains, extracts thereof, and compositions comprising same in the prevention or treatment of halitosis.
EP 1 169 340 “Lantibiotic” (2007). US 6,773,912 “Lantibiotic” (2004). This invention provides an antibacterial protein, Saliva- ricin B. Salivaricin B is bacteriocidal with respect to, inter alia, S. pyogenes and therefore has numerous therapeutic applica- tions. These applications include, but are not limited to, forming part of therapeutic formulations for use in treating or prevent- ing streptococcal infections of the throat.
Published Research in Peer-reviewed Journals:
Dental Health 1) Di Pierro F, Zanvit A, Nobili P, Risso P, Fornaini C. (2015) Cariogram outcome after 90 days of oral treatment with Strep- tococcus salivarius M18 in children at high risk for dental caries: results of a randomized, controlled study. Clinical, Cosmetic and Investigational Dentistry, 7:107-113.
2) Gobbi E, De Francesco MA, Piccinelli G, Caruso A, Bardellini E and Majorana A. (2020) In vitro inhibitory effect of two commercial probiotics on chromogenic actinomycetes. European Archives of Paediatric Dentistry, https://doi.org/10.1007/ s40368-020-00512-2.
3) Bardellini E, Amadori F, Gobbi E, Ferri A, Conti G and Majorana A. (2020) Does Streptococcus salivarius strain M18 as- sumption make black stains disappear in children? Oral Health and Preventive Dentistry, 18:161-164.
4) Scariya L, Nagarathna D and Varghese M. (2015) Probiotics in Periodontal Therapy. International Journal of Pharma and Bio Sciences, 6(1):242-250.
5) Burton J, Drummond B, Chilcott C, Tagg J, Thomson W, Hale J and Wescombe P. (2013) Influence of the probiotic Strep- tococcus salivarius strain M18 on indices of dental health in children: a randomized double-blind, placebo-controlled trial. Journal of Medical Microbiology, 62(6):875-884.
6) Burton J, Wescombe P, Macklaim J, Chai M, MacDonald K, Hale J, Tagg J, Reid G, Gloor G and Cadieux P. (2013) Per- sistence of the oral probiotic Streptococcus salivarius M18 is dose dependent and megaplasmid transfer can augment their bacteriocin production and adhesion characteristics. PLoS One, 8:e65991.
Safety 7) Heng N, Haji-Ishak N, Kalyan A, Wong A, Lovric´ M, Bridson J, Artamonova J, Stanton J, Wescombe P, Burton J, Cullinan M and Tagg J. (2011) Genome sequence of the bacteriocin-producing oral probiotic Streptococcus salivarius strain M18. Journal of Bacteriology, 193(22):6402-6403.
Patent Portfolio:
EP 1 483 366 “Antimicrobial Composition” (2010). US 7,226,590 “Antimicrobial Composition” (2007). This invention provides novel Streptococcus salivarius, compositions containing same, and use of S. salivarius strains as antimicrobial agents. The strains are bacterial inhibitors with respect to at least S. mutans and/or MS and therefore have a number of therapeutic appli- cations. The applications include but are not limited to forming part of therapeutic formulations for use in controlling, treating, or preventing dental caries. stratumnutrition.com [email protected] (800) 970-4479
*These statements have not been evaluated by the Food and Drug Administration. This product is not intended to diagnose, treat, cure, or prevent any disease. applied sciences
Article Probiotic Streptococcus salivarius Reduces Symptoms of Denture Stomatitis and Oral Colonization by Candida albicans
Claudio Passariello 1 , Francesco Di Nardo 2, Antonella Polimeni 3 , Dario Di Nardo 3,* and Luca Testarelli 3 1 Department of Public Health and Infectious Diseases, ‘Sapienza’ University of Rome, P.le Aldo Moro, 5, 00185 Rome, Italy; [email protected] 2 Azienda Sanitaria Locale di Novara, Viale Roma, 7-28100 Novara, Italy; [email protected] 3 Department of Oral and Maxillo-Facial Sciences, ‘Sapienza’ University of Rome, Via Caserta, 6-00161 Rome, Italy; [email protected] (A.P.); [email protected] (L.T.) * Correspondence: [email protected]; Tel.: +39-339-3935-527
Received: 31 March 2020; Accepted: 23 April 2020; Published: 25 April 2020
Abstract: Denture stomatitis (DS) is an inflammatory status of oral mucosae frequently observed in denture wearers, and mainly associated with oral overgrowth of Candida albicans. DS is the cause of multiple visits to the dental office and is thought to enhance the risk of systemic infections. The treatment of DS mainly relies upon improvement of oral hygiene measures and prescription of topical or systemic antifungal agents, and disinfectants that, although effective, are not without drawbacks. Since, in recent years, some probiotics were investigated as a means to contrast oral colonization by Candida spp., this study was designed to preliminarily evaluate the effects of probiotic strain Streptococcus salivarius K12, in subjects affected by DS, and the duration of these effects. Fifty adult denture wearers affected by DS were enrolled and randomly divided into two groups: the experimental group was instructed to perform careful oral and denture hygiene and to assume the probiotic preparation for 30 days; the control group received only oral hygiene instructions. Patients were evaluated for signs of DS at the beginning of the study, at the end of treatment and 30 days later. Microbiological samples were obtained at the beginning of the study and at the end of treatment to quantify Candida albicans cells. Experimental treatment reduced clinical signs and symptoms of DS and the count of C. albicans. The clinical effects of experimental treatment were still evident after 30 days, suggesting that administration of probiotic strain Streptococcus salivarius K12 could be a promising approach in the treatment of DS.
Keywords: denture stomatitis; Candida albicans; probiotic; Streptococcus salivarius
1. Introduction Life expectancy significantly increased in industrialized countries in the last century, while natality progressively reduced [1]; consequently, the proportion of elderly subjects significantly increased, with evident healthcare issues in all fields of medicine, including dentistry [2,3]. Edentulism (both partial and total) is among the most frequent dental problems of an aged population, and in many cases it is treated by removable dentures [4]. An inflammatory status of the oral mucosal areas covered by the denture is frequently observed in denture wearers. This inflammatory condition is commonly known as denture stomatitis (DS). The prevalence of DS was reported to range from 15% to over 70%, depending on variables including: continuous use of the denture, quality of oral and denture hygiene (frequently limited by dexterity of the subject), adequateness of the denture, and co-morbidities such as diabetes [5].
Appl. Sci. 2020, 10, 3002; doi:10.3390/app10093002 www.mdpi.com/journal/applsci Appl. Sci. 2020, 10, 3002 2 of 10
The etiology of DS is multifactorial, but Candida albicans and other fungi of the genus Candida are believed to be key etiologic factors. Several members of the genus Candida are common members of oral biofilms and are able to overgrow in the denture microenvironment, inducing inflammation and acting as promoters of opportunistic polymicrobial infections, frequently observed in DS [5–9]. Clinically DS is characterized by soreness, pain, discomfort, denture mobilization and is consequently the cause of multiple visits to the dental office. DS is, moreover, believed to be a condition potentially enhancing the risk of pulmonary and other systemic infections, particularly in institutionalized elderly subjects [10–12]. The prevention and treatment of DS in many cases relies only upon an examination of the adequacy of the denture, improvement of oral hygiene measures and a discontinuation of nocturnal wearing of the denture [13]. Therapeutic strategies based upon the administration of topical or systemic antifungal agents and disinfectants [14], or upon incorporation of slow release antifungal/antimicrobial agents into denture base materials [15] were also proposed. Although antifungal drugs proved effective in relieving clinical signs and symptoms of DS, they are not without drawbacks. In fact, high rates of early post-treatment relapse and recurrence were reported [16], while prolonged therapeutic regimens or multiple cycles of treatment greatly enhance the risk of potential systemic adverse effects [17] and of induction of antifungal drug resistance in resident fungal strains [18], making the treatment of DS by their means challenging. In recent years the administration of specific probiotic preparations was investigated as a means to contrast oral colonization by Candida spp. in denture wearers both in the presence and in the absence of DS, although with contrasting results [19–22]. The present work was consequently designed to preliminarily evaluate if a probiotic preparation, containing Streptococcus salivarius strain K12 could prove effective in reducing clinical signs and symptoms of DS and in reducing oral colonization by C. albicans, and if the duration of clinical effects continued after the end of treatment.
2. Experimental Section
2.1. Studied Subjects and Study Design Fifty adult human subjects of both sexes were enrolled for this study from a larger population of denture wearers attending or referred to the Department of Oral and Maxillo-Facial Sciences of “Sapienza” University of Rome. Inclusion criteria were as follows: presence of at least one totally edentulous dental arch, presence of a full arch, well-fitting removable acrylic denture, presence of subjective discomfort/pain in relation to denture, and presence of clinical signs of DS. Exclusion criteria were as follows: use of adhesives for denture stabilization, use of antibiotics in the last 30 days, presence of systemic diseases influencing homeostasis of the oral mucosae (i.e., lupus erythematosus, lichen planus, xerostomia) or significantly influencing immunity (malignancies, transplantations requiring immunosuppressive therapy). Upon enrollment in the study patients were informed of the scope of the study and were asked to sign an informed consent in accordance with criteria of the Helsinki Declaration of 1975, as revised in 2000. The present study was approved by the Ethical Committee of Policlinico Umberto I of Rome (n. 4790) and registered with the trial identification number ISRCTN14751782. A written informed consent form was signed by all the patients before their enrollment. All patients were instructed to perform scrupulous mechanic denture and oral hygiene daily. More precisely they were instructed to clean the denture with a dedicated brush under a constant flux of tap water and to carefully brush their teeth, the oral mucosae and tongue with their toothbrush. They were also instructed to refrain from wearing the denture 24 h a day and invited not to use oral rinses containing antimicrobial substances. Patients enrolled in the study were subjected to baseline (T-0) clinical evaluation and microbiological sampling and randomly assigned to either the experimental group (25 subjects) or to the control group (25 subjects). Patients assigned to the experimental group (EXP) were invited to perform mechanic denture and oral hygiene as previously explained, and to Appl. Sci. 2020, 10, 3002 3 of 10
Appl. Sci. 2020, 11, x FOR PEER REVIEW 3 of 10 take 1 tablet of Bactoblis® (Pharmaextracta Spa, Pontenure, Piacenza, Italy), containing 109 CFU of the 9 probioticcontaining strain 10 CFUS. salivarius of the probioticK12 for strain 30 days S. salivarius in the evening, K12 for just 30 days before in goingthe evening, to sleep. just Patients before going were instructedto sleep. Patients to remove were the instructed denture to and remove allow the the denture tablet to and dissolve allow the in the tablet mouth, to dissolve and to in refrain the mouth, from drinkingand to refrain for the from next drinking 60 min. for the next 60 min. Patients assigned to to the the control control group group (CTR) (CTR) were were invited invited to perform to perform mechanic mechanic denture denture and andoral oralhygiene hygiene as previously as previously explained explained for 30 for days. 30 days.All subjects All subjects of both of groups both groupswere instructed were instructed not to wear not tothe wear denture the denturewhile sleeping while sleepingand to maintain and to maintain the denture the within denture a withindedicated a dedicated box during box the during night. the At night.the end At of the period end of of the 30 period days all of patients 30 days were all patients subjected were to a subjectedsecond (T-30) to a clinical second evaluation (T-30) clinical and evaluationmicrobiological and microbiological sampling, and sampling, further instructed and further to instructed reinstate toprevious reinstate oral previous and denture oral and hygiene denture hygienemeasures measures for the fornext the 30 next days. 30 days.At the At end the endof this of thisperiod period they they were were subjected subjected to to further further clinical evaluation (T-60)(T-60) (Figure(Figure 11).).
Figure 1. Experimental study design. Figure 1. Experimental study design. 2.2. Clinical Evaluation 2.2. Clinical Evaluation Clinical evaluation included recording of two subjective parameters and one objective index. SubjectiveClinical feeling evaluation of pain included in the oral recording mucosa and of two dryness subjective of the mouthparameters were recordedand one objective for each patient. index. AnswersSubjective were feeling recorded of pain as in presence the oral mucosa (1) or absence and dr (0).yness Each of the patient mouth was were inspected recorded by for an each experienced patient. clinicianAnswers in were order recorded to determine as presence the presence (1) or absence and extension (0). Each ofclinical patient signs was inspected of DS according by an experienced to Newton’s classificationclinician in order [23]. Thisto determine classification the of presence DS describes and threeextension steps ofof stomatitis clinical signs according of DS to diaccordingffusion and to intensityNewton’s of classification clinical signs [23]. of inflammation. This classification Grade of 1: DS presence describes of pin-pointthree steps hyperemic of stomatitis lesions according (localized to simplediffusion inflammation); and intensity grade of clinical 2: presence signs of diinflammation.ffuse erythema Grade involving 1: presence most of of the pin-point mucosa hyperemic contacting thelesions denture (localized (generalized simple simpleinflammation); inflammation); grade 2: grade presence 3: presence of diffuse of inflammationerythema involving associated most with of the a granularmucosa contacting surface of the the denture mucosa (generalized contacting the simple denture inflammation); (inflammatory grade papillary 3: presence hyperplasia). of inflammation associatedAll clinical with evaluationsa granular weresurface performed of the mucosa separately contacting by three the experienced denture (inflammatory clinicians (C.P., papillary D.D.N., andhyperplasia). L.T.), and calibrated to provide consistent determination of Newton’s class as follows: twenty All clinical evaluations were performed separately by three experienced clinicians (C.P., D.D.N., and L.T.), and calibrated to provide consistent determination of Newton’s class as follows: twenty Appl. Sci. 2020, 10, 3002 4 of 10 subjects were selected among those participating in the study. Each examiner independently evaluated and scored each subject; measures were repeated after 24 h on the same subjects. Values recorded by the three examiners at the same time were used to calculate inter-examiner reproducibility. Values recorded by each examiner at different times were used to calculate intra-examiner reproducibility. Inter- and intra-examiner reproducibility was measured through Cohen’s weighted kappa; values obtained suggest an almost perfect agreement among the three examiners [24].
2.3. Microbiological Samples Microbiological samples for detection and quantification of C. albicans cells were obtained from all patients at T0 and T30 by two methods [25]: (i) by streaking a cotton swab along the apex of the gingival process for a length of 30 mm in areas with signs of DS; the swab was then inserted in a sterile polystyrene tube containing 1 mL of Stuarts transport medium; (ii) by instructing each patient to remove the denture and to rinse vigorously with 10 mL of sterile physiologic saline for 1 min. The rinse was collected in a sterile 50 mL polypropylene tube. Samples were always stored on ice until further processing.
2.4. Quantification of Candida Albicans in Samples Tubes containing swabs for enumeration of C. albicans cells were vortexed for 1 min before transferring the transport medium to a sterile 1.5 mL polypropylene centrifuge tube. Samples were then centrifuged at 10,000 g at 4 C for 5 min; the supernatant was removed, and cellular pellets were × ◦ suspended in 1 mL of sterile physiologic saline. Tubes containing rinses were centrifuged at 10,000 g × at 4 ◦C for 5 min; the supernatant was then discarded, and pellets were suspended in 1 mL of sterile physiologic saline. Tenfold dilutions were prepared from all samples, and 0.1 mL of each sample and of its dilution was plated on BBL Chromagar Candida Medium (Becton Dikinson GmbH, Heidelberg, Germany). Following incubation for 48 h at 37 ◦C, plates were inspected and colonies of C. albicans (i.e., green colored colonies) were counted. The development of colonies with phenotypes typical of non-albicans Candida spp. was always recorded.
2.5. Statistical Analysis Differences in mean counts of C. albicans in the swab and rinse cultures between the study and control group at T0 and T30 were analyzed using the Student’s t-test. Differences in terms of DS according to the Newton’s class were compared using the Mann–Whitney U test. Differences between groups in the distribution of pain and dryness were compared using the Fisher’s exact test. Statistical analysis was performed with SPSS 13.0 for Windows. The significance level was set at p 0.05. ≤ 3. Results
3.1. Studied Population Fifty adult denture wearers of both sexes were selected for this study and randomly assigned to two groups of 25 subjects. The two groups were comparable for age (EXP mean age 74.3 3.8 years, ± age range 68–82, CTR mean age 73.1 3.6 years, age range 67–83, p = 0.26), and gender (males/females: ± EXP 13/12, CTR 11/14, p = 0.58) (Table 1). At T0 the EXP and CTR groups were comparable with respect to clinical parameters, and C. albicans counts. With respect to the degree of DS, as determined by Newton’s classification, at T0 the EXP group showed a mean score of 2.1 0.6, and the CTR group ± a mean score of 2.2 0.6 (p = 0.66). All patients in both groups suffered pain at T0, while 36% of ± patients of the EXP group suffered from dryness, as compared to 44% in the CTR group (p = 0.77). No significant differences were observed at T0 between groups in the mean C. albicans counts in the swab culture (191.2 CFU/mL in the EXP group vs. 183.8 in the CTR group, p = 0.63) and in the rinse culture (477.1 vs. 463.9, p = 0.64). Appl. Sci. 2020, 10, 3002 5 of 10
Table 1. Main characteristics of patients enrolled in the study, divided according to treatment group.
Group Experimental Control Age (mean SD) 74.3 3.8 73.1 3.6 ± ± ± Age range 68–82 67–83 Gender (Males/Females) 13/12 11/14 Smokers a (%) 24 20 Diabetes b (%) 36 28 Arterial hypertension c (%) 64 52 a Only subjects smoking <10 cigarettes/day were enrolled in the study; b only subjects with diabetes in good control were enrolled in the study; c only patients under therapy and with arterial pressure level <140/90 mmHg were enrolled in the study.
3.2. Probiotic S. salivarius Improved Clinical Conditions Clinical parameters recorded for the two groups at T0, T30 and T60 are reported in Tables 1 and 2. Although careful mechanic denture and oral hygiene according to a standard protocol was able to significantly improve clinical conditions in the CTR group between T0 and T30, the adjunctive administration of the probiotic preparation Bactoblis® caused a significantly greater improvement of objective clinical conditions (Table 1) in the same time lapse. Moreover, when patients of both groups discontinued therapeutic regimens, and resumed their usual oral hygiene behavior for 30 days (T60), subjects of the EXP group showed further improvement of clinical conditions while those of the CTR group showed partial worsening (Table 2).
Table 2. Distribution of denture stomatitis (DS) (according to Newton’s classification) between the study and control groups at T0 (p = 0.665), T30 (p = 0.005) and T60 (p < 0.001).
Group Control Experimental Count Column N % Count Column N % Newton class at T0 0 0 0.0% 0 0.0% 1 2 8.0% 4 16.0% 2 17 68.0% 15 60.0% 3 6 24.0% 6 24.0% Newton class at T30 0 6 24.0% 15 60.0% 1 16 64.0% 10 40.0% 2 3 12.0% 0 0.0% 3 0 0.0% 0 0.0% Newton class at T60 0 4 16.0% 18 72.0% 1 13 52.0% 7 28.0% 2 8 32.0% 0 0.0% 3 0 0.0% 0 0.0%
With respect to the degree of DS, no significant difference was observed at T0, while differences were statistically significant at T30 (p = 0.005) and at T60 (p < 0.001), with DS being more severe in the CTR group (Table 1). All patients in both groups suffered pain at T0. At T30 7 out of 25 patients reported pain in the EXP group (28.0%) against 14 out of 25 in the CTR group (56.0%, p = 0.085). Differences in pain were significant at T60, with four (16.0%) patients reporting it in the EXP group against 17 in the CTR group (68.0%, p < 0.001, Table3). No significant differences in dryness of mouth were observed between groups at T0 (p = 0.77), T30 (p = 0.42), and T60 (p = 0.14, Table 3). The higher number of patients suffering from dryness at T30 and T60 in the CTR group can be explained by the higher starting number registered at T0. No patient in the EXP group reported any adverse effect related to the assumption of Bactoblis®. Appl. Sci. 2020, 11, x FOR PEER REVIEW 6 of 10
Appl. Sci.Table2020, 103. ,Distribution 3002 of pain and dryness between groups before treatment (T0), after 30 days of 6 of 10 treatment (T30) and after 30 days after treatment had stopped (T60).
Table 3. Distribution of pain and dryness between groupsGroup before treatment (T0), after 30 days of treatment (T30) and after 30 days after treatmentControl had stopped (T60). Experimental Count Column N % Count Column N % Group Pain T0 No 0 0.0% 0 0.0% Yes 25 Control100.0% 25 Experimental100.0% Pain T30 No 11 Count Column44.0% N % Count18 Column72.0% N % Pain T0 Yes No 14 056.0% 0.0% 07 0.0%28.0% Yes 25 100.0% 25 100.0% Pain T60Pain T30 No No8 1132.0% 44.0% 2118 72.0%84.0% Yes Yes17 1468.0% 56.0% 74 28.0%16.0% Dryness T0Pain T60 No No14 856.0% 32.0% 1621 84.0%64.0% Yes 17 68.0% 4 16.0% Dryness T0Yes No11 1444.0% 56.0% 169 64.0%36.0% Dryness T30 No Yes20 1180.0% 44.0% 239 36.0%92.0% Dryness T30Yes No5 2020.0% 80.0% 232 92.0%8.0% Yes 5 20.0% 2 8.0% DrynessDryness T60 T60No No18 1872.0% 72.0% 23 92.0%92.0% Yes Yes7 728.0% 28.0% 2 8.0%8.0%
3.3. Probiotic Probiotic S. S. salivarius salivarius Reduced C. albicans Counts Counts of C. albicans were obtained from all patients at T0 and T30 by collecting two different different samples, a swab streaked for a length of 30 mm on the diseased mucosa underlying the denture and an oral rinse with 10 mL of sterile physiologic sali saline.ne. As As expected expected from from previous reports [25], [25], counts obtained from oral rinses were, on average, 2.5 times higher than thosethose obtainedobtained fromfrom swabs.swabs. While countscounts ofofC. C. albicans albicansobtained obtained at at T0 T0 from from samples samples of patients of patients of both of both the EXP the andEXP CTR and group CTR groupwere comparable, were comparable, analysis analysis of both swabof both and swab rinse samplesand rinse showed samples that showed the EXP that group the underwent EXP group a underwentreduction of a aboutreduction 60% of of aboutC. albicans 60% ofcounts C. albicans between counts T0 between and T30, T0 whereas and T30, the whereas reduction the in reduction the CTR ingroup, the CTR although group, significant, although significant, was only about was only 20% about (Figure 20%2). (Figure Colonies 2). with Colonies phenotypes with phenotypes typical of typicalnon-albicans of non- Candidaalbicansspp. Candida were spp. observed werein observed many cases in many but their cases counts but their were counts always were low always so that theylow sowere that considered they wereas considered not relevant as not for therelevant purposes for the of thepurposes study. of the study.
Figure 2. Candida albicansalbicans countscounts before before (T0) (T0) and and after after 30 30 days days treatment treatment regimens regimens (T30) (T30) with with (EXP) (EXP) and ® andwithout without (CTR) (CTR) probiotic probioticS. salivarius S. salivariusBLIS K12.BLISC.®K12. albicans C. albicanscounts obtainedcounts obtained by two distinct by two sampling distinct samplingprocedures procedures (swab and (swab rinse) areand represented rinse) are represente in the plotd and in reportedthe plot and in the reported explanatory in the table explanatory as colony forming units/ml (CFU/mL) means ( standard deviation). Significance of differences between single table as colony forming units/ml (CFU/mL)± means (±standard deviation). Significance of differences groups of data was calculated by the Student T test and is reported in the table as values of P. Appl. Sci. 2020, 10, 3002 7 of 10
4. Discussion The present work was designed to preliminarily evaluate the potential effectiveness of combining scrupulous oral and denture hygiene with the administration of a probiotic preparation, containing Streptococcus salivarius K12 for the treatment of DS in patients wearing well-fitting full arch dentures. DS is a multifactorial inflammatory disease of the oral mucosal areas covered by the denture, in which an overgrowth of C. albicans and other opportunistic fungal species normally found in the oral biofilm, is believed to play a key etiologic role [5,6,26]. DS is the cause of multiple visits to the dental office for pain, sensation of dryness of the mouth, discomfort and denture mobilization and is also believed to enhance the risk of pulmonary and other systemic infections [10–12]. C. albicans, as many other fungal species, is a normal colonizer of mucosal surfaces including the oral mucosa [8], although in healthy subjects its counts are low. Some clinical conditions, as for example the presence of acrylic bases of removable prostheses and a diminished hygienic skill favored by ageing, are known to promote a significant overgrowth of resident fungal species and of C. albicans in particular, thus promoting the onset of DS [6–8,16]. The availability of effective preventative and therapeutic approaches for DS is consequently important. As a direct consequence of the multifactorial nature of DS, its treatment may rely on different approaches, including examination and correction of the denture base, discontinuation of nocturnal wearing of the denture, improvement of oral and denture hygiene measures [13]. Other strategies could be the administration of topical or systemic antifungal agents and disinfectants [14], or the incorporation of slow release antifungal/antimicrobial agents into denture base materials [15]. Despite its multifactorial etiology, the main etiological factor and the principal cause of extensive inflammation observed in DS is certainly the colonization of the denture base and of the underlying mucosa by Candida spp. and other fungal species [26]. Consequently, the administration of antifungal drugs is highly effective in relieving clinical signs and symptoms of DS. Nevertheless, the use of such drugs is not without drawbacks, since short term treatments are affected by high rates of early post-treatment relapse and recurrence [16]. Furthermore, prolonged or repeated therapeutic regimens enhance the risk of systemic adverse effects [17] and are likely to induce antifungal drug resistance in resident fungal strains [18]. It is well known that the administration of probiotics can be beneficial for patients suffering for mucosal candidiasis [27]. Previous studies have already shown that the assumption of some, but not all [22], probiotic preparations can reduce symptoms of DS [19–21], and Candida colonization levels in healthy denture wearers [19,20] and in subjects affected by DS [21]. However, common probiotic strains of the genus Lactobacillus have few chances to exert prolonged protective activity since they are not adapted to be oral colonizers. To overcome this limitation, studies were recently performed to isolate probiotic Lactobacillus strains directly from the oral cavity [28]. As an alternative strategy, probiotic strains were searched among normal pioneer colonizers of the oral cavity as S. salivarius [29]. S. salivarius strain K12 is considered as the prototype probiotic strain of this species. It was originally selected for its ability to inhibit Streptococcus pyogens, but it was subsequently shown to possess several other interesting activities, including inhibitory activity on Candida spp. [29,30]. Although data on this matter are still incomplete, several probiotic strains were shown to be able to inhibit biofilm growth, and expression of virulence and resistance genes of C. albicans [20,30–33]. These considerations prompted us to preliminarily evaluate the effectiveness of a probiotic preparation containing S. salivarius strain K12 in the treatment of DS. Inclusion/exclusion criteria were designed to minimize the influence of factors other than microbial dysbiosis due to inadequate oral hygiene on the presence of clinical signs and symptoms of DS. Subjects wearing not-well-fitting dentures were excluded, as well as subjects affected by diseases altering immunity and oral homeostasis. In the selection of patients, attention was paid to minimize the possible interference of potential confounders. Consequently, in addition to the rigid application of inclusion/exclusion criteria, attention was dedicated to include only patients in apparent good conditions: diabetic patients with high glycemic levels, patients with arterial hypertension not well controlled by drugs (i.e., pressure levels > 140/90 mmHg) Appl. Sci. 2020, 10, 3002 8 of 10 and patients smoking >10 cigarettes/day were excluded from the study. Nevertheless diabetes, arterial hypertension and smoking were not included as variables in the statistical analysis. Due to the preliminarily nature of this study, the CTR group was not designed to receive a placebo; this could have influenced perception of subjective symptoms between the two groups of patients. As expected, our experimental data confirm that, in the absence of repeated trauma due to inadequacy of the denture base or too prolonged denture wearing, improvement of the oral and denture hygiene procedure reduces clinical signs and symptoms of DS and reduces oral colonization by C. albicans [13,14]. Moreover, data show that the effectiveness of oral and denture hygiene alone is limited in time. In fact, when (after T30) patients of the CTR group were invited to resume their previous habits with the dentures, their clinical conditions worsened significantly. Although microbiological samples were not analyzed at T60, it can be considered plausible, in accordance with data from the literature [25], that clinical relapse was paralleled by an increase in oral C. albicans counts. Experimental data show that when improved oral and denture hygiene procedures were flanked by the administration of a preparation of the probiotic strain S. salivarius K12, a significantly greater improvement of clinical conditions and a higher reduction of oral C. albicans counts were obtained in the EXP group at T30. Interestingly and unexpectedly, clinical evaluations performed at T60, when patients of the EXP group had discontinued treatment for 30 days and had resumed previous oral and denture hygiene habits, revealed a further improvement of clinical conditions, as opposed to the partial relapse observed in the CTR group. These data suggest that S. salivarius K12 could be able to colonize oral mucosa at least for some weeks after discontinuation of treatment and consequently exhibit a prolonged anti-Candida action. Unfortunately, microbiological sampling was not planned for T60 and consequently this aspect will deserve future further investigations. A prolonged presence of the probiotic strain would be in accordance with the well-known role of S. salivarius as a pioneer colonizer of the human oral cavity [29]. The effective duration of oral colonization by S. salivarius K12 after 30 days of treatment and the consequent duration of its anti-Candida activity will be the object of future investigations using specific molecular methods that were recently made available [34]. Future studies will also be necessary to elucidate the cellular and molecular mechanisms underlying the clinical and microbiological effects of S. salivarius K12 on DS described in this paper.
5. Conclusions The present work was designed to preliminarily evaluate the clinical and microbiological effects of a probiotic preparation, containing S. salivarius K12, in Candida albicans-positive subjects affected by DS, and the duration of clinical effects. Data presented in this paper confirm that, at least in subjects wearing well-fitting full-arch dentures and affected by DS, reinforcement of oral and denture hygiene procedures coupled with administration of a probiotic preparation containing S. salivarius K12 is effective in reducing symptoms and clinical signs of DS, and significantly reduces oral colonization by C. albicans. The clinical effects associated with the administration of S. salivarius K12 persist for at least 30 days after discontinuation of treatment. The tested probiotic preparation could consequently prove as a valid and safe aid in combination with the improvement of oral and denture hygiene measures for the treatment of DS.
Author Contributions: C.P., A.P. and L.T. were responsible for study design, C.P., L.T. and D.D.N. performed clinical examinations and collected microbiological samples, C.P. performed microbiological analyses, F.D.N. performed statistical analyses, all authors analyzed and discussed data, and cooperated at writing the paper. All authors have read and agreed to the published version of the manuscript. Funding: This research received no external funding. Acknowledgments: Pharmaextracta Spa contributed by supplying patients with the amounts of BactoBlis necessary for the study. Conflicts of Interest: The authors declare no conflict of interest. Pharmaextracta Spa had no role in the design of the study; in the collection, analyses, or interpretation of data, and in the writing of the manuscript. Appl. Sci. 2020, 10, 3002 9 of 10
References
1. Bongaarts, J. Human population growth and the demographic transition. Philos. Trans. R. Soc. B Biol. Sci. 2009, 364, 2985–2990. [CrossRef][PubMed] 2. Griffin, S.O.; Jones, J.A.; Brunson, D.; Griffin, P.M.; Bailey, W.D. Burden of Oral Disease Among Older Adults and Implications for Public Health Priorities. Am. J. Public Health 2012, 102, 411–418. [CrossRef][PubMed] 3. Meurman, J.H.; Hämäläinen, P. Oral health and morbidity-implications of oral infections on the elderly. Gerodontology 2006, 23, 3–16. [CrossRef][PubMed] 4. Kassebaum, N.; Bernabe, E.; Dahiya, M.; Bhandari, B.; Murray, C.; Marcenes, W. Global Burden of Severe Tooth Loss. J. Dent. Res. 2014, 93, 20S–28S. [CrossRef][PubMed] 5. Gendreau, L.; Loewy, Z.G. Epidemiology and Etiology of Denture Stomatitis. J. Prosthodont. 2011, 20, 251–260. [CrossRef] 6. Gauch, L.M.R.; Pedrosa, S.S.; Silveira-Gomes, F.; Esteves, R.A.; Marques-Da-Silva, S.H. Isolation of Candida spp. from denture-related stomatitis in Pará, Brazil. Braz. J. Microbiol. 2017, 49, 148–151. [CrossRef] 7. Chevalier, M.; Ranque, S.; Precheur, I. Oral fungal-bacterial biofilm models in vitro: A review. Med. Mycol. 2017, 56, 653–667. [CrossRef] 8. Morales, D.; Hogan, D.A. Candida albicans Interactions with Bacteria in the Context of Human Health and Disease. PLoS Pathog. 2010, 6, e1000886. [CrossRef] 9. Shirtliff, M.; Peters, B.M.; Jabra-Rizk, M.A. Cross-kingdom interactions: Candida albicans and bacteria. FEMS Microbiol. Lett. 2009, 299, 1–8. [CrossRef] 10. Gendron, R.; Grenier, D.; Maheu-Robert, L.-F. The oral cavity as a reservoir of bacterial pathogens for focal infections. Microbes Infect. 2000, 2, 897–906. [CrossRef] 11. O’Donnell, L.E.; Smith, K.; Williams, C.; Nile, C.J.; Lappin, D.F.; Bradshaw, D.; Lambert, M.; Robertson, D.; Bagg, J.; Hannah, V.; et al. Dentures are a Reservoir for Respiratory Pathogens. J. Prosthodont. 2015, 25, 99–104. [CrossRef][PubMed] 12. Coulthwaite, L.; Verran, J. Potential pathogenic aspects of denture plaque. Br. J. Biomed. Sci. 2007, 64, 180–189. [CrossRef][PubMed] 13. Hasan, S.; Kuldeep; Shamimul, H. Denture Stomatitis: A Literature Review. J. Orofac. Health Sci. 2015, 6, 65. [CrossRef] 14. Hilgert, J.B.; Giordani, J.M.D.A.; De Souza, R.F.; Wendland, E.M.; D’Avila, O.P.; Hugo, F.N. Interventions for the Management of Denture Stomatitis: A Systematic Review and Meta-Analysis. J. Am. Geriatr. Soc. 2016, 64, 2539–2545. [CrossRef][PubMed] 15. Bueno, M.; Urban, V.; Barbério, G.; Da Silva, W.J.; Porto, V.; Pinto, L.; Neppelenbroek, K. Effect of antimicrobial agents incorporated into resilient denture relines on the Candida albicans biofilm. Oral Dis. 2013, 21, 57–65. [CrossRef][PubMed] 16. Ramage, G.; Tomsett, K.; Wickes, B.L.; Lopez-Ribot, J.L.; Redding, S.W. Denture stomatitis: A role for Candida biofilms. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endodontol. 2004, 98, 53–59. [CrossRef][PubMed] 17. Perfect, J.R.; Lindsay, M.H.; Perfect, J.R.; Drew, R.H. Adverse Drug Reactions to Systemic Antifungals. Drug Saf. 1992, 7, 323–363. [CrossRef] 18. White, T.C.; Marr, K.A.; Bowden, R.A. Clinical, Cellular, and Molecular Factors That Contribute to Antifungal Drug Resistance. Clin. Microbiol. Rev. 1998, 11, 382–402. [CrossRef] 19. Ishikawa, K.; Mayer, M.P.A.; Miyazima, T.Y.; Matsubara, V.H.; Silva, E.G.; Paula, C.R.; Campos, T.T.; Nakamae, A. A Multispecies Probiotic Reduces Oral Candida Colonization in Denture Wearers. J. Prosthodont. 2014, 24, 194–199. [CrossRef] 20. Song, Y.-G.; Lee, S.-H. Inhibitory effects of Lactobacillus rhamnosus and Lactobacillus casei on Candida biofilm of denture surface. Arch. Oral Biol. 2017, 76, 1–6. [CrossRef] 21. Lee, X.; Vergara, C.; Lozano, C.P. Severity of Candida-associated denture stomatitis is improved in institutionalized elders who consume Lactobacillus rhamnosus SP1. Aust. Dent. J. 2019, 64, 229–236. [CrossRef][PubMed] 22. Sutula, J.; Coulthwaite, L.; Thomas, L.; Verran, J. The effect of a commercial probiotic drink on oral microbiota in healthy complete denture wearers. Microb. Ecol. Health Dis. 2012, 23, 175. [CrossRef] 23. Newton, A.V. Denture sore mouth. A possible etiology. Br. Dent. J. 1962, 112, 357–360. Appl. Sci. 2020, 10, 3002 10 of 10
24. Koch, J.R.L.G. The Measurement of Observer Agreement for Categorical Data. Biometrics 1977, 33, 159. [CrossRef] 25. Tooyama, H.; Matsumoto, T.; Hayashi, K.; Kurashina, K.; Kurita, H.; Uchida, M.; Kasuga, E.; Honda, T. Candida concentrations determined following concentrated oral rinse culture reflect clinical oral signs. BMC Oral Health 2015, 15, 150. [CrossRef][PubMed] 26. Zomorodian, K.; Haghighi, N.N.; Rajaee, N.; Pakshir, K.; Tarazooie, B.; Vojdani, M.; Sedaghat, F.; Vosoghi, M.; Vossoughi, M. Assessment ofCandidaspecies colonization and denture-related stomatitis in complete denture wearers. Med. Mycol. 2011, 49, 208–211. [CrossRef] 27. Salazar, S.B.; Simões, R.S.; Pedro, N.A.; Pinheiro, M.J.; Carvalho, M.F.N.N.; Mira, N.P. An Overview on Conventional and Non-Conventional Therapeutic Approaches for the Treatment of Candidiasis and Underlying Resistance Mechanisms in Clinical Strains. J. Fungi 2020, 6, 23. [CrossRef] 28. Rossoni, R.D.; De Barros, P.P.; De Alvarenga, J.A.; Ribeiro, F.D.C.; Velloso, M.D.S.; Fuchs, B.B.; Mylonakis, E.; Jorge, A.O.C.; Junqueira, J.C. Antifungal activity of clinical Lactobacillus strains against Candida albicans biofilms: Identification of potential probiotic candidates to prevent oral candidiasis. Biofouling 2018, 34, 212–225. [CrossRef] 29. Wescombe, P.A.; Hale, J.D.; Heng, N.C.; Tagg, J.R. Developing oral probiotics fromStreptococcus salivarius. Futur. Microbiol. 2012, 7, 1355–1371. [CrossRef] 30. Hu, L.; Mao, Q.; Zhou, P.; Lv, X.; Hua, H.; Yan, Z. Effects of Streptococcus salivarius K12 with nystatin on oral candidiasis—RCT. Oral Dis. 2019, 25, 1573–1580. [CrossRef] 31. Aarti, C.; Ameer, K.; Varghese, R.; Arasu, M.V.; Agastian, P.; Al-Dhabi, N.A.; Ilavenil, S.; Choi, K.C. In vitro investigation on probiotic, anti-Candida, and antibiofilm properties of Lactobacillus pentosus strain LAP1. Arch. Oral Biol. 2018, 89, 99–106. [CrossRef][PubMed] 32. Kim, H.; Kang, S.-S. Antifungal activities against Candida albicans, of cell-free supernatants obtained from probiotic Pediococcus acidilactici HW01. Arch. Oral Biol. 2019, 99, 113–119. [CrossRef][PubMed] 33. Oliveira, V.; Dos Santos, S.S.F.; Silva, C.; Jorge, A.; Leão, M. Lactobacillus is able to alter the virulence and the sensitivity profile of Candida albicans. J. Appl. Microbiol. 2016, 121, 1737–1744. [CrossRef][PubMed] 34. Reid, P.; Heng, N.C.; Hale, J.D.; Krishnan, D.; Crane, J.; Tagg, J.R.; Milne, T.J. A TaqMan™-based quantitative PCR screening assay for the probiotic Streptococcus salivarius K12 based on the specific detection of its megaplasmid-associated salivaricin B locus. J. Microbiol. Methods 2020, 170, 105837. [CrossRef]
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/). Nutrafoods (2019) 2:80-88. DOI 10.17470/NF-019-0011 Review
Streptococcus salivarius K12 in pharyngotonsillitis and acute otitis media – a meta-analysis
Abstract
The oral administration of Streptococcus salivarius K12 represents a valid solution for the prevention of pharyngitis or pharyngotonsillitis, of bacterial or viral origin, and/or acute otitis media. In particular, this could be an interesting alternative to antibiotic prophylaxis in patients with re- lapse or disease recurrence. In this regard, the studies published in the scientific iter ture re i ited nd thus it s of interest to ro ide meta-analysis in order to analyze in more detail the results obtained in this rese rch fie d or the et n sis c inic studies ere se ected s identified throu h PubMed, which examined the relationship between the use of formula- tions based on Streptococcus salivarius K12 and the number of cases or episodes of pharyngitis or pharyngotonsillitis, of bacterial or viral origin, and acute otitis media in children and adults. The effect size (ES) was cal- cu ted ccordin to ohen usin the fi ed effects ode fixed effects). e en studies et the redefined inc usion criteri nd the ere Alexander Bertuccioli 1* included in the meta-analysis. ES values equal to -1.40 [-1.67; -1.13] and Marco Rocchi 1 ere o t ined for the effect of Streptococcus salivarius Ilaria Morganti 1 K12 on the prevention of pharyngitis and acute otitis media, respectively. Giorgia Vici 2 oth ues ere tr ns ted into i effect ccordin to ohen s sc e Marco Gervasi 1 re t ent sed on this str in is effecti e for oth the re ention of Stefano Amatori 1 pharyngitis and acute otitis media. In addition, it is further revealed that Davide Sisti 1 the str in is ore effecti e in the re ention of h r n itis It is desirable that further clinical investigation continues to expand and 1 Department of Biomolecular update the meta-analysis work and to recommend the use of the strain as Sciences,University of Urbino “Carlo Bo” a useful prophylactic tool to reduce the events of pharyngotonsillitis and
2 School of Bioscience and Veterinary acute otitis media. Medicine, University of Camerino
Keywords: BLIS K12, Streptococcus salivarius K12, pharyngotonsillitis, *Corresponding author: Alexander Bertuccioli oral probiotics [email protected]
80 Streptococcus salivarius K12 in pharyngotonsillitis and acute otitis media – a meta-analysis
we could assess more thoroughly the results Introduction o t ined in this rese rch fie d co rin the resu ts differenti for h r n itis nd Streptococcus salivarius K12 is a strain bacterial infections of the ear. isolated from a New Zealand child [1]. It is capable of producing salivaricin A2 and salivaricin B, molecules belonging to the lantibiotics [2] f i e to counter ct effecti e in itro the Materials and methods growth of S. pyogenes [3], in addition to inhibiting he studies ere sourced fro scientific the growth of other pathogens including and biomedical journals and through the use Haemophilus influenzae, Moraxella catarrhalis of the PubMed database. To be included in the and S. pneumoniae, which are all potentially meta-analysis, the studies had to meet the fol- involved in the aetiopathogenesis of acute lowing inclusion criteria: (a) clinical trials; (b) otitis media (AOM) [4], and pharyngotonsillitis [5]. parallel studies; or (c) historical control studies; The K12 strain proved to also have the ability d studies in hich the effecti eness of sic to inhibit the proliferation of Micrococcus luteus, S. anginosus, Eubacterium saburreum and formulations of Streptococcus salivarius K12 Micromonas micros, involved in the production ATCC BAA-1024 was assessed; (e) studies that of volatile sulfur compounds implicated in reported the number of cases or episodes of halitosis development [6, 7]. Jamali et al [8] pharyngitis or pharyngotonsillitis of bacterial or showed that probiotic K12 therapy following viral infection and/or AOM; (f) studies in which oral disinfection with chlorhexidine may reduce paediatric patients or adults were enrolled. the severity of halitosis over longer periods. t first the inc usion of e ords such s The strain also appears to be capable of antiviral "BLIS K12", "Streptococcus salivarius K12", "pro- actions, mainly attributed to an ability to biotic Streptococcus salivarius K12" and "bacte- incre se the e e s of s i r interferon nd riocin-like inhibitory substances Streptococcus to reduce interleukin (IL)-8 release, while leaving salivarius K12" produced a number of records the re e se of or tu or necrosis f ctor equal to 103 publications; after eliminating unaltered [4]. K12 also exhibited potential duplicates, this was reduced to 43, of which e c c nd s fet s n d u nt in tre tin 28 were screened articles. Finally, there was a oral candidiasis by enhancing mycological total of 21 studies excluded, while seven were cure and shortening the treatment course of included in the meta-analysis. Although one conventional antifungal therapy [9]. Colonization stud co ied ith the redefined inc usion has been demonstrated in the human model criteria [14] it s not inc uded in the fin u n- from the third day of treatment at the level of titative analysis because of a characteristic that the nasopharynx and adenoids [10], persisting differed si nific nt et een tre ted su ects up to 32 days after discontinuation [11], and a and controls. ood o er s fet rofi e in ni s [12] and More precisely, children diagnosed with humans [13] has been reported. Several clinical recurrent streptococcal pharyngitis (mean > studies have been conducted to investigate the three episodes of pharyngotonsillitis during potential of the K12 strain in the prevention of the year before the study) were included in the pharyngitis, pharyngotonsillitis and/or AOM of treatment group, while children without a diag- bacterial or viral origin. The aim of this work nosis of recurrent disease were enrolled in the was to carry out a meta-analysis through which control group.
81 Nutrafoods (2019) 2:80-88. DOI 10.17470/NF-019-0011
In Fig. 1 the flo di r or inc uded in the fin n sis [15]. flo ch rt is de icted this is n instru ent The extraction and processing of data from that allows documentation of all stages for the individual studies then took place (Table 1). se ection nd identific tion of studies to e
PRISMA 2009 Flow Diagram
n° of records identified through n° of further records identified database research (n=103) through other sources (n=0)
cation fi
nt i
Id e
n° of records after duplicate elimination (n=43)
ee ning
n° of records subjected to n° of records excluded Scr screening (n=28) (n=14)
n° of full-text articles n° of full-text articles excluded evaluated for their (n=6) because they do not
eligibility (n=14) adhere to inclusion criteria
Eligibility
n° of studies included in the qualitative synthesis (n=8)
n° of studies included in
the quantitative synthesis In clusion (meta-analysis) (n=7)
Figure 1 heFigure 1 The flo PRISMA di r flow ofdiagram the iter ture of the lit re tederature to related to BLIS hich K12 s which e ined was examined in order toin de e o the meta-analysisorder work to develop the meta-analysis work
ro oherFrom: M i er tioher D, Li be et ffrati A, Tetzla t nff J, Altman DG, he The PRISMA Gro rou up (200 9). Preferred referred Reporti e ortin ng Items for te s Systematic for ste tic e- views and Meta-Analyses:Reviews and Meta-Analyses: The PRISMA The PRISMAStatement. Statement. PLoS PLoS Med Med 6(7): 6(7): e1000097. e1000097. doi:10.1371/journal.pmed1000097doi:10.1371/journal.pmed1000097 For For more information,more information, visit www.prisma-statement.org. visit www.prisma-statement.org.
82 Streptococcus salivarius K12 in pharyngotonsillitis and acute otitis media – a meta-analysis
Authors N° of N° of Locations Sample N° of subjects experimental control Duration Doses Outcomes and year age subjects subjects
1 daily pill of Tolerance to the treatment, onset of collateral effects 180 days of Bactoblis® containing or symptoms of toxicity during administration of the treatment + not less than product, ef cacy of BLIS K12 in the prevention of Di Pierro et al 3-year-old 3 months of Milan, Italy 222 children 111 111 1 billion CFU of Streptococcus pyogenes infections and number of (2016) children follow-up for Streptococcus events of streptococcal pharyngitis, tonsillitis, scarlet 29 children of salivarius K12 fever and the ef cacy of BLIS K12 in reducing the each group ATCC BAA-1024 occurrence of acute otitis media
78 children. Initially, 82 children; 65 with a diagnosis of at 90 days of Episodes of pharyngitis, tonsillitis, 37 least 3 events of recurring treatment + 1 daily pill of acute otitis media in recidivist patients, not treated (20 with 3-12- pharyngitis and/or tonsillitis 6 months of Bactoblis® containing and not-recidivist-not-treated-groups during Cuneo, Brescia, 41 recurring Di Pierro et al year-old in the previous year and follow-up for 5 billion CFU of 90 days of treatment with the product and during Verona, Novara, (with recurring disease and (2012) children 17 without recurring events. 30 children Streptococcus the 6 months of follow-up. Turin, Italy (mean age: pathology) 17 without During the study, (16 of the treated salivarius K12 Results of pharyngeal swab and signs of acute otitis 7 years old) recurring subjects and 14 of 4 children with the ATCC BAA-1024 media; tolerability, compliance and collateral effects disease) the 20 controls with diagnosis were excluded recurring infections) of the product during the 90 days of treatment for failed adherence to the experimental therapy
The ef cacy of Bactoblis® in the prevention of pharyngotonsillitis in group A streptococcus or 1 daily pill of 60 children. Initially 61. S. pyogenes groups, in reducing infections of Bactoblis® 3-13- Only one subject pharyngotonsillitis of viral origin during the period containing not less Di Pierro et al year-old immediately abandoned 90 days of of study. The occurrence of collateral effects and Milan, Italy 30 30 than 1 billion CFU of (2014) children the study for the treatment toxicity during the administration of the product. (mean age: 8 Streptococcus mouthfeel unpleasantness Collection of information on the use of antibiotic years) salivarius K12 of the product therapy, on antipyretic treatment, working days lost ATCC BAA-1024 by parents and absences at school (or at kindergarten for children below 6 years of age)
Retrospectively evaluate if the use of Ss K12 in paediatric patients with RPTI could signi cantly reduce the occurrence of streptococcal pharyngotonsillitis relapses during the treatment 1 daily pill of period and the following 9 months compared to the Bactoblis® 3-7- 90 days of period of 6 to 12 months immediately before the containing not less Gregori et al year-old treatment + beginning of the antibiotic treatment, signi cantly Piacenza, Italy 130 children 76 54 than 1 billion CFU of (2016) children 9 months of reduce the occurrence of pharyngotonsillitis relapses (mean age: Streptococcus follow-up during the treatment period and during the following 5 years old) salivarius K12 9 months when compared with a control group of ATCC BAA-1024 children who experienced RPTI but who were not treated with Ss K12. Evaluate if subjects treated with Ss K12 had signi cant differences in the occurrence of bronchitis, otitis, sinusitis and bronchial pneumonia
1 daily pill of 90 days of ® Preventive role of BLIS K12 in streptococcal or viral 3–14- Bactoblis treatment pharyngotonsillitis and acute otitis media. Collateral year-old containing not less Di Pierro et al 133 children (October to December effects, tolerance, doses and number of days in Genova, Italy 133 children 133 children than 1 billion CFU (2018) children (previous year) 2015) + 90 days of which children were subjected to an antibiotic and (mean age: of Streptococcus treatment antipyretic therapy, number of absences at school for 8 years old) salivarius K12 (April to June 2016) children and at work for parents ATCC BAA-1024
1 daily pill of Ef cacy of Ss K12 in reducing worsening effects Streptococcus related to chronic adenoiditis (acute otitis media); 6-7- 113 salivarius K12 frequency of diagnosed otitis; necessity of an Karpova et al 106 nasal 30 days of Russia year-old 219 children (probiotics + ATCC BAA-1024 + anti-in ammatory therapy; frequency of adenoiditis (2015) shower) treatment children nasal shower) nasal shower with complications development (acute otitis media and NaCl solution at 0.9%. acute rhinosinusitis). Necessity of using systemic Doses not speci ed antibacterial drugs
Evaluation, through visits and pharyngeal swabs, Adults 1 daily pill of of the number of episodes of pharyngitis and/or aged 90 days Bactoblis® containing tonsillitis of bacterial origin in treated and not-treated Di Pierro et al Merano, Verona, between of treatment 5 billion CFU of 40 adults 20 20 groups during 90 days of treatment with the product (2013) Piacenza, Italy 18–65 + 6 months of Streptococcus and the 6th month of follow-up. years follow-up salivarius K12 (mean age: Tolerability, compliance and collateral effects during ATCC BAA-1024 42 years old) 90 days of treatment
Table 1 Data extracted from individual studies relating to: authors, year, places, age of the enrolled subjects, number of treated subjects, number of controls, duration of treatment with S. salivarius K12, dose and outcomes; RPTI = recurrent pharyngo-tonsillar infections
As we can see from Table 1, the studies six studies involved children aged between 3 were mainly carried out in Italy and in subjects and 14 years, while the study "Di Pierro et al of paediatric age, and they looked at the role (2013)" [16] is the only one that involved adults of Streptococcus salivarius K12 in the prevention aged between 18 and 65 years. In "Di Pierro et and reduction of occurrences of typical al (2018)" [17] 133 children were enrolled and the childhood diseases, such as pharyngotonsillitis number of episodes of illness during the period of cteri or ir ori in nd ecific of treatment with Streptococcus salivarius K12
83 Nutrafoods (2019) 2:80-88. DOI 10.17470/NF-019-0011 was compared with the number recorded in In Fig. 2 the forest ot re rdin the effect the same 133 children in the previous year of the strain on the prevention of pharyngitis is where treatment was not given. The absence depicted. From the observation of the forest of a control group treated with placebo, of plot of the "Number of pharyngitis cases" (Fig. 2), randomization and of blinded conditions are it is clear that all studies included in the me- all limitations shared by some of the studies ta-analysis are in favour of the treatment exam- included in the meta-analysis. ined and none are in favour of the controls; this Oral formulations containing between is apparent from the fact that all estimates fall to 1 and 5 billion CFU of Streptococcus salivarius the eft of the insi nific nce ine K12 ATCC BAA-1024 were administered to the patients, although the study "Karpova et al" [18] does not specify the used dose. The duration of treatment varied from 30 to 180 days. General- ly, during the period of treatment, children with a positive throat swab test for S. pyogenes re- ceived antibiotics. After the discontinuation of antibiotic therapy, the treatment was resumed and brought to an end. Viral infections, throat/ Figure 2 Forest plot of the "Number of pharyngitis cases" laryngeal pain and/or fever were treated with acetaminophen or ibuprofen or according to he no si nific nce ine is not crossed the reference guidelines. the confidence inter s corres ondin to Subsequently, in order to obtain a single individual studies, which means they are all fin esti te e focused on the nu er of si nific nt he studies i ierro et al (2012)" enrolled subjects with or without episodes of [19], "Di Pierro et al (2014)" [20], "Di Pierro et al disease in the treated group and the control (2018)" [17] and "Di Pierro et al (2013)" [16] are more group, only considering the period of treatment si nific nt the res ecti e sho the ues with formulations based on S. salivarius K12. of the nd the corres ondin confidence The meta-analyses were performed using intervals as being -3.37 [-5.03; -1.71], -3.40 [-5.06; the statistical software ProMeta (version 3.0) 1.74], -3.83 [-5.38; -2.28] and -2.76 [-4.41; -1.11]. ith the do tion of the fi ed effects ode or onsiderin ohen s sc e these ues re fixed effects. tr ns ted into re t effect he studies ust mentioned were carried out in male and female subjects with or without diagnosis of recurrent Results disease aged between 3 and 14 years, except for the study "Di Pierro et al (2013)" [16] which The results of the individual studies involved adults aged between 18 and 65 years. and the overall estimate of the meta-analysis, One tablet per day containing not less ssoci ted ith the confidence inter than 1 billion CFU of Streptococcus salivarius (CI), are shown in a type of graph called a forest K12 ATCC BAA-1024 was administered to ot ecific t o forest ots ere o t ined the patients in "Di Pierro et al (2014)" [20] and on the basis of the outcomes "n° pharyngitis "Di Pierro et al (2018)" [17] and one tablet per cases" and "n° otitis cases" that were attributed day containing 5 billion CFU of Streptococcus respectively to six and four of the included salivarius K12 ATCC BAA-1024 in "Di Pierro et al studies. (2012)" [19] and "Di Pierro et al (2013)" [16].
84 Streptococcus salivarius K12 in pharyngotonsillitis and acute otitis media – a meta-analysis
For each study, the duration of treatment was 90 consecutive days. In relation to the num- ber of participants and events, less weight (W) was attributed to these studies as seen by the square that rests on the horizontal line; it rep- resents the confidence inter nd indic tes Figure 3 Forest plot for "N. otitis cases" the degree of uncertainty of the study, poten- ti ttri ut e so e to the effect of ch nce The "Di Pierro et al (2016)" [21] and "Gregori et al on the studies the ost si nific nt is (2016)" [22] studies are less uncertain. Both studies "Di Pierro et al (2018)" [17], the most recent and were conducted on a greater number of children so the ost si nific nt in the re ious n - aged between 3 and 7 years old, with or with- sis. According to Cohen, the ES has a "great ef- out a diagnosis of recurrent disease. One tablet fect ssu in ue of ith confidence per day containing not less than 1 billion CFU of intervals of [-1.53; -0.91]. To carry out the study, Streptococcus salivarius K12 ATCC BAA-1024 was using historical controls, boys and girls aged 3 administered to the patients in "Di Pierro et al to 14 years diagnosed with at least one episode (2016)" [21] for 180 days and for 90 days in "Grego- of AOM and/or pharyngitis in the year prior to ri et al (2016)" [22] he ues nd confidence the study were enrolled. One tablet per day intervals correspond to -0.88 [-1.22; -0.53] for "Di containing not less than 1 billion CFU of Strep- Pierro et al (2016)" [21] and -1.80 [-2.32; -1.28] for tococcus salivarius K12 ATCC BAA-1024 was ad- "Gregori et al (2016)" [22]. As for the studies men- ministered for 180 days; or for 90 consecutive tioned above, both translated as "big impact" on days in two separate quarters. In addition, the the Cohen scale. From the quantitative combina- software gave more weight to this study. tion of resu ts the o er nd the confidence Less weight was attributed to "Di Pierro et intervals were obtained, and they are represent- al (2012)" [19], considering the highest variance ed respectively by the diamond core and the and smaller sample size. In addition, "Di Pierro amplitude of its sides. In numerical terms, the et al (2012)" [19] is the most uncertain study o er effect esti te is indic- s o ser ed the en th of the confidence ti e of re t effect of the tre t ent sed intervals. The study was conducted by enrolling on the strain in the prevention of pharyngitis or 61 children of both sexes, aged between 3 pharyngotonsillitis. As the available studies were and 12 years. One tablet per day containing 5 not numerous, the total value is closer to "more billion CFU of Streptococcus salivarius K12 ATCC important studies" which, as expected, impacted BAA-1024 was administered for 90 consecutive more strongly on the analysis. days to the patients. In contrast to the previous In Fig. 3 the forest ot re rdin the effect study, it shows the lowest ES obtained, -0.89 of the strain on the prevention of AOM is repre- [-1.65; -0.12], but this is still translatable into a sented. Observing the forest plot for "n° otitis re t effect cases" (Fig. 3) it is evident that the studies show The overall ES was -1.01 [-1.19; -0.83] a preference for treatment based on S. salivari- hich e ns re t effect throu h the re din us K12, as the individual estimates are placed on of ohen s sc e n conc usion tre t ent ith the eft side of the r h he ine of si nific nce the str in in the ro h is of is effecti e is not crossed the confidence inter s of the Fig. 4 depicts a forest plot which individual studies, which is why the latter studies summarizes the previous two plots. In both re considered si nific nt graphs, the diamond is not placed close to
85 Nutrafoods (2019) 2:80-88. DOI 10.17470/NF-019-0011
quently require the support of a paediatrician or general practitioner and the use of prescrip- tion medications, including antibiotics and non- steroid nti infl tor dru s s Moreover, both for pharyngotonsillitis and AOM, events of recurrence and relapse often involving long antibiotic prophylaxis are doc- umented. On the other hand, it is now known Figure 4 Forest plot for "Number of pharyngitis cases" (upper that excessive use of antibiotics increases the section) and "Number of otitis cases" (lower section) risk of appearance of resistant microbes, both at the individual level and at the community the ine of insi nific nce so the n sis is level. Finally, in order to try to improve the qual- considered si nific nt for the t o studied it of tients i es the di nosis of chronic or variables. Considering the global data for recurrent pharyngotonsillitis can identify the "Number of pharyngitis cases" (N=779), the ES need for tonsillectomy, or the surgical removal is -1.40 and ranges from -1.67 to -1.13. of the tonsi s s st resort nd the fin re- On the other hand, considering the global sult of this action has not been demonstrated data for "Number of otitis cases" (N=768), the ES in random controlled studies as of yet. is -1.01 and ranges from -1.19 to -0.83. According Streptococcus salivarius K12 or BLIS K12 to ohen the ues re resent re t effect is a component of the human oral microbiota his confir s the effecti eness of the tre t ent naturally present in a small percentage of the under investigation in the prevention of population, that with a lower incidence of phar- pharyngitis or pharyngotonsillitis and/or AOM. yngitis, tonsillitis and otitis. After it was isolat- Further data that emerged from the ANOVA Q ed from the throat of a healthy child [1], it was test is that treatment with the strain appears to demonstrated in vitro to produce two bacterio- e ore effecti e in the re ention of h r n itis cins, salivaricin A2 and salivaricin B, with strong than in the prevention of AOM. inhibitory action towards Streptococcus pyo- Finally, the software provides the statisti- genes and other pathogenic strains [3–5], some cal heterogeneity and variability among studies, of which promote symptoms of halitosis [6, 7]. which according to Higgins (I2) was 85.35% and Moreover, the strain has antifungal [23], anti-in- 0.00%, respectively, for the studies to which the fl tor nd nti ir ro erties outcomes "N° pharyngitis cases" and "N° otitis n rticu r it see s to si nific nt reduce cases" were attributed. The heterogeneity of the levels of IL-8, which explains the treatment is considered si nific nt hi e the het- effect o ser ed in infections of ir ori in s ero eneit of is defined s not i ort nt well as its positive action when administered The clinical and methodological heterogeneity to children with periodic fever, adenitis, phar- are added to the statistical heterogeneity and yngitis, aphthous ulcer (PFAPA) syndrome [24]. they were evaluated during the selection phase ecent the effic c of in the re ention nd identific tion of the studies of pharyngo-tonsillar infections, the decreased use of antibiotics and the improvement of Discussion o er u it of ife s confir ed ith de- creased number of absences from school and Pharyngitis or pharyngotonsillitis and fewer patients undergoing surgery [25]. AOM are among the diseases that most fre- Finally, it is considered safe for human
86 Streptococcus salivarius K12 in pharyngotonsillitis and acute otitis media – a meta-analysis use [12, 13] and is able to colonize and persist in the therapeutic solution in the prevention of oral cavity, the nasopharynx and adenoids [10]. pharyngitis or pharyngotonsillitis, of viral or Within the present work, clinical studies bacterial origin, and/or AOM, with or without aimed at investigating the role of Streptococcus a diagnosis of recurrent disease. Studies, salivarius K12 ATCC BAA-1024 in the preven- including those in the meta-analysis, show a tion of pharyngitis or pharyngotonsillitis and/ si nific nt reduction in the nu er of e isodes or AOM were selected, in order to conduct a of i ness th t is cco nied si nific nt meta-analysis able to assess in more detail the reduction in the use of antibiotics, antipyretics resu ts o t ined in this rese rch fie d nd nti infl tories fo o in or For the development of the meta-analy- administration of the strain [17, 18, 21]. In addition, sis s nu er of studies ere identified there is a reduction in the number of days lost and those included were clinical trials, non-ran- with respect to preschool or school for children domized, non-placebo-controlled and not and work for their parents [17, 19]. Similar results blinded, carried out mainly in Italy and in pae- were obtained in a study aimed to evaluate the diatric subjects. In a preliminary study only the role of Streptococcus in PFAPA [24]. role of the strain was evaluated in 40 adult sub- In conclusion, it is desirable that further jects diagnosed with pharyngitis or recurring clinical investigation continues to expand and pharyngotonsillitis [16]. To the treated subjects update the work of the meta-analysis and to enrolled in several studies, oral formulations recommend the use of S. salivarius K12 as a were administered for a variable period from useful prophylactic tool to reduce the events of 30 to 180 days, which contained between 1 pharyngotonsillitis and AOM, the clinical man- and 5 billion CFU of Streptococcus salivarius K12 ifestations derived therefrom, the use of anti- ATCC BAA-1024. iotics in the ho e of fi htin on nother front From the results obtained from the me- antibiotic resistance, the use of antipyretics ta-analysis, it is concluded that the treatment nd nti infl tories nd to oid sur ic sed on is effecti e for the re en- operations or tonsillectomies in cases of recur- tion of pharyngitis or pharyngotonsillitis, of ring pharyngitis. viral or bacterial origin, and/or AOM, with or without a diagnosis of recurrent disease. In References fact, ES values corresponding to -1.40 and -1.01, respectively, for the prevention of pharyngitis 1. Tagg JR (2004) Prevention of streptococcal pharyngitis by nd ere o t ined ccordin to ohen s anti-Streptococcus pyogenes bacteriocin-like inhibitory substances (BLIS) produced by Streptococcus salivarius. sc e oth re tr ns ted into re t effect n Indian J Med 119:13–16 addition, it was found that the strain appears to e e en ore effecti e in the re ention of 2. Hyink O, Wescombe PA, Upton M, Ragland N, Burton JP, Tagg JR (2007) Salivaricin A2 and the novel lantibiotic sali- pharyngitis than the prevention of AOM. varicin B are encoded at adjacent loci on a 190-kilobase transmissible megaplasmid in the oral probiotic strain Streptococcus salivarius K12. Appl Environ Microbiol Conclusions 73:1107–1113 3. Sharma S, Verma KK (2001) Skin and soft tissue infection. The results obtained from the meta- Indian J Pediatr 68:S46–S50 analysis, integrated with present knowledge, 4. Wescombe PA, Hale JD, Heng NC, Tagg JR (2012) Develop- suggest that formulations based on ing oral probiotics from Streptococcus salivarius. Future Streptococcus salivarius K12 may be a viable Microbiol 7:1355–1371
87 Nutrafoods (2019) 2:80-88. DOI 10.17470/NF-019-0011
5. van Zon A, van der Heijden GJ, van Dongen TM, Bur- tococcus salivarius K12 in the prevention of recurrent ton MJ, Schilder AG (2012) Antibiotics for otitis media pharyngitis and/or tonsillitis caused by Streptococcus ith effusion in chi dren ochr ne t se st e pyogenes in adults. Expert Opin Biol Ther 13:339–343 9:CD009163 17. Di Pierro F, Risso P, Poggi E, Timitilli A, Bolloli S, Bruno 6. Burton JP, Chilcott CN, Tagg JR (2005) The rationale and M, Caneva E, Campus R, Giannattasio A (2018) Use of potential for the reduction of oral malodour using Strep- Streptococcus salivarius K12 to reduce the incidence of tococcus salivarius probiotics. Oral Dis 11:29–31 pharyngo-tonsillitis and acute otitis media in children: a retrospective analysis in not-recurrent pediatric subjects. 7. Burton JP, Chilcott CN, Moore CJ, Speiser G, Tagg JR (2006) Minerva Pediatr 70:240–245 re i in r stud of the effect of ro iotic tre tococ- cus salivarius K12 on oral malodour parameters. J Appl 18. Karpova EP, Karpycheva IE, Tulupov DA (2015) Prophylax- Microbiol 100:754–764 is of chronic adenoiditis in the children. Vestn Otorinolar- ingol 80:43–45 8. Jamali Z, Aminabadi NA, Samiei M, Sighari Deljavan A, Shokravi M, Shirazi S (2016) Impact of chlorhexidine pre- 19. Di Pierro F, Donato G, Fomia F, Adami T, Careddu D, Cas- treatment followed by probiotic Streptococcus salivarius sander C, Albera R (2012) Preliminary pediatric clinical strain K12 on halitosis in children: a randomised con- evaluation of the oral probiotic Streptococcus salivarius trolled clinical trial. Oral Health Prev Dent 14:305–13 K12 in preventing recurrent pharyngitis and/or tonsillitis 9. Hu LJ, Mao QH, Zhou PR, Lv X, Hua H, Yan ZM (2019) Ef- caused by Streptococcus pyogenes and recurrent acute fects of Streptococcus salivarius K12 with nystatin on otitis media. Int J Gen Med 5:991–997 oral candidiasis – RCT. Oral Dis. doi:10.1111/odi.13142 20. Di Pierro F, Colombo M, Zanvit A, Risso P, Rottoli AS 10. Power DA, Burton JP, Chilcott CN, Dawes PJ, Tagg JR (2008) (2014) Use of Streptococcus salivarius K12 in the preven- Preliminary investigations of the colonization of the up- tion of streptococcal and viral pharyngotonsillitis in chil- per respiratory tract tissues of infants using a pediatric dren. Drug Healthc Patient Saf 6:15–20 formulation of the oral probiotic Streptococcus salivarius K12. Eur J Clin Microbiol Infect Dis 27:1261–1263 21. Di Pierro F, Colombo M, Giuliani MG, Danza ML, Basile I, o ni onti n it otto i ffect of 11. Horz HP, Meinelt A, Houben B, Conrads G (2007) Distri- administration of Streptococcus salivarius K12 on the bution and persistence of probiotic Streptococcus sali- occurrence of streptococcal pharyngo-tonsillitis, scarlet varius K12 in the human oral cavity as determined by fever and acute otitis media in 3 years old children. Eur real-time quantitative polymerase chain reaction. Oral Rev Med Pharmacol Sci 20:4601–4606 Microbiol Immunol 22:126–130 22. Gregori G, Righi OR, Risso P, Boyars G, Demuru G, Fer- 12. Burton JP, Wescombe PA, Moore CJ, Chilcott CN, Tagg zetti TO, Galli TO, Ghisoni TO, Lenzini S, Marenghi C, JR (2006) Safety assessment of the oral cavity probiot- Walls C, Bags R, Suzzani L (2016) Reduction of group A be- ic Streptococcus salivarius K12. Appl Environ Microbiol ta-hemolytic streptococcus pharyngo-tonsillar infections 72:3050–3053 associated with use of the oral probiotic Streptococcus salivarius K12: a retrospective observational study. Ther 13. Burton JP, Cowley S, Simon RR, McKinney J, Wescombe Clin Risk Manag 12:87–92 PA, Tagg JR (2011) Evaluation of safety and human toler- ance of the oral probiotic Streptococcus salivarius K12: 23. Ishijima SA, Kazumi M, Burton JP, Reid G, Okada M, Mat- a randomized, placebo-controlled, double-blind study. sushit e ffect of tre tococcus s i rius Food Chem Toxicol 49:2356–2364 K12 on the in vitro growth of Candida albicans and its rotecti e effect in n or c ndidi sis ode n i- 14. Di Pierro F, Colombo M, Zanvit A, Rottoli AS (2016) Positive ron Microbiol 78:2190–2199 clinical outcomes derived from using Streptococcus salivar- ius K12 to prevent streptococcal pharyngotonsillitis in chil- 24. Di Pierro F, Campana A, Panatta ML, Antenucci V, De Vin- dren: a pilot investigation. Drug Healthc Patient Saf 8:77–81 centiis G (2016) The use of Streptococcus salivarius K12 in attenuating PFAPA syndrome, a pilot study. Altern In- oher i er ti et ff t n re- tegr Med 5:222 ferred reporting items for systematic reviews and me- ta-analyses: the PRISMA statement. J Clin Epidemiol 25. Marini G, Sitzia E, Panatta ML, De Vincentiis GC (2019) 62:1006–1012. doi:10.1016/j.jclinepi.2009.06.005 i ot stud to e ore the ro h ctic e c c of or probiotic Streptococcus salivarius K12 in preventing re- 16. Di Pierro F, Adami T, Rapacioli G, Giardini N, Streitberger current pharyngo-tonsillar episodes in pediatric patients. C (2013) Clinical evaluation of the oral probiotic Strep- Int J Gen Med 12:213–217
88
International Journal of General Medicine Dovepress
open access to scientific and medical research
Open Access Full Text Article ORIGINAL RESEARCH Pilot study to explore the prophylactic efficacy of oral probiotic Streptococcus salivarius K12 in preventing recurrent pharyngo-tonsillar episodes in pediatric patients
This article was published in the following Dove Press journal: International Journal of General Medicine
Giulia Marini Background: In the pediatric population, acute pharyngo-tonsillitis represents one of the Emanuela Sitzia most frequent causes of access to outpatient treatment and use of antibiotics. In frequent Maria Laura Panatta tonsillitis, the pharmacological approach is no longer effective, and, therefore, surgery Giovanni Carlo De Vincentiis becomes the treatment of choice. Methods: This study compares the prophylactic efficacy of Streptococcus salivarius K12 Department of Otorhinolaryngology, ® IRCCS Bambino Gesù Pediatric Hospital, (Bactoblis ) in children with recurrent pharyngo-tonsillitis treated vs untreated, with a 12 - Rome, Italy month follow-up. The primary objectives are: The incidence of recurrence of pharyngo-tonsillar
For personal use only. episodes and the concomitant use of other drugs. Secondary objectives are: tolerability of the treatment, the effectiveness in terms of clinical improvement, days of absence from school, reduction of the use of standard therapies, and cancellation from the surgical planning list. Results: Patients belonging to group A (treated with K12 for 90 days) were 24 males and 26 females, mean age 6.6 years (SD=1.57), those belonging to group B (untreated) were 23 males and 27 females, average age 6.8 years (SD=1.72). In the follow-up, group A reported 26 inflammatory pharyngo-tonsillary episodes in the first trimester, unlike group B, who reported 72 in the second trimester. This has shown a lower incidence (3.38%) of the disease compared to group B (6.66%), for a total of 169 inflammatory pharyngo-tonsillary episodes in group A against 333 in group B. A reduction in days of school absence of 429 days in group A and 927 days in the control group (P<0.01) was also noted. Finally, 14 children of group A (28%) underwent adenotonsillectomy, against the whole group B. No adverse events were reported. Conclusion: The efficacy of K12 on the prevention of pharyngo-tonsillar infections, the
International Journal of General Medicine downloaded from https://www.dovepress.com/ by 150.199.191.185 on 17-Jul-2019 decrease in the use of antibiotics and the improvement of the overall quality-of-life was confirmed, with a decreased number of absences from school and fewer patients undergoing surgery. Keywords: Blis K12, pediatric pharyngo-tonsillitis, adenotonsillectomy, children, probiotics
Introduction Among the most common upper respiratory tract infections in the pediatric popula- Correspondence: Giulia Marini Department of Otorhinolaryngology, tion, acute pharyngotonsillitis represents one of the most frequent causes of access IRCCS Bambino Gesù Pediatric Hospital, to outpatient treatment and use of antibiotics. Via Torre di Palidoro, snc, 00050 Fiumicino, Rome, Italy These infections particulary affect children, up to an age of about 10 years, and Tel +39 066 859 3478 are more frequently caused by viruses (respirators, enteroviruses, and herpes); only Fax +39 339 691 6087 Email [email protected] 30% of them are of bacterial origin.
submit your manuscript | www.dovepress.com International Journal of General Medicine 2019:12 213–217 213 DovePress © 2019 Marini et al. This work is published and licensed by Dove Medical Press Limited. The full terms of this license are available at https://www.dovepress.com/terms. php and incorporate the Creative Commons Attribution – Non Commercial (unported, v3.0) License (http://creativecommons.org/licenses/by-nc/3.0/). By accessing the http://doi.org/10.2147/IJGM.S168209 work you hereby accept the Terms. Non-commercial uses of the work are permitted without any further permission from Dove Medical Press Limited, provided the work is properly attributed. For permission for commercial use of this work, please see paragraphs 4.2 and 5 of our Terms (https://www.dovepress.com/terms.php).
Powered by TCPDF (www.tcpdf.org) 1 / 1
Marini et al Dovepress
The most serious types of pharyngitis are attributed to children with recurrent pharyngo-tonsillitis treated for 3 bacterial etiologies, such as group A β-haemolytic months with oral discoid Streptococcus salivarius K12 Streptococcus pyogenes (GAS).1,2 with patients not treated with K12/or standard care for In bacterial tonsillitis, the first choice therapy is the a period of 12 months. We evaluated the prophylactic antibiotic therapy with frequent use of penicillins, ampi- efficacy with the capability of Streptococcus salivarius cillin and amoxicillin, alone or with clavulanic acid, in K12 in reducing the recurrence rate of pharyngeal and particular. The use of non-steroidal anti-inflammatory tonsillar episodes and the concomitant use of other drugs drugs (paracetamol and ibuprofen) is effective in reducing as the primary objective. Secondary objectives are: to symptoms such as fever and pharingodynia.3 evaluate the tolerability of the treatment, the effectiveness In the case of particularly frequent tonsillitis or chronic in terms of clinical improvement, days of absence from tonsillitis, the pharmacological approach is no longer school, reduction of the use of standard therapies, and effective. The patient in these cases will be referred to cancellation from the surgical planning list. surgery: in particular, the surgical removal of the tonsils (tonsillectomy) will be considered. Materials and methods The criteria proposed for the inclusion in the surgical The project was submitted and approved by the Ethics planning list are those described by the PNLG edition of Committee of the Bambino Gesù Pediatric Hospital (regis- 2008 (SNLG – Appropriateness and safety of tonsillect- tration number 867_OPBG_2014). omy and/or adenoidectomy) for recurrent inflammation The study is prospective, randomized, open, and mono- (five or more episodes of tonsillitis in a year, episodes centric. Recruited subjects are of both sexes; aged between 5 incapacitating such as to prevent normal activities, symp- and 10 years; enrolled in the surgical planning list, since toms persisting for at least 1 year). 2014 at the U.O.C. of Otorhinolaryngology of the Bambino An improvement in the quality-of-life after tonsillectomy Gesù Pediatric Hospital of Palidoro, for adenotonsillectomy has been reported in subjects undergoing repeated cycles of according to the criteria described by the 2008 PNLG for For personal use only. antibiotic therapy, but no randomized controlled trials eval- recurrent inflammation; not being treated with Streptococcus uating the effect of tonsillectomy on the general well-being, salivarius K12 in the 3 months prior to inclusion. development, and behavior of the child are available. These Diagnosis was confirmed by clinical exam by one of measures, however, represent important treatment outcomes the four authors. to be inserted in future clinical research.4,5 Parents provided written consent to the medical treat- With the aim of reducing the prescription of antibiotic ment and the divulging of personal data for scientific therapies and surgical referrals, the use of specific probiotic research purposes. therapy for the oral cavity has been proposed, based on the The children were divided into two groups: studies of Dr. J. Tagg and colleagues. The Australian micro- biologist finally succeeded in isolating a Streptococcus sal- ● group A (50 patients) were treated with Streptococcus ivarius, called Blis K12®. salivarius K12 discoid; and He found it from the throat of a child whose medical ● group B (50 patients) were not treated with International Journal of General Medicine downloaded from https://www.dovepress.com/ by 150.199.191.185 on 17-Jul-2019 history revealed that he had never been infected with Streptococcus salivarius K12 discoid. pharyngo-tonsillar infections; this pathogen, then, was able to kill the dreaded Streptococcus pyogenes, known All subjects included in the study were treated, as needed, to be responsible for most of the pharyngo-tonsillar infec- with NSAIDs, Antibiotics, Steroids, according to good tions of bacterial etiology, and a significant share of acute clinical practice. average otitis. The exclusion criteria are: the presence of comorbidity; With this study we propose to explore the prophylactic the presence of complicated manifestations of suppurative efficacy of oral Streptococcus salivarius K12 in the pedia- type and the presence of sleep disorder. The duration of the tric population affected by recurrent pharyngitis-tonsillitis. study was 18 months, 6 for enrollment and 12 for therapy and follow-up. Parents were asked to complete a clinical Aims of the study diary describing the inflammatory episodes and possible In the present study we propose to compare the prophy- drug treatment. A clinical evaluation of the patient was lactic efficacy of oral Streptococcus salivarius K12 in performed quarterly, and the pharyngo-tonsillar episodes
214 submit your manuscript | www.dovepress.com International Journal of General Medicine 2019:12 DovePress
Powered by TCPDF (www.tcpdf.org) 1 / 1
Dovepress Marini et al
and the relative therapies were noted. No pharyngeal swabs 26 inflammatory pharyngo-tonsillary episodes unlike were performed during the inflammatory episodes, because group B which reported 72, in the second trimester, despite all patients enrolled had previously been diagnosed with the absence of treatment group A has showed a lower chronic tonsillitis by GAS. incidence (3.38%) of the disease compared to group B (6.66%) for a total in the year of observation of 169 Statistic analysis EFT in group A against 333 of group B (Table 1). The proposed study is an exploratory pilot study, whereby We also evaluated the consumption, by dose, of the sample size of 100 subjects (50 per group) was chosen NSAIDs and antibiotic drugs, with a reduction in the use purely for convenience and adequate for feasibility. of group A drugs, especially in the quarter of treatment Data are expressed as mean and standard deviation and with Streptococcus salivarius K12 (Table 2). compared with the Mann-Whitney test, Kruskall Wallis, or In the 12 months of observation we also noticed 2-way variance analysis. The analysis will be “intention to a reduction in days of school absence of 429 days in treat”, leaving each patient in the original randomization group A and 927 days in the control group (P<0.01) arm. The data, possibly missing, are therefore not taken (Table 3). into consideration. Finally, based on the results obtained and after having subjected all the patients enrolled to clinical control, 14 Results children of group A (28%) underwent adenotonsillectomy, against the whole group B. No adverse events were Patients belonging to group A (treated with oral discoid reported after use of oral Streptococcus salivarius K12 Streptococcus salivarius K12 for 90 days) were 24 males (Table 4). and 26 females, mean age 6.6 years (SD=1.57), those belonging to group B (untreated) were 23 males and 27 females, average age 6.8 years (SD=1.72). In the 12 Discussion
For personal use only. months of follow-up, group A reported in the first trime- Interest in probiotic therapy has gained considerable ster, that of treatment with Streptococcus salivarius K12, importance in the treatment of bacterial infections in
Table 1 Number of inflammatory pharyngo-tonsillary episodes in two groups in 12 months of follow-up
I trimester II trimester III trimester IV trimester
Group A 26* 46* 53* 44* (0.5±0.7) (0.9±1.02) (1.06±1.05) (0.8±0.9) Group B 72* 93* 94* 74* (1.4±1.01) (1.8±0.8) (1.8±0.9) (1.4±0.7)
Note: *P<0.01.
Table 2 Consumption, by dose, of NSAIDs and antibiotic drugs in 12 months of follow-up International Journal of General Medicine downloaded from https://www.dovepress.com/ by 150.199.191.185 on 17-Jul-2019 I trimester II trimester III trimester IV trimester
NSAIDs
Group A 55* 98** 114*** 109*** (1.4±1.07) (1.4±1.9) (2.2±1.5) (2.1±1.3) Group B 119* 127** 134*** 107*** (2.3±1.4) (2.5±1.2) (2.6±1.05) (2.1±0.9)
Antibiotic
Group A 13* 38* 41* 36* (0.6±0.2) (0.9±0.7) (0.8±0.8) (0.8±0.7) Group B 72* 93* 94* 74* (1.4±1.01) (1.8±0.8) (1.8±0.9) (1.4±0.7)
Note: *P<0.01; **P<0.05; ***P>0.05.
International Journal of General Medicine 2019:12 submit your manuscript | www.dovepress.com 215 DovePress
Powered by TCPDF (www.tcpdf.org) 1 / 1
Marini et al Dovepress
Table 3 Days of school absence in two groups in 12 months of The efficacy results, in terms of incidence of streptococ- follow-up (P<0.01) cal-pharyngeal disease during the study compared to the ® Total days of Average days of school previous year, confirmed that prophylaxis with Bactoblis school absence absence per child reduced the incidence of β-hemolytic streptococcal orophar-
Group A 429 8.58 yngeal infections of about 96% and viral infections of 80%. Group B 927 18.54 Treatment was well tolerated, with no notable side-effects. Compliance was very good. Other studies on the preventive efficacy of K12 on the pediatric population10–13 and on Table 4 Patients who underwent surgery or not adults followed, and all showed a significant decrease in 14 Adeno-tonsillectomy No surgery pharyngo-tonsillary infectious episodes. With this study, we have confirmed that the treatment Group A 14 36 with oral Streptococcus salivarius K12 prevents the onset Group B 50 0 of pharyngo-tonsillary infections, is a valid alternative to antibiotic therapy and, above all, never taken into account recent years, so that in the past antibiotic therapy existed in the previously cited studies, avoids the use of adeno- as the only alternative. After John Tagg’s results, in the tonsillectomy, non-surgical intervention of risks, such as following years a number of different strains of postoperative hemorrhage, and lethal complications.15 Streptococcus pyogenes were tested and collected in The limitations of these studies are the number of microbiological laboratories around the world. The testing, patients enrolled (50 per study group), pharyngo-tonsillar to date, has given excellent results. In fact, all tested infections during follow-up were diagnosed and treated by strains were killed by Blis K12®.6 the treating physician and without the execution of a throat The analysis of the genome of Blis K12® shows the swab and the absence of double blind randomization. mechanism behind this anti-streptococcal action. In its cell Future investigations are needed to confirm these results For personal use only. body is in fact identified a megaplasmide of 190 kilobases in a bigger sample size. coding for two bacteriocins belonging to the group of lantibiotics: salivaricin A2 and salivaricin B. These, also Conclusions isolated, effectively determine the death of Streptococcus The results of this study confirmed the efficacy of oral pyogenes and also some other strains involved in infec- Streptococcus salivarius K12 on the prevention of phar- tious processes that affect the middle ear or periodontitis yngo-tonsillar infections, and we were able to show the with halitosis. decrease in the use of antibiotics and the improvement of The secretion of the two bacteriocins, however, is not the the overall quality-of-life, with a decreased number of only mechanism of action of its potential clinical effects. absences from school and fewer patients undergoing sur- In fact, it has been observed that the administration of gery of adenotonsillectomy. K12 down modulates, in the host, the expression of some genes involved in the inflammatory cascade, as well as the International Journal of General Medicine downloaded from https://www.dovepress.com/ by 150.199.191.185 on 17-Jul-2019 release of some pro-inflammatory lymphokines (IL-6 and Disclosure IL-8). The overall action resulting from the oral adminis- The authors report no conflicts of interest in this work. tration of Streptococcus salivarius K12 is probably the result of an integrated mechanism where a targeted action References against other streptococci (pyogenes in particular) is asso- 1. Murray RC, Chennupati SK. Chronic streptococcal and ciated with an anti-inflammatory capacity of promoting non-streptococcal pharyngitis. Infect Disord Drug Targets. 2012;12 7,8 (4):281–285. doi:10.2174/187152612801319311 host-microbe homeostasis. 2. Bonsignori F, Chiappini E, De Martino M. The infections of the upper For this purpose, a study was carried out, the results of respiratory tract in children. Int J Immunopathol Pharmacol. 2010;23 – whichwerepublishedintheInternational Journal of (Suppl 1):16 19. 3. Stelter K. Tonsillitis and sore throat in childhood. Laryngorhinootologie. General Medicine, which showed that, in a group of patients 2014;93(Suppl 1):S84–S102. doi:10.1055/s-0033-1363210 treated for 90 days with K12, there was a statistically sig- 4. Douglas CM, Lang K, Whitmer WM, Wilson JA, Mackenzie K. fi The effect of tonsillectomy on the morbidity from recurrent ni cant decrease in the incidence of pharyngo-tonsillitis by tonsillitis. Clin Otolaryngol. 2017;42:1206–1210. doi:10.1111/ 9 SBEA and otitis. coa.12850
216 submit your manuscript | www.dovepress.com International Journal of General Medicine 2019:12 DovePress
Powered by TCPDF (www.tcpdf.org) 1 / 1
Dovepress Marini et al
5. El Hennawi DE, Rifaat Ahmed M. Quality of life after tonsillectomy 11. Gregori G, Righi O, Risso P, et al. Reduction of group A versus azithromycin. Interv Med Appl Sci. 2016;8(4):141–146. beta-hemolytic streptococcus pharyngo-tonsillar infections associated doi:10.1556/1646.8.2016.4.2 with use of the oral probiotic Streptococcus salivarius K12: 6. Wescombe PA, Hale JD, Heng NC, Tagg JR. Developing oral probi- a retrospective observational study. Ther Clin Risk Manag. otics from Streptococcus salivarius. Future Microbiol. 2012;7 2016;12:87–92. doi:10.2147/TCRM.S96134 (12):1355–1371. doi:10.2217/fmb.12.113 12. Di Pierro F, Di Pasquale D, Di Cicco M. Oral use of Streptococcus 7. Tagg JR. Prevention of streptococcal pharyngitis by anti-Streptococcus salivarius K12 in children with secretory otitis media: preliminary pyogenes bacteriocin-like inhibitory substances (BLIS) produced by results of a pilot, uncontrolled study. Int J Gen Med. 2015;8:303–308. Streptococcus salivarius. Indian J Med. 2004;119(Suppl):13–16. doi:10.2147/IJGM.S92488 8. Hyink O, Wescombe PA, Upton M, Ragland N, Burton JP, 13. Di Pierro F, Colombo M, Zanvit A, Risso P, Rottoli AS. Use of Tagg JR. Salivaricin A2 and the novel lantibiotic salivaricin Streptococcus salivarius K12 in the prevention of streptococcal and B are encoded at adjacent loci on a 190-kilobase transmissible viral pharyngotonsillitis in children. Drug Healthc Patient Saf. megaplasmid in the oral probiotic strain Streptococcus salivarius 2014;6:15–20. doi:10.2147/DHPS.S59665 K12. Appl Environ Microbiol. 2007;73(4):1107–1113. doi:10.1128/ 14. Di Pierro F, Adami T, Rapacioli G, Giardini N, Streitberger C. AEM.02265-06 Clinical evaluation of the oral probiotic Streptococcus salivarius 9. Di Pierro F, Donato G, Fomia F, et al. Preliminary pediatric clinical K12 in the prevention of recurrent pharyngitis and/or tonsillitis evaluation of the oral probiotic Streptococcus salivarius K12 in prevent- caused by Streptococcus pyogenes in adults. Expert Opin Biol Ther. ing recurrent pharyngitis and/or tonsillitis caused by Streptococcus 2013;13(3):339–343. doi:10.1517/14712598.2013.75871 pyogenes and recurrent acute otitis media. Int J Gen Med. 15. Reusser NM, Bender RW, Agrawal NA, Albright JT, Duncan NO, 2012;5:991–997. doi:10.2147/IJGM.S38859 Edmonds JL. Post-tonsillectomy hemorrhage rates in children com- 10. Di Pierro F, Colombo M, Giuliani MG, et al. Effect of administration pared by surgical technique. Ear Nose Throat J. 2017;96(7):E7–E11. of Streptococcus salivarius K12 on the occurrence of streptococcal doi:10.1177/014556131709600702 pharyngo-tonsillitis, scarlet fever and acute otitis media in 3 years old children. Eur Rev Med Pharmacol Sci. 2016;20(21):4601–4606. For personal use only. International Journal of General Medicine downloaded from https://www.dovepress.com/ by 150.199.191.185 on 17-Jul-2019
International Journal of General Medicine Dovepress Publish your work in this journal The International Journal of General Medicine is an international, across all disease areas. The manuscript management system is peer-reviewed open-access journal that focuses on general and completely online and includes a very quick and fair peer-review internal medicine, pathogenesis, epidemiology, diagnosis, moni- system, which is all easy to use. Visit http://www.dovepress.com/ toring and treatment protocols. The journal is characterized by the testimonials.php to read real quotes from published authors. rapid reporting of reviews, original research and clinical studies
Submit your manuscript here: https://www.dovepress.com/international-journal-of-general-medicine-journal
International Journal of General Medicine 2019:12 submit your manuscript | www.dovepress.com 217 DovePress
Powered by TCPDF (www.tcpdf.org) 1 / 1
Received: 1 February 2019 | Revised: 12 May 2019 | Accepted: 25 May 2019 DOI: 10.1111/odi.13142
ORIGINAL ARTICLE
Effects of Streptococcus salivarius K12 with nystatin on oral candidiasis—RCT
Lijun Hu | Qinghua Mao | Peiru Zhou | Xin Lv | Hong Hua | Zhimin Yan
Department of Oral Medicine, Peking University School and Hospital of Abstract Stomatology, Beijing, China Objective: To evaluate the efficacy and safety of Streptococcus salivarius K12 as an
Correspondence adjuvant in treating oral candidiasis. Zhimin Yan, Department of Oral Medicine, Methods: A total of 56 patients were participated in the randomized, double‐blinded, Peking University School and Hospital of Stomatology, 22 South Zhongguancun placebo‐controlled clinical trial. The S. salivarius K12 or placebo lozenges plus nys‐ Avenue, Haidian District, Beijing 100081, tatin tablets were given for up to 4 weeks at 1‐week interval and then followed up China. Email: [email protected] for 1 week thereafter. We collected and analyzed the mycological and clinical data, treatment course, and safety data. Funding information National Natural Science Foundation of Results: At the end of the treatment, significant differences were found in the my‐ China, Grant/Award Number: 81570985 cological cure rates between K12 group and control group (90.48% and 55.56%, respectively, p = 0.008). Survival analysis demonstrated no statistical difference in overall cure rates comprehensively considering mycological cure, clinical improve‐ ment, and recurrence (p = 0.078), while statistical difference was found in mycologi‐ cal cure (p = 0.013) between the two groups. The median treatment courses of K12 group and control group were 3 weeks and 4 weeks, respectively. No severe events were reported during the study. Conclusion: Streptococcus salivarius K12 exhibited potential efficacy and safety as an adjuvant in treating oral candidiasis by enhancing mycological cure and shortening the treatment course of conventional antifungal therapy in this randomized, dou‐ ble‐blinded, placebo‐controlled clinical trial. Further large‐scale clinical studies are desired to accumulate more evidence for its clinical applications.
KEYWORDS efficacy, oral candidiasis, randomized controlled trial, safety, Streptococcus salivarius K12
1 | INTRODUCTION studies revealed that S. salivarius K12 has the ability to interfere with the excessive growth of pathogens occupying the naso‐ Probiotics have drawn more and more attention for their benefi‐ pharynx and oral cavity (Wescombe, Hale, Heng, & Tagg, 2012; cial role in health. As one of the commercially available probiot‐ Zupancic, Kriksic, Kovacevic, & Kovacevic, 2017). Accumulated ics, Streptococcus salivarius K12, also called BLIS (bacteriocin‐like evidence suggested that it is beneficial for otitis media (Pierro, inhibitory substance) K12, is isolated from the oral cavity of a Colombo, Giuliani, et al., 2016), halitosis (Burton, Chilcott, & Tagg, healthy child (Tagg & Dierksen, 2003) and used as a kind of oral 2005; Masdea et al., 2012), and acute pharyngotonsillitis (Pierro, probiotic on maintaining the health of ear and oral cavity. Previous Colombo, Zanvit, & Rottoli, 2016) possibly due to its antimicrobial
© 2019 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd. All rights reserved
Oral Diseases. 2019;25:1573–1580. wileyonlinelibrary.com/journal/odi | 1573 1574 | HU et al. activity and immunomodulatory properties. In addition to produc‐ signs and laboratory tests (smear fungal test and/or saliva's fungal ing bacteriocin‐like inhibitory substances as the lantibiotic saliva‐ culture). The exclusion criteria were as follows: (a) chronic mucocu‐ ricin A2 and salivaricin B (Hyink et al., 2007; Wescombe, Heng, taneous candidiasis or systemic fungal infections; (b) use of systemic Burton, Chilcott, & Tagg, 2009) do, K12 strain also plays an ac‐ antifungal agents and antibiotics within 1 month prior to participa‐ tive role in the host defense process, such as inhibiting the NF‐kB tion or use of topical antifungal agents (except for use of Daktarin or pathway to down‐regulate inflammatory responses (Cosseau et al., nystatin cream or suppository for the treatment of vaginal candidi‐ 2008). asis) within 2 weeks prior to participation; (c) an allergic or intoler‐ Apart from the application in oral diseases such as halitosis, in able history of the S. salivarius K12 lozenges; (d) pregnant or lactating 2012 Ishijima SA reported that S. salivarius K12 could protect the women; (e) HIV infection; (f) uncooperative patients for a psycho‐ mice from oral Candida infection, indicating that S. salivarius K12 logical history or other disorders; (g) abnormal liver and kidney func‐ played a protective role against oral candidiasis (Ishijima et al., 2012). tion; and (h) participation in other clinical trials within 1 month prior Oral candidiasis is common in AIDS patients, xerostomia, and diabe‐ to participation. tes, and in those on antibiotics or immunosuppressant and even in those who are denture wearers or with poor oral hygiene (Berberi, 2.3 | Randomization and blinding Noujeim, & Aoun, 2015; Ellepola & Samaranayake, 2000; Lamster, Lalla, Borgnakke, & Taylor, 2008; Shinozaki et al., 2012). Currently, All the patients were randomly allocated into two groups (K12 or antifungal agents such as nystatin, fluconazole, and miconazole are control) using a sequence generated by computer using SAS soft‐ frequently used to treat oral candidiasis (Niimi, Firth, & Cannon, ware (SAS Institute Inc). Allocation concealment was achieved via 2010), but the subsequent resistance of Candida species and the side sequentially numbered, sealed, opaque envelopes. Both the subjects effects limit their application (Lopez‐Martinez, 2010). Therefore, and investigators who distributed the S. Salivarius K12/placebo loz‐ S. salivarius K12 is worth to be further explored as a new adjuvant enges to the subjects were blinded to the interventions used. The for oral candidiasis. placebo had similar appearance, size, and color but without S. sali- Although probiotics such as Bifidobacterium longum, Lactobacillus varius K12. acidophilus, and Lactobacillus rhamnosus do have a role against oral candidiasis (Li et al., 2014; Miyazima, Ishikawa, Mayer, Saad, 2.4 | Sample size & Nakamae, 2017), there is currently a lack of evidence on clinical application of S. salivarius K12 in oral candidiasis. Thus, this study In previous study, the mycological cure rates of probiotics for treat‐ aimed to assess the efficacy and safety of S. salivarius K12 in combi‐ ing oral candidiasis in the probiotics group and control group were nation with nystatin in treating oral candidiasis. Its potential and ap‐ 90% and 65%, respectively (Li et al., 2014). For the purpose of plicability in the improvement of oral candidiasis will be of essential achieving 80% power with 10% significance level (α = 0.05; β = 0.20; clinical significance. both one‐sided) in this study, and considering the withdrawal rate of 20%, the trial required 38 subjects for each group.
2 | MATERIALS AND METHODS 2.5 | Interventions 2.1 | Study registration The patients in the K12 group received the S. salivarius K12 lozenges The study was approved by the Human Research Ethics Committee (≥1 × 109 CFU of S. salivarius K12 per lozenge, BLIS K12®, Alaron of Peking University Health Center (PKUSSIRB‐201412024) in June Products Limited) with the regimen of 1 lozenge BID and nystatin 2014, and the randomized controlled trial (RCT) was registered with tablets (500,000 U, Zhejiang Zhenyuan Pharmaceutical Co., Ltd) the Chinese Clinical Trial Registry (ChiCTR‐TCR‐14005090). All sub‐ with the regimen of topical administration (TID). Patients in the con‐ jects signed written informed consent before participation. The trol group received placebo lozenges and nystatin tablets with the study followed the CONSORT statement (Moher et al., 2012; Schulz, same regimen. The patients were required return visits on the 7th, Altman, & Moher, 2010). 14th, 21st, and 28th day from then. The end point of treatment was defined as the negative laboratory testing (by smear test and saliva's fungal culture). The last follow‐up visit was 1 week after the end of 2.2 | Study design and patients the treatment. This study was a randomized, double‐blinded, placebo‐controlled clinical trial aimed to evaluate the efficacy and safety of S. salivarius 2.6 | Collection and culture of oral specimens K12 in combination with nystatin in treating oral candidiasis. The subjects were outpatients of Peking University School and Hospital One milliliter unstimulated saliva was collected from each subject. of Stomatology from September 2014 to June 2018. The inclusion For the saliva collection, subjects were asked not to consume solid criteria were as follows: (a) 18 years and older, gender is not limited; food or liquids or to perform any oral hygiene procedures for at least and (b) oral candidiasis diagnosed on the basis of clinical symptoms/ 2 hr before collecting saliva. Then, 0.5 ml sample was incubated at HU et al. | 1575
37°C for 48 hr on CHROMagar plates (CHROMagar) at baseline and Mycological cure on Sabouraud Dextrose Agar (BioMérieux) at return visits on the Demonstrated by negative microscopy results by using 10% potas‐ 7th, 14th, 21st, and 28th day. Two researchers counted the num‐ sium hydroxide and no growth of Candida in culture. This outcome is ber of colony‐forming units (CFUs) per milliliter of saliva by visual distinct from the clinical cure in that it does not require the demon‐ inspection. stration of the normal appearing. The treatment end point was determined as the complete eradi‐ cation of Candida species (mycological cure). 2.7 | Outcome measures
2.7.1 | Primary outcomes 2.7.2 | Secondary outcomes
Clinical cure Patient responses were also assessed by median treatment courses Complete remission of clinical symptoms and signs. The self‐re‐ and recurrence (clinical and mycological) 1‐week after the end of ported clinical symptom scores were recorded: 0 score repre‐ treatments. sented no symptoms; 1 score represented mild symptoms; 2 score The overall cure was defined as mycological cure, marked im‐ represented moderate symptoms; and 3 score represented severe provement (60% or more) of clinical symptoms and signs, and no re‐ symptoms. The signs of removable white plaque or erythema were currence in the follow‐up visit 1 week after the end of the treatment. scored based on the area of oral lesions: 0 score represented no lesions; when the area of the lesions were less than 0.5 cm2 or 2.7.3 | The safety evaluation between 0.5 and 1 cm2, 1 score and 2 score were given, respec‐ tively; and 3 score was given if the area of the lesion was more During the study period, any symptoms and objective findings of than 1 cm2. the subjects were recorded, and abnormal changes were monitored
Enrolled (n = 56)
Randomized (n = 56)
S. Salivarius K12 group Control group (n = 27) (n = 29)
Withdraw (n = 5) Withdraw (n = 2) No safety data after No safety data after randomization randomization
n = 27 n = 22 *Safety-set (SS) population *Safety-set (SS) population **Full-analysis set (FAS) Population
Excluded (n = 2) Use prohibited Excluded (n = 1) medicines Equivocal diagnosis (antibiotics and glucocorticoids)
n = 21 n = 25 **Full-analysis set (FAS) population ***Per-protocol set (PPS) population ***Per-protocol set(PPS) population
FIGURE 1 Patient randomization and disposition. *For safety analyses, the safety‐set (SS) population is used. Safety population includes all randomized patients who take at least one dose of the study medicine. **The full‐analysis set (FAS) population is a trial population, that is, as close as possible to the general population for which a test treatment is intended. The FAS population can include individuals who fail to comply with the treatment protocol. *** The per‐protocol set (PPS) population is the subset of the FAS population that adhered to the treatment protocol, and consequently, excluding individuals who fail to comply with the treatment protocol 1576 | HU et al.
TABLE 1 Demographics of subjects Streptococcus salivarius K12 Control group Baseline characteristics group (n = 21) (n = 27) p value
Age (years, mean ± SD) 61.15 ± 10.227 66.19 ± 12.081 0.124 Gender (M/F) 3/18 4/23 1.000 Underlying diseasesa (Yes/ 14/7 21/6 0.390 No) aUnderlying diseases include cardiovascular diseases such as hypertension and angina, endocrine diseases such as diabetes and hyperthyroidism, digestive diseases such as gastritis, and immune system diseases such as rheumatoid arthritis.
TABLE 2 Baseline characteristics of Streptococcus salivarius K12 Control group the full‐analysis set population who had Baseline group (n = 21) (n = 27) p value oral candidiasis Oral Candida counts (lg CFU/ 2.37 ± 1.15 2.75 ± 0.81 0.221 ml; mean ± SD) Pain No (0) 12 (57.14%) 17 (62.96%) 0.584 Mild (1) 5 (23.81%) 7 (25.93%) Moderate (2) 4 (19.05%) 3 (11.11%) Severe (3) 0 (0%) 0 (0%) Burning No (0) 15 (71.43%) 14 (51.85%) 0.323 Mild (1) 2 (9.52%) 9 (33.33%) Moderate (2) 4 (19.05%) 4 (14.81%) Severe (3) 0 (0%) 0 (0%) Pseudomembrane No (0) 20 (95.24%) 27 (100%) 0.257 Mild (1) 1 (4.76%) 0 (0%) Moderate (2) 0 (0%) 0 (0%) Severe (3) 0 (0%) 0 (0%) Erythema No (0) 0 (0%) 1 (3.70%) 0.737 Mild (1) 9 (42.86%) 11 (40.74%) Moderate (2) 8 (38.10%) 11 (40.74%) Severe (3) 4 (19.05%) 4 (14.81%)
to identify the occurrence of adverse events (AE) for the safety 3 | RESULTS evaluation. 3.1 | Subject disposition
2.8 | Statistical analysis Patients were recruited over four years of period. Because of re‐ cruitment difficulties, in total, 56 patients participated in the study, SPSS 22.0 (SPSS Inc) was utilized to perform statistical analysis. The including 27 patients in K12 group and 29 in control group. Figure 1 data analysis and the reporting of the results of the trial followed the summarized the patient disposition. CONSORT guidelines. The differences in baseline data between the S. Salivarius K12 group and the control group were analyzed using chi‐squared test, t test, and nonparametric tests. The improvement 3.2 | Baseline characteristics of clinical symptoms/signs between the two groups was analyzed by nonparametric tests. Chi‐squared test and survival analysis were used No significant differences were found between the K12 group and to analyze the differences in the cure rates and treatment course of the the control group with regard to age, gender, and underlying dis‐ two groups. All included patients in the safety analysis were received eases (Table 1). Table 2 lists the baseline CFU counts of fungal cul‐ at least 1 dose of study medication. ture and clinical symptoms/signs scores of subjects, and it showed HU et al. | 1577
FIGURE 2 (a) Kaplan–Meier survival analysis of the studied groups considering the mycological cure. (b) Kaplan–Meier survival analysis of the studied groups considering the overall cure [Colour figure can be viewed at wileyonlinelibrary.com]
TABLE 3 Comparison of the clinical Streptococcus salivarius K12 therapeutic efficacy between the two Symptoms/signs group Control group p value groups Pain Alleviate (1) 8 (88.89%) 9 (90.00%) 0.968 Unchanged (2) 1 (11.11%) 1 (10.00%) Aggravate (3) 0 (0%) 0 (0%) Total 9 10 Burning Alleviate (1) 5 (83.33%) 10 (76.92%) 0.831 Unchanged (2) 1 (16.67%) 3 (23.08%) Aggravate (3) 0 (0%) 0 (0%) Total 6 13 Pseudomembrane Alleviate (1) 1 (100%) 0 (0%) ‐‐ Unchanged (2) 0 (0%) 0 (0%) Aggravate (3) 0 (0%) 0 (0%) Total 1 0 Erythema Alleviate (1) 20 (95.24%) 23 (88.46%) 0.413 Unchanged (2) 1 (4.76%) 3 (11.54%) Aggravate (3) 0 (0%) 0 (0%) Total 21 26
no significant difference between the K12 group and the control and significant difference was showed between the two groups group. Besides, the Candida species distribution of the subjects was (p = 0.008). Survival analysis demonstrated that there was statisti‐ listed in the Table S1. cal difference in mycological cure rate between K12 group and con‐ trol group (p = 0.013, Figure 2a), while no statistical difference was found considering overall cure (comprehensively considering myco‐ 3.3 | Efficacy analysis logical cure, marked improvement of clinical symptoms and signs, The mycological cure rates of the K12 group and the control group and recurrence in the follow‐up visit) (p = 0.078, Figure 2b). Besides, during the study period were 90.48% and 55.56%, respectively, the median treatment courses of K12 group and control group were 1578 | HU et al.
TABLE 4 Summary of overall safety Streptococcus salivarius Control group data Adverse events K12 group (n = 22) (n = 27) p value
Oral discomfort Xerostomia (n = 1), numb‐ Xerostomia (n = 4), 0.654 ness (n = 1), burning burning (n = 1) (n = 1) Gastrointestinal discomfort Borborygmus and pharyn‐ Nausea (n = 1) 0.885 geal discomfort (n = 1) Neuropathic symptoms Light dizziness (n = 1), light Light dizziness (n = 1) 0.445 headache (n = 1) Skin symptoms ‐‐ Erythra (n = 1) 0.372
3 weeks and 4 weeks, respectively. And at the time points of 3 and in vitro effect of S. Salivarius K12 on the excessive growth of Candida 4 weeks during the treatment, both the overall and mycological cure albicans, the author found that S. salivarius K12 was not directly an‐ rates of the K12 group were all higher than that of the control group tifungal but preferentially bound to hyphae rather than yeast to (Figure 2a and 2b). suppress Candida adhesion to the plastic substratum, and it was not From the clinical aspect, at the end of treatment, no signifi‐ correlated with the antimicrobial activity of the bacteriocin (Ishijima cant differences were noted in the remission of clinical symptoms/ et al., 2012). Then in vivo, a study indicated that S. salivarius K12 pro‐ signs between K12 and control groups (Table 3). What we observed tected the mice from oral candidiasis (Ishijima et al., 2012). Although was that when the mycological cure was achieved, the subjects in the existing studies indicated that S. salivarius K12 have the potential both groups maintained improving clinically even after ceasing the against oral Candida growth, it is noteworthy that there is a lack of treatment. clinical evidence in humans on S. Salivarius K12 for the treatment The photographs of pretreatment and post‐treatment were sup‐ of oral candidiasis. For this purpose, a randomized, double‐blinded, plied in the Figure S1. After treatment, the symptoms of erythema placebo‐controlled trial was designed to assess the efficacy as well and atrophy of papilla improved in both K12 and control groups. as safety of S. salivarius K12 lozenges as an adjuvant in treating oral candidiasis. The main findings of this study were S. salivarius K12 exhibited 3.4 | Safety analysis potential efficacy as an adjuvant in oral candidiasis by increasing the A total of 14 patients, 6 in the K12 group and 8 in the control group, mycological cure rate and shortening the routine treatment course reported adverse events during the study (Table 4). In the safety of antifungal therapy with nystatin. It is found that the mycologi‐ profile, no statistical difference was found between the two groups cal cure rate of the K12 group was significantly higher than control (p > 0.05). No severe adverse events occurred in both groups. One group, suggesting that S. salivarius K12 might prevent the Candida patient complained borborygmus and pharyngeal discomfort in K12 colonization and/or promote Candida eradication. This finding from group, and it was considered a possible drug‐related adverse event. clinical trial is consistent with what previously reported in the vitro and animal study (Ishijima et al., 2012). It is with no doubt that treat‐ ment with a shortened course has the potential to greatly reduce 4 | DISCUSSION antifungal medication use in regions of oral candidiasis, with antici‐ pated cost savings and improved compliance. Moreover, shortened Streptococcus salivarius K12 appears to have excellent evidences as a course of antifungals may protect the patients from developing kind of oral probiotic with more than a decade of tradition (Zupancic drug‐resistant strains and decrease the likelihood of adverse events. et al., 2017). It is reported that S. salivarius strains inhibit the bio‐ Another interesting phenomenon is that there was a statistical film formation of Streptococcus mutans and suppress potentially difference in cure rate considering mycological cure between K12 detrimental upper respiratory tract bacteria, such as Streptococcus group and control group, while no statistical difference in clinical pneumonia and Streptococcus pyogenes in vitro (James & Tagg, 1991; cure rate between the two groups. A possible inference is that remis‐ Ogawa et al., 2011; Tamura et al., 2009; Wescombe et al., 2009). sion of clinical symptoms/signs lags behind mycological elimination, Also, some clinical trials and retrospective observational studies which was consistent with what was observed from clinic. Besides, supported that S. Salivarius K12 was effective for secretory otitis the current scoring system (0–3) of clinical symptoms and signs is not media, recurrent tonsillitis and/or pharyngitis and hemolytic strepto‐ delicate enough, although it is the commonly accepted method for coccus pharyngo‐tonsillar infections (Gregori et al., 2016; Di Pierro, evaluating clinical manifestations of oral candidiasis. In the future, Adami, Rapacioli, Giardini, & Streitberger, 2013; Di Pierro, Pasquale, a modified scoring system with more practicability and accuracy is & Cicco, 2015). desired for clinical study. However, the interaction and mechanism between S. Salivarius With respect to the safety of S. Salivarius K12, no severe ad‐ strains and fungi of Candida remain unclear. In a study focus on the verse event occurred in the K12 and control groups. Although HU et al. | 1579 short‐term adverse events reported involving the oral cavity, gas‐ AUTHOR CONTRIBUTION trointestinal tract, and even the nervous system (dizziness) and Zhimin Yan and Hong Hua designed the study. Lijun Hu, Qinghua skin, no significant difference was showed compared with the Mao, Xin Lv, and Peiru Zhou conducted the research. Lijun Hu and placebo control group. In K12 group, one patient complained bor‐ Zhimin Yan analyzed the data. Lijun Hu drafted the paper. Zhimin borygmus and pharyngeal discomfort and it was considered a pos‐ Yan revised the manuscript. sible S. Salivarius K12 lozenges‐related adverse event. The safety findings are consistent with what Burton JP et al. and other clinical studies reported on the use of S. salivarius K12 in the treatment ORCID of oral malodor and streptococcal pharyngitis (Burton, Chilcott, Lijun Hu https://orcid.org/0000‐0001‐5196‐5759 Wescombe, & Tagg, 2010; Burton et al., 2011; Burton, Wescombe, Moore, Chilcott, & Tagg, 2006; Burton, Chilcott, Moore, Speiser, & Zhimin Yan https://orcid.org/0000‐0002‐0751‐7374 Tagg, 2006; Gregori et al., 2016; Masdea et al., 2012; Di Pierro et al., 2013, 2012; Di Pierro, Colombo, Zanvit, Risso, & Rottoli, 2014). REFERENCES However, further investigations are still needed for the detection of long‐term and rare adverse events. Berberi, A., Noujeim, Z., & Aoun, G. (2015). Epidemiology of oropha‐ This study has some limitations that should be considered. ryngeal candidiasis in human immunodeficiency virus/acquired im‐ mune deficiency syndrome patients and CD4+ counts. Journal of Firstly, the insufficient number of subjects related with recruit‐ International Oral Health, 7, 20–23. ment difficulties had impact on the reliability of the results. We Burton, J. P., Chilcott, C. N., Moore, C. J., Speiser, G., & Tagg, J. R. (2006). strictly implemented every step of the study accordance with the A preliminary study of the effect of probiotic Streptococcus salivar‐ study protocol to provide some useful and interesting information ius K12 on oral malodour parameters. Journal of Applied Microbiology, 100, 754–764. or clue for the clinicians and future studies. Further clinical stud‐ Burton, J. P., Chilcott, C. N., & Tagg, J. R. (2005). The rationale and poten‐ ies are also necessary to confirm these findings in a larger‐scale, tial for the reduction of oral malodour using Streptococcus salivarius multicenter context. Secondly, since this is the first clinical study probiotics. Oral Diseases, 11(Suppl 1), 29–31. of S. Salivarius K12 on oral candidiasis, few references can be ob‐ Burton, J. P., Chilcott, C. N., Wescombe, P. A., & Tagg, J. R. (2010). Extended Safety Data for the Oral Cavity Probiotic Streptococcus tained. We reviewed the similar clinical studies of other species of salivarius K12. Probiotics Antimicrob Proteins, 2, 135–144. probiotics on oral candidiasis as the basis of sample size calcula‐ Burton, J. P., Cowley, S., Simon, R. R., McKinney, J., Wescombe, P. A., tion (Li et al., 2014), which may have influence on the assessment & Tagg, J. R. (2011). Evaluation of safety and human tolerance of of efficacy. Thirdly, owing to the follow‐up period was relatively the oral probiotic Streptococcus salivarius K12: A randomized, pla‐ limited, the maintenance of efficacy was not able to be ascer‐ cebo‐controlled, double‐blind study. Food and Chemical Toxicology, 49, 2356–2364. tained. Finally, the possible mechanisms of S. salivarius K12 against Burton, J. P., Wescombe, P. A., Moore, C. J., Chilcott, C. N., & Tagg, J. R. Candida infection and the changing in oral microflora before and (2006). Safety assessment of the oral cavity probiotic Streptococcus after the application of S. salivarius K12 need to be explored in the salivarius K12. Applied and Environment Microbiology, 72, 3050–3053. future. Cosseau, C., Devine, D. A., Dullaghan, E., Gardy, J. L., Chikatamarla, A., Gellatly, S., … Hancock, R. E. (2008). The commensal Streptococcus salivarius K12 downregulates the innate immune responses of human epithelial cells and promotes host‐microbe homeostasis. Infection 5 | CONCLUSION and Immunity, 76, 4163–4175. Di Pierro, F., Adami, T., Rapacioli, G., Giardini, N., & Streitberger, C. (2013). Clinical evaluation of the oral probiotic Streptococcus salivar‐ Streptococcus salivarius K12 exhibited potential efficacy and safety ius K12 in the prevention of recurrent pharyngitis and/or tonsillitis as an adjuvant in treating oral candidiasis by enhancing mycological caused by Streptococcus pyogenes in adults. Expert Opin Biol Ther, cure and shortening the treatment course of conventional antifungal 13, 339–343. therapy in this first randomized, double‐blinded, placebo‐controlled Di Pierro, F., Colombo, M., Giuliani, M. G., Danza, M. L., Basile, I., Bollani, T., … Rottoli, A. S. (2016). Effect of administration of Streptococcus clinical trial. Further large‐scale clinical studies are desired to accu‐ salivarius K12 on the occurrence of streptococcal pharyngo‐ton‐ mulate more evidence for its clinical applications. sillitis, scarlet fever and acute otitis media in 3 years old children. European Review for Medical and Pharmacological Sciences, 20, 4601–4606. ACKNOWLEDGEMENTS Di Pierro, F., Colombo, M., Zanvit, A., Risso, P., & Rottoli, A. S. (2014). Use of Streptococcus salivarius K12 in the prevention of streptococcal The authors would like to thank all the participants for their coop‐ and viral pharyngotonsillitis in children. Drug, Healthcare and Patient eration and availability. The study was supported by the Natural Safety, 6, 15–20. Science Foundation of China (grant number 81570985). Di Pierro, F., Colombo, M., Zanvit, A., & Rottoli, A. S. (2016). Positive clinical outcomes derived from using Streptococcus salivarius K12 to prevent streptococcal pharyngotonsillitis in children: A pilot investi‐ CONFLICTS OF INTEREST gation. Drug, Healthcare and Patient Safety, 8, 77–81. Di Pierro, F., Di Pasquale, D., & Di Cicco, M. (2015). Oral use of The authors declare that they have no competing interests. Streptococcus salivarius K12 in children with secretory otitis media: 1580 | HU et al.
Preliminary results of a pilot, uncontrolled study. International Journal Niimi, M., Firth, N. A., & Cannon, R. D. (2010). Antifungal drug resistance of General Medicine, 8, 303–308. of oral fungi. Odontology, 98, 15–25. Di Pierro, F., Donato, G., Fomia, F., Adami, T., Careddu, D., Cassandro, C., Ogawa, A., Furukawa, S., Fujita, S., Mitobe, J., Kawarai, T., Narisawa, N., & Albera, R. (2012). Preliminary pediatric clinical evaluation of the … Senpuku, H. (2011). Inhibition of Streptococcus mutans biofilm oral probiotic Streptococcus salivarius K12 in preventing recurrent formation by Streptococcus salivarius FruA. Applied and Environment pharyngitis and/or tonsillitis caused by Streptococcus pyogenes and Microbiology, 77, 1572–1580. recurrent acute otitis media. International Journal of General Medicine, Schulz, K. F., Altman, D. G., & Moher, D. (2010). CONSORT 2010 5, 991–997. Statement: Updated guidelines for reporting parallel group random‐ Ellepola, A. N., & Samaranayake, L. P. (2000). Oral candidal infections ized trials. Open Med, 4, e60–e68. and antimycotics. Critical Reviews in Oral Biology and Medicine, 11, Shinozaki, S., Moriyama, M., Hayashida, J. N., Tanaka, A., Maehara, T., 172–198. Ieda, S., & Nakamura, S. (2012). Close association between oral Gregori, G., Righi, O., Risso, P., Boiardi, G., Demuru, G., Ferzetti, A., Candida species and oral mucosal disorders in patients with xerosto‐ … Suzzani, L. (2016). Reduction of group A beta‐hemolytic strep‐ mia. Oral Diseases, 18, 667–672. tococcus pharyngo‐tonsillar infections associated with use of the Tagg, J. R., & Dierksen, K. P. (2003). Bacterial replacement ther‐ oral probiotic Streptococcus salivarius K12: A retrospective ob‐ apy: Adapting 'germ warfare' to infection prevention. Trends in servational study. Therapeutics and Clinical Risk Management, 12, Biotechnology, 21, 217–223. 87–92. Tamura, S., Yonezawa, H., Motegi, M., Nakao, R., Yoneda, S., Watanabe, Hyink, O., Wescombe, P. A., Upton, M., Ragland, N., Burton, J. P., & Tagg, H., … Senpuku, H. (2009). Inhibiting effects of Streptococcus sali‐ J. R. (2007). Salivaricin A2 and the novel lantibiotic salivaricin B are varius on competence‐stimulating peptide‐dependent biofilm forma‐ encoded at adjacent loci on a 190‐kilobase transmissible megaplas‐ tion by Streptococcus mutans. Oral Microbiology and Immunology, 24, mid in the oral probiotic strain Streptococcus salivarius K12. Applied 152–161. and Environment Microbiology, 73, 1107–1113. Wescombe, P. A., Hale, J. D., Heng, N. C., & Tagg, J. R. (2012). Developing Ishijima, S. A., Hayama, K., Burton, J. P., Reid, G., Okada, M., Matsushita, oral probiotics from Streptococcus salivarius. Future Microbiology, 7, Y., & Abe, S. (2012). Effect of Streptococcus salivarius K12 on the 1355–1371. in vitro growth of Candida albicans and its protective effect in an Wescombe, P. A., Heng, N. C., Burton, J. P., Chilcott, C. N., & Tagg, J. R. oral candidiasis model. Applied and Environment Microbiology, 78, (2009). Streptococcal bacteriocins and the case for Streptococcus 2190–2199. salivarius as model oral probiotics. Future Microbiology, 4, James, S. M., & Tagg, J. R. (1991). The prevention of dental caries by BLIS‐ 819–835. mediated inhibition of mutans streptococci. N Z Dent J, 87, 80–83. Zupancic, K., Kriksic, V., Kovacevic, I., & Kovacevic, D. (2017). Influence Lamster, I. B., Lalla, E., Borgnakke, W. S., & Taylor, G. W. (2008). The of Oral Probiotic Streptococcus salivarius K12 on ear and oral cavity relationship between oral health and diabetes mellitus. Journal of the health in humans: Systematic review. Probiotics Antimicrob Proteins, American Dental Association, 139(Suppl), 19S–24S. 9, 102–110. Li, D., Li, Q., Liu, C., Lin, M., Li, X., Xiao, X., … Zhou, H. (2014). Efficacy and safety of probiotics in the treatment of Candida‐associated stomati‐ tis. Mycoses, 57, 141–146. Lopez‐Martinez, R. (2010). Candidosis, a new challenge. Clinics in SUPPORTING INFORMATION Dermatology, 28, 178–184. Masdea, L., Kulik, E. M., Hauser‐Gerspach, I., Ramseier, A. M., Filippi, A., Additional supporting information may be found online in the & Waltimo, T. (2012). Antimicrobial activity of Streptococcus salivar‐ Supporting Information section at the end of the article. ius K12 on bacteria involved in oral malodour. Archives of Oral Biology, 57, 1041–1047. Miyazima, T. Y., Ishikawa, K. H., Mayer, M., Saad, S., & Nakamae, A. How to cite this article: Hu L, Mao Q, Zhou P, Lv X, Hua H, Yan (2017). Cheese supplemented with probiotics reduced the Candida levels in denture wearers‐RCT. Oral Diseases, 23, 919–925. Z. Effects of Streptococcus salivarius K12 with nystatin on oral Moher, D., Hopewell, S., Schulz, K. F., Montori, V., Gotzsche, P. C., candidiasis—RCT. Oral Dis. 2019;25:1573–1580. https ://doi. Devereaux, P. J., … Altman, D. G. (2012). CONSORT 2010 explana‐ org/10.1111/odi.13142 tion and elaboration: Updated guidelines for reporting parallel group randomised trials. International Journal of Surgery, 10, 28–55. anno: 2018 Lavoro: 5182-MPed Mese: June titolo breve: S. SaLivariUS K12 in PHarYnGO-tOnSiLLitiS and acUte OtitiS volume: 70 primo autore: di PierrO no: 3 pagine: 240-5 rivista: Minerva Pediatrica citazione: Minerva Pediatr 2018;70:240-5 cod rivista: Minerva Pediatr
© COPYRIGHT 2018 EDIZIONI MINERVA MEDICA ,
© 2018 ediZiOni Minerva Medica Minerva Pediatrica 2018 June;70(3):240-5 Online version at http://www.minervamedica.it DOI: 10.23736/S0026-4946.18.05182-4 ORIGINAL ARTICLE
Use of Streptococcus salivarius K12 to reduce the incidence of pharyngo-tonsillitis and acute otitis media in children: a retrospective analysis in not-recurrent pediatric subjects
Francesco di PierrO 1 *, Paolo riSSO 2, elena POGGi 3, anna tiMitiLLi 4, Sara BOLLOLi 4, Maurizio BrUnO 4, egidio caneva 4, riccardo caMPUS 4, alessandro GiannattaSiO 5
1Scientific and Research Department, Velleja Research, Milan, Italy;2 department of Health Sciences, University of Genoa, Genoa, Italy; 3Department of Pediatrics, University of Genoa, Genoa, Italy; 4department of Public Health, University of Genoa, Genoa, Italy; 5department of Biophysical, Medical, and Odontostomatological Sciences and technologies, University of Genoa, Genoa, italy *corresponding author: Francesco di Pierro, velleja research, viale Lunigiana 23, 20125, Milan, italy. e-mail: [email protected]
a BStract BacKGrOUnd: Previous trials, performed in subjects affected by recurrent streptococcal pharyngo-tonsillar infection, have shown that the use for 90 days of Streptococcus salivarius K12 (K12), an oral colonizing probiotic producing lanti- biotic bacteriocins, reduces the occurrence of streptococcal and viral pharyngitis and acute otitis media (aOM). the aim was to evaluate the role of K12 in reducing the incidence of streptococcal and viral pharyngo-tonsillitis and aOM when administered in two separate trimesters, from October to december and then from april to June, in pediatric subjects with non-recurrent streptococcal infection. MetHOdS: We retrospectively analyzed the incidence of pharyngo-tonsillitis and aOM in 133 children by comparing the number of episodes occurring between September 1st, 2014 and august 31st, 2015, when no treatment with K12 was given, with the period between September 1st, 2015 and august 31st, 2016, when K12 was administered. RESULTS: Analysis of the findings for the 133 children demonstrated that K12 use decreased the incidence of pharyngo- tonsillitis by about 90% (P<0.001) and the occurrence of AOM by about 70% (P<0.001) and confirms the high safety profile of the strain. cOncLUSiOnS: as already demonstrated in subjects with recurrent streptococcal pharyngo-tonsillar infection, K12, if administered for two trimesters out of 12 months, is associated with a reduced incidence of pharyngitis and aOM in pediatric subjects with non-recurrent streptococcal infection. (Cite this article as: di Pierro F, risso P, Poggi e, timitilli a, Bolloli S, Bruno M, et al. Use of Streptococcus salivarius K12 to reduce the incidence of pharyngo-tonsillitis and acute otitis media in children: a retrospective analysis in not-recurrent pediatric subjects. Minerva Pediatr 2018;70:240-5. DOI: 10.23736/S0026-4946.18.05182-4) Key words: Probiotics - Streptococcal infections - Streptococcus salivarius - child.
treptococcus salivarius K12 (K12) is an tococcus pyogenes, which is involved in the Soral colonizing, persistent, antibiotic- etiopathogenesis of pharyngo-tonsillar infec- sensitive and safe strain 1-4 which produces tion, and, to a smaller degree, Haemophilus two megaplasmid-encoded class i lantibiot- influenzae, Streptococcus pneumoniae, and ics, namely salivaricin a2 and salivaricin B, Moraxella catarrhalis, which cause acute whose expression limits the growth of Strep- otitis media (aOM).5-7 Previous works have This document is protected by international laws.This document is protected by copyright No additional reproduction is authorized. of this Article. only one file and print only one copy and save use to download personal It is permittedfor It is not permitted additional copies to make either printed purpose. or electronic) of the Article any for or systematically, (either sporadically of the article It is not permitted the electronic copy to distribute other through online internet electronic mailing or any sharing file and/or intranet systems, access to the Article. allow means which may part The use of all or any permitted.is not Use Commercial of the Article any for works from the Article The creation of derivative is not permitted. personal or commercial use is The production of reprints for post on the Article. notices or terms may copyright the Publisher of use which or change any block, obscure, not permitted. trademark, logo overlay, It is not permittedenclose any techniques to or use framing to frame cover, It is not permitted to remove, or other proprietary of the Publisher. information 240 Minerva Pediatrica June 2018 © COPYRIGHT 2018 EDIZIONI MINERVA MEDICA ,
S. SALIVARIUS K12 in PHarYnGO-tOnSiLLitiS and acUte OtitiS di PierrO
shown that 90-day use of K12 in subjects Materials and methods with a diagnosis of recurrent streptococcal in- fection (that is with more than two episodes BLiS K12 was formulated by Siit (trez- of streptococcal pharyngo-tonsillitis over 6 zano sul naviglio, Milan, italy) as slowly-dis- months or more than three episodes over 1 solving oral tablets and notified to the Italian year) or in children with a diagnosis of se- Ministry of Health on July 5th, 2011 as Bac- cretory otitis media, decreases the number of toblis® by Omeopiacenza (Pontenure, italy), episodes of streptococcal pharyngo-tonsillitis according to the provisions of law no. 169 of and aOM.8-10 in addition, very preliminary 2004 (notification no. 53435). The Bactoblis® results have also suggested that K12 can pre- preparation used in the clinical trial contained vent viral pharyngeal infection.11 this last 1 billion or more CFU/tablet of Streptococ- action could be due to its ability to elevate cus salivarius K12 (Blis technologies, Otago, salivary γ-interferon concentrations with- new Zealand) as declared for the expiry date. out modifying either IL-1β or TNF-α levels, and by substantially lowering iL-8 release.7 Clinical trial these biochemical effects on salivary cyto- kines could possibly explain the positive ac- Our retrospective analysis was conducted on tion shown by the strain when administered 133 (68 males and 65 females) children living in children affected by periodic fever with in the Genoa area of italy at the end of 2016. aphthous stomatitis, pharyngitis, and adenitis the children were treated with K12 for two tri- (PFaPa).12 a wider range of clinical action mesters, from October to december 2015 and has been recently observed in a trial where then from april to June 2016. the number of 90-day administration of the strain to children episodes of streptococcal and viral pharyngo- with a diagnosis of recurrent streptococcal tonsillitis and aOM from September 1st, 2015 pharyngeal infection, reduced the number of and august 31st, 2016 were compared with the episodes of some non-streptococcal diseases, number recorded in the same 133 children the including rhinitis, tracheitis, flu, enteritis, and year before when K12 was not administered. laryngitis.13 to date, just one trial has ex- the retrospective analysis was conducted in amined the benefits of K12 administered for accordance with the declaration of Helsinki more than 90 days. according to the results and was approved by the local ethics commit- of that trial, administration of K12 for 180 tee in Genoa (comitato etico regione Liguria days to 3-year-old healthy children during Sezione n° 1), italy. the parents of all study their first year of kindergarten and without a participants were informed of the retrospective diagnosis of recurrent streptococcal pharyn- analytical methods and signed the appropriate go-tonsillar infection, resulted in a significant consent and privacy policy documents. decrease in the number of episodes of strepto- coccal pharyngo-tonsillitis and aOM record- Inclusion and exclusion criteria ed in the same year. in the present study, we have retrospectively analyzed the incidence all recruited individuals were 3-14 years of pharyngo-tonsillitis and aOM in subjects of age and attending our pediatric outpatient with recurrent non-streptococcal infection by clinics. the 133 children analyzed were ad- comparing the number of episodes between ministered K12 to prevent possible pharyngo- September 1st, 2014 and august 31st, 2015, tonsillar infection or aOM. they had all been when no treatment with K12 was given, with diagnosed at least once with pharyngo-tonsil- the period between September 1st, 2015 and lar infection and/or AOM in the previous year. august 31st, 2016, when K12 was adminis- none of the enrolled children had been diag- tered daily for a total of 180 days in two sep- nosed with recurrent streptococcal pharyngo- arate trimesters, from October to december tonsillitis. exclusion criteria were as follows: a 2015 and then from april to June 2016. history of rheumatic disorders, bronchospasm, This document is protected by international laws.This document is protected by copyright No additional reproduction is authorized. of this Article. only one file and print only one copy and save use to download personal It is permittedfor It is not permitted additional copies to make either printed purpose. or electronic) of the Article any for or systematically, (either sporadically of the article It is not permitted the electronic copy to distribute other through online internet electronic mailing or any sharing file and/or intranet systems, access to the Article. allow means which may part The use of all or any permitted.is not Use Commercial of the Article any for works from the Article The creation of derivative is not permitted. personal or commercial use is The production of reprints for post on the Article. notices or terms may copyright the Publisher of use which or change any block, obscure, not permitted. trademark, logo overlay, It is not permittedenclose any techniques to or use framing to frame cover, It is not permitted to remove, or other proprietary of the Publisher. information vol. 70 - no. 3 Minerva Pediatrica 241 © COPYRIGHT 2018 EDIZIONI MINERVA MEDICA ,
di PierrO S. SALIVARIUS K12 in PHarYnGO-tOnSiLLitiS and acUte OtitiS
severe asthma or allergy requiring corticoste- emia. acetaminophen or ibuprofen was used roids; past tonsillectomy or an indication for to treat viral infections presenting with fever adeno-tonsillectomy; or severe respiratory and/or pharyngo-laryngeal pain. Pneumatic or systemic disorders. individuals were also otoscopy and clinical signs were used to diag- excluded if they were immunocompromised nose aOM, which was treated in accordance or had a condition favoring aOM, including with the italian pediatric guidelines. any other severe atopy, acquired or congenital immuno- conditions or diseases were also treated in ac- deficiency, cleft palate, craniofacial abnormal- cordance with italian pediatric guidelines. ities, obstructive adenoids, a chronically rup- tured eardrum, sleep apnea, or tympanostomy Study aims tubes. the primary endpoint of the study was to Treatments and diagnosis evaluate the role of K12 in preventing strep- tococcal and viral pharyngo-tonsillitis and the children were told how to adminis- aOM from September 2015 to august 2016. ter the oral probiotic. the tablets were to be K12 was administered in two separate tri- taken from October to december 2015 for 90 mesters, from October to december 2015 and consecutive days and then from april to June then from april to June 2016, to subjects with 2016 for another 90 days. after teeth were non-recurrent streptococcal infection. the in- brushed, one tablet was to be dissolved slowly cidence of pharyngo-tonsillar infection and in the mouth just before going to sleep. the aOM in the same children the previous year tablet was not to be chewed or swallowed before K12 was administered was also retro- whole. nothing else was to be drunk or swal- spectively analyzed. the secondary endpoints lowed after use of the product. it was recom- were: side effects, tolerability and compli- mended that just before the first tablet was ance, number of days absent from kindergar- administered, the children rinsed their mouth ten, school, or work, and doses of antibiotics with a 0.2% chlorhexidine mouthwash in or- and anti-inflammatory drugs administered. All der to increase colonization by the strain, by secondary endpoints were analyzed by the re- decreasing competition from oral Streptococ- sponsible of the study according to a daily di- cus salivarius. For the entire 12 months, if the ary filled by parents. children showed any symptoms of infection they were to be brought immediately to the Statistical analysis clinic for examination and a pharyngeal rapid test. a rapid swab positive for group a strep- the characteristics of enrolled subjects tococcus (test Strep-a, Gima, Gessate, italy) (age, birthweight, type of delivery, breastfed confirmed streptococcal pharyngo-tonsillar in- or not, ethnicity, nursery, toy library/kinder- fection. antibiotic treatment was prescribed if garten attendance, use of antihistamines or the test was positive. after completion of an- anti-leukotrienes drugs, and other possible on- tibiotic therapy, treatment with K12 resumed going therapies) were examined using Fisher’s and continued until the previously designated exact test. differences in episodes of infection, 90th day of the trimester. viral infection was days lost and drugs used were determined us- diagnosed according to the following criteria: ing Wilcoxon’s signed rank sum test. JMP 10 negative rapid swab for streptococcal disease, for Mac OsX was used for statistical analysis absence of petechiae on the palate, absence of and statistical significance was set at 95%. submandibular lymphadenopathy, mild dys- phagia, and absence of headache, abdominal Results pain, or hyperpyrexia. Patients presenting with viral pharyngitis had mild dysphagia, low- We retrospectively analyzed the incidence grade fever, and moderate pharyngeal hyper- of pharyngo-tonsillitis and aOM by compar- This document is protected by international laws.This document is protected by copyright No additional reproduction is authorized. of this Article. only one file and print only one copy and save use to download personal It is permittedfor It is not permitted additional copies to make either printed purpose. or electronic) of the Article any for or systematically, (either sporadically of the article It is not permitted the electronic copy to distribute other through online internet electronic mailing or any sharing file and/or intranet systems, access to the Article. allow means which may part The use of all or any permitted.is not Use Commercial of the Article any for works from the Article The creation of derivative is not permitted. personal or commercial use is The production of reprints for post on the Article. notices or terms may copyright the Publisher of use which or change any block, obscure, not permitted. trademark, logo overlay, It is not permittedenclose any techniques to or use framing to frame cover, It is not permitted to remove, or other proprietary of the Publisher. information 242 Minerva Pediatrica June 2018 © COPYRIGHT 2018 EDIZIONI MINERVA MEDICA ,
S. SALIVARIUS K12 in PHarYnGO-tOnSiLLitiS and acUte OtitiS di PierrO
ing the number of episodes occurring between tonsillar infections was significantly reduced September 1st, 2014 and august 31st, 2015, following prophylaxis with K12 by about 90% when no treatment with K12 was given, with in both cases. A significant reduction of about the period between September 1st, 2015 and 70% was also observed for aOM. as shown august 31st, 2016, when K12 was adminis- in table iii, compliance and tolerability were tered daily (Figure 1). the characteristics of both excellent for all but one of the children, a the 133 children are reported in table i. ta- 6-year-old boy who experienced a single epi- ble ii shows that the number of episodes of sode of mild bronchospasm. Lastly, as shown streptococcal and non-streptococcal pharyngo- in Table IV, prophylaxis with K12 significantly reduced the use of both antibiotics and anti- 09.01.14 08.31.15 pyretics/anti-inflammatory drugs by more than 80% and significantly decreased the number Evaluation of episodes of infection Antibiotics and drugs according to medical prescription of school or work days lost by children or adults by about 85% and 75%, respectively. Our multi-variate analysis (data not shown) 09.01.15 08.31.16 Sep Oct Nov Dec Jan Feb Mar Apr May Jun Jul Aug showed that the positive results obtained re-
K12 K12 K12 K12 K12 K12
Evaluation of episodes of infection Antibiotics and drugs according to medical prescription Table III.—Tolerability, compliance, and side effects re- Figure 1.—Study scheme. corded annually in children (N.=133) treated for two trimesters (October-December 2015 and April-June 2016) with K12. Table I.—Characteristics of children enrolled in the study. tolerability compliance Side effects Males Females P value excellent, n. 132 133 none Good, n. 0 0 none total number 68 65 acceptable, n. 1 0 Bronchospasm a age, years) 8.1±3.1 8.2±3.9 nS a this event occurred only once after a few days of treatment with Birthweight, kg 3.4±0.3 3.4±0.4 nS K12 and never happened again. eutocia 38 38 nS dystocia 30 27 nS Breastfed 48 50 nS Table IV.—Days with antibiotics/antipyretics/anti-in- not breastfed 20 15 nS flammatory drugs and pre-school/school/working days caucasian 67 61 nS lost by children and adults in 2014-2015 (no K12) and nursery 14 14 nS 2015-2016 (K12 administered for two trimesters). toy library 42nS Kindergarten 58 52 nS 2014- 2015- P Parameter 2015 2016 ∆ value Pcv13 68 65 nS anti-histamine 15 6 nS antibiotics, days 3334 395 -88.1% <0.01 anti-leukotrienes 77nS antipyretics 489 75 -84.7% <0.01 Other therapies 22 13 nS or anti-inflammatory drugs, days values are number or mean±Sd. NS: non-significant difference; PCV13: 13-valent pneumococcal School or pre-school, days 1493 224 -84.9% <0.01 vaccine. Work, days 772 193 -75% <0.01
Table II.—Annual episodes of pharyngo-tonsillitis, caused or not by Streptococcus pyogenes, and occurrence of AOM in 133 children with (2015-2016) or without (2014-2015) K12 administration daily from October to Decem- ber 2015 and then from April to June 2016. Group 2014-2015 2015-2016 P value ∆ GaBHS 1.8±1.2 0.2±0.6 <0.001 -88.9% not GaBHS 3.1±1.6 0.2±0.5 <0.001 -93.5% aOM 0.7±1.2 0.2±0.5 <0.001 -71.4% AOM: acute otitis media; GABHS: pharyngo-tonsillar infection with group A beta-hemolytic streptococcus; not GABHS: pharyngo-tonsillar infection negative to group a beta-hemolytic streptococcus. This document is protected by international laws.This document is protected by copyright No additional reproduction is authorized. of this Article. only one file and print only one copy and save use to download personal It is permittedfor It is not permitted additional copies to make either printed purpose. or electronic) of the Article any for or systematically, (either sporadically of the article It is not permitted the electronic copy to distribute other through online internet electronic mailing or any sharing file and/or intranet systems, access to the Article. allow means which may part The use of all or any permitted.is not Use Commercial of the Article any for works from the Article The creation of derivative is not permitted. personal or commercial use is The production of reprints for post on the Article. notices or terms may copyright the Publisher of use which or change any block, obscure, not permitted. trademark, logo overlay, It is not permittedenclose any techniques to or use framing to frame cover, It is not permitted to remove, or other proprietary of the Publisher. information vol. 70 - no. 3 Minerva Pediatrica 243 © COPYRIGHT 2018 EDIZIONI MINERVA MEDICA ,
di PierrO S. SALIVARIUS K12 in PHarYnGO-tOnSiLLitiS and acUte OtitiS
garding episodes of infection, drug use, and ten occurs, could protect subjects with no fea- days lost (pre-school, school, and work) were tures of recurrent streptococcal infection from not associated with sex, age, or any other vari- both pharyngo-tonsillar infection and aOM. able listed in table i. Our results confirm our hypothesis. In subjects with non-recurrent streptococcal infections, the prophylactic administration of K12 during tri- Discussion mesters with increased incidence of infection the concept of oral probiotics is relatively significantly reduced the number of streptococ- new.7 Probiotics are known to help the host cal and viral pharyngo-tonsillar infections and combat gastrointestinal disorders including aOM episodes. consequently, there was also diarrhea, constipation, and irritable bowel syn- a significant reduction in antibiotic and drug drome.14 the development of the strain K12, use and a decrease in the number of pre-school, selected from the oral cavity commensal spe- school, and work days lost. the strain K12 is endowed with a “bacterio- cies Streptococcus salivarius, suggests oral cins action” exerted versus Streptococcus pyo- health benefits can be achieved with probiotic genes and partially versus Moraxella catarrha- therapy. isolated originally from the oral cav- lis, Haemophilus influenzae and Streptococcus ity of a young child without recent experience pneumoniae.7 this, at least in part, could ex- of infection with Streptococcus pyogenes, the plain the effects observed against streptococcal strain K12 has subsequently been shown inhibit oral disease and aOM. Moreover, some recent Streptococcus pyogenes and oral cavity bacteri- investigations 11, 12 have clearly shown that al pathogens associated with aOM. its previous strain K12 could antagonize also not strepto- clinical use has shown that, used as a prophy- coccal diseases like viral sore throat and PFa- lactic agent in subjects diagnosed with recurrent Pa may be due to its ability to elevate salivary streptococcal pharyngeal and/or tonsillar infec- γ-interferon concentrations without modifying tion, it can reduce the incidence of streptococ- either IL-1β or TNF-α levels, and by substan- cal pharyngo-tonsillar episodes by more than tially lowering iL-8 release.7 this could a pos- 80% during the time of K12 administration and sible explanation for the effect observed in the 8, 9 by about 60% during a 6-month or 9-month not streptococcal infections. follow-up.15 in these studies, where subjects did not have recurrent aOM, the protective effect of K12 on episodes of aOM only showed a ten- Limitations of the study dency and never reached statistical significance. Our work has some limitations, particularly However, it was observed that prophylactic use the lack of a control group. We know the num- of K12 significantly decreased the incidence of ber of illnesses such as streptococcal pharyngo- aOM in subjects with more severe ear involve- tonsillar infection and aOM in children tends ment, such as secretory otitis media.10 in all of to reduce spontaneously year on year, as seen in these studies, K12 was administered daily for one of our previous studies. in that study, a 90% a maximum of 90 days. recently, a prospec- reduction in incidence was observed in children tive study examined the role of K12 prophy- treated with K12 compared with the number of laxis in healthy 3-year-olds without recurrent episodes seen in the same children the previous infections. the study demonstrated that daily year, but a 50% reduction was also observed in administration of K12 for 180 consecutive days the control group where children were untreated significantly reduced the incidence of strepto- but one year older. in our current study, the re- coccal infections and aOM.16 in our retrospec- duction percentage was calculated by compar- tive study we wanted to verify if administration ing the number of episodes of infection seen in of K12 for 180 days divided into two different 2014-2015 with those evaluated in 2015-2016. trimesters, October-december and april-June, this means that the same possible bias could be periods when more streptococcal infection of- present in the study. However, even if 50% of This document is protected by international laws.This document is protected by copyright No additional reproduction is authorized. of this Article. only one file and print only one copy and save use to download personal It is permittedfor It is not permitted additional copies to make either printed purpose. or electronic) of the Article any for or systematically, (either sporadically of the article It is not permitted the electronic copy to distribute other through online internet electronic mailing or any sharing file and/or intranet systems, access to the Article. allow means which may part The use of all or any permitted.is not Use Commercial of the Article any for works from the Article The creation of derivative is not permitted. personal or commercial use is The production of reprints for post on the Article. notices or terms may copyright the Publisher of use which or change any block, obscure, not permitted. trademark, logo overlay, It is not permittedenclose any techniques to or use framing to frame cover, It is not permitted to remove, or other proprietary of the Publisher. information 244 Minerva Pediatrica June 2018 © COPYRIGHT 2018 EDIZIONI MINERVA MEDICA ,
S. SALIVARIUS K12 in PHarYnGO-tOnSiLLitiS and acUte OtitiS di PierrO
the reduction we found is due to an age effect, omized, placebo-controlled, double-blind study. Food Chem Toxicol 2011;49:2356-64. the other 50% should be due to K12 adminis- 5. Hyink O, Wescombe Pa, Upton M, ragland n, Burton tration. Last, cannot be excluded that during JP, tagg Jr. Salivaricin a2 and the novel lantibiotic sali- varicin B are encoded at adjacent loci on a 190-kilobase the year of the study a reduced rate of infection transmissible megaplasmid in the oral probiotic strain could be occurring. On the basis of our experi- Streptococcus salivarius K12. appl environ Microbiol 2007;73:1107-13. ence anyway the rates of infection of the two 6. Wescombe Pa, Burton JP, cadieux Pa, Klesse na, years considered were not different. Finally, as Hyink O, Heng nc, et al. Megaplasmids encode differing shown, we have demonstrated that K12 is a safe combinations of lantibiotics in Streptococcus salivarius. Antonie Van Leeuwenhoek 2006;90:269-80. probiotic, with very high tolerability. 7. Wescombe Pa, Hale Jd, Heng nc, tagg Jr. develop- ing oral probiotics from Streptococcus salivarius. Future Microbiol 2012;7:1355-71. Conclusions 8. di Pierro F, adami t, rapacioli G, Giardini n, Streitberg- er c. clinical evaluation of the oral probiotic Streptococ- cus salivarius K12 in the prevention of recurrent pharyn- in conclusion, as previously demonstrat- gitis and/or tonsillitis caused by Streptococcus pyogenes ed in subjects with recurrent streptococcal in adults. Expert Opin Biol Ther 2013;13:339-43. 9. di Pierro F, donato G, Fomia F, adami t, careddu d, pharyngo-tonsillar infection, the use of K12, cassandro c, et al. Preliminary pediatric clinical evalua- if prophylactically administered for two tri- tion of the oral probiotic Streptococcus salivarius K12 in preventing recurrent pharyngitis and/or tonsillitis caused mesters out of 12 months, is associated with by Streptococcus pyogenes and recurrent acute otitis me- reduced incidence of pharyngitis and aOM dia. Int J Gen Med 2012;5:991-7. in subjects with non-recurrent streptococcal 10. di Pierro F, di Pasquale d, di cicco M. Oral use of Streptococcus salivarius K12 in children with secretory infection, leading to a significant reduction in otitis media: preliminary results of a pilot, uncontrolled the use of antipyretics, antibiotics, and anti- study. Int J Gen Med 2015;8:303-308. 11. di Pierro F, colombo M, Zanvit a, risso P, rottoli aS. inflammatory drugs, together with a decrease Use of Streptococcus salivarius K12 in the prevention of in the number of pre-school, school, and work streptococcal and viral pharyngo-tonsillitis in children. Drug Healthc Patient Saf 2014;6:15-20. days lost. 12. di Pierro F, campana a, Panatta ML, antenucci v, de vincentiis G. the use of Streptococcus salivarius K12 in attenuating PFaPa syndrome, a pilot study. altern integr Med 2016;5:222. References 13. di Pierro F, colombo M, Zanvit a, rottoli aS. Positive clinical outcomes derived from using Streptococcus sali- 1. Power da, Burton JP, chilcott cn, dawes PJ, tagg Jr. varius K12 to prevent streptococcal pharyngotonsillitis in Preliminary investigations of the colonisation of upper children: a pilot investigation. drug Healthc Patient Saf respiratory tract tissues of infants using a paediatric for- 2016;8:77-81. mulation of the oral probiotic Streptococcus salivarius 14. Hod K, ringel Y. Probiotics in functional bowel disor- K12. Eur J Clin Microbiol Infect Dis 2008;27:1261-3. ders. Best Pract Res Clin Gastroenterol 2016;30:89-97. 2. Horz HP, Meinelt a, Houben B, conrads G. distribution 15. Gregori G, righi O, risso P, Boiardi G, demuru G, Fer- and persistence of probiotic Streptococcus salivarius K12 zetti a, et al. reduction of group a beta-hemolytic strep- in the human oral cavity as determined by real-time quan- tococcus pharyngo-tonsillar infections associated with titative polymerase chain reaction. Oral Microbiol immu- use of the oral probiotic Streptococcus salivarius K12: a nol 2007;22:126-30. retrospective observational study. ther clin risk Manag 3. Burton JP, Wescombe Pa, Moore cJ, chilcott cn, 2016;12:87-92. tagg Jr. Safety assessment of the oral cavity probiotic 16. di Pierro F, colombo M, Giuliani MG, danza ML, Basile Streptococcus salivarius K12. appl environ Microbiol i, Bollani t, et al. effect of administration of Streptococ- 2006;72:3050-3. cus salivarius K12 on the occurrence of streptococcal 4. Burton JP, cowley S, Simon rr, McKinney J, Wescombe pharyngo-tonsillitis, scarlet fever and acute otitis media Pa, tagg Jr. evaluation of safety and human tolerance of in 3 years old children. eur rev Med Pharmacol Sci the oral probiotic Streptococcus salivarius K12: a rand- 2016;20:4601-6.
Authors’ contributions.—Francesco Di Pierro wrote the paper and prepared the figure and tables. Paolo Risso performed the statistical analysis. all the other authors were involved in the diagnosis and treatment. Conflicts of interest.—Francesco Di Pierro is the main formulator of the tested product and is on the scientific council of the company (Omeopiacenza) which markets the tested product in Italy. The other authors do not report any conflict of interest. Acknowledgments.—We wish to thank acP Liguria for supporting this study. Article first published online: January 11, 2018. - Manuscript accepted: January 10, 2018. - Manuscript received: December 27, 2017. This document is protected by international laws.This document is protected by copyright No additional reproduction is authorized. of this Article. only one file and print only one copy and save use to download personal It is permittedfor It is not permitted additional copies to make either printed purpose. or electronic) of the Article any for or systematically, (either sporadically of the article It is not permitted the electronic copy to distribute other through online internet electronic mailing or any sharing file and/or intranet systems, access to the Article. allow means which may part The use of all or any permitted.is not Use Commercial of the Article any for works from the Article The creation of derivative is not permitted. personal or commercial use is The production of reprints for post on the Article. notices or terms may copyright the Publisher of use which or change any block, obscure, not permitted. trademark, logo overlay, It is not permittedenclose any techniques to or use framing to frame cover, It is not permitted to remove, or other proprietary of the Publisher. information vol. 70 - no. 3 Minerva Pediatrica 245 European Review for Medical and Pharmacological Sciences 2016; 20: 4601-4606 Effect of administration of Streptococcus salivarius K12 on the occurrence of streptococcal pharyngo-tonsillitis, scarlet fever and acute otitis media in 3 years old children
F. DI PIERRO1, M. COLOMBO2, M.G. GIULIANI3, M.L. DANZA4, I. BASILE4, T. BOLLANI5, A.M. CONTI6, A. ZANVIT7, A.S. ROTTOLI8
1Scientific Department, Velleja Research, Milan, Italy 2ATS, District 5, Milan, Italy 3ATS District 8, Milan, Italy 4ATS, District 6, Milan, Italy 5ATS, District 4, Milan, Italy 6ATS, District 7, Milan, Italy 7Biological Dentistry Department, Italian Stomatology Institute, Milan, Italy 8Pediatric Department, “Uboldo Hospital”, Cernusco S/N, Milan, Italy
Abstract. – OBJECTIVE: Streptococcus sali- ment or follow-up. All of the enrolled children varius K12 (BLIS K12) is a probiotic strain completed the study. strongly antagonistic to the growth of Strepto- CONCLUSIONS: The daily administration of coccus pyogenes, the most important bacterial BLIS K12 to children attending their first year of cause of pharyngeal infections in humans. kindergarten was associated with a significant Shown to colonize the oral cavity and to be safe reduction in episodes of streptococcal pharyngi- for human use, BLIS K12 has previously been re- tis and acute otitis media. No protection against ported to reduce pharyngo-tonsillitis episodes in scarlet fever was detected. children or adults known to have experienced re- current streptococcal infection. The present Key Words: study was focussed upon evaluating the role of Paediatric infections, Pharyngo-tonsillitis, Scarlet BLIS K12 in the control of streptococcal disease fever, Acute otitis media, Blis K12, Bactoblis®. and acute otitis media in children attending the first year of kindergarten. PATIENTS AND METHODS: By randomization, 222 enrolled children attending the first year of kindergarten were divided into a treated group (N = 111) receiving for 6 months a daily treat- Introduction ment with BLIS K12 (Bactoblis®) and a control group (N = 111) who were monitored as untreat- Streptococcus salivarius K12 (hereafter BLIS ed controls. During the 6 months of treatment K12) is a probiotic strain shown to strongly in- and 3 months of follow-up, the children were hibit the in vitro growth of Streptococcus pyo- evaluated for treatment tolerance, and for genes, Streptococcus pneumonia, Haemophilus episodes of streptococcal pharyngo-tonsillitis, influenza, and Moraxella catarrhalis principal scarlet fever and acute otitis media. RESULTS: During the 6-month trial (N = 111 etiological agents respectively of bacterial 1,2 per group) the incidence of streptococcal pharyngo-tonsillitis and acute otitis media . This pharyngo-tonsillitis, scarlet fever and acute oti- antagonism seems to be due to the release of the tis media was approximately 16%, 9% and 44% lantibiotics salivaricin A2 and salivaricin B3. Af- respectively in the treated group and 48%, 4% ter oral administration, BLIS K12 colonizes the and 80% in the control group. During the 3- oral cavity, nasopharynx and adenoids4 persisting months follow-up (N = 29 per group) the corre- there for up to one month after the last dose5. It is sponding rates of infection were 15%, 0% and 6 12% in the treated group and 26%, 6% and 36% antibiotic-sensitive and has a thoroughly-investi- in the controls. No apparent side effects were gated safety profile7. From a clinical perspective, detected in the treated group either during treat- administration of BLIS K12 has been shown to
Corresponding Author: Francesco Di Pierro, Ph.D; e-mail [email protected] 4601 F. Di Pierro, M. Colombo, M.G. Giuliani, M.L. Danza, I. Basile, et al. reduce re-occurrences of streptococcal and viral Exclusion Criteria pharyngo-tonsillitis as well as acute and secreto- Children were excluded from the study if they ry otitis media8-12. A common denominator of were immunocompromised, had undergone ton- these previous studies has been the enrolment of sillectomy or had an indication for adeno-tonsil- subjects having a history of recurrent streptococ- lectomy. Other exclusion criteria included a his- cal, infection, with no less than three episodes tory of rheumatic disorders, bronchospasm per year as demonstrated by culture growth of and/or a diagnosis of asthma and/or allergy; a di- Streptococcus pyogenes. By contrast, in the pre- agnosed respiratory or significant systemic disor- sent study, we have evaluated whether BLIS K12 der. Also excluded were children who were either could provide protection for children who were undergoing current pharmacological therapies to attending their first year of kindergarten and who prevent recurrent respiratory infections or who had no recent history of recurrent streptococcal presented with conditions that could favour the pharyngo-tonsillitis or acute otitis media. development of acute otitis media, including se- vere atopy, acquired or congenital immunodefi- ciency, cleft palate, a chronically ruptured Patients and Methods eardrum, craniofacial abnormalities or obstruc- tive adenoids, sleep apnoea syndrome or place- Product ment of tympanostomy tubes. BLIS K12 was formulated as slowly-dissolv- ing oral tablets by SIIT (Trezzano S/N, Milan, Study Pattern Italy) and notified to the Italian Ministry of All individuals enrolled were first subjected to Health as Bactoblis® by Omeopiacenza (Pon- a general medical examination and pharyngeal tenure, Italy), according to the provisions of law swab (Test Strep-A, Gima, Gessate, Italy) and No 169 of 2004, on July 5th, 2011 (notification then were randomized by tossed coin in two number: 53435). The preparation Bactoblis® used groups: a treated group daily administered, for 6 in the clinical trial contained no less than 1 bil- months, with BLIS K12 in the form of Bactoblis® lion CFU/tablet of Streptococcus salivarius K12 tablets and an untreated group not receiving any (Blis Technologies Ltd., New Zealand). treatment and simply monitored as control group. The parents of the children in the BLIS K12 Clinical Trial group were instructed on how to use the product. This multicentre, open-label, randomized, con- The tablets were to be administered for 180 con- trolled clinical trial was conducted on 222 chil- secutive days. The children had to let one tablet dren (116 females and 106 males aged 33-45 dissolve slowly in the mouth immediately before months) enrolled in the area of Milan (Italy). The going to sleep, after brushing their teeth. The chil- children were treated (N = 111) or untreated (N = dren were to be carefully instructed not to chew 111), between September 2015 and March 2016 the tablets or to swallow them whole. Further- with Bactoblis®. Between April and July 2016 (N more, they should not drink or swallow anything = 29 per group) a 90-days follow-up was per- else just following the use of the product. For the formed. The trial was conducted according to the trial period, it was requested that at the first sign criteria set by the Declaration of Helsinki and of any oropharyngeal symptoms of infection the with the approval of the local (Milan, Italy) children should be brought to the clinic for an im- Ethics Committee. The parents of all the partici- mediate medical examination and pharyngeal pants in the study were informed of the trial swab test. In the case of a positive result, treat- methods and signed the appropriate consent and ment was prescribed. The prescribed therapy for privacy policy documents. streptococcal infection was a combination of amoxicillin and clavulanic acid to be adminis- Inclusion Criteria tered for 10 days. Following antibiotic therapy, At the time of enrolment, all of the children treatment with BLIS K12 was resumed and con- were around 3 years of age and were soon to at- tinued until the scheduled 180th day of the study. tend the first year of kindergarten. All partici- Infections accompanied by pharyngo-laryngeal pants were free of streptococcal disease, as estab- pain and/or a fever were treated with aceta- lished by a rapid throat swab test for group A minophen or ibuprofen. Diagnosis of scarlet streptococcus. None were clinically ill on enrol- fever13 and acute otitis14 media was done on the ment. basis of the microbial and clinical evidence and
4602 BLIS K12 in 3 years old children performed by trained investigators. Any other rolled and randomized into two groups of 111 pathologies possibly occurring during the study children, one of which was treated, and the other were treated according to the recommendations of not treated for 6-months by daily administration the Italian Paediatric guidelines. of Bactoblis® tablets to effect slow release into the oral cavity of the anti-streptococcal probiotic Study Aims strain BLIS K12. After this period some of the The present study aimed to evaluate the fol- children (N = 29 per group) continued to be lowing: (1) the onset of side effects or symptoms monitored for a further three months (follow-up). of toxicity while the product was being adminis- None of the enrolled children presented charac- tered; (2) the efficacy of BLIS K12 in the preven- teristics of streptococcal recurrence and/or were tion of Streptococcus pyogenes infections assessed as otitis media-prone. Compliance (pharyngo-tonsillitis and scarlet fever) during 6- throughout the 180 days of Bactoblis® treatment months of treatment and a 3-month follow-up pe- was assessed as very good; no side effects were riod; 3) the efficacy of BLIS K12 in reducing the reported and none of the children were with- occurrence of acute otitis media. drawn from the study (data not shown). Since, as shown in Table I, the two groups did not exhibit Statistical Analysis significantly different characteristics in terms of The equivalence of the two subject groups was age, sex, previous streptococcal or acute otitis determined using Fisher’s exact test and the two- media episodes, ethnicity, pneumococcal vac- tailed Wilcoxon-Mann-Whitney test respectively. cine, type of delivery, weight at birth, type of The difference in terms of numbers of streptococ- feeding, presence of older brothers and previous cal pharyngo-tonsillitis, scarlet fever and acute oti- attendance at nursery school, their backgrounds tis media episodes was determined using the two- were considered to be comparable. Table II tailed Wilcoxon-Mann-Whitney test. Statistical shows the number of children diagnosed with software used was JMP 10 for Mac OsX and the streptococcal pharyngo-tonsillitis, scarlet fever threshold for statistical significance was 95%. and acute otitis media during the 6-month treat- ment period. Eighteen of 111 (16.2%) of the treated group and 54 of 111 (48.6%) in the con- Results trol group were diagnosed with streptococcal throat infections. On the other hand, no statistical Children (N = 222) attending the first year of difference was found for episodes of scarlet fever kindergarten in the area of Milan (Italy) were en- (10 of the treated group versus 7 of the controls).
Table I. Features* of the children (222) enrolled and ending the study.
Treated Untreated
Total number 111 111 Males 50 56 Age of males (months ± SD) 36 ± 3.2 35 ± 3.0 Females 61 55 Age of females (months ± SD) 34 ± 3.0 35 ± 3.6 Previous streptococcal episodes 16 14 Previous AOM episodes 43 Italians 75 69 Arabs/Africans 30 33 Asians 69 Pneumococcal vaccine^ 9 10 Naturally delivered 72 75 Caesarean delivered 39 36 Weight at birth (kg ± SD) 3.2 ± 0.7 3.3 ± 0.8 Breastfed 39 42 With older brothers 51 56 Nursery attenders 45 51
*None of the features is significantly different between the two groups; ^PCV13; SD: standard deviation.
4603 F. Di Pierro, M. Colombo, M.G. Giuliani, M.L. Danza, I. Basile, et al.
Table II. Number of children with pharyngo-tonsillitis (PT), scarlet fever (SF) and acute otitis media (AOM) during the 6- months treatment period in the two study groups (N=111/group).
PT % SF % AOM %
Treated 18* 16.2 10 9.0 49* 44.1 Control 54 48.6 7 6.3 89 80.2
*p < 0.01 vs. control.
A diagnosis of acute otitis media was made for Table III. Total episodes of pharyngo-tonsillitis (PT) and ® acute otitis media (AOM) during the 6-months treatment pe- 49 (44.1%) of the 111 Bactoblis -treated chil- riod in the two study groups (N=111/group). Into brackets dren and this was significantly fewer than the 89 number of children with 1, 2 or 3 episodes. (80.2%) of 111 control group children having a positive diagnosis. Further analysis of the diag- PT AOM nosed episodes of streptococcal throat infection (1, 2, 3 episodes) (1, 2, 3 episodes) (Table III) shows that in the treated group 16 Treated 21* (16, 1, 1) 53* (46, 2, 1) children experienced a single infection, one child Control 67 (45, 5, 4) 101 (80, 6, 3) had two infections and another child had three episodes during the 6-month treatment period, *p < 0.01 vs. control. for a total of 21 episodes. By comparison, in the control group 67 streptococcal throat infections were diagnosed, with 45 children each having a was found for reported cases of acute otitis me- single episode, five with two episodes and four dia with 12 (41.3%) of the 29 children infected in children having three episodes. A similar situa- the control group. tion was observed for total episodes of acute oti- tis media: in the treated group 46 children had a single episode, two children each experienced Discussion two episodes and another child had three episodes giving a total of 53 episodes versus 101 Achieving oral health benefits from probiotic episodes in the control group, with 80 children therapy has recently become possible with the having one episode, six having two episodes and development of novel probiotics such as BLIS three with three episodes reported. During the 3- K12 selected from the oral cavity commensal month follow-up period (Table IV) five (17.2%) species Streptococcus salivarius. The BLIS K12 of the 29 children in the treated group experi- strain was originally isolated from the oral cavity enced streptococcal pharyngo-tonsillitis and four of a young child who had no recent experience of (13.8%) were reported to have single episodes of S. pyogenes infection. The lantibiotic bacteri- acute otitis media. None of these children devel- ocins produced by this strain have subsequently oped scarlet fever. No significant difference in been shown to be inhibitory not only to S. pyo- the occurrence of streptococcal infections during genes but also to other oral cavity bacterial the follow-up period was observed for the control pathogens associated with acute otitis media2 and group, with eight (27.6) of the 29 children expe- halitosis15,16. Previous investigations have demon- riencing infection and two cases of scarlet fever strated that the oral administration to healthy vol- reported. Nevertheless, a significant difference unteers of BLIS K12 reduces IL-8 plasma con-
Table IV. Number of children with pharyngo-tonsillitis (PT), scarlet fever (SF) and acute otitis media (AOM) during the 3- months follow-up in the two study groups (N=29/group).
PT % SF % AOM %
Treated 5 17.2 004* 13.8 Control 8 27.6 2 6.9 12 41.3
*p < 0.051 vs. control.
4604 BLIS K12 in 3 years old children
2 centrations and increases salivary γ-interferon. small number of subjects (29 per group), who ac- These modulations may also rationally account cepted to be monitored during the follow-up for the anti-inflammatory, immuno-modulating could have led to an absence of significant results and anti-viral activity recently observed by our in terms of episodes of streptococcal throat infec- group17,18. All of the clinical trials performed to tions. date on BLIS K12 have aimed to reduce strepto- coccal pharyngo-tonsillitis or acute otitis media episodes in subjects already having a clear histo- Conclusions ry of recurrent streptococcal disease or otitis me- dia. It has not however yet been established Limitations of the present study include the whether the prophylactic administration of BLIS absence of blind randomisation and a totally un- K12 can help provide a clinical benefit to indi- treated control group. Nevertheless, the results viduals not known to have a predilection to strep- appear to demonstrate for the first time that the tococcal infection or otitis media. The results of prophylactic administration of BLIS K12 could the current study provide some preliminary sup- generate positive clinical outcomes even in very port for this proposition. BLIS K12 prophylaxis young children who have not been pre-selected given to 3 years old children attending the first as recurrent streptococcal infection or acute otitis year of kindergarten and who did not yet seem to media-prone. Follow-up studies should be con- be either streptococcal pharyngitis or acute otitis ducted to establish whether BLIS K12 is for media prone, appeared to highlight a reduction in some reason specifically non-protective against episodes of both of these infections, the treated development of scarlet fever. These studies children being protected by about 60% and 50% should include in vitro tests of the action of BLIS respectively by comparison with the children in K12 against scarlet fever toxin-positive and -neg- the control group. ative strains of Streptococcus pyogenes and also Also, the consideration of subjects who expe- a double-blind, placebo-controlled trial contain- rienced infection recurrences appears to show a ing a large number of young scarlet fever vulner- beneficial effect from the use of BLIS K12. In- able subjects. deed, only two subjects of the treated group ver- sus nine of the controls were found to have recur- rent streptococcal throat infections. Also, only –––––––––––––––––-–––– three of the treated group had recurrences of Conflict of Interest acute otitis media by comparison with nine of the FDP is the main formulator of the tested product and he is control subjects. Perhaps anomalously the BLIS involved in the Scientific Council of the Company (Omeopi- acenza®) trading the tested product. The other authors do not K12 treatment did not seem to create any benefit report any conflict of interest. in terms of prevention of scarlet fever episodes. Although this pathology occurs as a result of Streptococcus pyogenes infection, its main char- acteristic, skin rash, is due to the release of ery- References throgenic toxins19 that the bacterium produces when is infected by a specific phage20. One pos- 1) WESCOMBE PA, BURTON JP, CADIEUX PA, KLESSE NA, sible hypothesis is that Streptococcus salivarius HYINK O, HENG NC, CHILCOTT CN, REID G, TAGG JR. Megaplasmids encode differing combinations of K12 more effectively antagonizes the replication lantibiotics in Streptococcus salivarius. Antonie of Streptococcus pyogenes strains that are not Van Leeuwenhoek 2006; 90: 269-280. phage-infected. Another possible theory is that 2) WESCOMBE PA, HALE JD, HENG NC, TAGG JR. Devel- although strain K12 may have killed the phage- oping oral probiotics from Streptococcus salivar- infected streptococci, the latter may still have re- ius. Future Microbiol 2012; 7: 1355-1371. leased rash-inducing concentrations of toxins in- 3) HYINK O, WESCOMBE PA, UPTON M, RAGLAND N, BUR- to the throat tissues. The prophylactic role TON JP, TAGG. Salivaricin A2 and the novel lantibiot- against streptococcal throat infections and ic salivaricin B are encoded at adjacent loci on a 190-kilobase transmissible megaplasmid in the episodes of otitis media played by BLIS K12 oral probiotic strain Streptococcus salivarius K12. during the 6-month treatment period seems also Appl Environ Microbiol 2007; 73: 1107-1113. to have been maintained for acute otitis media 4) POWER DA, BURTON JP, CHILCOTT CN, DAWES PJ, TAGG during the 3-month washout period. Even in this JR. Preliminary investigations of the colonisation case, there is a possible bias, since the relatively of upper respiratory tract tissues of infants using
4605 F. Di Pierro, M. Colombo, M.G. Giuliani, M.L. Danza, I. Basile, et al.
a paediatric formulation of the oral probiotic 12) DI PIERRO F, COLOMBO M, ZANVIT A, RISSO P, ROTTOLI Streptococcus salivarius K12. Eur J Clin Microbiol AS. Use of Streptococcus salivarius K12 in the Infect Dis 2008; 27: 1261-1263. prevention of streptococcal and viral pharyngo- 5) HORZ HP, MEINELT A, HOUBEN B, CONRADS G. Distribu- tonsillitis in children. Drug Healthc Patient Saf tion and persistence of probiotic Streptococcus sali- 2014; 6: 15-20. varius K12 in the human oral cavity as determined 13) WESSELS MR. Pharyngitis and Scarlet Fever. In: Fer- by real-time quantitative polymerase chain reaction. retti JJ, Stevens DL, Fischetti VA, editors. Strepto- Oral Microbiol Immunol 2007; 22: 126-130. coccus pyogenes: Basic Biology to Clinical Mani- 6) BURTON JP, WESCOMBE PA, MOORE CJ, CHILCOTT CN, festations. Oklahoma City (OK): University of Ok- TAGG JR. Safety assessment of the oral cavity pro- lahoma Health Sciences Center, 2016. biotic Streptococcus salivarius K12. Appl Environ 14) LIEBERTHAL AS, CARROLL AE, CHONMAITREE T, GANIATS Microbiol 2006; 72: 3050-3053. TG,HOBERMAN A,JACKSON MA,JOFFE MD,MILLER DT, ROSENFELD RM, SEVILLA XD. The diagnosis and 7) BURTON JP, COWLEY S,SIMON RR,MCKINNEY J, management of acute otitis media. Pediatrics WESCOMBE PA, TAGG JR. Evaluation of safety and human tolerance of the oral probiotic Streptococ- 2013; 131: e964-999. cus salivarius K12: a randomized, placebo-con- 15) BURTON JP, CHILCOTT CN,MOORE CJ,SPEISER G, trolled, double-blind study. Food Chem Toxicol TAGG JR. A preliminary study of the effect of pro- 2011; 49: 2356-2364. biotic Streptococcus salivarius K12 on oral mal- odour parameters. J Appl Microbiol 2006; 100: 8) DI PIERRO F, ADAMI T, RAPACIOLI G, GIARDINI N, STREIT- 754-764. BERGER C. Clinical evaluation of the oral probiotic Streptococcus salivarius K12 in the prevention of 16) MASDEA L, KULIK EM, HAUSER-GERSPACH I, RAMSEIER AM, recurrent pharyngitis and/or tonsillitis caused by FILIPPI A, WALTIMO T. Antimicrobial activity of Strepto- Streptococcus pyogenes in adults. Expert Opin coccus salivarius K12 on bacteria involved in oral Biol Ther 2013; 13: 339-343. malodour. Arch Oral Biol 2012; 57: 1041-1047. 9) DI PIERRO F, DONATO G, FOMIA F, ADAMI T, CAREDDU 17) DI PIERRO F, CAMPANA A,PANATTA ML,ANTENUCCI V, D,CASSANDRO C,ALBERA R. Preliminary pediatric DE VINCENTIIS G. Possible use of Streptococcus clinical evaluation of the oral probiotic Streptococ- salivarius K12 in counteracting PFAPA Syn- cus salivarius K12 in preventing recurrent pharyn- drome. Ped Intern. Alter Integr Med 2016. Sub- gitis and/or tonsillitis caused by Streptococcus mitted. pyogenes and recurrent acute otitis media. Int J 18) DI PIERRO F, COLOMBO M, ZANVIT A, ROTTOLI AS. Posi- Gen Med 2012; 5: 991-997. tive clinical outcomes derived from using Strepto- 10) GREGORI G, RIGHI O, RISSO P, BOIARDI G, DEMURU G, coccus salivarius K12 to prevent streptococcal FERZETTI A, GALLI A, GHISONI M, LENZINI S, MARENGHI pharyngo-tonsillitis in children. Drug, Healthcare C,MURA C,SACCHETTI R,SUZZANI L. Reduction of Pat Saf. Submitted July 2016. group A beta-hemolytic streptococcus pharyngo- 19) RALPH AP, CARAPETIS JR. Group A streptococcal dis- tonsillar infections associated with use of the oral eases and their global burden. Curr Top Microbiol probiotic Streptococcus salivarius K12: a retro- Immunol 2013; 368: 1-27. spective observational study. Ther Clin Risk Man- 20) SMITH NL,TAYLOR EJ,LINDSAY AM,CHARNOCK SJ, ag 2016; 12: 87-92. TURKENBURG JP, DODSON EJ,DAVIES GJ,BLACK GW. 11) DI PIERRO F, DI PASQUALE D, DI CICCO M. Oral use of Structure of a group A streptococcal phage-en- Streptococcus salivarius K12 in children with secre- coded virulence factor reveals a catalytically ac- tory otitis media: preliminary results of a pilot, un- tive triple-stranded beta-helix. Proc Natl Acad Sci controlled study. Int J Gen Med 2015; 8: 303-308. U S A 2005; 102: 17652-17657.
4606 Journal name: Drug, Healthcare and Patient Safety Article Designation: ORIGINAL RESEARCH Year: 2016 Volume: 8 Drug, Healthcare and Patient Safety Dovepress Running head verso: Di Pierro et al Running head recto: Clinical outcomes derived from using K12 in children open access to scientific and medical research DOI: http://dx.doi.org/10.2147/DHPS.S117214
Open Access Full Text Article ORIGINAL RESEARCH Positive clinical outcomes derived from using Streptococcus salivarius K12 to prevent streptococcal pharyngotonsillitis in children: a pilot investigation
Francesco Di Pierro1 Background: Streptococcus salivarius K12 (BLIS K12®) is a probiotic strain producing the Maria Colombo2 bacteriocins salivaricin A2 and salivaricin B, both of which strongly antagonize the growth of Alberto Zanvit3 Streptococcus pyogenes, the most important bacterial cause of pharyngeal infections in humans. It Amilcare S Rottoli4 successfully colonizes and exhibits persistence in the oral cavity and is endowed with an excellent safety profile. Previous observations of a small group of children indicated that the use of BLIS 1Scientific Department, Velleja Research, Milan, 2Pediatric K12 could also reduce the occurrence of viral pharyngitis. The present study focused on a further Department, University of Parma, evaluation of the role of BLIS K12 in the control of pediatric streptococcal disease and moreover 3 Parma, Stomatology Institute, whether its use could also help provide protection against various nonstreptococcal infections. 4Pediatric Department, Uboldo Hospital, Cernusco S/N, Milan, Italy Methods: In total, 48 children with a recent history of recurrent pharyngeal streptococcal disease were enrolled in the treated group. The control group comprised 76 children known to have had a very low recent occurrence of oral streptococcal disease. The treated children were given BLIS K12 daily for 90 days. The number of episodes of streptococcal pharyngotonsillitis, tracheitis, viral pharyngitis, rhinitis, flu, laryngitis, acute otitis media, enteritis, and stomatitis was recorded during probiotic treatment and for a follow-up period of 9 months, and this was compared with the episodes of the control group over the corresponding period. Results: Compared with the pretreatment time period, 2013, a 90% reduction of streptococcal pharyngeal disease was observed in 2014; compared with untreated children, a statistically significant reduction of all of the other disease conditions assessed, other than stomatitis, was detected in the probiotic-treated children. Conclusion: In agreement with previous findings, in the present study, it was found that the daily use of BLIS K12 has been associated with a concurrent and persisting reduction in the occurrence of pharyngeal, recurrent, streptococcal disease. Moreover, the benefits to children may also extend to a reduction of nonstreptococcal diseases, including tracheitis, viral pharyn- gitis, rhinitis, flu, laryngitis, acute otitis media, and enteritis. Keywords: Streptococcus salivarius K12, pediatric infections, pharyngotonsillitis, rhinitis, flu, tracheitis, laryngitis, stomatitis, enteritis, otitis
Introduction The oral probiotic Streptococcus salivarius strain K12 (also referred to here as BLIS K12®) is known to produce the megaplasmid-encoded class I lantibiotics, salivaricin Correspondence: Francesco Di Pierro A2, and salivaricin B.1 Expression of these two salivaricins enables BLIS K12 to coun- Scientific Department, Velleja Research, Viale Lunigiana 23, 20125 Milano, Italy teract the growth of Streptococcus pyogenes2 and, also to a lesser extent, Haemopilus Tel +39 349 552 7663 influenzae, Streptococcus pneumoniae, and Moraxella catarrhalis, all of which are Fax + 39 0523 511894 Email [email protected] involved in the etiopathogenesis of acute otitis media.3 BLIS K12 colonizes the oral submit your manuscript | www.dovepress.com Drug, Healthcare and Patient Safety 2016:8 77–81 77 Dovepress © 2016 Di Pierro et al. This work is published and licensed by Dove Medical Press Limited. The full terms of this license are available at https://www.dovepress.com/terms. php and incorporate the Creative Commons Attribution – Non Commercial (unported, v3.0) License (http://creativecommons.org/licenses/by-nc/3.0/). By accessing the work http://dx.doi.org/10.2147/DHPS.S117214 you hereby accept the Terms. Non-commercial uses of the work are permitted without any further permission from Dove Medical Press Limited, provided the work is properly attributed. For permission for commercial use of this work, please see paragraphs 4.2 and 5 of our Terms (https://www.dovepress.com/terms.php). Di Pierro et al Dovepress cavity and, to a lesser extent, the nasopharynx and adenoids,4 In terms of recurrent streptococcal pharyngotonsillitis, remaining present in the tissues for up to 1 month after the the individuals enrolled for treatment (n=48) exhibited an last administration.5 Characterized by excellent antibiotic average of >3 episodes in the previous year (2013). The epi- sensitivity6 and safety profiles7 and consistent with the known sodes were confirmed by a rapid swab positive for Group A activity spectrum of its salivaricin products, the regular use streptococcus (Test Strep-A; Gima, Gessate, Italy). None of of BLIS K12 has been shown to reduce reoccurrences of the individuals were clinically ill on enrolment. None of the streptococcal pharyngotonsillitis and acute otitis media.8–10 control group subjects had experienced recurrent streptococ- In addition, however, some preliminary studies have indi- cal pharyngotonsillitis in the previous year, and only 9 of the cated that BLIS K12 may also help prevent episodes of 76 children having single episode of streptococcal infection oropharyngeal infections of viral origin.11 A potential basis had been reported. for this effect has been shown, whereby the administration of BLIS K12 in adults can increase salivary γ-interferon levels Exclusion criteria without modifying the levels of either interleukin-1β (IL- Potential subjects were excluded from the study if they were 1β) or tumor necrosis factor-α (TNF-α), but considerably immunocompromised, had undergone tonsillectomy or had an reducing IL-8 release.3 In the present study, whether there indication for adenotonsillectomy, had a history of rheumatic is any associated reduction in the occurrence of episodes of disorders, bronchospasm and/or a diagnosis of asthma and/ tracheitis, viral pharyngitis, rhinitis, flu, laryngitis, acute otitis or allergy, had diagnosed respiratory or significant systemic media, enteritis, and stomatitis in children having a history of disorders, or were undergoing current pharmacological recurrent streptococcal pharyngotonsillitis who are receiving therapies to prevent recurrent respiratory infections. Also a 3-month course of BLIS K12 was evaluated. individuals presenting with conditions that could favor the development of acute otitis media, including severe atopy, Materials and methods acquired or congenital immunodeficiency, cleft palate, a Product chronically ruptured eardrum, craniofacial abnormalities or BLIS K12 was formulated in the form of slowly dissolving obstructive adenoids, sleep apnea syndrome, or placement oral tablets by SIIT (Trezzano S/N, Milan, Italy) and notified to of tympanostomy tubes, were excluded. the Italian Ministry of Health as Bactoblis® by Omeopiacenza (Pontenure, Italy), according to the provisions of law number Study pattern 169 of 2004, on July 5, 2011 (notification number: 53435). All the individuals enrolled in this study were first subjected The preparation strain K12 used in the clinical trial contained to a general medical examination and pharyngeal swab (Test >1 billion colony forming unit (CFU)/tablet of S. salivarius Strep-A) and then were subdivided, according to a previous K12 (BLIS Technologies Ltd., Otago, New Zealand). diagnosis of recurrent streptococcal pharyngotonsillitis, into two groups: one group was treated with BLIS K12 in the form Clinical trial of strain K12 tablets, whereas the other did not receive any The multicenter, open, nonrandomized, controlled clinical treatment and served as the control group. The individuals trial was conducted on 124 pediatric individuals enrolled in in the BLIS K12-treated group were instructed on how to the area of Milan (Italy) during 2014. The trial population use the product. The tablets were to be administered for 90 consisted of 65 boys and 59 girls. The first 90 days repre- consecutive days. The children had to let one tablet dissolve sented the treatment period. The following 9 months was slowly in the mouth immediately before going to sleep, after the follow-up period. The trial was conducted according to brushing their teeth. They were carefully instructed not to the criteria set by the Declaration of Helsinki and with the chew the tablet or to swallow it whole. They were asked not approval of the Local Ethics Committee (Milan, Italy). The to drink or swallow anything else following the use of the parents of all the participants in the study were informed product. Before administration of the first tablet, the use of a of the trial methods and signed the appropriate consent and 0.2% chlorhexidine mouthwash was recommended in order privacy policy documents. to enhance the colonization process of the strain, by reducing competition from endogenous S. salivarius already inhabiting Inclusion criteria the mouth. For the trial period, it was requested that at the first All the individuals enrolled in this study were of 3–10 years sign of any oropharyngeal symptoms of infection, the sub- of age and attended preschool or school in the Milan area. jects should be brought to the clinic for an immediate medical
78 submit your manuscript | www.dovepress.com Drug, Healthcare and Patient Safety 2016:8 Dovepress Dovepress Clinical outcomes derived from using K12 in children examination and pharyngeal rapid test. In case of a positive symptoms (eg, cough, nasal congestion, and sore throat). result, treatment was prescribed. The prescribed therapy for Virus isolation from throat swabs or sputum to identify the streptococcal infection was a combination of amoxicillin and causative agent is only recommended in carefully selected clavulanic acid to be administered for 10 days. Following the cases, and this was not done in the present study. Acute otitis antibiotic therapy, treatment with BLIS K12 was resumed media were diagnosed by pneumatic otoscopy performed by and continued until the scheduled 90th day of the study. Viral a trained investigator. infections accompanied by pharyngolaryngeal pain and/or a fever were treated with acetaminophen or ibuprofen. Any Aims of the study other pathologies present were treated according to the rec- The present study aimed to evaluate the following: 1) the ommendations of the Italian Pediatric Guidelines. efficacy of the BLIS K12-containing product strain K12 in the prevention of S. pyogenes pharyngotonsillitis in young Diagnosed pathologies children during 3 months of treatment and a further 9-month Diagnosis of viral infection was according to the follow- follow-up; 2) the efficacy of strain K12 in reducing tracheitis, ing criteria: negative rapid swab for streptococcal disease, viral pharyngitis, rhinitis, flu, laryngitis, acute otitis media, absence of submandibular lymphadenopathy, absence of enteritis, and stomatitis in these same subjects; and 3) the petechiae on the palate, mild dysphagia, absence of headache, onset of side effects or toxicity while the product was being absence of abdominal pain, and absence of hyperpyrexia. administered. From a clinical standpoint, patients with viral pharyngitis pre- sented with modest pharyngeal hyperemia, low-grade fever, Statistical analysis mild dysphagia, presence of rhinitis with serous secretion, The equivalence of the two subject groups in terms of sex and spontaneous resolution of symptoms without medication and age was determined by using Fisher’s exact test and the in ∼48–72 hours. With regard to enteritis, according to the two-tailed Wilcoxon–Mann–Whitney test, respectively. The Italian Pediatrics Guidelines, high fever (>40°C), live blood in difference between the two groups in terms of numbers of the stool, abdominal pain and involvement of the central ner- streptococcal pharyngotonsillitis, tracheitis, viral pharyngi- vous system may suggest the presence of pathogenic bacteria tis, rhinitis, flu, laryngitis, acute otitis media, enteritis, and in the gut. Differently, vomiting and respiratory symptoms are stomatitis episodes was determined by using the two-tailed more frequently associated with a viral etiology. Therefore, Wilcoxon–Mann–Whitney test. Statistical software JMP the diagnosis was clinical, and microbiological examination Version 10 for Mac OS X was used, and the threshold for of stool was indicated only if diarrhea is prolonged for >7–8 statistical significance was 95%. days or is relapsing. The diagnosis of stomatitis was also clinical and according to the presence of ulcerations local- Results ized preferentially in the fornix or in gingival–labial mucosa Forty-eight children having a diagnosis of recurrent strepto- of the lips. In all the cases, the etiology was considered to coccal pharyngotonsillitis were enrolled as subjects to assess be of herpetic origin, being further and more extensively the preventive role associated with daily use of slowly dis- investigated only in the case of patients who were severely solving oral tablets containing the oral probiotic S. salivarius debilitated. With regard to rhinitis, diagnosis was done on the K12 (>1 billion CFU/tablet), against S. pyogenes infection. basis of absence of mucoid nasal secretion, absence of fever, The children were treated with 1 tablet of strain K12 each absence adenomegaly, no signs of retropharyngeal exudate, day for 90 consecutive days and then continued to be moni- and symptoms resolution within 72 hours. Diagnosis of tored for a further 9 months. The other group of 76 children, tracheitis was done clinically in the presence of mild fever, not previously diagnosed with recurrent streptococcal pha- mild/moderate pharyngeal redness, no submandibular lymph- ryngotonsillitis, served as controls for the same periods. adenopathy, and crowing sound when inhaling. With regard Compliance assessed throughout the 90 days of strain K12 to laryngitis, diagnosis was done with moderate or no fever treatment was very good, and no child withdrew from the resolving within 72 hours, pharyngeal redness with negative study. As shown in Table 1, the two groups did not exhibit streptococcal rapid swab, and clear signs of dysphonia along significantly different characteristics. The only significant with dysphagia. Diagnosis of acute respiratory infection (flu) difference was in the diagnosis of recurrent streptococcal was also on a clinical basis with onset with fever, headache, pharyngotonsillitis, the distinctive feature of their enrolment malaise, and myalgia followed by predominantly respiratory in the treatment group. Table 2 shows the total episodes per
Drug, Healthcare and Patient Safety 2016:8 submit your manuscript | www.dovepress.com 79 Dovepress Di Pierro et al Dovepress
Table 1 Characteristicsa of the children enrolled and ending the Table 4 Episodes per child of tracheitis, viral pharyngitis, study rhinitis, flu, laryngitis, acute otitis media, enteritis and stomatitis Treated Untreated P-values highlighted in 2014 Total number 48 76 Treated Untreated P-values Odds ratio Boys 25 40 0.43 (95% CI) Age of boys 5.4±2.9 4.9±2.4 0.25 Tracheitis 0.08±0.29 1.17±1.00 <0.01 0.04 (0.01, 0.12) Girls 23 36 0.52 Pharyngitis (viral) 0.13±0.37 0.55±0.77 <0.01 0.19 (0.06, 0.52) Age of girls 5.6±2.0 5.1±2.4 0.37 Rhinitis 0.17±0.43 0.54±0.84 <0.05 0.36 (0.13, 0.96) b Episodes/child 3.208 0.118 0.0001 Flu 0.02±0.17 0.44±0.58 <0.01 0.04 (0.01, 0.19) Notes: aNonsignificant differences between groups; age expressed as years ± Laryngitis 0.02±0.17 0.28±0.55 <0.01 0.08 (0.01, 0.45) b standard deviation; parameter expressed with reference to 12 months of 2013. Acute otitis media 0.00±0.00 0.17±0.43 <0.01 0.01 (0.00, 0.24) Enteritis 0.05±0.24 0.30±0.56 <0.01 0.16 (0.03, 0.16) Table 2 Episodes of pharyngotonsillitis caused in 2013 and 2014 Stomatitis 0.00±0.00 0.08±0.30 ns 0.01 (0.00, 0.70) by Streptococcus pyogenes in the two study groups Abbreviations: CI, confidence interval; ns, no significant differences between 2013 A/Ca 2014 A/Ca ∆% P-values groups. Treated (n=48) 154 3.208 16 0.333 −89.6 <0.01 Control (n=76) 9 0.118 12 0.157 +33.3 ns the use of probiotic BLIS K12. Multivariate analysis (data not Note: aAverage/child. Abbreviation: ns, not significant. shown) demonstrates the absence of any dependency between these findings and sex and/or age variables. child of diagnosed streptococcal pharyngotonsillitis occur- ring during the study year 2014. When these findings are Discussion compared to those obtained in 2013, the treated children can Some intestinal probiotics have been shown to be capable of be found to have experienced ∼90% reduction in the diag- helping the consumer to counteract constipation, diarrhea, nosed streptococcal pharyngitis episodes. By comparison, in irritable bowel syndrome, and a number of other gastrointesti- the control group, a nonsignificant increase in streptococcal nal disorders.12 Recently, the development of novel probiotics infections of ∼30% was observed, when compared to 2013. such as BLIS K12 from the oral cavity commensal species S. As shown in Table 3, during 2013, the number of episodes salivarius has introduced the prospect of specifically achiev- of tracheitis, flu, acute otitis media, enteritis, and stomatitis ing oral health benefits from probiotic therapy. The BLIS K12 overlapped between the two groups. A difference was pres- strain was originally isolated from the oral cavity of a young ent only in the episodes of viral pharyngitis and rhinitis, the child who had no recent experience of S. pyogenes infection. incidences of which seemed to be higher and significant in The salivaricins produced by BLIS K12 have subsequently the treated group versus the control group. The differences been shown to be inhibitory not only to S. pyogenes but also observed for laryngitis did not seem to be statistically sig- to oral cavity bacterial pathogens associated with acute otitis nificant. As shown in Table 4, during 2014 when strain K12 media and halitosis. Some more recent studies demonstrated treatment was performed, the episodes per child of tracheitis, that oral administration of BLIS K12, through a still not per- viral pharyngitis, rhinitis, flu, laryngitis, acute otitis media, fectly understood molecular mechanism, also reduces IL-8 and enteritis, but not of stomatitis, seemed to be significantly plasma concentrations and increases salivary γ-interferon.3 lower, showing an apparent protective effect associated with These modulations may also rationally account for an anti- inflammatory, immunomodulating and anti-viral activity, Table 3 Episodes per child of tracheitis, viral pharyngitis, rhinitis, flu, laryngitis, acute otitis media, enteritis, and stomatitis which would augment the already-described beneficial highlighted in 2013 antibacterial action of BLIS K12. The results of the current Treated Untreated P-values study provide further support for this proposition. BLIS Tracheitis 1.35±1.35 1.14±1.36 ns K12 prophylaxis of children who appeared historically to Pharyngitis (viral) 1.40±1.61 0.71±1.40 <0.01 be at an increased risk of streptococcal pharyngitis reduced Rhinitis 1.60±1.61 0.87±1.23 <0.01 streptococcal infections by ∼90%, a finding consistent with Flu 0.15±0.40 0.33±0.61 ns those of previous studies but – and this is something new – Laryngitis ns 0.90±1.74 0.49±1.32 also demonstrated an apparent reduction of tracheitis, viral Acute otitis media 0.25±0.60 0.22±0.61 ns Enteritis 0.20±0.67 0.30±0.62 ns pharyngitis, rhinitis, flu, laryngitis, acute otitis media, and Stomatitis 0.08±0.29 0.11±0.40 ns enteritis. Only the incidence of stomatitis seemed unchanged Abbreviation: ns, no significant differences between the groups. in the treated group. This protection should not be due to a
80 submit your manuscript | www.dovepress.com Drug, Healthcare and Patient Safety 2016:8 Dovepress Dovepress Clinical outcomes derived from using K12 in children different use of antibiotics, vaccines, or immune stimulant References supplements or else occurred along the year of study, being 1. Hyink O, Wescombe PA, Upton M, Ragland N, Burton JP, Tagg JR. Sali- the two groups comparable in this perspective, too (data not varicin A2 and the novel lantibiotic salivaricin B are encoded at adjacent shown). Moreover, the slight difference in terms of antibi- loci on a 190-kilobase transmissible megaplasmid in the oral probiotic strain Streptococcus salivarius K12. Appl Environ Microbiol. 2007;73(4): otic administration linked to the episodes (average/child) of 1107–1113. pharyngeal streptococcal disease between the treated and the 2. Wescombe PA, Burton JP, Cadieux PA, et al. Megaplasmids encode dif- fering combinations of lantibiotics in Streptococcus salivarius. Antonie untreated group, 0.333 and 0.157, respectively (Table 2), is Van Leeuwenhoek. 2006;90(3):269–280. not significant. Last, children resulted to be protected mostly 3. Wescombe PA, Hale JD, Heng NC, Tagg JR. Developing oral probi- against viral diseases, where the use of antibiotics was not otics from Streptococcus salivarius. Future Microbiol. 2012;7(12): 1355–1371. effective. These results, together with the excellent tolerabil- 4. Power DA, Burton JP, Chilcott CN, Dawes PJ, Tagg JR. Preliminary ity and compliance found in this study, as well as the absence investigations of the colonisation of upper respiratory tract tissues of infants using a paediatric formulation of the oral probiotic Strep- of side effects, show that prophylactic BLIS K12 administra- tococcus salivarius K12. Eur J Clin Microbiol Infect Dis. 2008; tion could provide a safe, simple, and cost-effective preventa- 27(12):1261–1263. tive for a broad variety of pediatric infections and microbial 5. Horz HP, Meinelt A, Houben B, Conrads G. Distribution and persistence of probiotic Streptococcus salivarius K12 in the human oral cavity as dysequilibria. The authors recognize that this observational determined by real-time quantitative polymerase chain reaction. Oral study has less validity than a double-blind, controlled, pro- Microbiol Immunol. 2007;22(2):126–130. 6. Burton JP, Wescombe PA, Moore CJ, Chilcott CN, Tagg JR. Safety spective, and randomized investigation and also that it may assessment of the oral cavity probiotic Streptococcus salivarius K12. contain significant bias due to the relatively small number Appl Environ Microbiol. 2006;72(4):3050–3053. of treated subjects and the absence of a control, placebo, 7. Burton JP, Cowley S, Simon RR, McKinney J, Wescombe PA, Tagg JR. Evaluation of safety and human tolerance of the oral probiotic Strepto- or alternative probiotic treatment. In any case, the findings coccus salivarius K12: a randomized, placebo-controlled, double-blind of this study confirm the anti-streptococcal action of BLIS study. Food Chem Toxicol. 2011;49(9):2356–2364. 8. Di Pierro F, Adami T, Rapacioli G, Giardini N, Streitberger C. Clinical K12 and further demonstrate that its use can generate other evaluation of the oral probiotic Streptococcus salivarius K12 in the positive outcomes. Further studies are ongoing to highlight prevention of recurrent pharyngitis and/or tonsillitis caused by Strepto- why an oral colonizing probiotic strongly recognized as able coccus pyogenes in adults. Expert Opin Biol Ther. 2013;13(3):339–343. 9. Di Pierro F, Donato G, Fomia F, Adami T, Careddu D, Cassandro C, to antagonize streptococci and also to counteract pathologies Albera R. Preliminary pediatric clinical evaluation of the oral probiotic of viral etiology and/or disorders in nonoral tissues such as Streptococcus salivarius K12 in preventing recurrent pharyngitis and/or tonsillitis caused by Streptococcus pyogenes and recurrent acute otitis enteritis. media. Int J Gen Med. 2012;5:991–997. 10. Di Pierro F, Di Pasquale D, Di Cicco M. Oral use of Streptococcus salivarius K12 in children with secretory otitis media: preliminary Disclosure results of a pilot, uncontrolled study. Int J Gen Med. 2015;8:303–308. FDP is the main formulator of the tested product, and he is 11. Di Pierro F, Colombo M, Zanvit A, Risso P, Rottoli AS. Use of Strep- involved in the Scientific Council of the Company (Omeopia- tococcus salivarius K12 in the prevention of streptococcal and viral ® pharyngotonsillitis in children. Drug Healthc Patient Saf. 2014;6:15–20. cenza ) trading the tested product. The other authors report 12. Hod K, Ringel Y. Probiotics in functional bowel disorders. Best Pract no other conflicts of interest in this work. Res Clin Gastroenterol. 2016;30(1):89–97.
Drug, Healthcare and Patient Safety Dovepress Publish your work in this journal Drug, Healthcare and Patient Safety is an international, peer-reviewed post-marketing surveillance studies, risk management, health literacy open access journal exploring patient safety issues in the healthcare and educational programs across all areas of healthcare delivery. The continuum from diagnostic and screening interventions through to treat- manuscript management system is completely online and includes a very ment, drug therapy and surgery. The journal is characterized by the rapid quick and fair peer-review system. Visit http://www.dovepress.com/ reporting of reviews, original research, clinical, epidemiological and testimonials.php to read real quotes from published authors.
Submit your manuscript here: https://www.dovepress.com/drug-healthcare-and-patient-safety-journal
Drug, Healthcare and Patient Safety 2016:8 submit your manuscript | www.dovepress.com 81 Dovepress Journal name: Therapeutics and Clinical Risk Management Article Designation: Original Research Year: 2016 Volume: 12 erapeutics and Clinical Risk Management Dovepress Running head verso: Gregori et al Running head recto: Reduction of GABHS pharyngo-tonsillar infections open access to scientific and medical research DOI: http://dx.doi.org/10.2147/TCRM.S96134
Open Access Full Text Article OR IGINAL RESEARCH Reduction of group A beta-hemolytic streptococcus pharyngo-tonsillar infections associated with use of the oral probiotic Streptococcus salivarius K12: a retrospective observational study
Giuseppe Gregori1 Abstract: Recurrent pharyngo-tonsillar infections caused by group A beta-hemolytic streptococci Ornella Righi1 (GABHS) occur frequently in young children, and the treatment of these infections contributes Paolo Risso2 substantially to the total current requirement for antibiotic prescribing. Our study goal was to assess Goffreda Boiardi1 through a retrospective observational analysis whether the administration of the oral probiotic, Giovanni Demuru1 Streptococcus salivarius K12 (SsK12), could reduce the occurrence of GABHS pharyngo-tonsillar Anna Ferzetti1 infections in children who had a recent history of recurrent episodes of these infections. Twelve primary care pediatricians identified, through their databases, a total of 130 children who had experi- Antonio Galli1 enced recurrent GABHS pharyngo-tonsillar infections over a period of at least 6–12 months prior to Marco Ghisoni1 their inclusion in the study. Of these children, 76 then undertook a 90-day program requiring once- 1 Sonia Lenzini a-day dosing with a commercially available (Bactoblis) lozenge containing SsK12. No probiotic 1 Claudio Marenghi supplement was given to the remaining 54 (control) children. Each subject was monitored for the 1 Caterina Mura occurrence of GABHS pharyngo-tonsillitis and also for acute otitis media, bronchitis, sinusitis, and Roberto Sacchetti1 bronchopneumonia for at least 12 months following their entry to the study. Even 9 months after the Lucia Suzzani1 use of SsK12 had been stopped, the probability of new GABHS infections was significantly lower 1Primary Care Department, Local (P.0.001) when compared to the period before dosing commenced. When compared to the untreated Health Unit (ASL), Piacenza, children, those taking SsK12 appear to have had significantly fewer GABHS infections both during 2 Department of Health Science the 90-day period of prophylaxis and during the following 9 months (P,0.001). These observations (DISSAL), University of Genoa, Genoa, Italy are supportive of the use of probiotic SsK12 for the control of recurrent GABHS pharyngo-tonsillar infections in children, and as an associated benefit, the use of this probiotic could lead to reduced antibiotic consumption. Follow-up controlled prospective studies should now be initiated in order to further establish the efficacy of this newly emerging prophylactic strategy. Keywords: recurrent pharyngo-tonsillar infections, group A beta-hemolytic streptococcus, Streptococcus salivarius K12
Background Group A beta-hemolytic streptococci (GABHS) are a frequent cause of recurrent pharyngo-tonsillar infections (RPTIs) in young children, and this is associated with the further requirements for recurrent clinical examinations, pharmacological treatments, specialist consultations, and sometimes surgical intervention. Correspondence: Giuseppe Gregori Primary Care Department, Local Health In Italy, oral penicillin is not available, and penicillin G is only provided through Unit (ASL), Via Conciliazione 45/A, 29121 the National Health Service for patients with rheumatic disease. Therefore, amoxicillin Piacenza, Italy Email [email protected] is the drug of choice for treatment of single acute episodes of GABHS.1,2 submit your manuscript | www.dovepress.com Therapeutics and Clinical Risk Management 2016:12 87–92 87 Dovepress © 2016 Gregori et al. This work is published and licensed by Dove Medical Press Limited. The full terms of this license are available at https://www.dovepress.com/terms.php and incorporate the Creative Commons Attribution – Non Commercial (unported, v3.0) License (http://creativecommons.org/licenses/by-nc/3.0/). By accessing the work you http://dx.doi.org/10.2147/TCRM.S96134 hereby accept the Terms. Non-commercial uses of the work are permitted without any further permission from Dove Medical Press Limited, provided the work is properly attributed. For permission for commercial use of this work, please see paragraphs 4.2 and 5 of our Terms (https://www.dovepress.com/terms.php). Gregori et al Dovepress
For those experiencing recurrent GABHS infections, Methods and selection of patients cycles of antibiotic therapy and tonsillectomy are given con- Twelve of the 33 primary care pediatricians of the LHU of sideration. Recently, an orally administered probiotic product Piacenza participated in the study. Each pediatrician collected (Bactoblis), based on Streptococcus salivarius K12 (SsK12), the retrospective data of patients ranging from 3 to 7 years of became available in Italy. SsK12, a normal inhabitant of the age who had received a diagnosis of GABHS RPTIs during human oral cavity, produces two bacteriocins, salivaricin A2 the period January 1, 2011 to December 31, 2013. and salivaricin B, both of which interfere with the growth of Since 2010, the primary care pediatricians of LHU have GABHS.3,4 Bacteriocins are antimicrobials having relatively used standardized clinical and microbiological criteria for the specific killing activity. Their action leads to suppression diagnosis of GABHS infections based on the McIsaac clinical of the growth of bacteria that are phylogenetically closely score6 and the rapid throat swab (RAD), as a requirement of related to the bacteriocin-producing strain. Unlike the classi- the ProBA (Project Children-Antibiotics) regional project.7 cal antibiotics used to treat infections, the action of bacterio- According to the McIsaac clinical score and flow chart, the cins does not extend to microbial species that are distanced diagnosis of GABHS infection could, in probability terms, phylogenetically from the producer strain. be excluded, confirmed, or remain questionable: in the case As is often the case for nutraceutical products, reports of of a questionable clinical score, the availability of RAD its efficacy are still quite limited.5 enables a diagnosis to be made with reduced error rates.8 The product is provided as tablets to be sucked slowly Therefore, the following definitions were adopted for the in the evening before bedtime with a recommended dosing present study. program of one tablet daily for 90 days. We asked the primary care pediatricians of the Local Definition of pharyngo tonsillar infection Health Unit (LHU) of Piacenza to analyze their databases McIsaac score with clinical score $2 (adenopathy, retrospectively for children experiencing GABHS RPTIs, fever .38°C, absence of cough, pharyngo-tonsillar exudate, and then to compare the subsequent clinical sequelae in the age, season) + confirmation of GABHS presence with RAD children who had been treated with the recommended pro- method or McIsaac score =5. gram of SsK12 with those who had not taken this product. The primary objective of the study was to assess retro- Definition of R I spectively if SsK12 use in pediatric patients with GABHS RPTI is defined as three or more episodes of pharyngo- RPTIs could: tonsillitis over a period of 6 months, or four or more episodes (a) significantly reduce the occurrence of GABHS relapses over a period of 12 months. during the treatment period itself and over the following For each patient, a form was completed listing infec- 9 months, when compared to the 6- to 12-month tious events observed over the 12 months following his/her period immediately prior to the start of their probiotic RPTI diagnosis, and/or any antibiotic therapy used. Patients treatment; and diagnosed as having RPTIs who then received a standard (b) significantly reduce the occurrence of GABHS relapses 3-month treatment with SsK12 were then observed for a fur- during the treatment period and over the following ther 9 months so that all patients in the study were monitored 9 months, when compared with a control group of children for at least 12 months after RPTI diagnosis. experiencing GABHS RPTIs but nontreated with SsK12. A secondary study objective was to assess whether the Administration of SsK12 subjects treated with SsK12 had experienced any significant SsK12 was administered as tablets sucked slowly in the differences in the occurrence of bronchitis, otitis, sinusitis, evening just before bedtime, one tablet each day for 90 days. or bronchopneumonia. Every tablet (Bactoblis commercial lozenges) contains one billion units forming colonies of SsK12/dose (based on the Materials and methods product expiry date). This study was performed according to the criteria contained in the Declaration of Helsinki and was approved by the Eth- Statistical analysis ics Committee of the Local Health Authority of Piacenza. For a suitable statistical assessment, it was necessary to have A written consent was obtained from parents of children a sample size of at least 100 cases of RPTIs. Nonparametric enrolled in the study. tests were used. To compare the results of the 12-month
88 submit your manuscript | www.dovepress.com Therapeutics and Clinical Risk Management 2016:12 Dovepress Dovepress Reduction of GABHS pharyngo-tonsillar infections observations of the two groups of patients with RPTIs Discussion (ie, those first treated for 3 months with SsK12 vs those GABHS pharyngo-tonsillitis is one of the most frequently not treated with SsK12), Fisher’s exact test was used for occurring infectious diseases in the pediatric age. Although contingency analysis, while the Mann–Whitney test was RPTIs are a well-recognized problem in geographical applied for ordinal variables analysis. areas such as the North of Italy, there are relatively little epidemiological data on this topic. Cardiac and rheumatic Results complications, although still present in developing countries, Included in the present study were 130 children who were have been greatly reduced in recent decades in most western established to be affected by RPTIs and whose clinical countries, and so their prevention is no longer the primary records could be followed up for a subsequent period of goal of pharyngo-tonsillitis therapy.9 Appropriate antibiotic 12 months: 76 children were first treated for 90 days with therapy typically effects a rapid healing of acute pharyngo- SsK12, while 54 did not receive SsK12 and were considered tonsillitis, and this, in practice, is the most pressing need for to be the control group. The group of treated children con- parents, as a consequence of current social and economic sisted of 38 males, mean age 5.0±1.3 years, and 38 females, patterns differing from those of the past. mean age 4.9±1.6 years. The group of nontreated children The secondary prevention of GABHS RPTIs typically consisted of 25 males, mean age 5.3±1.7 years, and 29 focuses upon tonsillectomy as a therapeutic option, although females, mean age 5.3±1.5 years. The two groups had no this is less frequently applied than it was 20–30 years ago. statistically significant differences in age and sex. In Italy, the use of penicillin G has been gradually neglected The children treated with SsK12 had a significantly because of increased concern about the risk of adverse ana- lower number of pharyngo-tonsillar infections than in phylactic reactions, and it is not granted by National Health the period before treatment (P,0.001). Interestingly, Service, with a high cost per vial. At present, there are no the control group also experienced a significantly lower validated alternative pharmacological options for the second- occurrence of GABHS infections during the observation ary prevention of GABHS RPTIs. period of 1 year following RPTI diagnosis. However, the Studies of a group of school children in New Zealand10 reduction of infections obtained in the treated group was demonstrated that some of the children had bacteriocin- statistically higher in the SsK12-treated children (P,0.001) producing S. salivarius present in their saliva, which had strong (Table 1). inhibitory action against Streptococcus pyogenes. S. salivarius By comparison with the control group, the group of are known to be harmless, frequently occurring inhabitants of children treated with SsK12 experienced significantly fewer the human oral cavity, and one isolate, named SsK12, was GABHS infections both during the initial 90 days of inclu- shown to produce two bacteriocins, salivaricin A2 and salivari- sion in the study, during which the treatment group received cin B, both having strong inhibitory action against GABHS.3,4 SsK12 (nine relapses vs 42; P,0.001, odds ratio 0.03), and The ability of SsK12 to colonize the upper respiratory in the following 9 months (eleven relapses vs 39; P,0.001, tract when taken as a probiotic preparation in tablet form has odds ratio 0.07) (Tables 2 and 3). been established both in adults and in children.11,12 The pres- Multivaried analysis has also demonstrated the absence ence of SsK12 and of its released bacteriocins is detectable, of any dependency on sex and age variables. Regarding through use of bacterial culture analysis and polymerase documented episodes of acute otitis media, bronchitis, chain reaction methodologies for at least 32 days after its sinusitis, and bronchopneumonia, no significant differences last administration.12 were found between the group treated with SsK12 and the The safety profile of SsK12 has been assessed in several nontreated group. studies, and according to the Ministry of Health directives,
Table 1 Incidence of GABHS infections in treated group and control group with RPTIs before enrollment and in the next 12 months Monthly GABHS Monthly GABHS in Wilcoxon signed-rank frequency on enrollment the next 12 months test SsK12 group 0.38±0.08 0.03±0.07 Significant atP ,0.001 Control group 0.39±0.08 0.17±0.1 Significant atP ,0.001 Wilcoxon signed-rank test Not significant Significant atP ,0.001 Abbreviations: GABHS, group A beta-hemolytic streptococci; RPTIs, recurrent pharyngo-tonsillar infections; SsK12, Streptococcus salivarius K12.
Therapeutics and Clinical Risk Management 2016:12 submit your manuscript | www.dovepress.com 89 Dovepress Gregori et al Dovepress Odds ratio Odds ratio 0.03 (0.02 ± 0.11) 0.07 (0.03 ± 0.16) Number Media Number Media One-way mean Mann–Whitney nonparametric test Approach B Analysis with multiplicity SsK12 12 months 76 0.14 Control 12 months 54 0.88 P , 0.001 One-way mean Mann–Whitney nonparametric test Approach B Analysis with multiplicity SsK12 12 months 76 0.22 Control 12 monthsP , 0.001 54 1.1 No event Group 67 12 Events No event Group 1 or more events Analysis performed on the number of events with contingency analysis Fisher’s exact test Analysis without multiplicity Approach A Group SsK12 12 months 11 65 Control 12 months 39 15 P , 0.001 Analysis performed on the number of events with contingency analysis Fisher’s exact test Analysis without multiplicity Approach A Group SsK12 12 months 9 Control 12 months 42 P , 0.001 Streptococcus salivarius K12. Streptococcus salivarius K12. 2 or more events 2 or more events 9 2 23 16 6 3 36 6 Subjects 54 No event 1 event Subjects 54 No event 1 event GABHS, group A beta-hemolytic streptococci; SsK12, GABHS, group A beta-hemolytic streptococci; SsK12, Statistical analysis of GABHS infections in group treated with SsK12 and control during 90-day therapy Statistical analysis of GABHS infections in group treated with SsK12 and control during 9 months observation after therapy Group SsK12Control 76 Analysis performed on the number of events with contingency analysis Fisher’s exact test Abbreviations: Table 2 Group General data SsK12 12 months 67 Group SsK12Control 76 Analysis performed on the number of events with contingency analysis Fisher’s exact test Table 3 Abbreviations: Group General data Control 12 months 12 SsK12 12 months 65 P , 0.001 Control 12 months 15 P , 0.001
90 submit your manuscript | www.dovepress.com Therapeutics and Clinical Risk Management 2016:12 Dovepress Dovepress Reduction of GABHS pharyngo-tonsillar infections it is considered safe for human use in probiotic formulations randomized or placebo-controlled and also not blinded and intended to achieve oral colonization.13,14 with fewer children enrolled.5 Up to now, our study is the During our study, compliance rate assessed throughout one with the largest number of children enrolled. the 3-month period on SsK12 was very good: no child has stopped therapy earlier than established. Conclusion The present retrospective observational study has indi- On the basis of the results of this observational and retrospec- cated that the use of SsK12 has significantly reduced the tive study, it appears that oral preparations containing SsK12 occurrence of GABHS pharyngo-tonsillitis in a group of may provide a beneficial option for the prevention of pedi- children established to have GABHS RPTIs, by comparison atric GABHS RPTIs: their use may be particularly useful in to the occurrence of these infections both in this group of patients who would otherwise be forced to undergo frequent children in the period prior to their use of SsK12 and in a cycles of antibiotic therapy. Hopefully, further investigations control group of children characterized by the same clinical of this new approach to prophylaxis against GABHS infection history of RPTIs, but untreated with SsK12. will follow, also bearing in mind the ever-increasing need to Control group also showed reduced rate of GABHS reduce our antibiotic usage in patients of all ages in order to infections over a period of 12 months: this is more likely reduce the risk of antibiotic resistance development. due to immune competence that physiologically increases in childhood; nevertheless, there remained a very high statistical Author contributions difference when compared with group treated with SsK12. GG and OR designed the study and have made substantial Ours is a retrospective observational study, and hence, the contributions in drafting manuscript. PR performed statistical different number of subjects in the two groups. Anyway, we analysis. GB, GD, AF, AG, SL, CMa, and CMu performed are not concerned about the effects of numerical imbalance data acquisition and validation and contributed to interpreta- between the two groups because, according to Ruvuna,15 tion of data. MG and LS verified data analysis and revised we calculated the statistical impact on the power of our test the manuscript critically. All authors contributed toward data discovering it as minimal. analysis, drafting and critically revising the paper and agree According to our data, SsK12 assumption makes four to be accountable for all aspects of the work. times less likely the need for antibiotic therapy against GABHS infections providing the chance of reducing antibi- Disclosure The authors report no conflicts of interest in this work. otic pressure in the era of multi-resistant germs. It is recognized that this retrospective, observational study References has less validity than a double-blind, controlled, prospective, 1. Van Driel ML, De Sutter AIM, Keber N, Habraken H, Christiaens T. and randomized investigation and also that it may contain Different antibiotic treatments for group A streptococcal pharyngitis. Cochrane Database Syst Rev. 2013;(4):CD004406. significant bias: for example, no account has been taken 2. Spinks A, Glasziou PP, DelMar CB. Antibiotics for sore throat. Cochrane of poorly compliant subjects who may either have stopped Database Syst Rev. 2013;(11):CD000023. taking inconsistently used SsK12 during the recommended 3. Tagg JR. Streptococci as effector organism for probiotic and replacement therapy. In: Versalovic J, Wilson M, editors. Therapeutic Microbiology: 90-day course of treatment. Also, no account has been made Probiotics and Related Strategies. Washington, DC: ASM Press; 2008: of the use by the test or control subjects of any other nutri- 61–81. 4. Tagg JR, Dierksen KP. Bacterial replacement therapy: adapting ‘germ war- tional and/or probiotic products. Moreover, entry to the study fare’ to infection prevention. Trends Biotechnol. 2003;21(5):217–223. occurred in a voluntary way, and the criteria established by the 5. Di Pierro F, Donato G, Fornia F, et al. Preliminary pediatric clinical pediatricians for the recommendation for SsK12 use by each evaluation of the oral probiotic Streptococcus salivarius K12 in preventing recurrent pharyngitis and/or tonsillitis caused by Streptococcus pyogenes patient with an RPTI diagnosis were purely subjective. On the and recurrent acute otitis media. Int J Gen Med. 2012;5:991–997. other hand, the treatment and control groups were uniform 6. McIsaac WJ, Kellner JD, Aufricht P, Vanjaka A, Low DE. Empirical validation of guidelines for the management of pharyngitis in children for age and sex, and the diagnostic–therapeutic management and adults. JAMA. 2004;291(13):1587–1595. protocols for pharyngo-tonsillitis (ie, clinical assessment with 7. E-R Agenzia sanitaria e sociale regionale. Dossier n.153/2007 – Farin- McIsaac score and the use of RAD) have been well estab- gotonsillite in età pediatrica. Linea Guida regionale [update February 15, 2013]. Available from: http://assr.regione.emilia-romagna.it/it/servizi/ lished for all of the pediatricians participating in the study. pubblicazioni/dossier/doss153. Accessed March 24, 2015. Few studies are available about clinical evaluation of the oral 8. Di Mario S, Gagliotti C, Moro ML. Nuovelinee Guidafaringotonsil- lite – Regione Emilia – Romagna. June 2015. Available from: http://assr. probiotic SsK12 in preventing recurrent pharyngitis and/or regione.emilia-romagna.it/it/servizi/pubblicazioni/rapporti-documenti/ tonsillitis in childhood caused by S. pyogenes, all of them not faringotonsillite-guida-rapida-2015
Therapeutics and Clinical Risk Management 2016:12 submit your manuscript | www.dovepress.com 91 Dovepress Gregori et al Dovepress
9. National Institute for Health and Clinical Excellence. Centre for Clinical 12. Horz HP, Meinelt A, Houben B, Conrads G. Distribution and persistence Practice. Respiratory tract infections – antibiotic prescribing. Prescrib- of probiotic Streptococcus salivarius K12 in the human oral cavity as ing of antibiotics for selflimiting respiratory tract infections in adults determined by real-time quantitative polymerase chain reaction. Oral and children in primary care (Clinical guideline; no. 69). London, UK: Microbiol Immunol. 2007;22(2):126–130. NICE; 2008. 13. Burton JP, Wescombe PA, Moore CJ, Chilcott CN, Tagg JR. Safety 10. Tagg JR. Prevention of streptococcal pharyngitis by anti-Streptococcus assessment of the oral cavity probiotic Streptococcus salivarius K12. pyogenes bacteriocin-like inhibitory substances (BLIS) produced by Appl Environ Microbiol. 2006;72(4):3050–3053. Streptococcus salivarius. Indian J Med Res. 2004;119(Suppl):13–16. 14. Burton J, Chilcott C, Wescombe P, Tagg J. Extended safety data for the 11. Power DA, Burton JP, Chilcott CN, Dawes PJ, Tagg JR. Preliminary oral cavity probiotic Streptococcus salivarius K12. Probiot Antimicrob investigations of the colonization of upper respiratory tract tissues of Proteins. 2010;2:135–144. infants using a paediatric formulation of the oral probiotic Streptococ- 15. Ruvuna F. Unequal center sizes, sample size, and power in multicenter cus salivarius K12. Eur J Clin Microbiol Infect Dis. 2008;27(12): clinical trials. Drug Inf J. 2004;38(4):387–394. 1261–1263.
erapeutics and Clinical Risk Management Dovepress Publish your work in this journal Therapeutics and Clinical Risk Management is an international, peer- EMBase, Scopus and the Elsevier Bibliographic databases. The reviewed journal of clinical therapeutics and risk management, focusing manuscript management system is completely online and includes a on concise rapid reporting of clinical studies in all therapeutic areas, very quick and fair peer-review system, which is all easy to use. Visit outcomes, safety, and programs for the effective, safe, and sustained http://www.dovepress.com/testimonials.php to read real quotes from use of medicines. This journal is indexed on PubMed Central, CAS, published authors.
Submit your manuscript here: http://www.dovepress.com/therapeutics-and-clinical-risk-management-journal
92 submit your manuscript | www.dovepress.com Therapeutics and Clinical Risk Management 2016:12 Dovepress International Journal of General Medicine Dovepress open access to scientific and medical research
Open Access Full Text Article ORIGINAL R ESEARCH Oral use of Streptococcus salivarius K12 in children with secretory otitis media: preliminary results of a pilot, uncontrolled study
Francesco Di Pierro1 Abstract: Secretory otitis media (SOM) remains a common disease among children. Although Daniele Di Pasquale2 its cause is not yet perfectly established, the pathology, often a sequel of acute otitis media Maurizio Di Cicco2 (AOM), is mainly characterized by persistent fluid in the middle ear cavity. Twenty-two children with a diagnosis of SOM were treated daily for 90 days with an oral formulation containing 1Velleja Research, Milan, Italy; 2ORL ® Department, Ospedale Maggiore the oral probiotic Streptococcus salivarius K12 (Bactoblis ). After treatment, the children Policlinico Ca’ Grande IRCCS, were evaluated for AOM episodes and subjected to tone audiometry, tympanometry, endonasal Milan, Italy endoscopy, otoscopy, and tonsillar examination. Subject compliance and probiotic tolerability and side effects have also been evaluated. Our results indicate a good safety profile, a substantial reduction of AOM episodes, and a positive outcome from the treatment for all of the clinical outcomes tested. We conclude that strain K12 may have a role in reducing the occurrence and/or severity of SOM in children. From our perspective, this study constitutes a starting point toward the organization of a more extensive placebo-controlled study aimed at critically appraising our preliminary observations. Keywords: BLIS K12, Bactoblis®, acute otitis media, exudative otitis media
Introduction Otitis media is one of the most frequent problems that must be addressed by physicians dealing with pediatric patients. Approximately 80% of children have at least one episode of acute otitis media (AOM), and between 80% and 90% of preschool children have at least one episode of secretory otitis media (SOM).1,2 In AOM, bacterial pathogens such as Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, and Streptococcus pyogenes ascend through the eustachian tube from the nasopharynx to the middle ear, causing an inflammatory response.3 SOM, asymptomatic persistence of effusion in the middle ear cavity, is a possible sequel of AOM. SOM often resolves spontaneously but in some cases, especially when bilateral exudate persists for more than 3 months, the insertion of a tympanostomy tube may be required for drain- age to avoid hearing difficulties and/or chronic anatomical damage of the tympanic membrane.4 Antibiotics, decongestants, and corticosteroids fail to eliminate middle ear exudation and therefore are not recommended.5,6 It has been observed that otitis- prone children carry more bacterial pathogens in their nasopharyngeal microbiota and fewer potentially-interfering microorganisms such as alpha-hemolytic streptococci, nonhemolytic streptococci, Prevotella and Peptostreptococcus species.7,8 Some strains Correspondence: Francesco Di Pierro Velleja Research, Viale Lunigiana 23, of alpha-hemolytic streptococci depress the growth of pathogenic bacteria in vitro9 and 20125 Milan, Italy nasal spraying with alpha-hemolytic streptococci in otitis-prone children reduces the Tel +39 349 552 7663 Email [email protected] risk of recurrence of AOM and the development of SOM.10 Also, spray treatment with submit your manuscript | www.dovepress.com International Journal of General Medicine 2015:8 303–308 303 Dovepress © 2015 Di Pierro et al. This work is published by Dove Medical Press Limited, and licensed under Creative Commons Attribution – Non Commercial (unported, v3.0) License. The full terms of the License are available at http://creativecommons.org/licenses/by-nc/3.0/. Non-commercial uses of the work are permitted without any further http://dx.doi.org/10.2147/IJGM.S92488 permission from Dove Medical Press Limited, provided the work is properly attributed. Permissions beyond the scope of the License are administered by Dove Medical Press Limited. Information on how to request permission may be found at: http://www.dovepress.com/permissions.php Di Pierro et al Dovepress alpha-hemolytic streptococci in children with established Materials and methods SOM can diminish the amount of fluid in the middle ear, thus Subjects reducing hearing problems and rendering surgery unneces- Twenty-two children (3–9 years old) having a recent his- 11 sary in many cases. Many oral commensal streptococci tory of recurrent AOM and with unilateral or bilateral fluid have been recently investigated for their ability to interfere in the middle ear for at least 2 months were included in this with the growth of pathogens inhabiting the oral cavity and/ preliminary, uncontrolled study after informed consent was 12 or nasopharynx. Of these, the oral probiotic Streptococcus obtained from their parents. Exclusion criteria were severe salivarius K12 has been most thoroughly studied. Originally underlying disease, immune deficiency, heart disease or isolated from the throat of a New Zealand child, strain K12 congenital heart defects, sore mucosae, antibiotic use within produces two distinct megaplasmid-encoded lantibiotics, the last month, and upper respiratory tract infection in the named salivaricin A2 and salivaricin B, that inhibit the 10 days preceding the enrollment. growth of S. pyogenes, S. pneumoniae, and M. catarrhalis, all of which are involved in the pathogenesis of AOM and Study scheme bacterial pharyngotonsillitis in children and adults.13–17 Strain This pilot, uncontrolled study was conducted in the field of K12 typically colonizes the oral cavity of more than 30% of routine clinical practice in the area of Milan (Italy) between children after 3 days of administration, with clear coloniza- November 2013 and September 2014, in agreement with the tion of even the nasopharynx and adenoids detected for up to criteria set by the Declaration of Helsinki. As the product 32 days after the last administration.18,19 The K12 strain is also being tested is a nutraceutical, the approval from the ethical endowed with an excellent antibiotic-sensitivity profile and board was not required. The parents of all the participants high safety-assurance characteristics, as demonstrated in tests in the study were informed of the trial methods and signed in laboratory animals and humans.20,21 Recent clinical trials22–24 the consent and privacy policy documents giving the autho- conducted both in adults and children demonstrated that treat- rization to publish the results. The subjects were followed ment with the strain K12 reduces recurrences of bacterial for 2 months before entering the study. At the enrollment pharyngotonsillitis and AOM. The present preliminary and (T=0) and after 90 days, all the subjects underwent to physi- uncontrolled study, performed in children diagnosed with cal examination, pharyngeal buffer (Test Strep-A; Gima, recurrent AOM and also affected by asymptomatic SOM, was Gessate, Italy), bilateral tone audiometric testing, bilateral therefore designed first to evaluate the safety and tolerability tympanometry, bilateral otoscopy, endonasal endoscopy, profile of strain K12 when administered in children with and tonsillar examination (Figure 1). Every 15 days, for clear presence of a middle ear exudate, second to establish the whole duration of the study, all of the enrolled subjects the possible protective effect in terms of reduction of AOM were in contact with the physician responsible for the study recurrences, and third to follow the progression of SOM by to report their medical condition and specific study param- using tone audiometry, tympanometry, endonasal endoscopy, eters such as probiotic tolerability and dosing compliance otoscopy, and tonsillar examination. as well as to enable documentation of the occurrence of any
60 days of clinical observation 90 days of treatment with of the status of asymptomatic SOM Streptococcus salivarius K12
T=−60 T=−30 T=0 T=30 T=60 T=90
Enrollment Physical examination physical examination bilateral tone audiometric testing bilateral tone audiometric testing bilateral tympanometry bilateral tympanometry bilateral otoscopy bilateral otoscopy endonasal endoscopy endonasal endoscopy tonsillar examination tonsillar examination statistical analysis
Figure 1 Scheme of the study. Abbreviation: SOM, secretory otitis media.
304 submit your manuscript | www.dovepress.com International Journal of General Medicine 2015:8 Dovepress Dovepress Role of K12 in SOM side effects possibly linked to the treatment. The subjects described at T=0 corresponds to the one calculated according were also provided with the possibility of daily access to to the episodes occurred the previous 12 months. The value the physician responsible for the study. The treatment was of AOM incidence described at T=90 corresponds to the for 3 months from T=0 to T=90. All 22 enrolled subjects one calculated according to the episodes occurred during completed the study, and statistical analysis was performed the 90 days of treatment. on all subjects. Audiometry Tested product AM13 FreeQuency (Tecnomed) audiometer, TDH 39 S. salivarius K12, also known as BLIS K12 (BLIS Technolo- (Telephonics) headphones, and a soundproof booth (Mitaso) gies, Dunedin, New Zealand), was formulated as slowly- were used. Pure tone audiometry (air conduction) was per- dissolving oral tablets by SIIT (Trezzano, Milan, Italy) and formed at frequencies ranging from 250 to 8,000 Hz for notified as nutritional supplement to the Italian Ministry of the hearing threshold test. When necessary the bone route Health as Bactoblis® by Omeopiacenza (Pontenure, Italy), (frequencies of 250 to 4,000 Hz) was applied. The technique according to the provisions of law 169 of 2004, on July 5, used was sound-to-silence, and the threshold was considered 2011 (notification number 53435). The preparation of Bac- to be the lowest intensity at which the child responded 100% toblis® used in the clinical trial contained no less than 1 billion of the times to the presence of sound. To classify the degree, colony-forming units/tablet of S. salivarius K12. we used the mean tonal thresholds per airway at the frequen- cies of 250–2,000 Hz and values proposed by Northern and Treatment protocol Downs25 for children classifying as normal (score =0; up to Starting from T=0 to T=90, 1 tablet of Bactoblis® was 15 dB); mild transmissive hypoacusis (score =1; from 16 administered to each subject every night, just before sleep. to 70 dB); severe transmissive hypoacusis (score =2; when The tablet was allowed to slowly dissolve in the oral cavity, more than 71 dB). without biting or swallowing. Saliva production is typically reduced in the evening hours and this improves the effective- Tympanometry ness of oral colonization. Only for the very first treatment, A Zodiac 901 tympanometer (Madsen Electronics, Taastrup, the administration of the tablet was preceded, approximately Denmark) was used to assess the condition of the middle ear. 30 minutes before, by the use of a chlorhexidine-based (0.2%) The tympanogram was evaluated according to three types mouthwash. This procedure improves the efficacy of oral of conditions: type A (normal); type B (presence of middle colonization by BLIS K12 by creating bacteria-depleted ear exudate); type C (tubaric dysfunction). niches in the oral tissues. In order to evaluate the level of subject adherence to the established protocol, the subjects Otoscopy were asked to return any unused product boxes and tablets. The data obtained from otoscopy were categorized into Acceptable adherence was considered to be the administra- four grades of classification: normal tympanic membrane tion of not less than 95% of the allocated tablets. (score =0); matt-like tympanic membrane (score =1); matt- like and retracted tympanic membrane (score =2); and adher- Study objectives ent (glue-ear) tympanic membrane (score =3). The study aims were to evaluate: 1) the safety profile of S. salivarius K12 when administered for 90 days to children Endonasal endoscopy with a previous diagnosis of recurrent AOM and in presence Endonasal endoscopic examination was done using an of middle ear exudate for at least 2 months; 2) the capabil- Olympus pediatric fiberscope with a 2.2 mm flexible nasal ity of S. salivarius K12 to protect against AOM recurrence; endoscope. The other equipment used for assessing slow 3) to follow the possible evolution of SOM by using tone movements were video camera attached to the endoscope, audiometry, tympanometry, endonasal endoscopy, otoscopy, a colored television, and an image recorder. Data have been and tonsillar examination. evaluated as percentage of obstruction.
AOM incidence Tonsillar examination The incidence of AOM has been calculated as episodes of Tonsil volume was classified according to validated criteria26 AOM per month per child. The value of AOM incidence as follows: tonsils in the tonsillar fossa barely seen behind the
International Journal of General Medicine 2015:8 submit your manuscript | www.dovepress.com 305 Dovepress Di Pierro et al Dovepress anterior pillar (score =0); tonsils visible behind the anterior 40%. Eustachian tube obstructions due to adenoid vegetation pillar (score =1); hypertrophic tonsils extended three-quarters hypertrophy decreased by approximately 30%. Collectively, of the way to middle line (score =2); and tonsils completely the sizes of palatine tonsils were reduced by 40%, and only obstructing the airway, known as kissing tonsils (score =3). two cases of kissing tonsils were detected at T=90 by com- parison to ten cases at T=0 (data not shown). As shown in Statistical analysis Table 3, tympanometry was substantially improved, particu- The difference between the two groups of clinical variables, larly concerning the presence of middle ear exudate which pre- and posttreatment with S. salivarius K12, was deter- occurred at T=90 in only two cases, bilaterally. No relevant mined using the two-tailed Wilcoxon–Mann–Whitney test. differences were observed concerning tubaric dysfunction. Only for endonasal endoscopy, since it is a ratio variable, Finally, the probiotic treatment demonstrated a very good we transformed the data with arcsin function before applying safety profile with no treatment-related side effects occurring the Wilcoxon–Mann–Whitney test. The difference between and no subject drop out. As shown in Table 4, tolerability pre- and posttympanometry data was determined using the was assessed as “good” and “very good” in 20 of the 22 Fisher’s exact test. Statistical software used was JMP® 10 for subjects and overlapping results were obtained as regards Mac OS X (SAS Institute, Cary, NC, USA), and the threshold to compliance. for statistical significance was 95%. Discussion Results In a previous study, a nasal spray bacterial treatment was In our study, 22 children aged between 3 and 9 years were shown to reduce the development of SOM as a sequel to enrolled. At the end of the study, all were considered eligible AOM in otitis-prone children.10 In a later study, it was shown for statistical analysis, having completed the study according that a spray treatment with alpha-hemolytic streptococci led to the protocol. In Table 1, sex, age, weight, height, body to complete or almost complete resorption of middle ear mass index, and other clinical characteristics of the enrolled effusion in one-third of treated patients having long-standing subjects are reported. Among the 22 enrolled subjects, SOM.11 In our preliminary uncontrolled study, performed eight reported a history of allergy, 20 had been breastfed in children diagnosed with recurrent AOM and affected by for at least 4 months since delivery, and 20 had been vac- asymptomatic SOM, we have used the well-established probi- cinated with 13-valent pneumococcal conjugate vaccine. At otic strain S. salivarius K12. Strain K12 was administered to enrollment, four of the 22 subjects were swab-test positive children having well-documented middle ear exudate and/or but asymptomatic for S. pyogenes. The same four subjects rhinotubaric dysfunction. Our results demonstrate that strain were also swab-test positive and asymptomatic at the end K12: 1) is endowed with a good safety profile when used in of the study, indicating that they were healthy carriers. At otitis-prone children affected by asymptomatic SOM; 2) has the end of the study, no other subjects were swab-test posi- a protective effect against AOM recurrence; and 3) seems to tive for S. pyogenes. As shown in Table 2, the oral use of improve some of the clinical outcomes and features relevant S. salivarius K12 appears to have modified some clinically in children with SOM. Our study can be criticized for being relevant outcomes. AOM incidence, calculated as the number uncontrolled and for utilizing subjective clinical examination. of episodes per month per child, was reduced by approxi- Nevertheless, 1) this study principally proposed to reevaluate mately 40% during the 3 months of treatment as compared the already well-documented general safety profile of strain with the corresponding incidence calculated according to the K12, but now, specifically with respect to children with SOM; number of episodes that occurred in the previous year. Pure 2) this was the first time that strain K12 has been administered tone audiometry improved by more than 50% (left ear) and to evaluate its possible benefit in subjects experiencing middle 60% (right ear), and, otoscopy, bilaterally, by approximately ear asymptomatic exudate and/or tubaric dysfunction; 3) most
Table 1 Demographic characteristics of the enrolled subjects Sex Number Age (yr) Weight (kg) Height (m) BMI (kg/m2) Allergy Breastfed PCV13 SBEA Female 5 4.8±1.0 18.4±3.3 1.05±0.07 16.7±2.9 1 4 5 0 Male 17 5.8±2.2 24.2±6.3 1.14±0.11 18.5±2.8 7 16 15 4 Total 22 5.6±2.1 22.9±6.2 1.12±0.11 18.1±2.8 8 20 20 4 Abbreviations: BMI, body mass index; PCV13, 13-valent pneumococcal vaccine; SBEA, Streptococcus beta-hemolytic group-A (Streptococcus pyogenes); yr, year.
306 submit your manuscript | www.dovepress.com International Journal of General Medicine 2015:8 Dovepress Dovepress Role of K12 in SOM
Table 2 Clinical outcome in children with secretory otitis media Table 4 Tolerability, compliance, and side effects in children treated by oral route with Streptococcus salivarius K12 (N=22) with secretory otitis media treated for 90 days by oral route with Streptococcus salivarius K12 as reported by parents and T=0 T=90 Δ (%)a P established by clinician AOM incidenceb 0.40 0.23 42.5 ,0.01 Tone audiometry (right) 1.2±0.6 0.4±0.5 66 ,0.01 Tolerability Compliance Side effects Tone audiometry (left) 1.1±0.7 0.4±0.6 54.6 ,0.01 Very good N=13 N=16 None Otoscopy (right) 1.5±0.9 0.9±1.0 40 ,0.05 Good N=7 N=4 None Otoscopy (left) 1.3±0.8 0.8±0.3 38.5 ,0.05 Acceptable N=2 N=2 None Endonasal endoscopyc 70 50 28.6 ,0.01 Unacceptable N=0 N=0 None Tonsillar examination 1.9±1.1 1.2±0.8 36.8 ,0.01 Note: N = number of children. Notes: aT=90 versus T=0; bepisodes/month/child; creported as average value of the % of obstruction, statistical analysis has been performed by using arcsin value. Abbreviation: AOM, acute otitis media. K12 is able to reduce colonization by Candida in the oral mucosa and that this effect is not mediated by any type of children are not likely to improve spontaneously after having chemical interference.29 This could suggest that stimulation experienced chronic SOM. If the encouraging preliminary of antibacterial immune effector mechanisms, rather than (or results that we have obtained are confirmed in a subsequent in addition to) bacterial interference, might be responsible double-blind, placebo-controlled study, two hypothesis can for the observed clinical benefits. Both of these hypotheses be formulated. The first is that the oral treatment with strain should now be tested. Originally we also thought that a third K12 may have reduced populations of relevant pathogens in possible hypothesis could be drawn to explain the obtained the nasopharyngeal microbiota. Indeed, S. salivarius K12 has results. It could be that the children with a spontaneous, or been shown to be endowed with strong in vitro inhibitory activ- caused by the administration of the strain K12, improvement ity against S. pyogenes, S. pneumoniae, and M. catarrhalis. of the adenoid condition also had a clear improvement in Moreover, children with recurrent AOM seem to have a rela- terms of exudate presence in the middle ear. We have then tive absence of interfering commensal streptococci in their decided to statistically analyze the impact of the improvements nasopharyngeal flora.7,8 In this study, we did not establish observed by endonasal endoscopy to possibly correlate them whether alterations in the populations of pathogens occurred. with a parallel and proportional improvement in audiometry, Further trials should include this as an important endpoint. otoscopy, and tympanometry. Statistical results of this analysis The pathogenesis of SOM is still poorly understood. Analyzed (data not shown) demonstrated that no correlation like that exudates from children with SOM have demonstrated the pres- could be established. To conclude, our preliminary results ence of pathogens in approximately 35% of cases, by culture have reconfirmed the good safety profile of strain K12 and techniques, and in approximately 75% of cases, by polymerase also seem to indicate that oral treatment with the strain K12 in chain reaction.11,27 The presence of bacterial pathogens in the children with SOM could diminish the amount of fluid in the exudate could lead to inflammation. Indeed, high levels of middle ear and improve some possible hearing problems. This proinflammatory cytokines were found in exudates of children study has to be considered only a starting point to evaluating with SOM.28 S. salivarius K12 has been shown to lower IL-8, the role of strain K12 in children with AOM and/or SOM. a well-known proinflammatory cytokine, in the oral mucosa of colonized subjects.12 A possible second hypothesis is then Acknowledgments The authors wish to thank Dr Risso P for the statistical analy- that treatment with strain K12 might have stimulated innate sis of the results and Dr Tagg J for the kind suggestions and immunity, promoting the clearance of bacteria from the middle review of the paper. ear. As a support for this hypothesis, we know that S. salivarius Disclosure Table 3 Left and right tympanometry in children with secretory Di Pierro F is the Scientific Director of Velleja Research, otitis media treated by oral route with Streptococcus salivarius K12 the company that developed the finished product tested in Left T=0 T=90 P Right T=0 T=90 P this study. The authors report no other conflicts of interest A 6 14 ,0.05 A 7 13 ,0.05 in this work. B 9 2 ,0.05 B 10 2 ,0.05 C 7 6 ns C 5 7 ns References Notes: A = normal; B = presence of middle ear exudate; C = tubaric dysfunction. 1. Tos M. Epidemiology and natural history of secretory otitis. Am J Otol. Abbreviation: ns, not significant. 1984;5(6):459–462.
International Journal of General Medicine 2015:8 submit your manuscript | www.dovepress.com 307 Dovepress Di Pierro et al Dovepress
2. Burrows HL, Blackwood RA, Cooke JM, Cooke JM, Harrison RV, 16. Wescombe PA, Burton JP, Cadieux PA, et al. Megaplasmids encode Passamani PP; Otitis Media Guideline Team. University of Michigan differing combinations of lantibiotics in Streptococcus salivarius. Health System: Otitis Media Guideline 2013. Antonie Van Leeuwenhoek. 2006;90(3):269–280. 3. Loos BG, Bernstein JM, Dryja DM, Murphy TF, Dickinson DP. 17. van Zon A, van der Heijden GJ, van Dongen TM, Burton MJ, Determination of the epidemiology and transmission of non-typable Schilder AG. Antibiotics for otitis media with effusion in children. Haemophilus influenza in children with otitis media by comparison Cochrane Database Syst Rev. 2012;9:CD009163. of total genomic DNA restriction fingerprints. Infect Immun. 1989; 18. Power DA, Burton JP, Chilcott CN, Dawes PJ, Tagg JR. Preliminary 57(9):2751–2757. investigations of the colonisation of upper respiratory tract tissues 4. Rosenfeld RM, Schwartz SR, Pynnonen MA, et al. Clinical practice of infants using a paediatric formulation of the oral probiotic Strep- guideline: tympanostomy tubes in children. Otolaryngol Head Neck tococcus salivarius K12. Eur J Clin Microbiol Infect Dis. 2008; Surg. 2013;149(Suppl 1):S1–S35. 27(12):1261–1263. 5. Gluth MB, McDonald DR, Weaver AL, Bauch CD, Beatty CW, 19. Horz HP, Meinelt A, Houben B, Conrads G. Distribution and persistence Orvidas LJ. Management of eustachian tube dysfunction with nasal of probiotic Streptococcus salivarius K12 in the human oral cavity as steroid spray: a prospective, randomized, placebo-controlled trial. Arch determined by real-time quantitative polymerase chain reaction. Oral Otolaryngol Head Neck Surg. 2011;137(5):449–455. Microbiol Immunol. 2007;22(2):126–130. 6. American Academy of Family Physicians; American Academy of 20. Burton JP, Wescombe PA, Moore CJ, Chilcott CN, Tagg JR. Safety Otolaryngology-Head and Neck Surgery; American Academy of assessment of the oral cavity probiotic Streptococcus salivarius K12. Pediatrics Subcommittee on Otitis Media with Effusion. Otitis media Appl Environ Microbiol. 2006;72(4):3050–3053. with effusion. Pediatrics. 2004;113(5):1412–1429. 21. Burton JP, Cowley S, Simon RR, McKinney J, Wescombe PA, Tagg JR. 7. Brook I, Gober AE. In vitro bacterial interference in the nasopharynx Evaluation of safety and human tolerance of the oral probiotic Strepto- of otitis media-prone and non-otitis media-prone children. Arch Oto- coccus salivarius K12: a randomized, placebo-controlled, double-blind laryngol Head Neck Surg. 2000;126:1011–1013. study. Food Chem Toxicol. 2011;49(9):2356–2364. 8. Bernstein JM, Faden HF, Dryja DM, Wactawski-Wende J. 22. Di Pierro F, Adami T, Rapacioli G, Giardini N, Streitberger C. Clinical Micro-ecology of the nasopharyngeal bacterial flora in otitis-prone and evaluation of the oral probiotic Streptococcus salivarius K12 in the pre- non-otitis-prone children. Acta Otolaryngol. 1993;113:88–92. vention of recurrent pharyngitis and/or tonsillitis caused by Streptococ- 9. Tano K, Olofsson C, Grahn-Hakansson E, Holm SE. In vitro inhibi- cus pyogenes in adults. Expert Opin Biol Ther. 2013;13(3):339–343. tion of S. pneumoniae, non-typable H. influenzae and M. catarrhalis 23. Di Pierro F, Donato G, Fomia F, et al. Preliminary pediatric clinical by alpha-hemolytic streptococci from healthy children. Int J Pediatr evaluation of the oral probiotic Streptococcus salivarius K12 in pre- Otorhinolaryngol. 1999;47:49–56. venting recurrent pharyngitis and/or tonsillitis caused by Streptococcus 10. Roos K, Hakansson EG, Holm S. Effect of re-colonization with “inter- pyogenes and recurrent acute otitis media. Int J Gen Med. 2012;5: fering” alpha streptococci on recurrences of acute and secretory otitis 991–997. media in children: randomized placebo controlled trial. BMJ. 2001;322: 24. Di Pierro F, Colombo M, Zanvit A, Risso P, Rottoli AS. Use of Strepto- 210–212. coccus salivarius K12 in the prevention of streptococcal and viral phar- 11. Skovbjerg S, Roos K, Holm SE, et al. Spray bacteriotherapy decreases yngotonsillitis in children. Drug Healthc Patient Saf. 2014;6:15–20. middle ear fluid in children with secretory otitis media. Arch Dis Child. 25. Northern JL, Downs MP. Hearing in Children. 3rd ed. Philadelphia, PA: 2009;94(2):92–98. Williams and Wilkins; 1984. 12. Wescombe PA, Hale JD, Heng NC, Tagg JR. Developing oral probi- 26. Friedman M, Tanyeri H, La Rosa M, et al. Clinical predictors of obstruc- otics from Streptococcus salivarius. Future Microbiol. 2012;7(12): tive sleep apnea. Laryngoscope. 1999;109:1901–1907. 1355–1371. 27. Matar GM, Sidani N, Fayad M, Hadi U. Two-step PCR-based assay 13. Tagg JR. Prevention of streptococcal pharyngitis by anti-Streptococcus for identification of bacterial etiology of otitis media with effusion in pyogenes bacteriocin-like inhibitory substances (BLIS) produced by infected Lebanese children. J Clin Microbiol. 1998;36:1185–1188. Streptococcus salivarius. Indian J Med. 2004;119(Suppl):13–16. 28. Schousboe LP, Ovesen T, Eckhardt L, Rasmussen LM, Pedersen CB. 14. Hyink O, Wescombe PA, Upton M, Ragland N, Burton JP, Tagg JR. How does endotoxin trigger inflammation in otitis media with effusion? Salivaricin A2 and the novel lantibiotic salivaricin B are encoded at Laryngoscope. 2001;111(2):297–300. adjacent loci on a 190-kilobase transmissible megaplasmid in the oral 29. Ishijima SA, Hayama K, Burton JP, et al. Effect of Streptococcus probiotic strain Streptococcus salivarius K12. Appl Environ Microbiol. salivarius K12 on the in vitro growth of Candida albicans and its 2007;73(4):1107–1113. protective effect in an oral candidiasis model. Appl Environ Microbiol. 15. Sharma S, Verma KK. Skin and soft tissue infection. Indian J Pediatr. 2012;78(7):2190–2199. 2001;68(Suppl 3):S46–S50.
International Journal of General Medicine Dovepress Publish your work in this journal The International Journal of General Medicine is an international, A key focus is the elucidation of disease processes and management peer-reviewed open-access journal that focuses on general and internal protocols resulting in improved outcomes for the patient. The manu- medicine, pathogenesis, epidemiology, diagnosis, monitoring and treat- script management system is completely online and includes a very ment protocols. The journal is characterized by the rapid reporting of quick and fair peer-review system. Visit http://www.dovepress.com/ reviews, original research and clinical studies across all disease areas. testimonials.php to read real quotes from published authors.
Submit your manuscript here: http://www.dovepress.com/international-journal-of-general-medicine-journal
308 submit your manuscript | www.dovepress.com International Journal of General Medicine 2015:8 Dovepress Drug, Healthcare and Patient Safety Dovepress open access to scientific and medical research
Open Access Full Text Article ORIGINAL RES EARCH Use of Streptococcus salivarius K12 in the prevention of streptococcal and viral pharyngotonsillitis in children
AUTHOR1 Francesco Di Pierro Background: Streptococcus salivarius K12 is an oral probiotic strain releasing two lantibiotics Maria Colombo2 (salivaricin A2 and salivaricin B) that antagonize the growth of S. pyogenes, the most important Alberto Zanvit3 bacterial cause of pharyngeal infections in humans also affected by episodes of acute otitis media. Paolo Risso4 S. salivarius K12 successfully colonizes the oral cavity, and is endowed with an excellent safety Amilcare S Rottoli5 profile. We tested its preventive role in reducing the incidence of both streptococcal and viral pharyngitis and/or tonsillitis in children. 1Scientific Department, Velleja We enrolled 61 children with a diagnosis of recurrent oral strep- Research, Milan, 2Pediatric Materials and methods: Department, University of Parma, tococcal disorders. Thirty-one of them were enrolled to be treated daily for 90 days with a PROOFParma, 3Stomatology Institute, slow-release tablet for oral use, containing no less than 1 billion colony-forming units/tablet 4 Milan, Laboratory of Epidemiology ® and Social Psychiatry, Mario of S. salivarius K12 (Bactoblis ), and the remaining 30 served as the untreated control group. Negri Institute, Milan, 5Pediatric During treatment, they were all examined for streptococcal infection. Twenty children (ten per Department, Uboldo Hospital, group) were also assessed in terms of viral infection. Secondary end points in both groups were Cernusco sul Naviglio, Italy the number of days under antibiotic and antipyretic therapy and the number of days off school (children) and off work (parents). Results: The 30 children who completed the 90-day trial with Bactoblis® showed a significant reduction in their episodes of streptococcal pharyngeal infection (.90%), as calculated by COPYcomparing the infection rates of the previous year. No difference was observed in the control group. The treated group showed a significant decrease in the incidence (80%) of oral viral infections. Again, there was no difference in the control group. With regard to secondary end points, the number of days under antibiotic treatment of the treated and control groups were 30 and 900 respectively, days under antipyretic treatment 16 and 228, days of absence from school 16 and 228, and days of absence from work 16 and 228. The product was well tolerated by the subjects, with no side effects, and only one individual reported bad product palatability and dropped out. NotConclusion: for Prophylactic administration of S. salivarius K12 to children with a history of recurrent oral streptococcal disease resulted in a considerable reduction of episodes of both streptococcal and viral infections and reduced the number of days under antibiotic and/or anti- pyretic therapy and days of absence from school or work. Keywords: Blis K12, pediatric trial, Bactoblis, S. pyogenes, antibiotic therapy
Introduction Streptococcus salivarius K12 is a strain isolated from the throat of a New Zealand Correspondence: Francesco Di Pierro child,1 and capable of producing two distinct lantibiotics – salivaricin A2 and salivaricin Scientific Department,publication Velleja Research, 23 Viale Lunigiana, Milan 20125, Italy B – encoded on two adjacent loci on a 190-kilobase megaplasmid.2 Owing to these Tel +39 349 552 7663 two salivaricins, the K12 strain successfully counteracts the growth of S. pyogenes Fax +39 0523 511 894 Email [email protected] in vitro.3 In contrast the K12 P– strain (negative plasmid) is totally ineffective.4
submit your manuscript | www.dovepress.com Drug, Healthcare and Patient Safety 2014:6 1–6 1 Dovepress © 2014 Di Pierro et al. This work is published by Dove Medical Press Limited, and licensed under Creative Commons Attribution – Non Commercial (unported, v3.0) License. The full terms of the License are available at http://creativecommons.org/licenses/by-nc/3.0/. Non-commercial uses of the work are permitted without any further 59665 permission from Dove Medical Press Limited, provided the work is properly attributed. Permissions beyond the scope of the License are administered by Dove Medical Press Limited. Information on how to request permission may be found at: http://www.dovepress.com/permissions.php Di Pierro et al Dovepress
The K12 strain is not only effective against S. pyogenes but Materials and methods also inhibits the growth of such pathogens as Haemophilus The product influenzae, S. pneumoniae, and Moraxella catarrhalis, all The K12 strain was formulated in the form of slowly dis- of which are involved in the etiopathogenesis of acute otitis solving oral tablets by SIIT (Trezzano, Milan, Italy) and 5 media. The four pathogens are responsible for almost all notified to the Italian Ministry of Health as Bactoblis® by 6 bacterial pharyngotonsillitis cases in children and adults. Omeopiacenza (Pontenure, Italy), according to the provisions The results of K12 administration in children demonstrate of law 169 of 2004, on July 5, 2011 (notification number that the strain can colonize the oral cavity in some 30% of 53435). The preparation of Bactoblis® used in the clinical trial children as early as on the third administration day, with clear contained no less than 1 billion colony-forming units (CFU)/ 7 colonization even in the nasopharynx and adenoids, and tablet of S. salivarius K12 (BLIS Technologies, Dunedin, can remain in tissue for up to 32 days after the last admin- New Zealand). istration.8 The K12 strain is also endowed with an excellent antibiotic-sensitivity profile and high safety characteristics, The clinical trial 9 10 as demonstrated in tests in animals and humans. Recent The multicenter, open, nonrandomized, controlled clinical 11 12 clinical trials, conducted both in adults and children, trial was conducted on 61 pediatric individuals enrolled in demonstrated that treatment with the K12 strain reduces the area of Milan, Italy, and treated between January 31 and recurrences of bacterial pharyngotonsillitis by approxi- April 30, 2013. The trial population consisted of 32 males mately 80% and 90%, respectively. Even if a treatment over (53.4%) and 29 females (46.6%). The trial was conducted at least 90 days is followed by a 6-month washout period, according to the criteria set by the Declaration of Helsinki the protection rates against recurrence remain high (about and with the approval of the local ethics committee. The 60% in either case). Preliminary data indicate that treatment parents of all the participants in the study were informed of with the K12 strain also seems to reduce acute otitis media the trial methods and signed the consent and privacy-policy 12 recurrences by 40% in children. As the K12 strain can documents. also inhibit proliferation of Micrococcus luteus, S. angi- nosus, Eubacterium saburreum, and Micromonas micros, Inclusion criteria it has been successfully used in the treatment of halitosis All the enrolled individuals were 3–13 years of age and by eliminating volatile sulfur compounds in 14 days.13,14 A attended school in the Milan area. In terms of recurrent recent study highlighted the action of the K12 strain against pharyngotonsillitis, the enrolled individuals exhibited an Candida albicans, though in this case the authors did not average of not less than three episodes in the same quarter demonstrate a cytotoxic action referable to the release of as that of the study (January 31 to April 30) of the previous the two salivaricins (A2 and B), but reported a mechani- year (2012). The episodes were confirmed by a rapid swab cal antihyphae action.15 In addition to the aforementioned positive for group A and group B streptococci. None of the biological actions, the K12 strain also seems to possess individuals were affected by infectious diseases of any nature preventive properties against oropharyngeal infections of on enrolment. viral origin and gingivitis. This possibility seems to be confirmed by the fact that administration of the K12 strain Exclusion criteria in adults may increase salivary interferon- levels without The following exclusion criteria were used: immunocom- modifying the levels of either interleukin (IL)-1 or tumor promised individuals, individuals who had undergone necrosis factor- , but considerably reducing IL-8 release.5 tonsillectomy or with an indication for adenotonsillectomy, The incidence of pharyngotonsillitis is very high in children, individuals with rheumatic disorders, individuals with and is caused by bacteria in about 35% of cases (with 80% bronchospasm and/or a diagnosis of asthma and/or allergy, of these being caused by S. pyogenes) and by respiratory individuals with respiratory disorders or important systemic viruses in about 65% of cases.16,17 We resolved to verify disorders, and individuals undergoing therapies to prevent the prophylactic action of the K12 strain administered in any recurrent respiratory infections. children with a diagnosis of recurrent pharyngotonsillitis caused by -hemolytic streptococcus, while assessing the Study pattern aspects of potential prevention of either S. pyogenes infec- The individuals enrolled following their parents’ approval tions or possible viral infections. were first subjected to a general medical examination and
2 submit your manuscript | www.dovepress.com Drug, Healthcare and Patient Safety 2014:6 Dovepress Dovepress S. salivarius K12 for pharyngotonsillitis prevention pharyngeal buffer (Test Strep-A; Gima, Gessate, Italy) and toxicity while the product was being administered, and the then subdivided, according to a simple 1+1 enrolment key, compliance of the individuals. Secondary objectives were the into two groups: one group was treated with Bactoblis®, collection of information concerning resorting to antibiotic while the other did not receive any treatment and served as therapy, treatment with antipyretics, working days lost by the control group. The individuals of the Bactoblis® group parents, and days of absence from school (or preschool for were instructed on how to use the product. The product was children under 6 years of age). to be administered for 90 consecutive days. The children had to let it dissolve slowly in the mouth immediately before Statistical analysis going to sleep, after brushing their teeth. They were care- The equivalence of the two treatment groups in terms of fully instructed not to chew the product or swallow it whole. sex and age was determined using Fisher’s exact test and They were asked not to drink or swallow any substance fol- the two-tailed Wilcoxon–Mann–Whitney test, respectively. lowing the administration of the product. During the whole The difference between the two treatment groups in terms of trial period, the individuals were invited to come to the number of pharyngotonsillitis episodes was determined using clinic as soon as any oropharyngeal symptoms suggested the two-tailed Wilcoxon–Mann–Whitney test. Statistical soft- an infection. In this case, the individual was immediately ware used was JMP® 10 for Mac OS X (SAS Institute, Cary, subjected to a medical examination and pharyngeal buffer NC, USA), and the threshold for statistical significance was test. In the case of a positive result, treatment was prescribed 95%. The sample size was determined in the following way. to the individual. The prescribed therapy was antibiotics in We estimated the prevalence of pharyngotonsillitis episodes the case of streptococcal infection. The selected antibiotic in the untreated population to be 90% of the whole popula- in the study was the combination of amoxicillin and clavu- tion, while the application of the product could determine lanic acid to be administered for 10 days. At the end of the a reduction to 50%. For the hypothesis of 95% specificity prescribed antibiotic therapy, treatment with Bactoblis® was and 90% test power, in consideration of Fisher’s exact test, resumed and continued until the scheduled 90th day. In the the resulting sample size amounted to 58 units, to be equally case of a viral infection accompanied by pharyngolaryngeal divided into the two treatment branches. It was thus decided pain and/or a fever, treatment was based on acetaminophen to include at least 60 individuals to obtain the required sta- or ibuprofen. tistical effectiveness.
Diagnosis of viral infection Results Diagnosis of viral infection was done according to the fol- Sixty children with a diagnosis of recurrent pharyngotonsil- lowing criteria: negative rapid swab for streptococci, absence litis were enrolled to highlight the preventive role played by of submandibular lymphadenopathy, absence of petechiae on slowly dissolving oral tablets (Bactoblis®) containing a strain the palate, mild dysphagia, absence of headache, absence of S. salivarius K12 (no less than 1 billion CFU/tablet), of abdominal pain, and absence of hyperpyrexia. From a against -hemolytic streptococcal or viral pharyngotonsillitis. clinical standpoint, patients with viral pharyngitis presented Thirty children were treated with one tablet of product a day with modest pharyngeal hyperemia, low-grade fever, mild for 90 consecutive days. The other 30 children served as dysphagia, presence of rhinitis with serous secretion, and the control group in the same period. As shown in Table 1, spontaneous resolution of symptoms without medication in the two groups did not exhibit such important characteris- 48–72 hours. Differential diagnosis with mononucleosis, ie, tics as to make them significantly different. The statistical absence of adenomegaly, absence of splenomegaly, absence of plaque exudates on the tonsils, and absence of hyperpy- Table 1 Characteristics* of the children who completed the study rexia, was also made. Treated Untreated P-value Total number 30 30 Study objectives Males 19 13 0.20 The study aimed to verify the following parameters: the Age† of males 6.7±2.5 6.1±2.8 0.14 efficacy of Bactoblis® in the prevention of pharyngotonsil- Females 11 17 0.20 Age† of females 0.14 litis from group A S. pyogenes during the study period, the 5.7±1.9 5.2±1.8 Episodes/child‡ 3.1 3.0 0.70 efficacy of Bactoblis® in reducing viral pharyngotonsillar Notes: Nonsignificant differences between groups; †years ± standard deviation; infections in the same period, the onset of side effects or ‡for the quarter considered for enrolment (January 31–April 30, 2012).
Drug, Healthcare and Patient Safety 2014:6 submit your manuscript | www.dovepress.com 3 Dovepress Di Pierro et al Dovepress
equivalence in sex, age, and number of past episodes between Table 3 Rhino-pharyngotonsillar episodes of viral etiopathogenesis the treatment groups was verified using Fisher’s exact test in two subgroups of individuals (n=10/group) (P=0.20), the Wilcoxon–Mann–Whitney test (P=0.14), and Treatment 2012 A/C 2013 A/C Delta % the Wilcoxon–Mann–Whitney test (P=0.70), respectively. quarter quarter Table 2 shows the data on the prevalence of streptococcal Treated 25 2.5 5* 0.5 80 Control 28 2.8 24 2.4 14.3 pharyngotonsillitis episodes (diagnosed with a rapid pharyn- Note: *P,0.01 versus the 2012 quarter and versus the control group result geal swab). During the 90-day treatment in the 2013 quarter, relatable to the 2013 quarter. the 30 treated children who completed the study were affected Abbreviation: A/C, average/child. by three episodes of streptococcal etiology: pharyngotonsil- litis was diagnosed in two children and scarlet fever in a third and one with one episode). In the control group, with the child. These same 30 children had suffered from 94 episodes assessment being referred again to ten children, the 28 viral of oral streptococcal infection in the same quarter of the infections diagnosed in the quarter of 2012, with a prevalence previous year. The children in the control group, who had of 100%, were reduced to 24 in the corresponding quarter of suffered from 90 episodes of oral streptococcal infection in 2013 (prevalence 100%). Treatment with Bactoblis® reduced the same quarter of 2012, suffered from 84 episodes in the the incidence of viral oropharyngeal infections by 80% same quarter of 2013. Prophylaxis with Bactoblis® reduced (about 14% reduction observed in the control group). From the incidence of -hemolytic streptococcal infections by some a statistical perspective, in 2013 we observed a prevalence of 96% (about 7% reduction observed in the control group). viral episodes in the untreated group of 100%, while in the The statistical analysis also shows that in 2012, the two study treated one we observed viral infection only in 30%; by the groups did not exhibit statistically significant differences in hypothesis of 95% specificity, this leads to a test power of the onset of tonsillitis (Wilcoxon–Mann–Whitney P=0.16). 70%. Therefore these results are significant at P,0.01. The On the contrary, in 2013 the two groups were found to differ treatment (Table 4), referable only to the 30 children who had in a statistically significant manner with regard to the onset of received Bactoblis®, was well tolerated and without any side tonsillitis (Wilcoxon–Mann–Whitney P,0.001). The result is effects worth mentioning. Compliance was very good, with that the odds ratio of suffering from tonsillitis following the only one child complaining of the bad taste of the product. administration of Bactoblis® was equal to 0.003, with a 95% Because of the perceived poor palatability, the individual confidence interval amounting to 0.001–0.026. The assess- dropped out of the study immediately on the first enrolment ment of viral oropharyngeal infections was performed only day. As shown in Table 5, the number of days on which the in one of the medical centers involved in the study. For this children were treated with antibiotics or antipyretics were 30 reason, the data reported in Table 3 refer to only ten children and 16, respectively, in the treated group. Antipyretics were of either group. As the table shows, the ten children of the administered for 6 days following pain/fever due to a strep- treated group had had 25 infections of viral etiology in the tococcal infection and for 10 days for the same reasons, but corresponding quarter of 2012, with a prevalence of 100%. due to a viral infection; this caused the loss of 16 school days In the same quarter of 2013, viral infections diagnosed in (or preschool days, depending on the child’s age) and the loss the same ten children during treatment were only five, with of 16 working days by the children’s parents. In the control a prevalence of 30% (two children with two episodes each group, there were instead 900 antibiotic therapy days and 228 antipyretic therapy days, 180 of which owing to streptococcal Table 2 Episodes of pharyngotonsillitis caused by Streptococcus infections and 48 owing to viral infections. This caused the pyogenes in the two study groups (n=30/group) loss of 228 school (or preschool) days and the loss of 228 Treated A/C Untreated A/C January 31–April 30, 2012 94 3.1 90 3.0 Table 4 Tolerability, compliance, and side effects during the 90- January 31–April 30, 2013 3*,† 0.1 84‡ 2.8 day treatment in 31 individuals enrolled in the Bactoblis® group % reduction of episodes 96.79 6.79 Tolerability Compliance Side effects Notes: *P,0.001 versus episodes relatable to the same quarter of 2012 and versus episodes relatable to the control group in the same uarter of ; †one child Excellent n=30 n=30 None with scarlet fever, two children suffering from one pharyngotonsillitis episode each; Good n=0 n=0 None ‡ 15 children suffering from four pharyngotonsillitis episodes each, ten children Acceptable n=0 n=0 None suffering from one pharyngotonsillitis episode each and one from scarlet fever, two Unacceptable n 1* n 1* None children suffering from two pharyngotonsillitis episodes each, three children without = = any episodes. Note: Refused to continue on the very first treatment day due to an obvious Abbreviation: A/C, average/child. distaste for the product.
4 submit your manuscript | www.dovepress.com Drug, Healthcare and Patient Safety 2014:6 Dovepress Dovepress S. salivarius K12 for pharyngotonsillitis prevention
Table 5 Days under treatment with antibiotics and/or antipyretics which have been described as able to counteract the action of or days off preschool/school or working days lost by parents in -hemolytic streptococcus. Its oral colonization reduces the the study groups (n=30/group) risk of oral colonization by S. pyogenes. As a matter of fact, Group Antibiotics Antipyretics* School/preschool Work the same antagonism described for -hemolytic streptococ- Treated 30 6+10 16 16 cus has also been observed for other strains, which are also Control 900 180+48 228 228 sensitive to the same two lantibiotics and responsible for acute Note: he first number indicates the antipyretic administered because ofa 5 streptococcal disease, and the second the antipyretic administered because of a otitis media and halitosis. More recent information seems viral disease. to demonstrate that oral administration of the K12 strain can not only colonize the oropharynx with the release of the working days. In terms of costs (see Table 6), the treated two salivaricins acting as antagonists for certain pathogenic group reported a total expenditure of slightly over €2,600. strains but also, through a still not perfectly clear molecular The overall expenditure of the control group amounted to mechanism, reduce IL-8 plasma concentrations and increase approximately €1,530. In particular, the treated group spent salivary interferon- . These modulations may also rationally €2,558.25 to acquire the product Bactoblis®, €44.79 for anti- account for anti-inflammatory and antiviral activity, which biotics (about €11 borne by the families and the remainder would then be added to the antibacterial action of the K12 by the public health service) and €36.80 to buy antipyretics. strain already described. The results of the trial described in The control group spent €1,343.70 in antibiotics (€335.70 this work go exactly in this direction. Prophylaxis with the borne by the families and the remainder by the public health K12 strain reduced streptococcal infections by over 90%, service) and €184 in antipyretics. thus confirming the results of other works,11,12 but – and this is something new – also demonstrated an 80% reduction of Discussion viral infections. Use of the K12 strain also contributed to an The chief objective of treatment with probiotics – that is, important reduction in the children’s and their parents’ days with strains isolated from human feces (or from the feces of off school and work. In consideration of the need to rest at mice, pigs, or other animals) – is the achievement of intes- home during a high-grade fever or high infectivity hazard, tinal health. Probiotics are described as capable of counter- use of the K12 strain resulted in absence from school, pre- acting constipation, diarrhea, or irritable bowel syndrome. school, or work for 32 days in all, corresponding to about These effects can be achieved, but are closely linked to their 1 day per family. On the contrary, not using it caused absence intestinal colonization capability. Probiotic therapy may from school/preschool/work for 456 days, corresponding be also aimed at a nonintestinal benefit. Examples of these to about 15 days per family. With regard to the expenditure applications are attempts to prevent or treat such gynecologi- parameter, the advantage of not having lost 14 school/ working cal and/or urological conditions as vaginitis, vaginosis, or days per family cost the group treated with the K12 strain cystitis, particularly in patients with recurrent forms. Even about €900 more than the expenditure borne by the control in these cases, however, the effect seems to be directly con- group. To put this in individual family terms, this €900 delta nected to the ability of the probiotic to colonize the intestine. corresponds to a cost of €30 per family, and €30 spread Once the strain has reached and colonized the intestine, it over 90 treatment days corresponds to 33 a day per family. can transmigrate to the surrounding, anatomically connected The same calculation can be demonstrated by arguing on tissues, like the vagina or bladder, and exert its biological the basis of not losing school days and working days. In this action by counteracting the growth of pathogens.18 In the case case, as stated earlier, use of the K12 strain prevented the of the K12 strain, the issue of this study, things are different. loss of 14 days off school or work per family. As each fam- This strain, isolated from the oral cavity through a pharyngeal ily spent €30 more than those who did not resort to the K12 swab, can colonize the oropharynx rather than the intestine strain, it can be stated that each “saved” day cost about €2 and locally release the two lantibiotics (salivaricin A2 and B), per family. Hiring a babysitter to avoid losing a working day will certainly cost much more than that. The most impor- Table 6 Expenses (€) borne by the two groups to buy Bactoblis®, tant benefit offered by the use of the K12 strain in children antibiotics, and antipyretics (n=30/group) suffering from recurrent oral infections of a streptococcal Group Bactoblis® Antibiotics Antipyretics Total nature is not the undoubted economic advantage, but rather Treated 2,558.25 44.79 36.80 2,639.84 the dramatic reduction in the number of days under antibi- Control 0 1,343.70 184.00 1,527.70 otic therapy. As shown in Table 5, in the group treated with
Drug, Healthcare and Patient Safety 2014:6 submit your manuscript | www.dovepress.com 5 Dovepress Di Pierro et al Dovepress the K12 strain, resorting to antibiotic therapy was 30 times 4. Wescombe PA, Burton JP, Cadieux PA, et al. Megaplasmids encode lower. Similar data can be evinced from those resorting to differing combinations of lantibiotics in Streptococcus salivarius. Antonie Van Leeuwenhoek. 2006;90(3):269–280. antipyretic/anti-inflammatory/analgesic therapy. In this case, 5. Wescombe PA, Hale JD, Heng NC, Tagg JR. Developing oral probi- use of the K12 strain reduced the occurrence of resorting to otics from Streptococcus salivarius. Future Microbiol. 2012;7(12): 1355–1371. acetaminophen or ibuprofen 14-fold. These results, together 6. van Zon A, van der Heijden GJ, van Dongen TM, Burton MJ, Schilder AG. with the excellent tolerability and compliance, as well as the Antibiotics for otitis media with effusion in children. Cochrane absence of side effects, demonstrate that the K12 strain can Database Syst Rev. 2012;9:CD009163. 7. Power DA, Burton JP, Chilcott CN, Dawes PJ, Tagg JR. Preliminary be a valid therapeutic solution in the prevention of infective investigations of the colonisation of upper respiratory tract tissues of diseases of the oral cavity, whether of streptococcal or viral infants using a paediatric formulation of the oral probiotic Streptococ- cus salivarius K12. Eur J Clin Microbiol Infect Dis. 2008;27(12): etiology, and in particular those of a recurrent nature. This 1261–1263. study confirms, at least with regard to streptococcal infection 8. Horz HP, Meinelt A, Houben B, Conrads G. Distribution and persistence prevention, the data observed and published in two previ- of probiotic Streptococcus salivarius K12 in the human oral cavity as determined by real-time quantitative polymerase chain reaction. ous works,11,12 and adds another piece of information: the Oral Microbiol Immunol. 2007;22(2):126–130. prevention of viral infections, which will obviously require 9. Burton JP, Wescombe PA, Moore CJ, Chilcott CN, Tagg JR. Safety assessment of the oral cavity probiotic Streptococcus salivarius K12. further clinical confirmation before it can be validated with Appl Environ Microbiol. 2006;72(4):3050–3053. greater certainty. This study certainly exhibits some limits: 10. Burton JP, Cowley S, Simon RR, McKinney J, Wescombe PA, Tagg JR. the absence of a placebo group, the absence of blind condi- Evaluation of safety and human tolerance of the oral probiotic Strepto- coccus salivarius K12: a randomized, placebo-controlled, double-blind tions, the small size of the sample, only one center involved study. Food Chem Toxicol. 2011;49(9):2356–2364. in checking viral infection, and an inability to follow up the 11. Di Pierro F, Adami T, Rapacioli G, Giardini N, Streitberger C. Clinical evaluation of the oral probiotic Streptococcus salivarius K12 enrolled children in the 6–9 subsequent months to assess in the prevention of recurrent pharyngitis and/or tonsillitis caused by further trends in infective oropharyngeal events. These limits Streptococcus pyogenes in adults. Expert Opin Biol Ther. 2013;13(3): will be overcome in a subsequent multicenter study presently 339–343. 12. Di Pierro F, Donato G, Fomia F, et al. Preliminary pediatric in progress in the Emilia Romagna (Italy) territory. clinical evaluation of the oral probiotic Streptococcus salivarius K12 in preventing recurrent pharyngitis and/or tonsillitis caused by Streptococcus pyogenes and recurrent acute otitis media. Int J Gen Disclosure Med. 2012;5:991–997. FDP is the main formulator of the tested product and involved 13. Burton JP, Chilcott CN, Tagg JR. The rationale and potential for the in the scientific council of the company (Omeopiacenza) trad- reduction of oral malodour using Streptococcus salivarius probiotics. Oral Dis. 2005;11 Suppl 1:29–31. ing the tested product. The other authors report no conflicts 14. Burton JP, Chilcott CN, Moore CJ, Speiser G, Tagg JR. A preliminary of interest in this work. study of the effect of probiotic Streptococcus salivarius K12 on oral malodour parameters. J Appl Microbiol. 2006;100(4):754–764. 15. Ishijima SA, Hayama K, Burton JP, et al. Effect of Streptococcus References salivarius K12 on the in vitro growth of Candida albicans and its 1. Tagg JR. Prevention of streptococcal pharyngitis by anti-Streptococcus protective effect in an oral candidiasis model. Appl Environ Microbiol. pyogenes bacteriocin-like inhibitory substances (BLIS) produced by 2012;78(7):2190–2199. Streptococcus salivarius. Indian J Med. 2004;119 Suppl:13–16. 16. Murray RC, Chennupati SK. Chronic streptococcal and non- streptococcal 2. Hyink O, Wescombe PA, Upton M, Ragland N, Burton JP, Tagg. pharyngitis. Infect Disord Drug Targets. 2012;12(4):281–285. Salivaricin A2 and the novel lantibiotic salivaricin B are encoded at 17. Bonsignori F, Chiappini E, De Martino M. The infections of the adjacent loci on a 190-kilobase transmissible megaplasmid in the oral upper respiratory tract in children. Int J Immunopathol Pharmacol. probiotic strain Streptococcus salivarius K12. Appl Environ Microbiol. 2010;23(Suppl 1):16–19. 2007;73(4):1107–1113. 18. Singh VP, Sharma J, Babu S, Rizwanulla MT, Singla A. Role of 3. Sharma S, Verma KK. Skin and soft tissue infection. Indian J Pediatr. probiotics in health and disease: a review. J Pak Med Assoc. 2013;63(2): 2001;68 Suppl 3:S46–S50. 253–257.
Drug, Healthcare and Patient Safety Dovepress Publish your work in this journal Drug, Healthcare and Patient Safety is an international, peer-reviewed post-marketing surveillance studies, risk management, health literacy open-access journal exploring patient safety issues in the healthcare and educational programs across all areas of healthcare delivery. The continuum from diagnostic and screening interventions through to treat- manuscript management system is completely online and includes a very ment, drug therapy and surgery. The journal is characterized by the rapid quick and fair peer-review system. Visit http://www.dovepress.com/ reporting of reviews, original research, clinical, epidemiological and testimonials.php to read real quotes from published authors.
Submit your manuscript here: http://www.dovepress.com/drug-healthcare-and-patient-safety-journal
6 submit your manuscript | www.dovepress.com Drug, Healthcare and Patient Safety 2014:6 Dovepress Original Research Clinical evaluation of the oral probiotic Streptococcus salivarius K12 in the prevention of recurrent 1. Introduction 2. Materials and methods pharyngitis and/or tonsillitis 3. Results caused by Streptococcus 4. Discussion pyogenes in adults
† Francesco Di Pierro , Teresa Adami, Giuliana Rapacioli, Nadia Giardini & Christian Streitberger † Velleja Research, Scientific Department, Milano, Italy
Background: Streptococcus salivarius K12 has been shown to inhibit the growth of Streptococcus pyogenes due to bacteriocins release. Because of its ability to colonize the oral cavity, we have tested the strain K12 for its efficacy in preventing streptococcal pharyngitis and/or tonsillitis in adults. Methods: Forty adults with a diagnosis of recurrent oral streptococcal pharyn- gitis were enrolled in the study. Twenty of these subjects took for 90 days a tablet containing Streptococcus salivarius K12 (Bactoblis ). The other 20 subjects served as untreated controls. A 6-month follow-up was included to evaluate any persistent protective role. Results: The 20 adults who completed the 90-day course of Bactoblis showed a reduction in their episodes of streptococcal pharyngeal infection (about 80%). The 90 days treatment was also associated with an approximately
For personal use only. 60% reduction in the incidence of reported pharyngitis in the 6-month period following use of the product. The product was well tolerated by the subjects with no treatment-related side effects or drop-outs reported. Conclusion: Prophylactic administration of Streptococcus salivarius K12 to adults having a history of recurrent oral streptococcal pathology reduced the number of episodes of streptococcal pharyngeal infections and/ or tonsillitis.
Keywords: bactoblis , BLIS, pharyngitis, Streptococcus salivarius K12, tonsillitis
Expert Opin. Biol. Ther. [Early Online] Expert Opin. Biol. Ther. Downloaded from informahealthcare.com by Monash University on 01/06/13 1. Introduction
Most probiotics currently in use by humans have been derived from intestinal sour- ces and they have targeted the improvement of intestinal tract maladies [1]. However, more recently it has been recognized that there is potential for probiotic intervention in non-intestinal body sites using effector strains of species that are indigenous to alternative target tissues, in order to possibly obtain more specific and enduring health benefits [2]. This kind of approach could be referred to as “bacterial therapy”or“bioprotic” therapy, where bio indicates “living bacteria,” pro stands for “in favor of” and tic refers to “a well identified and precise pharmaceutical or nutraceutical application.” To our knowledge, Streptococcus salivarius K12 could be one of the first examples of the “bioprotic” approach. One probiotic on the mar- ket, called BLIS K12 (where BLIS is the acronym for Bacteriocin-Like Inhibitory Substances) uses the S. salivarius strain K12 which was isolated from the mouth
10.1517/14712598.2013.758711 © 2013 Informa UK, Ltd. ISSN 1471-2598, e-ISSN 1744-7682 1 All rights reserved: reproduction in whole or in part not permitted F. Di Pierro et al.
of an healthy child [3]. It is known to inhibit the growth of all treatment protocol. In a second part of the study, 16 subjects tested strains of b-hemolytic (Lancefield group A) S. pyogenes, of treated group and 17 of the not-treated group were followed the most common cause of bacterial pharyngitis and tonsillitis for a further 6 months, during which time the product was not and also sometimes implicated in acute otitis media administered to them. The product, Bactoblis in agreement (AOM) [4,5]. This inhibitory activity is known to be due to with the Italian law number 169/2004, has been notified to the action of the lantibiotics salivaricin A2 and salivaricin B, the Minister of Health on July the 5th, 2011 (Registration both of which are encoded by a 190 kb megaplasmid present number still pending) and registered as a food supplement. in strain K12 [6]. Derivatives of strain K12 lacking the mega- Bactoblis contains at the time of manufacturing, 5 billion plasmid DNA fail to show any BLIS activity against CFU/tablet of S. salivarius K12 ATCC BAA-1 024 (BLIS Tech- S. pyogenes [7]. The inhibitory spectrum of BLIS K12 also nologies Ltd., New Zealand) and has been manufactured by includes strains of Micrococcus luteus, Streptococcus anginosus, SIIT (Italy). According to the treatment protocol, the round- Eubacterium saburreum and Micromonas micros some of which shaped, vanilla-flavored, slowly-dissolving tablet, had to be can contribute to the symptoms of halitosis [8,9]. Pilot studies administered just before bedtime (after teeth-washing and/ have shown that BLIS K12 can achieve persistent colonization or mouthwash use) once daily for 90 days. The correct adminis- of various tissues within the upper respiratory tract of infants tration of the product requires that the tablet is not to be chewed (oral cavity, nasopharynx, and adenoid tissues) [10,11]. On the or directly swallowed, but that it has to be sucked for about basis of its i) good oral cavity colonization capabilities, 4 -- 5 min. Before administration of the first tablet, a chlorhexi- ii) excellent safety record (recently having achieved self- dine (0.2%) mouthwash was given to decrease the population of affirmed GRAS status) [12,13] and iii) reputed ability to pre- endogenous S. salivarius inhabiting the mouth in order to vent or treat certain oral infections [14], we decided to evaluate enhance the colonization process. Data were collected on a the efficacy of BLIS K12 when administered to adults having document filled out by the physician during each subject visit. a history of recurrent streptococcal pharyngitis and/ The visits occurred every 15 days regardless of the presence of or tonsillitis with the principal endpoint being the number any apparent pathology. When oral pathology (sore throat) of episodes of oral streptococcal infections. was apparent, the subjects reported straight away to the medical center prior to the 15th day appointment. The following infor- 2. Materials and methods mation was entered into the document: name of physician, inclusion and exclusion criteria, beginning and end date of ther- The study has been carried out in a routine clinical practice apy, name of patient, age, weight, height, sex, other concomitant setting, following international guidelines and in line with the therapy, clinical history during the 90 days of trial, number of
For personal use only. principles outlined in the Declaration of Helsinki. This study episodes of oral S. pyogenes infection in the previous year, types was carried out in out-patient department (Merano Hospital, of vaccines given to subject, results of oral swab at the time of Merano, Italy) and in clinics (Verona and Piacenza, Italy) where enrollment to exclude healthy carriers, results of oral swab per- it is not mandatory to obtain ethical approval in order to formed at every visit, types of side effects observed during the perform experimental protocols on nutraceutical products. 90 days of treatment, tolerance to the course of tablets and com- Inclusion criteria were informed signed consent; age between pliance at the end of the therapy. Primary study endpoints were 18 and 65 years; total absence of symptoms of infective disease the evaluation, through medical visits and throat swabs, of num- at the time of enrolment; diagnosis of recurrent, streptococcal ber of episodes of pharyngitis and/or tonsillitis in the treated and (group A hemolytic Streptococcus) pharyngitis and/or tonsillitis in the not-treated groups during the 90 days of treatment with in the previous year. Exclusion criteria were absence of informed the product and during the 6-month follow-up period when consent; age below 18 or above 65; severe respiratory and/ the product was not administered. Secondary study endpoints
Expert Opin. Biol. Ther. Downloaded from informahealthcare.com by Monash University on 01/06/13 or systemic pathologies; asthma; healthy carriage of Streptococcus were the evaluation of parameters like tolerability, compliance pyogenes. In the study, from October 2011 to August 2012, there and side effects during the 90 days of treatment. With respect were 40 subjects enrolled with a diagnosis of not less than to the assessment of tolerability and compliance we have defined four episodes of recurrent pharyngitis and/or tonsillitis in the four terms to describe the different reactions: very good, good, previous year confirmed by throat swab (S. pyogenes positive). acceptable, and unacceptable. Compliance, as adherence to ther- Selection was done on the basis of the information available in apy, was both monitored by a document to be filled every day by the files of the out-patient department and clinics involved in the subjects, to be delivered every 30 days to the physician, and the study. These files contained information either coming by a check of the returned boxes of the product every 30 days. directly from the department and clinics or coming from a visit The follow-up data were collected using procedures identical report filled by the medical doctors visiting the patient in the to those reported above with the exception that the planned first aid of an hospital. Twenty subjects were selected for the visits occurred every 30 days and the parameters of compliance, treatment group and 20 for the not-treated (control) group. tolerability and side effects were not evaluated. Out of the These subjects were followed for 90 days. After this period, all 20 subjects in the treated group, one was experiencing chronic subjects in the treated group were considered valid for the gingivitis with bleeding and two had recurrent aphthous stoma- aims of the study, having declared a total adherence to the titis previously demonstrated not to be responsive to treatment
2 Expert Opin. Biol. Ther. [Early Online] Preventive role of BLIS K12 in adult
Table 1. Demographic parameters of enrolled adults. and/or tonsillitis in the previous year. These 20 adults had 98 streptococcal episodes in the previous 12 months, but dur- Group NMF Age* ing the 90 days of treatment the subjects experienced only four diagnosed episodes of oral streptococcal infection, the Treated 20 7 13 33.0 ± 6.4 Not-treated 20 8 12 35.7 ± 7.0 incidence per month per subject dropping from 0.410 to 0.067. *Expressed as median ± standard deviation. The control group, adults enrolled with prior diagnosis of F: Females; N: Number of subjects; M: Males. recurrent streptococcal oral disease but not treated with BLIS K12, showed an increase in episodes of streptococcal Table 2. Episodes of streptococcal oral pathology pharyngitis and/or tonsillitis in comparison with the previous during the 90 days of treatment with BLIS K12 in year, as shown by the calculation of the incidence per month adults (n = 20) with recurrent streptococcal pharyngitis per subject (Table 3). This increase, from 0.421 to 0.48, is and/or tonsillitis. likely due to seasonal variations, since the previous year value also includes a period of warm months when the incidence of Pharyngitis/ Pharyngitis/ streptococcal infections normally drops, while the second tonsillitis in the tonsillitis while value includes infections acquired only during 3 winter previous year taking BLIS K12 months. Sixteen and 17, respectively of the adults in the treated and Number of episodes 98 (1 year) 4 (90 days) Incidence/month/subject 0.410 0.067* non-treated groups consented to continue with a 6-month Delta (%) -83.7 follow-up component of the study to evaluate possible ongo- ing protection against streptococcal pathology following the *p < 0.001 considering 98 episodes and p < 0.01 considering 25 episodes (98/4). 90 days of treatment with BLIS K12. As shown in Table 5, in the 6-month period the 17 adults from the not- with hyaluronic acid, chlorhexidine, topical antibiotics and treated group had 14 episodes of oral streptococcal pathology corticosteroids. Unscheduled endpoints were for evaluation of whereas the 16 adults coming from the treated group experi- these two localized mouth complaints. The statistical analysis enced only five oral streptococcal infections. This represents was performed using the Standardized Incidence Ratio (SIR) a reduction in incidence of approximately 60%. and its confidence interval 100(1-)% as proposed by Vanden- broucke [15].Iftherangeincludes100%itishighlylikelythat 4. Discussion the difference between observed and expected is due to chance For personal use only. (random fluctuations in the data). On the other hand, if the con- Pharyngitis is a common medical problem in the outpatient fidence interval does not include 100%, it is very likely that the medical setting, resulting in millions of patient visits each difference is not due to chance. The statistical comparisons year in Italy. Most episodes of pharyngitis are caused by infec- between treatment and past controls are shown in the tables tious etiologies, especially viruses. However, some of the more where the real number of episodes is reported along with, in serious types of pharyngitis are bacterial in origin, and the table notes, the same value/4 to allow a real statistical compari- most common agent is S. pyogenes. Complications of son otherwise not possible using values obtained in 12 months untreated S. pyogenes pharyngitis include rheumatic fever, with values obtained in 3 months. deep space abscesses, and toxic shock. Although most episodes of pharyngitis are acute in nature, a small percentage become 3. Results recurrent or chronic. Antibiotic therapy is typically prescribed
Expert Opin. Biol. Ther. Downloaded from informahealthcare.com by Monash University on 01/06/13 to treat both acute and recurrent infections. However, when In this study, we have attempted to evaluate the preventive patients present with sore throat, physicians must also con- role played by BLIS K12 when administered to adults having sider a wider range of potential pathogens including viruses a history of recurrent pharyngitis and/or tonsillitis of strepto- and other bacteria. Aside from a few rare streptococcal infec- coccal origin. The main endpoint was the number of episodes tions due to species other than S. pyogenes, antimicrobial ther- of streptococcal oral pathology. The 40 adults enrolled in apy is of no proven benefit to treat any other causes of the study were assigned either to the treated (20 subjects) pharyngitis other than those provoked by Lancefield group or not-treated (20 subjects) group. As shown in Table 1 A S. pyogenes. Inappropriate antibiotic therapy imposes the demographic characteristics of the 40 enrolled, and unnecessary expense and also contributes to the emergence therapy-adherent, adults do not differ statistically. of antibiotic-resistant bacteria, which are being reported Statistically-significant results have however been seen with increasing frequency. Consequently a conservative during the 90 days of treatment with BLIS K12 (Table 2)in approach to managing sore throats is increasingly promoted, terms of episodes of streptococcal pharyngitis and/or tonsilli- with antibiotic therapy held in reserve until S. pyogenes infec- tis in the 20 adults enrolled on the basis that they had experi- tion is confirmed. Prevention of infection by non-antibiotic enced not less than four episodes of streptococcal pharyngitis therapy is a preferable approach to the use of repeated
Expert Opin. Biol. Ther. [Early Online] 3 F. Di Pierro et al.
Table 3. Episodes of streptococcal oral pathology and also the prevalence of sore throats [17-20]. These data during 90 days in adults (n = 20) with recurrent have been recently confirmed in a pediatric clinical investiga- streptococcal pharyngitis and/or tonsillitis not treated tion performed in Italy [21] in which children with a history of with BLIS K12. recurrent streptococcal oral pathology were for 90 days, given a nutritional supplement (Bactoblis ) containing as its unique Pharyngitis/ Pharyngitis/ active ingredient 5 billion CFU/tablet of S. salivarius K12. In tonsillitis in the tonsillitis in that same study, the influence on acute otitis media (AOM) previous year 90 days incidence in the children was also assessed. Since that investi- gation included some risk of the incidence values potentially Number of episodes 101 29 Incidence/month/subject 0.421 0.48* being affected by normal fluctuations of oral and ear pathol- Delta (%) +38.5 ogy, the incidence values in the treated group were compared with those of two untreated groups. The first untreated group *p < 0.001 considering 101 episodes and p > 0.05 considering 25 episodes had the same characteristic as the treated one, being consti- (101/4). tuted of children enrolled because of recurrent streptococcal oral pathology. However, for an additional control of possible Table 4. Tolerability, compliance and side effects incidence fluctuations, disease episodes were also monitored during the 90 days of treatment with BLIS K12 in in a second group of children in whom previous recurrent adults (n = 20) having a history of recurrent oral streptococcal pathology had not been demonstrated. streptococcal pharyngitis and/or tonsillitis. This approach to the study showed that the approximately 90% reduction in the incidence of S. pyogenes pathology dur- Tolerability Compliance Side effects ing the 90 days of treatment with BLIS K12 was not due to fortuitous fluctuations in exposure of the subjects to S. pyo- Very Good n = 19 n = 19 None Good n = 1 n = 1 None genes during the study period. In the second part of that study, Acceptable an assessment was made of whether the administration of Unacceptable BLIS K12 resulted in persistent protection in the 6 months following treatment. This evaluation demonstrated that the N: Number of adults. prior use of the product provided enduring protection against oral streptococcal pathology and AOM, with about 65% Table 5. Episodes of oral streptococcal pathology reduction compared to the control. In spite of several limita- during the course of a 6-month follow-up of adults For personal use only. tions inherent in that study design; it was not randomized, who had been previously treated or not-treated with placebo-controlled or blinded, and it was based on use of a BLIS K12. relatively small number of children -- the results demonstrated for the first time that the use of the oral probiotic S. salivarius Group Number of Incidence/ %vs K12 by children having a history of recurrent oral streptococ- episodes month/ control cal disease, could substantially reduce the incidence of subject bacterial infections of the throat and ear. In the present study, Control (n = 17) 14 0.137 we have decided to evaluate the same clinical endpoints in a (from not-treated group) cohort of adult people enrolled on the basis of their recurrent Tested (n = 16) 5 0.052* -62.1 streptococcal oral pathology. Of the 40 enrolled subjects, (from treated group) 20 were treated for 90 days with 5 billion CFU/tablet of Expert Opin. Biol. Ther. Downloaded from informahealthcare.com by Monash University on 01/06/13 *p = 0.0389 (Pearson chi-squared test for difference in proportion. Chi^2 = 4.26). S. salivarius K12. The other 20 subjects served as untreated N: Number of children. controls. Supporting the outcome of our parallel pediatric study, for the treated group the protection rate was about treatment doses of antibiotics. The ability of the normal oral 80% with a very high profile in terms of tolerability, compli- cavity bacterial microflora of some individuals to inhibit the ance and side effects (Table 4). Following the 90 days of growth of S. pyogenes has been previously established. Most treatment, the protocol included an assessment of whether of this inhibitory activity has been attributed to BLIS- the prior administration of BLIS K12 resulted in persistent producing S. salivarius [16]. Since S. salivarius has extremely protection in the following 6 months. As was also found low pathogenic potential and it is a prominent member of in the pediatric study enduring protection against oral the normal oral microbiota it is regarded as an excellent can- streptococcal pathology was observed with about 60% didate for bacterial interference-mediated prevention of recur- reduction found by comparison to the control group. Also rent pharyngitis and tonsillitis. Certain S. salivarius can of note, the treated group included one subject suffering interfere with the growth of S. pyogenes due to their produc- chronic gingivitis with bleeding and two having recurrent tion of BLIS. For example, S. salivarius K12 has been shown aphthous stomatitis, previously demonstrated not to be to reduce acquisitions of S. pyogenes by school-aged children responsive to treatment with B-vitamins supplementation or
4 Expert Opin. Biol. Ther. [Early Online] Preventive role of BLIS K12 in adult
with hyaluronic acid, chlorhexidine, antibiotic and corticoste- of the encouraging outcome from our tests of BLIS K12 roids. Clinical assessments of these three patients have shown efficacy in both children and adults, our group is currently that a total resolution of these conditions occurred in associa- organizing a much larger randomized, blinded, placebo- tion with their exposure to BLIS K12. Whether these controlled study to more thoroughly evaluate the findings of responses are directly related to the use of BLIS K12 remains these preliminary investigations. an open question. In conclusion, the regular use of BLIS K12 appears to have effected a substantial reduction in the Declaration of interest incidence of recurrent oral streptococcal pathology, reducing the requirement for these BLIS K12-treated individuals to FDP is the principal formulator of the product. There are no be exposed to therapeutic courses of antibiotics. On the basis other conflicts of interest.
Bibliography 1. Sathyabama S, Vijayabharathi R, 10. Power DA, Burton JP, Chilcott CN, 18. Ragland N, Tagg JR. Applications of Bruntha Devi P, et al. Screening for et al. Preliminary investigations of the bacteriocin-like inhibitory substance (BLIS) probiotic properties of strains isolated colonisation of upper respiratory tract typing in a longitudinal study of the oral from feces of various human groups. tissues of infants using a paediatric carriage of beta-haemolytic streptococci by J Microbiol 2012;50:603-12 formulation of the oral probiotic a group of Dunedin schoolchildren. 2. Tagg JR, Dierksen KP. Bacterial Streptococcus salivarius K12. Eur J Clin Zentralbl Bakteriol 1990;274:100-8 replacement therapy: adapting ’germ Microbiol Infect Dis 2008;27:1261-3 19. Tagg JR. Significance of bacteriocin warfare’ to infection prevention. 11. Horz HP, Meinelt A, Houben B, et al. production by oral streptococci. In: Trends Biotechnol 2003;21:217-23 Distribution and persistence of probiotic Lutticken R, editor. Proceedings of the 3. Tagg JR. Prevention of streptococcal Streptococcus salivarius K12 in the human Xth Lancefield Symposium. Gustav Fischer pharyngitis by anti-Streptococcus oral cavity as determined by real-time Verlag; Stuttgart and New York; 1990 pyogenes bacteriocin-like inhibitory quantitative polymerase chain reaction. 20. Dierksen KP, Tagg JR. The influence of substances (BLIS) produced by Oral Microbiol Immunol 2007;22:126-30 indigenous bacteriocin-producing Streptococcus salivarius. Indian J 12. Burton JP, Wescombe PA, Moore CJ, Streptococcus salivarius on the acquisition Med Res 2004;119(Suppl):13-16 et al. Safety assessment of the oral cavity of Streptococcus pyogenes by primary 4. Jack RW, Tagg JR, RAY B. Bacteriocins probiotic Streptococcus salivarius K12. school children in Dunedin. In: of gram-positive bacteria. Microbiol Rev Appl Environ Microbiol 2006;72:3050-3 Martin DR, Tagg JR, editors. Streptococci 1995;59:171-200 13. Burton JP, Cowley S, Simon RR, et al. and streptococcal diseases entering the new For personal use only. millennium. Securacopy; Auckland, New 5. Sharma S, Verma KK. Skin and soft Evaluation of safety and human tolerance Zealand: 2000. p. 81-5 tissue infection. Indian J Pediatr of the oral probiotic Streptococcus 2001;68(Suppl 3):S46-50 salivarius K12: a randomized, 21. Di Pierro F, Donato G, Fomia F, et al. placebo-controlled, double-blind study. Preliminary pediatric clinical evaluation of 6. Hyink O, Wescombe PA, Upton M, et al. Food Chem Toxicol 2011;49:2356-64 the oral probiotic Streptococcus salivarius Salivaricin A2 and the novel lantibiotic K12 in preventing recurrent pharyngitis salivaricin B are encoded at adjacent loci on 14. Tagg J, Wescombe P, Burton J. Oral and/or tonsillitis caused by Streptococcus a 190-kilobase transmissible megaplasmid streptococcal BLIS: Heterogeneity of the pyogenes and recurrent acute otitis media. in the oral probiotic strain Streptococcus effector molecules and potential role in Int J Gen Med 2012;5:991-7 salivarius K12. Appl Environ Microbiol the prevention of streptococcal infections. Int Congress Series 2006;1289:347-50 2007;74:1107-13 Affiliation 15. Vandenbroucke JP. A shortcut method 7. Wescombe PA, Burton JP, Cadieux PA, †1 2 Expert Opin. Biol. Ther. Downloaded from informahealthcare.com by Monash University on 01/06/13 Francesco Di Pierro , Teresa Adami , for calculating the 95 per cent confidence et al. Megaplasmids encode differing Giuliana Rapacioli3, Nadia Giardini4 & interval of the standardised mortality combinations of lantibiotics in 4 Christian Streitberger ratio. Am J Epidemol 1982;115:303 † Streptococcus salivarius. Antonie van Author for correspondence Leeuwenhoek 2006;90:269-80 16. Tagg JR. A longitudinal study of 1Velleja Research, Scientific Department, Viale 8. Burton JP, Chilcott CN, Tagg JR. The Lancefield group A streptococcus Lunigiana 23, 20125, Milano, Italy rationale and potential for the reduction acquisitions by a group of young Tel: +39 3495527663; Fax: +39 0523 511894; of oral malodour using Streptococcus Dunedin school children. NZ Med J E-mail: [email protected] salivarius probiotics. Oral Dis 1990;103:429-31 2Infective Diseases, Verona, Italy 2005;11(Suppl 1):29-31 17. Fantinato VC, Shimizu MT. Production 3A.I.O.R., Piacenza, Italy 4 9. Burton JP, Chilcott CN, Moore CJ, of bacteriocin-like inhibitory substances Merano Hospital, ORL Department, Merano, et al. A preliminary study of the effect of (BLIS) by Streptococcus salivarius strains Italy probiotic Streptococcus salivarius K12 on isolated from the tongue and throat of oral malodour parameters. children with and without sore throat. J Appl Microbiol 2006;100:754-64 Rev Microbiol 1999;30:332-4
Expert Opin. Biol. Ther. [Early Online] 5 Protective Mechanisms of Respiratory Tract Streptococci against Streptococcus pyogenes Biofilm Formation and Epithelial Cell Infection
Tomas Fiedler, Catur Riani, Dirk Koczan, Kerstin Standar, Bernd Kreikemeyer and Andreas Podbielski Appl. Environ. Microbiol. 2013, 79(4):1265. DOI: 10.1128/AEM.03350-12. Published Ahead of Print 14 December 2012. Downloaded from
Updated information and services can be found at: http://aem.asm.org/content/79/4/1265
These include: http://aem.asm.org/ SUPPLEMENTAL MATERIAL Supplemental material http://aem.asm.org/
REFERENCES This article cites 89 articles, 43 of which can be accessed free at: http://aem.asm.org/content/79/4/1265#ref-list-1
CONTENT ALERTS Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more» on June 16, 2014 by guest on June 16, 2014 by guest
Information about commercial reprint orders: http://journals.asm.org/site/misc/reprints.xhtml To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/ Protective Mechanisms of Respiratory Tract Streptococci against Streptococcus pyogenes Biofilm Formation and Epithelial Cell Infection
Tomas Fiedler,a Catur Riani,a* Dirk Koczan,b Kerstin Standar,a Bernd Kreikemeyer,a Andreas Podbielskia University of Rostock, Institute of Medical Microbiology, Virology, and Hygiene, Rostock, Germanya; University of Rostock, Institute of Immunology, Rostock, Germanyb
Streptococcus pyogenes (group A streptococci [GAS]) encounter many streptococcal species of the physiological microbial biome when entering the upper respiratory tract of humans, leading to the question how GAS interact with these bacteria in order to establish themselves at this anatomic site and initiate infection. Here we show that S. oralis and S. salivarius in direct contact assays inhibit growth of GAS in a strain-specific manner and that S. salivarius, most likely via bacteriocin secretion, also exerts this effect in transwell experiments. Utilizing scanning electron microscopy documentation, we identified the tested strains as
potent biofilm producers except for GAS M49. In mixed-species biofilms, S. salivarius dominated the GAS strains, while S. oralis Downloaded from acted as initial colonizer, building the bottom layer in mixed biofilms and thereby allowing even GAS M49 to form substantial biofilms on top. With the exception of S. oralis, artificial saliva reduced single-species biofilms and allowed GAS to dominate in mixed biofilms, although the overall two-layer structure was unchanged. When covered by S. oralis and S. salivarius biofilms, epithelial cells were protected from GAS adherence, internalization, and cytotoxic effects. Apparently, these species can have probiotic effects. The use of Affymetrix array technology to assess HEp-2 cell transcription levels revealed modest changes after exposure to S. oralis and S. salivarius biofilms which could explain some of the protective effects against GAS attack. In sum- mary, our study revealed a protection effect of respiratory tract bacteria against an important airway pathogen and allowed a
first in vitro insight into local environmental processes after GAS enter the respiratory tract. http://aem.asm.org/
treptococcus pyogenes (group A streptococci [GAS]) belongs to persisting pathogens and better resist future pathogen exposure. Sthe most important bacterial species causing purulent respira- Third, after the application of antibiotics or antiseptics, void tory tract and skin infections in humans in more than 720 million spaces on human surfaces could be filled by robust harmless bac- patients per year (1, 2). Many of the GAS virulence factors in- teria until the resident microbial biome is reconstituted. volved in these infectious processes, as well as the underlying cir- GAS are transmitted between humans by direct contact or by cuits controlling their expression, have been identified in the re- contaminated airborne droplets. Therefore, the skin and the up- on June 16, 2014 by guest cent years (3–9). per respiratory tract are the primary GAS contact sites on new The administration of -lactams is the treatment of choice to human hosts (18). Both anatomic sites are physiologically inhab- fight purulent GAS infections. Despite this appropriate therapy, 5 ited by several dozen (skin) to several hundred (respiratory tract) to 10% of patients suffer from recurrent episodes (10). This phe- different bacterial species (19–23), of which the majority can only nomenon could be associated with the ability of GAS to adhere to be demonstrated by molecular techniques (24, 25). Many of these and, more importantly, internalize into eukaryotic cells (3, 11). species have probiotic potential that could be exerted by biofilm Unfortunately, a high capacity for internalization is apparently formation on anatomical sites serving as targets for pathogenic associated with resistance to macrolides (12), preventing this in- bacteria. Several recent studies have shown that dairy bacteria tracellularly active antibiotic from being a true therapeutic alter- such as Lactobacillus helveticus, L. rhamnosus, L. oris, and L. reuteri, native, especially for recurrent GAS infections. Therefore, new as well as other oral bacterial species, can protect the pharyngeal options would be welcome to combat such infections, and, in final mucosa from GAS attack (26, 27). Thus far, it is unclear whether consequence, the spread of the bacteria from such carrier patients this defense mechanism in vivo involves biofilm growth. in a nonepidemic setting. In turn, the pathogens could build their own biofilm or inte- Probiotics, defined as “live microorganisms [that] when ad- grate into existing ones. GAS form biofilms in vivo and in vitro ministered in adequate amounts confer a health benefit on the host” (FAO/WHO, 2002) could serve as a therapeutic alternative (13). Beneficial roles of probiotic bacteria have already been re- Received 6 November 2012 Accepted 6 December 2012 ported for treatments in the oral cavity (14). Thus far, only a few Published ahead of print 14 December 2012 products became commercially available, e.g., the Streptococcus Address correspondence to Bernd Kreikemeyer, [email protected] salivarius strain K-12, which is sold as BLIS lozenges in New Zea- -rostock.de, or Andreas Podbielski, [email protected]. land (15), and freeze-dried powders of Lactobacillus rhamnosus * Present address: Catur Riani, School of Pharmacy, Institut Teknologi Bandung, plus Bifidobacterium casei and Enterococcus faecalis, which are sold Bandung, Indonesia. as Symbiolact compositum and Symbioflor, respectively (16, 17). T.F. and C.R. contributed equally to this article. Like other probiotics these have three major activity routes. First, Supplemental material for this article may be found at http://dx.doi.org/10.1128 using appropriate adhesins, detergents, bacteriocins, or quorum- /AEM.03350-12. sensing inhibitors, the probiotic microorganism can outgrow and Copyright © 2013, American Society for Microbiology. All Rights Reserved. permanently replace pathogens. Second, the host defense mecha- doi:10.1128/AEM.03350-12 nisms are stimulated or modulated in favorable ways to eradicate
February 2013 Volume 79 Number 4 Applied and Environmental Microbiology p. 1265–1276 aem.asm.org 1265 Fiedler et al.
(28–30). Several GAS virulence factors have been suggested to be biofilms on coverslips were washed with phosphate-buffered saline (PBS) involved in biofilm formation, including M protein, antigen I/II and fixed with 2.5% glutaraldehyde overnight. Coverslips were washed family polypeptide AspA, SpeB production, and the GAS pilus two to three times with 0.1 M sodium phosphate buffer (pH 7.3), dehy- (31–36). drated with a series of increasing ethanol concentrations (5 min in 30%, 5 Several issues associated with the protective biofilm hypothesis min in 50%, 10 min in 70%, 10 min in 90%, and twice for 10 min in ethanol absolute), and dried with CO by critical point method with a have not been resolved. (i) Can probiotic bacteria interfere with 2 Emitech dryer as outlined by the manufacturer. Dried coverslips were the biofilm formation capacity of GAS? (ii) Are GAS able to invade covered with gold to a 10-nm layer and scanned with a Zeiss DSM 960A and establish within existing probiotic biofilms. (iii) Can probi- electron microscope (29). otic bacteria protect epithelial cells from infection with GAS. (iv) Confocal laser scanning microscopy (CLSM). The visualization of S. Finally, what are the underlying mechanisms of these interactions pyogenes in single- and mixed-species biofilms was done by immunoflu- with regard to transcription and function levels. Consequently, in orescence staining using a specific anti-S. pyogenes polyclonal antibody the present study we used the well-studied BLIS S. salivarius K-12 together with an Alexa 488-coupled secondary antibody. Hexidine iodine strain and two Streptococcus oralis strains (DSMZ reference strain was used for staining all Gram-positive bacterial species. After the removal DSM20627 and patient isolate 4087) as representatives of the pre- of planktonic bacteria, the biofilms were washed once with PBS, fixed with dominant upper respiratory tract species to test their potential 3% paraformaldehyde for 15 min at 4°C, and subsequently blocked with protective capacity against GAS biofilm formation and host cell 1% FCS at room temperature for 30 min. The biofilm was washed three Downloaded from infection. times with PBS and incubated for1hatroom temperature with a rabbit IgG anti-S. pyogenes antibody (1:5,000 in PBS). After being washed with MATERIALS AND METHODS PBS, the second antibody (goat anti-rabbit-IgG-Alexa Fluor 488) was added at a 1:500 dilution in PBS for 45 min at room temperature in the Strains and culture conditions. S. pyogenes M49 strain 591 (37) and M6 dark. Again, three washing steps with PBS were performed. Hexidine strain 616 (clinical isolate, Centre of Epidemiology and Microbiology, iodine (1 l in 1 ml of PBS [Invitrogen]) was added for 10 min at room National Institute of Public Health, Prague, Czech Republic), S. salivarius temperature in the dark. The biofilm was inspected with a Zeiss inverted strain K-12 (BLIS Technologies, Ltd., Dunedin, New Zealand), and S. microscope attached to a Leica TCS SP2 AOBS laser scanning confocal oralis strains DSM 20627 (German Collection of Microorganisms and Cell http://aem.asm.org/ imaging system with an Argon laser at 480- and 488-nm excitation wave- Cultures [DSMZ]) and 4087 (isolate from a healthy person [the present lengths. study]) were cultured in brain heart infusion (BHI) or on Columbia blood Bacteriocin assay. The bacteriocin assay was performed based on a agar plates containing 5% sheep erythrocytes at 37°C under a 5% CO – 2 modified deferred antagonism cross streak technique on blood agar (40). 20% O atmosphere. Eukaryotic laryngeal epithelial cell line HEp-2 2 Potential bacteriocin producers were streaked on blood agar, incubated (American Type Culture Collection) was cultured in Dulbecco modified for 18 h, and subsequently killed with a vapor of chloroform for 4 min. Eagle medium (DMEM) supplemented with 10% fetal calf serum (FCS) in Chloroform vapors were removed by passive ventilation of the agar plate cell culture flasks or 24-well microtiter plates under a 5% CO –20% O 2 2 for 10 to 15 min. S. pyogenes strains were streaked across the primary atmosphere. Coaggregation experiments. Bacteria were harvested from overnight streak and incubated overnight. Growth inhibition and beta-hemolysis cultures by centrifugation and washed twice with coaggregation buffer inactivation were observed around the intersection of bacterial streaks. on June 16, 2014 by guest (tris[hydroxymethyl]aminomethane, 1 mM [pH 8.0]; CaCl , 0.1 mM; Adherence and internalization assays. Adherence to and internaliza- 2 tion into HEp-2 cells was quantified using an antibiotic protection assay MgCl2, 0.1 mM; NaN3, 0.02%; NaCl, 0.15 M) (38). The suspension of bacterial cells in coaggregation buffer was adjusted to an optical density at (41). Three different seeding strategies were used for this assay: (i) simul- 600 nm of 2.0. To assess two-species coaggregation, the respective strains taneous seeding (S. pyogenes and respiratory tract streptococci were added were mixed 1:1 to a final volume of 4 ml and vortexed for 10 s. After2hof to the HEp-2 cells at the same time), (ii) S. pyogenes first seeding (S. incubation at room temperature coaggregation was determined by visual pyogenes was incubated with HEp-2 cells for 1 h prior to addition of the S. inspection. oralis or S. salivarius), and (iii) S. pyogenes last seeding (respiratory tract Biofilm culture conditions. For biofilm assays, conditions optimized streptococci were incubated with HEp-2 cells for 2 h prior to inoculation for GAS were used (39). In detail, bacterial overnight cultures in BHI of S. pyogenes). Moreover, several modifications of the latter method were broth were suspended in fresh BHI broth supplemented with 0.5% glu- performed. (i) DMEM medium and planktonic respiratory tract bacteria cose (BHI-G), adjusted to 104 CFU/ml, and inoculated into 96- or 24-well were removed prior to S. pyogenes infection, and Hep-2 cells were washed microtiter plates for quantification of biofilm masses or microscopic anal- three times with sterile prewarmed PBS preceding the S. pyogenes inocu- yses, respectively. Alternatively, BHI broth mixed 1:3 with artificial saliva lation. (ii) A transwell system was used, preventing direct contact between (0.1% Lab Lemco Powder, 0.2% yeast extract, 0.5% peptone, 0.25% mu- the respiratory tract bacteria (upper compartment) and HEp-2 cells cin from porcine stomach [type III; Sigma], 6 mM NaCl, 2.7 mM KCl, 3.5 (lower compartment). In addition, adherent and internalized S. pyogenes chains were visualized using double immune fluorescence as described mM KH2PO4, 1.5 mM K2HPO4, 0.05% urea [pH 6.7]) was used as culti- vation medium. For one-species biofilms 100 l of bacterial suspension previously (42). All assays were performed with three technical and at least (104 CFU/ml), and 100 l of BHI-G were added per well of a 96-well plate. three biological replicates. For two-species biofilm cultures, 100 l of bacterial suspension (104 CFU/ Eukaryotic cell viability assay. The live/dead viability/cytotoxicity kit ml) of each species were simultaneously inoculated per well. For micro- for animal cells (Molecular Probes; Mobitec) was used to determine via- scopic observations, biofilms were generated in 24-well polystyrene plates bility of HEp-2 cells in the presence of S. pyogenes and respiratory tract (Cellstar Greiner; Bio-One) with inserted round plastic coverslips (Nunc) species. Exposure of HEp-2 cells to the respective bacteria was as described or in glass-bottom 2/4-chambers (Nunc). Bacteria were inoculated in ra- for adherence and internalization experiments, except that HEp-2 cells tios as described above to a final volume of 1 ml. Biofilm analysis was were cultivated in 24-well plates on coverslips. Visualization and inspec- performed after incubation for 3 days as standing cultures at 37°C under tion of live or dead HEp-2 cells was done under a fluorescence microscope
5% CO2–20% O2 atmosphere. All assays were performed in triplicate at 400-fold magnification. In each assay, three randomly chosen micro- (technical replicates) on at least three independent occasions (biological scopic fields were documented as a picture. In order to express the results replicates). as quantitative data, living cells (green fluorescence) were counted and Scanning electron microscopy (SEM). Biofilm bacteria were cultured expressed as the percentage of all cells (live and dead) visible in each as described above. After the removal of remaining planktonic bacteria, picture.
1266 aem.asm.org Applied and Environmental Microbiology Oral Streptococci and GAS Biofilm Formation Downloaded from http://aem.asm.org/ on June 16, 2014 by guest
FIG 1 Cocultivation experiments with S. pyogenes and respiratory tract streptococci. The figure shows CFU of S. pyogenes M49 (A to C) and M6 (D to F) after 24 h of either coincubation in direct contact (light gray bars) or in transwell assays (dark gray bars) with S. salivarius (Ss) and S. oralis (So) DSMZ strain or strain 4087, respectively. Numbers below the bars indicate the initially inoculated number of bacteria (in CFU/ml). Error bars resulted from three independent experiments.
HEp-2 cell transcriptome analysis. To compare host cell gene expres- Statistical analysis. Where applicable, statistical analyses were per- sion profile changes caused by S. salivarius K-12 and S. oralis DSMZ, formed using the Student t test. Significant differences were defined when high-density oligonucleotide microarrays were applied. Two biological the P values were Ͻ0.05. replicates of total RNA samples from infected HEp-2 cells were hybridized to Human Genome U133 plus 2.0 array (Affymetrix, St. Clara, CA), in- RESULTS terrogating 47,000 transcripts with more than 54,000 probe-sets. Array Cocultures of S. pyogenes and respiratory tract streptococci in hybridization was performed according to the supplier’s instructions us- ing GeneChip expression 3= amplification one-cycle target labeling and liquid culture media. Only scarce information exists regarding control reagents (Affymetrix). Subsequently, washing and staining proto- how S. salivarius and S. oralis could influence cultures of GAS. cols were performed with the Affymetrix Fluidics Station 450. For a signal Thus, coculture experiments were performed by growing GAS enhancement, an antibody amplification was carried out with a biotin- serotypes M49 and M6 in direct (tubes) or indirect (transwell ylated anti-streptavidin antibody (Vector Laboratories, United King- system) contact with the two respiratory tract streptococci in sev- dom), which was cross-linked by a goat IgG (Sigma, Germany), followed eral combinations. In initial coaggregation experiments, coincu- by a second staining with streptavidin-phycoerythrin conjugate (Molec- bation of the different species was shown to increase the bacterial ular Probes/Invitrogen). The scanning of the microarray was done with a dispersion in combinations of GAS with S. salivarius and S. oralis GeneChip Scanner 3000 (Affymetrix) at a 1.56- m resolution. DSMZ (see Fig. S1 in the supplemental material), indicating a The data analysis was performed using MAS 5.0 (Microarray Suite statis- lower degree of coaggregation in planktonic mixtures of these tical algorithm; Affymetrix) and probe-level analysis using GeneChip Oper- ating Software (GCOS 1.4), and the final data extraction was performed with species. Serial combinations of high to low bacterial CFU counts the DataMiningTool 3.1 (Affymetrix). Differentially upregulated and down- were used to test whether bacterial numbers play a role in this regulated genes from two independent experiments were clustered manually interaction. From the outcome of these experiments, only mean- and analyzed for their molecular function using tools in NetAffx analysis ingful results are shown. As shown in Fig. 1, the direct contact center (http://www.affymetrix.com/analysis/index.affx). experiments revealed that a high initial CFU count of S. salivarius
February 2013 Volume 79 Number 4 aem.asm.org 1267 Fiedler et al.
FIG 2 Bacteriocin production. S. salivarius K-12 (A), S. oralis DSMZ (B), and S. oralis strain 4087 (C) were grown on Columbia agar plates overnight and killed by chloroform exposure. Subsequently, S. pyogenes M6 and M49 were perpendicularly streaked across the primary streak and incubated for another 24 h. Growth inhibition zones are visible close to the S. salivarius streak. He- molysin production is obviously not selectively suppressed in growing S. pyo- genes bacteria. and S. oralis mixed with a low GAS M49 and M6 CFU count caused the repression of GAS growth. In contrast, low numbers of S. salivarius CFU inhibited the growth of low initial GAS M49 and Downloaded from M6 CFU (Fig. 1A and D). In experiments using the transwell system, secreted substances from most bacteria did not decrease GAS CFU, except for S. sali- varius (Fig. 1). The initial mixture of 106 CFU of S. salivarius/ml plus 103 CFU of GAS/ml led to a 7-log decrease in GAS CFU compared to untreated controls. Furthermore, the S. oralis strains reduced GAS M49 CFU by 1 log (Fig. 1B and C). No other strain combination or CFU variation revealed significant effects. The http://aem.asm.org/ effect of S. salivarius on GAS M49 was more prominent than the effect on GAS M6. Apparently, S. salivarius secreted a diffusible substance that exerted a growth inhibition effect on GAS, and the GAS M6 strain is more resistant against its action. The fitness of the tested respiratory tract species in the presence of GAS strains was also monitored in the direct contact system (see FIG 3 Single-species biofilms. The biofilm-forming capacity of M6 and M49 Fig. S2 in the supplemental material). Even mixtures of initially S. pyogenes strains, as well as of S. salivarius K-12, S. oralis DSMZ 20627, and S. high GAS CFU with low S. salivarius and S. oralis CFU did not oralis 4087 strains, was assessed after 72 h of incubation by safranin staining and absorption measurements at 492 nm. Error bars resulted from three in- on June 16, 2014 by guest prevent the growth of the respiratory tract streptococci in the dependent experiments. The panel below the graph shows SEM images of the mixed cultures. biofilms of the respective strains after 72 h of incubation. Bacteriocin production. One possible explanation for some of the results of the coculture experiments could be the secretion of diffusible substances such as bacteriocins. Thus, we tested bacte- biofilm development and bacterial interaction with host cells (43). riocin production by the respiratory tract species using a solid Therefore, coaggregation capacity of BHI-grown single- and blood agar test system. The potential producers were grown in a mixed-species was examined. Only the GAS strains revealed an first streak and inactivated by chloroform vapor. Hence, any ob- aggregation effect in single-species experiments. In addition, S. served effect was caused by chloroform-stable, diffusible sub- oralis 4087 coaggregates with both of the GAS strains tested (see stances that were produced by the first streaked strain. The results Fig. S1A-C in the supplemental material). shown in Fig. 2 revealed that exclusively S. salivarius could kill After we established the optimal conditions for monospecies both GAS strains by bacteriocin production. biofilms, we investigated the isolates’ behavior in mixed-species Combined species biofilm phenotypes. GAS are able to form settings. As documented by SEM and CLSM, biofilms of both GAS biofilms in vitro. However, the biofilm phenotype is serotype serotype strains plus S. salivarius were dominated by S. salivarius dependent (29, 39). Here, biofilm formation of GAS M6 bacteria, since GAS were hardly visible in this combination (Fig. 4; (strong biofilm producer) and M49 (poor to moderate biofilm see also Fig. S3 in the supplemental material). This finding was producer) was investigated in the presence of S. salivarius and supported by the biofilm masses as quantified by safranin staining. S. oralis strains to observe whether GAS can integrate into The amounts of the S. salivarius/GAS two-species biofilms were respiratory tract biofilms or GAS biofilms can be disturbed by almost identical to those of S. salivarius monospecies biofilms but respiratory tract bacteria. were significantly higher than GAS M6 and M49 monospecies Initial tests revealed that BHI supplemented with 0.5% (wt/ biofilm masses (Fig. 4). Obviously, the observed effects were in- vol) glucose best supported growth of all species (data not shown). dependent of the biofilm-forming capacity of the individual GAS Prior to mixed-species experiments, the biofilm-forming ability of strain. all strains was assessed using monospecies cultures. From the A different picture emerged in the case of the mixed GAS/S. safranin assay results and SEM pictures (Fig. 3), it is apparent that oralis biofilms. Both short-chain growing S. oralis strains predom- all species developed significant biofilm masses except for the GAS inated the bottom layer and long-chain growing GAS strains in the M49 strain in accordance with published results (29). Bacterial top layer of the two-species biofilm (Fig. 4; see also Fig. S3 in the coaggregation was previously shown to play an important role in supplemental material), indicating that S. oralis acted as a support
1268 aem.asm.org Applied and Environmental Microbiology Oral Streptococci and GAS Biofilm Formation Downloaded from http://aem.asm.org/ on June 16, 2014 by guest
FIG 4 Biofilm formation of cocultures of S. pyogenes M49 (A) or M6 (B) and respiratory tract streptococci. After 72 h of incubation, the biofilms were quantified by safranin staining and absorption measurement at 492 nm. White bars represent the S. pyogenes monospecies biofilms, light gray bars represent the mono- species biofilms of the respiratory tract streptococci, and dark gray bars represent the mixed-species biofilms. Error bars resulted from three independent experiments, asterisks indicate significant differences (Student t test: **, P Ͻ 0.01; ***, P Ͻ 0.001). (C) The panel below the graph shows SEM images of mixed-species biofilms after 72 h of incubation in the combinations indicated. for GAS biofilm development. Obviously, the biofilm was not as Artificial saliva reduced all monospecies biofilm masses except exclusively formed by S. oralis, as was the case for S. salivarius, but for S. oralis DSMZ (see Fig. S4 in the supplemental material). The this time was somewhat affected by the biofilm-forming capacity addition of artificial saliva also reduced the masses of the mixed- of the individual GAS strains. In the case of GAS M49, biofilm species biofilms involving S. salivarius (Fig. 5). The predominance masses in combination with the S. oralis strains were significantly of S. salivarius in combinations with GAS disappeared upon saliva higher than the biofilm masses of GAS M49 or each S. oralis strain addition. Now, both GAS strains prevailed in the SEM pictures, alone (Fig. 4A). In contrast, biofilm masses of GAS M6 combined the M6 strain more than the M49 strain (compare Fig. 4 to 5). with either S. oralis strain did not significantly differ from that of The results for the GAS/S. oralis combinations in the presence single-species biofilms (Fig. 4B). of artificial saliva diverged in a strain-dependent manner. Combi- Artificial saliva effects on biofilms. Copious amounts of saliva nations of the two GAS strains with S. oralis DSMZ did not lead to are present in parts of the human upper respiratory tract. Besides a statistically significant change in biofilm masses (Fig. 5). The physiological effects on host surfaces, it has an important role in effect of artificial saliva on the GAS/S. oralis 4087 combinations microbial homoeostasis on these surfaces (44). Therefore, the ef- differed for the M49 and M6 strains. In combination with the M49 fect of artificial saliva was determined for monospecies and strain, the biofilm mass was drastically decreased, whereas the mixed-species biofilms. biofilm mass was unaffected by saliva in the S. oralis 4087/GAS M6
February 2013 Volume 79 Number 4 aem.asm.org 1269 Fiedler et al. Downloaded from http://aem.asm.org/ on June 16, 2014 by guest
FIG 5 Impact of artificial saliva on biofilm formation of cocultures of S. pyogenes M49 (A) or M6 (B) and respiratory tract streptococci. After 72 h of incubation, the biofilms were quantified by safranin staining and absorption measurements at 492 nm. Light gray bars represent mixed-species biofilms in the presence of artificial saliva, and dark gray bars represent mixed-species biofilms in the absence of artificial saliva. Error bars resulted from three independent experiments, asterisks indicate significant differences (Student t test: ***, P Ͻ 0.001). (C) The panel below the graph shows SEM images of the mixed-species biofilms after 72 h of incubation in the presence of artificial saliva. combination. Consistently, artificial saliva did not change the two Compared to consequences after single-species exposure, only streptococcal biofilm layers formed by the S. oralis and GAS strategy ii had significant effects. The initial presence of the respi- strains (Fig. 5). ratory tract streptococci led to a marked reduction in HEp-2 cell Effects of respiratory tract streptococci on GAS host cell ad- adherence and internalization for both GAS serotype strains (Fig. herence and internalization. After obtaining data on the mixed- 6). Consistently, cytotoxicity of GAS toward host cells was re- species biofilm behavior of GAS and respiratory tract streptococci duced in this setting (see Fig. S5 in the supplemental material). In on inanimate supports, we were now interested in this interaction conclusion, S. salivarius and both S. oralis strains protected HEp-2 on host cell surfaces, which are typical targets for GAS adherence cells from the attack of both GAS strains to a comparable degree; and internalization. Different experimental setups were chosen to however, this only happened when the respiratory tract strepto- reflect all possible interaction scenarios: (i) GAS strains were first cocci first interacted with the host cells. allowed to contact the HEp-2 cells prior to adding the other respi- Modifications of the experimental setup, such as a washing ratory tract streptococci; (ii) the other respiratory tract strepto- step between the application of the different bacteria and a trans- cocci were initially seeded to the HEp-2 cells, and only thereafter well setup with respiratory tract streptococci in the upper com- were GAS introduced into this setting; and (iii) both species were partment and GAS plus host cells in the lower compartment, were simultaneously added to the host cells. With each strategy, we introduced in order to uncover details of the protection mecha- examined whether the respiratory tract streptococci could in- nism. As a result of both modifications, an unchanged presence of crease, delay, or even cure harmful effects inflicted by GAS on host the respiratory tract streptococci in the immediate vicinity of the cells. host cells is crucial for the observed protective effects (see, for
1270 aem.asm.org Applied and Environmental Microbiology Oral Streptococci and GAS Biofilm Formation Downloaded from http://aem.asm.org/ on June 16, 2014 by guest
FIG 6 Impact of respiratory tract streptococci on adherence and internalization of S. pyogenes to/into HEp-2 cells. The numbers of adherent (dark gray bars) and internalized (light gray bars) bacteria of S. pyogenes M49 (A) and M6 (B) alone on HEp-2 cells were set to 100%. The adherence and internalization values for both S. pyogenes strains after pretreatment of the HEp-2 cells with the respiratory tract streptococci were related to the values in the absence of the respiratory tract streptococci. Error bars reflect data from three independent experiments. (C) The adherence of both GAS strains (green) to HEp-2 cells (gray) is shown in a fluorescence/light microscopy overlay picture. example, Fig. S6 in the supplemental material) for the adherence high numbers of S. salivarius K-12 bacteria forming biofilm-like and internalization of the M49 strain. structures on the host cells. Both S. oralis strains were present in SEM pictures of the interaction of the respiratory tract strep- only low numbers on the host cell surfaces and did not attain tococci with the HEp-2 cells (Fig. 7) demonstrated the presence of biofilm-like structures. This finding suggested that the similar protective effects exerted by the respiratory tract streptococci could be based on different functional or molecular backgrounds. The S. salivarius strain could potentially act as steric barrier, whereas the S. oralis strains could use molecular ways to influence GAS-host cell interaction. Transcriptional HEp-2 cell responses upon exposure to streptococcal strains. In order to clarify some of the molecular details of the different mechanisms that the respiratory tract strep- tococci used for their similar protection of HEp-2 cells, we exam- ined the host cell transcriptomes after exposure to the protective FIG 7 Adherence of respiratory tract streptococci to HEp-2 cells. The SEM images show the adherence of S. salivarius K-12 (A), S. oralis 4087 (B), and S. streptococci by utilizing Affymetrix whole-genome transcriptome oralis DSMZ (C) strains to HEp-2 cells. microarrays. HEp-2 cells were incubated with the M49 GAS strain
February 2013 Volume 79 Number 4 aem.asm.org 1271 Fiedler et al. for 2 h as positive controls. In parallel, HEp-2 cells were preincu- planktonic S. salivarius and S. oralis generally suppressed the bated for 2 h with respiratory tract streptococci, and then GAS growth of S. pyogenes—more pronounced for the M49 than for M49 was added, followed by incubation for another 2 h. In sub- the M6 serotype strain—in direct contact experiments. However, sequent data analysis, at least 3-fold altered transcript amounts in transwell assays separating both growth partners, as well as in (signal log ratio Ն 1.58) were defined as a threshold for signifi- classical bacteriocin assays on solid media, only S. salivarius dis- cance. played this effect on the growth of both GAS serotype strains, Pre-exposure of HEp-2 cells to S. oralis DSMZ revealed 10 implying the production of diffusible active substances specifically genes with annotated functions that were differentially expressed by this species. The latter result was consistent with recent findings compared to cells exposed to GAS M49 alone. Of these genes, only on this probiotic bacterium (49, 50), provided the S. pyogenes one (endothelin-2 gene EDN2) displayed an increased transcript strain was susceptible to the substance(s) and the cell numbers of amount, while transcripts of nine genes were present at a lower the probiotic strain exceeded that of S. pyogenes by several logs. level (see Table S1 in the supplemental material). Among the The present results extend the published data since thus far genes with decreased transcript amounts was PLG (plasminogen), growth inhibition testing of S. pyogenes has only been conducted which has been associated with bacterial adhesion and internal- on solid media or in liquid assays using (semi)purified bacterio- ization (45). cin. Several bacteriocin-producing S. salivarius strains were Similarly, analysis of the HEp-2 cell transcriptomes after pre- shown to have probiotic effects and inhibit Gram-positive patho- Downloaded from incubation with S. salivarius and subsequent GAS M49 exposure gens of the upper respiratory tract such as S. pneumoniae or S. compared to GAS M49 exposure alone revealed 19 annotated pyogenes (51), e.g., by the production of the lantibiotic salivaricin genes with an at least 3-fold difference in transcript amounts. Sev- D(52). However, the S. salivarius-produced salivaricin could in- enteen of these genes exhibited lower transcript amounts, whereas duce the production of defensive agents such as the S. pyogenes only two genes showed higher transcript amounts (see Table S2 in bacteriocin SalA1. In the present study, the growth of the respira- the supplemental material). tory tract streptococci was not suppressed in the presence of dif- fusible substances from the GAS strains. In in situ studies, S. pyo- DISCUSSION genes SalA1 expression was induced by a minimum of 8 ϫ 105 S. http://aem.asm.org/ S. pyogenes as an exclusive human pathogen uses various routes to salivarius cells per ml of saliva (49). This number is above the levels enter the host. Uptake via airborne droplets is the predominant of S. salivarius in saliva from healthy children, i.e., 105 CFU/ml way of entering the respiratory tract and causing infections such as (53) and 104 to 105 CFU/ml of saliva from adults treated with the pharyngitis and tonsillitis. Many details of the first infection steps corresponding probiotic strains (54). Therefore, a GAS-associated at this anatomic site have been elucidated in the last several de- growth inhibition of respiratory tract streptococci could be irrel- cades concerning the involved GAS virulence factors and mecha- evant for the natural encounter between both bacterial species in nisms of pathogen-host cell interactions (3, 7, 9). However, before their human hosts. attaching to host tissues GAS will encounter the resident microbial Nutrient competition-derived reduced growth of one species on June 16, 2014 by guest biome. The published information about that incident is still in the presence of large inocula of another species could be the scarce. Thus, the present work had several major objectives. explanation for the observed effects of planktonic S. oralis on GAS First, the consequences of mixing different GAS serotype and vice versa. However, the strain specificity of this effect for S. strains with diverse respiratory tract streptococci should be exam- pyogenes, as well as the exclusive occurrence in direct contact but ined and quantified in planktonic and biofilm states under aspects not in transwell system experiments, insinuated the presence of of survival and virulence factor expression. Second, mixed-species additional mechanisms. Such cell-associated but still undefined biofilm development with the different species should be scruti- factors have also been observed in cocultures between S. oralis/ nized since the specific GAS target epithelia on the pharynx and Haemophilus influenzae or Moraxella catarrhalis (55) or cocul- tonsils are especially covered by bacterial biofilms (46). Third, the tures between E. faecalis/S. pneumoniae, S. aureus, or Listeria effect of respiratory tract streptococci on the interaction between ivanovii (56, 57). GAS and host cells should be inspected with specific regard to an S. pyogenes has been demonstrated to form single-species bio- antecedent, simultaneous, or subsequent presence of the poten- films in vitro and in animal model infections (29, 32, 58). The tially protective streptococci. Since the findings could have thera- protective function of a biofilm leading to an increased antibiotic peutic implications, besides representatives of the leading local resistance level stimulated the idea that biofilms could be associ- species, i.e., S. oralis (47, 48) and an established probiotic bacte- ated with long-term persistence in asymptomatic carrier persons rium, the S. salivarius K-12 strain, were chosen as interaction part- (59). However, in the pharynx, S. pyogenes encounters preexisting ners. mixed-species biofilms on its target cells. Thus, it has to establish Streptococci are the predominant bacteria in the oral cavity itself within and eventually to penetrate these biofilms. Based on and are present in numbers ranging between 5 and 8 logs per ml of data from other pathogens, it is conceivable that both establish- fluid or mg of material (46). Much less is known about the num- ment and penetration will be influenced by many factors pro- bers of S. pyogenes bacteria when introduced into the pharynx. duced by the resident microbial biome (60–63). Most probably, S. pyogenes will not be taken up as single bacteria Consequently, respiratory tract streptococci were used to study but inhaled in droplets or ingested as dried material containing defined mixed-species biofilms with the serotype M49 and M6 S. densely packed bacteria that could equal several logs. To assess pyogenes strains. Here, we could show that in general S. pyogenes numerical changes as a consequence of simultaneous presence of can form mixed-species biofilms with the streptococcal species potential antagonists, S. pyogenes wild-type strains were mixed under investigation. In most cases, increased biofilm masses were with respiratory tract bacteria in various ratios to reflect the nu- detected. Of note, GAS M49, which forms scanty biofilms as single merical variability of the natural environment. High numbers of species, was stimulated to a higher production rate in the presence
1272 aem.asm.org Applied and Environmental Microbiology Oral Streptococci and GAS Biofilm Formation of S. oralis. Moreover, in all combinations with S. oralis strains, S. pairs (Fig. 7). Although the molecular basis for S. pyogenes eukary- oralis formed the bottom layer and S. pyogenes formed the top otic cell attachment and microcolony formation is well established layer (Fig. 4). This is consistent with the pioneer character of S. (28, 31, 33), for S. salivarius thus far only surface antigen C has oralis also observed in ex vivo samples from human volunteers been determined as a responsible adhesin (84, 85). (64) and in models of oral biofilms (65). The avidity of S. oralis for S. salivarius and S. oralis strongly reduced S. pyogenes HEp-2 human cell surfaces seems to be associated with the activity of cell adhesion and internalization if present for 2 h before S. pyo- specific galactose- or sialic acid/N-acetylgalactosamine- binding genes was seeded (Fig. 6). Obviously, the established probiotic S. lectins (66, 67). Also, the interaction between S. oralis and S. pyo- salivarius K-12 strain and the two S. oralis isolates could efficiently genes could rely on the activity of lectins and appropriate sugar protect eukaryotic cells from S. pyogenes adherence, provided the moieties, since the latter species was shown to bind the lectin con- streptococcal strains have sufficient time to establish themselves canavalin A (33), as well as several human glycoproteins (68). before S. pyogenes is inoculated. According to the results of the Since pharyngeal biofilms would be bathed in saliva, the exper- bacteriocin assays (Fig. 2), this protection was not associated to iments were repeated in the presence of mucin as the major com- decreased GAS hemolysin production. Since S. salivarius was ponent of saliva (44). Generally, S. pyogenes should be able to deal demonstrated by microscopy and quantitative measurements to well with saliva. It was shown to bind to mucin by its M protein form biofilm-like structures on eukaryotic cells, while S. oralis (69). Simultaneously, the two-component regulator SptRS is in- hardly bound to this target, the protection is most probably based Downloaded from duced by the presence of saliva (70). This control circuit induces on different mechanisms. virulence factors such as Sic and SpeB, which inactivate antimi- In addition to the killing of planktonic GAS (Fig. 1), the eu- crobial peptides normally contained in saliva (70–73). Other sali- karyotic cell protection exerted by S. salivarius could be due to va-driven regulatory circuits (MalR and CcpA) couple the usage steric effects, i.e., the biofilm-like structure by which these bacteria of maltodextrin, the predominant sugar in saliva, as an exclusive cover the cells. Such protective effects of S. salivarius K-12 have energy source with the expression of several virulence factors and also been demonstrated against candidiasis in mouse models after thereby support its respiratory tract persistence (74, 75). How- oral application (86). For the S. oralis strains, which, according to ever, in earlier publications it was shown that saliva decreased the the results from the cytotoxicity assays (see Fig. S5 in the supple- http://aem.asm.org/ ability of S. pyogenes to attach to eukaryotic epithelial cells (76). mental material), guard the HEp-2 cells even more efficiently, In testing single-species biofilms, S. pyogenes and S. salivarius only small bacterial amounts bind to host cells, thereby precluding biofilm masses were strongly diminished by artificial saliva. Arti- the steric hindrance hypothesis. Thus, most probably another ficial saliva has been described to facilitate S. salivarius growth but mechanism applies. Potentially, regulatory and metabolic path- counteracts its viability during stationary phase and under starva- ways in the eukaryotic cells could be influenced by the presence of tion conditions (77). the S. oralis strains rendering the cells less susceptible to the S. In mixed-species biofilms, biofilm masses were minimized for pyogenes attack. Such beneficial effects on eukaryotic cells, as well blends of both GAS isolates with S. salivarius, whereas in combi- as the opposite, have been described for several viridans strepto- on June 16, 2014 by guest nations with the S. oralis DSMZ strain, artificial saliva had com- cocci (87–89). In contrast to the findings of Cosseau et al. (87) paratively small or rather augmenting effects. This augmenting with the human bronchial epithelial cell line 16HBE14O, a nota- effect of artificial saliva on biofilm formation of both S. oralis bly few number of transcripts showed significantly altered abun- DSMZ single- and mixed-species biofilms is consistent with the dances in HEp-2 cells first exposed to respiratory tract strepto- species’ capacity to use mucin or the mucin component sialic acid cocci and then to M49 GAS compared to the positive control: 19 in as a carbon source by expressing secreted enzymes such as -D- the case of S. salivarius and 10 in the case of S. oralis. Among the galactosidase, -D-glucosidase, and -N-acetyl-D-glucosamini- genes repressed in the presence of S. oralis is PLG, encoding for dase (78–80). However, we observed the contrary in the S. oralis plasminogen, which has been shown to be involved in the adher- 4087 strain, on which saliva apparently exerts a negative influence ence and internalization of GAS M49 to or into host cells (45). on its biofilm-forming capacity. Such strain-specific effects of sa- Although the production of an active compound has been de- liva on S. oralis have recently been described and putatively been scribed in S. salivarius that inhibits the NF-B pathway in human associated with the expression of specific adhesins (81). epithelial cells and reduces secretion of the proinflammatory in- Once integrated and established in the biofilms, GAS is located terleukin-8 (IL-8) (90), IL-8 transcript amounts were unaltered in closer to the underlying epithelial cell layers. Binding of S. pyo- our experimental setup. Both streptococcal species lead to a genes to eukaryotic cells is indispensable for causing disease and downregulation of genes involved in cGMP, GTPase, RAB, and persisting in its human host (3). The influence of simultaneously RAS signaling (GFM1, HRSALS, GUCA1B, RAB6A, and present bacteria on this interaction is not well studied. Thus far, RAPGEF2), as well as a changed expression of genes involved in only for Moraxella catarrhalis, another nasopharyngeal pathogen, apoptosis regulation (XRCC5, CCAR1, and MNDA). Further- was coaggregation with S. pyogenes reported to lead to increased more, upregulation of the expression of endothelin-2 in the case of eukaryotic cell adherence but decreased internalization (82, 83). S. oralis could lead to an enhanced activation and acquisition of To collect more data on the interaction of two bacterial and neutrophils and macrophages in vivo. one eukaryotic partner, HEp-2 respiratory epithelial cells were Taken together, the study showed that S. oralis could induce exposed to combinations of the two S. pyogenes strains and the S. protection of the eukaryotic cells even without largely binding to oralis and S. salivarius strains. When testing the growth of single the cells or producing bacteriocins affecting S. pyogenes. Also, species on the eukaryotic cells by SEM inspection, S. pyogenes transcriptome analysis does not uncover apparent mechanisms by strains formed structures resembling microcolonies, S. salivarius which S. oralis could protect the eukaryotic cells. The surprisingly formed large masses on the cell surface, while the S. oralis strains less effective protection of HEp-2 cells by S. salivarius also in- only occasionally adhered to the eukaryotic cells as single cells or volved expression changes in only a restricted panel of genes and,
February 2013 Volume 79 Number 4 aem.asm.org 1273 Fiedler et al. instead, could predominantly be exerted by building an almost evaluation of the principal tissue reservoir for group A streptococci iso- impermeable, potentially bacteriocin-producing wall of S. sali- lated from normally sterile sites. J. Infect. Dis. 176:177–182. varius biofilm in front of the host cell target. 19. Moore WE, Moore LV. 1994. The bacteria of periodontal diseases. Peri- odontol. 2000 5:66–77. We demonstrated here that S. pyogenes can establish itself in 20. Kolenbrander PE. 2000. Oral microbial communities: biofilms, interac- mixed-species biofilms with typical species of the resident pharyn- tions, and genetic systems. Annu. Rev. Microbiol. 54:413–437. geal microbial biome. However, the species, i.e., S. oralis, which 21. Aas JA, Paster BJ, Stokes LN, Olsen I, Dewhirst FE. 2005. Defining the most efficiently supports S. pyogenes growth in mixed-species bio- normal bacterial flora of the oral cavity. J. Clin. Microbiol. 43:5721–5732. 22. Grice EA, Segre JA. 2011. The skin microbiome. Nat. Rev. Microbiol. films and simultaneously does not affect virulence factor produc- 9:244–253. tion in the beta-hemolytic streptococci, also most efficiently pro- 23. Grice EA, Kong HH, Conlan S, Deming CB, Davis J, Young AC, tects underlying epithelial host cells from S. pyogenes-inflicted Bouffard GG, Blakesley RW, Murray PR, Green ED, Turner ML, Segre damages. JA. 2009. Topographical and temporal diversity of the human skin micro- biome. Science 324:1190–1192. 24. Wade W. 2002. Unculturable bacteria–the uncharacterized organisms ACKNOWLEDGMENTS that cause oral infections. J. R. Soc. Med. 95:81–83. This study was financially supported by the German Ministry of Educa- 25. Parahitiyawa NB, Scully C, Leung WK, Yam WC, Jin LJ, Samaranayake LP. 2010. Exploring the oral bacterial flora: current status and future tion and Research (BMBF, SysMO-LAB2, ERA-NET1, and ERA-NET2 directions. Oral Dis. 16:136–145. Downloaded from initiatives) and the German Academic Exchange Service (DAAD). 26. Guglielmetti S, Taverniti V, Minuzzo M, Arioli S, Stuknyte M, Karp M, We thank Gerhard Fulda, Wolfgang Labs and Michael Laue from the Mora D. 2010. Oral bacteria as potential probiotics for the pharyngeal Electron Microscopy Centre of the University of Rostock for their help mucosa. Appl. Environ. Microbiol. 76:3948–3958. with generating SEM pictures and Jana Normann for excellent technical 27. Guglielmetti S, Taverniti V, Minuzzo M, Arioli S, Zanoni I, Stuknyte assistance. M, Granucci F, Karp M, Mora D. 2010. A dairy bacterium displays in vitro probiotic properties for the pharyngeal mucosa by antagonizing group A streptococci and modulating the immune response. Infect. Im- REFERENCES mun. 78:4734–4743. 1. Cunningham MW. 2000. Pathogenesis of group A streptococcal infec- 28. Akiyama H, Morizane S, Yamasaki O, Oono T, Iwatsuki K. 2003. tions. Clin. Microbiol. Rev. 13:470–511. Assessment of Streptococcus pyogenes microcolony formation in infected http://aem.asm.org/ 2. Carapetis JR, Steer AC, Mulholland EK, Weber M. 2005. The global skin by confocal laser scanning microscopy. J. Dermatol. Sci. 32:193–199. burden of group A streptococcal diseases. Lancet Infect. Dis. 5:685–694. 29. Lembke C, Podbielski A, Hidalgo-Grass C, Jonas L, Hanski E, Kreike- 3. Kreikemeyer B, Klenk M, Podbielski A. 2004. The intracellular status of meyer B. 2006. Characterization of biofilm formation by clinically rele- Streptococcus pyogenes: role of extracellular matrix-binding proteins and vant serotypes of group A streptococci. Appl. Environ. Microbiol. 72: their regulation. Int. J. Med. Microbiol. 294:177–188. 2864–2875. 4. Hynes W. 2004. Virulence factors of the group A streptococci and genes 30. Swidsinski A, Goktas O, Bessler C, Loening-Baucke V, Hale LP, Andree that regulate their expression. Front. Biosci. 9:3399–3433. H, Weizenegger M, Holzl M, Scherer H, Lochs H. 2007. Spatial organi- 5. Olsen RJ, Shelburne SA, Musser JM. 2009. Molecular mechanisms un- zation of microbiota in quiescent adenoiditis and tonsillitis. J. Clin. derlying group A streptococcal pathogenesis. Cell Microbiol. 11:1–12. Pathol. 60:253–260.
6. McIver KS. 2009. Stand-alone response regulators controlling global vir- 31. Frick IM, Mörgelin M, Björck L. 2000. Virulent aggregates of Streptococ- on June 16, 2014 by guest ulence networks in Streptococcus pyogenes. Contrib. Microbiol. 16:103– cus pyogenes are generated by homophilic protein-protein interactions. 119. Mol. Microbiol. 37:1232–1247. 7. Fiedler T, Sugareva V, Patenge N, Kreikemeyer B. 2010. Insights into 32. Cho KH, Caparon MG. 2005. Patterns of virulence gene expression differ Streptococcus pyogenes pathogenesis from transcriptome studies. Future between biofilm and tissue communities of Streptococcus pyogenes. Mol. Microbiol. 5:1675–1694. Microbiol. 57:1545–1556. 8. Dmitriev AV, Chaussee MS. 2010. The Streptococcus pyogenes proteome: 33. Manetti AG, Zingaretti C, Falugi F, Capo S, Bombaci M, Bagnoli F, maps, virulence factors, and vaccine candidates. Future Microbiol. Gambellini G, Bensi G, Mora M, Edwards AM, Musser JM, Graviss EA, 5:1539–1551. Telford JL, Grandi G, Margarit I. 2007. Streptococcus pyogenes pili pro- 9. Bessen DE, Lizano S. 2010. Tissue tropisms in group A streptococcal mote pharyngeal cell adhesion and biofilm formation. Mol. Microbiol. infections. Future Microbiol. 5:623–638. 64:968–983. 10. Podbielski A, Kreikemeyer B. 2001. Persistence of group A streptococci 34. Manetti AG, Köller T, Becherelli M, Buccato S, Kreikemeyer B, Pod- in eukaryotic cells: a safe place? Lancet 358:3–4. bielski A, Grandi G, Margarit I. 2010. Environmental acidification drives 11. O¨ sterlund A, Engstrand L. 1997. An intracellular sanctuary for Strepto- Streptococcus pyogenes pilus expression and microcolony formation on coccus pyogenes in human tonsillar epithelium: studies of asymptomatic epithelial cells in a FCT-dependent manner. PLoS One 5:e13864. c18 doi: carriers and in vitro cultured biopsies. Acta Otolaryngol. 117:883–888. 10.1371/journal.pone.0013864. 12. Facinelli B, Spinaci C, Magi G, Giovanetti E, Varaldo E. 2001. Associ- 35. Kimura KR, Nakata M, Sumitomo T, Kreikemeyer B, Podbielski A, ation between erythromycin resistance and ability to enter human respi- Terao Y, Kawabata S. 2012. Involvement of T6 pili in biofilm formation ratory cells in group A streptococci. Lancet 358:30–33. by serotype M6 Streptococcus pyogenes. J. Bacteriol. 194:804–812. 13. Reid G. 2005. The importance of guidelines in the development and 36. Maddocks SE, Wright CJ, Nobbs AH, Brittan JL, Franklin L, Stromberg application of probiotics. Curr. Pharm. Des. 11:11–16. N, Kadioglu A, Jepson MA, Jenkinson HF. 2011. Streptococcus pyogenes 14. Tagg JR, Dierksen KP. 2003. Bacterial replacement therapy: adapting antigen I/II-family polypeptide AspA shows differential ligand-binding ‘germ warfare’ to infection prevention. Trends Biotechnol. 21:217–223. properties and mediates biofilm formation. Mol. Microbiol. 81:1034– 15. Walls T, Power D, Tagg J. 2003. Bacteriocin-like inhibitory substance 1049. (BLIS) production by the normal flora of the nasopharynx: potential to 37. Podbielski A, Woischnik M, Leonard BA, Schmidt KH. 1999. Charac- protect against otitis media? J. Med. Microbiol. 52:829–833. terization of Nra, a global negative regulator gene in group A streptococci. 16. Rosenkranz W, Grundmann E. 1994. Immunomodulator action of Mol. Microbiol. 31:1051–1064. living, nonpathogenic Enterococcus faecalis bacteria from humans. 38. Cisar JO, Kolenbrander PE, McIntire FC. 1979. Specificity of coaggre- Arzneimittelforschung 44:691–695. (In German.) gation reactions between human oral streptococci and strains of Actino- 17. Habermann W, Zimmermann K, Skarabis H, Kunze R, Rusch V. 2002. myces viscosus or Actinomyces naeslundii. Infect. Immun. 24:742–752. Reduction of acute recurrence in patients with chronic recurrent hyper- 39. Köller T, Manetti AG, Kreikemeyer B, Lembke C, Margarit I, Grandi G, trophic sinusitis by treatment with a bacterial immunostimulant (Entero- Podbielski A. 2010. Typing of the pilus-protein-encoding FCT region and coccus faecalis Bacteriae of human origin. Arzneimittelforschung 52:622– biofilm formation as novel parameters in epidemiological investigations 627. (In German.) of Streptococcus pyogenes isolates from various infection sites. J. Med. Mi- 18. Fiorentino TR, Beall B, Mshar P, Bessen DE. 1997. A genetic-based crobiol. 59:442–452.
1274 aem.asm.org Applied and Environmental Microbiology Oral Streptococci and GAS Biofilm Formation
40. Abbott JD, Shannon R. 1958. A method for typing Shigella sonnei, using 62. Stoodley P, Sauer K, Davies DG, Costerton JW. 2002. Biofilms as colicine production as a marker. J. Clin. Pathol. 11:71–77. complex differentiated communities. Annu. Rev. Microbiol. 56:187–209. 41. Molinari G, Rohde M, Talay SR, Chhatwal GS, Beckert S, Podbielski A. 63. Suntharalingam P, Cvitkovitch DG. 2005. Quorum sensing in strepto- 2001. The role played by the group A streptococcal negative regulator Nra coccal biofilm formation. Trends Microbiol. 13:3–6. on bacterial interactions with epithelial cells. Mol. Microbiol. 40:99–114. 64. Li J, Helmerhorst EJ, Leone CW, Troxler RF, Yaskell T, Haffajee AD, 42. Fiedler T, Kreikemeyer B, Sugareva V, Redanz S, Arlt R, Standar K, Socransky SS, Oppenheim FG. 2004. Identification of early microbial Podbielski A. 2010. Impact of the Streptococcus pyogenes Mga regulator on colonizers in human dental biofilm. J. Appl. Microbiol. 97:1311–1318. human matrix protein binding and interaction with eukaryotic cells. Int. J. 65. Sanchez MC, Llama-Palacios A, Blanc V, Leon R, Herrera D, Sanz M. Med. Microbiol. 300:248–258. 2011. Structure, viability and bacterial kinetics of an in vitro biofilm model 43. Palmer RJ, Jr, Gordon SM, Cisar JO, Kolenbrander PE. 2003. Coaggre- using six bacteria from the subgingival microbiota. J. Periodontal Res. gation-mediated interactions of streptococci and actinomyces detected in 46:252–260. initial human dental plaque. J. Bacteriol. 185:3400–3409. 66. Murray PA, Levine MJ, Tabak LA, Reddy MS. 1982. Specificity of 44. Amerongen AV, Veerman EC. 2002. Saliva: the defender of the oral salivary-bacterial interactions. II. Evidence for a lectin on Streptococcus cavity. Oral Dis. 8:12–22. sanguis with specificity for a NeuAc␣2, 3Ga11, 3Ga1NAc sequence. 45. Siemens N, Patenge N, Otto J, Fiedler T, Kreikemeyer B. 2011. Strep- Biochem. Biophys. Res. Commun. 106:390–396. tococcus pyogenes M49 plasminogen/plasmin binding facilitates keratino- 67. Weerkamp AH, McBride BC. 1980. Adherence of Streptococcus salivarius cyte invasion via integrin-integrin-linked kinase (ILK) pathways and pro- HB and HB-7 to oral surfaces and saliva-coated hydroxyapatite. Infect. tects from macrophage killing. J. Biol. Chem. 286:21612–21622. Immun. 30:150–158.
46. Wilson M. 2005. Microbial inhabitants of humans: their ecology and role 68. Hytonen J, Haataja S, Finne J. 2006. Use of flow cytometry for the Downloaded from in health and disease. Cambridge University Press, Cambridge, United adhesion analysis of Streptococcus pyogenes mutant strains to epithelial Kingdom. cells: investigation of the possible role of surface pullulanase and cysteine 47. Kreth J, Merritt J, Qi F. 2009. Bacterial and host interactions of oral protease, and the transcriptional regulator Rgg. BMC Microbiol. 6:18. doi: streptococci. DNA Cell Biol. 28:397–403. 10.1186/1471-2180-6-18. 48. Rosan B, Lamont RJ. 2000. Dental plaque formation. Microbes. Infect. 69. Ryan PA, Pancholi V, Fischetti VA. 2001. Group A streptococci bind to 2:1599–1607. mucin and human pharyngeal cells through sialic acid-containing recep- 49. Wescombe PA, Upton M, Dierksen KP, Ragland NL, Sivabalan S, tors. Infect. Immun. 69:7402–7412. Wirawan RE, Inglis MA, Moore CJ, Walker GV, Chilcott CN, Jenkinson 70. Shelburne SA, Sumby P, III, Sitkiewicz I, Granville C, Deleo FR, Musser HF, Tagg JR. 2006. Production of the lantibiotic salivaricin A and its JM. 2005. Central role of a bacterial two-component gene regulatory sys- variants by oral streptococci and use of a specific induction assay to detect tem of previously unknown function in pathogen persistence in human http://aem.asm.org/ their presence in human saliva. Appl. Environ. Microbiol. 72:1459–1466. saliva. Proc. Natl. Acad. Sci. U. S. A. 102:16037–16042. 50. Hyink O, Wescombe PA, Upton M, Ragland N, Burton JP, Tagg JR. 71. Fernie-King BA, Seilly DJ, Davies A, Lachmann PJ. 2002. Streptococcal 2007. Salivaricin A2 and the novel lantibiotic salivaricin B are encoded at inhibitor of complement inhibits two additional components of the mu- adjacent loci on a 190-kilobase transmissible megaplasmid in the oral cosal innate immune system: secretory leukocyte proteinase inhibitor and probiotic strain Streptococcus salivarius K-12. Appl. Environ. Microbiol. lysozyme. Infect. Immun. 70:4908–4916. 73:1107–1113. 72. Fernie-King BA, Seilly DJ, Lachmann PJ. 2004. The interaction of strep- 51. Santagati M, Scillato M, Patane F, Aiello C, Stefani S. 2012. Bacteriocin- tococcal inhibitor of complement (SIC) and its proteolytic fragments with producing oral streptococci and inhibition of respiratory pathogens. the human beta defensins. Immunology 111:444–452. FEMS Immunol. Med. Microbiol. 65:23–31. 73. Frick IM, PÅkesson Rasmussen M, Schmidtchen A, Björck L. 2003. SIC,
52. Birri DJ, Brede DA, Nes IF. 2012. Salivaricin D, a novel intrinsically a secreted protein of Streptococcus pyogenes that inactivates antibacterial on June 16, 2014 by guest trypsin-resistant lantibiotic from Streptococcus salivarius 5M6c isolated peptides. J. Biol. Chem. 278:16561–16566. from a healthy infant. Appl. Environ. Microbiol. 78:402–410. 74. Shelburne SA, Keith D, III, Horstmann N, Sumby P, Davenport MT, 53. Carlsson J, Grahnen H, Jonsson G, Wikner S. 1970. Early establishment Graviss EA, Brennan RG, Musser JM. 2008. A direct link between car- of Streptococcus salivarius in the mouth of infants. J. Dent. Res. 49:415– bohydrate utilization and virulence in the major human pathogen group A 418. Streptococcus. Proc. Natl. Acad. Sci. U. S. A. 105:1698–1703. 54. Horz HP, Meinelt A, Houben B, Conrads G. 2007. Distribution and 75. Shelburne SA, Okorafor N, III, Sitkiewicz I, Sumby P, Keith D, Patel P, persistence of probiotic Streptococcus salivarius K-12 in the human oral Austin C, Graviss EA, Musser JM. 2007. Regulation of polysaccharide cavity as determined by real-time quantitative polymerase chain reaction. utilization contributes to the persistence of group A streptococcus in the Oral Microbiol. Immunol. 22:126–130. oropharynx. Infect. Immun. 75:2981–2990. 55. Bernstein JM, Faden HS, Scannapieco F, Belmont M, Dryja D, Wolf J. 76. Courtney HS, Hasty DL. 1991. Aggregation of group A streptococci by 2002. Interference of nontypeable Haemophilus influenzae and Moraxella human saliva and effect of saliva on streptococcal adherence to host cells. catarrhalis by Streptococcus oralis in adenoid organ culture: a possible Infect. Immun. 59:1661–1666. strategy for the treatment of the otitis-prone child. Ann. Otol. Rhinol. 77. Roger P, Delettre J, Bouix M, Beal C. 2011. Characterization of Strep- Laryngol. 111:696–700. tococcus salivarius growth and maintenance in artificial saliva. J. Appl. 56. Bottone E, Allerhand J, Pisano MA. 1971. Characteristics of a bacteriocin Microbiol. 111:631–641. derived from Streptococcus faecalis var. zymogenes antagonistic to Diplo- 78. Byers HL, Homer KA, Beighton D. 1996. Utilization of sialic acid by coccus pneumoniae. Appl. Microbiol. 22:200–204. viridans streptococci. J. Dent. Res. 75:1564–1571. 57. Galvez A, Valdivia E, Abriouel H, Camafeita E, Mendez E, Martinez- 79. van der Hoeven JS, van den Kieboom CW, Camp PJ. 1990. Utilization Bueno M, Maqueda M. 1998. Isolation and characterization of enterocin of mucin by oral Streptococcus species. Antonie Van Leeuwenhoek 57:165– EJ97, a bacteriocin produced by Enterococcus faecalis EJ97. Arch. Micro- 172. biol. 171:59–65. 80. van der Hoeven JS, Camp PJ. 1991. Synergistic degradation of mucin by 58. Takemura N, Noiri Y, Ehara A, Kawahara T, Noguchi N, Ebisu S. 2004. Streptococcus oralis and Streptococcus sanguis in mixed chemostat cultures. Single species biofilm-forming ability of root canal isolates on gutta- J. Dent. Res. 70:1041–1044. percha points. Eur. J. Oral Sci. 112:523–529. 81. Dorkhan M, Chavez de Paz LE, Skepo M, Svensater G, Davies JR. 2012. 59. Baldassarri L, Creti R, Recchia S, Imperi M, Facinelli B, Giovanetti E, Effects of saliva or serum coating on adherence of Streptococcus oralis Pataracchia M, Alfarone G, Orefici G. 2006. Therapeutic failures of strains to titanium. Microbiology 158:390–397. antibiotics used to treat macrolide-susceptible Streptococcus pyogenes in- 82. Brook I, Gober AE. 2006. Increased recovery of Moraxella catarrhalis and fections may be due to biofilm formation. J. Clin. Microbiol. 44:2721– Haemophilus influenzae in association with group A beta-hemolytic strep- 2727. tococci in healthy children and those with pharyngo-tonsillitis. J. Med. 60. Davies DG, Parsek MR, Pearson JP, Iglewski BH, Costerton JW, Green- Microbiol. 55:989–992. berg EP. 1998. The involvement of cell-to-cell signals in the development 83. Lafontaine ER, Wall D, Vanlerberg SL, Donabedian H, Sledjeski DD. of a bacterial biofilm. Science 280:295–298. 2004. Moraxella catarrhalis coaggregates with Streptococcus pyogenes and 61. Federle MJ, Bassler BL. 2003. Interspecies communication in bacteria. J. modulates interactions of S. pyogenes with human epithelial cells. Infect. Clin. Invest. 112:1291–1299. Immun. 72:6689–6693.
February 2013 Volume 79 Number 4 aem.asm.org 1275 Fiedler et al.
84. Weerkamp AH, Jacobs T. 1982. Cell wall-associated protein antigens of commensal Streptococcus salivarius K-12 downregulates the innate im- Streptococcus salivarius: purification, properties, and function in adher- mune responses of human epithelial cells and promotes host-microbe ence. Infect. Immun. 38:233–242. homeostasis. Infect. Immun. 76:4163–4175. 85. Weerkamp AH, Handley PS, Baars A, Slot JW. 1986. Negative staining 88. Stinson MW, Alder S, Kumar S. 2003. Invasion and killing of human and immunoelectron microscopy of adhesion-deficient mutants of Strep- endothelial cells by viridans group streptococci. Infect. Immun. 71:2365– tococcus salivarius reveal that the adhesive protein antigens are separate 2372. classes of cell surface fibril. J. Bacteriol. 165:746–755. 89. Hasegawa T, Minami M, Okamoto A, Tatsuno I, Isaka M, Ohta M. 86. Ishijima SA, Hayama K, Burton JP, Reid G, Okada M, Matsushita Y, 2010. Characterization of a virulence-associated and cell-wall-located Abe S. 2012. Effect of Streptococcus salivarius K-12 on the in vitro growth DNase of Streptococcus pyogenes. Microbiology 156:184–190. of Candida albicans and its protective effect in an oral candidiasis model. 90. Kaci G, Lakhdari O, Dore J, Ehrlich SD, Renault P, Blottiere HM, Appl. Environ. Microbiol. 78:2190–2199. Delorme C. 2011. Inhibition of the NF-B pathway in human intestinal 87. Cosseau C, Devine DA, Dullaghan E, Gardy JL, Chikatamarla A, Gel- epithelial cells by commensal Streptococcus salivarius. Appl. Environ. Mi- latly S, Yu LL, Pistolic J, Falsafi R, Tagg J, Hancock RE. 2008. The crobiol. 77:4681–4684. Downloaded from http://aem.asm.org/ on June 16, 2014 by guest
1276 aem.asm.org Applied and Environmental Microbiology International Journal of General Medicine Dovepress open access to scientific and medical research
Open Access Full Text Article O RIGINAL R ESEARCH Preliminary pediatric clinical evaluation of the oral probiotic Streptococcus salivarius K12 in preventing recurrent pharyngitis and/or tonsillitis caused by Streptococcus pyogenes and recurrent acute otitis media
Francesco Di Pierro1 Background: The oral probiotic Streptococcus salivarius K12 has been shown clearly to antago- Guido Donato2 nize the growth of Streptococcus pyogenes, the most important bacterial cause of pharyngeal Federico Fomia3 infections in humans, by releasing two bacteriocins named salivaricin A2 and salivaricin B. Teresa Adami4 Unpublished observations indicate that it can also antagonize the growth of other bacteria Domenico Careddu5 involved in acute otitis media. Because of its ability to colonize the oral cavity and its safety Claudia Cassandro6 profile, we have tested its efficacy in reducing the incidence of streptococcal pharyngitis and/or tonsillitis and episodes of acute otitis media. Roberto Albera6 Methods: We enrolled 82 children, including 65 with and 17 without a recent diagnosis of 1 Scientific Department, Velleja recurrent oral streptococcal pathology. Of those with recurrent pathology, 45 were treated daily Research, Milano, 2ASL 1, Cuneo, 3ASL 3, Brescia, 4Infective Diseases, for 90 days with an oral slow-release tablet containing five billion colony-forming units of Verona, 5ASL 13, Novara, 6Surgical S. salivarius K12 (Bactoblis®), and the remaining 20 served as an untreated control group. The Science Department, Università degli 17 children without a recent diagnosis of recurrent oral pathology were used as an additional Studi, Torino, Italy control group. After 90 days of treatment, a 6-month follow-up period without treatment was included to evaluate a possible persistent protective role for the previously administered product. Results: The 41 children who completed the 90-day course of Bactoblis showed a reduction in their episodes of streptococcal pharyngeal infection (about 90%) and/or acute otitis media (about 40%), calculated by comparing infection rates in the previous year. The 90-day treatment also reduced the reported incidence of pharyngeal and ear infections by about 65% in the 6-month follow-up period during which the product was not administered. Subjects tolerated the product well, with no side effects or dropouts reported. Conclusion: Prophylactic administration of S. salivarius K12 to children with a history of recurrent oral streptococcal pathology reduced episodes of streptococcal pharyngeal infections and/or tonsillitis as well as episodes of acute otitis media. Keywords: BLIS K12, bacteriocin-like inhibitory substance K12, Streptococcus salivarius K12, Bactoblis®, pharyngitis, tonsillitis, acute otitis media
Introduction Correspondence: Francesco Di Pierro To date, the use of probiotic strains has almost exclusively focused on the gastrointestinal Velleja Research, Viale Lunigiana 23, 20125, Milano, Italy benefits of ingestion of selected bacteria obtained from intestinal sources.1 However, Tel +39 34 9552 7663 the potential for probiotic intervention at nonintestinal body sites suggests possible Fax +39 05 2351 1894 Email [email protected] application of effector strains of species selected from alternative target tissues in order submit your manuscript | www.dovepress.com International Journal of General Medicine 2012:5 991–997 991 Dovepress © 2012 Di Pierro et al, publisher and licensee Dove Medical Press Ltd. This is an Open Access article http://dx.doi.org/10.2147/IJGM.S38859 which permits unrestricted noncommercial use, provided the original work is properly cited. Di Pierro et al Dovepress to obtain more specific and durable benefits.2 Streptococcus diagnosis of obstructive sleep apnea syndrome, respiratory, salivarius K12, also known as BLIS (bacteriocin-like and/or systemic severe pathologies; asthma; and being a inhibitory substance) K12, was isolated in New Zealand healthy carrier of S. pyogenes. Eighty-two children were from the mouth of a healthy child.3 It is known to release two enrolled in the study, which was conducted from October 2011 lantibiotic bacteriocins named salivaricin A2 and salivaricin to August 2012. Sixty-five were with and 17 were without a B, with high efficiency.4 Via these two lantibiotics, encoded by diagnosis of not less than three episodes of recurrent pharyngitis a 190 kb megaplasmid,5 BLIS K12 can effectively counteract and/or tonsillitis in the previous year confirmed by throat swab the growth of -hemolytic (group A) Streptococcus pyogenes, (positive for group A hemolytic Streptococcus). In agreement a common cause of pharyngitis, tonsillitis, and acute otitis with their parents, 45 of the 65 children with recurrent oral media.6 This inhibitory action is strongly linked to the release pathology were selected as the treated group and 20 as the not- of lantibiotics because BLIS K12 P( ), the same strain without treated group. The 17 children enrolled without a diagnosis of the 190 kb plasmid, does not show any antagonism of growth recurrent pathology were selected as a not-treated group. The of Streptococcus pyogenes.7 recurrent-treated (n = 45), recurrent-not-treated (n = 20), and In addition to its action against S. pyogenes, BLIS K12 can not-recurrent-not-treated (n = 17) subjects were followed for also inhibit growth of Haemophilus influenzae, Streptococcus 90 days. After this period, 41 of the 45 children in the recurrent- pneumoniae, Moraxella catarrhalis, Micrococcus luteus, treated group were considered appropriate for the aim of the Streptococcus anginosus, Eubacterium saburreum, and study, their parents having declared total adherence to the Micromonas micros.8 Many of these are potential pathogens treatment protocol. in the ear and oral cavity, causing acute otitis media9 and In a second part of the study, in accordance with parental halitosis.10 Preliminary investigations have shown that consent, 16 of the 41 children in the recurrent-treated group BLIS K12 colonizes the upper respiratory tract of infants and 14 of the 20 children in the recurrent-not-treated group (oral cavity, nasopharyngeal and adenoid tissues)11 and with were enrolled for follow-up lasting a further 6 months, good persistence, given that after only 3 days of administration, during which the product was not administered. The product, it can still be detected 32 days later.12 Therefore, because Bactoblis®, in agreement with Italian law (169/2004), of its good colonization capability and very high safety was notified to the Minister of Health on July 5, 2011 and profile,13,14 combined with its reputed ability to counteract registered as a food supplement. At the time of manufacturing, oral pathology,15 we decided to evaluate the preventive role Bactoblis contains five billion colony-forming units per tablet of BLIS K12 when administered to children having a history of S. salivarius K12 ATCC BAA-1 024 (BLIS Technologies of recurrent streptococcal pharyngitis and/or tonsillitis. Our Ltd, North Dunedin, New Zealand) and is manufactured by main endpoint was the number of episodes of streptococcal SIIT, (Trezzano S/N, Milan,Italy). In accordance with the infections and acute otitis media. treatment protocol, the product is administered as one tablet daily for 90 days. The product, an oral, round-shaped, vanilla- Materials and methods tasting, slow-release tablet (dissolving in about 5 minutes) This research was carried out in the field of routine clinical is administered just before bedtime (ie, after teeth brushing practice, following international guidelines and in line with and/or mouthwashing). Correct administration of the product the principles outlined in the Declaration of Helsinki, such that requires that the tablet is not chewed or directly swallowed, but approval from local ethics boards was not required. The study is sucked for about 4–5 minutes. Before administration of the was carried out in five Italian day care centers, located in Cuneo, first tablet, a chlorhexidine 0.2% mouthwash is recommended Brescia, Verona, Novara, and Torino, where it is not mandatory in order to enhance the colonization process of the strain, to obtain ethical approval in order to perform experimental reducing extreme competition from endogenous S. salivarius protocols on nutraceutical products. Inclusion criteria were: inhabiting the mouth. informed signed consent from parents; age 3–12 years; total The primary study endpoints were evaluation by absence of symptoms of infective disease at the time of medical visits, results of a throat swab, and otoscopic enrollment; and diagnosis of recurrent streptococcal (group A signs of acute otitis media, and episodes of pharyngitis, hemolytic Streptococcus) pharyngitis and/or tonsillitis in the tonsillitis, and/or acute otitis media in the recurrent-treated, previous year. Exclusion criteria were: lack of parental signature recurrent-not-treated, and not-recurrent-not-treated groups of informed consent; age below 3 years or above 12 years; during 90 days of treatment with the product and during
992 submit your manuscript | www.dovepress.com International Journal of General Medicine 2012:5 Dovepress Dovepress Preventive role of BLIS K12 in oral and ear pathologies the 6-month follow-up period in which the product was not Table 2 Episodes of streptococcal oral pathology during 90 days administered. Secondary study endpoints were tolerability, of treatment with BLIS K12 in children (n = 41) with recurrent compliance, and side effects during the 90 days of treatment. streptococcal pharyngitis and/or tonsillitis As regards to tolerability and compliance, we defined four Pharyngitis/ Pharyngitis/ tonsillitis in the tonsillitis during terms able to describe the different conditions, ie, very good, previous year BLIS K12 good, acceptable, and unacceptable. Number of episodes 152 (1 year) 3 (90 days) Incidence/month/child 0.309 0.024* Statistical analysis Delta (%) 92.2 The statistical analysis was performed using the standardized Notes: *P , 0.0001 considering 152 episodes and P , 0.01 considering 38 episodes (152/4). incidence ratio and its confidence interval 100 (1 )% as Abbreviation: BLIS, bacteriocin-like inhibitory substance. proposed by Vandenbroucke.16 If the range includes 100%, it is highly likely that the difference between observed and expected values is due to chance (random fluctuations in Table 3 Episodes of streptococcal oral pathology during 90 days the data). On the other hand, if the confidence interval does in children (n = 20) with recurrent streptococcal pharyngitis not include 100%, it is very likely that the difference is not and/or tonsillitis not treated with BLIS K12 due to chance. The statistical comparisons between treatment Pharyngitis/ Pharyngitis/ and past controls are shown in Tables 2–7, where the real tonsillitis in the tonsillitis previous year in 90 days number of episodes is reported along with, in table notes, the Number of episodes 78 27 same value/4 to allow a real statistical comparison, otherwise Incidence/month/child 0.325 0.45* not possible comparing values obtained in 12 months with Delta (%) +38.5 values obtained in 3 months. Note: *P , . considering episodes and not significant considering . episodes (78/4). Abbreviation: BLIS, bacteriocin-like inhibitory substance. Results In this study, we attempted to establish the preventive role played by BLIS K12 when administered to children Table 4 Episodes of streptococcal oral pathology during 90 days with a history of recurrent pharyngitis and/or tonsillitis of in children (n = 17) without recurrent streptococcal pharyngitis streptococcal origin. The main endpoint was the number of and/or tonsillitis and not treated with BLIS K12 episodes of oral streptococcal pathology and/or acute otitis Pharyngitis/ Pharyngitis/ media. The 82 children enrolled in this study were assigned to tonsillitis in tonsillitis one of three groups, ie, recurrent-treated, recurrent-not-treated, previous year in 90 days or not-recurrent-not-treated. Four children were eliminated Number of episodes 4 4 Incidence/month/child 0.020 0.078* because of failure to adhere strictly to therapy. As shown in Delta (%) +290 Table 1, the demographic characteristics of the 78 therapy- Note: Not significant considering four episodes and P , 0.05 considering one adherent enrolled children did not differ statistically. episode (4/4). Abbreviation: BLIS, bacteriocin-like inhibitory substance. Statistically significant results were seen during the 90 days of treatment with BLIS K12 (Table 2) in terms of episodes of streptococcal pharyngitis and/or tonsillitis in the 41 children having had more than three episodes of streptococcal pharyngitis Table 5 Episodes of acute otitis media during the 90 days of treatment with BLIS K12 in children (n = 41) with recurrent and/or tonsillitis in the previous year. These 41 children had streptococcal pharyngitis and/or tonsillitis AOM in AOM during Table 1 Demographic parameters of enrolled children previous year BLIS K12 Group n M F Age, years* Number of episodes 27 4 (90 days) Incidence/month/child 0.055 0.033* Recurrent-treated 41 19 22 4.5 ± 1.4 Delta (%) 40 Recurrent-not-treated 20 9 11 4.2 ± 1.3 Note: *P , . considering episodes and not significant considering . Not-recurrent-not-treated 17 9 8 5.1 ± 1.5 episodes (27/4). Note: *Expressed as the median ± standard deviation. Abbreviations: AOM, acute otitis media; BLIS, bacteriocin-like inhibitory Abbreviations: n, number of children; M, males; F, females. substance.
International Journal of General Medicine 2012:5 submit your manuscript | www.dovepress.com 993 Dovepress Di Pierro et al Dovepress had 152 episodes in 12 months, and during the 90 days of In the other control (not-recurrent-not-treated) children treatment, only three episodes of oral streptococcal infection enrolled without a diagnosis of recurrent streptococcal oral were diagnosed, with the calculated incidence per month per disease, there was an increase in terms of episodes of acute child dropping from 0.3109 to 0.024. otitis media in comparison with the previous year, as shown The control group, (children enrolled with a diagnosis of by the incidence per month per child (Table 7). This value recurrent oral streptococcal disease but not-treated) showed an increased from 0.020 to 0.039, again likely for seasonal increase in terms of episodes of streptococcal pharyngitis and/ reasons. or tonsillitis in comparison with the previous year, as shown The evaluation of tolerability, compliance, and side by the incidence per month per child (Table 3). This increase, effects is reported only for the recurrent-treated group as from 0.325 to 0.45, is likely due to seasonal reasons being the enrolled in terms of number (n = 45). As shown in Table 8, first value calculated, considering also warm months where the treatment with BLIS K12 seemed to be well tolerated and incidence normally decreases, while the second value calcu- devoid of side effects. The four children who were excluded lated is only considered during the three winter months. from the study were removed because they did not adhere The other controls, (not-recurrent not-treated children strictly to the study therapy, not because of side effects. enrolled without a diagnosis of recurrent oral streptococcal According to their parents, they have missed more than disease) also showed an increase in terms of episodes of 20 days of treatment. streptococcal pharyngitis and/or tonsillitis in comparison With parental consent, only 16 of the 41 recurrent-treated with the previous year, as shown by the incidence per month children and 14 of the 20 recurrent-not-treated children, per child (Table 4). This value increased from 0.020 to 0.078. respectively, continued into the 6-month follow-up period This is again likely due to seasonal reasons being the first to determine if BLIS K12 had a protective role. As shown value calculated considering also warm months where the in Table 9, the 14 children in the recurrent-not-treated incidence normally drops down, while the second value is group had eight episodes of oral streptococcal pathology calculated only considering the 3 winter months. and 10 episodes of acute otitis media over 6 months. The Relevant ( 40%) results were seen during 90 days of 16 children in the recurrent-treated group were confirmed to treatment with BLIS K12 (Table 5) in terms of episodes of be protected, having had four oral streptococcal infections, acute otitis media in the 41 children enrolled for having had no two episodes of acute otitis media, and one case of scarlet fewer than three episodes of streptococcal pharyngitis and/or fever, with a reduction by about 65% of incidence. tonsillitis in the previous year. In fact, these 41 children had had 27 episodes in 12 months and four episodes during the Discussion 90 days of treatment, with the incidence per month per child Acute pharyngitis and/or tonsillitis in children are among dropping from 0.055 to 0.033. the most frequent recurrent illnesses presenting to general In the control (not-treated) children enrolled with a practitioners and pediatricians. Group A beta-hemolytic diagnosis of recurrent oral streptococcal disease, there was streptococci is the most common bacterial cause of acute an increase in terms of episodes of acute otitis media in pharyngitis and tonsillitis. Antibiotic therapy is typically pre- comparison with the previous year, as shown by the incidence scribed to treat the acute infection and to prevent development per month per child (Table 6). This increase, from 0.054 to of sequelae, such as rheumatic fever. However, when patients 0.117, is again likely due the seasonal reasons explained earlier. present with sore throat, physicians must also consider a
Table 6 Episodes of AOM during 90 days in children (n = 20) Table 7 Episodes of acute otitis media during 90 days in children with recurrent streptococcal pharyngitis and/or tonsillitis not (n = 17) without recurrent streptococcal pharyngitis and/or treated with BLIS K12 tonsillitis and not treated with BLIS K12 AOM in AOM in AOM in AOM in previous year 90 days previous year 90 days Number of episodes 13 7 Number of episodes 4 2 Incidence/month/child 0.054 0.117* Incidence/month/child 0.020 0.039* Delta (%) +116 Delta (%) +95 Note: *P , . considering episodes and not significant considering . Note: *P , . considering four episodes and not significant considering one episodes (13/4). episode (4/4). Abbreviations: AOM, acute otitis media; BLIS, bacteriocin-like inhibitory Abbreviations: AOM, acute otitis media; BLIS, bacteriocin-like inhibitory substance. substance.
994 submit your manuscript | www.dovepress.com International Journal of General Medicine 2012:5 Dovepress Dovepress Preventive role of BLIS K12 in oral and ear pathologies
Table 8 Tolerability, compliance and side effects during the K12 reduces group A streptococcus acquisition and also 90 days of treatment with BLIS K12 in children (n = 45) with the prevalence of sore throat.18–21 Therefore, the feasibility recurrent streptococcal pharyngitis and/or tonsillitis as reported of using this harmless strain as a prophylactic agent was by parents and established by clinician investigated in this preliminary study. Ear infections are Tolerability Compliance Side effects also common in children, and in severe cases can lead to Very good None n = 42 n = 42 deafness. Acute otitis media is the most common bacterial Good n = 3 n = 1 None Acceptable n = 2 None infection in young children. It is thought that the bacteria Unacceptable from the nasopharyngeal tissue that infect the middle ear do Abbreviations: n, number of children; BLIS, bacteriocin-like inhibitory substance. so via the eustachian tubes. In Italy, over 90% of cases of acute otitis media result in antibiotic treatment. Relapses are wider range of potential pathogens, including viruses and common, and repeat treatment may contribute to a reservoir of other bacteria. Apart from a few rare non-group A streptococ- resistant microorganisms. Published studies have shown that cal infections, antimicrobial therapy is of no proven benefit to at least 50% of patients acquire a new otitis media infection treat causes of pharyngitis other than those provoked by within 3 months of a previous episode.22 The ability of the group A beta-hemolytic streptococci. Inappropriate antibiotic normal microflora of the upper airways to inhibit growth of therapy imposes unnecessary expense and also contributes potential pathogens in vitro has been well described.23 Most of to the emergence of antibiotic-resistant bacteria, which are this inhibitory activity has been attributed to alpha-hemolytic being reported with increasing frequency. Consequently, a streptococci. One as yet unpublished study, (data on file at conservative approach to managing sore throats is being BLIS Ltd, Dunedin, New Zealand) has shown that S. salivarius promoted increasingly, with antibiotic therapy held in reserve K12 produces BLIS with activity against S. pneumoniae, S. until group A beta-hemolytic streptococcal infection is con- pyogenes, H. influenzae, and M. catarrhalis, ie, the principal firmed. Prevention of recurrent infection by nonantibiotic agents known to be causative of acute otitis media. On this therapy is preferable than having repeated doses of antibiot- basis, we decided to test the role played by S. salivarius K12 in ics. The ability of the normal bacterial microflora in the oral the prevention of streptococcal oral pathology and acute otitis cavity to inhibit the growth of group A streptococci has been media. Sixty-five children with a history of recurrent oral established previously. Most of this inhibitory activity has streptococcal pathology were given Bactoblis, a nutritional been attributed to BLIS-producing S. salivarius.17 Because S. supplement containing as its unique active ingredient five salivarius is a member of the normal bacterial flora found in billion colony-forming units per tablet of S. salivarius K12 the oral cavity and is considered to be essentially nonpatho- for 90 days. genic, it is regarded as an excellent candidate for bacterial We also checked the incidence of acute otitis media interference-mediated prevention of recurrent pharyngitis during treatment. This preliminary investigation was not and tonsillitis. placebo-controlled, so risks determining incidence values Our study is based upon the observation that certain potentially affected by normal fluctuations of mouth and strains of S. salivarius are capable of preventing the growth ear pathology. To minimize such a risk, we compared the of bacteria associated with sore throat due to their production incidence values in the treated group with those of two of BLIS. In particular, it has been shown that S. salivarius untreated groups. The first untreated group had the same characteristics as the treated one, being comprised of children Table 9 Episodes of oral streptococcal pathology and acute otitis enrolled because of recurrent oral streptococcal pathology. media in a 6-month follow-up period in children coming from the For further control of possible fluctuations in incidence, we recurrent-treated and from the recurrent-not-treated groups monitored disease episodes in a second group of children in Group Number Incidence/ % versus whom oral streptococcal pathology had not been recurrent. of episodes month/child control This methodological approach allowed us to demonstrate that Control (n = 14) 18 0.214 the approximately 90% reduction in incidence observed by (from recurrent-not-treated) administering BLIS K12 for 90 days was not due to random Tested (n = 16) 7 0.073* 65.9 (from recurrent-treated) fluctuations during the study period in 2012. Notes: *P = 0.0278 (Pearson Chi-squared test for difference in proportions, Chi- In the second part of the study, we investigated whether squared test = 4.84); oral streptococcal pathology (n = 8) and acute otitis media administration of BLIS K12 resulted in durable protection (n = 10); oral streptococcal pathology (n = 4), acute otitis media (n = 2), scarlet fever (n = 1). in the months following treatment. This evaluation lasted
International Journal of General Medicine 2012:5 submit your manuscript | www.dovepress.com 995 Dovepress Di Pierro et al Dovepress from March to August 2012, and demonstrated that prior 9. van Zon A, van der Heijden GJ, van Dongen TM, Burton MJ, Schilder AG. use of the product provided durable protection against oral Antibiotics for otitis media with effusion in children. Cochrane Database Syst Rev. 2012;9:CD009163. streptococcal pathology and acute otitis media, with about 10. Burton JP, Chilcott CN, Moore CJ, Speiser G, Tagg JR. A preliminary 65% reduction compared with controls. study of the effect of probiotic Streptococcus salivarius K12 on oral malodour parameters. J Appl Microbiol. 2006;100:754–764. This study has several limitations, in that it is not ran- 11. Power DA, Burton JP, Chilcott CN, Dawes PJ, Tagg JR. Preliminary domized nor placebo-controlled, and was also not blinded. investigations of the colonisation of upper respiratory tract tissues of Furthermore, it was carried out in a relatively small number infants using a paediatric formulation of the oral probiotic Streptococcus salivarius K12. Eur J Clin Microbiol Infect Dis. 2008;27:1261–1263. of children with recurrent oral streptococcal pathology but 12. Horz HP, Meinelt A, Houben B, Conrads G. Distribution and persistence not specifically with recurrent acute otitis media, with epi- of probiotic Streptococcus salivarius K12 in the human oral cavity as determined by real-time quantitative polymerase chain reaction. Oral sodes of the latter only being an endpoint. However, in spite Microbiol Immunol. 2007;22:126–130. of these limitations, the results demonstrate for the first time 13. Burton JP, Wescombe PA, Moore CJ, Chilcott CN, Tagg JR. Safety that use of S. salivarius K12, an oral probiotic, can reduce assessment of the oral cavity probiotic Streptococcus salivarius K12. Appl Environ Microbiol. 2006;72:3050–3053. the incidence of bacterial throat and ear infections in children 14. Burton JP, Cowley S, Simon RR, McKinney J, Wescombe PA, Tagg JR. with a history of recurrent oral streptococcal infection. Our Evaluation of safety and human tolerance of the oral probiotic Strepto- coccus salivarius K12: a randomized, placebo-controlled, double-blind research group is currently organizing a larger, randomized, study. Food Chem Toxicol. 2011;49:2356–2364. blinded, placebo-controlled study in children with recur- 15. Tagg J, Wescombe P, Burton J. Oral streptococcal BLIS: heterogeneity of rent oral streptococcal pathology to confirm more precisely the effector molecules and potential role in the prevention of streptococ- cal infections. International Congress Series 1289. 2006:347–350. what has been observed in this preliminary investigation. 16. Vandenbroucke JP. A shortcut method for calculating the 95 per cent This study will be performed with approval and a reference confidence interval of the standardised mortality ratio. Am J Epidemiol. 1982;115:303–304. number from our local ethics committee. 17. Tagg JR. A longitudinal study of Lancefield group A streptococcus acquisitions by a group of young Dunedin school children. N Z Med J. 1990;103:429–431. Disclosure 18. Fantinato VC, Shimizu MT. Production of bacteriocin-like inhibitory FDP is the main formulator of the study product. Otherwise, substances (BLIS) by Streptococcus salivarius strains isolated from the the authors report no conflicts of interest in this work. tongue and throat of children with and without sore throat. Revista de Microbiologia. 1999;30:332–334. 19. Ragland N, Tagg JR. Applications of bacteriocin-like inhibitory sub- References stance (BLIS) typing in a longitudinal study of the oral carriage of 1. Sathyabama S, Vijayabharathi R, Bruntha Devi P, Ranjith Kumar M, beta-haemolytic streptococci by a group of Dunedin schoolchildren. Priyadarisini VB. Screening for probiotic properties of strains isolated Zentralbl Bakteriol. 1990;274:100–108. from feces of various human groups. J Microbiol. 2012;50:603–612. 20. Tagg JR. Significance of bacteriocin production by oral streptococci. In: 2. Tagg JR, Dierksen KP. Bacterial replacement therapy: adapting R Lutticken R, editor. Proceedings of the Xth Lancefield Symposium. ‘germ warfare’ to infection prevention. Trends Biotechnol. 2003;21: New York, NY: Gustav Fischer Verlag; 1990. 217–223. 21. Dierksen KP, Tagg JR. The influence of indigenous bacteriocin- 3. Tagg JR. Prevention of streptococcal pharyngitis by anti-Streptococcus producing Streptococcus salivarius on the acquisition of Streptococcus pyogenes bacteriocin-like inhibitory substances (BLIS) produced by pyogenes by primary school children in Dunedin, New Zealand, In: Streptococcus salivarius. Indian J Med Res. 2004;119 Suppl:13–16. Martin DR, Tagg JR, editors. Streptococci and Streptococcal Diseases 4. Jack RW, Tagg JR, Ray B. Bacteriocins of Gram-positive bacteria. Entering the New Millenium. Auckland, New Zealand: Securacopy; Microbiol Rev. 1995;59:171–200. 2000. 5. Hyink O, Wescombe PA, Upton M, Ragland N, Burton JP, Tagg JR. 22. Roos K, Hakansson EG, Holm S. Effect of recolonisation with Salivaricin A2 and the novel lantibiotic salivaricin B are encoded at “interfering” alpha streptococci on recurrences of acute and secretory adjacent loci on a 190-kilobase transmissible megaplasmid in the oral otitis media in children: randomized placebo controlled trial. BMJ. probiotic strain Streptococcus salivarius K12. Appl Environ Microbiol. 2001;322:210–212. 2007;73:1107–1113. 23. Tano K, Olofsson C, Grahn-Hakansson E, Holm SE. In vitro inhibi- 6. Sharma S, Verma KK. Skin and soft tissue infection. Indian J Pediatr. tion of S. pneumoniae, nontypable H. influenzae and M. catharralis 2001;68 Suppl 3:S46–S50. by alpha-hemolytic streptococci from healthy children. Int J Pediatr 7. Wescombe PA, Burton JP, Cadieux PA, et al. Megaplasmids encode dif- Otorhinolaryngol. 1999;47:49–56. fering combinations of lantibiotics in Streptococcus salivarius. Antonie Van Leeuwenhoek. 2006;90:269–280. 8. Burton JP, Chilcott CN, Tagg JR. The rationale and potential for the reduction of oral malodour using Streptococcus salivarius probiotics. Oral Dis. 2005;11 Suppl 1:29–31.
996 submit your manuscript | www.dovepress.com International Journal of General Medicine 2012:5 Dovepress Dovepress Preventive role of BLIS K12 in oral and ear pathologies
International Journal of General Medicine Dovepress Publish your work in this journal The International Journal of General Medicine is an international, A key focus is the elucidation of disease processes and management peer-reviewed open-access journal that focuses on general and internal protocols resulting in improved outcomes for the patient.The manu- medicine, pathogenesis, epidemiology, diagnosis, monitoring and treat- script management system is completely online and includes a very ment protocols. The journal is characterized by the rapid reporting of quick and fair peer-review system. Visit http://www.dovepress.com/ reviews, original research and clinical studies across all disease areas. testimonials.php to read real quotes from published authors.
Submit your manuscript here: http://www.dovepress.com/international-journal-of-general-medicine-journal
International Journal of General Medicine 2012:5 submit your manuscript | www.dovepress.com 997 Dovepress Effect of Streptococcus salivarius K12 on the In Vitro Growth of Candida albicans and Its Protective Effect in an Oral Candidiasis Model
Sanae A. Ishijima, Kazumi Hayama, Jeremy P. Burton, Gregor Reid, Masashi Okada, Yuji Matsushita and Shigeru Abe Appl. Environ. Microbiol. 2012, 78(7):2190. DOI: 10.1128/AEM.07055-11. Published Ahead of Print 20 January 2012. Downloaded from
Updated information and services can be found at: http://aem.asm.org/content/78/7/2190
These include: http://aem.asm.org/ REFERENCES This article cites 31 articles, 10 of which can be accessed free at: http://aem.asm.org/content/78/7/2190#ref-list-1
CONTENT ALERTS Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more» on March 13, 2012 by guest
Information about commercial reprint orders: http://aem.asm.org/site/misc/reprints.xhtml To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/ Effect of Streptococcus salivarius K12 on the In Vitro Growth of Candida albicans and Its Protective Effect in an Oral Candidiasis Model
Sanae A. Ishijima,a Kazumi Hayama,a Jeremy P. Burton,b Gregor Reid,d Masashi Okada,a Yuji Matsushita,c and Shigeru Abea Teikyo University Institute of Medical Mycology, Tokyo, Japana; BLIS Technologies Ltd., Centre for Innovation, University of Otago, Dunedin, New Zealandb; Tradepia Co., Tokyo, Japanc; and Department of Microbiology and Immunology, University of Western Ontario, London, Ontario, Canadad
Oral candidiasis is often accompanied by severe inflam mation, resulting in a decline in the quality of life of immunosuppressed individuals and elderly people. To develop a new oral therapeutic option for candidiasis, a nonpathogenic commensal oral pro-
biotic microorganism, Streptococcus salivarius K12, was evaluated for its ability to modulate Candida albicans growth in vitro, Downloaded from and its therapeutic activity in an experimental oral candidiasis model was tested. In vitro inhibition of mycelial growth of C. al- bicans was determined by plate assay and fl uorescence microscopy. Addition ofS. salivarius K12 to modified RPMI 1640 culture medium inhibited the adherence of C. albicans to the plastic petri dish in a dose-dependent manner. Preculture of S. salivarius K12 potentiated its inhibitory activity for adherence of C. albicans. Interestingly, S. salivarius K12 was not directly fungicidal but appeared to inhibit Candida adhesion to the substratum by preferentially binding to hyphae rather than yeast. To determine the potentially anti-infective attributes of S. salivarius K12 in oral candidiasis, the probiotic was administered to mice with orally induced candidiasis. Oral treatment with S. salivarius K12 significantly protected the mice from severe candidiasis. These
findings suggest that S. salivarius K12 may inhibit the process of invasion of C. albicans into mucous surfaces or its adhesion to http://aem.asm.org/ denture acrylic resins by mechanisms not associated with the antimicrobial activity of the bacteriocin. S. salivarius K12 may be useful as a probiotic as a protective tool for oral care, especially with regard to candidiasis.
he overgrowth of Candida albicans, which is one of the mem- albicans first by in vitro analysis and then by testing an experimen- Tbers of the oral microbial flora in a healthy human, causes tal oral candidiasis model with mice with furry white tongues. pathogenic symptoms such as oral candidiasis. Oral candidiasis MATERIALS AND METHODS accompanied with severe inflammation can significantly degrade on March 13, 2012 by guest the quality of life of immunosuppressed individuals and elderly Candida albicans and Streptococcus salivarius. The C. albicans strain people (9). It can cause a variety of mucosal infections in the TIMM1768 was isolated clinically from the blood of a candidiasis patient gastrointestinal, respiratory, and genital tracts and is a major cause and maintained at Teikyo University Institute of Medical Mycology; this strain, which was shown to induce oral candidiasis in a murine model, has of oral and esophageal infections (9, 23, 29). Oral candidiasis is been used for animal experiments (12, 14). Cultures were stored at Ϫ80°C common in patients with advanced AIDS, hyposalivation, and in Sabouraud dextrose broth (Becton Dickinson, MD) containing 0.5% diabetes mellitus, those on antibiotic therapy or immunosuppres- yeast extract (Becton Dickinson, MD) and 10% glycerol (vol/vol, final sive drugs, and those who have poor oral hygiene (9, 22, 23, 29). concentration) until use. Strain TIMM1768 was cultured on a Sabouraud The probiotic strain Streptococcus salivarius K12 was originally dextrose agar plate for 18 h at 37°C, and the cells were harvested with a isolated from the saliva of a healthy child and produces several microspatula and suspended in RPMI 1640 medium containing 2.5% fetal calf serum (RPMI 1640 medium). The cultured C. albicans cells were used megaplasmid-encoded bacteriocin-like inhibitory substances for in vitro germ tube formation, the mycelial growth experiment, and also (BLISs), such as the lantibiotics salivaricin A and salivaricin B (11, in vivo oral inoculation of Candida. 13, 31). It has been used commercially as a probiotic for more than S. salivarius K12 is a commercially available probiotic that was origi- a decade and has numerous studies supporting its safety (3, 4, 5). nally isolated from the oral cavity of a child. It was supplied as a freeze- S. salivarius strains have been reported to inhibit the biofilm for- dried powder at 2 ϫ 1011 CFU per gram of material tested and was used mation of Streptococcus mutans (13, 19, 28), and Streptococcus sali- with CAB K12 agar, which consisted of Columbia blood agar base (Becton varius K12 has been shown to have the ability to inhibit various Dickinson, MD), 0.5% yeast extract (Becton Dickinson, MD), 0.25% glu- cose, and 0.1% calcium carbonate (pH 7.3 Ϯ 0.2). potentially deleterious upper respiratory tract bacteria, such as Measurement of antimicrobial activity of bacteriocins produced by Streptococcus pyogenes and Streptococcus pneumoniae (13, 31), and S. salivarius K12. To determine if the bacteriocins or other secretory decrease oral malodor (2). These properties suggest that S. sali- molecules from S. salivarius K12 inhibited C. albicans TIMM1768, a de- varius K12 might be widely applied as a management tool for oral health applications. C. albicans is a polymorphic yeast and grows predominantly as Received 3 October 2011 Accepted 10 January 2012 yeast, pseudohyphae, or hyphae (23). Mycelial growth of C. albi- Published ahead of print 20 January 2012 cans is often observed in mucosal infection and is considered to Address correspondence to Sanae A. Ishijima, [email protected]. contribute to pathogenesis by biofilm formation (22). In this Copyright © 2012, American Society for Microbiology. All Rights Reserved. study, we aimed to elucidate the potential mechanisms of Strepto- doi:10.1128/AEM.07055-11 coccus salivarius K12 suppression of the mycelial growth of the C.
2190 aem.asm.org 0099-2240/12/$12.00 Applied and Environmental Microbiology p. 2190–2199 Effect of Probiotic S. salivarius K12 on Candidiasis
ferred antagonism assay was employed. This was conducted essentially as Murine oral candidiasis model. All animal experiments were per- described by Tagg and Bannister (25), in duplicate, using the nine bacte- formed in accordance with the guidelines for the care and use of animals rial indicator strains described to be positive controls for S. salivarius K12 approved by Teikyo University. The derivation of the murine oral candi- bacteriocin production and also applying the C. albicans TIMM1768 diasis model has been described previously (15, 27). Six-week-old female strain. In brief, S. salivarius K12 was preliminarily cultured on a CAB agar ICR mice (Charles River Japan, Inc., Yokohama, Kanagawa, Japan) were
(with 5% blood, 0.1% CaCO3) plate to form a 1-cm-wide streak. After used for all animal experiments. The mice were randomized, kept in cages incubation of the plate at 37°C under 5% CO2 for 18 to 24 h, the culture of housing 3 to 4 individuals, and given food and water ad libitum. During S. salivarius K12 was removed from the plate using a clean microscope the experimental period, the photoperiods were adjusted to 12 h of light slide and sterilized with chloroform vapors for 30 min. The plates were and 12 h of darkness daily, and the environmental temperature was main- aired for 30 min in an extraction hood. Indicator bacterial strains as well as tained at 21°C. To induce an immunosuppressed condition, 100 mg of C. albicans were then inoculated horizontally across the original but now prednisolone (Mitaka Pharmaceutical Co., Japan) per kg of body weight sterile S. salivarius K12 streak. Plates were then reincubated for 18 h. The was injected subcutaneously to mice 20 to 24 h before oral inoculation. inhibitory effect of microbial growth was evaluated as follows: Ϫ, no in- Prior to prednisolone administration, 15 mg/ml of tetracycline hydro- hibition of the test organism; ϩ, inhibition of the test organism only over chloride (Takeda Shering Purau Animal Health Co., Japan) was adminis- the primary inoculation; ϩϩ, inhibition of the test organism just beyond tered in drinking water for 24 h. On the day of infection, animals were ϩϩϩ anesthetized by intramuscular injection with 14.4 mg/kg of chlorproma-
the primary inoculation; , inhibition of the test organism much Downloaded from beyond the primary inoculation. zine chloride in the femur, after which they were orally inoculated with ϫ 8 In vitro assay of germ tube formation and mycelial growth of Can- 2.0 10 CFU/ml of C. albicans TIMM1768 in modified RPMI 1640 dida albicans. The ability of C. albicans cells to undergo germ tube for- medium. Oral inoculation was performed by means of rubbing and roll- mation or mycelial growth with S. salivarius K12 was assessed as described ing a cotton swab (baby cotton buds; Johnson & Johnson Co., Tokyo, below. Japan) inside all parts of the mouth. The number of Candida cells inocu- ϫ 6 (i) Germ tube formation analysis. One hundred microliters of C. lated in the oral cavity was calculated to be 1 10 CFU/mouse on the albicans cells was aliquoted into 96-well microtiter plates (1 ϫ 104 CFU basis of the difference in viable cell number adhering to the cotton swabs per well for morphological analysis, 5 ϫ 105 CFU per well for crystal violet before and just after oral inoculation, as described by Takakura et al. (27).
[CV] staining), 100-l serial dilutions of freeze-dried S. salivarius K12 Oral administration of Streptococcus salivarius K12. Fifty microli- http://aem.asm.org/ powder were then added to the plates, which made final concentrations of ters of S. salivarius K12 solution, fluconazole (2 mg/ml), or distilled water 30 mg/ml (3.0 ϫ 109 CFU/ml) to 0.12 mg/ml (1.2 ϫ 107 CFU/ml), and the was administered into the oral cavity of the Candida-inoculated mice at five time points: 24 h and 3 h before and 3, 24, and 27 h after C. albicans plates were incubated at 37°C in 5% CO in air for 3 h. Germ tube forma- 2 inoculation. The total numbers of mice in each group during two different tion was assessed microscopically: cells were fixed with 70% ethanol and trials were as follows: water control, n ϭ 15; S. salivarius K12 at 7.5 mg/ml, stained with CV as described by Abe et al. (1) and Kamagata-Kiyoura et al. n ϭ 7; S. salivarius K12 at 15 mg/ml, n ϭ 12; 30 mg/ml, n ϭ 15; and (14). fluconazole at 2 mg/ml, n ϭ 6. Administration was undertaken using a (ii) Mycelial growth analysis. Mycelial growth analysis was carried rounded-top needle to spread the treatment over all parts of the mouth. out as described for the germ tube formation assay, except that the inoc- An active control of 50 l of fluconazole solution (2 mg/ml) was similarly ulum per well was 500 cells in 100 l and the culture period was length- on March 13, 2012 by guest administered. ened to 16 h. Mycelial growth of C. albicans cells was determined as de- Scoring severity of oral infection. The procedure of scoring the sever- scribed by Abe et al. (1). Culture medium for in vitro assays was composed ity of oral infection was performed as described previously (27). Forty- of diluted RPMI 1640 (1:3; Sigma Chemical Co., St. Louis, MO) contain- eight hours after inoculation, mice were sacrificed by cervical dislocation ing 0.8% fetal calf serum, 20 mM HEPES buffer, pH 7.2, 2 mM urea, and and the severity of the lesion of the tongue was evaluated by scoring the fur 10 mg/ml D-glucose with or without antibiotics (60 g/ml of benzylpen- coating on each tongue and the squamous disorder as follows: 0, normal; icillin potassium [Wako, Japan] and kanamycin sulfate [Wako, Japan]), 1, fur on less than 20% of the tongue; 2, fur on more than 21% but less according to the nutritional requirements of S. salivarius (6). The plank- than 90% of the tongue; 3, fur on more than 91% of the tongue and on the tonic cells were centrifuged, stained with 50% lactophenol blue solution squamous layer; 4, thick fur on more than 91% of the tongue and on the (containing 1 mg/ml of methyl blue [C.I. 42780], 204 mg/ml of phenol, squamous layer (12, 27). 247 mg/ml of lactic acid, and 502 mg/ml of glycerol; Merck, Germany) in Evaluation of number of viable Candida cells on murine tongues. At saline, and observed by microscopy. 48 h after inoculation, the cheek, tongue, and soft palate of each mouse Yeast viability assay using fluor escence microscopy.The effect of S. was swabbed uniformly using a cotton swab, and the swab was used for salivarius K12 on C. albicans viability was detected by use of a two-color microbiological evaluation. After swabbing, the cotton end was cut off fluorescent probe (FUN1; F-7030; Molecular Probes, Eugene, OR), a live/ and placed in 3 ml of sterile saline. Candida cells were resuspended by dead yeast viability kit, and fungal surface labeling with a reagent of a third mixing on a vortex mixer and diluted with a series of 20-fold and 100-fold color (calcofluor white M2R; Molecular Probes, Eugene, OR). C. albicans dilutions of sterile saline. Fifty microliters of each dilution was incubated and S. salivarius K12 were cultured as described above. In brief, C. albicans on a Candida GS agar plate (selection medium for Candida; Eiken Chem- and S. salivarius K12 were combined in adequate culture medium and ical Co. Ltd., Japan) for 20 h at 37°C. The Candida cells were counted, and cultured for 1 to3hinaCO2 incubator. After centrifugation at 3,000 rpm then the total numbers per swab were calculated and reported as numbers for 3 min and one-time washing with GH solution (2% glucose in 10 mM of CFU. HEPES buffer, pH 7.2), the GH solution was replaced with GH solution Histology. For histological study, the tongues were resected at the base containing 20 M FUN1 with 5 M calcofluor white M2R. After incuba- of the tongue, fixed with 4% paraformaldehyde (pH 7.4) at 4°C, dehy- tion for 30 min at room temperature, cells were observed with a fluores- drated by ethanol series, and embedded in paraffin in accordance with cence microscope (BH50; Olympus, Japan) equipped with a WU (wide common procedure. Specimens were sectioned to an 8-m thickness range of UV excitation), (WU), WBV (wide range of blue-violet excita- along the longitudinal center line. Sections on the slide were deparaf- tion), WG (wide range of green excitation), and NB (narrow range of UV finized by xylene, rehydrated by ethanol series, and stained with periodic excitation) filter assortment. Staining with FUN1 was observed using NB acid-Schiff (PAS). and calcofluor white WU. All images were taken as digital data with a Statistical analysis. The score data were compared by the nonparametric
DC200 camera (Leica, Germany), and the digital data were inserted into Mann-Whitney U test. Statistical analysis of the log10 number of CFU of C. the IM50 program and recorded. albicans isolated from each mouse part was compared using a Student’s t test.
April 2012 Volume 78 Number 7 aem.asm.org 2191 Ishijima et al. Downloaded from http://aem.asm.org/ on March 13, 2012 by guest
FIG 1 Inhibitory effect of BLIS K12 on germ tube formation of C. albicans cultured with different doses of S. salivarius K12 for 3 h at 37°C in 5% CO2 in air. Starting concentrations of Streptococcus salivarius K12 freeze-dried material were control (a), 0.12 mg/ml (b), 0.23 mg/ml (c), 0.47 mg/ml (d), 0.94 mg/ml (e), 1.88 mg/ml (f), 3.75 mg/ml (g), 7.5 mg/ml (h), 15 mg/ml (i), and 30 mg/ml (j) (1.2 ϫ 107 to 3 ϫ 109 CFU/ml).
P values of Ͻ0.05 were considered statistically significant. All mean values asis. The first step to make mycelia is germ tube formation, fol- given in the text include the standard deviation of the mean. lowed by an increase of the adherent capacity by hydrophobicity. We investigated the in vitro effects of S. salivarius K12 on the germ RESULTS tube formation of C. albicans. Figure 1a shows that C. albicans cells Inhibition of Candida albicans attachment to plastic substra- cultured in control culture medium formed germ tube-like hy- tum by S. salivarius BLIS K12. Mycelial growth of C. albicans is phae within 3 h. In the experimental group, where C. albicans was considered to contribute to the pathogenesis of mucosal candidi- cultured in the presence of S. salivarius K12 (Fig. 1b to j), the
2192 aem.asm.org Applied and Environmental Microbiology Effect of Probiotic S. salivarius K12 on Candidiasis Downloaded from
FIG 2 Number of planktonic cells after 3 h culture of C. albicans with various concentrations of S. salivarius K12. C. albicans was cultured with different doses of S. salivarius K12 for 3 h at 37°C in 5% CO2 in air. After the cultured plate was shaken, the supernatant was collected, diluted, and seeded on a GS agar plate for determining the number of planktonic cells. The experiments were performed in duplicate.
8 8 morphological shape and size of the Candida cells appeared to be 1.9 to 3.8 mg/ml (approximately 2.0 ϫ 10 to 4.0 ϫ 10 CFU/ml). http://aem.asm.org/ almost the same as those for the control group; however, the ad- These results indicate that S. salivarius K12 increased the number herence of the mycelial form to the plastic substratum was weaker of planktonic Candida cells in culture medium. The planktonic and the mycelial numbers on the plastic bottom were dose-de- cells, including unattached mycelia, were centrifuged and stained pendently reduced in the presence of more than 0.94 mg/ml of with lactophenol blue. Figure 3 shows that mycelial cells of Can- freeze-dried S. salivarius K12 starting material, equating to ap- dida attached to and were surrounded by S. salivarius K12. proximately 1 ϫ 108 CFU/ml. Effective inhibition of C. albicans attachment to substratum Figure 2 shows the results of the number of viable C. albicans by viable S. salivarius K12. Although S. salivarius K12 was shown cells growing in planktonic form, which were found to increase, to bind to mycelial growth of Candida at3hofculture and inhibit according to the concentration of S. salivarius K12, to more than Candida adherence to plastic plates, it is not clear whether these on March 13, 2012 by guest
FIG 3 Microscopic observation of interaction between S. salivarius K12 and Candida planktonic cells after 3 h culture and staining with lactophenol blue. Black arrows, Candida cells; white arrows, S. salivarius.
April 2012 Volume 78 Number 7 aem.asm.org 2193 Ishijima et al. Downloaded from
FIG 4 Inhibitory effect of S. salivarius K12 on hyphal growth of C. albicans. S. salivarius K12 was preliminarily cultured for1hor6handthen cultured with C. albicans for 3 h and stained with crystal violet. The optical absorbance at 620 nm (A620) was then detected. The experiments were performed in triplicate. http://aem.asm.org/ effects continue for longer periods of culture with Candida. My- vacuoles in the cytoplasm, indicating metabolic activity. The red celial growth of C. albicans for 16 h of culture was quantified using pigments appeared to be concentrated in vacuoles, which indi- the crystal violet staining method (1), and the results are shown in cated that the mycelial form of C. albicans was alive, although it Fig. 4. When S. salivarius K12 existed at 3.75 mg/ml (3.75 ϫ 108 was surrounded by S. salivarius K12. These results suggest that C. CFU/ml), there were no Candida hyphae attached to the plastic albicans is not killed by S. salivarius K12 but that C. albicans and plate. S. salivarius K12 form some sort of interaction with each other S. salivarius K12 was obtained as a lyophilized ingredient. To (Fig. 5). This interaction appears to occur preferentially for the determine the effect of the probiotic in an active culture, different mycelial form of C. albicans rather than the yeast form. inoculum or dose sizes were tested to see if hyphal growth and the No susceptibility of Streptococcus salivarius K12 bacterio- on March 13, 2012 by guest subsequent adherence ability were inhibited. When S. salivarius cins to Candida albicans TIMM1768. To examine the possibility K12 was preliminarily grown for 6 h, it appeared to enhance the that Streptococcus salivarius K12 bacteriocins interfere with the inhibition of Candida adherence; with concentrations as low as growth of C. albicans, the susceptibility of C. albicans to S. sali- 0.94 mg/ml (approximately 1 ϫ 108 CFU/ml), S. salivarius K12 varius K12 was tested by the deferred antagonism test (11, 25, 26). completely inhibited adherence of Candida (Fig. 4). Shorter incu- S. salivarius K12 inhibited all of the bacteria which were used as bation periods with higher inoculum doses also appeared to indicators of bacteriocin inhibitory activity but not the C. albicans greatly affect hyphal growth and adhesion. In contrast, when Can- strain, when tested in duplicate, as shown in Table 1. To further dida was preliminarily grown for 3 h, the inhibitory effect of S. confirm a lack of bacteriocin inhibitory activity on the Candida salivarius K12 at concentrations as low as 15 mg/ml (1.5 ϫ 109 strain, a simultaneous antagonism test was also performed in the CFU/ml; data not shown) on Candida adherence after an addi- liquid RPMI 1640 medium used in the other experiments de- tional 3 h culture appeared to decrease. scribed above, and again, no activity of live or heat-killed super- Preferential binding of S. salivarius to hyphae of C. albicans. natants against C. albicans was shown (data not shown). Earlier experiments indicated that S. salivarius K12 inhibited C. Effect of treatment with oral S. salivarius K12 on oral candi- albicans mycelial adhesion to plastic plates and that possible inter- diasis model. The effects of S. salivarius K12 on murine oral can- actions between S. salivarius K12 and C. albicans were occurring; didiasis were examined. S. salivarius K12 was orally administrated these findings were further investigated using staining techniques. to the mice at 24 and 3 h before and 3, 24, and 27 h after Candida C. albicans was cultured on a poly-L-lysine-coated glass slide with inoculation. It appeared that S. salivarius K12 application caused a or without S. salivarius K12 for 3 h and then stained by FUN1 to dose-dependent improvement in symptom score and fungal bur- determine its viability by detecting metabolic activity. Slides were den (Fig. 6). Although the oral administration of 7.5 ϫ 108 also stained by calcofluor white to identify the cell wall of Candida, CFU/ml of S. salivarius K12 (score ϭ 3.4 Ϯ 0.79, n ϭ 7) resulted in which is composed of -glucans. FUN1 staining showed that the no significant difference in symptom score from that for the sa- hyphae were surrounded by numerous small green particles (Fig. line-treated control group (score ϭ 3.3 Ϯ 0.88, n ϭ 15), oral 5). These particles were not stained with calcofluor white (and administration of 1.5 ϫ 109 CFU/ml and 3 ϫ 109 CFU/ml of S. thus not composed of -glucans) and were bacterial bodies of S. salivarius K12 (scores ϭ 2.0 Ϯ 0.74 [n ϭ 12] and 2.3 Ϯ 0.62 [n ϭ salivarius K12. Concurrently with staining of C. albicans with cal- 15], respectively) resulted in an obviously significant difference cofluor white, the green and red fluorescence of FUN1 was also from the saline-treated control group (P Ͻ 0.01) (Fig. 6). applied. In this system, green fluorescence accumulates through- The tongues of mice administered S. salivarius K12 showed out the cytoplasm and red particles transfer and concentrate in the fewer lesions than the tongues of the control mice (Fig. 7A and B).
2194 aem.asm.org Applied and Environmental Microbiology Effect of Probiotic S. salivarius K12 on Candidiasis Downloaded from http://aem.asm.org/ on March 13, 2012 by guest
FIG 5 Vital staining of C. albicans by FUN1 (1) and calcofluor white M2R (2). C. albicans was cultured with or without S. salivarius K12 at 30°C or 37°C for 3 h. (a) Hyphal form of control culture at 37°C; (b) hyphal form of culture at 37°C with S. salivarius K12; (c) yeast form of control culture at 30°C; (d) yeast form of culture with S. salivarius K12 at 30°C; (e) S. salivarius K12.
Even though there was no total eradication, as observed in the treated with S. salivarius K12 than the tongues in the control control using fluconazole, in the mice that were administered S. group. salivarius K12 at 30 mg/ml (3 ϫ 109 CFU/ml), there was a signif- icant decrease in fungal burden compared to that for the untreated DISCUSSION control. The reduced pathogenicity of C. albicans cells when mice The in vitro culture experiments that were conducted showed that were given S. salivarius K12 was illustrated by the histopathology S. salivarius K12 bound directly to Candida cells and inhibited the of tongue sections (Fig. 8A and B). Fewer PAS-staining mycelial adherence of Candida cells to the plastic petri dish. We also report elements were found to invade the oral epithelium of tongues that S. salivarius K12 had a protective effect against Candida inva-
April 2012 Volume 78 Number 7 aem.asm.org 2195 Ishijima et al.
TABLE 1 Detection of inhibitory properties of S. salivarius K12 against sion, indicated by the results obtained with the in vivo experimen- test organisms using deferred antagonism testing tal model of oral candidiasis. K12 deferred The results of in vitro culture experiments showed that S. sali- Test organism antagonisma varius K12 bound Candida cells at both the stage of germ tube Candida albicans TIMM1768 Ϫ formation and the stage of mycelial expansion. When S. salivarius Micrococcus luteus T-18 ϩϩϩ K12 was preliminarily cultured aerobically in a low-ionic-strength Streptococcus pyogenes FF22, M type 52, T pattern 3/13 ϩϩϩ medium with properties like those of saliva, the absorption at 620 Streptococcus anginosus T-29 ϩϩϩ nm increased, binding to Candida cells was enhanced, and the Streptococcus uberis ATCC 27958 ϩϩϩ adherence of Candida cells to the petri dish was further inhibited. Streptococcus pyogenes 71-679, M type 4, T pattern 4 ϩϩϩ The planktonic cells from mixed culture of S. salivarius K12 Lactococcus lactis T-21 ϩϩϩ and Candida cells proportionally increased according to the con- Streptococcus pyogenes 71-698, M type 28 ϩϩϩ centration of S. salivarius K12 in the medium. The planktonic cells Streptococcus pyogenes W-1, T pattern 6 ϩϩϩ were composed of the mycelial form of Candida cells and ap- Streptococcus agalactiae T-148 ϩϩϩ peared to be surrounded by S. salivarius, which may decrease its a Ϫ, no inhibition of the test organism; ϩϩϩ, inhibition of the test organism much adhesive ability and pathogenic potential. To analyze the cross- Downloaded from beyond the primary inoculation. kingdom interaction of Candida cells and S. salivarius in detail, vital staining with FUN1 for viability check and calcofluor white for yeast body analysis was undertaken, and it was confirmed that http://aem.asm.org/ on March 13, 2012 by guest
FIG 6 Effect of S. salivarius K12 on the symptom score (A) and fungal burden (B) in the murine model of oral candidiasis. Groups of immunosuppressed mice (control, n ϭ 15; S. salivarius K12 at 7.5 mg/ml, n ϭ 7; S. salivarius K12 at 15 mg/ml, n ϭ 12; S. salivarius K12 at 30 mg/ml, n ϭ 15; fluconazole at 2 mg/ml, n ϭ 6) were inoculated with C. albicans TIMM1768, and S. salivarius K12 was administered as described in Materials and Methods. Symptom scores (A) and fungal .significant differences (P Ͻ 0.01 and P Ͻ 0.05, respectively) with no S ,ءء and ء .burden (B) were assessed after 48 h, as described in Materials and Methods salivarius K12 (control), as determined using Student’s t test.
2196 aem.asm.org Applied and Environmental Microbiology Effect of Probiotic S. salivarius K12 on Candidiasis Downloaded from
FIG 7 Typical images of tongues from mice inoculated with C. albicans TIMM1768. (A) control; (B) S. salivarius K12 (30 mg/ml; 3 ϫ 109 CFU/ml); (C) fluconazole (2 mg/ml). http://aem.asm.org/
Candida cells were surrounded by S. salivarius. Interestingly, al- yond. This was an interesting result, in that previous studies of the most all of these were the mycelial form, and the staining indicated antimicrobial activity of S. salivarius K12 against bacteria indi- that they were viable. These findings, i.e., an increase in the num- cated that activity resulted from its bacteriocin production, since ber of planktonic Candida cells able to form colonies with the the percolation liquid in the culture, including bacteriocins from presence of S. salivarius K12 in the medium, were in agreement S. salivarius K12, did not appear to affect C. albicans when tested with the results observed in Fig. 2. This interaction was kinetically here, as shown in Table 1. observed from 30 min to 6 h, and the results showed that more This is the first report that the direct interaction between bac- than 30 min was needed for adhesion and 1 h was enough for teria and Candida induces a protective effect against oral candidi- on March 13, 2012 by guest interaction (data not shown). asis in an animal model and in vitro assay systems. Previous studies The results of tests of the in vivo effects of S. salivarius K12 of the cross-kingdom interaction of bacteria and fungi have fo- against murine experimental oral candidiasis indicated that S. cused upon direct antimicrobial interactions or interactions salivarius K12 had the ability to protect against severe fungal in- through chemical mechanisms, such as quorum-sensing mole- fection in a dose-dependent manner in the model used. The symp- cules or terpenoids (10, 17, 18). Despite the abundance of bacte- tom scoring of mouse tongues and histological studies of their rium-fungus interactions in nature and the clinical environment, fungal burdens indicated the appearance of an infection less severe very little is known about the molecular mechanisms underlying than that in the control group. However, those in the fluconazole these interactions and their importance to human health (7, 16, group showed no symptoms of infection after treatment. Further 19, 21, 24). Human microbial infections are often found to be studies may ascertain whether the S. salivarius K12 treatment over polymicrobial in composition and may include bacteria and fungi. a longer period of time will reduce the infection. These complex microbial consortiums are also usually structured The protective or therapeutic efficacy against oral candidiasis into biofilms, which have increased resistance against antimicro- was evaluated, as multiple possible probiotic mechanisms were bials, enhanced colonization, and enhanced interspecies antago- thought to be involved. These mechanisms include not only the nism (7, 16). There are examples in the literature where polymi- fungicidal effect or the inhibitory effect on germ tube formation crobial combinations of opportunistic pathogens are thought to but also blocking of the attachment of mycelium to the host epi- be much more deleterious than monoculture alone, such as S. thelial cells. Additionally, the reduction of C. albicans attachment mutans and Candida, which have been reported to produce a to artificial dentition or acrylic resin was previously presumed to mixed biofilm and to make candidiasis more severe (20). be an important mechanism for infection prevention (9). Saliva, While there are various reports on the antibacterial activities of which commonly contains S. salivarius, also has defensive effects S. salivarius K12 and other strains with bacteriocin action in the and may play a key role in the process. Previous studies showed literature (28, 30, 31), Candida albicans was not directly inhibited that adhesion of C. albicans germ tubes to polystyrene is decreased by bacteriocin action, and it appears that yeast cell-to-bacterial cell by saliva, whereas C. albicans yeast cell adhesion to the same ma- contact may be required. In this study, S. salivarius K12 directly terial is enhanced (8, 14). One may postulate that the possible interacted with Candida, as demonstrated by in vitro assays, and action of S. salivarius K12 in vivo might involve the latter type of also showed a protective effect in a murine model of Candida effect, whereby the rolled up Candida mycelial form prevents ad- infection. S. salivarius K12 appeared to inhibit the colonization of hesion to mucosal surfaces of the oral cavity, resulting in the fun- Candida by both direct and indirect mechanisms. It is not known gus then traveling harmlessly through to the esophagus and be- if these properties are unique to this particular strain of S. sali-
April 2012 Volume 78 Number 7 aem.asm.org 2197 Ishijima et al. Downloaded from http://aem.asm.org/ on March 13, 2012 by guest
FIG 8 Histology of longitudinal formalin-fixed paraffin-embedded (FFPE) sections of mouse tongues inoculated with C. albicans TIMM1768. (A) Represen- tative control mouse; (B) representative mouse given S. salivarius K12 (30 mg/ml; 3 ϫ 109 CFU/ml). Sections were stained with periodic acid-Schiff. varius or to the species in general; however, this strain has a history 2. Burton JP, Chilcott CN, Tagg JR. 2005. The rationale and potential for of safe use, and a human clinical study is warranted. The data the reduction of oral malodour using Streptococcus salivarius probiotics. obtained in this study suggest that the use of S. salivarius K12 as an Oral Dis. 11(Suppl 1):29–31. 3. Burton JP, et al. 2011. Evaluation of safety and human tolerance of the oral probiotic for the prevention or treatment of oral candidiasis oral probiotic Streptococcus salivarius K12: a randomized, placebo- may have merit and warrants further clinical investigations. The controlled, double-blind study. Food Chem. Toxicol. 49:2356–2364. mechanisms of the therapeutic effect of S. salivarius K12 against 4. Burton JP, Chilcott C, Wescombe PA, Tagg JR. 2010. Extended safety oral candidiasis will be studied in detail in future experiments. data for the oral cavity probiotic Streptococcus salivarius K12. Probiot. Antimicrob. Prot. 2:135–144. ACKNOWLEDGMENTS 5. Burton JP, Wescombe PA, Moore CJ, Chilcott CN, Tagg JR. 2006. Safety assessment of the oral cavity probiotic Streptococcus salivarius K12. J. P. Burton was a member of the finders of S. salivarius K12 and estab- Appl. Environ. Microbiol. 72:3050–3053. lished the company BLIS Technologies Ltd. at the Centre for Innovation 6. Carlsson J. 1971. Nutritional requirements of Streptococcus salivarius. J. of Otago University. Y. Mastushita is a member of the branch of BLIS Gen. Microbiol. 67:69–76. Technologies Ltd. in Japan. 7. De Sordi L, Mühlschlegel FA. 2009. Quorum sensing and fungal-bacterial interactions in Candida albicans: a communicative network regulating micro- REFERENCES bial coexistence and virulence. FEMS Yeast Res. 9:990–999. 1. Abe S, Satoh T, Tokuda Y, Tansho S, Yamaguchi H. 1994. A rapid 8. Elguezabal N, Maza JL, Dorronsoro S, Ponton J. 2008. Whole saliva has colorimetric assay for determination of leukocyte-mediated inhibition of a dual role on the adherence of Candida albicans to polymethylmetacry- mycelial growth of Candida albicans. Microbiol. Immunol. 38:385–388. late. Open Dent. J. 2:1–4.
2198 aem.asm.org Applied and Environmental Microbiology Effect of Probiotic S. salivarius K12 on Candidiasis
9. Ellepola AN, Samaranayake LP. 2000. Oral candidal infections and an- 21. Pereira-Cenci T, et al. 2008. The effect of Streptococcus mutans and Can- timycotics. Crit. Rev. Oral Biol. Med. 11:172–198. dida glabrata on Candida albicans biofilms formed on different surfaces. 10. Hogan DA, Vik A, Kolter R. 2004. A Pseudomonas aeruginosa quorum- Arch. Oral Biol. 53:755–764. sensing molecule influences Candida albicans morphology. Mol. Micro- 22. Sardi JC, et al. 2010. Candida spp. in periodontal disease: a brief review. biol. 54:1212–1223. J. Oral Sci. 52:177–185. 11. Hyink O, et al. 2007. Salivaricin A2 and the novel lantibiotic salivaricin B 23. Shapiro RS, Robbins N, Cowen LE. 2011. Regulatory circuitry governing are encoded at adjacent loci on a 190-kilobase transmissible megaplasmid fungal development, drug resistance, and disease. Microbiol. Mol. Biol. in the oral probiotic strain Streptococcus salivarius K12. Appl. Environ. Rev. 75:213–267. Microbiol. 73:1107–1113. 24. Shirtliff ME, Peters BM, Jabra-Rizk MA. 2009. Cross-kingdom interac- 12. Ishijima SA, et al. 2011. N-Acetylglucosamine increases symptoms and tions: Candida albicans and bacteria. FEMS Microbiol. Lett. 299:1–8. fungal burden in a murine model of oral candidiasis. Med. Mycol [Epub 25. Tagg JR, Bannister LV. 1979. “Fingerprinting” beta-haemolytic strepto- ahead of print.] doi:10.3109/13693786.2011.598194. cocci by their production of and sensitivity to bacteriocine-like inhibitors. 13. James SM, Tagg JR. 1991. The prevention of dental caries by BLIS- J. Med. Microbiol. 12:397–411. mediated inhibition of mutans streptococci. N. Z. Dent. J. 87:80–83. 26. Tagg JR, Dajani AS, Wannamaker LW. 1976. Bacteriocins of gram- 14. Kamagata-Kiyoura Y, Abe S, Yamaguchi H, Nitta T. 2003. Detachment positive bacteria. Bacteriol. Rev. 40:722–756. activity of human saliva in vitro for Candida albicans cells attached to a 27. Takakura N, et al. 2003. A novel murine model of oral candidiasis with plastic plate. J. Infect. Chemother. 9:215–220. local symptoms characteristic of oral thrush. Microbiol. Immunol. : 15. Kamagata-Kiyoura Y, Abe S. 2005. Recent studies on oral candidiasis 47 using a murine model. J. Oral Biosci. 47:60–64. 321–326. Downloaded from 16. Kumamoto CA, Vinces MD. 2005. Contributions of hyphae and hypha- 28. Tamura S, et al. 2009. Inhibiting effects of Streptococcus salivarius on co-regulated genes to Candida albicans virulence. Cell. Microbiol. 7:1546– competence-stimulating peptide-dependent biofilm formation by Strep- 1554. tococcus mutans. Oral Microbiol. Immunol. 24:152–161. 17. Morales DK, Hogan DA. 2010. Candida albicans interactions with bac- 29. Thompson GR, III, et al. 2010. Oropharyngeal candidiasis in the era of teria in the context of human health and disease. PLoS Pathog. 6:1–4. antiretroviral therapy. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. 18. Nickerson KW, Atkin AL, Hornby JM. 2006. Quorum sensing in dimor- Endod. 109:488–495. phic fungi: farnesol and beyond. Appl. Environ. Microbiol. 72:3805–3813. 30. Walls T, Power DA, Tagg JR. 2003. Bacteriocin-like inhibitory substance 19. Ogawa A, et al. 2011. Inhibition of Streptococcus mutans biofilm forma- (BLIS) production by the normal flora of the nasopharynx: potential to tion by Streptococcus salivarius FruA. Appl. Environ. Microbiol. 77:1572– protect against otitis media? J. Med. Microbiol. 52:829–833. 1580. 31. Wescomebe PA, Heng NCK, Burton JP, Chilcott CN, Tagg R. 2009. http://aem.asm.org/ 20. Peleg AY, Hogan DA, Mylonakis E. 2010. Medically important bacterial- Streptococcus bacteriocins and the case for Streptococcus salivarius as fungal interactions. Nat. Rev. Microbiol. 8:340–349. model oral probiotics. Future Microbiol. 4:819–835. on March 13, 2012 by guest
April 2012 Volume 78 Number 7 aem.asm.org 2199 APPLIED AND ENVIRONMENTAL MICROBIOLOGY, June 2010, p. 3948–3958 Vol. 76, No. 12 0099-2240/10/$12.00 doi:10.1128/AEM.00109-10 Copyright © 2010, American Society for Microbiology. All Rights Reserved.
Oral Bacteria as Potential Probiotics for the Pharyngeal Mucosaᰔ Simone Guglielmetti,1* Valentina Taverniti,1 Mario Minuzzo,2 Stefania Arioli,1 Milda Stuknyte,1 Matti Karp,3 and Diego Mora1 Dipartimento di Scienze e Tecnologie Alimentari1 and Dipartimento di Scienze Biomolecolari e Biotecnologie,2 Universita`degli Studi di Milano, Milan, Italy,2 and Institute of Environmental Engineering and Biotechnology, Tampere University of Technology, Tampere, Finland3
Received 15 January 2010/Accepted 10 April 2010
The research described here was aimed at the selection of oral bacteria that displayed properties compatible with their potential use as probiotics for the pharyngeal mucosa. We included in the study 56 bacteria newly isolated from the pharynges of healthy donors, which were identified at the intraspecies level and characterized in vitro for their probiotic potential. The experiments led us to select two potential probiotic bacterial strains (Streptococcus salivarius RS1 and ST3) and to compare them with the prototype oral probiotic S. salivarius strain K12. All three strains efficiently bound to FaDu human epithelial pharyngeal cells and thereby antag- onized Streptococcus pyogenes adhesion and growth. All were sensitive to a variety of antibiotics routinely used Downloaded from for the control of upper respiratory tract infections. Immunological in vitro testing on a FaDu layer revealed different responses to RS1, ST3, and K12. RS1 and ST3 modulated NF-B activation and biased proinflam- matory cytokines at baseline and after interleukin-1 (IL-1) induction. In conclusion, we suggest that the selected commensal streptococci represent potential pharyngeal probiotic candidates. They could display a good degree of adaptation to the host and possess potential immunomodulatory and anti-inflammatory
properties. aem.asm.org
Metagenomics and functional molecular immunology sub- respect to oral probiotics, particularly noticeable are the stud- stantiate the interpretation of humans as holobionts, in the ies done by J. R. Tagg and coworkers of Streptococcus salivarius at UNIV OF OTAGO on June 8, 2010 sense of functional superorganisms, combining the self and strain K12. Tagg and others, in fact, showed that, following oral microbes acting in concert to produce phenomena governed by administration, the bacterial strain K12 can colonize the oral the collective (25, 42). The association between host and mucosae of infants and adults (20, 34), downregulate the in- symbionts affects the fitness of the holobiont within its en- nate immune responses of human epithelial cells (11), and vironment, and it often governs the physiological homeosta- reduce oral volatile sulfur compound levels (8). Strain K12 was sis of the narrow balance between host well being and dys- also revealed to produce two plasmid-encoded lantibiotic pep- function (13, 35). tides (22, 38) that are active against Streptococcus pyogenes, the The mechanisms underlying the cross talk between a human main etiological agent of bacterial pharyngitis. These investi- host and microbes are only marginally understood. Their elu- gations demonstrated the potential effectiveness of the probi- cidation at a molecular level could supply the theoretical bases otic intervention in the oropharyngeal tract. to develop strategies for preventing or treating several human Encouraged by the promising results obtained in J. R. Tagg’s dysfunctions, such as autoimmune diseases, through the recon- experiments, in the present study, we screened oral bacteria for stitution of a proper human-microbe mutualism. their potential use as probiotics in the pharyngeal mucosa. We The probiotic approach, in its widest sense, falls into this tested the ability of bacteria, which were newly isolated from context, since it consists of the modification of a human mi- the pharynges of healthy volunteers, to adhere to a human crobiota by exogenous administration of microbial cells (or cell pharyngeal cell layer and to antagonize S. pyogenes on two components), aimed at benefiting the host’s health. A most different epithelial cell lines. The study allowed the selection of commonly accepted definition comes from FAO/WHO, which two bacterial strains, which were further investigated from an states that probiotics are “live microorganisms which when immunological point of view for their ability to cross talk with administered in adequate amounts confer a health benefit on human epithelial cells in vitro. the host” (17). So far, probiotics have been most predominantly investi- MATERIALS AND METHODS gated for and applied to the intestinal tract. Nevertheless, a few applications beyond the gut have proposed the potential Isolation of bacteria from pharyngeal mucosa, bacterial strains, and culture conditions. To isolate bacteria from the pharynx, specimens were collected using beneficial role of probiotics for the stomach (23), vaginal mu- polyester fiber-tipped applicator swabs (VWR, Milan, Italy) taken from 4 healthy cosa (36), urinary tract (6), skin (27), and oral cavity (39). With donors (3 females at 58, 32, and 29 years old, and a 32-year-old male). After serial dilutions in 0.1% peptonized saline, specimens were plated on MRS agar (Fluka Feinchemikalien GmbH, Neu-Ulm, Germany) supplemented with 0.05% * Corresponding author. Mailing address: Dipartimento di Scienze e cysteine-HCl (cMRS), M17 (Fluka Feinchemikalien GmbH) containing 2% lac- Tecnologie Alimentari, Universita degli Studi di Milano, Via Celoria 2, tose (LM17), and 2% glucose-tryptic soy agar (Difco, Detroit, MI). All 56 20133 Milan, Italy. Phone: 39 02 503 19136. Fax: 39 02 503 19191. colonies grown at the highest dilutions were picked and spread on a plate with a E-mail: [email protected]. loop. This procedure was repeated at least four times in order to obtain pure ᰔ Published ahead of print on 23 April 2010. cultures. Table 1 lists the oral bacterial isolates used in this study. If not differ-
3948 VOL. 76, 2010 LABs AS PROBIOTICS FOR THE PHARYNX 3949
TABLE 1. Bacteria isolated from pharyngeal mucosa
Human source BOX-PCR Isolation medium Additional Isolate(s)b Taxonomic identificationc designation genotypea usede identification methodd IS IS-A1 IS1 cMRS S. salivarius IS8, IS10, IS12 LM17 IS-A2 IS5, IS6 LM17 S. salivarius IS7 gTSA IS-B IS3, IS4 cMRS S. sanguinis IS-C IS9 LM17 Staphylococcus aureus IS15 gTSA IS-D IS11, IS13 LM17 Rothia mucilaginosa IS14 gTSA
RS RS-A1 RS1, RS8, RS10 LM17 S. salivarius RS3, RS6 cMRS RS13, RS14 gTSA RS-A2 RS9 LM17 S. salivarius RS-B RS4 cMRS Alloscardovia omnicolens RS-C RS5 cMRS Lactococcus lactis subsp. lactis his RS-D RS11 LM17 Micrococcus sp. (M. luteus)
RS-E RS12 gTSA Rothia mucilaginosa Downloaded from RS-F RS15 gTSA Bacillus subtilis
SM SM-A1 SM1, SM2, SM4, SM5 cMRS S. salivarius SM6, SM8, SM9 LM17 S. salivarius SM11, SM14, SM15 gTSA S. salivarius SM-A2 SM12 gTSA S. salivarius
SM-B SM3 cMRS S. oralis gdh aem.asm.org SM-C SM7 LM17 Rothia mucilaginosa SM-D SM13 gTSA Neisseria sp. (N. subflava)
ST ST-A1 ST3 cMRS S. salivarius ST-A2 ST12 LM17 S. salivarius ST-B ST2, ST5p cMRS S. oralis gdh at UNIV OF OTAGO on June 8, 2010 ST-C ST5g cMRS S. sanguinis ST-D ST4 cMRS S. oralis gdh ST15 gTSA ST-E ST7, ST11 LM17 S. infantis gdh ST-F ST1, ST8 LM17 Bacillus sp. (B. cereus) ST-G ST9 LM17 S. oralis gdh ST-H ST6 cMRS Staphylococcus epidermidis ST-I ST13, ST14 gTSA Rothia mucilaginosa
a Similar (but not identical) BOX-PCR electrophoretic patterns are indicated with the same letter but a different number. b Representative strains chosen for 16S rRNA gene sequence analysis are in boldface. Representative isolates were deposited in the culture collection of the Department of Food Science and Microbiology, Industrial Microbiology Section, University of Milan, Italy (MIM culture collection). c Species designations in parentheses refer to those with 16S rRNA gene sequence similarities below 95%. d gdh, taxonomic identification based on the sequence of an approximately 500-bp internal fragment of the glucose-6-phosphate dehydrogenase gene (gdh) (5); his, taxonomic identification based on the length polymorphism of a PCR-amplified fragment from a histidine biosynthesis operon (4). e gTSA, 2% glucose-tryptic soy agar.
ently specified, oral streptococci and Streptococcus thermophilus DSM20617T A similarity dendrogram was built using NTSYSpc version 2.01 (Applied were routinely grown overnight at 37°C in LM17, while Streptococcus pyogenes Biostatistics Inc., NY). was grown overnight at 37°C in brain heart infusion (BHI) medium (Difco, In vitro cultivation of epithelial cell lines. FaDu (human pharynx carcinoma Detroit, MI) supplemented with 0.3% yeast extract (yeBHI). S. pyogenes C11 has cell line; ATCC HTB-43) and HaCaT (human keratinocytes from a spontaneous been clinically isolated from a pharyngitis patient and has been ascribed to emm immortalized, nontumorigenic cell line) cells were routinely grown in 24-well type 77 through emm gene sequence analysis (data not shown). tissue culture plates in Dulbecco’s modified Eagle’s medium (DMEM), supple- Identification and molecular characterization of bacterial isolates. The iso- mented with 10% (vol/vol) heat-inactivated fetal calf serum (30 min at 56°C), 100 lates from each subject have been clustered by means of a BOX-PCR assay U mlϪ1 penicillin, 100 g mlϪ1 streptomycin, 0.1 mM nonessential amino acids, (Table 1), which was performed with the primer BoxA1 (5Ј-CTACGGCAAGG 2 mM L-glutamine and incubated at 37°C in a water-jacketed incubator in an CGACGCTGACG-3Ј). atmosphere of 95% air and 5% carbon dioxide, until a confluent monolayer was The 16S rRNA gene was amplified from at least one representative isolate formed. from each BOX genotypic group (Table 1) by PCR, using primers P0 (5Ј-GAA Bacterial adhesion to the FaDu cell layer. FaDu cells were grown in 3-cm petri GAGTTTGATCCTGGCTCAG-3Ј) and P6 (5Ј-CTACGGCTACCTTGTTACG plates on microscope cover glasses as described above. Cell monolayers were A-3Ј). The resulting amplicons (each about 1.5 kb long) were then completely carefully washed with phosphate-buffered saline (PBS; pH 7.3) before bacterial sequenced. Streptococcus salivarius isolates were further characterized by ran- cells were added. The bacterial cell concentration of an overnight culture was dom amplified polymorphic DNA (RAPD) analysis, performed with primers determined microscopically with a Neubauer-improved counting chamber OPI17 (5Ј-CGAGGGTGGTGATC-3Ј), OPI02-mod (5Ј-GCTCGGAGGAGAG (Marienfeld GmbH, Lauda-Ko¨nigshofen, Germany). Approximately 2 ϫ 108 G-3Ј), M13 (5Ј-GTAAAACGACGGCCAGT-3Ј), and PedAF (5Ј-ATACTACG cells of each strain resuspended in PBS (pH 7.3) were incubated with a mono- GTAATGGGGT-3Ј). layer of FaDu cells. After 1 h at 37°C, all monolayers were washed three times 3950 GUGLIELMETTI ET AL. APPL.ENVIRON.MICROBIOL. with PBS to release unbound bacteria. Cells were then fixed with 3 ml of (MCP-1), 0.8 pg mlϪ1; macrophage inflammatory protein 1 (MIP-1), 0.6 pg methanol and incubated for 8 min at room temperature. After methanol was mlϪ1; and tumor necrosis factor alpha (TNF-␣), 0.6 pg mlϪ1. removed, cells were stained with 3 ml of Giemsa stain solution (1:20; Carlo Erba, Construction of stable NF-B reporting FaDu cells. Stable transfectants of the Milan, Italy) and left for 30 min at room temperature. Wells were then washed FaDu cell line were obtained after transfection with the plasmid pNiFty2-Luc until no color was observed in the washing solution and dried in an incubator at (InvivoGen, Rho, Italy). This plasmid combines five NF-B sites with the insect 30°C for 1 h. Microscope cover glasses were then removed from the petri plate luciferase reporter gene luc. The presence of active NF-B molecules in the cell and examined microscopically (magnification of ϫ100) immersed in oil. Adher- activates the promoter, resulting in the expression of the luciferase gene. Trans- ent bacteria in 20 randomly selected microscopic fields were counted and aver- fection was performed by means of the StoS transfection kit (GeneSpin, Milan, aged. Italy), in accordance with the manufacturer’s protocol. Afterward, cells were Preparation of bioluminescent Streptococcus pyogenes. Reporter vector resuspended in fresh DMEM, seeded in 24-well plates, and incubated for 48 h, pCSS945, carrying a phage T5 promoter-lac operator upstream of the insect in order to obtain the expression of the antibiotic resistance. Finally, stable Ϫ1 luciferase gene lucGR (29), was used to obtain the luminescent phenotype in recombinant clones were selected by adding into the culture medium 50 g ml Streptococcus pyogenes C11, according to conventional electrotransformation of zeocin (InvivoGen, Rho, Italy). methods. Transformants were selected on yeBHI agar plates with 5 g mlϪ1 of Study of NF-B activation. Recombinant FaDu cells were cultured using the chloramphenicol. The selected luminescent S. pyogenes clone was named same protocol as that used for nontransfected FaDu cells, in the presence of 50 Ϫ1 C11LucFF. g ml of zeocin. After growth, the FaDu layer was detached by trypsinization, Ϫ1 Antagonistic activity against Streptococcus pyogenes. The antagonism against S. and cells were resuspended in DMEM at a concentration of 250,000 cells ml pyogenes was studied through exclusion and competition assays. Exclusion con- in the presence of 100 mM HEPES (pH 7.4). Subsequently, 50 l of tester 9 8 7 Ϫ1 sisted of an hour of preincubation of the FaDu layer with 1 ml of a tester strain bacterial suspension, containing 2 ϫ 10 ,2ϫ 10 ,or2ϫ 10 cells ml , was suspension (5 ϫ 108 cells mlϪ1), followed by a washing step with PBS and added to 450 l of a FaDu suspension, resulting in MOIs of about 1,000, 100, or incubation with 1 ml of the indicator strain (S. pyogenes C11LucFF) suspension 10, respectively. After incubation at 37°C for 4 h, samples were kept in ice and 8 Ϫ1 8 Ϫ1 sonicated at maximum frequency for 5 s (Bandelin sonicator; Bandelin electronic (2 ϫ 10 cells ml ) for 1 h. The concentration of 5 ϫ 10 tester cells ml was Downloaded from chosen because it corresponded to the plateau of dose-response curves which GmbH & Co., Berlin, Germany). Bacterial cells and insoluble particles were removed by centrifugation, and the supernatants were transferred into a new were prepared during the setup of the experiment by measuring the antagonistic tube. At this point, 100 l of supernatants was aliquoted in duplicate into the activity as a function of tester cell concentration (data not shown). Competition wells of a 96-well white microtiter plate (PerkinElmer, Monza, Italy); then, 12.5 consisted of an hour of coincubation of the same number of tester and indicator l of a 10 mM ATP solution and 12.5 l of 0.1 mM D-luciferin were added, and strains (2 ϫ 108 cells mlϪ1). the emitted bioluminescence was immediately recorded every 90 s with a Victor The bacterial cell concentration was determined from an overnight culture 3 luminometer (PerkinElmer). The maximum of the light production curve was microscopically by means of a Neubauer-improved counting chamber (Marien- aem.asm.org considered for comparison of the results. In a different set of experiments, feld GmbH). After incubation, FaDu layers were quickly washed twice with 1 ml recombinant FaDu cells were simultaneously stimulated with IL-1 (2 ng mlϪ1). PBS (pH 7.3), and D-luciferin (Sigma-Aldrich, Steinheim, Germany) was added In the setup of the experiment, we confirmed that IL-1 was not modified or at the concentration of 12.5 M in citrate buffer, pH 5. Immediately, the lumi- digested by bacteria during the incubation step (data not shown). All strains were nescence signal was measured with a Victor 3 luminometer (PerkinElmer, analyzed in duplicate in at least three independent experiments per each single
Monza, Italy). Each tester strain was analyzed in triplicate with at least two at UNIV OF OTAGO on June 8, 2010 MOI. An unpaired Student’s t test was performed to find statistically significant independent experiments. An unpaired Student’s t test was performed to find differences. statistically significant differences. Antibiotic susceptibility of selected bacteria. The inhibitory concentrations of Antibacterial activity against Streptococcus pyogenes and PCR detection of several antimicrobial agents were determined, according to conventional broth bacteriocin-encoding genes. In the first set of experiments, tester bacterial strains microdilution protocols, in commercial 96-well microtiter plates for the following were spread with a loop on an agar plate containing LM17 medium and incu- concentration ranges: ampicillin, chloramphenicol, erythromycin, oxytetracy- 6 bated overnight at 37°C. Then, 15 ml of soft yeBHI agar containing about 10 cline, and vancomycin, 1 to 16 g mlϪ1; gentamicin, 8 to 64 g mlϪ1; and cells of the indicator strain (S. pyogenes C11) was poured over the plates. The kanamycin and streptomycin, 16 to 128 g mlϪ1. The following three different plates were checked for inhibition zones after incubation at 37°C for 24 and 48 h. liquid media were used in this experiment: LM17, MRS, and BHI. The production of antimicrobial substances was also tested through disk diffu- Determination of urease activity and PCR detection of the ureC gene. Urease sion. Briefly, tester strains were grown until stationary growth phase in LM17 activity was tested by evaluating the release of ammonia by means of the phenol medium. Culture supernatants were neutralized to pH 7, filter sterilized, and red assay, as described in the literature (28). spotted (0.1 ml) on a filter paper disk, which was previously placed on yeBHI soft The amplification of the gene coding for the main subunit of the urease 6 agar plates inoculated with about 10 S. pyogenes cells. The presence of an complex (ureC) was carried out as previously described (31), using primers inhibition halo was checked after 24 and 48 h. ureIAf (5Ј-GGAATTGTAACAGCTTGGAT-3Ј) and ureCr (5Ј-GTCGTATGG The PCRs used to detect previously characterized bacteriocin structural genes ATTGGTTCACA-3Ј). (salivaricin A, salivaricin B, streptin, and peptide SA-FF22) were performed as described by Wescombe et al. (41). Stimulation of FaDu monolayers and enzyme-linked immunosorbent assay RESULTS (ELISA) measurement of cytokine production. Human pharyngeal carcinoma cells (FaDu) were seeded into 24-well plates and grown, as previously described. Isolation and characterization of bacteria from pharyngeal Bacterial cells were added to monolayers of FaDu cells in 0.5 ml of fresh mucosa. A total of 56 isolates were obtained from pharyngeal antibiotic-free Eagle’s minimum essential medium (EMEM) containing 100 mM swab samples taken from four healthy donors by using three HEPES (pH 7.4) and incubated overnight at 37°C. Each bacterial strain was used at a multiplicity of infection (MOI) of about 1,000, while EMEM/HEPES me- different culture media (Table 1). After a preliminary grouping dium without bacterial cells was used as a control. After overnight incubation, of all isolated bacteria through BOX-PCR fingerprinting (data the supernatants were collected by pipetting, centrifuged to remove cells, and not shown), 16S rRNA genes sequence analysis revealed that kept at Ϫ80°C. The same experiment was also performed by incubating bacteria 39 of the isolates belonged to the Streptococcus genus. Strep- Ϫ1 and FaDu cells in the presence of 2 ng ml of interleukin-1 (IL-1). Finally, tococcus salivarius was the most represented species (28 iso- different cytokines in the supernatants were determined with a Bio-Plex array reader (Luminex 100; Bio-Rad Laboratories, Hercules, CA) using the Bio-Plex lates). We also isolated Streptococcus oralis (6 isolates) and human cytokine 17-plex panel (Bio-Rad), according to the human cytokine Streptococcus infantis (2 isolates), which were distinguished by Bio-Plex panel assay protocol (Bio-Rad). The list of tested cytokines and the glucose-6-phosphate dehydrogenase gene (gdh) sequence anal- corresponding detection limits were as follows: IL-1, 0.3 pg mlϪ1; IL-2, 0.2 pg ysis (5). The only species isolated from all four pharyngeal Ϫ1 Ϫ1 Ϫ1 Ϫ1 Ϫ1 ml ; IL-4, 0.1 pg ml ; IL-5, 0.3 pg ml ; IL-6, 0.2 pg ml ; IL-7, 0.3 pg ml ; samples were S. salivarius and Rothia mucilaginosa (7 isolates). IL-8, 0.3 pg mlϪ1; IL-10, 0.2 pg mlϪ1; IL-12 (p70), 0.4 pg mlϪ1; IL-13, 0.3 pg mlϪ1; IL-17, 0.5 pg mlϪ1; granulocyte colony-stimulating factor (G-CSF), 0.2 All the other bacteria are listed in Table 1. pg mlϪ1; granulocyte-macrophage colony-stimulating factor (GM-CSF), 1.1 pg Streptococcus salivarius isolates were further characterized at mlϪ1; gamma interferon (IFN-␥), 2.6 pg mlϪ1; monocyte chemotactic protein 1 the intraspecies level by means of BOX-PCR and RAPD-PCR VOL. 76, 2010 LABs AS PROBIOTICS FOR THE PHARYNX 3951 Downloaded from aem.asm.org at UNIV OF OTAGO on June 8, 2010
FIG. 1. Unweighted-pair group method using average linkages (UPGMA) dendrogram derived from similarity coefficients calculated by the Jaccard method (simple Jaccard [Sj] coefficients; shown on the scale at the bottom), showing the relationship among Streptococcus salivarius pharyngeal isolates, analyzed by BOX-PCR and RAPD analysis using primers M13, OPI02mod, OPI17mod, and PedAF. Samples with a similarity coefficient higher than 0.9 have been included in the same genotype. Selected bacterial isolates included in antagonism experiments are indicated in boldface.
analyses (data not shown). A computer evaluation of similar- by nine other strains (ADI between 2,500 and 500), all belong- ities and clustering resulted in a total of 11 unique S. salivarius ing to the species S. salivarius. genotypes out of 28 pharyngeal isolates and the K12 commer- The antagonistic activity against Streptococcus pyogenes on cial probiotic strain (Fig. 1). The isolates that were included in human epithelial cell lines is strain dependent. All the oral S. a single genotypic group originated from the same pharyngeal salivarius strains studied in the adhesion assay, together with sample, suggesting that they were probably multiple isolates. the other bacteria displaying a significant adhesion on the Several oral isolates adhere efficiently to the FaDu epithelial FaDu cell layer (Fig. 2), were investigated with a three-com- layer. Twenty-three bacterial strains were tested for their abil- ponent system consisting of the epithelial cell layer, the S. ity to adhere to the FaDu epithelial cell layer. We studied 13 S. pyogenes C11LucFF indicator bioluminescent strain, and the salivarius strains, including at least one representative isolate tester bacterium. In this experiment, we measured the reduc- from each genotypic cluster and the commercial probiotic tion of bioluminescence produced by S. pyogenes C11LucFF as strain K12. We also included 10 other pharyngeal isolates that an indication of the antagonistic activity exerted by the tester were arbitrarily selected. After being extensively washed with strains. PBS, a significant proportion of cells from many bacterial Antagonism through exclusion was tested on the layers of strains remained attached to the FaDu monolayer, providing two different human epithelial cell lines, FaDu and HaCaT. evidence that the adhesion was not only nonspecific physical The results showed that antagonistic exclusion against S. pyo- entrapment. In particular, the following three strains displayed genes C11LucFF was generally stronger on FaDu hypopharyn- strong adhesive phenotypes, coinciding with an adhesion index geal carcinoma cells than HaCaT keratinocytes. The results (ADI; bacterial cells per 100 FaDu cells) of more than 2,500 also demonstrated that the exclusion activity is strain specific, (Fig. 2): Lactococcus lactis subsp. lactis RS5, S. salivarius K12, since significant differences were also observed among strains and S. salivarius ST3. Good adhesive ability was also displayed of the same species. 3952 GUGLIELMETTI ET AL. APPL.ENVIRON.MICROBIOL. Downloaded from aem.asm.org
FIG. 2. Adhesion of bacterial strains to the FaDu epithelial cell layer according to their adhesion indexes (ADI; number of bacteria/100 FaDu at UNIV OF OTAGO on June 8, 2010 cells). (A) ϩϩϩ, strong adhesion (ADI of Ͼ2,500); ϩϩ, good adhesion (ADI of between 2,500 and 500); ϩ, weak adhesion (ADI of between 500 and 100); Ϫ, no adhesion (ADI of Ͻ100). (B) Adhesion to FaDu cell monolayers, as observed with Giemsa staining under a light microscope. Bars, 8 m. One FaDu nucleus for each layer is indicated with the letter N.
We found a correlation between the results obtained with Inhibition of S. pyogenes and PCR detection of bacteriocin- the two cell lines. In fact, with only a few exceptions, those encoding genes. After 24 h of incubation at 37°C, we observed strains that significantly reduced the light production in clear inhibition zones corresponding to the colonies of the HaCaT cells also did so in the FaDu cell layer. Particularly, the tester strains K12, RS1, and ST3 (data not shown). On the following two strains were the most active in both cell lines: S. contrary, when cell-free neutralized broths were used in disk salivarius ST3 (with average reductions of bioluminescence of diffusion tests, inhibition zones were observed only for the 40% in FaDu and 24% in HaCaT) and S. salivarius RS1 reference strain S. salivarius K12. Accordingly, PCR experi- (Ϫ33% in FaDu and Ϫ25% in HaCaT) (Fig. 3). Their activity ments suggested that strains RS1 and ST3 could not possess was significantly stronger than that of the S. salivarius K12 bacteriocin genes, while strain K12 gave a positive signal for reference oral probiotic strain. Therefore, strains RS1 and ST3 two lantibiotics, salivaricins A and B (data not shown), which were selected and included in all of the following experiments. are known to be carried by strain K12 on a 190-kb transmissi- The antagonism by competition was tested only on the FaDu ble plasmid (22). In contrast, strains RS1 and ST3 are plasmid- cell layer for the two previously selected strains (S. salivarius free strains (G. Ricci, personal communication). Therefore, it ST3 and RS1), the reference oral probiotic K12, and four other appears plausible that the pharyngeal isolates ST3 and RS1 strains (S. salivarius RS13, S. oralis ST4 and ST5p, and S. inhibited the growth of S. pyogenes in the plate probably simply sanguinis ST5g), which were selected in order to have at least due to their acid production. one representative strain for each of the four typologies of S. salivarius K12, RS1, and ST3 drive different immune bacterial adhesion on the FaDu layer (Fig. 2). In this experi- responses in vitro. Overnight incubation of a FaDu monolayer ment, all tested strains markedly inhibited S. pyogenes biolu- with selected bacteria resulted in the modulation of cytokine minescence, with particular evidence for S. salivarius strains production profiles, as determined by the Bio-Plex human cy- (ϳ80% reduction) (Fig. 4). We also noticed a partial depen- tokine 17-plex array system (Bio-Rad) (Table 2 and Fig. 5). dence of competition on adhesion ability. The antagonism ef- Under baseline conditions, the oral isolate S. salivarius RS1 ficacy was in fact slightly weaker for poorly adhesive strains nearly eliminated IL-1 secretion and reduced IL-6 and (e.g., ST5p and ST5g) than strongly adhesive bacteria (e.g., TNF-␣ in the FaDu supernatant from 78.1 to 42.0 pg mlϪ1 and K12 and ST3; P values of Ͻ0.001, according to an unpaired from 1.9 to 0.6 pg mlϪ1, respectively. Similarly, S. salivarius Student’s t test) (Fig. 4). ST3 eliminated the secretion of IL-1 and TNF-␣ but, in VOL. 76, 2010 LABs AS PROBIOTICS FOR THE PHARYNX 3953
FIG. 4. Antagonistic competition activity of bacterial pharyngeal isolates against bioluminescent Streptococcus pyogenes C11LucFF on FaDu hypopharyngeal carcinoma cells. Data reported as percent variation of light emission, which referred to the cell layer treated with only S. pyogenes cells. Numerical results are given as arithmetic means Ϯ standard deviations. All samples resulted as being signif- icantly different compared to the control (P Ͻ 0.001, according to an unpaired Student’s t test). Downloaded from production of bioluminescence. NF-B activation was partic- ularly evident for strain ST3, which doubled the biolumines- cence produced by FaDu cells when we employed an MOI of about 1,000. In contrast, S. salivarius K12 did not significantly affect NF-B at baseline (Fig. 6A). In the series of experiments which followed, the effect of aem.asm.org FIG. 3. Antagonistic exclusion activity of bacterial pharyngeal iso- bacterial strains on NF-B activation was assessed during stim- lates against bioluminescent Streptococcus pyogenes C11LucFF on FaDu ulation of FaDu cells with the proinflammatory cytokine IL-1. hypopharyngeal carcinoma cells (A) and HaCaT keratinocytes (B). Ϫ1 Data reported as percent variation of light emission, which referred to The addition of 2 ng ml of IL-1 to FaDu culture medium the cell layer treated with only PBS buffer before incubation with S. caused an almost 2-fold increase in NF-B activity after4hof pyogenes. Numerical results are given as arithmetic means Ϯ standard incubation. The IL-1-dependent increase in bioluminescence at UNIV OF OTAGO on June 8, 2010 deviations. Each sample was processed in triplicate in at least two was partially inhibited only at the highest MOI tested (1,000) independent experiments. Strains belonging to species S. salivarius are indicated in boldface. Statistically significant differences compared to by S. salivarius strains K12 (Ϫ38%), RS1 (Ϫ34.5%), and ST3 strain K12 were calculated according to an unpaired Student’s t test (Ϫ29.2%) (Fig. 6B). (**, P Ͻ 0.001; *, P Ͻ 0.05). Safety assessment of selected bacteria by antibiotic suscep- tibility testing. We studied the antibiotic resistance of S. sali- varius K12, RS1, and ST3 with reference to the European Food addition, enhanced the production of IL-8 (from 1,721 to 2,331 Safety Authority (EFSA) breakpoints for Streptococcus ther- pg mlϪ1), GM-CSF (from 0.2 to 1.9 pg mlϪ1), and MIP-1 mophilus (16), because S. salivarius is phylogenetically close to (from 0.9 to 3.2 pg mlϪ1). The commercial oral probiotic Strep- S. thermophilus. Bacterial strains were found to be sensitive tococcus salivarius K12 decreased IL-6 and IL-8 at levels to ampicillin, chloramphenicol, erythromycin, oxytetracycline, greater than those of the other two streptococci (from 78.1 to and vancomycin. A variable resistance was observed with the 24.2 pg mlϪ1 and from 1,721 to 579 pg mlϪ1, respectively). aminoglycoside antibiotics (gentamicin, kanamycin, and strep- Furthermore, strain K12 induced a reduction of the secretion tomycin), depending on the strain and the growth medium. All of TNF-␣ (from 1.9 to 0.9 pg mlϪ1) and G-CSF (from 3.5 to 1.7 strains were assessed to be resistant to kanamycin, with the pg mlϪ1) and increased GM-CSF (from 0.2 to 1.6 pg mlϪ1) only exception being S. salivarius ST3 grown in LM17 medium (Table 2 and Fig. 5A). (Table 3). Strain K12 was resistant to gentamicin in LM17 When the FaDu layer was stimulated with 2 ng mlϪ1 of the medium and to streptomycin in BHI medium. Strain RS1 dis- proinflammatory cytokine IL-1, all strains tested noticeably played resistance to gentamicin in LM17 and MRS media and reduced the concentrations of IL-6 and IL-8 in the FaDu to streptomycin in BHI and LM17 media. Finally, S. salivarius culture supernatant. To be specific, strains K12, RS1, and ST3 ST3 was resistant to gentamicin in MRS medium and to strep- reduced IL-6 from 121.5 to 73.7, 65.2, and 86.7 pg mlϪ1, re- tomycin in BHI and MRS media (Table 3). spectively, and IL-8 from 3,353 to 2,043, 2,464, and 2,261 pg ST3 is a natural urease-negative S. salivarius strain. The mlϪ1, respectively. Furthermore, S. salivarius RS1 induced a potential safety of selected S. salivarius isolates was also tested, reduction of IFN-␥ secretion from 20.3 to 13.5 pg mlϪ1 (Table considering their ability to hydrolyze urea. S. salivarius K12 2 and Fig. 5B). and RS1 were markedly urealytic when grown in a medium To further explore the immunomodulatory properties of containing nickel cations. In contrast, strain ST3 did not hy- selected oral bacteria, we tested the effect of the microorgan- drolyze urea. According to the phenotypic assay, we failed to isms on NF-B activation using a recombinant cell line, ob- amplify from the strain ST3 ureC gene, which encodes the tained by transfecting FaDu cells with a luciferase reporter alpha subunit protein containing the active site and conserved vector inducible by NF-B. In FaDu cells, strains RS1 and ST3 nickel binding ligands of the urease complex. In contrast, a showed at baseline a stimulatory effect on NF-B-dependent PCR fragment of the expected length was obtained from the 3954 GUGLIELMETTI ET AL. APPL.ENVIRON.MICROBIOL.
TABLE 2. Cytokine levels
Cytokine level (pg mlϪ1) in EMEM culture brotha
Cytokine Without IL-1 With IL-1
Control K12 RS1 ST3 Control K12 RS1 ST3 IL-1 8.60 Ϯ 0.85 9.50 Ϯ 0.54 0.34 Ϯ 0.37 0.77 Ϯ 0.25 254.2 Ϯ 3.3 298.1 Ϯ 64.1 204.7 Ϯ 20.0 229.8 Ϯ 18.7 IL-2 0.35 Ϯ 0.49 1.18 Ϯ 0.00 0.35 Ϯ 0.49 1.16 Ϯ 0.37 0.86 Ϯ 0.49 2.75 Ϯ 0.45 0.15 Ϯ 0.05 0.98 Ϯ 0.04 IL-4 0.22 Ϯ 0.01 0.15 Ϯ 0.21 0.19 Ϯ 0.19 0.21 Ϯ 0.09 0.27 Ϯ 0.04 0.76 Ϯ 0.06 0.57 Ϯ 0.16 0.46 Ϯ 0.03 IL-5 BDL BDL BDL BDL BDL BDL BDL BDL IL-6 78.10 Ϯ 19.18 24.23 Ϯ 1.03 41.95 Ϯ 3.74 59.01 Ϯ 17.47 121.5 Ϯ 56.6 73.66 Ϯ 36.03 65.23 Ϯ 2.69 86.72 Ϯ 0.29 IL-7 0.28 Ϯ 0.03 0.20 Ϯ 0.28 0.45 Ϯ 0.26 0.86 Ϯ 0.27 0.61 Ϯ 0.23 0.37 Ϯ 0.06 0.83 Ϯ 0.12 0.46 Ϯ 0.22 IL-8 1,721 Ϯ 565 579,0 Ϯ 134.7 1,547 Ϯ 327 2,331 Ϯ 402 3,353 Ϯ 872 2,043 Ϯ 124 2,464 Ϯ 213 2,261 Ϯ 357 IL-10 0.07 Ϯ 0.10 0.26 Ϯ 0.04 0.02 Ϯ 0.03 0.16 Ϯ 0.22 BDL 0.33 Ϯ 0.22 BDL 0.15 Ϯ 0.05 IL-12 (p70) 0.40 Ϯ 0.57 0.80 Ϯ 0.28 0.34 Ϯ 0.07 BDL BDL 1.95 Ϯ 1.06 0.60 Ϯ 0.85 0.70 Ϯ 0.14 IL-13 0.61 Ϯ 0.09 0.36 Ϯ 0.01 0.09 Ϯ 0.03 0.18 Ϯ 0.25 0.21 Ϯ 0.05 1.16 Ϯ 0.37 0.48 Ϯ 0.04 0.67 Ϯ 0.11 IL-17 0.29 Ϯ 0.17 0.94 Ϯ 0.36 0.47 Ϯ 0.66 0.91 Ϯ 0.21 0.32 Ϯ 0.028 3.08 Ϯ 0.77 1.66 Ϯ 0.57 2.06 Ϯ 0.57 G-CSF 3.45 Ϯ 0.67 1.67 Ϯ 0.08 1.65 Ϯ 1.73 2.06 Ϯ 0.72 9.55 Ϯ 2.52 7.62 Ϯ 0.41 5.02 Ϯ 1.08 13.14 Ϯ 5.17 GM-CSF 0.19 Ϯ 0.01 1.59 Ϯ 0.28 1.17 Ϯ 0.98 1.85 Ϯ 0.65 2.84 Ϯ 0.75 5.55 Ϯ 2.12 2.88 Ϯ 0.95 2.37 Ϯ 0.51 IFN-␥ 10.83 Ϯ 4.60 9.42 Ϯ 0.86 10.90 Ϯ 2.09 8.38 Ϯ 4.82 20.31 Ϯ 4.12 28.54 Ϯ 0.35 13.52 Ϯ 0.21 22.11 Ϯ 5.90 MCP-1 1.13 Ϯ 0.28 0.58 Ϯ 0.81 1.39 Ϯ 0.87 2.09 Ϯ 0.85 3.08 Ϯ 0.66 3.36 Ϯ 0.40 2.57 Ϯ 0.02 2.73 Ϯ 0.45 MIP-1 0.92 Ϯ 0.38 0.25 Ϯ 0.18 1.08 Ϯ 0.79 3.23 Ϯ 0.63 1.79 Ϯ 0.24 2.46 Ϯ 0.76 2.37 Ϯ 1.59 3.54 Ϯ 0.97 Downloaded from TNF-␣ 1.88 Ϯ 0.62 0.86 Ϯ 0.17 0.62 Ϯ 0.52 BDL 3.51 Ϯ 0.15 5.99 Ϯ 1.87 3.18 Ϯ 1.51 7.26 Ϯ 1.49
a Determined by using Bio-Plex assays after overnight incubation of FaDu layers in the presence of bacterial cells (2 ϫ 108 cells mlϪ1) with or without IL-1 (2 ng mlϪ1). Control samples were obtained by incubating FaDu layers without bacterial cells. BDL, below detection limit.
other S. salivarius strains using primers targeting ureC (data cus pyogenes on human epithelial cell layers. The experimental aem.asm.org not shown). system set up during this study consisted of the use of a re- combinant S. pyogenes strain, expressing a firefly luciferase. Since luciferase catalyzes a bioluminescent reaction that de-
DISCUSSION at UNIV OF OTAGO on June 8, 2010 pends stoichiometrically on ATP, the measurement of light Upper respiratory tract infections (URTIs) are the most production, after addition of the substrate D-luciferin, is de- frequent reason for a visit to a pediatrician, and Streptococcus pendent on both the number and the metabolic state of bac- pyogenes is a major cause of acute pharyngeal infections, espe- terial cells. cially in children 5 to 12 years of age (12). At present, the We also included in this part of the study immortalized treatment of acute bacterial pharyngitis consists of the ad- HaCaT cells that have been reported to retain many charac- ministration of broad-spectrum antibiotics. These have been teristics of the human keratinocytes from which they were estimated to be prescribed in as high as 90% of the pediatric originally derived (7). Keratinocytes are, in fact, a constitutive visits for URTIs. A probiotic strategy effective in the pro- part of the stratified oral epithelium and represent a primary phylaxis of pharyngitis, therefore, could provide a significant target of adhesion for invading S. pyogenes cells (1, 14). In social benefit. exclusion experiments, the ability of the tested bacteria to In accordance with this objective, in this study we aimed to antagonize S. pyogenes was found to be strain specific. In fact, select oral bacteria with potential probiotic features for the the most active strains on both of the epithelial layers were S. pharyngeal mucosa. We included bacteria newly isolated from salivarius RS1 and ST3, while strain SM12, belonging to the the pharynges of healthy donors. Potentially, pharyngeal iso- same species, was unable to antagonize S. pyogenes. lates could, in fact, display better performances in the coloni- Adhesion experiments performed on the FaDu cell layer can zation of the oral ecosystem than traditional dairy or intestinal give a partial explanation of the strong antagonizing activity probiotic bacteria. displayed by S. salivarius ST3 and RS1 (Fig. 3). Strains ST3 and In this research, half of the pharyngeal isolates were ascribed RS1, in fact, adhered efficiently to the epithelial layer (Fig. 2). to the species Streptococcus salivarius (28 out of 56 isolates), in It can be hypothesized, therefore, that the competition for accordance with previous studies showing these bacteria to be adhesion sites is a major mechanism through which these bac- the dominant cultivable species in the oropharyngeal tract teria antagonize S. pyogenes on FaDu cells. (24). Nonpathogenic streptococci are the bacteria most largely One mechanism of action of probiotics is suggested to be present at the oropharyngeal level, and they have been pro- their modulation of host immune responses. In a recent study, posed to exert a key role in the protection against pathogenic Cosseau and collaborators showed that the oral probiotic S. agents, which cause inflammation and infections (39). In salivarius K12 can induce in vitro anti-inflammatory responses particular, Streptococcus salivarius already becomes a stable in epithelial cells, indicating a potential promotion of cellular colonizer of the oral microbiota a few days after birth and health and homeostasis (11). In that study, after coculture of represents, in adults, the major species at the levels of the human bronchial epithelial cells (16HBE14O- cells) with strain pharyngeal mucosa and dorsal tongue. K12, they observed an inhibition of the baseline secretion of The main criterion we adopted for the selection of potential the chemokine IL-8, in coincidence with the inhibition of the pharyngeal probiotics was the ability to antagonize Streptococ- activation of the NF-B pathway (11). VOL. 76, 2010 LABs AS PROBIOTICS FOR THE PHARYNX 3955 Downloaded from aem.asm.org at UNIV OF OTAGO on June 8, 2010
FIG. 5. Cytokine secretions that changed significantly after treatment of the FaDu layer with bacterial cells, as determined by using the Bio-Plex assay. The same results are also included in Table 2. FaDu layers were incubated overnight with bacterial cells (2 ϫ 108 cells mlϪ1) without (A) and in the presence of (B) 2 ng mlϪ1 of IL-1. The values are the means from two experiments conducted in duplicate. The vertical bars indicate standard deviations.
In our study, the immunomodulatory properties of S. sali- details, we found two different behaviors among the bacteria varius K12, RS1, and ST3 were tested on a FaDu layer by under study. While strain K12 reduced baseline IL-8 and IL-6 means of ELISA quantification of 17 secreted cytokines. secretion, in contrast, RS1 and ST3 inhibited drastically IL-1 Subsequently, in order to elucidate the possible mechanisms and stimulated the MIP-1 and MCP-1 cytokines. These re- involved in the effects on cytokine production, we studied the sults have been partially explained by the experiments on modulation of NF-B activation. NF-B activation. The reduced secretion of IL-8 and IL-6 In these experiments, none of the tested strains exhibited provoked by strain K12 can be attributed to the inhibition of potential proinflammatory effects, suggesting that they could NF-B activation, as already proposed by Cosseau et al. (11). be well tolerated by human epithelial cells in vivo. This state- In contrast, S. salivarius RS1 and ST3 promoted the baseline ment is consistent with the induced reduction of baseline activation of NF-B. Greten and collaborators have recently TNF-␣ secretion, which was observed with all tested strains. In demonstrated that NF-B activates the secretion of a selective 3956 GUGLIELMETTI ET AL. APPL.ENVIRON.MICROBIOL.
inhibitor of caspase-1, a peptidase required for pro-IL-1 mat- uration (18). Therefore, we can reasonably speculate that the inhibition of IL-1 secretion by strains RS1 and ST3 could also be mediated by a mechanism involving inhibition of the en- zyme caspase-1. The oral S. salivarius isolates RS1 and ST3, additionally, stimulated the secretion of MIP-1 and MCP-1 by FaDu cells. Similar behavior has been previously described for the well-known intestinal probiotic Escherichia coli Nissle 1917 (40). Even if MIP-1 and MCP-1 are proinflammatory cytokines, it has been proposed that, upon contact with com- mensal microbes, local induction of proinflammatory immune responses by way of the upregulation of the MCP-1 and MIP cytokines might reflect part of the host defense process against pathogenic bacteria by establishing a protective immunological barrier (40). Cytokine secretion and modulation of NF-B activity by selected bacteria were also tested on FaDu cells stimulated
with IL-1, a prototypical proinflammatory cytokine that plays Downloaded from a central role in the inflammation amplification cascade. After stimulation by IL-1, we observed that, at an MOI of 1,000, strains K12, RS1, and ST3 reduced the NF-B activation in a statistically significant manner, while the other conditions tested had no significant effect. The stimulatory activity of RS1
and ST3 bacterial cells on NF-B activation was, therefore, aem.asm.org eliminated in the presence of the inflammatory stimulus due to IL-1. Similarly, it is noteworthy that in IL-1-treated FaDu cells, S. salivarius strains can considerably reduce IL-6 and IL-8
secretion, suggesting their potential anti-inflammatory activity. at UNIV OF OTAGO on June 8, 2010 Recently, the European Food Safety Authority (EFSA) as- signed a “Qualified Presumption of Safety” (QPS) status (15) to several lactic acid bacterial species, including Streptococcus thermophilus but not Streptococcus salivarius. In Europe, S. FIG. 6. Effects of selected bacterial strains on FaDu cells stably salivarius belongs to risk group 2 (like S. pyogenes or S. pneu- transfected with an NF-B/luciferase reporter vector, without (A) or moniae), while the very closely related Streptococcus species S. Ϫ1 with (B) stimulation with IL-1 (2 ng ml ). Luciferase activity is thermophilus, S. uberis, and S. vestibularis (32) belong to risk expressed as percent change of relative luminescence units (RLU), assuming the control as 100%. Control, FaDu layers incubated without group 1. Presumably, S. salivarius is considered an opportunis- bacterial cells. The values are the means (Ϯ standard deviations) from tic pathogen because, as with many food-grade lactobacilli, at least three independent experiments conducted in duplicate. Aster- there have been sporadic reports of infections, generally in isks indicate statistically significant differences compared to the con- subjects under adverse medical conditions (2, 3, 10). Quite the trol. MOI, multiplicity of infection (bacterial cells per FaDu cell). opposite, in other parts of the world, S. salivarius has already acquired the status of safe microorganism and has been com- mercialized for several years as a probiotic without any re-
TABLE 3. Antibiotic sensitivities of selected bacterial strains
MIC (g mlϪ1)c EFSA MIC Antibiotic K12 RS1 ST3 (g mlϪ1)b BHI LM17 BHI LM17 MRS BHI LM17 MRS Ampicillin Ͻ1 Ͻ1 Ͻ1 Ͻ1 Ͻ1 Ͻ1 Ͻ1 Ͻ12 Chloramphenicol Ͻ1 Ͻ4, Ͼ1 Ͻ1 Ͻ4, Ͼ1 Ͻ4, Ͼ1 Ͻ1 Ͻ4, Ͼ1 Ͻ4, Ͼ14 Erythromycin Ͻ1 Ͻ1 Ͻ1 Ͻ1 Ͻ1 Ͻ1 Ͻ1 Ͻ12 Gentamicina Ͻ32 >64 Ͻ16 <64 >64 Ͻ16 Ͻ8 >64 32 Ͼ16 Ͼ8 >32 Ͼ8 Kanamycina >128 >128 >128 >128 >128 >128 Ͻ16 >128 64 Oxytetracycline Ͻ1 Ͻ1 Ͻ1 Ͻ4, Ͼ1 Ͻ1 Ͻ1 Ͻ1 Ͻ14 Streptomycin1 <128, >64 Ͻ16 <128, >64 <128, >64 Ͻ64, Ͼ32 <128, >64 Ͻ32, Ͼ16 <128, >64 64 Vancomycin Ͻ1 Ͻ4, Ͼ1 Ͻ1 Ͻ4, Ͼ1 Ͻ4, Ͼ1 Ͻ4, Ͼ1 Ͻ4, Ͼ1 Ͻ4, Ͼ14
a Possible interference of the growth medium is reported (16). b Microbiological breakpoints categorizing bacteria as resistant, according to EFSA guidelines for Streptococcus thermophilus (16). c MICs above EFSA limits are in boldface. LM17, M17 medium containing 2% lactose. VOL. 76, 2010 LABs AS PROBIOTICS FOR THE PHARYNX 3957 ported adverse consequences (9). In the light of the above- 5. Bek-Thomsen, M., H. Tettelin, I. Hance, K. E. Nelson, and M. Kilian. 2008. mentioned facts, the optimal strategy to assess the safety of S. Population diversity and dynamics of Streptococcus mitis, Streptococcus oralis, and Streptococcus infantis in the upper respiratory tracts of adults, deter- salivarius would be considering every specific strain indepen- mined by a nonculture strategy. Infect. Immun. 76:1889–1896. dently, in accordance with FAO/WHO guidelines on probiotics 6. Borchert, D., L. Sheridan, A. Papatsoris, Z. Faruquz, J. M. Barua, I. Junaid, Y. Pati, F. Chinegwundoh, and N. Buchholz. 2008. Prevention and treatment (17), as has been done for S. salivarius strain K12 (9, 11). From of urinary tract infection with probiotics: review and research perspective. this perspective, the absence of transmissible antibiotic resis- Indian J. Urol. 24:139–144. tances is considered a key safety prerequisite for the selection 7. Boukamp, P., R. T. Petrussevska, D. Breitkreutz, J. Hornung, A. Markham, and N. E. Fusenig. 1988. Normal keratinization in a spontaneously immor- of a probiotic microorganism (15, 17). In this study, S. saliva- talized aneuploid human keratinocyte cell line. J. Cell Biol. 106:761–771. rius strains, according to the EFSA breakpoints suggested for 8. Burton, J. P., C. N. Chilcott, C. J. Moore, G. Speiser, and J. R. Tagg. 2006. S. thermophilus, resulted in sensitivity to a variety of antibiotics A preliminary study of the effect of probiotic Streptococcus salivarius K12 on oral malodour parameters. J. Appl. Microbiol. 100:754–764. that are routinely used for the control of URTIs. Differently, 9. Burton, J. P., P. A. Wescombe, C. J. Moore, C. N. Chilcott, and J. R. Tagg. they showed resistance exclusively to the aminoglycosidic an- 2006. Safety assessment of the oral cavity probiotic Streptococcus salivarius K12. Appl. Environ. Microbiol. 72:3050–3053. tibiotics gentamicin, kanamycin, and streptomycin, for which 10. Corredoira, J. C., M. P. Alonso, J. F. Garcia, E. Casariego, A. Coira, A. an intrinsic resistance is known for several lactic acid bacteria Rodriguez, J. Pita, C. Louzao, B. Pombo, M. J. Lopez, and J. Varela. 2005. (10, 16, 21, 30). Clinical characteristics and significance of Streptococcus salivarius bacter- emia and Streptococcus bovis bacteremia: a prospective 16-year study. Eur. Another bacterial feature that exerts an important role in J. Clin. Microbiol. Infect. Dis. 24:250–255. the interaction with the human host is urease activity. Ammo- 11. Cosseau, C., D. A. Devine, E. Dullaghan, J. L. Gardy, A. Chikatamarla, S. nia production from ureolysis in saliva and crevicular fluids is, Gellatly, L. L. Yu, J. Pistolic, R. Falsafi, J. R. Tagg, and R. E. Hancock. 2008. The commensal Streptococcus salivarius K12 downregulates the innate im- Downloaded from in fact, a primary source of amino nitrogen and is thought to mune responses of human epithelial cells and promotes host-microbe ho- inhibit the initiation and progression of dental caries by reduc- meostasis. Infect. Immun. 76:4163–4175. 12. Cunningham, M. W. 2000. Pathogenesis of group A streptococcal infections. ing acidity (26, 33). At the same time, a high concentration of Clin. Microbiol. Rev. 13:470–511. ammonia can have deleterious effects on host cells (19), such 13. Eberl, G., and M. Lochner. 2009. The development of intestinal lymphoid as fibroblasts and polymorphonuclear leukocytes, and may tissues at the interface of self and microbiota. Mucosal Immunol. 2:478–485. 14. Edwards, M. L., P. K. Fagan, R. J. Towers, B. J. Currie, and K. S. Sri- therefore contribute to tissue damage (19). Among the species prakash. 2004. Inhibition of Streptococcus pyogenes adherence to HaCaT aem.asm.org of oral bacteria that have been identified as ureolytic, S. sali- cells by a peptide corresponding to the streptococcal fibronectin-binding varius is known to produce high levels of urease (37). Unex- protein, SfbI, is strain dependent. Microbes Infect. 6:926–928. 15. EFSA. 13-14 December 2004. Scientific Colloquium Summary Report. QPS: pectedly, S. salivarius strain ST3, selected for this work for its qualified presumption of safety of microorganisms in food and feed. EFSA, potential probiotic properties, was unable to hydrolyze urea. Brussels, Belgium.
16. EFSA. 2008. Update of the criteria used in the assessment of bacterial at UNIV OF OTAGO on June 8, 2010 Accordingly, the gene coding for the main subunit of the ure- resistance to antibiotics of human or veterinary importance. Prepared by the ase complex (ureC) was missing. In the consideration of its use Panel on Additives and Products or Substances Used in Animal Feed. EFSA as the pharynx’s probiotic, this bacterium would interact di- J. 732:1–15. 17. FAO/WHO. 2002. Report of a joint FAO/WHO expert consultation on rectly with oropharyngeal mucosae and tonsil crypts. There- guidelines for the evaluation of probiotics in food. World Health Organiza- fore, the inability to hydrolyze urea could be of potential ben- tion and Food and Agriculture Organization of the United Nations, London efit in preserving the host’s mucosal cells from ammonia injury. Ontario, Canada. 18. Greten, F. R., M. C. Arkan, J. Bollrath, L. C. Hsu, J. Goode, C. Miething, In summary, during this research, an in vitro rational process S. I. Goktuna, M. Neuenhahn, J. Fierer, S. Paxian, N. Van Rooijen, Y. Xu, led us to select two potential probiotic bacterial strains for the T. O’Cain, B. B. Jaffee, D. H. Busch, J. Duyster, R. M. Schmid, L. Eckmann, pharynx mucosa. These bacteria efficiently adhered to human and M. Karin. 2007. NF-B is a negative regulator of IL-1 secretion as revealed by genetic and pharmacological inhibition of IKK. Cell 130:918– epithelial pharyngeal cell lines, antagonizing the adhesion of 931. Streptococcus pyogenes. Furthermore, immunological tests sug- 19. Helgeland, K. 1985. pH and the effect of NH4Cl on human gingival fibro- blasts. Scand. J. Dent. Res. 93:39–45. gested a good degree of adaptation to the host and potential 20. Horz, H. P., A. Meinelt, B. Houben, and G. Conrads. 2007. Distribution and immunomodulatory and anti-inflammatory abilities by selected persistence of probiotic Streptococcus salivarius K12 in the human oral cavity commensal streptococci. Future work will aim to characterize as determined by real-time quantitative polymerase chain reaction. Oral Microbiol. Immunol. 22:126–130. the probiotic potential of these bacteria in the oral tract by 21. Hummel, A. S., C. Hertel, W. H. Holzapfel, and C. M. Franz. 2007. Antibiotic means of in vivo murine models of upper respiratory tract resistances of starter and probiotic strains of lactic acid bacteria. Appl. infections. Environ. Microbiol. 73:730–739. 22. Hyink, O., P. A. Wescombe, M. Upton, N. Ragland, J. P. Burton, and J. R. Tagg. 2007. Salivaricin A2 and the novel lantibiotic salivaricin B are encoded ACKNOWLEDGMENTS at adjacent loci on a 190-kilobase transmissible megaplasmid in the oral probiotic strain Streptococcus salivarius K12. Appl. Environ. Microbiol. 73: We thank Elisa Bertolasi and Giovanni Ricci for technical support. 1107–1113. Special thanks go to Marco Oggioni for providing Streptococcus pyo- 23. Johnson-Henry, K. C., D. J. Mitchell, Y. Avitzur, E. Galindo-Mata, N. L. genes C11. Jones, and P. M. Sherman. 2004. Probiotics reduce bacterial colonization Part of this study was financed by PUR 2008. and gastric inflammation in H. pylori-infected mice. Dig. Dis. Sci. 49:1095– 1102. REFERENCES 24. Kang, J. G., S. H. Kim, and T. Y. Ahn. 2006. Bacterial diversity in the human 1. Abbot, E. L., W. D. Smith, G. P. Siou, C. Chiriboga, R. J. Smith, J. A. Wilson, saliva from different ages. J. Microbiol. 44:572–576. B. H. Hirst, and M. A. Kehoe. 2007. Pili mediate specific adhesion of Strep- 25. Kelly, K. 1994. Out of control: the new biology of machines, social systems tococcus pyogenes to human tonsil and skin. Cell. Microbiol. 9:1822–1833. and the economic world. Addison-Wesley, Boston, MA. 2. Afek, S., A. D. Sperber, and Y. Almog. 2004. Carcinoma of the colon pre- 26. Kleinberg, I. 1967. Effect of urea concentration on human plaque pH levels senting as Streptococcus salivarius sepsis. J. Clin. Gastroenterol. 38:86–87. in situ. Arch. Oral Biol. 12:1475–1484. 3. Ahmed, R., T. Hassall, B. Morland, and J. Gray. 2003. Viridans streptococ- 27. Krutmann, J. 2009. Pre- and probiotics for human skin. J. Dermatol. Sci. cus bacteremia in children on chemotherapy for cancer: an underestimated 54:1–5. problem. Pediatr. Hematol. Oncol. 20:439–444. 28. Lanyi, B. 1987. Classical and rapid identification: methods for medically 4. Beimfohr, C., W. Ludwig, and K. H. Schleifer. 1997. Rapid genotypic dif- important bacteria, p. 1–67. In R. R. Colwell and R. Grigorova (ed.), Meth- ferentiation of Lactococcus lactis subspecies and biovar. Syst. Appl. Micro- ods in microbiology, vol. 19. Academic Press, New York, NY. biol. 20:216–221. 29. Loimaranta, V., J. Tenovuo, L. Koivisto, and M. Karp. 1998. Generation of 3958 GUGLIELMETTI ET AL. APPL.ENVIRON.MICROBIOL.
bioluminescent Streptococcus mutans and its usage in rapid analysis of the 36. Reid, G., J. Dols, and W. Miller. 2009. Targeting the vaginal microbiota with efficacy of antimicrobial compounds. Antimicrob. Agents Chemother. 42: probiotics as a means to counteract infections. Curr. Opin. Clin. Nutr. 1906–1910. Metab. Care 12:583–587. 30. Maragkoudakis, P. A., M. Papadelli, M. Georgalaki, E. G. Panayotopoulou, 37. Sissons, C. H., and T. W. Cutress. 1987. In-vitro urea-dependent pH-changes B. Martinez-Gonzalez, A. F. Mentis, K. Petraki, D. N. Sgouras, and E. by human salivary bacteria and dispersed, artificial-mouth, bacterial plaques. Tsakalidou. 2009. In vitro and in vivo safety evaluation of the bacteriocin Arch. Oral Biol. 32:181–189. producer Streptococcus macedonicus ACA-DC 198. Int. J. Food Microbiol. 38. Tagg, J. R. 2004. Prevention of streptococcal pharyngitis by anti-Streptococ- 133:141–147. cus pyogenes bacteriocin-like inhibitory substances (BLIS) produced by Strep- 31. Mora, D., E. Maguin, M. Masiero, C. Parini, G. Ricci, P. L. Manachini, and tococcus salivarius. Indian J. Med. Res. 119(Suppl.):13–16. D. Daffonchio. 2004. Characterization of urease genes cluster of Streptococ- 39. Tagg, J. R., and K. P. Dierksen. 2003. Bacterial replacement therapy: cus thermophilus. J. Appl. Microbiol. 96:209–219. adapting ‘germ warfare’ to infection prevention. Trends Biotechnol. 21: 32. Mora, D., G. Ricci, S. Guglielmetti, D. Daffonchio, and M. G. Fortina. 2003. 217–223. 16S-23S rRNA intergenic spacer region sequence variation in Streptococcus thermophilus and related dairy streptococci and development of a multiplex 40. Ukena, S. N., A. M. Westendorf, W. Hansen, M. Rohde, R. Geffers, S. ITS-SSCP analysis for their identification. Microbiology 149:807–813. Coldewey, S. Suerbaum, J. Buer, and F. Gunzer. 2005. The host response to 33. Peterson, S., J. Woodhead, and J. Crall. 1985. Caries resistance in children the probiotic Escherichia coli strain Nissle 1917: specific up-regulation of the with chronic renal failure: plaque pH, salivary pH, and salivary composition. proinflammatory chemokine MCP-1. BMC Med. Genet. 6:43. Pediatr. Res. 19:796–799. 41. Wescombe, P. A., J. P. Burton, P. A. Cadieux, N. A. Klesse, O. Hyink, N. C. 34. Power, D. A., J. P. Burton, C. N. Chilcott, P. J. Dawes, and J. R. Tagg. 2008. Heng, C. N. Chilcott, G. Reid, and J. R. Tagg. 2006. Megaplasmids encode Preliminary investigations of the colonisation of upper respiratory tract tis- differing combinations of lantibiotics in Streptococcus salivarius. Antonie Van sues of infants using a paediatric formulation of the oral probiotic Strepto- Leeuwenhoek 90:269–280. coccus salivarius K12. Eur. J. Clin. Microbiol. Infect. Dis. 27:1261–1263. 42. Zilber-Rosenberg, I., and E. Rosenberg. 2008. Role of microorganisms in the 35. Proal, A. D., P. J. Albert, and T. Marshall. 2009. Autoimmune disease in the evolution of animals and plants: the hologenome theory of evolution. FEMS era of the metagenome. Autoimmun. Rev. 8:677–681. Microbiol. Rev. 32:723–735. Downloaded from aem.asm.org at UNIV OF OTAGO on June 8, 2010 Eur J Clin Microbiol Infect Dis DOI 10.1007/s10096-008-0569-4
BRIEF REPORT
Preliminary investigations of the colonisation of upper respiratory tract tissues of infants using a paediatric formulation of the oral probiotic Streptococcus salivarius K12
D. A. Power & J. P. Burton & C. N. Chilcott & P. J. Dawes & J. R. Tagg
Received: 14 April 2008 /Accepted: 29 May 2008 # Springer-Verlag 2008
Abstract A powder preparation of the oral probiotic members of the alpha-haemolytic streptococcal species Streptococcus salivarius K12 has been given to 19 young Streptococcus mitis, Streptococcus sanguinis and Strepto- otitis media-prone children following a 3-day course of coccus oralis [2]. Unfortunately, however, each of these amoxicillin administered as a preliminary to ventilation species has been relatively commonly implicated in the tube placement. In two subjects, the use of strain K12 development of infective endocarditis [4]. More recently, appeared to effect the expansion of an indigenous popula- the non-haemolytic Streptococcus salivarius K12, a bacte- tion of inhibitory S. salivarius. In other children, strain K12 rium shown to have low pathogenic potential [5], has been colonisation extended beyond the oral cavity to also include widely used as an oral probiotic for the maintenance of oral the nasopharynx or adenoid tissue. The relatively low health and the control of halitosis. The potent inhibitory proportion (33%) of subjects that colonised was attributed activity of strain K12 has been attributed to its production to failure of the amoxicillin pre-treatment to sufficiently of several bacteriocins, including the lantibiotics salivaricin reduce the indigenous S. salivarius populations prior to A2 and salivaricin B, encoded by a 180-kb transmissible dosing with strain K12 powder. megaplasmid [6, 7]. The currently available strain K12 products principally comprise of freeze-dried cells com- pressed into lozenges, a format unsuitable for infants due to Otitis media is an all too frequently occurring bacterial the potential for choking. In the present study, a powdered disease afflicting children worldwide. Persistent episodes paediatric formulation has been evaluated for its efficacy in can result in either the need for surgical intervention or colonising the upper respiratory tracts of young children. serious long-term sequellae, such as hearing loss [1]. The powdered formulation, containing maltodextrin, Probiotics have been increasingly promoted as an alterna- xylitol and freeze-dried strain K12 cells, was provided by tive to antibiotics prophylaxis to reduce the occurrence of BLIS Technologies Ltd. (Dunedin, New Zealand). The the disease [2, 3]. Prominent amongst the candidate product was tested for stability at 4°C and 25°C over probiotics due to their efficacy in interfering with the 6 months and showed no detectable loss of viability at 4°C, growth of major respiratory tract pathogens in vitro are while at 25°C, the colony-forming units per gram dropped from 1.7×1010 to 5.0×109. Before commencement of the D. A. Power : J. R. Tagg (*) study, ethical approval was obtained from the University of Department of Microbiology and Immunology, Otago Ethics Committee. Nineteen subjects (age range University of Otago, P.O. Box 56, Dunedin, New Zealand 6 months to 5 years) were recruited from a group of patients e-mail: [email protected] scheduled for ventilation tube placement at the Dunedin J. P. Burton : C. N. Chilcott : J. R. Tagg Public Hospital. Two weeks prior to surgery, the enrolled BLIS Technologies Ltd., Dunedin, New Zealand subjects were treated with amoxicillin (125 mg, twice daily for 3 days) to effect a temporary reduction in the levels of P. J. Dawes Otolaryngology and Head and Neck Surgery, their native oral streptococcal populations in order to Department of Medical and Surgical Sciences, facilitate subsequent colonisation by the strain K12 cells University of Otago, Dunedin, New Zealand in the probiotic formulation. Following the antibiotic pre- Eur J Clin Microbiol Infect Dis treatment, a teaspoonful (equivalent to ca. 1 g of powder) of S. salivarius inhibitory to indicators I1 and I3 (and PCR- the strain K12 preparation was applied to the child’s tongue positive for both SalA2 and SalB) were detected in the pre- surface twice daily by a parent or guardian on each of the colonisation tongue samples of subjects 2, 8, 9 and 15 10 days prior to surgery. Tongue swab samples were (Table 1). However, only the isolates from subject 8 had an obtained just prior to the initiation of the antibiotics ERIC-PCR identical to that of strain K12. Following treatment and, at the time of surgery, swab samples of both application of the strain K12 colonisation protocol, 10 of the tongue and nasopharyngeal microbiotas were obtained. the 19 subjects were found to harbour strongly inhibitory In some cases (and with consent), an adenoid tissue sample S. salivarius. PCR testing showed K12-like ERIC profiles was also obtained. The presence of streptococci was for all of the representative strongly inhibitory post- specifically determined by plating the samples onto mitis- colonisation isolates from the six subjects who had initially salivarius agar (Becton, Dickinson and Company, Baltimore, harboured inhibitor-negative S. salivarius populations. The MD). The levels of colonisation with the probiotic strain responses to dosing with strain K12 differed in each of the were initially estimated using simultaneous antagonism four subjects who had prior populations of strongly tests, by determining the proportion of the typical (large, inhibitory S. salivarius. In subject 2, there was no boost soft and pale blue) S. salivarius colonies present in the in the low proportion of inhibitory S. salivarius. Subject mitis-salivarius cultures that, when tested as stab cultures, 8 already had a population of K12-like bacteria (based on produced wide zones of inhibition in the lawn cultures of ERIC profiles) and their proportion of K12-like S. salivarius indicator strain I1 (Micrococcus luteus) and indicator strain increased substantially following exposure to strain K12. I3 (Streptococcus anginosus)[8]. Enterobacterial repetitive Subject 9 also had a predominant population of strongly intergenic consensus polymerase chain reaction (ERIC- inhibitory S. salivarius, but these were distinctive from K12 PCR) genotyping [9] of representative strongly inhibitory by ERIC and their relative proportion in the total population colonies was then used to distinguish those colonies having did not appear to change following exposure to strain K12. the characteristic ERIC profile of strain K12 from other Subject 15 displayed a large increase in the proportion of strongly inhibitory S. salivarius that may have been present their pre-dosing population of non-K12-like strongly in the subjects’ microbiota prior to strain K12 administra- inhibitory S. salivarius. This apparent stimulation of tion. For further characterisation of representative isolates, population expansion of prior-established BLIS-producers PCR amplification was used with primers specific for the resembles the findings of an earlier study where the structural genes of the strain K12 lantibiotics SalA2 and exposure of children to an SalA-producing S. salivarius SalB [7]. was shown to evoke a marked increase in the proportion of
Table 1 Colonisation of the upper respiratory tract with Subject Pre-colonisation Post-colonisation Streptococcus salivarius K12 Oral Oral Nasopharynx Adenoid
ABCA BCABCABC
1+0ND1 + 18+ +0 ND+74+ 2 + 6 - + 7 - - ND + 0 ND 3 + 0 ND + 95 + + 98 + + 14 + 4 + 0 ND + 0 ND - ND - ND 5 + 0 ND + 0 ND - ND - ND 6 + 0 ND+ 0 ND+0 ND-ND 7 + 0 ND + 52 + - ND + 48 + 1 Not determined: in every case 8 + 10 + + 54 + - ND of ND, the samples were negative 9 + 94 - + 84 - - ND 2 No sample taken 10 + 0 ND + 0 ND - ND A=Streptococcus salivarius 11 + 0 ND NS2 -ND detected 12 + 0 ND + 0 ND - ND B=percentage of Streptococcus 13 + 0 ND + 80 + - ND salivarius that have strain K12- 14 + 0 ND + 2 + - ND like phenotype, as demonstrated by the inhibition of indicators I1 15 + 48 - + 100 - - ND and I3 16 + 0 ND + 0 ND - ND C=result of testing representative 17 + 0 ND + 16 + - ND bacteriocin-producing isolates 18 + 0 ND + 0 ND - ND for genomic fingerprints typical 19 + 0 ND + 0 ND - ND of strain K12 Eur J Clin Microbiol Infect Dis indigenous SalA-producing S. salivarius [10]. Only one of References the nasopharyngeal samples was culture-positive for strain K12. On the other hand, 3 of the 7 adenoid samples were 1. Roberts JE, Rosenfeld RM, Zeisel SA (2004) Otitis media and strain K12 culture-positive. speech and language: a meta-analysis of prospective studies. – The proportion of children newly colonised with K12-like Pediatrics 113:e238 e248. DOI 10.1542/peds.113.3.e238 2. Roos K, Håkansson EG, Holm S (2001) Effect of recolonisation S. salivarius following the taking of the powdered formula- with “interfering” alpha streptococci on recurrences of acute and tion was 6 of 18 (33%). This is substantially lower than the secretory otitis media in children: randomised placebo controlled colonisation proportions typically achieved with use of the trial. BMJ 322:210–212. DOI 10.1136/bmj.322.7280.210 BLIS K12 Throat Guard™ commercial product (ca. 80%). 3. Roos K, Holm SE, Grahn-Håkansson E, Lagergren L (1996) Recolonization with selected alpha-streptococci for prophylaxis of The lower frequency obtained in the present study may, in recurrent streptococcal pharyngotonsillitis—a randomized place- part, be due to a reduced oral cavity exposure time for cells bo-controlled multicentre study. Scand J Infect Dis 28:459–462. delivered as powdered preparations when compared to the DOI 10.3109/00365549609037940 use of lozenges. Since strain K12 is amoxicillin-sensitive, the 4. Douglas CW, Heath J, Hampton KK, Preston FE (1993) Identity of viridans streptococci isolated from cases of infective endocar- levels of colonisation achieved in the days immediately ditis. J Med Microbiol 39:179–182 following the amoxicillin pre-dosing would be anticipated to 5. Burton JP, Wescombe PA, Moore CJ, Chilcott CN, Tagg JR be relatively low. Another possible cause for the low levels (2006) Safety assessment of the oral cavity probiotic Streptococ- – of colonisation could be failure of the pre-treatment anti- cus salivarius K12. Appl Environ Microbiol 72:3050 3053. DOI 10.1128/AEM.72.4.3050-3053.2006 biotics regime to adequately reduce the levels of the 6. Wescombe PA, Burton JP, Cadieux PA, Klesse NA, Hyink O, indigenous S. salivarius. Many of the pre-colonisation Heng NC, Chilcott CN, Reid G, Tagg JR (2006) Megaplasmids S. salivarius recovered from the oral cavities of subjects encode differing combinations of lantibiotics in Streptococcus – enrolled in this study exhibited some degree of resistance to salivarius. Antonie Van Leeuwenhoek 90:269 280. DOI 10.1007/ s10482-006-9081-y amoxicillin (results not shown). These relatively high levels 7. Hyink O, Wescombe PA, Upton M, Ragland N, Burton JP, Tagg JR of amoxicillin-resistant S. salivarius may be a reflection of (2007) Salivaricin A2 and the novel lantibiotic salivaricin B are the typical treatment histories of these subjects. All of the encoded at adjacent loci on a 190-kilobase transmissible mega- recruited children had experienced multiple episodes of otitis plasmid in the oral probiotic strain Streptococcus salivarius K12. Appl Environ Microbiol 73:1107–1113. DOI 10.1128/ media, and these infections are often treated with amoxicillin. AEM.02265-06 Although it is clear that further optimisation of the dosing 8. Tagg JR, Pybus V, Phillips LV, Fiddes TM (1983) Application of protocol is still required, it appears that colonisation of the inhibitor typing in a study of the transmission and retention in the oral and adenoid tissues can be achieved in young children human mouth of the bacterium Streptococcus salivarius. Arch Oral Biol 28:911–915. DOI 10.1016/0003-9969(83)90086-9 using a powdered probiotic formulation. The application of 9. de Bruijn FJ (1992) Use of repetitive (repetitive extragenic probiotic preparations to achieve implantation of commensal palindromic and enterobacterial repetitive intergeneric consensus) bacteria that are able to target and preclude infection by sequences and the polymerase chain reaction to fingerprint the specific pathogens has considerable appeal as a cost-effective genomes of Rhizobium meliloti isolates and other soil bacteria. Appl Environ Microbiol 58:2180–2187 strategy to reduce the occurrence of upper respiratory tract 10. Dierksen KP, Moore CJ, Inglis M, Wescombe PA, Tagg JR (2007) infections in children The effect of ingestion of milk supplemented with salivaricin A-producing Streptococcus salivarius on the bacteriocin-like inhibitory activity of streptococcal populations on the tongue. Acknowledgements We gratefully acknowledge the assistance FEMS Microbiol Ecol 59:584–591. DOI 10.1111/j.1574- provided by nurse Rhonda Stafford in recruiting the patients. 6941.2006.00228.x Oral Microbiology Immunology 2007: 22: 126–130 2007 The Authors. Printed in Singapore. All rights reserved Journal compilation 2007 Blackwell Munksgaard
H.-P. Horz1, A. Meinelt1, B. Houben2, G. Conrads1 Distribution and persistence 1 Division of Oral Microbiology and Immuno- logy, Department of Medical Microbiology, and 2Department of Operative and Preventive of probiotic Streptococcus Dentistry & Periodontology, RWTH Aachen University Hospital, Aachen, Germany salivarius K12 in the human oral cavity as determined by real-time quantitative polymerase chain reaction
Horz H-P, Meinelt A, Houben B, Conrads G. Distribution and persistence of probiotic Streptococcus salivarius K12 in the human oral cavity as determined by real-time quantitative polymerase chain reaction. Oral Microbiol Immunol 2007: 22: 126–130. 2007 The Authors. Journal compilation 2007 Blackwell Munksgaard.
The bacteriocin producer Streptococcus salivarius K12 is used as a probiotic targeting the oral cavity, so our study aimed to assess whether its dispersal and persistence could be monitored using real-time quantitative polymerase chain reaction. To this end, we designed polymerase chain reaction primers and a hybridization probe specifically targeting salA, which encodes for the prepropeptide of salivaricin A. Using a single individual as our subject, we administered four lozenges of K12 Throat Guard per day over 3 days, then measured salA gene levels for 16 different oral sites at six different intervals over 35 days. Four samples each from gingival sulci and from teeth all remained negative. In contrast, in saliva and at all mucosal membranes K12 was detected, but with varying amounts and time profiles. Relatively high salA gene copy numbers, calibrated on the basis Key words: halitosis; pharyngitis; probiotics; of colony-forming units, were seen on the tongue (maximum 4.6 · 104/swab at day 4), in Streptococcus salivarius stimulated saliva (2.4 · 104/ml, day 4) and on buccal membranes (1.3 · 104/swab, day 8). Georg Conrads, Division of Oral K12 was present on both sides of the pharynx but asymmetrically in both quantity and Microbiology and Immunology, RWTH duration. In conclusion, we have developed a real-time quantitative-polymerase chain University Hospital, Pauwelsstrasse 30, reaction for counting S. salivarius K12 at various sites in the oral cavity. In the individual D-52057 Aachen, Germany studied, K12 could be detected at the mucosal membranes for as long as 3 weeks, but with Tel.: +49 241 8088448; fax: +49 241 8082483; steadily decreasing numbers after day 8. Thus, K12 may have the potential to control oral e-mail: [email protected] bacterial infections only when the uptake is repeated frequently. Accepted for publication July 27, 2006
Probiotics, defined by the World Health human body. Probiotic treatment was allowed unregulated growth of pathogenic Organization as ‘live microorganisms found to be successful when applied to or non-desirable bacteria (6, 15). Although which when administered in adequate the intestinal tract and the vagina after even gut probiotics are still controversial amounts confer a health benefit on the antibiotic therapy and for management of (1), similar or greater success has been host’ (3), have been used to modulate infections where there was a perceived found using oral probiotics to prevent bacterial populations in several areas of the imbalance in the microbial ecosystem that dental caries (2, 7, 10, 12, 13), plaque S. salivarius K12 oral distribution 127 biofilm formation (7), and – through studies it was concluded that an oral population levels of existing oral micro- strains of Streptococcus salivarius – group antimicrobial administration of bacterio- biota. At 2-h intervals for 8 h, preferably A streptococcal pharyngitis and malodor cin-producing S. salivarius K12 reduces after food, the subject sucked a lozenge (3–5). the volatile sulfur compounds responsible (four in total) containing about 1010 CFU S. salivarius is a predominant inhabitant for oral malodor, because anaerobes that of S. salivarius K12 (BLIS K12 Throat of the tongue dorsum and the pharyngeal produce valeric and butyric acids or Guard). This protocol was repeated on mucosa that becomes established in the putrescine are temporarily substituted by days 2 and 3. In addition to the recom- human oral cavity at a very early age – K12 (3, 4). mendations on the product insert, during within 2 days after birth. The levels of S. While the probiotic effects of SalA- the colonization trial period no spirits, salivarius in swab samples taken from producing K12 are generally acknow- other anti-bacterial agents, or anti-bacterial newborn infants represent 10% of the total ledged, it is still unknown which oral sites food (e.g. garlic, onions) were allowed to streptococci isolated, increasing to 25– are preferentially colonized by this strain be consumed. No adverse symptoms were 30% after 1 month. In healthy adults, S. and for how long, information that could reported during or after the trial. salivarius represents 2% of the total strep- be important for obtaining optimum To evaluate the K12 population over tococci isolated from the buccal mucosae, results. The aim of our study was to see time, specimens were collected using 17% from the tongue, and 30% from if we could monitor the spatial distribution polyester fiber-tipped applicator swabs the pharynx (9). In saliva samples from of K12 over time in a first (model) (Falcon, Becton Dickinson, Franklin adults, population levels of S. salivarius representative individual. For this purpose, Lakes, NJ) in intervals at days 4, 8, 14, range from 106 to 107 colony-forming after administering K12 exactly as recom- 21, 28 and 35 from the following sites: 1: units (CFU)/ml. mended by the manufacturer, we tracked pharynx, right; 2: pharynx, left; 3: buccal S. salivarius strain K12, isolated from a the probiotic strain in the oral cavity using mucosal membrane, right; 4: buccal, left; healthy individual, is known to produce a newly designed real-time quantitative 5: tongue, dorsal; 6: tongue, ventral; 7: high levels of at least two lantibiotic polymerase chain reaction format com- tooth 14, buccal; 8: tooth 24, palatinal; 9: bacteriocins, salivaricin A (SalA) (16, 21) posed of a K12-specific primer pair direc- tooth 34, buccal; 10: tooth 44, lingual; and salivaricin B (SalB) (20). Lantibiotics ted against the salA gene and an internal paper points (ISO 45, capacity approxi- are antimicrobial peptides that are pro- K12-specific TaqMan probe. mately 15 ll sulcus fluid and 2 · 106 duced by, and are active against, gram- cells) were used to sample the following positive organisms. These peptides are sites: 11: sulcus gingivae of tooth 14, Material and methods ribosomally synthesized and then undergo palatinal; 12: sulcus 24, buccal; 13: sulcus Culture conditions post-translational modifications, including 34, lingual; and 14: sulcus 44, buccal. A amino acid dehydration and thioether To obtain a reference culture, S. salivarius cotton tampon was used to collect about bridge formation (18, 21). SalA (22 amino strain K12 was grown overnight directly 1 ml of un-stimulated saliva by chewing acid residues) is a subclass A II lantibiotic from the BLIS K12 Throat Guard (BLIS on it for 1 min (sample 15) and, along with produced in approximately 20% of natur- Technologies Limited, Wellington, New a 1 ml sample of freshly paraffin-stimula- ally occurring isolates, including S. sali- Zealand) lozenges, which contain up to ted saliva (sample 16), was collected into varius as represented by reference strains 1010 cells each, on Columbia blood agar at tubes, centrifuged at 3000 g, and the cells DSM 20067 and 20P3 (8). The mature 37 C in 10% CO2. Other S. salivarius were re-suspended in 200 ll brain–heart SalA is generated from a 48 amino acid strains, used for comparison (see below), infusion (BHI) broth and frozen at )70 C. prepropeptide, encoded by the salA gene, were grown under the same conditions. Swabs and paper points were also trans- and processed and regulated by products ferred into 200 ll BHI broth and the cells of the salBCTXYKR operon (16). By were detached and suspended using sterile Clinical procedure, colonization protocol utilizing salA as a DNA hybridization glass beads. After removing the swabs, and sampling probe it was shown that all SalA peptide- paper points and glass beads, the suspen- producing strains of S. salivarius A single individual was selected, a sion was frozen at )70 C. The yield of contained salA sequences and that, inter- 40-year-old male who was otherwise bacterial cells recovered from swabs and estingly, 63 of 65 Streptococcus pyogenes healthy and who had not received antibi- cotton tampons was tested with a sample strains of different M-types contained a otic treatment during the previous of saliva and corresponded to approxi- salA gene homolog, designated salA1, 3 months, and had no previous K12 treat- mately 25% (swabs) and 8% (cotton which could explain the high susceptibility ment. The Ethics Committee of the tampons) relative to the amount of bacter- of S. pyogenes against SalA (17, 21). Thus, University Hospital, Rhine-Westfalian ial cells obtained directly from saliva. it is not surprising that in some countries Technical University, approved a protocol (New Zealand, Australia) S. salivarius describing the specimen collection for this DNA extraction K12 has been used for several years as investigation, and the individual signed an an oral probiotic (taken particularly by informed consent to participate. Microbial DNA from pure cultures and school-aged children) to prevent (re-)col- A saliva sample (sample 0) was collec- from oral samples was extracted and onization with S. pyogenes and to protect, ted and analysed before the commence- purified with a Qiamp DNA Mini Kit at least temporarily, against group A ment of the colonization protocol to ensure (Qiagen, Hilden, Germany) according to streptococcal pharyngitis, tonsillitis and that the test person did not harbor a K12 the manufacturer’s tissue protocol instruc- suppurative (peritonsillar cellulitis, peri- (or a BLIS K12 like-) strain before use of tions. The DNA concentration (absorbance tonsillar abscess, retropharyngeal abscess) lozenges. On the following day (day 1), at 260 nm; A260) and the purity (A260/ as well as non-suppurative (acute rheuma- the subject brushed his teeth, used floss, A280) were calculated using a Gene Quant tic fever, acute glomerulonephritis) com- and rinsed with 10 ml of 0.2% chlorhex- II photometer (Pharmacia Biotech, Cam- plications (19–21). In two other recent idine gluconate for 30 s to reduce the bridge, UK). 128 Horz et al.
designed were forward primer K12FP: 5¢- followed by 40 cycles of 94 C for 1 min, Sequencing of partial salivaricin operon AAGGGAGAATGATTGCCATGAA-3¢, and stringent annealing at 60 C for 1 min A partial fragment (1560 base pairs in and reverse primer K12RP: 5¢-GAG- 45 s. size) of the salivaricin operon salAB from TTTGGACAGTCATCAGTAATAGTTG- Data acquisition and subsequent analy- K12 was amplified using primers psalF1 3¢, targeting a 144-base-pair stretch sis were performed using the abi-prism 5¢-AGATGTATTGGTTACAATAAGAGC including the salA ATG start codon. 7000 sds software (Applied Biosystems). G-3¢ and psalAR3 5¢-GGCTTGCAAA As TaqMan probe we designed The amount of initial template DNA was AATTTTCCATAG-3¢. These primers were K12Taq: 6-FAM-5¢-AGAGGTACAGG- calculated by determining the threshold designed on the basis of the salivaricin TTGGTTTG-3¢-MGB. The primers were cycle (Ct), which is the number of polym- operon information for S. salivarius strain tested for possible cross-amplification with erase chain reaction cycles required for the 20P3 and S. pyogenes strain SF370 (Gen- the DNA of six other S. salivarius strains fluorescence to exceed a threshold value Bank accession nos. AY005472, [DSM20067, AC1802 (AC: strain collec- significantly higher than the background AE006616). The amplification was per- tion of the German National Reference fluorescence. A threshold value of 0.2 was formed on an Eppendorf thermocycler Center for Streptococci, Aachen), assumed which was approximately 10 (Mastercycler personal) in 50 ll contain- AC2051, AC3342, AC3994, and times the background fluorescence, ing 1x polymerase chain reaction buffer, AC4381] as well as with the DNA of defined as the mean fluorescence values 1.5 mm MgCl2, 2 units Taq-polymerase, two S. salivarius isolates (identified by of the first 6–15 polymerase chain reaction 0.2 mm each of dATP, dCTP, dGTP and rapID 32 strep, BioMe´rieux identification cycles. All samples were run in duplicate, dTTP (Roche Applied Science, Penzberg, system (BioMe´rieux, Marcy l’Etoile, and the mean value was used for analy- Germany), 100 nm of each primer and France), and given profile numbers sis. The coefficient of variation of the 1 ll template DNA (approximately 60077041112 and 60457041112) found Ct-values among replicates was below 1%. 50 ng). Polymerase chain reaction cycling initially in the oral cavity of the subject conditions were 94 C for 2 min, followed (grown from sample 0). Results by 25 cycles of 94 C for 60 s, 55 C for 1 min, and 72 C for 1.5 min, with a final To assess the validity of using a salA gene Real-time quantitative-polymerase chain extension of 72 C for 10 min. The polym- probe and primer set for specifically meas- reaction erase chain reaction product was purified uring the probiotic strain S. salivarius K12, using the Qiagen Purification Kit accord- Amplification and detection of DNA by six other S. salivarius strains as well as two ing to the manufacturer’s instructions. real-time quantitative-polymerase chain isolates obtained from the oral cavity of the Bidirectional sequencing was performed reaction was performed with the aid of male proband were tested for contrast. All using a Big Dye-Deoxy terminator cycle the ABI-PRISM 7000 Sequence Detection the strains tested except the target strain S. sequencing kit (Applied Biosystems, Fos- System (Applied Biosystems) using opti- salivarius K12 tested negative by real-time ter City, CA) and an automatic capillary cal grade 96-well plates. Included in each quantitative-polymerase chain reaction, DNA sequencer (API Prism 310, Applied run were four negative controls (nuclease- indicating the high specificity of this primer Biosystems). The generated sequence frag- free water as template), and serial dilutions set (data not shown). As the salA gene ment of salAB has been submitted to of DNA (corresponding to 102–106 CFU) levels of the probiotic strain measured by GenBank under accession no. DQ519425. of S. salivarius K12 used as standard for real-time quantitative-polymerase chain calibrating the salA gene target molecule reaction were calibrated using serial dilu- numbers determined by real-time quanti- tions ranging from 102 to 106 CFU, quan- Primer design tative-polymerase chain reaction. All sam- titative data are expressed as ‘CFU For real-time quantitative-polymerase ples were analysed using the TaqMan equivalents of salA copies’ (salA-CFU). chain reaction, primers and a TaqMan assay chemistry (TaqMan PCR Master The salA-CFU varied considerably probe were designed based on the K12 Mix, Applied Biosystems). Final reactions among the samples from different loca- salAB sequence information (see above) as contained 100 nm of each primer and 2 ll tions and time periods (see Table 1). Teeth opposed to S. salivarius strain 20P3 template DNA (approximately 50 ng tem- and sulci (samples 7–14) were negative for (GenBank AY005472). K12-specific plate DNA). The temperature profile was K12 over the whole testing period. As regions were located and the primers as follows: denaturation 94 C for 10 min, these locations are known to harbor a
Table 1. Levels of probiotic strain Streptococcus salivarius K12 over time (4–35 days) at various oral sites monitored by real-time quantitative- polymerase chain reaction and referred to as CFU equivalents to salA gene copy numbers (salA-CFU) Time (days) PxR PxL BuR BuL ToD ToV SaC SaS Total aerobes, day 4 9000 · 103 4000 · 103 3000 · 103 7000 · 103 120,000 · 103 24,000 · 103 300,000 · 103 200,000 · 103 Total anaerobes, day 4 29,000 · 103 14,000 · 103 4000 · 103 5000 · 103 250,000 · 103 96,000 · 103 380,000 · 103 210,000 · 103 K12 Day 4 1600 400 100 1000 2500 45,800 700 23,900 Day 8 32,900 123,700 3100 12,800 0 7800 6000 1700 Day 14 300 100 0 100 0 0 0 0 Day 21 500 0 0 0 200 800 900 0 Day 28 100 0 0 0 0 0 0 0 Day 35 100 0 0 0 0 0 0 0 PxR, pharynx, right; PxL, pharynx, left; BuR, buccal mucosal membrane, right; BuL, buccal, left; ToD, tongue, dorsal; ToV, tongue, ventral; SaC, saliva collected by chewing cotton tampon for 1 min; SaS, paraffin-stimulated saliva. Further samples (teeth: 14, buccal; 24, palatinal; 34, buccal; 44, lingual; sulci gingivae of teeth 14, palatinal; 24, buccal; 34, lingual, and 44, buccal) are not listed, as they remained K12-negative over the whole test period. S. salivarius K12 oral distribution 129 variety of bacteria, including various reaction (TaqMan format) to determine strain K12Str). As a result, the mean streptococcal species, in high cell numbers the potential colonization sites of the SalA- S. salivarius cell counts were between (108–109/mg plaque), negative findings producing probiotic S. salivarius K12 in 4.5 and 7.8 · 107 CFU/ml and the cell here indirectly confirm the specificity of the human oral cavity. counts of strain K12Str were between 1.8 the K12 directed real-time quantitative- The target sites for S. salivarius K12 are and 5.8 · 107 CFU/ml, measured at days polymerase chain reaction assay. the pharynx, tongue and buccal mem- 7 and 14 after commencing treatment. In K12 was detected at all other sites, but branes, habitats of agents causing pharyn- our study, the CFU equivalents per ml at different levels and with individual time gitis and/or halitosis. The maximum K12 saliva were much lower (between profiles (Fig. 1). The amount of salA-CFU cell numbers (salA-CFU) per swab found 2.4 · 104 on day 4 and 1.7 · 103 on day per sample ranged from 1 · 102 (detection at these sites were 3.3 · 104 and 8), a difference that was most likely level) to a maximum of 1.24 · 105. In the 1.24 · 105 (pharynx), 3.1 · 103 because, after the initial 3-day period of pharynx K12 had an asymmetric presence: and 1.3 · 104 (buccal), 2.5 · 103 and four K-12 lozenges per day, in the study by at the right side we found K12 until day 35 4.6 · 104 (tongue) and 6 · 103 and Burton et al. the subjects continued taking with a maximum of 3.3 · 104 salA-CFU at 2.4 · 104/ml saliva. Taking into account the K12 morning and night for the next day 8. In contrast, at the left side K12 was that the swabs contained a total number of 2 weeks. Thus, even if tested on only a found for a shorter period (until day 14), bacterial cells between 3 · 106 (buccal) single subject the study shows that the but with a maximum of 1.24 · 105 salA- and 1.2 · 108 (tongue, dorsal) aerobes, introduction of K12 (four times a day for CFU at day 8. Relatively high levels of and between 4 · 106 (buccal) and 3 days) into the oral cavity does not salA-CFU were also detected on the vent- 2.5 · 108 (tongue, dorsal) anaerobes, the necessarily result in high numbers or ral side of the tongue (4.6 · 104/swab proportion of K12 can be calculated and long-term colonization of K12, and there- maximum at day 4), in paraffin-stimulated reached only a maximum of 1% (pharynx, fore repeated administration of this strain saliva (2.4 · 104/ml maximum at day 4), left side, day 8) relative to the total might be required at certain intervals. and on the buccal mucosal membrane, left microbial flora. Nonetheless, as salA-CFUs were higher side (1.3 · 104/swab maximum at day 8). Burton et al. measured the prevalence on day 8 than on day 4 in most of the In terms of probiotic effect (health benefit) and abundance of K12 in 13 subjects (and mucous membrane samples, K12 cells or microbial impact, the amount of K12 10 controls) after chlorhexidine rinse and must have multiplied in situ, indicating detected after day 14 (see Table 1) K12 lozenges (in that case K12Str, a variant the potential for starting colonization of appeared negligible. resistant to 100 lg/ml streptomycin) (3). the oral surfaces. In any case it is import- In contrast to our study, only saliva was ant to note that the numbers of probiotic investigated and enumeration was per- cells present in probiotic lozenges, drinks, Discussion formed by plating 10-fold dilutions onto or washes are not necessarily the same The aim of this study was to design a Mitis-salivarius-agar (for S. salivarius) and numbers that actually colonize the target, real-time quantitative-polymerase chain Mitis-salivarius-streptomycin agar (for e.g. mucous membranes. To achieve opti- mal probiotic effects it would be important to monitor the amount and persistence of K12 in several individuals and link these 120,000 data with treatment effects. Questions worth considering could include: (i) the influence of the pre-treatment regimen 50,000 (type, concentration, and potency of anti- microbial agent as well as duration and frequency of treatment) on achieving an 40,000 adequate initial reduction of pharyngitis- or halitosis-associated bacteria (11, 14); (ii) formulation (lozenges, chewing gums, mouth-wash, etc.) of the probiotic and 30,000 timing of its administration; and (iii) the salA -CFU influence of anti-microbial (onions, garlic, spices) or other pro-microbial (probiotic 20,000 yoghurt) foods and beverages consumed during treatment. Since S. salivarius K12 is a non-tradi- 10,000 SaS SaC tional probiotic species, it generally evokes ToV greater concerns about potential adverse ToD effects but the most recent study by Burton 0 BuL et al. documented the absence of (i) BuR 4 adverse reactions in 14 subjects actively 8 PxL 14 ingesting S. salivarius K12, (ii) major 21 PxR Time (days) 28 streptococcal virulence factors (sagA for 35 streptolysin S, scpA for C5a peptidase, Fig. 1. Levels of probiotic strain Streptococcus salivarius K12 over time (4–35 days) at various oral smez-2 for SMEZ-2, speB for SPE-B and sites monitored by real-time quantitative-polymerase chain reaction and referred to as CFU emm for M-Proteins), and (iii) relevant equivalents to salA gene copy numbers (salA-CFU). For abbreviations see Table 1. antimicrobial resistances or acquisition of 130 Horz et al. corresponding resistance genes (5). Added effect of probiotic Streptococcus salivarius 13. Nase L, Hatakka K, Savilahti E et al. Effect to this is New Zealand’s 5- to 6-year K12 on oral malodour parameters. J Appl of long-term consumption of a probiotic history of commercial probiotic K12 dis- Microbiol 2006: 100: 754–764. bacterium, Lactobacillus rhamnosus GG, in 4. Burton J, Chilcott C, Tagg J. The rationale milk on dental caries and caries risk in tribution and application with no known and potential for the reduction of oral children. Caries Res 2001: 35: 412–420. adverse side-effects (more than 150,000 malodour using Streptococcus salivarius 14. Pratten J, Barnett P, Wilson M. Composition doses administered, mainly to children). probiotics. Oral Dis 2005: 11: 29–31. and susceptibility to chlorhexidine of multi- The probiotic S. salivarius K12 can there- 5. Burton JP, Wescombe PA, Moore CJ, species biofilms of oral bacteria. Appl fore be referred to as ‘safe’ and unlikely to Chilcott CN, Tagg JR. Safety assessment Environ Microbiol 1998: 64: 3515–3519. of the oral cavity probiotic Streptococcus 15. Reid G, Jass J, Sebulsky MT, McCormick cause disease in healthy humans (5). salivarius K12. Appl Environ Microbiol JK. Potential uses of probiotics in clinical In conclusion, the real-time quantitative- 2006: 72: 3050–3053. practice. Clin Microbiol Rev 2003: 16: polymerase chain reaction assay developed 6. Cadieux P, Burton J, Gardiner G et al. 658–672. in this study enabled us to portray a Lactobacillus strains and vaginal ecology. 16. Ross KF, Ronson CW, Tagg JR. Isolation heterogeneous distribution pattern for pro- JAMA 2002: 287: 1940–1941. and characterization of the lantibiotic sali- 7. Comelli EM, Guggenheim B, Stingele F, biotic K12 that may or may not be unique varicin A and its structural gene salA from Neeser JR. Selection of dairy bacterial Streptococcus salivarius 20P3. Appl Envi- to the individual that was monitored. In strains as probiotics for oral health. Eur ron Microbiol 1993: 59: 2014–2021. any case, we now have the tools for more J Oral Sci 2002: 110: 218–224. 17. Simpson WJ, Ragland NL, Ronson CW, extensive research and a method for mon- 8. Dempster RP, Tagg JR. The production of Tagg JR. A lantibiotic gene family widely itoring other individuals to test for the bacteriocin-like substances by the oral bac- distributed in Streptococcus salivarius and consistency of such profiles and ascertain a terium Streptococcus salivarius. Arch Oral Streptococcus pyogenes. Dev Biol Stand Biol 1982: 27: 151–157. 1995: 85: 639–643. correlation between K12 prevalence and 9. Frandsen EV, Pedrazzoli V, Kilian M. 18. Skaugen M, Nissen-Meyer J, Jung G et al. treatment efficacy. Ecology of viridans streptococci in the oral In vivo conversion of l-serine to d-alanine cavity and pharynx. Oral Microbiol Immu- in a ribosomally synthesized polypeptide. nol 1991: 6: 129–133. J Biol Chem 1994: 269: 27183–27185. Acknowledgments 10. Hatakka K, Savilahti E, Ponka A et al. 19. Tagg JR. Prevention of streptococcal phar- Effect of long term consumption of probi- yngitis by anti-Streptococcus pyogenes bac- We thank Ilse Seyfarth, Morgana Eli otic milk on infections in children attending teriocin-like inhibitory substances (BLIS) Vianna, and Vreni Merriam for various day care centres: double blind, randomised produced by Streptococcus salivarius. forms of assistance. trial. BMJ 2001: 322: 1327. Indian J Med Res 2004: 119 (suppl): 13–16. 11. McBain AJ, Bartolo RG, Catrenich CE, 20. Tagg JR, Dierksen KP. Bacterial replace- Charbonneau D, Ledder RG, Gilbert P. ment therapy: adapting ‘germ warfare’ to References Effects of a chlorhexidine gluconate-con- infection prevention. Trends Biotechnol taining mouthwash on the vitality and 2003: 21: 217–223. 1. Abbott A. Microbiology: gut reaction. antimicrobial susceptibility of in vitro oral 21. Upton M, Tagg JR, Wescombe P, Jenkinson Nature 2004: 427: 284–286. bacterial ecosystems. Appl Environ Micro- HF. Intra- and interspecies signaling 2. Ahola AJ, Yli-Knuuttila H, Suomalainen T biol 2003: 69: 4770–4776. between Streptococcus salivarius and Strep- et al. Short-term consumption of probiotic- 12. Montalto M, Vastola M, Marigo L et al. tococcus pyogenes mediated by SalA and containing cheese and its effect on dental Probiotic treatment increases salivary SalA1 lantibiotic peptides. J Bacteriol 2001: caries risk factors. Arch Oral Biol 2002: 47: counts of lactobacilli: a double-blind, rand- 183: 3931–3938. 799–804. omized, controlled study. Digestion 2004: 3. Burton JP, Chilcott CN, Moore CJ, Speiser 69: 53–56. G, Tagg JR. A preliminary study of the The e¡ect of ingestion of milk supplemented with salivaricin A-producing Streptococcus salivarius on the bacteriocin-like inhibitoryactivity of streptococcal populations on the tongue Karen P. Dierksen, Chris J. Moore, Megan Inglis, Philip A. Wescombe & John R. Tagg
Department of Microbiology and Immunology, University of Otago, Dunedin, New Zealand
Correspondence: John R. Tagg, Department Abstract of Microbiology and Immunology, University of Otago, PO Box 56, Dunedin, New Zealand. The colonization efficacies of salivaricin A (SalA)-producing Streptococcus salivar- Tel.: 1643 479 7714; fax: 1643 479 8540; ius strains 20P3 and 5 were compared when given in milk to 219 children, using e-mail: [email protected] either 2-day or 9-day dosing regimens. Colonization levels overall were superior for strain 5, and the 9-day dosing schedule resulted in higher levels of both initial Present address: Karen P. Dierksen, colonization and strain persistence. The indigenous streptococcal tongue popula- Department of Microbiology, Oregon State tions of 20 (10.9%) of the 189 children in the 2-day trial showed markedly University, Corvallis, OR, USA. increased SalA-like inhibitory activity following use of the S. salivarius-supple- mented milk. All 20 of these children were found to have had relatively small Present address: Philip A. Wescombe, Chris J. Moore, BLIS Technologies Ltd, Centre for (o 5% of total S. salivarius) indigenous tongue populations of SalA-producing Innovation, Dunedin, New Zealand. S. salivarius, and the relative proportions and/or inhibitory activity of these SalA producers on the childrens’ tongues increased following ingestion of the Received 12 June 2006; revised 8 August 2006; S. salivarius-supplemented milk. Because SalA is known to be strongly inhibitory accepted 4 September 2006. to Streptococcus pyogenes, an important implication of this study is that the consumption of SalA-producing probiotic S. salivarius could potentially help to DOI:10.1111/j.1574-6941.2006.00228.x effect a sustained increase in SalA-mediated protection against S. pyogenes infection. Editor: Julian Marchesi
Keywords Streptococcus salivarius ; bacteriocin; bacteriocin-like inhibitory substance; microbial interference; probiotic; colonization.
Introduction bacteriocin-like inhibitory substances (BLIS). Our labora- tory in the Department of Microbiology and Immunology, Probiotic bacterial replacement therapy, the practice of University of Otago, Dunedin, New Zealand utilizes a ingesting commensal bacteria to confer health benefits, has deferred antagonism method on blood agar to test strepto- long been an accepted method for delivering beneficial cocci for BLIS production against nine standard indicators microorganisms to the gastrointestinal tract of humans (Tagg & Bannister, 1979). By use of this P (producer)-typing (Sullivan & Nord, 2002), poultry (Patterson & Burkholder, procedure it has been shown that the production of BLIS is 2003), and swine (Abe et al., 1995). In recent years, however, both frequent and varied within the genus Streptococcus. researchers have begun to extend the use of probiotics to Many of the streptococcal BLIS activities detected by P- effect positive outcomes at a wider range of body sites (Tagg typing have now been attributed at least in part to antibiotic & Dierksen, 2003). Our principal goal is the application of peptides of the bacteriocin class, and several of these, streptococcal probiotics to afford protection against infec- including SA-FF22 (Jack et al., 1994), streptin (Wescombe tions of the oral cavity, especially streptococcal pharyngitis. & Tagg, 2003) and salivaricin A (SalA) (Ross et al., 1993) Probiotic bacteria can exert antipathogen effects through belong to the lantibiotic subclass. a variety of competitive exclusion mechanisms that include Streptococcus salivarius is a numerically prominent mem- (i) blocking attachment of other bacteria, (ii) sequestration ber of the indigenous oral microbiota of humans, and is only of essential nutrients and metal ions, and (iii) production of rarely associated with infections in healthy individuals inhibitory compounds such as acids, bacteriocins, and (Burton et al., 2006a). Our initial P-typing studies of
FEMS Microbiol Ecol xx (2006) 000–000 c 2006 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved 2 K.P. Dierksen et al.
S. salivarius defined six prototype BLIS-producing strains, lead to the enhancement of the inhibitory activity of the oral referred to as 5, 6, 9, 36, MPS and 20P3 (Dempster & Tagg, microbiota by at least two distinct mechanisms, namely (1) 1982). Streptococcus salivarius of P-type 676 or the very the additional activity contributed by the newly implanted similar P-type 677 (the prototypes of which are strains 5 and probiotic strain; and (2) specific amplification of the SalA- 20P3) was detected in saliva specimens from c. 10% of 180 producing activity of pre-existing components of the host’s tested subjects (Tagg et al., 1983). Later, Ross et al. (1993) indigenous microbiota. showed that S. salivarius 20P3 produces SalA, and subse- quently it was found (P. Wescombe, unpublished data) that Materials and methods this lantibiotic is also produced by S. salivarius 5. Tompkins & Tagg (1989) found that individuals harbouring large Subjects numbers of P-type 677 S. salivarius (comprising 4 90% of their total S. salivarius) had coexisting alpha-hemolytic Two hundred and nineteen children, aged between 5 and 10 streptococci on their tongues that were significantly less years old, were recruited from five Dunedin primary schools sensitive in vitro to P-type 677 BLIS producers. This was and provided with BLIS-milk according to the schedule in taken to indicate that sufficient SalA had been produced in Table 1. Streptococcus salivarius strains 5 and 20P3, both the oral cavity to effect in situ selection of SalA-resistant known to produce SalA, were compared for their coloniza- populations of some commensal oral streptococci. tion efficacies using either 2-day (Trial 1) or 9-day (Trial 2) Biologically active, extracellularly excreted SalA, like a dosing regimens. Approval was obtained from the Otago number of other antibiotics, is capable of upregulating its Ethics Committee. own production, but perhaps even more significantly it can also cross-induce production of SalA homologues encoded BLIS-milk by some strains of other oral streptococcal species including Large batch cultures of S. salivarius were grown in milk by S. pyogenes, S. agalactiae and S. dysgalactiae (Upton et al., the Cell Production Unit of the Dairy Research Institute 2001; Wescombe et al., 2006). An in vitro assay has been used (Palmerston, New Zealand), freeze-dried, and supplied in to detect specific inducing activity attributable to SalA in vacuum-sealed pouches. Containers of BLIS-milk powder saliva specimens from human subjects either colonized with were prepared for daily use by the children in the trials. Each or naturally harboring populations of SalA-producing S. contained a blend of freeze-dried cells (3 g), skim milk salivarius (Wescombe et al., 2006). Inducing activity could powder (7 g), and Nestle Quiks chocolate powder (5 g). only be detected when the subjects’ saliva contained a The 20P3/5 BLIS-milk contained a 1 : 1 mixture (total 3 g) 5 1 minimum of c.8 10 CFUmL of the SalA-producing of S. salivarius strains 20P3 and 5. Fresh BLIS-milk was S. salivarius (Wescombe et al., 2006). prepared by mixing 50 mL of cold tap water with the As part of a series of trials designed to establish an dehydrated powder and then refrigerating the suspension. effective protocol for colonizing children with probiotic The children were asked to sip the BLIS-milk slowly at least S. salivarius to provide them with a degree of protection four times during the day, especially after meals. The count against S. pyogenes infections (Tagg & Dierksen, 2003), we of S. salivarius in each of the freshly reconstituted wanted to evaluate milk as a potential delivery medium for BLIS-milks (c.3 107 CFU mL 1) was determined by spir- the bacterial cells. Milk freshly supplemented with freeze- al-plating serial 10-fold dilutions (in 0.85% NaCl) onto dried BLIS-producing S. salivarius is referred to here as Mitis-Salivarius agar (MSA) (Becton, Dickinson and Com- ‘BLIS-milk’. The original objective of these colonization pany, NJ) 11mgmL 1 streptomycin (MSA1S). All three trials was simply to compare the efficacies of oral implanta- tion of two strains of SalA-producing S. salivarius using either 2-day or 9-day BLIS-milk dosing schedules. This was Table 1. Distribution of children by trial group and BLIS colonizing strain carried out and the results are reported here. Much more Trial details No. of subjects Female Male interesting, however, we discovered upon retrospective Trial 1: 2-day course of BLIS-milk analysis of the colonization data that in a number of subjects Strain 20P3 81 47 34 there was an apparent large increase, following their con- Strain 5 81 48 33 sumption of BLIS-milk, in the total inhibitory activity of the Strains 20P3/5Ã 27 12 15 streptococcal component of their tongue microbiotas. The Total 189 107 82 extent of this enhancement of inhibitory activity was far Trial 2: 9-day course of BLIS-milk greater than could be accounted for by the relatively small Strain 20P3 15 6 9 numbers of the newly introduced colonizing strain. The Strain 5 15 5 10 Total 30 11 19 conclusion that we arrived at is that the drinking of BLIS- milk containing SalA-producing S. salivarius can potentially ÃBLIS-milk consisted of equal CFUs of each strain.
c 2006 Federation of European Microbiological Societies FEMS Microbiol Ecol xx (2006) 000–000 Published by Blackwell Publishing Ltd. All rights reserved Effect of BLIS milk on oral SalA-producing S. salivarius 3 types of BLIS-milk were found to contain SalA activity (titre sheet of glass) saturated with chloroform. The agar surface 8AUmL 1). was then aired for 15 min (to remove residual chloroform), and the set of nine standard indicator bacteria cross- Streptococcus salivarius and BLIS indicator streaked across the line of the original inoculum and the strains plate reincubated. The indicators were inoculated by swab- bing from Todd-Hewitt Broth (Becton, Dickinson and Naturally occurring variants (resistant to 1 mg mL 1 strep- Company) cultures. After incubation, the growth of tomycin) of S. salivarius 20P3 and 5 were used as the the indicator cultures was examined. Definite inhibition of colonizing strains (Dempster & Tagg, 1982). The use of the indicator culture was recorded as 1. For the purposes streptomycin-resistant cells was to facilitate accurate assess- of P-typing, the inhibitory activity against the nine standard ment of the levels of colonization. The BLIS P-types (677 indicators was recorded in code form (the P-type) as and 676 respectively) given by these two strains indicate previously described (Tagg & Bannister, 1979). The propor- that, of the nine standard indicators, only Indicator 3 tion of the indigenous S. salivarius population producing (Streptococcus anginosus strain T-29) is resistant to strain SalA-like inhibitory activity was estimated as described 20P3, whereas both Indicator 3 and Indicator 9 (Streptococ- previously (Tagg et al., 1983; Tompkins & Tagg, 1989) by cus dysgalactiae ssp. equisimilis strain T-148) are resistant to picking c. 100 individual S. salivarius colonies (recognized strain 5. Both strain 20P3 and strain 5 are SalA1 (produce by their characteristic large and mucoid morphology on salivaricin A), and in the P-typing test their BLIS activities MSA) into buffered blood agar freshly seeded with a lawn interfere with the growth of standard indicator strains inoculum of M. luteus (Indicator 1) and then incubating. Micrococcus luteus (Indicator 1); Streptococcus pyogenes Stab-cultures surrounded by inhibition zones of 4 5mm FF22, M-type 52 (Indicator 2); 71–679, M-type 4 (Indicator diameter were presumptive producers of SalA. Confirma- 5); 71–698, M-type 28 (Indicator 7); W-1, M-type 87 tion was obtained by recovering representative S. salivarius (Indicator 8); Streptococcus uberis ATCC 27958 (Indicator producing different-sized inhibition zones and testing 4); and Lactococcus lactis T-21, (Indicator 6). these for their inhibitory profile (P-type) and for the presence of salA using PCR (‘Detection of salA-positive Testing of streptococcal tongue populations for streptococci by PCR’). BLIS activity An assessment was made of the predominant in vitro BLIS Specific enumeration of the colonizing strain activity of the streptococcal populations on each of the and of indigenous streptococci exhibiting subjects’ tongues using samples obtained by firmly swabbing resistance to streptomycin the tongue surface from the back to the front. These samples were used to inoculate MSA, streaking out to obtain large In order to estimate the proportions of the total MSA- numbers of single colonies. In preparing MSA, 1 mL of 1% cultivable populations from each of the subjects’ tongues potassium tellurite was added per litre of medium just prior that were resistant to 1 mg mL 1 streptomycin (both pre- to pouring the plates as per the manufacturer’s instructions. and posttreatment) the following protocol was followed. A MSA is used for the selective culture of streptococcal cotton swab was rubbed (as above) across the surface of the and enterococcal species. All culture incubations in the tongue and then placed into a bottle containing 1 mL of 1% present study were for 18 h at 37 1C in a 5% CO2-enriched peptone (Becton, Dickinson and Company), to be trans- atmosphere. ported on ice to the laboratory for processing within 2 h. A sterile cotton swab was used to sample the mixed The bottle was vortex-mixed for 2–3 s, and then 50 mLofa (in our experience predominantly streptococcal) population 10 2 dilution in 0.85% NaCl was spiral-plated (Spiral growing in the primary (confluent growth) region of the Systems Inc., Model D) onto MSA (for the total cultivable MSA culture. The charged swab was then used to deliver count of streptococci/enterococci). Undiluted samples of a 1-cm-wide diametric inoculum across the surface of the 1% peptone suspension were spiral-plated onto MSA1S buffered blood agar [Columbia Agar Base (Becton, (streptomycin 1 mg mL 1). Because none of the precoloni- Dickinson and Company) containing 0.1% calcium carbo- zation samples of the childrens’ tongue microbiotas grew nate (to reduce acid-mediated inhibition) and 5% (v/v) any S. salivarius-like colonies on this medium, all such whole human blood], the test medium that we routinely use colonies grown from the postcolonization samples were for streptococcal BLIS P-typing (Tagg & Bannister, 1979). presumed to be the colonizing strain. Colonization levels After incubation of the streak culture, the macroscopic were recorded as the percentage of streptomycin-resistant bacterial growth was removed from the agar and the surface colonies (on MSA1S) of the total S. salivarius population sterilized by inverting the medium-containing portion of (enumerated from the 10 2 dilution on MSA). Samples were the plate for 30 min over a circular cloth pad (placed on a collected 1, 4, and 9 days postcolonization.
FEMS Microbiol Ecol xx (2006) 000–000 c 2006 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved 4 K.P. Dierksen et al.
Table 2. Retention of colonizing strain following a 2- or 9-day course of BLIS-milk Proportion of subjects whose tongue swabs yielded streptomycin-resistant Streptococcus salivarius after taking BLIS- milk supplemented with either 20P3, 5 or 20P315
20P3 5 20P3/5Ã Colonization Sample regime day n/totalw % n/total % n/total % Trial 1: 2-day 0 0/81 0 0/81 0 0/27 0 application 1 64/77 83 76/78 97 25/27 93 4 10/78z 13 55/79z 70 17/27 63 9 0/81z 0 22/79z 28 1/27 4 Trial 2: 9-day 0 0/15 0 0/15 0 NDz ND application 1 15/15 100 14/14 100 ND ND 4 11/15 73 13/14 93 ND ND 9 12/15 80 13/15 87 ND ND 11 3/15 20 7/14 50 ND ND 16 2/14 14 3/14 21 ND ND
ÃBLIS-milk consisted of equal CFUs of each strain. wNumber of subjects positive for the colonizing strain (determined by the growth of S. salivarius on streptomycin-containing media)/total number of subjects. zNot determined as this strain combination was not used in the 9-day colonization regime. zP value 0.001 (Fischer’s exact test).
Table 3. Level of colonization achieved 24 h after taking either 2-day or 9-day courses of BLIS-milk No. of subjects in group for whom the level of colonizationà was Strain used for No. of subjects Colonization regime colonization in group 0% o 0.01% 0.01–0.1 4 0.1–1 4 1–5 4 5 Trial 1: 2-day 20P3 77 13 11 37 12 4w 0 application 57832312911w 2w 20P3/5 27 2 1 10 12 1 1 Trial 2: 9-day 20P3 15 0 2 7 5 1 0 application 514015530
ÃExpressed as a percentage of the total Streptococcus salivarius population. wP = 0.071 (Fischer’s exact test) for the difference between the proportion of subjects colonized by strain 20P3 (i.e. 4/77) or by strain 5 (i.e. 13/78) at a level 4 1% of the total S. salivarius population.
Detection of salA-positive streptococci by PCR the children receiving strain 5 still had detectable levels of that strain 1, 4 and 9 days postcolonization than did children DNA was extracted from 100 mL of each peptone suspension given strain 20P3 (Table 2). Subjects dosed with a 1 : 1 using a previously described boiling lysis method (Beall mixture of strains 5 and 20P3 had retention rates inter- et al., 1996). Three microliters of template was used in mediate between those given either strain 20P3 or strain 5 subsequent PCR reactions with primers salAF 50-GAT ATT alone. Similarly, the actual colonization levels achieved 24 h TTG AAC AAT GCT ATC GAA G-30 and salAR 50-ACT AAT after completion of the dosing regimen were higher for the AGA AGT ATC TAG TAT GCT G-30, as described previously subjects who received strain 5 (either alone or when (Upton et al., 2001). 16S primers were included in the mix combined with strain 20P3) (Table 3). Indeed, 17% of to rule out PCR failure in the case of salA-negative reactions subjects given strain 5 had colonization levels of at least 1% (Wilson et al., 1990). at 24 h compared with only 5% of subjects dosed with strain 20P3 and 7% of those coinoculated with both strain 5 and Results and discussion strain 20P3. It is not clear why strain 5 is a more efficient colonizer than strain 20P3. Handley and coworkers have Trial 1: Dosing for 2 days with BLIS-milk demonstrated the importance of fimbriae (group K antigen) containing SalA-producing strains 5 and/or 20P3 in S. salivarius adhesion (Handley et al., 1984). However, The oral cavity retention rates of strains 5 and/or 20P3 were both strain 5 and strain 20P3 react positive when tested for compared in children given BLIS-milk for 2 days. More of Lancefield group K antigen (Johnstone, 1987).
c 2006 Federation of European Microbiological Societies FEMS Microbiol Ecol xx (2006) 000–000 Published by Blackwell Publishing Ltd. All rights reserved Effect of BLIS milk on oral SalA-producing S. salivarius 5
In this study there was no attempt made to reduce the Trial 2 80% of the children still had detectable levels of the levels of the children’s indigenous S. salivarius populations colonizing strain 9 days after they had stopped taking the before they drank the BLIS-milk, and this undoubtedly 20P3 BLIS-milk, and by day 16, 14% still remained positive. contributed to the relatively low levels of colonization Similarly, strain 5 was still detected 9 days after taking strain achieved. More recently we have found that with use of 5 BLIS-milk in 87% of the Trial 2 children compared with chlorhexidine pretreatment to effect reduction of the in- only 28% positive at the corresponding time in Trial 1. In digenous S. salivarius population, mean cell counts of addition, the proportion of children harbouring relatively 5.8 107 CFU mL 1 saliva are achieved 14 days postcoloni- high initial (day 1 postcolonization) levels (i.e. 4 0.1% of zation for the probiotic strain S. salivarius strain K12 their total streptococcal populations) was higher for the 9- (Burton et al., 2006b). Streptomycin-resistant S. salivarius day course (40% of those taking strain 20P3% and 57% for strains were used in the present study to facilitate accurate strain 5) than for the 2-day course (21% and 54% respec- assessment of their colonization levels. No tongue swabbings tively) (Table 3). obtained either before or after colonization grew (strepto- mycin-resistant) streptococcal colonies on MSA1S, other than for the appropriate colonizing strain(s) themselves. It is Colonization with BLIS1 S. salivarius may known that the expression of antibiotic resistance can confer stimulate the BLIS activity of the pre-existing a fitness cost on bacteria, and, in the absence of a persistent streptococcal microbiota selective antibiotic pressure, it has been observed that Just prior to taking BLIS-milk (day 0), 53 (65%) of the strain resistant bacteria are relatively disadvantaged in comparison 20P3-dosed children, 50 (62%) of the strain 5 group, and 16 with antibiotic-susceptible members of the same species (59%) of the combined (strain 5/strain 20P3) group in Trial (Andersson & Levin, 1999). Support for this observation 1 had P-type 000 (i.e. apparently BLIS-negative) MSA- can be found in the present study in the poor persistence of cultivable tongue populations as assessed by deferred antag- both of the streptomycin-resistant S. salivarius strains onism against the set of nine standard BLIS indicator following colonization, and this appeared particularly strains. However, the P-type profile of the tongue popula- marked when their initial colonization levels were low. By tions of 14 (8%) of these children changed to BLIS-positive contrast, individuals harbouring naturally acquired popula- soon (day 1) after they had taken BLIS-milk (Table 4). A tions of streptomycin-sensitive SalA-producing S. salivarius further six subjects, although not having P-type 000 pre- appear generally to retain the BLIS-producing bacteria for samples, displayed substantial relative increases in the periods of at least 6 months (Tompkins & Tagg, 1989). magnitude (zone width or number of affected indicators) of the P-type patterns given by their day 1 samples. In spite of its relatively less efficient colonization ability, strain 20P3 Trial 2: Dosing for 9 days with BLIS-milk seemed at least as effective as strain 5 in bringing about this containing SalA-producing strains 5 and/or 20P3 apparent enhancement of the total BLIS activity of the When the period of daily dosing with BLIS-milk containing childrens’ tongue microbiotas. either strain 5 or strain 20P3 was increased from 2 to 9 days It has been our experience (results not shown) that (Table 2), the proportion of individuals (1) initially colo- SalA-producing S. salivarius such as strains 5 and 20P3 need nized (day 1 following completion of the colonization to be present in proportions of at least c. 10% of the total protocol) and (2) exhibiting persistent colonization was test population in order for their inhibitory activity to be found to increase. Whereas in Trial 1, strain 20P3 was reliably detected in deferred antagonism tests such as used undetectable 9 days after colonization was completed, in here to screen the BLIS activity of the childrens’
Table 4. Effect of 2 days of taking milk containing Streptococcus salivarius strains 5 and/or 20P3 on the BLIS activity of the streptococcal microbiota of the tongue Proportion of BLIS1 reactions detected in tongue microbiota samples from subjects colonized with S. salivarius strain
Sampleà 20P3 5 20P3/5 Total Precolonization 28/81 (35%) 31/81 (38%) 11/27 (41%) 70/189 (37%) Postcolonization 34/81 (42%) 36/79 (46%) 14/27 (52%) 84/187 (45%) No. (%) changing to BLIS1 6(17%) 5 (18%) 3 (17%) 14 (18%)
ÃPre and postcolonization BLIS status was determined by P-typing samples of the MSA tongue swab cultures. A conversion from BLIS to BLIS1 indicates increased BLIS production as a result of colonization, increased endogenous production, or both. Numbers (and %) of BLIS1 tongue microbiotas/total children tested are indicated for each group of subjects.
FEMS Microbiol Ecol xx (2006) 000–000 c 2006 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved 6 K.P. Dierksen et al. streptococcal tongue populations. Hence the enhanced isolates from each of these subjects, and in every case the levels of BLIS activity detected in the 20 subjects described BLIS-positive colonies amounted to fewer than 5% of the above could not be accounted for by the relatively total S. salivarius colonies tested. Moreover, for only one of small numbers of the colonizing strains (0.14% or less the 16 PCR-positive convertor subjects was the level of of the total streptococcal population) present in their day colonization achieved on day 1 (viz 15%) by the BLIS-milk 1 samples. strain considered likely to be sufficiently high to account for Our previous studies have shown that both strain 5 and the production of detectable BLIS in the P-type test. In every strain 20P3, when grown in human saliva, can produce other case the level of colonization was o 1%. Hence it auto-inducing levels of SalA (P. Wescombe, unpublished seemed that most of the observed increase in total BLIS data), and furthermore that inducing levels of SalA can be activity in the convertor children resulted from an increase detected in the saliva of individuals colonized with the SalA- in the relative numbers and/or inhibitory activity of BLIS- positive probiotic S. salivarius K12 (Wescombe et al., 2006). positive members of their indigenous streptococcal tongue Examination of samples of BLIS-milk showed that both the populations. Similarly, just one of the four PCR salA- strain 5- and strain 20P3-supplemented milk had SalA titres negative convertor subjects had sufficiently high levels of 8 AU mL 1. The control (unsupplemented milk) was (25% in this case) of the colonizing strain to account for inhibitor-negative in this assay. We speculated that the 20 their increased tongue microbiota BLIS activity. For the children whose tongue populations converted from BLIS- three remaining salA PCR-negative convertor subjects the negative to BLIS-positive may have had small populations colonizing strain accounted for only 0.6% or less of their (o 10% of total streptococci) of SalA-positive S. salivarius total streptococcal tongue population. In summary, it just prior to taking the BLIS milk. To test for these putative appears that in these subjects the increase of total BLIS SalA producers, we used PCR to detect salA (the SalA activity probably arises from the expansion/stimulation of structural gene) in the precolonization samples from each the production of heterologous (non-SalA) BLIS, even if the of the 20 subjects (convertors) showing marked increase in mechanism for this is at present unclear. Only three of the 47 their BLIS-producing status and also from 47 Trial 1 subjects tested nonconvertors were salA PCR-positive, and in each who were consistently BLIS-negative (nonconvertors) case the levels of colonization achieved at day 1 were 0.14% (Table 5). The precolonization samples from 16 (80%) of or less. Failure to induce inhibitor production in some the convertors were salA1 by PCR. In addition, single salA1 clones is understandable in view of our previous colony picks of their S. salivarius populations (from MSA finding that the SalA locus is not always intact, deletions cultures) detected BLIS-positive (inhibitory to Indicator I1) sometimes being evident in the processing and transporter genes (Wescombe et al., 2006). On the basis of these observations we conclude that for
Table 5. Relationship of preexisting PCR-positive salA status in 67 individuals who have SalA1 S. salivarius as a component of subjects to the development of increased tongue microbiota BLIS activity their indigenous oral microbiota the consumption of BLIS- following exposure to BLIS-milk for 2 days milk (containing SalA1 S. salivarius and some associated
Number (%) of 19 salA1 and 48 salA subjects whose SalA peptide) may cause the level of salivary SalA to increase tongue microbiotas displayed sufficiently to be sensed by the indigenous SalA1 popula- Ã tion, thereby upregulating the expression of SalA and in turn Increase in BLIS No change in BLIS increasing the proportion of SalA1 S. salivarius within the w Strain salA1 salA salA1 salA tongue microbiota. In follow-up tests, three subjects having 20P3 11 0 1 21 streptococcal tongue populations PCR-negative for salA and 5 3 2117 three subjects salA PCR-positive were given 2-day courses of 20P3/5 2 2 1 6 (a) skim milk1chocolate powder (control) and then 2 z z Total 16 (84)z 4(8)z,‰ 3 (16) 44 (92) weeks later (b) 20P3 BLIS milk. No substantial differences ÃIncrease in BLIS activity was monitored by change in P-type. Fourteen were detected between the BLIS P-type activities of the BLIS-negative children and six with substantial BLIS P-type increase were streptococcal populations on the subjects’ tongues in sam- tested along with 47 randomly selected BLIS-negative subjects. ples obtained at day 0 and day 1 either following the taking w Precolonization samples were tested for the salA structural gene by of the control milk or for the subjects having salA PCR- PCR. negative precolonization tongue populations. By compar- z Numbers in brackets indicate the percentage of each group (salA1 or ison, two of the three salA PCR-positive subjects showed a salA ) that showed an increase in BLIS P-type. ‰ marked increase in the BLIS P-type activity of their day 1 One child was colonized at 25%, so their increase in BLIS activity may be caused by the colonizing strain. tongue samples and this was accompanied by an associated zNumbers in brackets indicate the percentage of each group (salA1 or increase in the proportion of indigenous SalA1 S. salivarius. salA ) that showed no change in BLIS P-type. In one subject the proportion changed from 5% to 40% and
c 2006 Federation of European Microbiological Societies FEMS Microbiol Ecol xx (2006) 000–000 Published by Blackwell Publishing Ltd. All rights reserved Effect of BLIS milk on oral SalA-producing S. salivarius 7
Table 6. Correlation of the SalA sensitivity of Streptococcus salivarius Acknowledgements strains and their producer and salA status This work was supported by grants from the Thrasher Streptococcus Sensitivity to Research Fund, the Health Research Council of New Zeal- salivarius strain salAÃ P-type strain 20P3 (SalA1) and, and the National Heart Foundation of New Zealand. 36 777 1 T30 000 1 8618 737 1 JO1 777 1 References K8P ori 226 1 220–1 634 1 Abe F, Ishibashi N & Shimamura S (1995) Effect of K19 P1 777 1 administration of bifidobacteria and lactic acid bacteria to Piriew 1 777 1 newborn calves and piglets. J Dairy Sci 78: 2838–2846. K33z 1 000 1 Andersson DI & Levin BR (1999) The biological cost of antibiotic 20P3 1 677 resistance. Curr Opin Microbiol 2: 489–493. K12 1 777 Beall B, Facklam RR, Thompson T (1996) Sequencing emm – K30 1 777 specific PCR products for routine and accurate typing of ‰ 9 1 636 group A streptococci. J Clin Microbiol 34: 953–958. 1–1 1 777 Burton JP, Wescombe PA, Moore CJ, Chilcott CN & Tagg JR SF1 1 777 (2006a) Safety assessment of the oral cavity probiotic 5 1 677 JH 1 777 Streptococcus salivarius K12. Appl Environ Microbiol 72: DC135B 1 677 3050–3053. Burton JP, Chilcott CN, Moore CJ, Speiser G & Tagg JR (2006b) A Ã PCR primers can detect any of the five reported salA variants (Wes- preliminary study of the effect of probiotic Streptococcus combe et al., 2006). w salivarius K12 on oral malodour parameters. J Appl Microbiol Does not express SalA. 100: 754–764. zTn916-derived SalA- (i.e. does not express SalA or immunity to SalA) Dempster RP & Tagg JR (1982) The production of bacteriocin- variant of S. salivarius strain 20P3. ‰ like substances by the oral bacterium Streptococcus salivarius. P-type is variable for this strain, sometimes being 677. Arch Oral Biol 27: 151–157. Handley PS, Carter PL & Fielding J (1984) Streptococcus salivarius strains carry either fibrils or fimbriae on the cell surface. J in the second the change was from o 1% to 45%. The third Bacteriol 157: 64–72. subject (also o 1% precolonization) showed no apparent Jack RW, Carne A, Metzger J, Stefanovic S, Sahl HG, Jung G & increase in SalA1 proportion. As previously, the level of Tagg J (1994) Elucidation of the structure of SA-FF22, a colonization at day 1 by strain 20P3 (streptomycin resistant) lanthionine-containing antibacterial peptide produced by was o 5% in all six subjects. Streptococcus pyogenes strain FF22. Eur J Biochem 220: Deferred antagonism testing of S. salivarius strain 20P3 455–462. against 18 indicator strains of S. salivarius (11 were salA1 Johnstone KF (1987) Novel phenotypic markers of Streptococcus and seven salA ) showed that all seven salA strains and salivarius. BSc (hons). University of Otago, Dunedin, New only two of the salA1 strains were inhibited (Table 6). Zealand. Interestingly, however, neither of these two salA1 strains Patterson JA & Burkholder KM (2003) Application of appeared capable of expressing SalA. In strain K33 a prebiotics and probiotics in poultry production. Poultry transposon had inserted within the SalA locus, but the Sci 82: 627–631. reason for lack of expression in strain Pirie is at present not Ross KF, Ronson CW & Tagg JR (1993) Isolation and known. This illustration of the in vitro anti-S. salivarius characterization of the lantibiotic salivaricin A and its structural gene salA from Streptococcus salivarius 20P3. Appl activity of strain 20P3 provides further support for the Environ Microbiol 59: 2014–2021. hypothesis that enhanced salivary levels of SalA, either Sullivan A & Nord CE (2002) The place of probiotics in human transiently acquired from the BLIS milk or from that intestinal infections. Int J Antimicrob Agents 20: 313–319. produced (possibly at induced levels) by the indigenous or Tagg JR & Bannister LV (1979) ‘‘Fingerprinting’’ b-haemolytic newly introduced SalA1 S. salivarius, can lead to a clonal streptococci by their production of and sensitivity to expansion of S. salivarius. These expanded S. salivarius bacteriocine-like inhibitors. J Med Microbiol 12: 397–411. populations may in turn, by producing and exhibiting Tagg JR & Dierksen KP (2003) Bacterial replacement therapy: immunity to SalA, outgrow non-SalA1 members of the adapting ‘germ warfare’ to infection prevention. Trends subject’s S. salivarius indigenous microbiota and thus Biotechnol 21: 217–223. potentially increase local protection of the host against Tagg JR, Pybus V, Phillips LV & Fiddes TM (1983) Application of S. pyogenes infection. inhibitor typing in a study of the transmission and retention in
FEMS Microbiol Ecol xx (2006) 000–000 c 2006 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved 8 K.P. Dierksen et al.
the human mouth of the bacterium Streptococcus salivarius. Wescombe PA & Tagg JR (2003) Purification and characterisation Arch Oral Biol 28: 911–915. of streptin, a type A1 lantibiotic produced by Streptococcus Tompkins GR & Tagg JR (1989) The ecology of bacteriocin- pyogenes. Appl Environ Microbiol 69: 2737–2747. producing strains of Streptococcus salivarius. Microb Ecol Wescombe PA, Upton M, Dierksen KP et al. (2006) Production of the lantibiotic salivaricin A and its variants by oral streptococci Health Dis 2: 19–28. and use of a specific induction assay to detect their presence in Upton M, Tagg JR, Wescombe P & Jenkinson HF (2001) Intra- human saliva. Appl Environ Microbiol 72: 1459–1466. and interspecies signaling between Streptococcus salivarius and Wilson KW, Blitchington RB & Greene RC (1990) Amplification Streptococcus pyogenes mediated by SalA and SalA1 lantibiotic of bacterial 16S ribosomal DNA with polymerase chain peptides. J Bacteriol 183: 3931–3938. reaction. J Clin Microbiol 28: 1942–1946.
c 2006 Federation of European Microbiological Societies FEMS Microbiol Ecol xx (2006) 000–000 Published by Blackwell Publishing Ltd. All rights reserved APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Feb. 2007, p. 1107–1113 Vol. 73, No. 4 0099-2240/07/$08.00ϩ0 doi:10.1128/AEM.02265-06 Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Salivaricin A2 and the Novel Lantibiotic Salivaricin B Are Encoded at Adjacent Loci on a 190-Kilobase Transmissible Megaplasmid in the Oral Probiotic Strain Streptococcus salivarius K12ᰔ Otto Hyink,1 Philip A. Wescombe,2 Mathew Upton,1,3 Nancy Ragland,1 Jeremy P. Burton,1,2 and John R. Tagg1* Department of Microbiology and Immunology, University of Otago, P.O. Box 56, Dunedin, New Zealand1; BLIS Technologies Ltd., Centre for Innovation, P.O. Box 56, Dunedin, New Zealand2; and Manchester Medical Microbiology Partnership, University of Manchester School of Medicine, Manchester M13 9WL, United Kingdom3
Received 26 September 2006/Accepted 17 December 2006
The commercial probiotic Streptococcus salivarius strain K12 is the prototype of those S. salivarius strains that are the most strongly inhibitory in a standardized test of streptococcal bacteriocin production and has been shown to produce the 2,368-Da salivaricin A2 (SalA2) and the 2,740-Da salivaricin B (SboB) lantibiotics. The previously uncharacterized SboB belongs to the type AII class of lantibiotic bacteriocins and is encoded by an eight-gene cluster. The genetic loci encoding SalA2 and SboB in strain K12 have been fully characterized and are localized to nearly adjacent sites on pSsal-K12, a 190-kb megaplasmid. Of 61 strongly inhibitory strains of S. salivarius, 19 (31%) were positive for the sboB structural gene. All but one (strain NR) of these 19 strains were also positive for salA2, and in each of these cases of double positivity, the two loci were separated by fewer than 10 kb. This is the first report of a single streptococcus strain producing two distinct lantibiotics.
Streptococcus salivarius is a primary and predominant colo- “lanthionine-containing antibiotics” (18), the prototype of nizer of oral mucosal surfaces in humans and is not known to which is nisin (8), have now been reported to be produced by initiate infections in healthy individuals (4). A feature of S. strains of a wide variety of gram-positive species (5, 10). Strain salivarius is its production of a variety of bacteriocin-like in- 20P3, the prototype P type 677 S. salivarius strain, produces hibitory substances (BLIS), the activity of which appears to be SalA, an atypical lantibiotic in that it (i) contains no dehy- particularly strong against Streptococcus pyogenes, a potentially drated residues in its biologically active propeptide form (16) pathogenic species that, like S. salivarius, has adapted to a and (ii) appears to exhibit bacteriostatic rather than bacteri- principally oral mucosal existence in humans. This laboratory cidal activity toward its probable target bacterium (in this case, utilizes a deferred antagonism method with blood agar to test S. pyogenes) (11). Another intriguing finding has been that streptococci for their patterns of BLIS activity against nine almost all tested S. pyogenes strains harbor large remnants of standard indicators, and these patterns are referred to in code the SalA locus (19), with to date only serotype M-4 S. pyogenes form as production (P) types (21). Our investigations of S. having an intact locus and expressing functional (inhibitory) salivarius strains have shown that they can produce a large SalA activity in vitro (29). Interestingly, it is a homolog of SalA, number of different P type patterns and that children harbor- named SalA1, that is encoded by S. pyogenes strains. The SalA ing strains with P types 677 or 777 appear less likely to acquire locus in S. pyogenes, like those in many other lantibiotic-pro- S. pyogenes (7). Approximately 10% of S. salivarius strains ducing species, encodes an autoinducing two-component reg- exhibit P type 677 activity, a pattern corresponding to the ulatory system (25). We have now detected five variants of inhibition of all nine standard indicators other than indicator 3 SalA (SalA1 through SalA5), produced by strains of four dif- (I3) (7). Only around 1% of S. salivarius strains display P type ferent streptococcal species, all of which are capable of cross- 777 activity (all nine indicators inhibited) (our unpublished inducing the production of the entire family of SalA peptides results). (29). Specific inducing activity can be detected in the saliva of Our wide-ranging application of the P-typing procedure has subjects following their colonization with SalA-producing S. shown the production of BLIS activity to be both frequent and salivarius (29). varied within the genus Streptococcus (2, 6, 21, 23, 24). Much of the streptococcal BLIS activity detected to date has subse- Our studies of the more broadly inhibitory (P type 777) S. quently been ascribed to peptides of the bacteriocin class, and salivarius strains have focused on strain K12, a bacterium now several of these, including SA-FF22 (9), streptin (12, 28), and widely used as a probiotic for the treatment of halitosis and the salivaricin A (SalA) (16), are of the lantibiotic subclass. These maintenance of throat health (3, 4, 22). In the present study, we demonstrate that strain K12 produces two lantibiotics, SalA2 (29) and salivaricin B (SboB), the genetic loci for which * Corresponding author. Mailing address: Department of Microbi- are closely linked in strain K12 and localized to a large, trans- ology and Immunology, University of Otago, P.O. Box 56, Dunedin, missible plasmid. This, to our knowledge, is the first example of New Zealand. Phone: 643 479 7714. Fax: 643 479 8540. E-mail: john.tagg @stonebow.otago.ac.nz. a streptococcus strain being shown to produce two different ᰔ Published ahead of print on 28 December 2006. types of lantibiotics.
1107 1108 HYINK ET AL. APPL.ENVIRON.MICROBIOL.
MATERIALS AND METHODS supernatant was mixed with 1 ml of absolute ethanol, precipitated, washed with 0.5 ml of 70% ethanol, and then resuspended in 50 l of TE buffer containing 0.2 Bacterial strains and growth conditions. All S. salivarius strains (K12, NR, g of RNase A. PCR and inverse PCR using appropriate specific primers were 20P3, and those listed in Table 2) were isolated from human saliva. The nine used to amplify individual regions and ultimately the entire salivaricin B locus, standard indicator strains (I1, Micrococcus luteus; I2, S. pyogenes M type 52; I3, which was sequenced using an ABI 377 sequencer (Centre for Gene Research, Streptococcus constellatus; I4, Streptococcus uberis; I5, S. pyogenes M type 4; I6, University of Otago). Sequences were analyzed using the DNAStar suite of DNA Lactococcus lactis; I7, S. pyogenes M type 28; I8, S. pyogenes M type 87; and I9, analysis programs (Lasergene). Putative open reading frames (ORFs) were com- Streptococcus dysgalactiae) used for P typing have been described previously (21). pared to known sequences and searched for known motifs by using the Web- Deferred antagonism studies were performed with Columbia agar base (Difco) based software programs BLAST and PredictProtein (1, 17). supplemented with 5% human blood (vol/vol) and 0.1% calcium carbonate Dot blot hybridization screening. The distribution of sboA, the structural gene (wt/vol). encoding SboB, among S. salivarius and various other BLIS-producing bacteria Deferred antagonism method. The method of deferred antagonism originally was determined by dot blotting. A 5-l portion of each DNA sample (prepared described by Tagg and Bannister (21) was used, either to determine the patterns as outlined above) was applied to a nylon membrane (Hybond-Nϩ [Amersham (P types) of BLIS activities of the test strains or to compare the relative suscep- Pharmacia Biotech, Inc.]) by using a vacuum manifold, followed by 100 lof2ϫ tibilities of different bacterial strains to the BLIS activities produced in agar SSC (0.3 M NaCl plus 0.03 M sodium citrate). Denaturation of the DNA was media. The test strain was inoculated diametrically across the surface of the effected by exposure to two 2-min washes with 0.4 M NaOH, followed by two supplemented agar base as a 1-cm-wide streak. After incubation (18 h at 37°C in 2-min washes with 1 M Tris-HCl. The membrane was then exposed to UV light 5% CO in air), the visible growth of the test strain was removed using a glass 2 for 5 min and probed with a digoxigenin-dUTP (Roche Diagnostics, Ltd., Lewes, slide and the surface of the agar was sterilized by exposure to chloroform vapors England)-labeled probe corresponding to the sboA gene. The probe was gener- for 30 min. The plate was then aired for 15 min prior to inoculation with 18-h ated by PCR using HotMaster Taq DNA polymerase (Eppendorf) and S. sali- Todd-Hewitt broth (THB) cultures of the indicator strains across the line of the varius K12 genomic DNA as the template with the following amplification original producer growth. The plates were then incubated as before for 24 h and parameters: 30 cycles, with denaturation at 95°C for 30 s, annealing at 40°C for examined for zones of interference with the indicator growth. Definite inhibition 30 s, and extension at 65°C for 30 s. ϩ of indicator growth was recorded as . For the purposes of P typing, the Nucleotide sequence accession number. The GenBank accession number for inhibitory activity toward the nine standard indicators was recorded in code form the sequence determined in this project is DQ889451. (as the P type) by considering the indicators as three triplets (i.e., I1, I2, I3; I4, I5, I6; and I7, I8, I9). Inhibition of the first member of an indicator triplet was given a score of 4; that of the second, 2; and that of the third, 1. Lack of inhibition of an indicator was scored as 0. The complete P type code was recorded as a RESULTS sequence of three numbers representing the sum for each triplet. All tests were performed in duplicate, and further testing was undertaken if significant discrep- Production, purification, and partial characterization of ancies were detected in the inhibition patterns obtained. salivaricin A2 and salivaricin B from S. salivarius K12. Two In a variation of the deferred antagonism test designed to assess the relative different lantibiotic bacteriocins that together appear to ac- heat stability of the BLIS activities produced by the test strain, the agar plates count for most of the relatively wide-ranging BLIS activity of were heated at 80°C for 30 min and then cooled to room temperature prior to the strain K12 have been detected and characterized in this study. application of the indicator bacteria. Decreased inhibition of an indicator com- pared to that on the unheated (control) plate indicated heat lability of the SalA2 and SboB were recovered from lawn cultures of S. inhibitory agent. salivarius K12 grown on M17 sucrose agar. Low levels of Purification and characterization of SalA2 and SboB. The purification proce- SalA2-like inhibitory activity and no SboB-like activity were dure was based on that developed previously for SalA (16). Cotton swabs detected in THB cultures, and when M17 agar was supple- charged by immersion in an 18-h THB culture of S. salivarius K12 were used to mented with 1% (wt/vol) glucose or lactose instead of sucrose, seed lawn cultures on plates containing a 1-liter total volume of M17 agar medium supplemented with 0.5% sucrose, 0.1% calcium carbonate, and 0.8% SboB-like activity was reduced (data not shown). bacteriological agar. The cultures were grown for 18 h in an atmosphere of 5% Preparations of both of these inhibitory peptides in a liquid Ϫ CO2 in air, followed by freezing at 80°C and thawing at 4°C. After clarification form were obtained by freeze-thaw extraction of M17 sucrose of the exudate by centrifugation (15,000 ϫ g for 25 min), the exudate was passed agar cultures of S. salivarius K12. Two high-pressure liquid through an XAD-2 column with a 500-ml bed volume and was followed by 1 liter of 80% (vol/vol) methanol and then 1 liter of acidified (pH 2) 95% methanol to chromatography fractions inhibitory (i) only to I1 (putative elute the inhibitory activity. Spot testing was carried out as described previously SalA2 activity) or (ii) to both I1 and I3 (putative SboB activity) to identify fractions harboring inhibitory activity (28). Briefly, 10 l of each were identified. The peak corresponding to SalA2 eluted from fraction was spotted onto the surface of a blood agar plate and allowed to dry. the C18 column in 36% acetonitrile and had a mass of 2,368 Da After sterilization of the agar surface by exposure to chloroform vapors, a swab (Fig. 1A). A second peak, eluting in 38% acetonitrile, con- charged by immersion in an 18-h THB culture of either I1 or I3 was used to inoculate the agar surface, followed by overnight incubation. A zone of no tained a single inhibitory peptide (SboB) with a mass of 2,740 growth demonstrates which fractions harbor inhibitory molecules. Fractions hav- Da (Fig. 1B). Amino acid analysis of the SboB peptide ing inhibitory activity were concentrated 10-fold using a rotary evaporator and detected lanthionine, a defining characteristic of lantibiotic then fractionated on a C8 (Brownlee) column by fast protein liquid chromatog- peptides. Edman degradation established a partial SboB N- raphy using an isocratic (26%) acetonitrile gradient followed by high-pressure terminal amino acid sequence of G-G-G-V-I-Q-X-I-X-H-E-X- liquid chromatography using a C18 column with an acetonitrile gradient of 33 to 44% over 35 min. This enabled the separation of fractions having inhibitory R-M-N-X-Q-F-L-F. The 21 residues sequenced included four activity toward both I1 and I3 (i.e., containing SboB) from those inhibitory only that were unidentifiable (X) and are presumed to be involved to I1 (i.e., due to SalA2). Mass spectrometry analysis and N-terminal sequencing in lanthionine ring formation. was carried out at the Protein Microchemistry Facility, Department of Biochem- Sequence analysis of the salivaricin B structural gene. The istry, University of Otago. salivaricin B structural gene (sboA)inS. salivarius K12 was DNA isolation, sequencing, and analysis. Chromosomal DNA was extracted from 18-h THB cultures. Briefly, the pelleted cells from 1.5 ml of culture were localized to a 1.8-kb EcoRI-HindIII restriction fragment by resuspended in 300 l of TE buffer (10 mM Tris-HCl [pH 8.0], 1 mM EDTA [pH Southern hybridization using a degenerate DNA oligonucleo- 8.0]). After the addition of 100 l of lysozyme (20 mg/ml) and 9 units of tide probe (5Ј-TCNTGGCAATTTTTRTTTACT-3Ј) designed mutanolysin and incubation at 37°C for 1 h, 60 l of 10% sodium dodecyl sulfate using the partial N-terminal amino acid sequence established (wt/vol) was added, followed by further incubation at 65°C for 15 min. The addition of 10 l of proteinase K (13.6 mg/ml) and a 30-min incubation at 37°C for SboB (see above). The 1.8-kb fragment was cloned into were followed by the addition of 170 l of 8 M LiCl and a 30-min incubation on pUC-19 and sequenced using universal and specifically de- ice. After clarification by centrifugation (16,100 ϫ g for 10 min), 500 lofthe signed primers. Inverse PCR was then used to sequence the VOL. 73, 2007 MEGAPLASMID-BORNE LANTIBIOTICS SALIVARICINS A AND B 1109
FIG. 1. Matrix-assisted laser desorption ionzation–time of flight analysis plots for purified salivaricin A2 (A) and salivaricin B (B). The sample of salivaricin B was also tested and found to be positive for lanthionine, indicating that salivaricin B is a lantibiotic.
region encompassing the EcoRI site, which was internal to the 481 propeptides, respectively. The residues involved in lanthio- sboA gene. The SboA amino acid sequence aligned strongly nine ring formation for these peptides are fully conserved in with those of other members of the group AII lantibiotic bac- the SboA sequence. A possible secondary structure of the teriocins (Fig. 2A). Conservation in the leader sequences of SboA propeptide, based on the resolved structures of the lac- lantibiotics is often low. This holds true for the group AII ticin 481 (15, 26) and mutacin II (13) peptides, is shown in lantibiotics, being limited to the eight amino acids directly Fig. 2B. preceding the cleavage site. The 25-amino-acid propeptide dif- Identification and analysis of the locus defining SboB pro- fers by five and six amino acids from the variacin and lacticin duction in S. salivarius strain K12. Inverse PCR and standard 1110 HYINK ET AL. APPL.ENVIRON.MICROBIOL.
FIG. 2. Comparison of salivaricin B to similar lantibiotics. (A) Alignment of the amino acid sequences of lantibiotic precursors similar to salivaricin B, with residues matching those in the salivaricin B sequence highlighted. Sequences are labeled as follows (GenBank accession numbers are in parentheses): SBO B, salivaricin B (DQ889451); VAR, variacin (CAA63706); L481, lacticin 481 (P36499); J46, bacteriocin J46 (CAA61674); MUT II, mutacin II (O54329); NUK A, nukacin A (NP_940772); RUM A, ruminococcin A (P83675); SCN A, streptococcin A-FF22 (P36501); BUT A, butyrivibriocin A (AAK32692); and BUT OR79, butyrivibriocin OR79 (AAC19355). Numbers along the top indicate amino acid positions. (B) Predicted structure of salivaricin B based on the resolved structures of lacticin 481 and mutacin II. Dehydrated residues and residues linked by lanthionine rings are highlighted. S, thioether sulfur.
PCR were subsequently used to amplify and sequence the to be involved in the autoregulation of SboB production. The remainder of the SboB operon. Eight ORFs with similarity to second predicted operon comprises the sboAMTFEG gene genes of known functions were identified (Table 1). Putative cluster, the products of which have homologies to type AII proteins involved in SboB regulation, modification, transport, lantibiotic structural (SboA), modification (SboM), trans- and immunity are encoded at this locus, with the genes prob- porter (SboT), and immunity (SboFEG) proteins (Table 1). ably arranged in a two-operon structure. The first predicted Putative transcription terminators were identified downstream operon encodes the putative proteins SboK and SboR, thought of sboK and sboG as well as a weaker terminator downstream of sboA that may allow readthrough into sboMTFEG (Fig. 3). Three repeat regions were identified at each end of the SboB TABLE 1. Genes of the sboB locus locus (Fig. 3). The inverted repeats 1 and 3 share 89.5% iden- Size of tity over a 1,470-bp region, while repeat 2, which is in the same b Protein most similar to gene Gene product Predicted function c orientation as repeat 3, is shorter, sharing 97% identity with a product (% ID) (aa) repeat 3 over a 537-bp stretch. Similarity searching reveals that sboK 456 Regulation S. pyogenes ScnK (47) the two longer repeats are similar to transposase genes, which sboR 232 Regulation S. pyogenes ScnR (60) have undergone multiple frameshift mutations and therefore sboA 56 SalB precursor Kocuria varians variacin (65) can no longer encode functional proteins. sboM 933 Modification S. pyogenes ScnM (39) sboT 693 Transport S. mutans MukT (55) Distribution of the SboB locus and its proximity to the SalA sboF 303 Immunity S. pyogenes ScnF (60) locus in S. salivarius. The SalA gene cluster and variants sboE 249 Immunity S. pyogenes ScnE (41) thereof have been found in at least four different species of sboG 242 Immunity S. pyogenes ScnG (40) streptococci (29). Moreover, 31 of 61 BLIS-active S. salivarius a aa, amino acids. strains were positive for salA. The distribution of the SboB b Data are based on functions of homologous genes in other lantibiotic- encoding loci. gene cluster was investigated by dot blot hybridization using c % ID refers to the percentage of identity at the amino acid level. sboA as a probe. Nineteen of 61 strongly BLIS-active S. sali- VOL. 73, 2007 MEGAPLASMID-BORNE LANTIBIOTICS SALIVARICINS A AND B 1111
FIG. 3. Arrangement of the two gene clusters encoding salivaricins A and B in S. salivarius K12. Predicted transcriptional terminators for both loci are indicated by stem-loop symbols, with the dashed stem-loop showing a possible weak terminator. Two putative genes are located between the two lantibiotic loci. The three repeat regions (R1, R2, and R3) identified are also indicated, as is the position of a small insertion sequence (IS; black triangle) identified upstream of the salivaricin B locus in some strains (Table 2). varius strains but none of 25 S. pyogenes strains (of different M cators by using surface spot assays. All nine standard indicators types) or 12 S. uberis strains were positive. A single strain of were inhibited by the purified salivaricin B preparation, al- Streptococcus mitis, identified for its ability to produce SboB- though I4 (S. uberis) was less sensitive than the other eight like activity, was positive for the sboA gene. Sequencing of the indicator strains (data not shown). The spectrum of activity of sboA gene from this S. mitis strain showed that the gene dif- S. salivarius strain NR in deferred antagonism studies gives the fered from the K12 sboA gene by a single point mutation from same result, with activity against all nine standard indicators guanine to adenine at position 131, resulting in an arginine- and weaker activity against I4. Deferred antagonism results for to-histidine change at amino acid 44. Of 19 sboA-positive S. strain NR were therefore used as a close approximation of the salivarius strains, 18 were also positive for salA: only strain NR spectrum of activity of salivaricin B. was sboA positive and salA negative (Table 2). Previous studies have shown that S. salivarius 20P3 is active The K12 SalA2 and SboB loci have recently been localized against all S. pyogenes strains tested (6). The demonstration of to a megaplasmid of approximately 190 kb (pSsal-K12) (27). the extended activity spectra of S. salivarius strains 20P3 (pro- Sequencing upstream of the SboB locus in strain K12 showed ducer of SalA), NR (producer of SboB), and K12 (producer of that the two lantibiotic loci are separated by only 7.5 kb. Only SalA2 and SboB) was undertaken using a variety of indicator two predicted protein-encoding ORFs (named orf1 and orf2) strains (summarized in Table 3). This enabled putative cate- were identified in this 7.5-kb region. Orf1 showed some simi- gorization of the indicators according to whether they ap- larity to repressor proteins expressed by some staphylococcal peared to be inhibited by both, either, or neither of the two phages, while Orf2 showed no similarity to any database-listed lantibiotics. S. salivarius K12 had a much broader overall spec- proteins. PCR analysis of the 18 salA-positive, sboA-positive S. trum than the single-lantibiotic-producing strains NR and salivarius strains showed that whereas the two loci are sepa- 20P3. Experiments using purified SalA and SboB showed no rated by 7.5 kb in 13 strains, the remaining 5 carry an addi- evidence of these two lantibiotics displaying synergistic inhib- tional 1.5 kb encoding a putative insertion sequence very sim- itory activity (data not shown). Of particular interest was the ilar to ISSmu2 found in Streptococcus mutans (GenBank identification of strains inhibited by strain K12 but not by accession number AE014133). either strain NR or strain 20P3. Two separate activities, ap- Comparative analysis of the inhibitory activities of SboB parently unrelated to either SalA2 or SboB, were identified: and related lantibiotics. Purified salivaricin B was used to assess the spectrum of activity against the nine standard indi- TABLE 3. Indicator strains that differentiate the inhibitory spectra of S. salivarius strains K12, NR, and 20P3 TABLE 2. Distribution of salivaricins A and B in 61 strongly BLIS- a active S. salivarius strains Indicator(s) inhibited by : Indicator(s) K12 NR 20P3 Gene PCR Length (kb) result for: of linkage S. salivarius strain(s)a I1 through I9 Y (777) Y (777) Y (677) PCR salA sboA productb S. salivarius K12 N Y Y S. salivarius NR N N Y 1-1, C78, H21-finger, K19, and ϩϩ 9.0 S. salivarius 20P3 N Y N SF-1 (5 strains) S. mutans 10449 Y N N 152T, 161T, 3B, G69, H28, ϩϩ 7.5 S. mutans OMZ175 Y N Y H31, K12, K28, K30, min5, S. sobrinus OMZ176 Y N Y N45, Strong-SA, T18A (13 S. mitis 15914 Y Y N strains) Staphylococcus hominis 2203 Y (HL) N N NR Ϫϩ Enterococcus faecalis ATCC Y (HR) N N 13 strains ϩϪ 19433 30 strains ϪϪ Actinomyces naeslundii Y (HR) N N NCTC 10301 a Only salivaricin B-positive strains have been named. b The linkage PCR results indicate the distance between the salivaricin A and a Y, yes; N, no; HL, heat-labile inhibitory activity; HR, heat-stable inhibitory salivaricin B loci in the named strains. activity. Numbers in parentheses are P types. 1112 HYINK ET AL. APPL.ENVIRON.MICROBIOL.
TABLE 4. Comparative inhibitory spectra of S. salivarius K12, variacin and lacticin 481 peptides by only five and six amino Micrococcus varians 1482, and Lactococcus lactis C2102 acids, respectively. Analysis of the activities of the strains S. Inhibitory activity No. of tested salivarius NR (SboA producer), Micrococcus varians 1482 P against straina: S. salivarius Producer strain (variacin producer), and Lactococcus lactis C2102 (lacticin 481 type strains inhibited NR 1482 C2102 (n ϭ 25) producer) was carried out to identify differences in the inhib- itory activity spectra of these three lantibiotics. Lacticin 481 S. salivarius NR 777 Ϫ ϩϩϩ ϩϩϩ 14 had no activity against the SboA and variacin producer strains ϩϩϩϩ Ϫ ϩϩϩ Micrococcus varians 777 25 and generally showed less inhibitory activity toward other in- 1482 Lactococcus lactis 636 ϪϪϪ 0 dicators tested. There was a lack of cross-immunity among the C2102 three producer strains, and the variacin and SboA producers showed different inhibitory profiles when tested against a set of a Levels of inhibition were scored from Ϫ, for no inhibition, to ϩϩϩϩ, for complete inhibition. 25 S. salivarius indicator strains. These results clearly demon- strated that these three inhibitors differ significantly in their inhibitory activity. one that was heat stable and directed against Enterococcus The present study has shown that SboB production appears faecalis strain ATCC 19433 and Actinomyces naeslundii strain to be defined by an 11-kb locus consisting of eight ORFs NCTC 10301 and another that appeared relatively heat labile organized into two putative operons (Fig. 3), the first of which (inactivated by heating at 80°C for 30 min) and was directed consists of genes encoding a putative two-component sensor against Staphylococcus hominis strain 2203. Both of these ac- kinase-response regulator system (sboK and sboR) and the tivities were absent from the plasmid-cured derivative of K12. second comprising genes encoding the SboB prepeptide (sboA) The molecules responsible for these inhibitory activities are yet and those responsible for the modification (sboM) and export to be identified. and activation (sboT) of SboB and for producer self-immunity The inhibitory spectrum of S. salivarius NR (SboB producer) (sboFEG). The presence of the two-component regulatory sys- was compared with that of Micrococcus varians 1482, which tem indicates that SboB production could be regulated in a produces variacin, and that of Lactococcus lactis C2102, which manner similar to that of the SalA and nisin loci (i.e., autoin- produces lacticin 481 (Table 4). Deferred antagonism cross- duced by the active peptide) (14, 25). SboB production on agar testing of the three producer strains showed that each was was shown to be inducible by the addition of a crude, SboB- immune to their own (i.e., the homologous) inhibitor. Strains containing preparation (M17-sucrose agar freeze-thaw exudate NR and 1482 were inhibitory to the other two strains and from the SboB producer strain S. salivarius NR), although the appeared to have broader inhibitory activities than strain exact nature of the inducing signal molecule has not yet been C2102. Strains NR and 1482 were both P type 777 (inhibitory defined (data not shown). to all nine standard indicators), whereas strain C2102 was P The SboB locus is flanked by large inverted repeat se- type 636. Further deferred antagonism testing with a set of 25 quences which show similarity to transposase gene sequences S. salivarius strains differentiated strain NR (inhibitory to 14 of that have undergone multiple frameshift mutations. These re- 25 S. salivarius strains) and 1482 (inhibitory to all 25 strains) peat regions are probably small insertion sequences that are no from strain C2102 (not inhibitory to any S. salivarius strains longer active. Small insertion sequences that encode solely a tested). transposase gene are quite common in streptococci (20), as evidenced by the appearance of the ISSmu2-like element be- tween the SalA and SboB loci in a subset of SalA/SboB pro- DISCUSSION ducer strains. In the present study, the probiotic S. salivarius strain K12 Nineteen of 61 BLIS-producing S. salivarius strains were was shown to produce a novel type AII lantibiotic, SboB, in sboA positive, and 31 were salA positive. This shows that there addition to the previously defined lantibiotic salivaricin A2 are still many antimicrobial activities produced by S. salivarius (29). Both were recovered from M17 sucrose agar cultures of that have not yet been characterized. Eighteen of the 19 strains S. salivarius K12. Although some low levels of inhibitory activ- positive for sboA were also positive for salA, indicating that ity attributable to SalA2 appeared to be produced in THB these two lantibiotic loci are commonly linked in S. salivarius. cultures of strain K12, no SboB activity could be detected in Further sequence analysis of S. salivarius strain K12 showed these cultures. Moreover, the production of SboB was also that the SalA and SboB loci are localized to the 190-kb plasmid found to be reduced in agar cultures supplemented with either pSsal-K12 (27), separated by just 7.5 kb. Only two open read- glucose or lactose at 1% (wt/vol) rather than sucrose, indicat- ing frames likely to encode proteins were identified in this ing that the SboB locus is susceptible to catabolite repression. interlocus region (orf1 and orf2) (Fig. 3), the functions of which The molecule responsible for the inhibition of S. constellatus are unknown. Screening the sensitivity of a large number of (I3 in the set of nine standard indicators) was characterized as indicator strains to S. salivarius strains K12 (SalA/SboB pro- a 25-amino-acid, 2,740-Da peptide, the partial N-terminal se- ducer), NR (SboB producer), and 20P3 (SalA producer) re- quence of which matched the predicted posttranslationally vealed that K12 produces at least two further molecules with modified product of sboA. The secondary structure of SboB is BLIS activity and that both of these are also carried by pSsal- proposed to resemble those of lacticin 481 and mutacin II, K12. each of which contains two lanthionine residues and one Variants of salA have been shown to be widely distributed methyl-lanthionine residue (Fig. 2). The amino acid sequence of within the streptococci, being present in more than 90% of S. the active SboA peptide differs from the sequences of the pyogenes strains tested (19). Six salA variants have been iden- VOL. 73, 2007 MEGAPLASMID-BORNE LANTIBIOTICS SALIVARICINS A AND B 1113 tified, five of which were identified in S. salivarius (29). By 6. Dempster, R. P., and J. R. Tagg. 1982. The production of bacteriocin-like contrast, sboB genes are identical in all S. salivarius strains in substances by the oral bacterium Streptococcus salivarius. Arch. Oral Biol. 27:151–157. which they have been identified and one variant in a single 7. Dierksen, K. P., and J. R. Tagg. 2000. The influence of indigenous bacterio- strain of S. mitis has been identified. cin producing Streptococcus salivarius on the acquisition of Streptococcus pyogenes by primary school children in Dunedin, New Zealand, p. 345–348. The spectrum of inhibitory activity of purified SboB was In D. R. Martin and J. R. Tagg (ed.), Streptococci and streptococcal dis- assayed against the set of nine standard indicators. The growth eases: entering the new millennium. Securacopy, Wellington, New Zealand. of all nine indicator strains was strongly inhibited with the 8. Gross, E., and J. L. Morell. 1971. The structure of nisin. J. Am. Chem. Soc. 93:4634–4635. exception of that of I4, which was only weakly inhibited. These 9. Jack, R. W., A. Carne, J. Metzger, S. Stefanovic, H. G. Sahl, G. Jung, and J. results were equivalent to the results obtained with S. salivarius Tagg. 1994. Elucidation of the structure of SA-FF22, a lanthionine-contain- strain NR, which appears to produce only the SboB inhibitor. ing antibacterial peptide produced by Streptococcus pyogenes strain FF22. Eur. J. Biochem. 220:455–462. S. salivarius strain K12 was compared with S. salivarius strains 10. Jack, R. W., J. R. Tagg, and B. Ray. 1995. Bacteriocins of gram-positive NR (SboB producer) and 20P3 (SalA producer) in an attempt bacteria. Microbiol. Rev. 59:171–200. to dissect the inhibitory activities related to the production of 11. Johnson, D. W., J. R. Tagg, and L. W. Wannamaker. 1979. Production of a bacteriocine-like substance by group-A streptococci of M-type 4 and T- SalA and SboB and the additional activity produced by strain pattern 4. J. Med. Microbiol. 12:413–427. K12. Indicators that appear to be specific for SalA are the 12. Karaya, K., T. Shimizu, and A. Taketo. 2001. New gene cluster for lantibiotic streptin possibly involved in streptolysin S formation. J. Biochem. (Tokyo) two strains S. mutans OMZ175 and Streptococcus sobrinus 129:769–775. OMZ176 since these are the only indicators inhibited by only 13. Krull, R. E., P. Chen, J. Novak, M. Kirk, S. Barnes, J. Baker, N. R. Krishna, K12 and 20P3. SboB-specific indicators (i.e., those inhibited by and P. W. Caufield. 2000. Biochemical structural analysis of the lantibiotic mutacin II. J. Biol. Chem. 275:15845–15850. only strains K12 and NR) are more common and include S. 14. Kuipers, O. P., M. M. Beerthuyzen, P. G. de Ruyter, E. J. Luesink, and constellatus (I3) and numerous non-SboB-producing S. saliva- W. M. de Vos. 1995. Autoregulation of nisin biosynthesis in Lactococcus rius strains. Some indicators that were inhibited by only strain lactis by signal transduction. J. Biol. Chem. 270:27299–27304. 15. Piard, J. C., O. P. Kuipers, H. S. Rollema, M. J. Desmazeaud, and W. M. de K12 were also identified (Table 3). Of the two putative extra Vos. 1993. Structure, organization, and expression of the lct gene for lacticin inhibitors that have been identified, one was heat stable and 481, a novel lantibiotic produced by Lactococcus lactis. J. Biol. Chem. 268: active against Enterococcus faecalis ATCC 19433 and Actino- 16361–16368. 16. Ross, K. F., C. W. Ronson, and J. R. Tagg. 1993. Isolation and character- myces naeslundii NCTC 10301 and the second was heat labile ization of the lantibiotic salivaricin A and its structural gene salA from and active against Staphylococcus hominis 2203. Neither of Streptococcus salivarius 20P3. Appl. Environ. Microbiol. 59:2014–2021. 17. Rost, B., and J. Liu. 2003. The PredictProtein server. Nucleic Acids Res. these extra inhibitory activities was produced by the plasmid- 31:3300–3304. cured K12 derivative, indicating they are also located on the 18. Schnell, N., K. D. Entian, U. Schneider, F. Gotz, H. Zahner, R. Kellner, and 190-kb pSsal-K12 and showing that this plasmid may act as a G. Jung. 1988. Prepeptide sequence of epidermin, a ribosomally synthesized antibiotic with four sulphide-rings. Nature 333:276–278. general repository for BLIS-encoding loci. 19. Simpson, W. J., N. L. Ragland, C. W. Ronson, and J. R. Tagg. 1995. A We have found that megaplasmids expressing a plethora of lantibiotic gene family widely distributed in Streptococcus salivarius and different BLIS activities are commonly and characteristically Streptococcus pyogenes. Dev. Biol. Stand. 85:639–643. 20. Smoot, J. C., K. D. Barbian, J. J. Van Gompel, L. M. Smoot, M. S. Chaussee, present in S. salivarius (27). Since the harboring and expression G. L. Sylva, D. E. Sturdevant, S. M. Ricklefs, S. F. Porcella, L. D. Parkins, of complex bacteriocin loci imposes a substantial genetic in- S. B. Beres, D. S. Campbell, T. M. Smith, Q. Zhang, V. Kapur, J. A. Daly, vestment and metabolic burden upon the host bacterium, it L. G. Veasy, and J. M. Musser. 2002. Genome sequence and comparative microarray analysis of serotype M18 group A Streptococcus strains associ- appears to us that the striking propensity of many S. salivarius ated with acute rheumatic fever outbreaks. Proc. Natl. Acad. Sci. USA strains to produce multiple anticompetitor molecules indicates 99:4668–4673. 21. Tagg, J. R., and L. V. Bannister. 1979. “Fingerprinting” beta-haemolytic that these bacteria may have a central population surveillance streptococci by their production of and sensitivity to bacteriocine-like and controlling role within the complex bacterial zoo that is inhibitors. J. Med. Microbiol. 12:397–411. human oral microflora. Future work will aim to characterize 22. Tagg, J. R., and K. P. Dierksen. 2003. Bacterial replacement therapy: adapting ‘germ warfare’ to infection prevention. Trends Biotechnol. 21:217–223. the other inhibitory molecules expressed by pSsal-K12 and by 23. Tagg, J. R., and L. G. Vugler. 1986. An inhibitor typing scheme for Strepto- numerous other plasmid-carrying strains of S. salivarius. coccus uberis. J. Dairy Res. 53:451–456. 24. Tagg, J. R., and H. K. Wong. 1983. Inhibitor production by group-G strep- 16: ACKNOWLEDGMENTS tococci of human and of animal origin. J. Med. Microbiol. 409–415. 25. Upton, M., J. R. Tagg, P. Wescombe, and H. F. Jenkinson. 2001. Intra- and This work was supported by grant UO0605 from the Marsden Fund, interspecies signaling between Streptococcus salivarius and Streptococcus pyo- 183: Royal Society of New Zealand, and also by a research grant from the genes mediated by SalA and SalA1 lantibiotic peptides. J. Bacteriol. 3931–3938. University of Otago. 26. van den Hooven, H. W., F. M. Lagerwerf, W. Heerma, J. Haverkamp, J. C. Piard, C. W. Hilbers, R. J. Siezen, O. P. Kuipers, and H. S. Rollema. 1996. REFERENCES The structure of the lantibiotic lacticin 481 produced by Lactococcus lactis: 1. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, location of the thioether bridges. FEBS Lett. 391:317–322. and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation 27. Wescombe, P. A., J. P. Burton, P. A. Cadieux, N. A. Klesse, O. Hyink, of protein database search programs. Nucleic Acids Res. 25:3389–3402. N. C. K. Heng, C. N. Chilcott, G. Reid, and J. R. Tagg. 2006. Megaplasmids 2. Balakrishnan, M., R. S. Simmonds, M. Kilian, and J. R. Tagg. 2002. Dif- encode differing combinations of lantibiotics in Streptococcus salivarius. ferent bacteriocin activities of Streptococcus mutans reflect distinct phyloge- Antonie Leeuwenhoek 90:269–280. netic lineages. J. Med. Microbiol. 51:941–948. 28. Wescombe, P. A., and J. R. Tagg. 2003. Purification and characterization of 3. Burton, J. P., C. N. Chilcott, C. J. Moore, G. Speiser, and J. R. Tagg. 2006. streptin, a type A1 lantibiotic produced by Streptococcus pyogenes. Appl. A preliminary study of the effect of probiotic Streptococcus salivarius K12 on Environ. Microbiol. 69:2737–2747. oral malodour parameters. J. Appl. Microbiol. 100:754–764. 29. Wescombe, P. A., M. Upton, K. P. Dierksen, N. L. Ragland, S. Sivabalan, 4. Burton, J. P., P. A. Wescombe, C. J. Moore, C. N. Chilcott, and J. R. Tagg. R. E. Wirawan, M. A. Inglis, C. J. Moore, G. V. Walker, C. N. Chilcott, H. F. 2006. Safety assessment of the oral cavity probiotic Streptococcus salivarius Jenkinson, and J. R. Tagg. 2006. Production of the lantibiotic salivaricin A K12. Appl. Environ. Microbiol. 72:3050–3053. and its variants by oral streptococci and use of a specific induction assay to 5. Chatterjee, C., M. Paul, L. Xie, and W. A. van der Donk. 2005. Biosynthesis detect their presence in human saliva. Appl. Environ. Microbiol. 72:1459– and mode of action of lantibiotics. Chem. Rev. 105:633–684. 1466. International Congress Series 1289 (2006) 347–350
www.ics-elsevier.com
Oral streptococcal BLIS: Heterogeneity of the effector molecules and potential role in the prevention of streptococcal infections
J. Tagg a,*, P. Wescombe b, J. Burton b
a Department of Microbiology and Immunology, University of Otago, P.O. Box 56, Dunedin, New Zealand b BLIS Technologies Ltd., Dunedin, New Zealand
Abstract. Streptococci commonly produce bacteriocin-like inhibitory substances (BLIS). Inhibitory molecules characterized to date have included members of bacteriocin classes I, II and III. Streptococcus salivarius, Streptococcus mutans and Streptococcus uberis strains frequently produce multiple bacteriocins of these various classes. Lantibiotics belonging to the streptococcin A-FF22 (SA- FF22) and salivaricin A (SalA) clusters are produced by several oral streptococcal species. Multi- bacteriocin-producing streptococci such as S. salivarius strain K12, which contain a variety of bacteriocin loci located on mega-plasmids, are now finding application as oral probiotics. D 2005 Published by Elsevier B.V.
Keywords: Streptococcus salivarius; Streptococcus pyogenes; Bacteriocins; BLIS; Lantibiotics; Probiotics
1. Introduction Tagg and Bannister [1] devised a bfingerprintingQ procedure to help detect and dif- ferentiate various streptococcal BLIS activities according to their characteristic patterns of inhibitory activity against a set of nine indicator bacteria. The BLIS production (P)-type of a strain is expressed as a 3-digit code that signifies the pattern of activity (inhibition or non- inhibition) of the test strain against these indicators. With the use of this P-typing test, we have found that a high proportion of streptococci produce BLIS activity. Furthermore, many of these inhibitory streptococci, especially of the species Streptococcus salivarius [2,3], Streptococcus mutans [4] and Streptococcus uberis [5], probably produce multiple BLIS.
* Corresponding author. Tel.: +64 3 4797714; fax: +64 3 4798540. E-mail address: [email protected] (J. Tagg).
0531-5131/ D 2005 Published by Elsevier B.V. doi:10.1016/j.ics.2005.11.016 348 J. Tagg et al. / International Congress Series 1289 (2006) 347–350
Both relatively large (N10 kDa) and smaller (b6 kDa) inhibitory peptides have now been characterized from each of these species. The present paper focuses attention on two clusters of relatively small bacteriocins of the lantibiotic class produced by S. salivarius and Streptococcus pyogenes, two species that have adopted the human oral mucosa as their preferred (indeed perhaps exclusive) habitat. The prospects for practical application of BLIS-producing S. salivarius to control proliferation of S. pyogenes are discussed, as are our findings relating to the distribution amongst oral streptococci of the genetic loci encoding the lantibiotics streptococcin A- FF22 (SA-FF22) and salivaricin A (SalA).
2. Results and discussion 2.1. SA-FF22 The first characterized S. pyogenes lantibiotic, streptococcin A-FF22 (SA-FF22), was recovered from the serotype M52 strain FF22 [6]. The determinants for SA-FF22 production could be transferred by transduction to other S. pyogenes, although the recipient strains sometimes failed to maintain this characteristic upon subculture [7,8]. A P-type 436 inhibition pattern is typical of strains producing SA-FF22-like inhibitory activity in the bacteriocin bfingerprintingQ procedure [1]. Upon testing of additional S. pyogenes isolates, P-type 436 activity has appeared to be most prevalent in strains of serotype M49 [9]. Also, P- type 436 Streptococcus dysgalactiae (e.g. strain 67) produce a lantibiotic peptide identical to SA-FF22 and various S. salivarius (the prototype being strain G32) produce SA-FF22 homologues named salivaricin G32 (SalG32) (unpublished). Each producer of SA-FF22- like activity displayed cross-immunity to the inhibitory products of the other members of the SA-FF22 lantibiotic cluster. 2.2. SalA The prototype of the SalA-producing streptococci is the P-type 677 S. salivarius strain 20P3 [3]. The lantibiotic SalA is produced by the coordinated action of an 8-gene cluster encoding structural (A), processing (B, C), transport (T), (putative) immunity (X, Y) and auto-induction (R, K) activities [10]. The anti-bacterial activity of SalA appears to be bacteriostatic, rather than bacteriocidal which is unusual for a lantibiotic [11]. Although it inhibits the in vitro growth of all tested S. pyogenes, the extent of its inhibition of strains of serotype M4 is considerably reduced (see below). Three types of naturally occurring mutations capable of abrogating expression of biologically active SalA have been detected in some strains of S. salivarius: (i) strain MPS has a single-bp mutation in the lantibiotic structural gene (salA) resulting in a truncated SalA propeptide; (ii) strain H16H contains a 16-bp insertion in salA (following bp 24) resulting in a frame-shift mutation in the region encoding the SalA leader peptide; and (iii) a progressive apparent loss of ability to express SalA was detected in a marked (streptomycin-resistant) population of S. salivarius strain Min5 that had been implanted within the oral microbiota of a subject. Further analysis of the SalA-negative derivatives of strain Min5 showed that the loss of expression of SalA was due to the insertion into salA of an insertion sequence having 99.8% sequence identity to IS1139 (Hyink, personal communication). J. Tagg et al. / International Congress Series 1289 (2006) 347–350 349
Interestingly, almost all S. pyogenes contain DNA regions highly homologous to components of the SalA operon and indeed a variant of the SalA structural gene, named salA1, was detected in 63 of 65 S. pyogenes strains of different M types [12]. Functional (inhibitory) SalA1 (i.e., R2K, I7F SalA) however is produced only by serotype M4 strains [11]. Most other S. pyogenes contain deletions within the genes encoding either the SalA1 processing enzymes or transporters. The S. pyogenes strains representative of serotypes M11 and M37 had least evidence for retention of components of the SalA1 locus. Interestingly, the M11 strain is an A-variant S. pyogenes, thought to have lost the ability to assemble intact group A carbohydrate during the course of prolonged laboratory subculture (D. Johnson, personal communication). Clearly S. pyogenes growing as pure cultures will derive no selective advantage from expression of SalA1 immunity and so loss of immunity-related components of the SalA1 locus will be more likely to occur. Also the M37 strain is quite unusual in that no other examples of strains of this serotype appear to have been isolated (D. Johnson, personal communication). Both of these observations are consistent with a survival advantage for S. pyogenes being linked to retention of the immunity-related components of the SalA1 locus. More recently we have found that SalA1 is also produced by several strains of Streptococcus agalactiae and S. dysgalactiae and, moreover, that four novel variants of SalA (named SalA2–SalA5) are expressed by some strains of S. salivarius. All six SalA peptides have been purified and shown to (a) inhibit the growth of SalA-sensitive indicators and (b) induce production of SalA-like peptides in both the homologous and heterologous SalA producer strains. In other studies, we have demonstrated that anti-S. pyogenes inhibitory activity is produced when SalA-positive S. salivarius are grown in saliva in an in vitro test system [unpublished].
2.3. Plasmid-encoded streptococcal bacteriocins Our previous studies demonstrated that some of the large bacteriocins produced by streptococci, including streptococcin A-M57 [13] and dysgalacticin (N.C.K. Heng et al., submitted for publication) are encoded by small (3–3.5 kb) plasmids. By comparison, we have now found in BLIS-producing strains of S. salivarius that various combinations of loci encoding the lantibiotics SalA, salivaricin B, salivaricin G32 and streptin are located on large 40–220 kb plasmids (unpublished). Remarkably, the 220 kDa plasmid in S. salivarius JH encodes at least three lantibiotic loci (SalA, salivaricin G32 and streptin). Low-frequency (ca. 0.1%) plasmid loss has been detected in cultures grown under conditions unfavourable for bacteriocin production. We speculate that the plasmid- integration and expression of bacteriocin loci is a strategy that has been very effectively developed in S. salivarius to enhance the retention of a plasmid-encoded antimicrobial repertoire favouring the survival of the BLIS-producing bacterium in its human host.
2.4. Probiotic applications of BLIS-producing streptococci S. salivarius is a primary and predominant coloniser of oral mucosal surfaces in humans and does not initiate infections in healthy individuals. On the other hand, the presence of large numbers of S. pyogenes in the oral cavity usually correlates with acute pharyngeal infection. The SalA2-producing S. salivarius strain K-12 (BLIS K12 Throat Guard, BLIS 350 J. Tagg et al. / International Congress Series 1289 (2006) 347–350
Technologies, New Zealand) [14] has recently been developed for use as an oral probiotic. However, although S. salivarius colonisation of the oral cavity can readily be effected, direct evidence for the in situ production and detection of SalA in saliva has not been reported. Some indirect evidence for the oral production and activity of SalAwas obtained by showing that the population levels of indigenous a-haemolytic cocci exhibiting resistance to SalA were significantly higher in samples of the oral microbiota from subjects who were naturally colonised with large numbers of SalA-producing S. salivarius [15]. The inference was that sufficient SalA had been produced in the oral cavity to select for a relatively resistant population. We have now used a highly specific SalA autoinduction assay to directly detect the presence of SalA in the saliva of subjects having SalA-producing S. salivarius either as part of their normal flora or following consumption of BLIS K12 Throat Guard. This, to our knowledge, is the first demonstration of in situ production of a lantibiotic at a level that may be capable of influencing either the survival or genetic regulation of another species within the oral cavity. Acknowledgements
The financial support of the Health Research Council of New Zealand, The Marsden Fund (Royal Society of New Zealand) is gratefully acknowledged. References
[1] J.R. Tagg, L.V. Bannister, bFingerprintingQ beta-haemolytic streptococci by their production of and sensitivity to bacteriocine-like inhibitors, J. Med. Microbiol. 12 (1979) 397–411. [2] K.F. Ross, et al., Isolation and characterization of the lantibiotic salivaricin A and its structural gene salA from Streptococcus salivarius 20P3, Appl. Environ. Microbiol. 59 (1993) 2014–2021. [3] R.P. Dempster, J.R. Tagg, The production of bacteriocin-like substances by the oral bacterium Streptococcus salivarius, Arch. Oral Biol. 27 (1982) 151–157. [4] M. Balakrishnan, et al., Different bacteriocin activities of Streptococcus mutans reflect distinct phylogenetic lineages, J. Med. Microbiol. 51 (2002) 941–948. [5] J.R. Tagg, L.G. Vugler, An inhibitor typing scheme for Streptococcus uberis, J. Dairy Res. 53 (1986) 451–456. [6] J.R. Tagg, et al., Bacteriocin of a group A Streptococcus: partial purification and properties, Antimicrob. Agents Chemother. 4 (1973) 214–221. [7] J.R. Tagg, et al., Transduction of bacteriocin determinants in group A streptococci, J. Exp. Med. 143 (1976) 1540–1544. [8] J.R. Tagg, L.W. Wannamaker, Genetic basis of streptococcin A-FF22 production, Antimicrob. Agents Chemother. 10 (1976) 299–306. [9] W.L. Hynes, et al., Duplication of the lantibiotic structural gene in M-type 49 group A Streptococcus strains producing streptococcin A-M49, Appl. Environ. Microbiol. 60 (1994) 4207–4209. [10] M. Upton, et al., Intra- and interspecies signaling between Streptococcus salivarius and Streptococcus pyogenes mediated by SalA and SalA1 lantibiotic peptides, J. Bacteriol. 183 (2001) 3931–3938. [11] D.W. Johnson, et al., Production of a bacteriocine-like substance by group-A streptococci of M-type 4 and T- pattern 4, J. Med. Microbiol. 12 (1979) 413–427. [12] W.J. Simpson, et al., A lantibiotic gene family widely distributed in Streptococcus salivarius and Streptococcus pyogenes, Dev. Biol. Stand. 85 (1995) 639–643. [13] N.C. Heng, et al., Sequence analysis of pDN571, a plasmid encoding novel bacteriocin production in M-type 57 Streptococcus pyogenes, Plasmid 52 (2004) 225–229. [14] http://www.blis.co.nz. [15] G.R. Tompkins, J.R. Tagg, The ecology of bacteriocin-producing strains of Streptococcus salivarius, Microb. Ecol. Health Dis. 2 (1989) 19–28. Antonie van Leeuwenhoek (2006) 90:269–280 DOI 10.1007/s10482-006-9081-y
ORIGINAL PAPER
Megaplasmids encode differing combinations of lantibiotics in Streptococcus salivarius
Philip A. Wescombe Æ Jeremy P. Burton Æ Peter A. Cadieux Æ Nikolai A. Klesse Æ Otto Hyink Æ Nicholas C. K. Heng Æ Chris N. Chilcott Æ Gregor Reid Æ John R. Tagg
Received: 28 February 2006 / Accepted: 27 April 2006 / Published online: 27 July 2006 Springer Science+Business Media B.V. 2006
Abstract Streptococcus salivarius strains com- repositories for bacteriocin loci, especially those monly produce bacteriocins as putative anti- of the lantibiotic class. competitor or signalling molecules. Here we report that bacteriocin production by the oral Keywords Streptococcus salivarius Æ probiotic strain S. salivarius K12 is encoded by a Megaplasmid Æ Bacteriocins Æ Lantibiotics large (ca. 190 kb) plasmid. Oral cavity transmission of the plasmid from strain K12 to a plasmid- negative variant of this bacterium was demon- strated in two subjects. Tests of additional Introduction S. salivarius strains showed large (up to ca. 220 kb) plasmids present in bacteriocin-produc- The development of oral bacteria as probiotics ing isolates. Various combinations (up to 3 per has been relatively overlooked due to the pre- plasmid) of loci encoding the known streptococ- dominant scientific and commercial emphasis on cal lantibiotics salivaricin A, salivaricin B, strep- applications of probiotic strains for use in the tin and SA-FF22 were localised to these plasmids. gastrointestinal tract. Although some intestinal Since all bacteriocin-producing strains of S. sali- strains and genetically engineered Streptococcus varius tested to date appear to harbour plasmids, mutans strains have been evaluated for the pre- it appears that they may function as mobile vention of dental caries, by and large there have been few attempts to apply probiotics to the prevention and treatment of oral infections P. A. Wescombe Æ J. P. Burton (&) Æ (Baker 2005; Burton et al. 2005; Hillman 1980; N. A. Klesse Æ C. N. Chilcott Moore 2004; Tanzer et al. 1985). In addition to BLIS Technologies Ltd., Centre for Innovation, University of Otago, PO Box 56, Dunedin 9001, dental caries, other oral targets include peri- New Zealand odontal diseases, streptococcal pharyngitis and e-mail: [email protected] halitosis (Tagg and Dierksen 2003). An advantage of targeting the oral cavity compared to the O. Hyink Æ N. C. K. Heng Æ J. R. Tagg Æ J. P. Burton Department of Microbiology and Immunology, intestinal tract is that relatively high concentra- University of Otago, Dunedin, New Zealand tions of viable microorganisms can be directly delivered to the oral cavity. In addition, samples P. A. Cadieux Æ G. Reid of the oral microbiota can readily be obtained to Department of Microbiology and Immunology, University of Western Ontario, London, ON, Canada determine colonisation and efficacy.
123 270 Antonie van Leeuwenhoek (2006) 90:269–280
Proteinaceous antibiotics (called bacteriocins) bacteriocin activity. Previous studies have shown produced by probiotic microorganisms may pro- that in S. pyogenes the salivaricin A locus is chro- vide new therapeutic and prophylactic options for mosomally located (Ferretti et al. 2001; Upton the management of oral cavity infections. High et al. 2001). However, we now report that both the proportions of oral streptococcal populations, salivaricin A and salivaricin B biosynthetic loci in including both pathogenic and commensal species, S. salivarius strain K12 are borne on a very large have been shown to produce bacteriocins or bac- plasmid which can be transmitted to other S. sali- teriocin-like inhibitory substances (BLIS), the varius strains co-habiting the human oral cavity. ecological significance of which has yet to be fully We also show that the genetic loci specifying pro- established (Deng et al. 2004; Heng et al. 2004; duction of several other known streptococcal Hyink et al. 2005; Kamiya et al. 2005; Kreth et al. bacteriocins belonging to the lantibiotic class are 2005; Upton et al. 2001; Walls et al. 2003). Nev- located on megaplasmids in S. salivarius. ertheless, it is known that bacteriocins tend to predominantly act against bacteria of relatively closely related species and they are presumed Materials and methods likely to confer a competitive growth advantage to the producing bacterium in complex multi-bacte- Bacterial strains and culture conditions rial ecosystems. As such, bacteriocinogenicity is potentially a favourable attribute for probiotic The principal test strains were S. salivarius K12 strains. Unfortunately, the producer of nisin (the and K12P– (plasmid negative), (BLIS Technolo- best characterised and most widely applied bac- gies Ltd, Dunedin, NZ). Strain K12 is known to teriocin) is Lactococcus lactis, a species that does produce the lantibiotics salivaricin A (Upton not significantly colonise the oral cavity. et al. 2001) and salivaricin B (Tagg and Dierksen Streptococcus salivarius appears to have an 2003). Strain K12P– is negative for the structural important role in maintaining oral health and is genes of both salivaricin A and B (as determined one of the numerically prominent species in the by Southern hybridisation and PCR). Strain mouth and oropharynx of humans. Many S. sali- K12P–StrR/SpecR is a variant of strain K12P– which varius produce strong BLIS activity against was first selected for spontaneous resistance to Streptococcus pyogenes (Dempster and Tagg 100 lgml–1 streptomycin and then also resistance 1982; Tagg and Dierksen 2003; Upton et al. 2001), to 100 lgml–1 spectinomycin. The double resis- a common cause of childhood throat infections tances of strain K12P–StrR/SpecR are not thought to that occasionally progress to more serious be genetically linked. The details of the other sequelae such as rheumatic fever. In a study of strains tested are listed in Table 2. The strains 780 school children, those that had large native used as indicators (I1–I9) to detect bacteriocin populations of certain BLIS-producing S. saliva- activity in deferred antagonism testing (Tagg rius appeared less likely to acquire S. pyogenes and Bannister 1979) were Micrococcus luteus (Dierksen and Tagg 2000). S. salivarius strain K12 (I1), S. pyogenes M-type 52 (I2), Streptococcus (BLIS Technologies Ltd. NZ) has been devel- constellatus (I3), Streptococcus uberis (I4), S. oped in New Zealand as a probiotic preparation pyogenes M-type 4 (I5), Lactococcus lactis ssp. to maintain oral health. lactis, (I6), S. pyogenes M-type 28 (I7), S. pyogenes The observation that prompted the present M-type 87 (I8) and Streptococcus dysgalactiae (I9). study was that a small proportion (ca. 0.1%) of All cultures were grown on BACa (Columbia agar colonies grown from samples of commercially base with 5% v/v human blood and 0.1% CaCO3) prepared lyophilised S. salivarius K12 cells ap- with incubation for 24 h at 37 Cin5%CO2 in air. peared to have simultaneously lost the ability to produce two lantibiotics, salivaricin A (Ross et al. Testing of inhibitory spectra 1993; Upton et al. 2001) and salivaricin B (Tagg and Dierksen 2003). Further studies were under- The inhibitory spectra of the test strains were taken to determine the genetic basis for this loss of established by use of deferred antagonism,
123 Antonie van Leeuwenhoek (2006) 90:269–280 271 essentially as described previously (Tagg and shots (Nitrogen laser—337 nm and 220 intensity Bannister 1979). In brief, a 1-cm wide diametric units) at various regions of the chip surface using streak culture of the test strain was inoculated a Protein Biology System II instrument (Cipher- onto BACa. Following incubation, the macro- gen Biosystems). Molecular weight peaks having scopic bacterial growth was removed with a glass intensities with signal-to-noise ratios of >3 were slide and residual cells on the agar surface were designated ‘‘true’’ protein peaks. killed by exposure to chloroform vapours for 30 min. The agar surface was then aired for Pulsed-field gel electrophoresis (PFGE) 30 min. Todd Hewitt broth (THB, Difco) cultures (18 h, 37 C) of the bacteriocin indicator strains PFGE was used to detect the presence of plasmid were inoculated at right angles across the line of DNA molecules and to determine if bacteriocin- the original streak culture using swabs. After deficient derivatives had extensive deletions in incubation for 24 h at 37 Cin5%CO2 in air, the their chromosomal DNA. In brief, genomic DNA extent of inhibition of each indicator strain was was prepared in agarose plugs. Strains of interest recorded by photography. were grown in THB, with or without glycine (up to 1% w/v) depending on the difficulty of effect- Surface-enhanced laser desorption/ ing cell lysis. The cultures were incubated until ionisation-time of flight-mass spectrometry they reached an absorbance at 650 nm of 0.5. The (SELDI-TOF-MS) cells were then washed and embedded in low- melting-point agarose in plug molds prior to To determine possible protein differences at their inducing cell lysis with lysozyme (40 mg ml–1) cell surfaces, K12 and K12P– cultures were sub- and proteinase K (1 mg ml–1). Restriction frag- jected to SELDI-TOF-MS analysis. Stocks of K12 ments obtained by digestion with either I-CeuIor and K12P– cells were grown for 24 h in brain SmaI were separated using a CHEF-DR III heart infusion (BHI, BBL, Becton and Dickinson, Pulsed Field Electrophoresis System (Bio-Rad
Cockeysville, MD) at 37 Cin5%CO2 in air. Laboratories, Hercules, CA) over 20–23 h in a Subcultures were then inoculated onto freshly 1% agarose TBE gel (Pulsed Field Certified prepared BHI agar (BBL) supplemented with Agarose, Bio-Rad Laboratories). A PFGE 0.5% yeast extract, 1 ml vitamin-K heme solution molecular weight standard (low range PFG mar- (0.5 lgml–1 hemin and 0.05 lgml–1 menadione) ker, NEB) was typically included in an outlying and 0.1 % Tween 80 (Sigma Chem.Co, St Louis, lane. An initial pulse time of 6 s and a final pulse MO) and incubated as previously. A calibrated time of 18 s were used. The included angle 1-ll disposable plastic inoculation loop was used (change in orientation of the field) was 120 , and to transfer cells from the surface of the agar plate the gel was run at 4.5 V cm–1 with the buffer to an Eppendorf tube containing 200 ll of HPLC- maintained at 14 C. Gels were stained with ethi- grade water. The cells were suspended by vor- dium bromide (5 lgml–1) and examined by UV texing and washed once by centrifugation transillumination. (5000 · g, 5 min) before resuspending in 200 llof HPLC-grade water. The uniform optical density Extraction of bacterial DNA for use as PCR of cell suspensions was determined by plate template reader at A600. Two microlitres of cell suspensions were applied onto a gold-plated chip (8 spot, Streptococcal DNA for use as a PCR template Ciphergen Biosystems, Inc., Palo Alto, CA) fol- was isolated by the method of Beall et al. (1996). lowed by two microlitres of a saturated solution Briefly, the streptococci were grown on BACa of alpha-cyano-4-hydroxycinnamic acid (CHCA, under usual incubation conditions. One loopful of Sigma) in 50% acetonitrile, 0.5% trifluoroacetic bacterial cells was suspended in 300 ll of 0.8% acid. The samples were mixed and allowed to air NaCl and heated for 30 min at 60 C. The cells dry at room temperature for 15 min. Mass iden- were pelleted by centrifugation (8000 · g, 5 min) tification was performed by averaging 35 laser and resuspended for 30 min at 37 Cin100llof
123 272 Antonie van Leeuwenhoek (2006) 90:269–280
TE buffer (10 mM Tris, 1 mM EDTA [pH 8]) oral cavities of subjects with a mixture of strains containing 300 U of mutanolysin (Sigma) and K12 and K12P–StrR/SpecR and then monitoring 30 lgml–1 of hyaluronidase (Sigma). These saliva samples for the presence of bacteriocin- preparations were then heated at 100 C for producing, streptomycin and spectinomycin 10 min and briefly centrifuged to pellet cellular resistant S. salivarius. To determine the natural debris. One microlitre of the supernatant was levels of S. salivarius resistant to streptomycin used as template per 50 ll PCR reaction. and spectinomycin in each subjects saliva, sam- ples were obtained just prior to commencing Southern hybridisation following PFGE treatment. Following this sampling the subjects first undertook a 30 s chemical oral cleansing DNA fragments were transferred to Hybond-N+ treatment with activated chlorine dioxide nylon membranes (Amersham Biosciences) using mouthwash (Therabreath, Los Angeles, CA) to a VACUGENE 2016 vacuum blotting apparatus reduce the population of indigenous S. salivarius, (Pharmacia LKB Biotechnology Ltd, Uppsala, followed 5 min later by a 10 ml mouthwash con- Sweden) and fixed to the membrane by exposure taining equivalent amounts (approximately to 0.4 M NaOH for 20 min. PCR products rep- 1 · 109 colony forming units of each) of freeze- resenting known bacteriocin structural genes dried S. salivarius K12 and S. salivarius from S. salivarius and other species (Karaya et al. K12P–StrR/SpecR. Mouth-rinsing with a mixture of 2001; McLaughlin et al. 1999; Ross et al. 1993; strains K12 and K12P–StrR/SpecR was repeated 2 h Tagg and Dierksen 2003; Wescombe and Tagg later and again on the morning of day 2. Saliva 2003) were radio-labelled using the Ready-To- samples were collected on days 3 and 6 post col- GoTM DNA Labelled Beads (dCTP) kit (Amer- onisation, serially diluted 10-fold in sterile phos- sham Biosciences Ltd, UK). Hybridisation with phate-buffered saline (PBS, pH 7.5) and 50 ll each of the probes was at 65 C for 18 h. Strin- aliquots of the 10–3 and 10–1 dilutions were spiral gency washes were 2 · 5 min in 2 · SSC + 0.1% plated onto Mitis-salivarius agar (MSA) con- SDS at room temperature followed by two 15-min taining streptomycin (100 lgml–1, Sigma) for washes in 0.1 · SSC + 0.1% SDS at 65 C. Probe enumeration of S. salivarius K12P–StrR/SpecR. hybridisation was detected by autoradiography. Incubation was in a 5% CO2 in air atmosphere for 24 h at 37 C. PCR to detect previously characterised For detection of bacteriocin-producing S. sali- bacteriocin structural genes varius, BACa medium was inoculated evenly by swabbing with an 18 h M. luteus Todd Hewitt The PCR primers are listed in Table 1. The PCR broth (Difco) culture. This bacterium is known to reaction mix per tube was 41.5 ll PCR quality be sensitive to a wide variety of streptococcal water (Eppendorf, Germany), 5 llof10· Buffer bacteriocins including both salivaricin A and sal- (Hotmaster, Eppendorf), 1 ll nucleotide mix ivaricin B (Ross et al. 1993). For each of the (Roche), 1 ll each of the appropriate forward subjects, up to 80 S. salivarius colonies (recogni- and reverse primers (1 lgml–1) and 0.5 ll Taq sable because they form especially large levan- (Hotmaster 5 U ll–1). Typical PCR parameters containing colonies on this medium) were picked consisted of 30 cycles of denaturation at 95 C for from MSA cultures and then stabbed into the 30 s, annealing at 55 C (or as indicated in freshly inoculated M. luteus lawn culture on
Table 1) for 30 s, and extension at 65 C for 30 s. BACa. Following incubation in a 5% CO2 in air atmosphere for 24 h at 37 C the bacteriocin-po- In vivo plasmid transfer sitive stab cultures (surrounded by a zone of inhibition) were counted and expressed as a per- Seven adult subjects were used in the study to centage of the total colonies tested. In order to determine whether the S. salivarius K12 plasmid establish the relatedness to strain K12P– of the can be transferred in vivo to a plasmid-negative bacteriocin-positive isolates were further tested K12 derivative. The study involved colonising the by (a) plating on MSA containing spectinomycin
123 Antonie van Leeuwenhoek (2006) 90:269–280 273
Table 1 Primers used to Lantibiotic Primer Primer sequence Annealing amplify lantibiotic name temperature structural genes for use as ( C) probes in Southern hybridisations Salivaricin A salAUS GTAGAAAATATTTACTACATACT 55 salADS GTTAAAGTATTCGTAAAACTGATG 55 Salivaricin B salBF GTGAATTCTCTTCAAGAATTGACTCTT 40 salBR AAAATATTCATACCGCTCTTCC 40 Streptin srtUS CTTTTTTTCTGAACARATTCTGAACT 55 srtDS TAAAGGAGCAAACTAAAAWCAGTCTACT 55 SA-FF22 G32F GTAGTTATCGAATCAATTAAAGAAG 55 G32R GCAACATGTAGCAAGAAATGCC 55
(100 lgml–1) (b) enterobacterial repetitive int- ously characterised lantibiotics salivaricin A ergenic consensus sequence (ERIC)-typing using (Ross et al. 1993) and salivaricin B (Tagg and a previously described methodology (Alam et al. Dierksen 2003) are evident only for strain K12. 1999) to establish whether their profile matched Several other major peaks within the 2–4 kDa that of strain K12P– and (c) PFGE to detect the molecular weight range were also only detected in presence of plasmid DNA. strain K12. By contrast, the profiles of strains K12 and K12P– were closely similar in the range of 4– 7 kDa (Fig. 2). Results Lantibiotic loci are megaplasmid borne in Plasmid loss and phenotypic changes S. salivarius
Deferred antagonism testing clearly demon- DNA from K12 and K12P– was subjected to strated the relative absence of inhibitory activity PFGE, either undigested, or following treatment associated with S. salivarius strain K12P– when with SmaIorI-CeuI (Fig. 3A). Plasmid in DNA compared to strain K12 (Fig. 1). The SELDI- samples that had not been endonuclease-treated TOF-MS spectra within the range of 2–7 kDa for could not always be clearly visualised, possibly the surface proteins of strains K12 and K12P– are due to it being present in a non-mobile large shown in Fig. 2. Peaks of intensity at the molec- circular DNA form. SmaI-digested DNA showed ular weights corresponding to those of the previ- an additional fragment associated only with strain
AB
I1 I2 I3 I4 I5 I6 I7 I8 I9
Fig. 1 Deferred antagonism test of S. salivarius strains K12 (A) and K12P– (B) against nine standard indicator strains (refer to methods)
123 274 Antonie van Leeuwenhoek (2006) 90:269–280
Fig. 2 SELDI-TOF-MS 25 profile of whole cells of S. A 20 salivarius strains K12P– (A) and K12 (B) applied 15 directly with CHCA 10 2070.5 2052.7 matrix to a gold-plated 5 2149.9 chip. Molecular weight 0 range of 2,000–7,000 Da Peak intensity 25 shown. Masses Salivaricin A Salivaricin B corresponding to known 20 2425.3 2284.9 lantibiotics are labelled B 15 2267.8 2409.8 2441.0 10 2362.4 2739.9 2071.8 5 2059.4 0 2000 2250 2500 2750 3000 Mass/ charge ratio (M/z)
10 A 7.5
5
3064.9 3287.9 2.5 3033.5 3143.3 3342.6 3489.5 3964.5 0 Peak intensity 10
7.5 3290.5 B 3493.8 5 3390.4 3969.8 3071.0 3347.3 3037.4 2.5 3146.8 0 3000 3250 3500 3750 4000 Mass/ charge ratio (M/z)
10
A 7.5
4360.1 5 4400.9 6576.1 4436.9 2.5 4118.5 5344.6 6291.5 6983.7 5403.9 5948.7 6684.1 4663.0 6132.8 0
10 6582.8 Peak intensity 7.5 4364.9 6990.4 B 4404.6 5 4130.8 4440.3
5349.6 6296.4 2.5 5954.6 6140.0 6692.5 4635.4 5002.7 5409.1 0 4000 5000 6000 7000 Mass/ charge ratio (M/z)
K12. The I-CeuI restriction profile, which only present in the structural genes of the lantibiotics has recognition sequences for its endonuclease salivaricin A (Fig. 4B) and salivaricin B (Fig. 3B) activity within chromosomal rRNA gene se- were tested against blots of the pulsed field gels. quences (Liu et al. 1993), appeared to be identical Both probes (salivaricin B is shown in Fig. 3B) for both strains. Specific probes to sequences hybridised only to DNA from strain K12. The
123 Antonie van Leeuwenhoek (2006) 90:269–280 275
Fig. 3 (A) Pulsed field A 12 34 567 8 B 12 34 567 8 gel electrophoresis of total DNA from S. salivarius strains K12 (lanes 2, 4, 6) and K12P– (lanes 3, 5, 7). Lanes 1 and 8, low range molecular weight marker, lanes 2–3, undigested DNA, lanes 4– 5, SmaI digested, lanes 6- 7, I-CeuI digested. (B) 194 kb Autoradiograph of PFGE gel in (A), probed with 145 kb radio-labelled structural gene of salivaricin B 97 kb
AB1 2 3 4 5 6 7 8 9 10 1 2 3 4 5 6 7 8 9 10
Fig. 4 (A) Pulsed field gel electrophoresis of total DNA molecular weight marker. (B) Autoradiograph of PFGE from S. salivarius strains (lanes 2–9), K12 (undigested), gel in (A), probed with radio-labelled structural gene of K12 (SmaI digested), 9 (undigested), 9 (SmaI digested), salivaricin A. Estimated size of megaplasmids are as JH (undigested), JH (SmaI digested), 193 (undigested) and follows; K12, 190 kb; JH 220 kb; 9, 160 kb; 193, 160 kb 193 (SmaI digested). Lanes 1 and 10 contains low range hybridisation also occurred at the same relative determinants for these lantibiotics were analysed migration position in each lane containing strain for their plasmid content using PFGE: (a) strain K12 DNA, irrespective of whether the DNA was K12 (positive for salivaricin A and salivaricin B), uncut or had been digested with endonucleases. (b) strain JH (salivaricin A3, SA-FF22 and This observation indicates that the fragment streptin), (c) S. salivarius having uncharacterised hybridising to the lantibiotic structural gene BLIS activity, (d) BLIS-negative S. salivarius and probes represents extra chromosomal or plasmid (e) BLIS-positive strains of various other strep- DNA. It should be noted that a proportion of the tococcal species (Table 2). Strains thought to be megaplasmid DNA failed to migrate out of the plasmid-positive by PFGE were further charac- wells of the gel and a small amount of non-specific terised by PCR or Southern hybridisation for hybridisation occurred with K12 chromosomal known streptococcal lantibiotic structural genes. DNA embedded in the agarose plug. Southern hybridisation of the pulsed-field gels Four different lantibiotics have been found to determined that the structural genes of SA-FF22, be produced by S. salivarius strains. The following streptin (results not shown) and salivaricin A3 strains, including some known to have the genetic (Fig. 4B) were megaplasmid (ca220 kb)-associ-
123 276 Antonie van Leeuwenhoek (2006) 90:269–280
Table 2 BLIS activity and plasmid content of representative streptococci Species Strain BLISa Lantibiotic locus Plasmid (approx kb)
S. salivarius K12 Y A2b,B 190c S. salivarius ATCC 25975 Y – 120 S. salivarius P Y A, B 190 S. salivarius G39 Y A 190 S. salivarius Mia Y A2 180 S. salivarius 9 Y A4 160 S. salivarius T18A Y A2, B 190 S. salivarius JH Y A3, F, S 220 S. salivarius NR Y B 180 S. salivarius 193 Y – 160 S. salivarius CHR Y A 150 S. salivarius DC Y – 160 S. salivarius SS3 Y – 160 S. salivarius JF Y – 240 S. salivarius K12P– N – ND S. salivarius NCTC 8606 N – ND S. salivarius AM N – ND S. salivarius CDA N – ND S. salivarius PAM N – 150 S. salivarius CN3928 N – ND S. salivarius PRB N – ND S. salivarius SPED2 N – ND S. salivarius DBD N – ND S. salivarius JC N – ND S. salivarius CH N – ND S. salivarius HB-7 N – ND S. salivarius HHT N – ND S. salivarius CN3410 N – ND S. agalactiae 121 Y A1 ND S. dysgalactiae 4003 Y A1 ND S. mitis SK648 Y B ND S. mutans H7 Y – ND S. mutans H1 Y – ND S. pyogenes 148 Y A1 ND S. pyogenes FF22 Y F, A1 ND S. pyogenes A1013 Y S, A1 ND S. uberis 42 Y – ND
A = salA; B = salB; S = streptin; F = SA-FF22; ND = not detected aAs determined by deferred antagonism using standard indicators bSalivaricin variants refer to Wescombe et al. (2006) cAdditionally sized by PFGE using the restriction enzymes FspI and StuI ated in strain JH (ca. 220 kb in size). Another to 80 of the S. salivarius colonies obtained from example of PFGE is shown in Fig. 5 and the data each specimen were tested for their bacteriocin- from all strains is summarised in Table 2. producing ability against an indicator strain sensitive to salivaricins A and B (strain I1). No BLIS-produc- Transmissibility of megaplasmid in vivo ing antibiotic-resistant S. salivarius were detected in the pre-sample or at days 1 and 2. At day 3, Before treatment and on days 1, 2, 3 and 6 fol- 20% of the doubly antibiotic-resistant S. salivari- lowing the oral dosing of seven subjects with a us isolates from subject 1 were inhibitor positive mixture of S. salivarius strains K12 and and 100% of the tested colonies from the day 6 K12P–StrR/SpecR, saliva samples were obtained sample were positive (Table 3). Subject 2 did not and plated on antibiotic-supplemented MSA. Up have any inhibitory S. salivarius detected at day 3,
123 Antonie van Leeuwenhoek (2006) 90:269–280 277
12345678910 but by day 6 all of the antibiotic-resistant S. sali- varius colonies tested were inhibitor-positive. None of the saliva specimens from the 5 other subjects yielded any streptomycin-resistant S. salivarius colonies, indicating that the plasmid- deficient strain had failed to establish at detect- 194 kb able levels within their oral microbiota. All of the streptomycin-resistant, inhibitor-positive S. sali- 145 kb varius isolates from subjects 1 and 2 also grew 97 kb when sub-cultured on spectinomycin-containing medium (100 lgml–1) establishing that they had the same antibiotic resistance phenotype as the Fig. 5 Examples of total DNA examined using PFGE of original plasmid-deficient K12 strain. Represen- K antigen-characterised reference S. salivarius strains tative streptomycin-spectinomycin resistant, bac- obtained from P. Handley (Handley et al. 1984). Lanes teriocin-producing isolates had ERIC profiles 1–9 contain undigested DNA from strains PAM, CDA, PRB, SPED2, HHT, SS3, JC, HB-7 and NCTC 8606, identical to that of strain K12 (Fig. 6). PFGE of respectively. Lane 10 contains low range molecular weight DNA extracts from representative streptomycin– marker. Arrows indicate bands thought to represent extra- spectinomycin-resistant inhibitor-positive isolates chromosomal DNA. Estimated size of megaplasmids are showed that all were the same profile to that of as follows; PAM, 150 kb; SS3 160 kb K12 and contained plasmid bands of size ca. 190 kb, identical in size to that present in strain K12 (Fig. 7). Testing of these isolates Table 3 Colonisation of subjects with S. salivarius against a battery of standard indicators demon- Subject Percentage of BLIS-producing S. salivarius strated that they had an identical antibacterial R R (Spec /Str ) from saliva spectrum of activity to that of S. salivarius K12. Day0123 6
1 0 0 0 20 100 Discussion 2 0 0 0 0 100 300000 400000The loss of a ca. 190 kb plasmid from S. salivarius 500000strain K12 was found to result in the elimination 600000of deferred antagonism inhibitory activity against 700000 all of nine tested standard indicator strains. Our
Fig. 6 ERIC-typing Subject 1 Day 3 Subject 1 Day 6 Subject 2 Day 6 K12 examples of streptomycin– spectinomycin resistant BLIS-producing S. salivarius isolated from subjects 1 and 2 during the in vivo plasmid transfer study. 3054 bp 2036 bp 1636 bp 1018 bp 517 bp
123 278 Antonie van Leeuwenhoek (2006) 90:269–280
1234 567 8 staphylococci (Aso et al. 2005). A remarkable feature of the S. salivarius plasmids is that some appear to encode several different lantibiotics. For example, three lantibiotic loci were localised to the 220 kb plasmid of S. salivarius strain JH. Our detection of four different plasmid-borne lantibiotics in tests of a relatively small set of S. 194 kb salivarius strains indicates that this species may 145 kb function as a repository for the accumulation and/ or dissemination of bacteriocin loci within the 97 kb oral microbiota. On the other hand, strain 193 had a large plasmid and bacteriocin activity, but 48.5 kb probes to known lantibiotics did not hybridise to 23.1 kb the plasmid DNA indicating the presence of un- characterised bacteriocins either on the plasmid Fig. 7 Single examples of PFGE analysis of streptomycin– or chromosome. Interestingly, S. salivarius strain spectinomycin resistant BLIS-producing S. salivarius iso- PAM did not appear to have inhibitory activity lated from subjects 1 and 2 during the in vivo plasmid against any of the nine standard indicator bacte- transfer study. Lane 1 low range molecular weight marker; lanes 2–3, example from subject 1 (day 3) SmaI digested ria, even though it does harbour a large plasmid. and undigested; lanes 4–5 subject 1 (day 6) SmaI digested Further studies are being undertaken to deter- and undigested; lanes 6–7 subject 2 (day 6) SmaI digested mine whether this strain produces inhibitory Sma and undigested; lane 8 strain K12 ( I digested). Arrows activity against other bacterial species. indicate bands thought to represent extra-chromosomal DNA The frequency of spontaneous loss of the S. salivarius K12 plasmid was found to be rela- tively high (~0.1%) when the strain was grown previous studies have shown that strain K12 under conditions unfavourable for bacteriocin produces at least two lantibiotics, salivaricin A production, such as those used during commercial and salivaricin B (Tagg and Dierksen 2003; Upton production, where little or no bacteriocin activity et al. 2001). Comparison of the SELDI-TOF is detectable in the culture supernatant (C. Chil- profiles of the proteins ionised from the surface of cott, personal communication). The expression of strain K12 and its plasmid-deficient derivative plasmid-encoded bacteriocins is potentially an K12P– indicated that the loss of inhibitory activity effective mechanism of plasmid retention, since was at least in part due to the loss of production progeny cells devoid of plasmid (and thus not of these two lantibiotics. Interestingly, compari- capable of expressing specific bacteriocin immu- son of the peptide profiles over the 2–3 kDa range nity) would be eliminated in a bacteriocin-con- indicated there were several other peaks associ- taining environment. In the present study the ated with strain K12, but not with the plasmid- strain K12 plasmid was shown to be transmissible deficient derivative K12P–. These peaks may in vivo to a double antibiotic-marked derivative represent additional, as yet uncharacterised plas- of strain K12P–. The double-marked antibiotic mid-encoded bacteriocins, bacteriocin-like pep- K12P– derivative was used to reduce the risk of tides or peptide pheromones involved in the acquiring spontaneous S. salivarius antibiotic- exchange of plasmid. resistant mutants under conditions of no antibi- Our screening of several additional S. salivari- otic selection. Whether the plasmid is capable of us strains showed that large plasmids (up to transferring with similar efficiency to indigenous 220 kb) were present in all strains producing S. salivarius has not yet been investigated. Follow bacteriocin-like inhibitory activity. Plasmids have up studies are being undertaken to determine been reported for bacteriocin-producing dairy the host range of the S. salivarius plasmids and lactococci (Morgan et al. 1995; Piard et al. 1993), whether they are transmissible to other species of enterococci (Sanchez-Hidalgo et al. 2003) and oral streptococci.
123 Antonie van Leeuwenhoek (2006) 90:269–280 279
Examination of several bacteriocin-producing Aso Y, Koga H, Sashihara T, Nagao J, Kanemasa Y, strains of S. pyogenes, S. agalactiae, S. mutans and Nakayama J, Sonomoto K (2005) Description of complete DNA sequence of two plasmids from the S. uberis failed to detect the presence of any nukacin ISK-1 producer, Staphylococcus warneri ISK- plasmids. In S. pyogenes the loci encoding the 1. Plasmid 53:164–178 lantibiotics salivaricin A (Upton et al. 2001), Bachrach G, Leizerovici-Zigmond M, Zlotkin A, Naor R, streptin (Wescombe and Tagg 2003) and SA- Steinberg D (2003) Bacteriophage isolation from hu- man saliva. Lett Appl Microbiol 36:50–53 FF22 (McLaughlin et al. 1999) are chromosom- Baker M (2005) Better living through microbes. Nat Bio- ally located. Horizontal gene transfer, much of it technol 23:645–647 attributed to the action of transducing bacterio- Beall B, Facklam R, Thompson T (1996) Sequencing phage, is considered responsible for the highly emm-specific PCR products for routine and accurate typing of group A streptococci. J Clin Microbiol mosaic nature of the composition of those strep- 34:953–958 tococcal genomes such as S. thermophilus analy- Bolotin A, Quinquis B, Renault P et al (2004) Complete sed to date (Bolotin et al. 2004). However, no sequence and comparative genome analysis of the phage have yet been described for S. salivarius dairy bacterium Streptococcus thermophilus. Nat Biotechnol 22:1554–1558 (Bachrach et al. 2003). All of the bacteriocin- Buckley ND, Vadeboncoeur C, LeBlanc DJ, Lee LN, producing S. salivarius tested in this study were Frenette M (1999) An effective strategy, applicable to found to contain large plasmids and there was no Streptococcus salivarius and related bacteria, to en- evidence of integration of bacteriocin determi- hance or confer electroporation competence. Appl Environ Microbiol 65:3800–3804 nants in the host chromosome in these strains. Burton J, Chilcott C, Tagg J (2005) The rationale and po- Since S. salivarius is not known to be naturally tential for the reduction of oral malodour using Strep- competent for transformation (Buckley et al. tococcus salivarius probiotics. Oral Dis 11:29–31 1999) it appears that plasmid-mediated conjuga- Dempster RP, Tagg JR (1982) The production of bacte- riocin-like substances by the oral bacterium Strepto- tion may be a predominant means of gene trans- coccus salivarius. Arch Oral Biol 27:151–157 fer for this species within the oral ecosystem. Deng H, Ding Y, Fu MD, Xiao XR, Liu J, Zhou T (2004) It is intriguing that these plasmids appear to Purification and characterization of sanguicin—a have a particular propensity to acquire (and bacteriocin produced by Streptococcus sanguis. Sich- uan Da Xue Xue Bao Yi Xue Ban 35:555–558 potentially to distribute) bacteriocin loci (espe- Dierksen KP, Tagg J (2000) Distribution of bacteriocin- cially lantibiotics). Their production of (some- producing Streptococcus salivarius within primary times) multiple bacteriocins may help account for school populations in Dunedin, New Zealand and the numerical prominence of this species in the oral their influence on acquisition or carriage of Strepto- coccus pyogenes. In: Martin DR, Tagg J (eds) Strep- cavity and may indicate a major role for S. saliva- tococci and streptococcal diseases entering the new rius in the maintenance of a balanced oral ecosys- millennium. Securacopy, Auckland, pp 81–85 tem. To the best of our knowledge this is the first Ferretti JJ, McShan WM, Ajdic D et al (2001) Complete report of very large plasmids in the species S. sali- genome sequence of an M1 strain of Streptococcus pyogenes. Proc Natl Acad Sci USA 98:4658–4663 varius.InS. salivarius we have demonstrated (a) Handley PS, Carter PL, Fielding J (1984) Streptococcus that these megaplasmids appear to function as salivarius strains carry either fibrils or fimbriae on the repositories for multiple bacteriocin loci and (b) cell surface. J Bacteriol 157:64–72 that as many as three lantibiotic loci can be present Heng NCK, Burtenshaw GA, Jack RW, Tagg JR (2004) Sequence analysis of pDN571, a plasmid encoding on a single plasmid. novel bacteriocin production in M-type 57 Strepto- coccus pyogenes. Plasmid 52:225–229 Acknowledgements We thank Dr Stefanie Keis and Hillman JD (1980) Replacement therapy for the control of Dr John Sullivan, Department of Microbiology and dental caries. New Dent 10:24–27 Immunology, University of Otago for their assistance. Hyink O, Balakrishnan M, Tagg JR (2005) Streptococcus rattus strain BHT produces both a class I two-com- ponent lantibiotic and a class II bacteriocin. FEMS Microbiol Lett 252:235–241 References Kamiya RU, Napimoga MH, Hofling JF, Goncalves RB (2005) Frequency of four different mutacin genes in Alam S, Brailsford SR, Whiley RA, Beighton D (1999) Streptococcus mutans genotypes isolated from caries- PCR-based methods for genotyping viridans group free and caries-active individuals. J Med Microbiol streptococci. J Clin Microbiol 37:2772–2776 54:599–604
123 280 Antonie van Leeuwenhoek (2006) 90:269–280
Karaya K, Shimizu T, Taketo A (2001) New gene cluster Tagg JR, Bannister LV (1979) ‘‘Fingerprinting’’ beta- for lantibiotic streptin possibly involved in streptoly- haemolytic streptococci by their production of and sin S formation. J Biochem (Tokyo) 129:769–775 sensitivity to bacteriocine-like inhibitors. J Med Kreth J, Merritt J, Shi W, Qi F (2005) Co-ordinated bac- Microbiol 12:397–411 teriocin production and competence development: a Tagg JR, Dierksen KP (2003) Bacterial replacement possible mechanism for taking up DNA from neigh- therapy: adapting ‘germ warfare’ to infection pre- bouring species. Mol Microbiol 57:392–404 vention. Trends Biotechnol 21:217–223 Liu SL, Hessel A, Sanderson KE (1993) Genomic mapping Tanzer JM, Kurasz AB, Clive J (1985) Competitive dis- with I-Ceu I, an intron-encoded endonuclease specific placement of mutans streptococci and inhibition of for genes for ribosomal RNA, in Salmonella spp., tooth decay by Streptococcus salivarius TOVE-R. Escherichia coli, and other bacteria. Proc Natl Acad Infect Immun 48:44–50 Sci USA 90:6874–6878 Upton M, Tagg JR, Wescombe P, Jenkinson HF (2001) McLaughlin RE, Ferretti JJ, Hynes WL (1999) Nucleotide Intra- and interspecies signaling between Streptococ- sequence of the streptococcin A-FF22 lantibiotic cus salivarius and Streptococcus pyogenes mediated by regulon: model for production of the lantibiotic SA- SalA and SalA1 lantibiotic peptides. J Bacteriol FF22 by strains of Streptococcus pyogenes. FEMS 183:3931–3938 Microbiol Lett 175:171–177 Walls T, Power D, Tagg J (2003) Bacteriocin-like inhibi- Moore A (2004) Finding my enemy’s enemies. EMBO tory substance (BLIS) production by the normal flora Rep 5:754–757 of the nasopharynx: potential to protect against otitis Morgan S, Ross RP, Hill C (1995) Bacteriolytic activity media? J Med Microbiol 52:829–833 caused by the presence of a novel lactococcal plasmid Wescombe PA, Tagg JR (2003) Purification and charac- encoding lactococcins A, B, and M. Appl Environ terization of streptin, a type A1 lantibiotic produced Microbiol 61:2995–3001 by Streptococcus pyogenes. Appl Environ Microbiol Piard JC, Delorme C, Novel M, Desmazeaud M, Novel G 69:2737–2747 (1993) Conjugal transfer of the determinants for Wescombe PA, Upton M, Dierksen KP, Ragland NL, bacteriocin (lacticin 481) production and immunity in Sivabalan S, Wirawan RE, Inglis MA, Moore CJ, Lactococcus lactis subsp. lactis CNRZ 481. FEMS Walker GV, Chilcott CN, Jenkinson HF, Tagg JR Microbiol Lett 112:313–318 (2006) Production of the lantibiotic salivaricin A and Ross KF, Ronson CW, Tagg JR (1993) Isolation and its variants by oral streptococci and use of a specific characterization of the lantibiotic salivaricin A and its induction assay to detect their presence in human structural gene salA from Streptococcus salivarius saliva. Appl Environ Microbiol 72:1459–66 20P3. Appl Environ Microbiol 59:2014–2021 Sanchez-Hidalgo M, Maqueda M, Galvez A, Abriouel H, Valdivia E, Martinez-Bueno M (2003) The genes coding for enterocin EJ97 production by Enterococcus faecalis EJ97 are located on a conjugative plasmid. Appl Environ Microbiol 69:1633–1641
123 Production of the Lantibiotic Salivaricin A and Its Variants by Oral Streptococci and Use of a Specific Induction Assay To Detect Their Presence in Human Saliva
Philip A. Wescombe, Mathew Upton, Karen P. Dierksen, Nancy L. Ragland, Senthuran Sivabalan, Ruth E. Wirawan, Megan A. Inglis, Chris J. Moore, Glenn V. Walker, Chris N. Chilcott, Howard F. Jenkinson and John R. Tagg Appl. Environ. Microbiol. 2006, 72(2):1459. DOI: 10.1128/AEM.72.2.1459-1466.2006.
Downloaded from
Updated information and services can be found at: http://aem.asm.org/content/72/2/1459
These include: http://aem.asm.org/ REFERENCES This article cites 25 articles, 15 of which can be accessed free at: http://aem.asm.org/content/72/2/1459#ref-list-1
CONTENT ALERTS Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more» on April 10, 2012 by guest
Information about commercial reprint orders: http://aem.asm.org/site/misc/reprints.xhtml To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/ APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Feb. 2006, p. 1459–1466 Vol. 72, No. 2 0099-2240/06/$08.00ϩ0 doi:10.1128/AEM.72.2.1459–1466.2006 Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Production of the Lantibiotic Salivaricin A and Its Variants by Oral Streptococci and Use of a Specific Induction Assay To Detect Their Presence in Human Saliva Philip A. Wescombe,1 Mathew Upton,2 Karen P. Dierksen,3 Nancy L. Ragland,3 Senthuran Sivabalan,3 Ruth E. Wirawan,3 Megan A. Inglis,3 Chris J. Moore,1 Glenn V. Walker,3 Chris N. Chilcott,1 Howard F. Jenkinson,4 and John R. Tagg1,3* BLIS Technologies Ltd., Dunedin, New Zealand1; Division of Laboratory and Regenerative Medicine, University of Manchester School of Medicine, Manchester, United Kingdom2; Department of Microbiology and Immunology, University of Otago, Dunedin, New Zealand3; and Department of Oral and Dental Science, University of Bristol, Bristol, United Kingdom4 Downloaded from Received 22 September 2005/Accepted 12 December 2005
Salivaricin A (SalA), the first Streptococcus salivarius lantibiotic to be characterized, appears to be inhibitory to most Streptococcus pyogenes strains. A variant of the SalA structural gene (salA1) is present in more than 90% of S. pyogenes strains, but only strains of M serotype 4 and T pattern 4 produce the biologically active peptide. The present study identifies four additional variants (salA2 to salA5) of the SalA structural gene and demon- strates that each of the corresponding inhibitory peptides (SalA2 to SalA5) is produced in vitro. These variants appear to be similar to SalA and SalA1 in their inhibitory activity against Micrococcus luteus and in their ability to act as inducers of SalA production. It had previously been shown that S. pyogenes strain SF370 had a deletion http://aem.asm.org/ (of approximately 2.5 kb) in the salM and salT genes of the salA1 locus. In the present study, several additional characteristic deletions within the salA1 loci were identified. S. pyogenes strains of the same M serotype all share the same salA1 locus structure. Since S. salivarius is a predominant member of the normal oral flora of healthy humans, strains producing anti-S. pyogenes lantibiotics, such as SalA, may have excellent potential for use as oral probiotics. In the present study, we have used a highly specific SalA induction system to directly detect the presence of SalA in the saliva of humans who either naturally harbor populations of SalA-producing S. salivarius or who have been colonized with the SalA2-producing probiotic S. salivarius K12. on April 10, 2012 by guest Class I bacteriocins, more commonly referred to as lantibi- initially detect bacterial inhibitory activity and, until fully char- otics because they contain the posttranslationally modified acterized, the inhibitory agents are referred to as bacteriocin- amino acids lanthionine and/or methyllanthionine, have now like inhibitory substances (BLIS). The patterns of inhibitory been shown to be produced by various members of the oral activity produced by the test strains against a set of nine stan- streptococcal species Streptococcus mutans (10–12), Streptococ- dard indicator bacteria (I1 to I9) are, for convenience, con- cus pyogenes (7, 26), and Streptococcus salivarius (13, 20). The verted to numerical codes referred to as BLIS production (P) first of the S. salivarius lantibiotics to be characterized was types. For example, P type 777 represents inhibition of all nine salivaricin A (SalA), coded by the structural gene salA in S. indicators (Fig. 1A) (19). SalA1-producing S. pyogenes strains salivarius strain 20P3 (13). Strains that produce SalA exhibit display a P type of 655 (25), corresponding to inhibition of all specific immunity to the homologous bacteriocin. Our initial indicators other than I3 (Streptococcus constellatus), I5 (S. pyo- observation that the growth of all of 81 tested S. pyogenes genes), and I8 (S. pyogenes) (Fig. 1B). A perusal of the results strains was inhibited by strain 20P3 in agar-based deferred of our P typing of several thousand strains of a wide variety of antagonism tests (2) at first appeared anomalous when it was streptococcal species has now shown us that only a small num- found that all but 2 of 65 S. pyogenes strains, each representing ber display P type 655, a finding consistent with inhibitory a different M protein serotype, hybridized with a salA probe activity being composed solely of SalA-like peptides. For ex- (15). The 63 salA-positive S. pyogenes strains differed, however, ample, most SalA-producing S. salivarius strains exhibit the in that they harbored a variant (named salA1) of the SalA somewhat broader P-type profiles of 676 or 677 (2), presum- structural gene, encoding a SalA homologue (SalA1) that had ably due to their production of some as-yet-uncharacterized conservative amino acid differences in residues 2 (R2K) and 7 BLIS, in addition to SalA. A survey of over 5,000 S. salivarius (I7F) of the propeptide part of the molecule. Interestingly, isolates from 180 subjects showed that 1% had P-type patterns expression of biologically active (inhibitory) levels of SalA1 by of 676 or 677 (21). Very occasionally, P-type 777 S. salivarius S. pyogenes was evident only in strains of serotype M4 (8, 19). strains have been detected and, upon further testing, it appears We use a blood agar-based deferred antagonism test to that at least some of these strains, such as the probiotic S. salivarius K12 (BLIS Technologies Ltd., Dunedin, New Zea- land), produce the lantibiotic salivaricin B (SalB) (20) in ad- * Corresponding author. Mailing address: Department of Microbi- ology, University of Otago, P.O. Box 56, Dunedin, New Zealand. dition to a SalA-like peptide. Phone: 64 3 479 7714. Fax: 64 3 479 8540. E-mail: john.tagg@stonebow Comparison of the entire salA and salA1 loci in S. salivarius .otago.ac.nz. 20P3 and S. pyogenes SF370 (serotype M-1), respectively,
1459 1460 WESCOMBE ET AL. APPL.ENVIRON.MICROBIOL.
FIG. 1. (A) Deferred antagonism of S. salivarius strain K12 illustrating a P-type pattern of 777 (i.e., inhibition of all nine indicator strains).
(B) Deferred antagonism test of S. pyogenes strain 148 illustrating a 655 P-type pattern (i.e., inhibition of indicators I1,I2,I4,I6,I7, and I9). Downloaded from
showed that the locus in strain 20P3 was approximately 2.5 kb Assay of SalA peptide inhibitory activity. Wells were cut in BaCa agar medium larger (25) than that in strain SF370. Open reading frames using a hollow glass rod (6-mm diameter). The base of each well was then sealed present in the salA locus, in addition to the structural genes, with 20 l of molten bacteriological agar (Scientific Supplies Ltd., Auckland, New Zealand). Samples (50 l) of preparations to be tested for inhibitory activity were those thought to encode prepeptide modification en- were deposited into the wells, and the plate was left to dry at 37°C. The surface zymes (salB, salC), transporters (salT), two-component re- of the medium was then sterilized by exposure to chloroform vapor for 30 min sponse regulators (salR, salK), and proteins conferring host cell followed by airing for a further 30 min. The SalA-sensitive Micrococcus luteus immunity to SalA (salX, salY). Present in strain 20P3 but miss- T18 (standard indicator strain I1), pregrown for 18 h in THB, was then applied
evenly over the surface of the agar using a cotton swab. Following incubation at http://aem.asm.org/ ing in strain SF370 were salC and part of salB and salT. In that 37°C in air, the bacteriocin titer (in arbitrary units [AU] per ml) was taken to be same study, it was demonstrated that SalA functions as the the reciprocal of the highest dilution (of a series of doubling dilutions) to show signal for up-regulation of its own production in cultures of definite inhibitory activity. strain 20P3 via the activation of the SalR/K signal transduction DNA extraction. Chromosomal DNA for Southern and dot blot analyses was system (25). Moreover, culture supernatants containing either extracted using the method of Upton et al. (24). Streptococcal DNA for use as template in PCRs was isolated as described elsewhere (1). One-microliter ali- SalA or SalA1 were found capable of specifically up-regulating quots of DNA-containing supernatant were used as template for each 50-l PCR the transcription of either salA (in strain 20P3) or salA1 (in mixture. strain T11), this being the first demonstration of interspecies DNA manipulations. Detection of salA was by application of a PCR of 30 cycles, consisting of a denaturing temperature of 94°C for 30 s followed by an
induction of lantibiotic gene expression (25). on April 10, 2012 by guest In the present study, we report the results of our examina- annealing temperature of 55°C for 30 s and an elongation time of 30 s at 65°C, using the primer pair SalAUS (5Ј-GTAGAAAATATTTACTACATACT) and tion of the distribution and variety of SalA-like peptides pro- SalADS (5Ј-GTTAAAGTATTCGTAAAACTGATG) (corresponding to posi- duced by a selection of strains of various streptococcal species. tions 544 to 556 and positions 859 to 882, respectively, within the sal locus of S. Furthermore, we have exploited the SalA auto-regulation sys- salivarius strain 20P3 [GenBank accession no. AY005472]). The products derived tem when developing a highly sensitive assay to specifically from the PCRs were purified and sequenced directly with a Perkin-Elmer ABI detect the presence of SalA peptides in saliva and demonstrate 377A sequencer. Primary sequence data were collated with SeqEd sequencer software, and sequence alignments, translation, and general analyses were per- that positive reactions occur only in specimens from individu- formed using either DNAMAN (Lynnon Biosoft, Vaudreuil, Canada) or Laser- als harboring populations of SalA-producing S. salivarius gene 99 expert sequence analysis software (DNASTAR, Inc., Madison, Wis.). within their oral microbiota. The consensus sequences derived were compared to those in DNA and protein sequence databases using the BLAST facilities on the National Center for Bio- technology Information (NCBI) server (http://www.ncbi.nlm.nih.gov) and the MATERIALS AND METHODS University of Oklahoma server (http://www.genome.ou.edu/strep.html). Bacterial strains and culture media. S. pyogenes SF370 (17), the standard Long-template PCR. PCR amplification of entire sal loci was done using the PCR primer pair SalAF (positions 604 to 629, GATATTTTGAACAATGCTA streptococcal BLIS indicator strains (I1 to I9) (19), the set of 73 prototype S. pyogenes strains (M serotypes 1 to 81) (18), and some of the streptococci found TCGAAGA) and SalRR (positions 10411 to 10391, 5ЈTCAACATAATCCTGA to be producers of SalA-like peptides, including S. salivarius 20P3 (2, 13, 25), S. GATTCG) with an annealing temperature of 60°C by using an Expand Long salivarius K12 (20), S. salivarius JH (22), S. salivarius 9 (2), Streptococcus dysga- Template PCR kit (Roche) following the manufacturer’s instructions. PCR prod- lactiae subsp. equisimilis 4003 (formerly called Streptococcus equisimilis 4003 [8, ucts were analyzed by electrophoresis through a 1% agarose gel to allow deter- 14]), and Streptococcus agalactiae 120 (14), have been described previously. The mination of locus size. representative strains of S. pyogenes, S. salivarius, S. agalactiae, S. dysgalactiae, Selected S. pyogenes strains of different M serotypes were tested to determine Streptococcus uberis, and Streptococcus thermophilus tested for the presence and the completeness of their salM and salT genes with a PCR of 30 cycles, consisting expression of salA were from the culture collection of J. R. Tagg. Unless stated of a denaturing temperature of 94°C for 30 s followed by an annealing temper-
otherwise, all incubation was at 37°C in a 5% CO2-in-air atmosphere. The ature of 55°C for 30 s and an elongation time of 3.5 min at 65°C, using the primer medium for detection of BLIS production was BaCa (Columbia agar base; Life pair S.pyodelFwd (5Ј-ATATACCCTCATTCAGTCTTC) and S.pyodelRev (5Ј- Technologies Ltd., Paisley, United Kingdom) supplemented with human blood GTTATACATCACATCCCCATCAA) (corresponding to positions 1415 to
(5%, vol/vol) and CaCO3 (0.1%, wt/vol). The representative serotype M4 S. 1435 and positions 5326 to 5304, respectively, of the salA locus of S. salivarius pyogenes strain 148 was incubated aerobically at 30°C in order to enhance its strain 20P3). Representatives of each PCR product type (based on product size) production of SalA1 (8). Other culture media utilized in the present study were were sequenced as described above. Ba (Columbia agar base supplemented with human blood [5%, vol/vol]), Todd salA detection using dot blots. The distribution of salA in sets of strains Hewitt broth (THB; Difco, Becton Dickinson and Co., Sparks, Md.), and THB representative of various streptococcal species was determined by dot blotting. supplemented with 1.8 M CaCO3 (THBCa) and sometimes also with 0.1% DNA was extracted and applied to the membranes as described previously (26). (wt/vol) glucose (THBCaGlu). The membranes were then probed with a digoxigenin-dUTP (Roche Diagnostics, VOL. 72, 2006 SALIVARICIN A PEPTIDES AND THEIR DETECTION IN SALIVA 1461
Ltd., Lewes, England)-labeled salA probe derived with the use of the PCR TABLE 1. Relationship between salA and P-type pattern in primers salAUS and salADS described above. representative strains of different streptococcal species Deferred antagonism method. The method of deferred antagonism originally P-type No. of No. of strains described by Tagg and Bannister (19) was used, either to determine the patterns Species (P type) of BLIS activity of the test strains or to compare the relative suscepti- pattern strains having salA bilities of different bacterial strains to the BLIS activities produced in agar media. S. pyogenes Ͼ655a 12 11 The test strain was inoculated diametrically across the surface of the BaCa 655 11 11 medium as a 1-cm-wide streak. After incubation, the visible growth of the test Ͻ655b 50 49 strain was removed using a glass slide, and the surface of the agar was sterilized S. salivarius Ͼ655 36 28 by exposure to chloroform vapors for 30 min. The plate was then aired for 15 min 655 1 1 prior to inoculating 18-h THB cultures of the indicator strains across the line of Ͻ655 30 5 the original producer growth. The plates were then incubated as before for 24 h S. agalactiae Ͼ655 0 0 and examined for zones of interference with the indicator growth. Definite 655 2 2 ϩ inhibition of indicator growth was recorded as . For the purposes of P typing, Ͻ655 14 0 the inhibitory activity against the nine standard indicators was recorded in code S. dysgalactiae Ͼ655 0 0 form (the P type) by considering the indicators to be three triplets (i.e., I1,I2,I3; 655 1 1 I4,I5,I6; and I7,I8,I9). Inhibition of the first member of an indicator triplet was Ͻ655 12 0 given a score of 4, that for the second a score of 2, and that for the third a score S. uberis Ͼ655 10 0 of 1. No inhibition of an indicator was scored as 0. The complete P-type code was 655 0 0 Downloaded from recorded as a sequence of three numbers representing the sum of each triplet. Ͻ655 2 0 All tests were performed in duplicate, and further testing was undertaken if S. thermophilus Ͼ655 0 0 significant discrepancies were detected in the inhibition patterns that were ob- 655 0 0 tained. Ͻ655 14 0 Purification and characterization of SalA-like peptides. Initial preparations of the SalA-like peptides were obtained by extracting the cells obtained from 1-liter a P-type pattern with a numerical value higher than 655, e.g., 677 or 777. b THBCa cultures of the producer strains with 200 ml of 95% methanol (adjusted P-type pattern with a numerical value lower than 655, e.g., 204, 004, or 000. to approximately pH 2 by the addition of 2 ml of concentrated HCl) at 4°C for 18 h. After centrifugation to pellet the cells, the supernatant was subjected to rotary evaporation to remove the methanol. Portions (4 ml) of the residual http://aem.asm.org/ of indicator I1 were considered presumptive SalA producers (for K12 identifi- aqueous preparations (titer of 64 to 128 AU/ml against indicator I1) were frac- cation, colonies were required to be inhibitory to both I1 and I3). A selection of tionated by C8 reversed-phase chromatography using an acetonitrile gradient of representative inhibitory isolates were then P typed, and those yielding patterns 0 to 80% over 60 min. Inhibitory activity against indicator I1 generally eluted in 655, 676, 677, or 777 (together with a positive PCR product with the salAUS and three 1-ml fractions at approximately 33% (vol/vol) acetonitrile. These fractions salADS primer pair) were considered to be confirmed SalA producers. This were pooled, vacuum concentrated to approximately 1 ml, and then refraction- information was then used to help estimate the number of CFU/ml of SalA ated using C18 reversed-phase chromatography with an acetonitrile gradient of producers in the original saliva specimens. For the detection of SalA using the 20 to 50% over 50 min. SalA-associated inhibitory activity was typically detected induction assay, the freshly collected saliva samples were first clarified by cen- for a single 0.5-ml fraction eluting at 34 to 35% acetonitrile. Fractions were trifugation and then boiled for 15 min to kill the natural bacterial population, subjected to mass spectrometry analysis (6) and N-terminal sequencing (5) at the after which 20-l aliquots were used in each assay (carried out in duplicate).
Protein Microchemistry Facility, Department of Biochemistry, University of Nucleotide sequence accession numbers. The new salivaricin A-variant DNA on April 10, 2012 by guest Otago, as described previously. sequences (salA1 to salA5) described in this paper were submitted to GenBank Assay of the auto-inducing and cross-inducing activities of SalA-like peptides. and assigned the following accession numbers: DQ217832, salA1 (S. pyogenes THB cultures (3 ml) of the SalA-producing test strain (e.g., S. pyogenes strain 148); DQ217837, salA1 (S. dysgalactiae subsp. equisimilis 4003); DQ217836, salA1 148) were grown for 18 h at 37°C in 5% CO2 in air. These cultures were (S. agalactiae 120); DQ217838, salA2 (S. salivarius K12); DQ217835, salA3 (S. ϫ centrifuged (15,300 g for 1 min), and the pellet was washed three times in salivarius JH); DQ217833, salA4 (S. salivarius 9); and DQ217834, salA5 (S. saline (0.85% NaCl [wt/vol]) to reduce background SalA prior to resuspension of salivarius H21f). the cells in a volume of saline equivalent to that of the original culture. A 20-ml THBCaGlu broth was inoculated with 100 l of washed cells, and then 180-l aliquots of this suspension were dispensed into wells in a microtiter plate. A total RESULTS of four wells were used for each sample to be tested for salA-inducing activity. Two wells of each set were designated controls (i.e., uninduced) and two as tests Occurrence and in vitro expression of salA and its variants (i.e., the experiment was performed in duplicate). To each of the test wells, 20 l in oral streptococci. A PCR-dot blot hybridization screen for of the sample was added, and the microtiter plate was incubated for 18 h (at 30°C salA was conducted with a selection of streptococcal strains in air for S. pyogenes strain 148 or at 37°C in 5% CO2 in air for other producer representative of different oral species. These strains were also strains). Following incubation, 20 l of each sample was added to the two control wells in the tray (i.e., for each pair of test wells, there is a pair of control wells tested by deferred antagonism for inhibitory activity against which are exactly the same as the test wells except that the sample is added indicators I1 to I9 and classified into three groups, (i) P type following the 18-h incubation). Samples (50 l) from the test and control wells 655 (activity typical of SalA alone), (ii) P types of less than 655 were then tested for inhibitory activity against indicator I1 using the agar well (not consistent with SalA production), and (iii) P types greater diffusion assay. Induction of SalA production is demonstrated by an inhibitory zone surrounding the test well, and not the corresponding control well, in the than 655 (possibly sometimes attributable to SalA plus addi- agar diffusion assay. tional BLIS having activity against indicators not affected by Saliva collection and quantitation of SalA-producing S. salivarius. Nonstimu- SalA) (Table 1). A comparison of the frequency of salA in each lated samples (ca. 2 ml) of freshly collected saliva were obtained from subjects species with the number of strains having a P-type pattern either known to be naturally colonized with SalA-producing S. salivarius or those consistent with SalA production showed that the species hav- who had just been colonized with the SalA-producing S. salivarius strain K12. Assessment of the population levels of SalA-producing S. salivarius in the saliva ing the highest frequency of salA-positive strains (97%) was S. was achieved by spiral plating a 10Ϫ4 dilution (in saline) of the saliva on Mitis- pyogenes, but the only strains found to produce SalA were of Salivarius agar (Difco). Following incubation, the S. salivarius count (CFU/ml) serotype M4. On the other hand, only 2 S. agalactiae strains out was estimated on the basis of the number of characteristic (large, soft) colonies. of 16 and 1 S. dysgalactiae strain out of 13 were salA positive One hundred of these putative S. salivarius colonies were then tested for pro- and, in each case, their BLIS activity profiles (P type 655) were duction of BLIS activity by stabbing into a freshly seeded lawn of indicator I1 on BaCa (to more specifically identify S. salivarius K12, colonies were also picked consistent with production of SalA only. In the tested S. sali- into a freshly seeded lawn of indicator I3). Colonies producing definite inhibition varius strains, the situation appeared more complex. Of the 36 1462 WESCOMBE ET AL. APPL.ENVIRON.MICROBIOL.
TABLE 2. Propeptide sequences and masses of SalA variants
Predicted mass Mass of purified Species Prototype strain SalA form Predicted propeptide sequencea (Da)b peptide (Da)c S. salivarius 20P3 SalA KRGSGWIATITDDCPNSVFVCC 2,316 2,315d S. pyogenes 148 SalA1 KKGSGWFATITDDCPNSVFVCC 2,322 2,327 S. dysgalactiae 4003 SalA1 S. agalactiae 120 SalA1 S. salivarius K12 SalA2 KRGTGWFATITDDCPNSVFVCC 2,364 2,368 S. salivarius JH SalA3 KKGPGWIATITDDCPNSIFVCC 2,312 2,319 S. salivarius 9 SalA4 KRGPGWIATITDDCPNSIFVCC 2,340 2,342 S. salivarius H21f SalA5 KRGPGWIATITDDCPNSVFVCC 2,328 2,329
a Residues that differ from SalA are underlined and in boldface type. b Based on the predicted translation product of the corresponding salA structural gene. c As determined by matrix-assisted laser desorption ionization–time of flight mass spectrometry. d From Ross et al. (13). Downloaded from strains having P types greater than 655 (e.g., 677, 777, etc.), 28 was salA2. Only the serotype M11 and M37 strains of S. pyo- (77%) were salA positive, as was the sole P-type 655 isolate. In genes had no detectable SalA structural gene (see below). contrast to the situation for S. pyogenes, only 5 (17%) of the 30 Previous studies had indicated that both SalA and SalA1 S. salivarius isolates with P types less than 655 were salA pos- could up-regulate production of either SalA or SalA1 when itive. None of the 14 S. thermophilus and 12 S. uberis strains added to cells containing the appropriate functional locus (25). tested were salA positive. By extending the induction assay to also include representative
An examination of the sequences of the PCR products of the strains encoding SalA2 to SalA5, it was found that prepara- http://aem.asm.org/ salA-positive strains revealed several new variants of salA cod- tions containing each of the newly identified SalA variants ing for amino acid differences in the propeptide parts of their were capable of inducing production of both the homologous putative SalA-like products (Table 2). Variations within the and heterologous forms of SalA (Table 3). Specific induction nucleotide sequence inferring amino acid differences within of SalA3 production by strain JH could not be detected, since the SalA leader peptide regions were not taken into consider- this strain also produces large amounts of an as-yet-uncharac- ation when novel variants of the SalA peptides were defined. terized BLIS (22) that masked the activity attributable to Inhibitory peptides corresponding to the propeptide forms of SalA3. The high specificity of the induction reaction for SalA SalA1 to SalA5 were purified from culture supernatants of and its variants was evident in that there was no cross-induc- representative host bacteria, and it was established by mass tion of any of the SalA variants brought about by the heterol- on April 10, 2012 by guest spectrometry that each peptide had a molecular mass closely ogous lantibiotics nisin and SA-FF22 (Table 3). In addition, it matching that predicted to be encoded by the form of salA was found (results not shown) that there was no cross-induc- detected in the host producer strain (Table 2). Interestingly, tion effected in the production of SalA1 by S. pyogenes strain salA1 was the only form of the SalA structural gene detected in 148 brought about by exposure to preparations of the strepto- the P-type 655 strains of S. agalactiae and S. dysgalactiae and coccal lantibiotics streptin and salivaricin B. Hence, it is evi- (with the exception of the M5 strain) also in the set of M- dent that the induction assay is highly specific for the SalA prototype strains of S. pyogenes. The M5 strain contained a lantibiotic group of peptides. S17L variation within the predicted SalA1 propeptide. By con- Differential expression of salA and variants by streptococci. trast, the form present in the sole P-type 655 S. salivarius strain Previous studies (25) showed that a portion of salB and of salT
TABLE 3. Auto- and cross-inducing activity of SalA variants
c Putative inducing Induction of inhibitor production in indicated strain Source of SalA a P-type pattern molecule 20P3 148 4003 120 K12 JH 9 FF22 A5 S. salivarius 20P3 SalA 677 ϩϩϩϩϩNDb ϩϪ Ϫ S. pyogenes 148 SalA1 655 ϩϩϩϩϩND ϩϪ Ϫ S. dysgalactiae 4003 SalA1 655 ϩϩϩϩϩND ϩϪ Ϫ S. agalactiae 120 SalA1 655 ϩϩϩϩϩND ϩϪ Ϫ S. salivarius K12 SalA2 777 ϩϩϩϩϩND ϩϪ Ϫ S. salivarius JH SalA3 677 ϩϩϩϩϩND ϩϪ S. salivarius 9 SalA4 677 ϩϩϩϩϩND ϩϪ Ϫ S. salivarius H25 SalA5 777 ϩϩϩϩϩND ϩϪ Ϫ S. pyogenes FF22 SA-FF22 436 ϪϪϪϪϪND Ϫϩ Ϫ Lactobacillus lactis A5 Nisin 777 ϪϪϪϪϪND ϪϪ ϩ
a All SalA-containing preparations were crude extracts that had been adjusted to a titer of 1 AU/ml against indicator I1 and were subinhibitory to the producer strains. Twenty microliters of extract per test well was used in the assay. b ND, not determined due to the production of multiple BLIS molecules by this strain, some of which interfered with the SalA induction assay. c ϩ, induction detected; Ϫ, no induction detected. VOL. 72, 2006 SALIVARICIN A PEPTIDES AND THEIR DETECTION IN SALIVA 1463
TABLE 4. Distribution of categories of salMT in M-prototype strains of S. pyogenes salMT category M serotype(s) of S. pyogenes
Complete salMT ...... 3, 4,a 8, 15, 19, 24, 34, 41, 43, 52, 57,a 74, 79, 80, MGAS 315 (M3), MGAS SS-1 (M3)b
One deletion in salMT...... 5, 17, 18, 36, 38, 89, MGAS 8232 (M18)b
Two deletions in salMT ...... 1, 2, 9, 12,a 25,a 27, 28,a 29, 32, 39, 42, 48, 49, 52,a 55, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 71, 75, 77, 81, M1GAS (M1),b MGAS 5005 (M1),b MGAS 10394 (M6),b MGAS 6180 (M28)b
Large deletions in salA locus including salA1...... 11
No detectable salA1 locus...... 37
a In addition to the M-prototype strain, there were 11 M4, 11 M57, 8 M12, 1 M25, 2 M28, and 1 M52 strains. b Genome sequence strains with M serotype shown in parentheses. Downloaded from and all of salC appeared to have been deleted from the SalA1 presentations of the salA1 locus were evident (Table 4). The locus of S. pyogenes strain SF370. It should be noted here, various S. pyogenes strains appeared either to have (i) an intact however, that due to an error in the sequencing of the S. salMT region (e.g., 20P3 and MGAS315) (Fig. 2), (ii) a single salivarius 20P3 locus, the lantibiotic processing gene(s) (now deletion in salMT (e.g., MGAS 8232) (Fig. 2), (iii) two dele- designated salM) was at that time designated as two distinct tions in salMT (e,g. M1GAS) (Fig. 2), (iv) no salMT region, genes, salB and salC. PCR primers S.pyodelFwd and S.pyodel- although retaining remnants of salYKR (detected using the
Rev were used to amplify the DNA in this region from each of PCR primer pair salAF and salRR), or (v) no detectable com- http://aem.asm.org/ the M-serotype S. pyogenes prototype strains. The only S. pyo- ponent of the salA locus (as assessed by PCR using, in combi- genes strains negative for salA and salMT (Table 4) were the M nation, the primers salAF, salAR, S.pyodelFwd, S.pyodelRev, serotype 11 and M serotype 37 reference strains. Based on the and salRR). PCR product size resulting from amplification reactions using Interestingly, when additional apparently epidemiologically the S.pyodelFwd and S.pyodelRev primer pair, five structural unrelated strains of S. pyogenes of M serotypes 4, 12, 25, 28, 52, on April 10, 2012 by guest
FIG. 2. (A) Genetic structure of the salA locus in S. salivarius strain 20P3 illustrating that the modification genes previously described as salB and salC are now designated salM (modified from the work of Upton et al., reference 25). (B) Schematic representation of a comparative alignment of the putative salM and salT gene products of the seven S. pyogenes genome strains (MGAS315 [GenBank accession no. AE014074], MGAS SS-1 [GenBank accession no. BA000034], MGAS 8232 [GenBank accession no. AE009949], M1GAS [GenBank accession no. AE004092], MGAS10394 [GenBank accession no. CP00003], MGAS6180 [GenBank accession no. CP000056], and MGAS5005 [GenBank accession no. CP000017]), with the S. salivarius strain 20P3 salM and salT gene products as sequenced in the present study (GenBank accession no. AY005472). Three of the five different variations observed for salMT within S. pyogenes are shown; the other two variations (not illustrated) consist of the complete absence of any portion of the locus or a significant loss including the genes salA, salM, and salT and part of salY. 1464 WESCOMBE ET AL. APPL.ENVIRON.MICROBIOL.
TABLE 5. Detection of SalA in the saliva of subjects having to those encoded by the target bacterium were detected. It was natural salA-positive populations of S. salivarius decided that the induction assay would be used to detect the CFU/ml of putative Induction of SalA1 presence of SalA peptides in human saliva. Test specimen SalA-producing production in Eight subjects were used in the first study (Table 5). Four S. salivarius strain 148 had SalA-producing S. salivarius present in their saliva at levels Saliva A 4.0 ϫ 106 Yes of at least 2.6 ϫ 105 CFU/ml. Freshly collected saliva samples Saliva B 1.4 ϫ 107 Yes from each of these subjects effected induction of SalA1 pro- ϫ 5 Saliva C 2.6 10 Yes duction in the detector strain S. pyogenes 148. On the other Saliva D 1.3 ϫ 106 Yes Saliva E 0 No hand, no SalA1-inducing activity was detected in the saliva of Saliva F 0 No the four subjects who did not have detectable levels of SalA- Saliva G 0 No producing S. salivarius (i.e., below the detection threshold of Saliva H 0 No ϫ 4 a c ca. 1 10 CFU/ml). In the second study, a 3-day course of 12 Positive control NA Yes lozenges containing S. salivarius K12 (BLIS Technologies Negative controlb NA No Ltd.), an oral probiotic strain known to produce both SalA2 a Purified SalA (1 AU/ml). b and SalB when grown in vitro, was given according to the Freeze-thaw extract from salA-negative S. salivarius strain Pre18. Downloaded from c NA, not applicable. manufacturer’s directions. Saliva samples taken just prior to commencement of the course were tested for their content of SalA-producing S. salivarius and for SalA1-inducing activity to ensure that there were no nonspecific saliva components ca- and 57 were tested, they all clustered in the same salMT cat- pable of inducing SalA1 production (Table 6). One and seven egory as the homologous M prototype (Table 4). Furthermore, days after the course of lozenges, further saliva samples were when the salA1 loci of seven genome-sequenced strains of S. obtained and tested as for the presamples. SalA1-inducing pyogenes were aligned with the salA locus of S. salivarius strain activity was detected in the saliva samples of subjects in which
20P3, three different salMT locus categories were represented http://aem.asm.org/ significant levels of strain K12 colonization was achieved (enu- (Fig. 2); in each case, the category corresponded to that of the merated as S. salivarius inhibitory to indicator I and also to homologous M-prototype strain. A single-base-pair deletion in 1 indicator I , which is sensitive to SalB but not SalA). The the salT gene resulting in a frame shift truncating the putative 3 lowest salivary count of strain K12 leading to production of SalA1 transporter to a shortened (222-amino-acid) form was SalA2 at levels able to be detected in the induction assay observed with 15 of 16 S. pyogenes strains tested. This natural appeared to be ca. 8 ϫ 105 CFU per ml. mutation may account for the observed lack of production of SalA1 in many of the S. pyogenes strains that otherwise appear to have complete SalA1 loci. DISCUSSION The detection of specific SalA-inducing activity in the saliva on April 10, 2012 by guest of human subjects subsequent to their colonization with SalA- In the present study, it has been shown that streptococci producing S. salivarius. Our preliminary studies indicated that apparently producing only the lantibiotic SalA or its variants when 50-l samples of serially (twofold) diluted purified prep- exhibit P-type pattern 655 when tested in standardized de- arations of SalA were assayed (i) by the well diffusion method ferred antagonism tests on agar medium. The BLIS indicator for inhibitory activity against M. luteus or (ii) for auto-induc- strains not inhibited by SalA are a S. constellatus (I3), a sero- tion of SalA production by S. pyogenes strain 148, the latter was type M4 S. pyogenes (itself a producer of SalA1) (I5), and a at least eightfold more sensitive. In addition, it had the benefit serotype T6 S. pyogenes (I8). Indicator I8 contains two deletions of high specificity, in that only molecules closely homologous in the salMT section of its salA1 locus (results not shown) and,
TABLE 6. Use of the induction assay to detect the presence of SalA2 in the saliva of subjects on days 1 and 7 following colonization with the oral probiotic S. salivarius K12
Counts of SalA2-producing S. salivarius and SalA1-inducing activity in saliva specimens
Subject Presample 1 Day 1 postcolonization Day 7 postcolonization
Count (CFU/ml) Induction Count (CFU/ml) Induction Count (CFU/ml) Induction 1 0 No 3.9 ϫ 106 No 4.1 ϫ 107 Yes 2 0 No 2.9 ϫ 105 No 4.1 ϫ 107 Yes 3 0 No 1 ϫ 106 Yes 2.7 ϫ 106 Yes 4 0 No 1 ϫ 106 Yes 1.9 ϫ 105 No 5 2.2 ϫ 105 No 8 ϫ 105 Yes 2.0 ϫ 105 No 6 3.2 ϫ 105 No 7 ϫ 106 Yes 6.6 ϫ 107 Yes 7 0 No 6.7 ϫ 107 Yes 4.1 ϫ 107 No 8 0 No 4.4 ϫ 107 Yes 2.2 ϫ 107 No Positive controla NAc Yes NA Yes NA Yes Negative controlb NA No NA No NA No
a Purified SalA (1 AU/ml). b Freeze-thaw extract from salA-negative S. salivarius strain Pre18. c NA, not applicable. VOL. 72, 2006 SALIVARICIN A PEPTIDES AND THEIR DETECTION IN SALIVA 1465 hence, is incapable of expressing SalA1 inhibitory or inducing bp 24 and 25 of salA, resulting in a frameshift disrupting the activity. The precise mode of action of SalA is not known; leader sequence of the SalA propeptide. therefore, further investigation is required to reveal the rea- All five forms of SalA were purified, established to have an son(s) for the apparent relative in vitro insensitivity of some S. Mr consistent with that predicted from the expression of the pyogenes strains to SalA. corresponding structural gene, and shown to have inhibitory
In the present study, only one strain of S. salivarius was activity against indicator I1 and auto- and cross-inducing activ- found to be P type 655 and, in this case, it was the SalA2 form ity. We propose that inhibitory peptides that are established to of the bacteriocin that was produced. All of the other S. sali- have closely similar amino acid sequences and also to exhibit varius strains found to produce SalA-type peptides also ap- both specific cross-immunity and cross-inducing activities be peared to express additional BLIS activities, accounting for considered members of the same bacteriocin cluster—in this their broader activity spectra (e.g., P types 676, 677, and 777; case, the SalA cluster. Hence, we have classified SalA-like results not shown). The expression of SalA1 was found to occur peptides containing amino acid changes within the propeptide in the widest range of species (S. pyogenes, S. dysgalactiae, and region that do not have an impact on both (i) the cross- and S. agalactiae) and, in each case, it appeared to be the sole BLIS auto-immunity and (ii) the induction specificities of the mole- cule as subtypes of that bacteriocin cluster (e.g., SalA, SalA1,
produced. All of the SalA1-producing strains of S. agalactiae Downloaded from and S. dysgalactiae were derived from nonhuman sources (14). and SalA2). The sal locus was not detectable in the S. pyogenes strain The presence of the SalA1 locus in all but one of the tested representative of serotype M37 and was severely degraded in representatives of 53 different M serotypes of S. pyogenes in- the strain representative of serotype M11. The M11 strain is an dicates that this locus was acquired early in the establishment A-variant S. pyogenes strain, thought to have lost the ability to of the species. The general absence, however, of SalA1 pro- assemble intact group A carbohydrate during the course of duction in these strains was initially ascribed to the deletion of prolonged serial subculture in vitro (D. Johnson, personal a portion of the salB, salC, and salT (now salM and salT) region of the salA1 loci in most S. pyogenes strains (25). In the present
communication). The lack of an obvious selective advantage http://aem.asm.org/ study, more-detailed investigation of the salA1 loci in the M- associated with SalA immunity for S. pyogenes strains grown prototype strains and also seven genome-sequenced S. pyo- for prolonged periods as laboratory monocultures could favor genes strains indicated that there are at least four possible loss of immunity-related components of the locus. In addition, mutations within salA1 loci that could adversely affect produc- the M37 strain is quite unusual in that no other examples of tion of biologically active SalA1. These mechanisms consist of strains of this serotype appear to have been isolated (D. John- three different deletions within salMT that appear to be con- son, personal communication). Both of these observations are served within groups of M-serotype S. pyogenes strains and one consistent with a survival advantage for S. pyogenes being frame shift in salT which would lead to truncation of the linked to retention of at least the immunity-related compo-
protein, presumably abrogating transport and leader peptide on April 10, 2012 by guest nents of the sal locus. The results from the present study cleavage of SalA1. PCR-based screening of the salM/salT re- support our previous observation (8) that all tested serotype gions of additional representatives of M serotypes 4, 12, 25, 28, S. pyogenes M4 strains appear capable of expressing SalA1. and 52 indicated that within M serotypes, the deletion type of However, the association appears only to be with M4 (emm4) the salA locus appears to be strongly conserved and, as such, strains that also have T antigen 4. S. pyogenes strains having may prove to be a useful marker of the evolutionary develop- other M or T antigens combined with either the M4 or T4 ment of the species. Potentially, members belonging to a par- antigen were inhibitor negative (8). Moreover, the SalA1-ex- ticular group will be more closely related to others within their pressing S. dysgalactiae (8) and S. agalactiae (results not shown) own group than to those of other groups. At present, there strains neither contained emm4 nor expressed T4. appears to be no obvious correlation between the salMT type Whereas S. pyogenes strains appear almost exclusively to and the opacity factor status, tissue site preference (9), or emm contain only the salA1 variant, S. salivarius strains exhibit a pattern (4) of the strains. Horizontal gene transfer followed by much greater diversity of SalA structural genes, but these ap- intergenomic recombination appears to be the major cause of parently do not include salA1. Four new variants (salA2, salA3, gene variation in S. pyogenes strains (3), which tends to negate salA4, and salA5) have been reported in this study. The amino phylogenetic signal from gene trees (9), indicating that any acid differences, in general, reflect conservative changes that direct links between the salA1 locus type and the emm type of do not appear to affect induction activity or inhibitor activity of a strain may weaken over time. It is interesting, however, that the peptides. The Ser-Pro differences in residue 4 of the the SalA locus occurs downstream of the same genes in each of propeptide could potentially have an impact on the peptide the seven S. pyogenes genomes, indicating that the acquisition conformation. However, this Ser residue is not dehydrated in of the SalA locus was an early event in the establishment of S. SalA (13), and Kyte-Doolittle plots (data not shown) indicate pyogenes as a species. no significant predicted differences in the hydrophobicity of S. salivarius is a primary and predominant colonizer of oral the SalA peptides containing either Ser or Pro. Two types of mucosal surfaces in humans and does not initiate infections in naturally occurring gene disruptions leading to abrogation of healthy individuals (16). On the other hand, the presence of expression of biologically active SalA were also detected in large numbers of S. pyogenes in the oral cavity usually corre- strains of S. salivarius (data not shown): (i) S. salivarius strain lates with acute pharyngeal infection. S. pyogenes strains are MPS has a single-base-pair mutation in salA, resulting in the typically very susceptible to growth inhibition by SalA when formation of a stop codon at residue 6 of the SalA propeptide, tested in vitro (13, 15), and the SalA-producing S. salivarius and (ii) S. salivarius strain H16H has a 16-bp insertion between strain K12 (BLIS Throat Guard; BLIS Technologies) has re- 1466 WESCOMBE ET AL. APPL.ENVIRON.MICROBIOL. cently been developed for use as an oral probiotic. However, a novel endoplasmic reticulum protein, from rat enamel cells: evidence for a although S. salivarius colonization of the oral cavity can be unique role in secretory-protein synthesis. Eur. J. Biochem. 267:1945–1957. 6. Hubbard, M. J., and N. J. McHugh. 1996. Mitochondrial ATP synthase effected, direct evidence for the in situ production and detec- F1--subunit is a calcium-binding protein. FEBS Lett. 391:323–329. tion of SalA in saliva has not been reported. Some indirect 7. Jack, R. W., A. Carne, J. Metzger, S. Stefanovic, H. G. Sahl, G. Jung, and J. Tagg. 1994. Elucidation of the structure of SA-FF22, a lanthionine-contain- evidence for the oral production and activity of SalA was ing antibacterial peptide produced by Streptococcus pyogenes strain FF22. obtained by showing that the population levels of indigenous Eur. J. Biochem. 220:455–462. ␣-hemolytic cocci exhibiting resistance to SalA were signifi- 8. Johnson, D. W., J. R. Tagg, and L. W. Wannamaker. 1979. Production of a bacteriocine-like substance by group-A streptococci of M-type 4 and T- cantly higher in samples of the oral microbiota from subjects pattern 4. J. Med. Microbiol. 12:413–427. who were naturally colonized with large numbers of SalA- 9. McGregor, K. F., B. G. Spratt, A. Kalia, A. Bennett, N. Bilek, B. Beall, and producing S. salivarius (23). The inference was that sufficient D. E. Bessen. 2004. Multilocus sequence typing of Streptococcus pyogenes representing most known emm types and distinctions among subpopulation SalA had been produced in the oral cavity to select for a genetic structures. J. Bacteriol. 186:4285–4294. relatively resistant population. In the present study, we have 10. Novak, J., P. W. Caufield, and E. J. Miller. 1994. Isolation and biochemical used a highly specific autoinduction assay to directly detect the characterization of a novel lantibiotic mutacin from Streptococcus mutans.J. Bacteriol. 176:4316–4320. presence of SalA in the saliva of subjects having SalA-produc- 11. Qi, F., P. Chen, and P. W. Caufield. 2000. Purification and biochemical ing S. salivarius as part of their normal flora, or following their characterization of mutacin I from the group I strain of Streptococcus mu- use of a commercial product containing the probiotic SalA2- tans, CH43, and genetic analysis of mutacin I biosynthesis genes. Appl. Downloaded from Environ. Microbiol. 66:3221–3229. positive strain S. salivarius K12. It is important to note, how- 12. Qi, F., P. Chen, and P. W. Caufield. 1999. Purification of mutacin III from ever, that the production of salivaricin A to levels detectable in group III Streptococcus mutans UA787 and genetic analyses of mutacin III the saliva is extremely varied from individual to individual, with biosynthesis genes. Appl. Environ. Microbiol. 65:3880–3887. 13. Ross, K. F., C. W. Ronson, and J. R. Tagg. 1993. Isolation and character- the number of S. salivarius K12 per ml of saliva required to ization of the lantibiotic salivaricin A and its structural gene salA from produce detectable levels apparently ranging from 8 ϫ 105 to Streptococcus salivarius 20P3. Appl. Environ. Microbiol. 59:2014–2021. ϫ 7 14. Schofield, C. R., and J. R. Tagg. 1983. Bacteriocin-like activity of group B 6.7 10 CFU per ml (Table 6). This variability may result in and group C streptococci of human and of animal origin. J. Hyg. 90:7–18. part either from variable saliva flow rates, which may differen- 15. Simpson, W. J., N. L. Ragland, C. W. Ronson, and J. R. Tagg. 1995. A tially dilute the SalA, or from adsorption of SalA by cells of the lantibiotic gene family widely distributed in Streptococcus salivarius and http://aem.asm.org/ Streptococcus pyogenes. Dev. Biol. Stand. 85:639–643. normal flora, either of which could potentially differ signifi- 16. Smith, D. J., J. M. Anderson, W. F. King, J. Van Houte, and M. A. Taubman. cantly from individual to individual. This is, to our knowledge, 1993. Oral streptococcal colonization of infants. Oral. Microbiol. Immunol. the first demonstration of in situ production of a lantibiotic at 8:1–4. 17. Suvorov, A. N., and J. J. Ferretti. 1996. Physical and genetic chromosomal a level that may be capable of influencing either the survival or map of an M type 1 strain of Streptococcus pyogenes. J. Bacteriol. 178:5546– genetic regulation of other species within the oral cavity. 5549. 18. Tagg, J. R. 1984. Production of bacteriocin-like inhibitors by group A strep- tococci of nephritogenic M types. J. Clin. Microbiol. 19:884–887. ACKNOWLEDGMENTS 19. Tagg, J. R., and L. V. Bannister. 1979. “Fingerprinting” beta-haemolytic streptococci by their production of and sensitivity to bacteriocine-like inhib- We thank N. Heng for help with preparation of the manuscript. on April 10, 2012 by guest itors. J. Med. Microbiol. 12:397–411. This work was supported by grant UO0605 from the Marsden Fund, 20. Tagg, J. R., K. P. Dierksen, and M. Upton. August 2004. Lantibiotic. U.S. Royal Society of New Zealand, and also by a research grant from the patent 6,773,912B1. University of Otago. 21. Tagg, J. R., V. Pybus, L. V. Phillips, and T. M. Fiddes. 1983. Application of inhibitor typing in a study of the transmission and retention in the human REFERENCES mouth of the bacterium Streptococcus salivarius. Arch. Oral Biol. 28:911–915. 1. Beall, B., R. Facklam, and T. Thompson. 1996. Sequencing emm-specific 22. Tompkins, G. R., and J. R. Tagg. 1987. Bacteriocin-like inhibitory activity PCR products for routine and accurate typing of group A streptococci. associated with beta-hemolytic strains of Streptococcus salivarius. J. Dent. J. Clin. Microbiol. 34:953–958. Res. 66:1321–1325. 2. Dempster, R. P., and J. R. Tagg. 1982. The production of bacteriocin-like 23. Tompkins, G. R., and J. R. Tagg. 1989. The ecology of bacteriocin-producing substances by the oral bacterium Streptococcus salivarius. Arch. Oral Biol. strains of Streptococcus salivarius. Microb. Ecol. Health Dis. 2:19–28. 27:151–157. 24. Upton, M., P. E. Carter, M. Morgan, G. F. Edwards, and T. H. Pennington. 3. Feil, E. J., E. C. Holmes, D. E. Bessen, M. S. Chan, N. P. Day, M. C. Enright, 1995. Clonal structure of invasive Streptococcus pyogenes in Northern Scot- R. Goldstein, D. W. Hood, A. Kalia, C. E. Moore, J. Zhou, and B. G. Spratt. land. Epidemiol. Infect. 115:231–241. 2001. Recombination within natural populations of pathogenic bacteria: 25. Upton, M., J. R. Tagg, P. Wescombe, and H. F. Jenkinson. 2001. Intra- and short-term empirical estimates and long-term phylogenetic consequences. interspecies signaling between Streptococcus salivarius and Streptococcus pyo- Proc. Natl. Acad. Sci. USA 98:182–187. genes mediated by SalA and SalA1 lantibiotic peptides. J. Bacteriol. 183: 4. Hollingshead, S. K., J. Arnold, T. L. Readdy, and D. E. Bessen. 1994. 3931–3938. Molecular evolution of a multigene family in group A streptococci. Mol. 26. Wescombe, P. A., and J. R. Tagg. 2003. Purification and characterization of Biol. Evol. 11:208–219. streptin, a type A1 lantibiotic produced by Streptococcus pyogenes. Appl. 5. Hubbard, M. J., N. J. McHugh, and D. L. Carne. 2000. Isolation of ERp29, Environ. Microbiol. 69:2737–2747. Indian J Med Res 119 (Suppl) May 2004, pp 13-16
Prevention of streptococcal pharyngitis by anti-Streptococcus pyogenes bacteriocin-like inhibitory substances (BLIS) produced by Streptococcus salivarius
J.R. Tagg
Department of Microbiology, University of Otago, P.O. Box 56, Dunedin, New Zealand
Received August 6, 2003
Background & objectives: Streptococcus salivarius is a numerically prominent member of the human oral microbiota that produces a variety of bacteriocin-like inhibitory substances (BLIS) having in vitro inhibitory activity against S. pyogenes. Our previous studies of S. salivarius isolates from children using a deferred antagonism BLIS production (P)-typing scheme showed that the 9 per cent of children having large populations of P-type 677 S. salivarius experienced fewer S. pyogenes acquisitions than either the 11 per cent of children having predominant P-type 226 populations or the 60 per cent of children with largely non-inhibitory (P-type 000) S. salivarius. Amongst the other BLIS P-types detected were a number of strongly-inhibitory (P-type 777) S. salivarius. In the present study the inhibitory agents produced by prototype strains of P-types 226, 677 and 777 S. salivarius are compared. Methods: The prototype BLIS-producing S. salivarius strains SN, 20P3, and K12 were isolated from tongue swabbings. BLIS P-typing was done using standard procedures. The BLIS molecules were purified and characterized. Results: S. salivarius SN (P-type 226) produces a heat-labile muramidase. S. salivarius 20P3 (P-type 677) produces the 2315 Da lantibiotic salivaricin A and S. salivarius K12 (P-type 777) produces two lantibiotics; salivaricin A2 (2368 Da) and salivaricin B (2733 Da). Interpretation & conclusion: The P-type 777 S. salivarius strain produced salivaricin A2 and salivaricin B. The combined production of two anti-S. pyogenes BLIS activities by this strain indicates that it could be adopted as a colonizing strain in bacterial interference trials. Key words Bacteriocin - bacteriocin-like inhibitory substance - lantibiotic - replacement therapy - Streptococcus salivarius
Streptococcus pyogenes is a major cause of acute possibility of adverse host reactions, severe disruption infections and of serious delayed sequelae, particularly of the indigenous microbiota and bacterial resistance in children. At present, the most effective strategy development. The implementation of bacterial available to deal with S. pyogenes is treatment of acute interference may offer a relatively specifically-targeted infections by administration of therapeutic doses of a alternative means of preventing the development of acute broad-spectrum antibiotic like penicillin. Also, since there S. pyogenes infections. Since commensal streptococci is currently no anti-S. pyogenes immunization available, are numerically predominant in the oral cavity, it seems the only means of protecting at risk individuals is antibiotic reasonable to speculate that they may be central to any prophylaxis. However, these approaches have many naturally occurring interference with colonization or inherent problems: the cost of the antibiotics, the infection by S. pyogenes. Children who acquire
13 14 INDIAN J MED RES (SUPPL) MAY 2004 S. pyogenes have been shown to have a lower Material & Methods proportion of throat cultures containing bacteria inhibitory or bacteriocidal for S. pyogenes than those who do not Bacterial strains and BLIS P-typing: The prototype become colonised1. The pantothenic acid antagonist BLIS-producing S. salivarius strains SN (P-type 226), enocin, produced by S. salivarius, was later speculated 20P3 (P-type 667)10 and K12 (P-type 777) were isolated to contribute to protection against S. pyogenes on Mitis Salivarius agar (Difco Laboratories, Detroit) infections2. Grahn and Holm3 established that the from tongue swabbings of human subjects. The prevalence of oral alpha-haemolytic streptococci having 9 standard indicators and the standard procedure used inhibitory activity against S. pyogenes was lower in those for the BLIS P-typing of streptococci have been children who became infected during an outbreak of described previously7. streptococcal tonsillitis. This group later recommended dosing with a mixture of alpha haemolytic streptococci Isolation and characterization of BLIS molecules: as a supplementary treatment of recurrent streptococcal The BLIS produced by S. salivarius strain SN was tonsillitis4. purified from 18 h 35C Todd Hewitt broth (Difco) culture supernatants using the procedures previously Of all the bacterial species known to regularly inhabit devised for the similar BLIS, zoocin A, produced by the human oral microbiota in large numbers S. salivarius S. equi subsp. zooepidemicus11. The procedures for is perhaps the most innocuous. There appear to be no isolation of the lantibiotic peptides salivaricin A2 and reports of this species causing infections within the oral salivaricin B from S. salivarius strain K12 were those cavity and the rare instances of its association with applied previously to the purification of salivaricin A bacteraemia or meningitis appear to have occurred in from S. salivarius strain 20P310. Amino acid immunologically-compromised patients or following compositions, mass spectrometry and N-terminal amino trauma to the patients tissues5. Since S. salivarius is acid sequencing were done by the Protein common, not only on the dorsum of the tongue but also Microchemistry Facility, Department of Biochemistry, on the oropharyngeal mucosa6 , it is well positioned to University of Otago. To enable Edman degradation to directly repel invasion by S. pyogenes. Our previous proceed through blockages caused by the presence of studies7,8 have demonstrated that approximately 45 per dehydro amino acids, these residues were first modified cent of S. salivarius strains inhibit the growth of one or by addition of thiol groups12. more members of a set of 9 strains used routinely as indicators of streptococcal BLIS. The pattern of inhibition Results of these indicators, when expressed in code form, is referred to as the BLIS production (P)-type of a A muralytic enzyme, salivaricin SN, was isolated bacterium. Subsequent studies of streptococcal from the supernatants of Todd Hewitt broth cultures pharyngitis in populations of school-aged children showed of S. salivarius strain SN. Tests of the inhibitory that some children were seldom infected. Many of these spectrum of strain SN using the deferred antagonism rarely-infected children were found to harbour large test established that 18 of 20 S. pyogenes were populations of S. salivarius producing anti-S. pyogenes susceptible, but none of a variety of other streptococci, BLIS activity. A study of 780 Dunedin school children9 including representatives of Lancefield groups B, C, found that there were two major types of BLIS activities D, F and G, S. salivarius, S. sanguinis and produced by the S. salivarius, the corresponding P-type S. mutans. The purified protein was inactivated on patterns being referred to as 226 (11% of children positive) heating at 80º C for 30 min. The N-terminal sequence and 677 (9% positive). A further 20 per cent of the of salivaricin SN was DINGGANTPGAYD……. children had S. salivarius of various other P-type designations, including some isolates producing S. salivarius strain 20P3 has been shown particularly strong (P-type 777) BLIS activity. The previously10 to produce the lantibiotic salivaricin A present study compares the BLIS activities produced (Table). Also shown in the Table is the sequence of by S. salivarius strains SN, 20P3 and K12, the salivaricin A1, the homologous lantibiotic produced by prototypes of BLIS P-types 226, 677 and 777 respectively. the serotype M4 S. pyogenes strain 2000613,14. TAGG : APPLICATION OF STREPTOCOCCUS SALIVARIUS BLIS 15 S. salivarius strain K12 was found to produce two in 15 probe-positive S. pyogenes revealed consistent anti-S. pyogenes peptides (Table). The detection of codon differences indicative of conservative amino acids lanthionine in amino acid analyses and stability to heating changes in positions 2 (K instead of R) and 7 (F instead at 100ºC for 30 min indicated that both are of the of I) of the salivaricin A propeptide. This variant form, lantibiotic class of bacteriocins. One of these was a T4S/ called salivaricin A1, appears to be expressed as a F7I variant of salivaricin A, named salivaricin A2. The functional product only in serotype M4 strains of second was quite unrelated to salivaricin A and is referred S. pyogenes but is sufficiently similar to effect induction to as salivaricin B. of salivaricin A production in salA-positive strains of S.salivarius. Discussion In the present study, yet another variant of salivaricin The present study shows that the anti-S. pyogenes A has been found to be produced by S. salivarius strain inhibitory activities previously shown to be relatively K12. Interestingly this variant, salivaricin A2, which commonly produced in vitro by S. salivarius are of three differs in two conservative amino acid substitutions markedly different molecular types. Strain SN, the from both salivaricin A and salivaricin A1, appears prototype of the P-type 226 S. salivarius produced a commonly to be produced together with salivaricin B heat labile lytic enzyme, salivaricin SN, the N-terminus in P-type 777 S. salivarius (data not shown). The of which was completely different from that of the P-type 777 S. salivarius strain K12 was shown to previously-described streptococcal muralysin, zoocin A produce in addition to salivaricin A2 an unrelated (ATYTRPLDTG…). Zoocin A has been shown to be lantibiotic salivaricin B. The combined production of a domain-structured enzyme similar to lysostaphin, with two anti-S. pyogenes BLIS activities by strain K12 the N-terminus responsible for catalysis and the was one consideration leading to its adoption as a C-terminal domain effecting target recognition15. Unlike colonizing strain in bacterial interference trials in zoocin A, which displays strong activity against S. mutans populations of school children and young adults. in addition to S. pyogenes, the S. salivarius agent appears relatively specifically active against Acknowledgment S. pyogenes. Cloning of the salivaricin SN structural gene is in progress and when completed will facilitate The financial support from the Marsden Fund, Royal Society of New Zealand and by the Health Research Council of New Zealand is direct comparison between the two enzymes for evidence acknowledged. of domain sharing. References Our previous studies13,14 have shown that the structural gene salA, which encodes the lantibiotic 1. Crowe CC, Sanders WE Jr, Longley S. Bacterial interference. II. salivaricin A, is the usual form detected in S. salivarius, Role of the normal throat flora in prevention of colonization by PCR amplification and sequencing of the salA-like gene group A streptococcus. J Infect Dis 1973; 128: 527-32.
Table. Primary sequence and molecular mass of lantibiotic salivaricins
Salivaricin Amino acid sequence Mass (Da)
A* KRGSGWIATITDDCPNSVFVCC 2315
A1* KKGSGWFATITDDCPNSVFVCC 2327
A2 KRGTGWFATITDDCPNSVFVCC 2368
B GGGVIQTISHECRMNSWQFLFTCCS 2733
* The data for salivaricin A10 and salivaricin A113 have been previously published 16 INDIAN J MED RES (SUPPL) MAY 2004
2. Sanders CC, Sanders WE Jr. Enocin: an antibiotic produced by and streptococcal diseases entering the new millenium. Streptococcus salivarius that may contribute to protection New Zealand: Securacopy; 2000 p. 81-5. against infections due to group A streptococci. J Infect Dis 10. Ross KF, Ronson CW, Tagg JR. Isolation and characterization 1982; 146 : 683-90. of the lantibiotic salivaricin A and its structural gene salA from 3. Grahn E, Holm SE. Bacterial interference in the throat flora Streptococcus salivarius 20P3. Appl Environ Microbiol 1993; during a streptococcal tonsillitis outbreak in an apartment house 59: 2014-21. area. Zentralbl Bakteriol Mikrobiol Hyg (A) 1983; 256: 72-9. 11. Simmonds RS, Naidoo J, Jones CL, Tagg JR. The streptococcal 4. Roos K, Holm SE, Grahn E, Lind L. Alpha-streptococci as bacteriocin-like inhibitory substance, zoocin A, reduces the supplementary treatment of recurrent streptococcal tonsillitis: proportion of Streptococcus mutans in an artificial plaque. a randomized placebo controlled study. Scand J Infect Dis 1993; Microb Ecol Health Dis 1995; 8: 281-92. 25: 31-5. 5. Carley NH. Streptococcus salivarius bacteremia and meningitis 12. Navaratna MA, Sahl HG, Tagg JR. Two-component anti- following upper gastrointestinal endoscopy and cauterization Staphylococcus aureus lantibiotic activity produced by for gastric bleeding. Clin Infect Dis 1992; 14 : 947-8. Staphylococcus aureus C55. Appl Environ Microbiol 1998; 64 : 4803- 8. 6. Frandsen EV, Pedrazzoli V, Kilian M. Ecology of viridans streptococci in the oral cavity and pharynx. Oral Microbiol 13. Simpson WJ, Ragland NL, Ronson CW, Tagg JR. A lantibiotic Immunol 1991; 6: 129-33. gene family widely distributed in Streptococcus salivarius and Streptococcus pyogenes. Dev Biol Stand 1995; 85 : 639-43. 7. Tagg JR, Bannister LV. “Fingerprinting” ß-haemolytic streptococci by their production of and sensitivity to 14. Upton M, Tagg JR, Wescombe P, Jenkinson HF. Intra- bacteriocine-like inhibitors. J Med Microbiol 1979; 12 : 397-411. and interspecies signaling between Streptococcus 8. Dempster RP, Tagg JR. The production of bacteriocin-like salivarius and Streptococcus pyogenes mediated by SalA substances by the oral bacterium Streptococcus salivarius. and SalA1 lantibiotic peptides. J Bacteriol 2001; 183: Arch Oral Biol 1982; 27: 151-7. 3931-8. 9. Dierksen KP, Tagg JR. The influence of indigenous bacteriocin- 15. Lai AC, Tran S, Simmonds RS. Functional characterization of producing Streptococcus salivarius on the acquisition of domains found within a lytic enzyme produced by Streptococcus Streptococcus pyogenes by primary school children in Dunedin, equi subsp. zooepidemicus. FEMS Microbiol Lett 2002; 215: New Zealand. In: Martin DR, Tagg JR, editors. Streptococci 133.
Reprint requests: Dr J.R. Tagg, Professor, Department of Microbiology, University of Otago, P.O. Box 56, Dunedin, New Zealand e-mail: [email protected]
RevistaV. Fantinato de Microbiologia et al. (1999) 30:332-334 ISSN 0001-3714
PRODUCTION OF BACTERIOCIN-LIKE INHIBITORY SUBSTANCES (BLIS) BY STREPTOCOCCUS SALIVARIUS STRAINS ISOLATED FROM THE TONGUE AND THROAT OF CHILDREN WITH AND WITHOUT SORE THROAT
Vera Fantinato1*; A. O. C. Jorge2; Mário. T. Shimizu2
1Instituto de Pesquisa e Desenvolvimento, Universidade do Vale do Paraíba - UNIVAP, São José dos Campos, SP, Brasil; Faculdade de Odontologia de São José dos Campos, Universidade Estadual Paulista - UNESP, São José dos Campos, SP, Brasil
Submitted: April 3, 1997 ; Returned to authors for corrections: March 16, 1998; Approved: December 20, 1999
SHORT COMMUNICATION
ABSTRACT
Streptococcus salivarius strains, isolated from children with and without sore throat, were tested for bacteriocin production against Streptococcus pyogenes. S. salivarius strains producing bacteriocin-like inhibitory substances (BLIS) against S. pyogenes were more frequently found in children without sore throat. These results suggest that these children may be protected against sore throat by the presence of BLIS-positive S. salivarius strains.
Key-words: Streptococcus salivarius, Streptococcus pyogenes, bacteriocin-like- inhibitory-substances, BLIS
Bacterial interference has been recognized as a producing strain possesses a specific self-protection tool to prevent certain diseases. Several researchers mechanism (8). Inhibitors that do not fulfill this criteria believe that this is a natural protection against some should be classified as bacteriocin-like inhibitory pathogenic bacteria. Streptococcus are usually substances (BLIS) (12). isolated from the mouth and are the dominant bacteria A wide range of interactions have been observed of this habitat. Among them, S. salivarius, a non within oral bacteria including interactions with agents pathogenic bacterium, is numerically the most of throat infection. The potential protective role played significant of those on the tongue (5). Antagonism by the resident microflora was explained by Sanders between Streptococcus, based on production of (11), who compared the inhibitory viridans streptococci bacteriocins, has been investigated (2, 12). in the throat of children infected with Group A The term bacteriocin was first coined by Jacob et streptococci with children who had not been infected. al. (4). More recently, this term has been used to This inhibitory activity was present in children without designate bacterial peptides and protein antibiotics S. pyogenes and was independent of the Group A test which are ribossomally produced or derived from gene- organism and inoculum size. Fantinato and Zelante (2) encoded precursor peptides, and towards which the noted that among the oral bacteria which produce BLIS
* Corresponding author. Mailing address: Av. Shishima Hifumi, 2911, Urbanova, CEP 12244-000, São José dos Campos, SP, Brasil. E.mail: [email protected]
332 BLIS produced by S. salivarus
against S. pyogenes, S. salivarius was one of the most The results suggest that the presence of BLIS- common in the mouth. positive S. salivarius strains in children who had not The aim of the present study was to verify if the developed sore throats may be related to protection presence of BLIS-positive S. salivarius strains in the against throat infection. mouth and throat of children with and without sore As noted by Pichichero (6), sore throat is one of thoats, could be associated to protection against the most commom problems in children and Group throat infection. A Streptococcus infections account for nearly all sore The samples were collected from 54 children who throats of bacterial etiology. The author also had frequently experienced sore throat (Group I) and commented about the therapy failure in 20% of from a control group of 50 children who had not children under antibiotic treatment. experienced this disease in the last 3 years (Group Sanders et al. (10) evaluated the effects of orally II). The samples of Group I were collected in the administered antibiotics on the composition of the Taubate Hospital (São Paulo - Brazil), from children normal throat flora and its ability to inhibit the growth with clinically diagnosed throat infections. The of group A streptococci; the interfering activity of samples of Group II were collected from an the flora was remarkedly diminished or absent during Intermediate School in S. José dos Campos (São penicillin therapy. Paulo - Brazil), from children who did not experience Several studies were performed on the treatment sore throats. All children were 7 to 14 years old. A of recurrent streptococcal tonsilitis by Roos et al. consent form and a questionaire about the frequency (7). Alpha-streptococci, inoculated into the throat of of the illness were full filled by the parents or the patients, presented a successful protective effect guardians of all children. against recurrence. Samples were collected by swabbing the tongue S. salivarius can be considered more appropriate and throat. Mitis Salivarius Agar (Difco) was used than other streptococci for prevention of throat to isolate S. salivarius strains. Ten colonies from each infections since this species is one of the most active plate were submitted to biochemical identification, antagonist against group A streptococci. following the scheme outlined by Hardie and Bowden (3). Bacteriocin production was tested by RESUMO performing the deferred antagonism test (1), using S. pyogenes ATCC 8133 (Type 23) as the indicator Produção de substâncias inibidoras semelhantes strain. à bacteriocina por cepas de Streptococcus Any child was presenting BLIS positive salivarius, isoladas da língua e garganta de S.salivarius strains either on the tongue or in the crianças com e sem dor de garganta throat was considered a carrier. Results in Table 1 show that 53.7% of children Cepas de Streptococcus salivarius, isoladas de from Group I and 98% of children from Group II crianças com e sem dor de garganta, foram testadas were BLIS-positive S. salivarius carriers. A quanto à produção de bacteriocina contra statistically significant difference between results for Streptococcus pyogenes. Os resultados mostraram Group I and II was found, at 5% level. que as crianças que não tinham dor de garganta
a Table 1 - Isolation of BLIS producing Streptococcus salivarius strains from children with and without sore throats
Number of Total of strainsc Total of BLIS + strains BLIS + strains Groupb Children Tongue Throat Tongue Throat Carriers I 54 46/85.1 48/88.8 24/44.4 22/40.7 29/53.7 II 50 48/96.0 49/98.0 43/86.0 43/86.0 49/98.0 Total 104 94/90.3 97/93.2 67/64.4 65/62.5 78/75.0 a =Bacteriocin-like inhibitory substances b =Group I, children with sore throat Group II, children without sore throat c =Number/%
333 V. Fantinato et al.
possuiam, na boca, cepas de bactérias produtoras de 5. McCarthy C, Snyder M L, Parker R B. The indigenous oral flora of man. I. The newborn to the 1 year old infant. Arch. substâncias inibidoras semelhantes à bacteriocina Oral. Biol. 10:61-70, 1965. contra S. pyogenes. 6. Pichichero M E. Explanations and therapies for penicillin failure in streptococcal pharyngitis. Clin. Pediatr. (Phila). 31(11):642-49, 1992. Palavras-chave: Streptococcus salivarius, 7. Roos K, Grahn E, Holm S E, Johansson H, Lind L. Interfering Streptococcus pyogenes, substâncias inibidoras alpha-streptococci as a protection against recurrent semelhantes à bacteriocina, BLIS streptococcal tonsillitis in children. Int. J. Pediatr. Otorhinolaryngol. 25(1-3):141-48, 1993. 8. Sahl H G. Gene-encoded antibiotics made in bacteria. REFERENCES Antimicrobial peptides. Wiley, Chichester (Ciba Foundation Symposium). 186:27-53, 1994. 1. Crowe C C, Sanders W E Jr, Longley S. Bacterial interference. 9. Sanders C C, Sanders W E, Enicin: An Antibiotic Produced II. Role of the normal throat flora in prevention of by Streptococcus salivarius That May Contribute to colonization by Group A Streptococcus. J. Infect. Dis. 128:527- Protection Against Infections Due to Group A Streptococci. 32, 1973. J. Infect. Dis. 146(5):683-90,1982. 2. Fantinato V, Zelante F. Streptococcus salivarius: detecção 10. Sanders, C C, Sanders W E, Harrowe D J. Bacterial de cepas produtoras de substâncias semelhantes a bacteriocina Interference: Effects of Oral Antibiotics on the Normal Throat contra algumas bacterias bucais. Rev. Microbiol. 22(1):1-6, Flora and Its Ability to Interfere with Group A Streptococci. 1990. Infect. Immun. 13(3):808-12, 1976. 3. Hardie J M, Bowden G H. Physiological classification of oral 11. Sanders E. Bacterial interference. I. Its ocurrence among the viridans streptococci. J. Dent. Res. 55 (special issue A):166-76, respiratory tract flora and characterization of inhibition of 1976. group A streptococci by viridans streptococci. J. Infect. Dis. 4. Jacob F, Lwoff A, Simminovitch A, Wollman E. Definition 120:698 707, 1979. de quelques terms relatifs a la lysogenie. Ann. Inst. Pasteur. 12. Tagg J R , Ragland N L. Applications of BLIS typing to (Paris) 84:222-24, 1953. studies of the survival on surfaces of salivary streptococci and staphylococci. J. Appl. Bacteriol. 71:339-42, 1991.
334 ORIGINALJamali ARTICLE et al
Impact of Chlorhexidine Pretreatment Followed by Probiotic Streptococcus salivarius Strain K12 on Halitosis in Children: A Randomised Controlled Clinical Trial
Zahra Jamalia / Naser Asl Aminabadib / Mohammad Samieic / Alireza Sighari Deljavand / Marzieh Shokravie / Sajjad Shirazif
Purpose: The aim of this study was to examine the effect of chlorhexidine disinfection, as a chemical method of oral hygiene practice, and subsequent use of probiotics on halitosis in children. The effects of mechanical and chemical oral hygiene practice methods on the severity of halitosis were also assessed.
Materials and Methods: 208 children with organoleptic test (OLT) scores of 2 or more were randomly assigned to four groups: A: conventional oral hygiene practices (COH) including toothbrushing and flossing; B: COH + tongue scraping (TS); C: COH + TS + chlorhexidine; D: COH + TS + chlorhexidine + probiotics. OLT was performed at 1-week and 3-month follow-ups.
Results: A significant and stable number of participants showed major and moderate levels of improvement in OLT scores in group D (p < 0.001). The improvement of OLT scores in group C was also significant (p < 0.001), but not stable over the follow-ups (p = 0.44). Neither significant nor stable improvements in the OLT scores were detected in groups A and B through follow-ups (p > 0.05).
Conclusion: Probiotic therapy following oral disinfection with chlorhexidine may reduce the severity of halitosis over longer periods.
Key words: antimicrobial agent, chlorhexidine, halitosis, oral hygiene, probiotics
Oral Health Prev Dent 2016;14:305-313 Submitted for publication: 18.02.15; accepted for publication: 18.09.15 doi: 10.3290/j.ohpd.a36521
alitosis or oral malodor is any unpleasant odor the imbalance of the normal microflora of the tongue Hemerging from the mouth that is detected by dorsum, saliva and the periodontal pockets.2,7 others. It may be a result of several intra- and extra- Several strategies have been developed for ei- oral factors.26 Although halitosis has a multifactori- ther elimination or alleviation of halitosis, targeting al aetiology, localised factors play a major role in the potential origins such as poor oral hygiene, gin- most cases; 90% of oral odor originates from the gival inflammation, dental plaque, dental caries or oral cavity as a result of microbial metabolism and salivary flow reduction.2,21 Nonetheless, the cur-
a Assistant Professor, Department of Oral Science, Faculty of Den- e Postgraduate Student, Department of Paediatric Dentistry, Fac- tistry, Tabriz University of Medical Science, Tabriz, East Azerbai- ulty of Dentistry, Tabriz University of Medical Science, Tabriz, East jan, Iran. Data acquisition and interpretation, wrote the manu- Azerbaijan, Iran. Data acquisition and interpretation, wrote the script, gave final approval and agreed to be accountable for all manuscript, gave final approval and agreed to be accountable for aspects of the work. all aspects of the work. b Professor, Department of Paediatric Dentistry, Faculty of Den- f Research Fellow and Lecturer, Dental and Periodontal Research tistry, Tabriz University of Medical Science, Tabriz, East Azerbai- Centre and Student Research Committee, Faculty of Dentistry, jan, Iran. Conception and design, critically revised the manu- Tabriz University of Medical Science, Tabriz, East Azerbaijan, Iran. script, gave final approval and agreed to be accountable for all Conception and design, critically revised the manuscript, consult- aspects of the work. ed on and performed statistical evaluation, contributed substan- c Associate Professor, Department of Endodontics, Faculty of Den- tially to discussion, gave final approval and agreed to be account- tistry, Tabriz University of Medical Science, Tabriz, East Azerbai- able for all aspects of the work. jan, Iran. Contributed substantially to discussion, gave final ap- proval and agreed to be accountable for all aspects of the work. d Research Assistant, Faculty of Dentistry, Tabriz University of Med- Correspondence: Professor Naser Asl Aminabadi, Department of ical Science, Tabriz, East Azerbaijan, Iran. Data acquisition and Paediatric Dentistry, Faculty of Dentistry, Tabriz University of Medical interpretation, wrote the manuscript, gave final approval and Science, Daneshgah St, Golgasht St, 51665, Tabriz, East Azerbaijan, agreed to be accountable for all aspects of the work. Iran. Tel: +989-144-157-200; Email: [email protected]
Vol 14, No 4, 2016 305 Jamali et al rent trend focuses on non-selective anti-bacterial The current study was designed to assess the treatment to reduce the total number of oral micro- effects of prophylactic use of CHX and subsequent flora. Such protocols typically require physical or probiotic consumption on oral malodor in children. chemical therapy to be carried out daily and only The study design and hypothesis were based on provide a short-term benefit, as the malodor-caus- the principle of competitive exclusion, which fa- ing bacteria quickly recover once treatment stops.10 vours the beneficial bacteria if they adhere to vari- Probiotics, by a generally-accepted definition, ous parts of mouth before pathogenic strains do consist of a live microbial food supplement which so. Thus, the current study compared the effect of beneficially affects the host by improving its intes- probiotic strains along with different mechanical tinal microbial balance. Probiotics confer a health and chemical methods of oral hygiene practice on benefit on the host and may have beneficial appli- oral malodor. Four sets of variables, including (a) cations in the reduction of halitosis.13 The use of DMFT/dmft, (b) mechanical and chemical oral hy- probiotics in treatment of gingivitis, periodontal giene practices, (c) mechanical and chemical oral disease17 and risk reduction of candidal mucosal hygiene practices along with consumption of S. infections has been described.23 It has also been salivarius probiotics, (d) oral malodor, in addition to proposed that probiotics may have anti-cariogenic parental satisfaction about the treatment results, activity by inhibition of mutans streptococci.12 Their were analysed to determine how mechanical/chem- mechanism of action is based on their ability to ical oral hygiene practices along with application of compete with pathogenic microorganisms for adhe- probiotic bacteria influence oral malodor in children sion sites such as biofilm or dental plaque and to to test the hypothesis that a marked alteration in antagonise these pathogens.10,28 the balance between oral microbiota and probiotic Several studies were performed to replace bac- strains – along with routine mechanical methods – teria responsible for halitosis with probiotic bacte- can lead to the rapid purging of inherent pathogenic ria such as Streptococcus salivarius (K12), Lactoba- bacterial populations, thereby quickly switching to a cillus salivarius or Weissella cibaria. The general more persistent colonisation with probiotic strains objective is to prevent re-establishment of undesir- and consequently treatment of oral malodor. able bacteria and thereby prevent the reoccurrence of oral malodor.15,17 A study on individuals with halitosis reported reduced levels of volatile sulphur MATERIALS AND METHODS compounds after consumption of gum or lozenges containing S. salivarius (K12).10 Kang et al19 showed Participants that W. cibaria produces hydrogen peroxide, which inhibits the growth of Fusobacterium nucleatum and This randomised clinical trial was performed at the causes a marked reduction in the production of hy- Department of Paediatric Dentistry, Tabriz Univer- drogen sulphide and methanethiol, hence diminish- sity of Medical Sciences, during the period from ing foul odors.19 However, recurrence of oral malo- July to October 2014. The children admitted to this dor over a prolonged period persists as a main department are mostly referrals from general den- concern using these protocols. tal practitioners working in the area, and also from When levels of oral microbiota are sufficiently di- Tabriz Paediatric Hospital, for comprehensive as- minished in the oral cavity, adding beneficial live sessments as well as routine dental treatments. bacteria can lead to the switching of a pathogenic Once admitted, a comprehensive medical and den- condition to a more stable colonisation with probi- tal history is taken and a treatment plan is estab- otic strains.4 Therefore, it seems reasonable to lished for each patient. presume that a marked alteration in the balance During the study period, 312 children whose par- between oral microbiota responsible for halitosis ents reported degrees of oral malodor were select- and probiotic strains after exposure to an antimi- ed consecutively through careful screening for the crobial agent (e.g. chlorhexidine) provides a more following criteria: efficient colonisation of probiotic strains and there- • Children with non-compromised oral health, no fore more long-lasting treatment of oral malodor. clinical signs of gingivitis or periodontal disease Chlorhexidine (CHX) is widely used for chemical and no current orthodontic therapy. plaque control because of its antibacterial effect • Absence of systemic conditions or developmen- on both Gram-positive and Gram-negative microor- tal disturbances that have an association with ganisms. oral malodor, such as diabetes mellitus, renal
306 Oral Health & Preventive Dentistry Jamali et al
disease, gastrointestinal tract disorders, respir- Randomisation and blinding atory disease, chronic sinusitis and local/sys- temic conditions affecting saliva quality and A random allocation list was generated using ran- quantity. domisation software (RandList version 1.2, DatIng; • No use of medications affecting the quality and Tübingen, Germany) to allocate subjects to each quantity of saliva for the last six months. group, one by one according to their order of admis- • No habitual mouth breathing. sion. The operator was not blinded to the interven- • No previous consumption of probiotic products. tions because of different manipulation techniques implemented for the studied groups. All other con- The study design, which was in accordance with tributors to the study were blinded to the generation the Helsinki Declaration of Human Rights, was sub- and implementation of the treatment assignment. mitted to and approved by the Committee for Eth- ics in Research on Humans at Tabriz University of Medical Sciences (Ref. No.: 7663). Study groups and interventions
One week after the first stage, 208 children who Sample size and power calculation had an OLT score of 2 or more were randomly as- signed to four groups, each consisting of 52 par- To estimate sample size based on a mean com- ticipants: group A, conventional oral hygiene prac- parison test, the SAS 9.1 statistical software pack- tices (COH) including toothbrushing and flossing; age (SAS Institute; Cary, NC, USA) was used. Ac- group B, COH + tongue scraping (TS); group C, chlo- cording to a pilot study, assuming the mean change rhexidine (CHX) + COH+ TS; group D, CHX + COH + in halitosis in the four groups and considering TS + probiotics (PB). The parents and children were _ = 0.05 and power = 80%, the 15% outcome dif- informed of the nature of the interventions. ference led to a required sample size of 38 for All subjects in group A performed COH using each group, which was increased to 52 to improve toothpaste (Colgate Total, Colgate; Sydney, Austral- the power of the study and compensate for proba- ia) and flossing. In group B, COH was followed by TS ble loss to follow-up. using a plastic tongue scraper for 30 s. In group C, COH and TS were supplemented by a 30-s rinse with 5 ml of mouthwash containing 0.12% CHX (Peri- Subject recruitment dex, Omni Oral Pharmaceutical; West Palm Beach, FL, USA) twice daily 1 h after toothbrushing for two At the baseline visit, the objectives of the study weeks. The children in group D received COH, TS and its methodology were explained to the parents. and CHX mouthwash as described for group C, and A detailed medical history interview was conducted then were asked to suck a probiotic lozenge contain- with the parents, and they were asked to inform the ing >1 x 109 colony forming units (CFU) of S. salivar- interviewer of any need for antibiotics during the ius (K12). No toothbrushing was allowed for at least study course. Sample selection consisted of two 1 h after lozenge consumption for 2 weeks. As the consecutive phases. In the first phase, a total of substantivity of CHX is 8–12 h,4 consumption of loz- 312 healthy children aged 6 to 9 years (182 fe- enges started 24 h after cessation of CHX applica- males and 130 males) with reported oral malodor tion. The subjects attended the Department of Pae- were enrolled at the Department of Paediatric Den- diatric Dentistry every week for check-ups, and their tistry. The malodor was determined using an or- records were registered in the chart. Those who did ganoleptic test (OLT), a method used for the direct not follow the given instructions were excluded from sniffing of expelled mouth air. The OLT scores were the study during the study course. estimated on a 6-point scale of 0 to 5. Subjects having an organoleptic score of 2 or more were re- cruited. Thereafter, all dental treatments including Oral malodor assessment pulp treatments, restorations or extraction were performed as indicated. The organoleptic test (OLT) is the simplest method In the second phase, 208 subjects who received of oral malodor measurement by human judges dental treatment as needed and had an OLT score and reflects an everyday situation. It is considered of 2 or higher were included in the study. to be the gold standard for measuring bad breath.29
Vol 14, No 4, 2016 307 Jamali et al
Table 1 Definition of different levels in the organoleptic test (OLT)
Score Description
0Absence of odor
1 Questionable odor: odor is detectable, although the examiner could not recognise it as malodor
2 Slight malodor: odor is deemed to exceed the threshold of malodor recognition
3 Moderate malodor: malodor is definitely detected
4 Strong malodor: malodor is objectionable but examiner can tolerate it
5 Severe malodor: overwhelming malodor, examiner cannot tolerate it
The subjects were asked to refrain from eating, Table 2 Numerical scale indicating degree of improve- drinking, chewing gum, smoking, brushing or rins- ment of halitosis in adolescents ing the mouth for at least 5 h. Each subject was instructed to remain quiet with lips closed for a pe- Improvement Decrease in degree of halitosis riod of 30 s and then asked to exhale through the Major Organoleptic score change > 2 mouth with a moderate force at a distance of ap- Moderate Organoleptic score change = 2 proximately 10 cm from the investigator. The oral malodor scores were recorded on a 6-point scale Slight Organoleptic score change = 1 of 0 to 5 as follows: 0, no odor; 1, barely noticeable No improvement Organoleptic score change = 0 odor; 2, slight but clearly noticeable odor; 3, mod- erate odor; 4, strong odor; 5, extremely foul odor. A score of 2 was diagnosed as halitosis (Tables 1 question ‘Are you satisfied with the overall improve- and 2). ment in your child’s halitosis?’ Parents were asked The two examiners were experienced dental hy- to rate their responses on a 3-point Likert scale: 1 gienists with previous experience in assessment of (not at all satisfied); 2 (moderately satisfied); 3 malodor and no history of chronic allergies or asth- (completely satisfied). ma. They had completed a sensory training exer- cise using smelling test strips dipped in 0-, 10-, 50-, 100-, 500- and 1000-ppb methyl mercaptan Statistical analysis (provided by the Faculty of Pharmacy) and conduct- ed pre- and post-training odor measurements dur- The main statistical tests addressing the research ing the pilot study. The percentage of agreement in question were the chi-squared test or Fisher’s Ex- scores exceeded 80% (g = 0.86). act test to assess differences between gender On the examination day, to enable the most reli- and study groups, and one-way ANOVA to compare able measurement results, the examiners were quantitative data. A post-hoc test was applied to asked to restrict their consumption of beverages compare differences between groups. In case of such as coffee, tea, and juice and avoid smoking statistical significance, Bonferroni-Holm correc- and use of scented cosmetics before the OLT tion was carried out. Data were analysed using measurements. To avoid adaptation of the examin- SPSS software (version 16), with p < 0.05 consid- ers’ sense of smell to possibly detectable odors, ered statistically significant. The Kappa statistic there was a break of 5 min after each examination. was calculated for interexaminer reliability assess- OLT measurements were carried out at 1 week ment. and 3 months following interventions by the two ex- aminers who were blinded to the interventions. In case of disagreement, examination by a third exam- RESULTS iner was recorded as the outcome. The flow of par- ticipants and interventions were followed from alloca- The 208 participants consisted 91 females and tion to the final data analysis after 3 months (Fig 1). 117 males, 6–9 years of age (mean: 7.46 ± 1.09 Parental satisfaction about the treatment result years), organised into four groups. Eleven subjects was assessed through parental response to the were excluded from the study because they did not
308 Oral Health & Preventive Dentistry Jamali et al
Assessed for eligibility (n=312)
Enrollment Excluded (n=104) • Did not meet inclusion criteria (n=98) • Declined to participate (n=6)
Randomised (n=208)
Allocation
Allocated to COH Allocated to COH+TS Allocated to COH+TS+CLH Allocated to (n=52) (n=52) (n=52) COH+TS+CLH+PB (n=52) Received allocated interven- Received allocated interven- Received allocated interven- Received allocated interven- tion (n=50) tion (n=49) tion (n=49) tion (n=49) Did not receive allocated Did not receive allocated Did not receive allocated Did not receive allocated intervention (inaccessible intervention (migration to intervention (migration to intervention (use of subjects) (n=2) other place) (n=3) other place) (n=3) antibiotics) (n=3)
First follow-up: one week after intervention
Major improvement (n=5) Major improvement (n=12) Major improvement (n=22) Major improvement (n=21) Moderate improvement Moderate improvement Moderate improvement Moderate improvement (n=7) (n=14) (n=15) (n=18) Slight improvement (n=20) Slight improvement (n=10) Slight improvement (n=10) Slight improvement (n=8) No improvement (n=18) No improvement (n=13) No improvement (n=2) No improvement (n=2) Lost to follow-up (n=0) Lost to follow-up (n=0) Lost to follow-up (n=0) Lost to follow-up (n=0)
Second follow-up: three months after intervention
Major improvement (n=4) Major improvement (n=10) Major improvement (n=12) Major improvement (n=19) Moderate improvement Moderate improvement Moderate improvement Moderate improvement (n=6) (n=11) (n=10) (n=19) Slight improvement (n=25) Slight improvement (n=15) Slight improvement (n=15) Slight improvement (n=9) No improvement (n=15) No improvement (n=13) No improvement (n=12) No improvement (n=2) Lost to follow-up (n=0) Lost to follow-up (n=0) Lost to follow-up (n=0) Lost to follow-up (n=0)
Analysis
Analysed (n=197) Excluded from analysis (n=11)
Fig 1 Flow diagramme of study participants.
Vol 14, No 4, 2016 309 Jamali et al
Table 3 Baseline characteristics of the study samples Group A Group B Group C Group D (n = 50) (n = 49) (n = 49) (n = 49) p-value Demographic parameters Age (y) 7.54 ± 1.18 7.31 ± 1.12 7.53 ± 1.01 7.45 ± 1.10 0.42* Male 27 (54%) 18 (36.7%) 21 (42.9%) 25 (51%) Sex 0.3** Female 23 (46%) 31 (63.3%) 28 (57.1%) 24 (49%) Clinical parameters Number of teeth 24.32 ± 4.08 24.11 ± 4.23 25.68 ± 4.32 25.27 ± 5.76 0.21* Plaque index 55.22 ± 10.23 52.46 ± 9.35 61.38 ± 8.59 54.73 ± 8.42 0.09* OLT score 3.02 ± 0.83 2.84 ± 0.72 3.28 ± 0.68 3.15 ± 0.41 0.08* * Results of one-way ANOVA. ** Results of chi-squared test.
Table 4 Organoleptic test (OLT) score according to the subjects’ caries experience Caries experience level Caries free dmft/ Low dmft/ Moderate 2 ≤ dmft/ High dmft/ DMFT = 0 DMFT = 1 DMFT ≤ 3 DMFT ≥ 4 p-value OLT 2.6 ± 0.4 2.8 ± 0.5 3 ± 0.3 3 ± 0.2 0.24 score complete the trial period. Baseline characteristics Intergroup comparison of the study samples are shown in Table 3. The agreement between the two examiners at The levels of improvement at the first (F1) and sec- baseline and the 3-month follow-up was excellent ond follow-up (F2) sessions for all groups are shown (baseline g = 0.87, p < 0.001; final follow-up in Table 5. There was no significant difference in g = 0.91, p < 0.001). There was no need for a third the OLT scores between groups A and B (p = 0.11) examiner to make a reference decision. nor between groups C and D at the first follow-up An increase in the OLT scores was seen with in- (p = 0.27). However, OLT scores differed signifi- creasing DMFT/dmft levels, but this was not statis- cantly between groups B and C (p = 0.03), A and C tically significant (p > 0.05; Table 4). (p < 0.001), A and D (p < 0.001), and B and D (p < 0.001). At the second follow-up, there was no significant difference between groups A and B Intragroup results (p = 0.51), groups B and C (p = 0.18) or groups A and C (p = 0.33). Comparing all groups at the sec- Group A: A statistically significant number of sub- ond follow-up, a significant difference in the OLT jects showed no or slight improvement in OLT scores scores for groups C and D (p < 0.001), groups A at the first and second follow-up sessions (p = 0.03). and D (p = 0.02) and groups B and D (p < 0.001) Group B: No statistically significant difference was was observed. The differences between groups A registered between degree of the improvement in and C, A and D, and B and D at the first follow-up, OLT scores at the first and second follow-up ses- and groups B and D, as well as C and D at the sec- sions (p = 0.18). Group C: A statistically significant ond follow-up were still significant after Bonferroni- number of the participants had major and moderate Holm correction. The improvement of OLT scores in levels of improvement in OLT scores at the first fol- group D was maintained through the first and sec- low-up (p < 0.001), while the improvement was not ond follow-ups, while a worsening in other groups statistically significant at the second follow-up was recorded at the 3-month follow-up. (p = 0.44). Group D: At the first and second follow- Considering parents’ satisfaction with the treat- up sessions, a statistically significant number of ment outcome at the 3-month follow-up session, participants showed major and moderate levels of 39 (79.59%) and 45 (91.83%) parents in group C improvement in OLT scores (p < 0.001). and D, respectively, were very satisfied regarding
310 Oral Health & Preventive Dentistry Jamali et al
Table 5 Improvements in organoleptic test score in the first and second follow-ups across all study groups Group A (N=50) Group B (N=49) Group C (N=49) Group D (N=49) Level of improvement F1 F2 F1 F2 F1 F2 F1 F2 Major 5 (10.0) 4 (8.0) 12 (24.5) 10 (20.5) 22 (44.9) 12 (24.5) 21 (42.9) 19 (38.8) Moderate 7 (14.0) 6 (12.0) 14 (28.6) 11 (22.4) 15 (30.6) 10 (20.5) 18 (36.8) 19 (38.8) Slight 20 (40.0) 25 (50.0) 10 (20.4) 15 (30.6) 10 (20.5) 15 (30.6) 8 (16.3) 9 (18.4) No improvement 18 (36.0) 15 (30.0) 13 (26.5) 13 (26.5) 2 (4.0) 12 (24.4) 2 (4.0) 2 (4.0) A and B p-values: p F1 = 0.11, p F2 = 0.51 B and C p-values: p F1 = 0.03, p F2 = 0.18 C and D p-values: p F1 = 0.27, p F2 < 0.001* A and C p-values: p F1 < 0.001*, p F2 = 0.33 A and D p-values: p F1 < 0.001*, p F2 = 0.02 B and D p-values: p F1 < 0.001*, p F2 < 0.001* * Significant after Bonferroni-Holm correction. F1: first follow-up session; F2: second follow-up session. their children’s halitosis, while in groups A and B al methods to induce a significant decrease in oral only 21 (42.00%) and 25 (51.02%), respectively, malodor in groups C and D compared to that in were very satisfied. The difference in parental satis- groups A and B. Considering the bacterial activity faction values between groups C and D and groups of mainly gram-negative anaerobes as the major A and B was statistically significant (p = 0.01). origin of persistent oral malodor,3 it is a plausible postulate that improvement of oral hygiene along with the use of antimicrobial products can often DISCUSSION prevent or manage oral malodor due to a decrease in bacterial activity and population.25 Similarly, cur- The main objective of the present study was to rent evidence shows good short-term reduction in compare the efficacy of mechanical methods of halitosis scores with CHX, while long-term use is oral hygiene practice with and without CHX and pro- neither recommended nor effective.8 CHX is con- biotic bacteria (S. salivarius) on oral malodor. sidered the gold standard and primary agent for S. salivarius appears to have excellent creden- controlling plaque and gingivitis.20 The antibacterial tials as an oral probiotic because it is unlikely to activity of CHX is related to the cationic molecule, contribute significantly to oral malodour.31 It has which is rapidly attracted by the negatively charged been shown that S. salivarius (K12) suppressed the bacterial cell surfaces. After adsorption, the integ- growth of the various reference strains of bacteria rity of the bacterial cell membrane is altered, which implicated in halitosis. More importantly, this bac- results in a reversible leakage of bacterial low mo- terial strain is a pioneer coloniser of oral surfaces lecular-weight components at low dosage or more and is a numerically predominant nondisease-as- severe membrane damage at higher doses.27 How- sociated member of the oral microbiota of healthy ever, long-term use of CHX is associated with ex- humans.20 It is also is known as the commensal trinsic staining of the teeth and tongue, increased probiotic of the oral cavity because of its ability to calculus formation, irritation of oral mucosa, burn- produce bacteriocins that contribute to the reduc- ing sensation and alteration of the taste sense.30 tion of bacterial species implicated in halitosis. In Although the chemical method of oral hygiene vitro testing has shown that S. salivarius K12 sup- practice in group C yielded a significant decrease in presses the growth of black-pigmented bacteria in halitosis score at the first follow-up session, the re- the oral cavity. Reduced levels of volatile sulphur occurrence of oral malodor at the second follow-up compounds after consumption of gum or lozenges confirmed the main concern of previous studies on containing S. salivarius K12 have been reported in reducing oral malodor using CHX. Conversely, im- patients with halitosis.20 proved halitosis values in group D did not show sig- We found the chemical method of oral hygiene nificant differences between the follow-ups. There- practice using CHX in combination with convention- fore, the result seen in group D confirms our
Vol 14, No 4, 2016 311 Jamali et al hypothesis that probiotic therapy following oral dis- bacillus sp. and Porphyromonas sp., have also re- infection may be an effective approach for longer- ceived considerable attention as pathogens respon- term control of oral malodor. The principle of com- sible for halitosis. In addition, recent findings have petitive exclusion, meaning the suppression of oral shown that an increase in the salivary pH and buff- pathogens using CHX and promotion of the growth ering capacity and decrease in viscosity is linearly of probiotics, seems to provide a reasonable expla- related to the number of eliminated carious tooth nation for this finding. In fact, based on the principle surfaces.7,10 Therefore, it seems logical to assume of competitive exclusion, a reduction in oral micro- that lower carbohydrate accumulation and salivary bial counts provides a unique opportunity for easy viscosity, plaque removal, increased pH and buffer- colonisation with probiotic strains.5,29 Accordingly, ing capacity result in the elimination of cariogenic effective biofilm control strategies should control bacteria and caries, and finally less halitosis.7 microbial activity to prevent colonisation with select- Since providing quality outcomes as well as pa- ed microorganisms while supporting the growth of tient satisfaction with treatment is the priority and other selected species.5,29 Our results are in agree- the primary competitive edge in any healthcare sys- ment with those of Iwamoto et al,18 who showed tem, we also evaluated the extent to which the par- that oral administration of probiotic lactobacilli pri- ents’ satisfaction with the improvement in halitosis marily improved oral halitosis. However, considering differed from that of the healthcare practitioners. the small number of participants and the short fol- Interestingly, the perceptions of parents and practi- low-up period, they suggested further work to im- tioners were consistent regarding the level of im- prove the stability of L. salivarius in the complex oral provement in halitosis. Current evidence reveals microflora and allow it to maintain its activity.24 that patient satisfaction surveys using ratings are The results obtained in groups A and B are not leading indicators of healthcare outcomes, includ- surprising. Relative improvement in group B com- ing compliance with medical advice, likelihood to pared to that in group A may be attributed to the recommend, and return visits for care.11,24 A pa- fact that oral malodor arises mainly from the resi- tient-centered approach should take into account dent microbes – particularly anaerobic ecosystems the patient’s needs, expectations, and evaluations – on the dorsum of the tongue. The papillary struc- for the purpose of quality improvement. It is impor- ture of the dorsum represents a unique ecological tant to help parents and their children see the situ- niche in the oral cavity, offering a large surface ation during treatment planning the same way den- area that favors the accumulation of oral debris tists sees it, so that everyone has similar and microorganisms. Therefore, the posterior dor- expectations of the treatment. sum of the tongue is the principal site for the bac- terial mass producing malodorous compounds.16,24 It has been suggested that there is a direct rela- CONCLUSIONS tionship between the quantity of microbes present and the degree of odor.16 Based on the results of the present study, it can be Although the result of the preliminary phase of concluded that mechanical removal of biofilm and the study revealed a relationship between DMFT/ microorganisms responsible for oral malodor is the dmft and halitosis, OLT scores according to differ- first step in controlling halitosis.9 In view of the fact ent levels of the DMFT/dmft did not differ signifi- that 60% of halitosis originates from the surface of cantly. A small number of studies investigating the the tongue,24 it is reasonable to recommend tongue relationship between caries and halitosis have scraping as a main mechanical oral hygiene prac- shown inconsistencies in their findings. Evirgen et tice to prevent halitosis. In addition, the mechani- al14 suggested there is no significant relationship cal oral hygiene methods could be supplemented between DMFT/dmft and halitosis. It is reported by a chemical regimen (e.g. CHX) as a superior ap- that young children with oral malodor are caries proach in removing biofilm.6 According to the pre- free; whereas age-matched children without malo- sent results, probiotic therapy following oral disin- dor have moderate to high caries activity.22 The fection with CHX may be a practical method to contradictory results may be related to the fact that induce a persistent switch in the oral microbiota the aetiological factors of caries, periodontal dis- and improve malodor. eases and oral malodor are mostly associated with However, a generalisation of the present findings bacterial accumulation and plaque composition. to broader implementation necessitates further in- Some of the bacteria causing caries, such as Lacto- vestigation, particularly considering selected oral
312 Oral Health & Preventive Dentistry Jamali et al biofilm and microbial activities to prevent colonisa- 13. Duchmann R. The role of probiotics and antibiotics in regu- lating mucosal inflammation. Adv Exp Med Biol 2006;579: tion of selected organisms while supporting the 219–226. growth of probiotic bacteria to establish control 14. Evirgen S, Kamburoğlu K. Effects of tongue coating and strategies. Further studies, including large-scale oral health on halitosis among dental students. Oral randomised clinical trials, are needed to determine Health Prev Dent 2013;11: 169–173. the efficacy of other probiotic strains targeting mi- 15. Gupta G. Probiotics and periodontal health. J Med Life croorganisms responsible for oral malodor, as well 2011;4: 387–394. 16. Hartley G, McKenzie C, Greenman J, El-Maaytah MA, Scul- as other salivary parameters. ly C, Porter S. Tongue microbiota and malodour.Effects of metronidazole mouthrinse on tongue microbiota and breath odour. Microb Ecol Health Dis 1999;11: 226–233. ACKNOWLEDGEMENTS 17. Haukioja A. Probiotics and Oral Health. Eur J Dent 2010;4: 348–355. This study was supported and funded by Tabriz University of Medical 18. Iwamoto T, Suzuki N, Tanabe K, Takeshita T, Hirofuji T. Ef- Sciences. The authors would like to thank the staff at the Depart- fects of probiotic Lactobacillus salivarius WB21 on halito- ment of Paediatric Dentistry for their assistance, and the parents sis and oral health: an open-label pilot trial. Oral Surg Oral and children for participating in the study. We are also grateful to Dr. Med Oral Pathol Oral Radiol Endod 2010;110: 201–208. Morteza Ghojazadeh for his contribution to statistical analysis. 19. Kang MS, Chung J, Kim SM, Yang KH, Oh JS. Effect of Weissella cibaria isolates on the formation of Streptococ- cus mutans biofilm. Caries Res 2006;40:418–425. 20. Kazor CE, Mitchell PM, Lee AM, Stokes LN, Loesche WJ, REFERENCES Dewhirst FE, Paster BJ. Diversity of bacterial populations on the tongue dorsa of patients with halitosis and healthy 1. Addy M, Moran JM. Clinical indications for the use of patients. J Clin Microbiol 2003;41: 558–563. chemical adjuncts to plaque control: chlorhexidine formu- 21. Kim YJ, Chung JW, Lee SJ, Choi KS, Kim JH, Hahm KB. lations. Periodontol 2000 1997;15:52–54. Progression from chronic atrophic gastritis to gastric can- 2. Akaji EA, Folaranmi N, Ashiwaju O. Halitosis: a review of cer; tangle, toggle, tackle with Korea red ginseng. J Clin the literature on its prevalence, impact and control. Oral Biochem Nutr 2010;46: 195–204. Health Prev Dent 2014;12: 297–304. 22. Loesche WJ, Kazor C. Microbiology and treatment of hali- 3. Allaker RP, Waite RD, Hickling J, North M, McNab R, Bos- tosis. Periodontol 2000 2002;28: 256–279. ma MP, Hughes FJ. Topographic distribution of bacteria 23. Nett JE, Marchillo K, Spiegel CA, Andes DR. Development associated with oral malodour on the tongue. Arch Oral and validation of an in vivo Candida albicans biofilm den- Biol 2008;53: 8–12. ture model. Infect Immun 2010;78;3650–3659. 4. Aminabadi NA, Erfanparast L, Ebrahimi A, Oskouei SG. Ef- 24. Parhiscar A, Rosenfeld RM. Can patient satisfaction with fect of chlorhexidine pretreatment on the stability of sali- decisions predict compliance with surgery? Otolaryngol vary lactobacilli probiotic in six- to twelve-year-old children: Head Neck Surg 2002;126: 365–370. a randomized controlled trial. Caries Res 2011;45: 25. Porter SR, Scully C. Oral malodour (halitosis). BMJ 148–154. 2006;333: 632–635. 5. Anderson MH, Shi W. A probiotic approach to caries man- 26. Pratibha PK, Bhat KM, Bhat GS. Oral malodor: a review of agement. Pediatr Dent 2006;28:151–153. the literature. J Dent Hyg 2006;80:1-9. 6. Armstrong BL, Sensat ML, Stoltenberg JL. Halitosis, a re- 27. Rolla G, Melsen B. On the mechanism of plaque inhibition view of current literature. J Dent Hyg 2010;84: 65 –74. by chlorhexidine. J Dent Res 1975;54: 57–62. 7. Aylıkcı BU, Colak H. Halitosis: From diagnosis to manage- 28. Singh VP, Sharma J, Babu S, Rizwanulla, Singla A. Role of ment. J Nat Sci Biol Med 2013;4: 14–23. probiotics in health and disease: a review. J Pak Med As- 8. Bosy A. Oral malodor: philosophical and practical aspects. soc 2013;63:253–257. J Can Dent Assoc 1997;63: 196–201. 29. Sopapornamorn P, Ueno M, Vachirarojpisan T, Shinada K, 9. Brunette DM, Proskin HM, Nelson BJ. The effects of denti- Kawaguchi Y. Association between oral malodor and frice systems on oral malodor. J Clin Dent 1998;9: 76–82. measurements obtained using a new sulfide monitor. J 10. Burton JP, Chilcott CN, Moore CJ, Speiser G, Tagg JR. A Dent 2006;34: 770–774. preliminary study of the effect of probiotic Streptococcus 30. Wu CD, Savitt E. Evaluation of the safety and efficacy of salivarius K12 on oral malodour parameters. J Appl Micro- over-the-counter oral hygiene products for the reduction biol 2006;100: 754–764. and control of plaque and gingivitis. Periodontol 2000 11. Cameron C. Patient compliance: recognition of factors in- 2002;28: 91–105. volved and suggestions for promoting compliance with 31. Yoshida Y, Negishi M, Amano A, Oho T, Nakano Y. Differ- therapeutic regimens. J Adv Nurs 1996;24: 244–250. ences in the betaC-S lyase activities of viridans group 12. Çaglar E, Cildir S, Ergeneli S, Sandalli N, Twetman S. Sali- streptococci. Biochem Biophys Res Commun 2003;300: vary mutans streptococci and lactobacilli levels after in- 55–60. gestion of the probiotic bacterium Lactobacillus reuteri ATCC 55730 by straws or tablets. Acta Odontol Scand 2006;64:314–318.
Vol 14, No 4, 2016 313
AOB-2765; No. of Pages 7
a r c h i v e s o f o r a l b i o l o g y x x x ( 2 0 1 2 ) x x x – x x x
Available online at www.sciencedirect.com
journal homepage: http://www.elsevier.com/locate/aob
Antimicrobial activity of Streptococcus salivarius K12 on
bacteria involved in oral malodour
a a a, a b a
L. Masdea , E.M. Kulik , I. Hauser-Gerspach *, A.M. Ramseier , A. Filippi , T. Waltimo
a
Institute of Preventive Dentistry and Oral Microbiology, School of Dental Medicine, University of Basel, Switzerland
b
Department of Oral Surgery, Oral Radiology and Oral Medicine and the Centre of Dental Traumatology, School of Dental Medicine, University
of Basel, Switzerland
a r t i c l e i n f o a b s t r a c t
Article history: Objective: To investigate the antimicrobial activity of the bacteriocin-producing strain
Accepted 11 February 2012 Streptococcus salivarius K12 against several bacteria involved in halitosis.
Design: The inhibitory activity of S. salivarius K12 against Solobacterium moorei CCUG39336,
Keywords: four clinical S. moorei isolates, Atopobium parvulum ATCC33793 and Eubacterium sulci
ATCC35585 was examined by a deferred antagonism test. Eubacterium saburreum ATCC33271
Streptococcus salivarius K12
Halitosis and Parvimonas micra ATCC33270, which have been tested in previous studies, served as
positive controls, and the Gram-negative strain Bacteroides fragilis ZIB2800 served as a
Solobacterium moorei
negative control. Additionally, the occurrence of resistance in S. moorei CCUG39336 to S.
Deferred antagonism test
Bacteriocin salivarius K12 was analysed by either direct plating or by passage of S. moorei CCUG39336 on
chloroform-inactived S. salivarius K12-containing agar plates.
Results: S. salivarius K12 suppressed the growth of all Gram-positive bacteria tested, but the
extent to which the bacteria were inhibited varied. E. sulci ATCC35585 was the most sensitive
strain, while all five S. moorei isolates were inhibited to a lesser extent. Natural resistance
seems to be very low in S. moorei CCUG39336, and there was only a slight decrease in
sensitivity after exposure to S. salivarius K12 over 10 passages.
Conclusion: Our studies demonstrate that S. salivarius K12 has antimicrobial activity against
bacteria involved in halitosis. This strain might be an interesting and valuable candidate for
the development of an antimicrobial therapy for halitosis.
# 2012 Elsevier Ltd. All rights reserved.
compounds consist of VSC (volatile sulphur compounds),
1. Introduction 2
valeric acid, butyric acid and putrescine. A diverse group of
Gram-negative and Gram-positive bacteria has been found to
Oral malodour, also called halitosis, afflicts a significant contribute to the problem. By contrast, certain bacterial
proportion of the adult population and is of common interest species that predominate in the mouths of ‘‘healthy’’ subjects
3
due to its compromising influence in social and working are noticeably absent in subjects with halitosis.
environments. Most halitosis oral malodour compounds are Current treatments focus on the use of chemical or physical
by-products of the metabolism of certain species of oral antibacterial regimens to reduce the numbers of these bacteria.
1,2
bacteria, mainly those on the dorsum of the tongue. These The treatments typically provide only short-term relief because
* Corresponding author at: Institute of Preventive Dentistry and Oral Microbiology, School of Dental Medicine, University of Basel,
Hebelstrasse 3, 4056 Basel, Switzerland. Tel.: +41 061 267 25 98; fax: +41 061 267 26 58.
E-mail address: [email protected] (I. Hauser-Gerspach).
0003–9969/$ – see front matter # 2012 Elsevier Ltd. All rights reserved.
doi:10.1016/j.archoralbio.2012.02.011
Please cite this article in press as: Masdea L, et al. Antimicrobial activity of Streptococcus salivarius K12 on bacteria involved in oral malodour.
Archives of Oral Biology (2012), doi:10.1016/j.archoralbio.2012.02.011
AOB-2765; No. of Pages 7
2 a r c h i v e s o f o r a l b i o l o g y x x x ( 2 0 1 2 ) x x x – x x x
the offensive bacteria quickly recover after treatment is Switzerland), which served as a negative control. The test
4
stopped. strains included Atopobium parvulum ATCC 33793, Eubacterium
The use of probiotics has long been popular in the food sulci ATCC 35585, Solobacterium moorei CCUG 39336 and four
industry. The World Health Organisation defines probiotics as clinical S. moorei isolates, CH1#23, CH3A#109A, CH3#63 and
15
a ‘live organism which when administered in adequate CH8#20, which had, to date, not yet been tested for
amounts confers a health benefit on the host’. Their use in susceptibility against S. salivarius K12 in vitro.
5
clinical practice has previously been discussed. One potential All bacteria were grown on Columbia agar (Columbia Agar
and clinically important use of probiotics is in the prevention Base [BBL Becton Dickinson, Allschwil, Switzerland]) supple-
6–10
of dental caries. mented with 4 mg/l hemin (Fluka, Buchs, Switzerland), 1 mg/l
Preventing the re-growth of odour-causing organisms menadione (VWR International, Dietikon, Switzerland) and
through the pre-emptive colonisation of the oral cavity with 50 ml/l human blood (Blutspendezentrum, Basel, Switzerland)
non-odorous, commensal microorganism may be a reason- under anaerobic conditions (Oxoid AnaeroGen Compact,
able alternative to chemical or physical antibacterial regi- Oxoid, Pratteln, Switzerland) at 37 8C for 2–4 days.
mens. Given that the dorsum of the tongue is the origin of
most halitosis problems, a candidate probiotic to counter this 2.2. Antimicrobial activity of S. salivarius K12
condition should be able to persist in this particular ecosys-
tem. The production of anti-competitor molecules such as Inhibitory activities of S. salivarius K12 and the salivaricin non-
bacteriocins also appears to confer an ecological advantage to producer S. salivarius MU were analysed using a modified
16
some bacteria. A probiotic strain that efficiently colonises the deferred antagonism test. Sterile blotting paper (Inapa
tongue surface and does not produce odours metabolic by- Schweiz AG, Regensdorf, Switzerland) was cut to the size of
products would be highly advantageous. 9 cm  1 cm and carefully immersed in a S. salivarius culture
Streptococcus salivarius is known to be a pioneer coloniser of with a density of 4-5 McFarland standard. After removing excess
oral surfaces and is found predominant in ‘healthy’ humans fluid, the blotting paper was placed in the middle of a plate of
3
not affected by halitosis. BLIS K12 Throat Guard lozenges Columbia agar containing 5% human blood and 0.1% calcium
(BLIS Technologies, Centre for Innovation, Dunedin, New carbonate (CaCO3) (E. Merck, Darmstadt) left in place for 2 s and
Zealand) contain S. salivarius K12, which has been shown to then removed. The plates were incubated at 37 8C under
help maintain throat health by supporting the defence against anaerobic conditions for 24 h. After incubation, the growth
11
undesirable bacteria. The bacterium is not genetically was removed with a sterile cotton swab. To kill any residual
modified or engineered, and the product is available in three bacterial cells on the mediums surface, the plate was exposed to
flavours (vanilla, strawberry and peppermint). The particular chloroform (E. Merck, Darmstadt) vapours for 30 min at room
strain used produces two natural antibacterial peptides, temperature. The plate was then aired for 30 min.
12,13 14
salivaricin A2 and salivaricin B, which are lantibiotic- Several colonies of each indicator strain grown on Colum-
type bacteriocins. In deferred antagonism studies, S. salivarius bia blood agar-calcium carbonate medium were suspended in
K12 inhibited the Gram-positive bacteria Streptococcus anginosis 3 ml Todd-Hewitt broth and streaked at right angles to the
T29, Eubacterium saburreum and Micromonas micros, which are original S. salivarius culture zone with a sterile cotton swab.
implicated in halitosis, and significantly inhibited black- The plates were incubated under anaerobic conditions at 37 8C
4
pigmented colony types present in saliva samples. for at least 48 h, and the extent of inhibition was recorded in
Based on these investigations and other promising results, mm (the distance between the original producer line and the
S. salivarius K12 has an excellent potential for use as a probiotic inhibition line of indicator strains). Each test was performed at
targeting halitosis producing bacteria. least three times.
The aim of this study was to evaluate the extent of the
inhibitory spectrum of S. salivarius K12 against three additional 2.3. Test for resistance of S. moorei CCUG 39336 against
bacterial species recently found to be implicated in halitosis S. salivarius K12
and to investigate the development of bacterial resistance
against S. salivarius K12. S. salivarius K12 or S. salivarius MU cells were each suspended
in 3 ml Todd Hewitt broth and swabbed onto Columbia blood
agar-calcium carbonate medium. Afterwards, the plates were
2. Materials and methods incubated at 37 8C under anaerobic conditions for 24 h until
confluent growth was observed. Bacterial cells were removed
2.1. Bacterial strains and growth conditions from the plates with sterile cotton swabs, and the agar
surfaces exposed to chloroform vapour for 30 min and aired
The bacteriocin-producing strain S. salivarius K12 and the for another 30 min. Control plates without S. salivarius were
nonproducer S. salivarius MU, were kindly provided by Prof. J. also exposed to the same conditions.
Tagg (Department of Microbiology and Immunology, Univer- To detect bacteriocin-resistant S. moorei isolates, several
4
sity of Otago, Dunedin, New Zealand). colonies of S. moorei CCUG 39336 were inoculated in 2 ml Todd-
The indicator strains used in this study included the Hewitt broth. After incubation at 37 8C under anaerobic
following: E. saburreum ATCC 33271; Parvimonas micra (previ- conditions for 24 h, 1 ml of this suspension was centrifuged
ously known as Micromonas micros or Peptostreptococcus micros) at 10,000 rpm for 15 min at 15 8C and resuspended in 300 ml
4
ATCC 33270, which served as a positive control and Bacteroides Todd-Hewitt broth. The exact cell density was determined
fragilis ZIB 2800 (School of Dental Medicine, University of Basel, by plating appropriate dilutions onto Columbia blood
Please cite this article in press as: Masdea L, et al. Antimicrobial activity of Streptococcus salivarius K12 on bacteria involved in oral malodour.
Archives of Oral Biology (2012), doi:10.1016/j.archoralbio.2012.02.011
AOB-2765; No. of Pages 7
a r c h i v e s o f o r a l b i o l o g y x x x ( 2 0 1 2 ) x x x – x x x 3
Antimicrobial Activity of S. salivarius K12
agar-calcium carbonate medium. One-hundred microlitres of
25
this S. moorei suspension was streaked onto the agar plate
pretreated with S. salivarius K12 and 100 ml onto the agar plate
20
pretreated with S. salivarius MU.
15
2.4. Test for induction of resistance in S. moorei CCUG
39336 against the bacteriocins from S. salivarius K12 10
Bacteriocin-producing S. salivarius K12 and the indicator strain 5
inhibition zone ±SD [mm]
S. moorei CCUG 39336 were grown, streaked onto Columbia
0
blood agar-calcium carbonate medium and incubated as
described above for the modified deferred antagonism test.
The S. moorei colonies closest to the inhibition zone were E. sulci P. micra CH1#23 CH3#63 CH8#20
A. parvulum
E. saburreum
subcultivated onto Columbia blood agar-calcium carbonate CCUG 39336 CH3A#109A
medium and again tested against S. salivarius K12. This S. moorei S. moorei S. moorei
S. moorei
procedure was repeated for 10 passages. S. moorei
Fig. 1 – Mean inhibition zone W standard deviation of S.
2.5. Statistical analysis
salivarius K12 against nine Gram-positive indicator strains
(n = 3).
The inhibitory activity of S. salivarius K12 against the indicator
strains was tested using a linear model. The dependent
Fig. 2 – Inhibitory effect of S. salivarius K12 (a and b) compared to S. salivarius MU (c and d). A clear inhibition zone was
produced against S. moorei CCUG 39336 culture (a), whereas growth of B. fragilis was not inhibited by S. salivarius K12 (b).
The non-producer strain S. salivarius MU did not inhibit the growth of either S. moorei CCUG 39336 (c) or B. fragilis (d).
Please cite this article in press as: Masdea L, et al. Antimicrobial activity of Streptococcus salivarius K12 on bacteria involved in oral malodour.
Archives of Oral Biology (2012), doi:10.1016/j.archoralbio.2012.02.011
AOB-2765; No. of Pages 7
4 a r c h i v e s o f o r a l b i o l o g y x x x ( 2 0 1 2 ) x x x – x x x
variable was the size of the inhibition zone, the independent Table 1 – Results of the statistical analysis of the
variable was the indicator strain. To compare the inhibition inhibition of the Gram-positive indicator bacteria by S.
salivarius K12 compared to the bacteriocin-nonproducing
zones of each indicator strain against the salivaricin non-
strain S. salivarius MU. Shown are the respective indi-
producer S. salivarius MU, a model with no intercept term was
cator strain, the estimated mean differences (est. mean
used. Means were estimated with 95% confidence intervals
difference) in mm, the upper and lower 95% confidence
with corresponding P-values. intervals (95% confint) in mm and the corresponding P-
To analyse the induction of resistance in S. moorei CCUG values.
39336 against the salivaricins from S. salivarius K12, a linear
Indicator strain Est. mean 95% confint P-Value
mixed effects model (LME) was used because data structures difference
with serial dependency had to be described. The dependent
Lower Upper
variable was the size of the inhibition zones and the
A. parvulum 14.38 12.40 16.35 <0.001
independent variable was the passage number. The experi-
E. saburreum 8.59 6.52 10.66 <0.001
mental unit was treated as a random factor.
E. sulci 16.67 12.71 20.63 <0.001
The results are presented as differences of means, with 95% P. micra 9.28 6.99 11.56 <0.001
confidence intervals and corresponding P-values. P- S. moorei CCUG 39336 9.75 7.33 12.17 <0.001
values < 0.05 were considered statistically significant. S. moorei CH1#23 5.29 3.31 7.27 <0.001
S. moorei CH3A#109A 9.17 6.88 11.45 <0.001
All statistical evaluations and graphs were done with the
1 17 S. moorei CH3# 63 9.04 7.06 11.02 <0.001
publicly available R software v. 2.14.0 for Windows . The
S. moorei CH8#20 5.54 3.56 7.52 <0.001
linear model was calculated using function lm( ) and corre-
sponding confidence intervals were calculated using the
function confint( ) (package stats). The linear mixed effects even after prolonged incubation, while there was confluent
model was calculated using the function lme( ) and confidence growth of S. moorei CCUG 39336 on plates pretreated with S.
intervals were estimated using the function intervals( ) (pack- salivarius MU.
age nlme). Tests for normality of distribution were conducted
using the function qqPlot( ) fom the package car. No systematic 3.3. Test for induction of resistance in S. moorei CCUG
deviations from normal distribution were observed. For crea- 39336 against the bacteriocins from S. salivarius K12
tion of graphs, packages plotrix and gplots were used.
The inhibition zones of S. moorei CCUG 39336 decreased
slightly with each passage, from 8.2 Æ 0.6 mm at the beginning
3. Results to 6.2 Æ 0.3 mm after 10 passages (Fig. 3). Comparing inhibition
zones of successive passages with those of the first passage,
3.1. Antimicrobial activity of S. salivarius K12 the linear mixed-effect model indicated that this reduction
was statistically significant (Table 2). From the 5th passage on,
All Gram-positive indicator strains were inhibited byS. salivarius all differences were highly significant (P < 0.001).
K12 (Fig. 1), while B. fragilis, a Gram-negative bacterium, was not
inhibited (Fig. 2b). The mean size of the inhibition zones for the
4. Discussion
five S. moorei isolates were between 5.3 mm for S. moorei CH1#23
and 9.8 mm for the type strain S. moorei CCUG 39336. The zones
of inhibition for E. saburreum and P. micra were in the same To compete with other species for nutrients in the same
range, whereas A. parvulum and E. sulci where more susceptible ecological niche, many different bacterial species produce
to S. salivarius K12 with inhibition zones of 14.4 mm and
16.7 mm, respectively. Variability was evident within most
species. E. saburreum, E. sulci and P. micra showed the biggest Table 2 – Results of the statistical analysis comparing the
variation in the results, whereas S. moorei CCUG 39336 and S. size of the inhibition zones of the first passage with
those of the following passages. Shown are the respec-
moorei CH1#23 had the smallest variation.
tive passage number, the estimated mean differences
The bacteriocin-nonproducing strain S. salivarius MU did
(est. mean difference) in mm, the upper and lower 95%
not inhibit any of the indicator strains (Fig. 2c and d). The
confidence intervals (95% confint) in mm and the
inhibition of all Gram-positive indicator bacteria by S.
corresponding P-value.
salivarius K12 was statistically significant (P < 0.001) when
Passage Est. mean 95% confint P-Value
compared to the bacteriocin-nonproducing strain S. salivarius
number difference
MU (Table 1).
Lower Upper
2 À0.67 À1.20 À0.14 0.017
3.2. Test for resistance of S. moorei CCUG 39336 against
3 À0.83 À1.36 À0.30 0.004
S. salivarius K12
4 À0.67 À1.20 À0.14 0.017
5 À1.83 À2.36 À1.30 <0.001
To test for an intrinsic resistance of S. moorei against the
6 À2.00 À2.53 À1.47 <0.001
7
bacteriocins produced by S. salivarius K12, up to 9.1 Â 10 S. 7 À2.33 À2.86 À1.80 <0.001
moorei CCUG 39336 cells were streaked on plates previously 8 À1.67 À2.20 À1.14 <0.001
9 À2.00 À2.53 À1.47 <0.001
seeded with S. salivarius K12 or S. salivarius MU. No growth
10 À2.00 À2.53 À1.47 <0.001
could be detected on the plates pretreated with S. salivarius K12
Please cite this article in press as: Masdea L, et al. Antimicrobial activity of Streptococcus salivarius K12 on bacteria involved in oral malodour.
Archives of Oral Biology (2012), doi:10.1016/j.archoralbio.2012.02.011
AOB-2765; No. of Pages 7
a r c h i v e s o f o r a l b i o l o g y x x x ( 2 0 1 2 ) x x x – x x x 5
Induction of Solobacterium moorei CCUG 39336
pharyngitis in children; indeed, lozenges containing
9 S. salivarius K12 are sold in some countries as an oral probiotic
11,28–31
to maintain throat health.
8 Therefore, the possibility of screening probiotics against
several bacteria implicated in halitosis seems very promising.
The experiments in the present study were performed to
7
elucidate the inhibitory effect of the probiotic S. salivarius K12,
which produces at least two lantibiotic bacteriocins, on strains
6 of several species of Gram-positive bacteria.
Inhibition zone ±SD [mm]
Recently, the use of S. salivarius K12 as a probiotic in clinical
5
practice has been tested. In a deferred antagonism test, Burton
1 98765432 10 et al. reported strong inhibition by S. salivarius K12 against Gram-
passages positive halitosis associated species, including E. saburreum and P.
4
micra (M. micros). The procedures followed in our study were
16
Fig. 3 – Test for induction of resistance in S. moorei CCUG related to the test used by Tagg and Bannister. The results
39336 against the bacteriocins from S. salivarius K12. demonstrated an inhibition of E. saburreum and P. micra,
Shown are levels of inhibition (mm) in different passages. indicating adequate culture conditions for the bacteriocin-
production of S. salivarius. In addition, Gram-negative bacteria
showed no inhibition, which was consistent with the corre-
bacteriocins. These ribosomally synthesised peptides or sponding literature. Thus, the applied test arrangement could be
18,19
proteins have antibacterial activity. Due to their potential routinely used to study further bacterial species implicated in
as food preservatives and their antagonistic effect against halitosis.
important food pathogens, the bacteriocins that have been S. moorei has recently been identified in specimens from
3,15
studied most extensively are derived from lactic acid bacteria. patients suffering from halitosis. Inhibition by S. salivarius
The lantibiotic nisin, which is produced by different Lactococcus K12 was demonstrated against type strain CCUG 39336 and four
lactis spp., is the best studied bacteriocin and, so far, the only clinical isolates of S. moorei (CH1#23, CH3A#109A, CH3#63,
20,21 15
one that is used as a food additive. However, bacteriocin- CH8#20) that originated from samples taken from the human
producing starter cultures are commonly used in food oral cavity. A. parvulum ATCC 33793 and E. sulci ATCC 35585 were
fermentations, and probiotic bacteria have recently gained used for this study because they are known to be implicated in
increased interest and acceptance due to their potential health halitosis and because they had not been tested with the
benefit. Production of antimicrobial substances against patho- deferred antagonism test. The variation in inhibition zones of E.
gens has been proposed as an important mechanism by which saburreum, E. sulci and P. micra could be attributed to their
22,23
probiotic bacteria may improve human health. demanding growth conditions and challenging cultivation.
There have been few attempts to examine the effects of The development of strain resistance is of major concern for
24
probiotic bacteria in the oral cavity. This complex ecosystem the in vivo application of probiotic strains, and the emergence of
25
is inhabited by more than 700 bacterial species, some of resistance against bacteriocins has been best documented for
which have been shown to produce antimicrobial substances, nisin. In laboratory settings, nisin-resistant bacteria can be
including bacteriocins. The caries pathogen Streptococcus obtained by repeatedly exposing sensitive strains to increasing
mutans produces several kinds of bacteriocins called mutacins. amounts of nisin. Gram-positive and Gram-negative bacteria
The efficient replacement of indigenous cariogenic mutans can exhibit resistance against nisin. The molecular mechanisms
streptococci by a genetically modified S. mutans strain is based leadingto nonsusceptibility have been shown to involve changes
on the production of the broad-spectrum lantibiotic mutacin in the bacterial cell membrane or cell wall, although the precise
1140. Animal testing indicates that an avirulent S. mutans nature of the factors involved in resistance development
strain producing ethanol instead of lactic acid and harbouring remains elusive, and bacteria may employ several strategies
mutacin 1140 can successfully displace other S. mutans strains simultaneously to acquire nisin resistance (reviewed in Ref. 21).
26
and lead to significantly reduced level of caries. Phase I A possible mechanism leading to the acquisition of resis-
safety trials using an auxotrophic strain are planned to tance is horizontal gene transfer wherein genes are transferred
27
determine the level of transmission of this bacterium. between bacteria. This mode of gene transfer was demonstrat-
A few other studies have examined the effect of probiotic ed in S. salivarius K12 where the large plasmid harbouring the
bacteria, mainly lactic acid bacteria, on salivary bacterial loci for bacteriocins production could be transferred in vivo into
32,33
counts and caries prevention. These initial studies yielded a plasmid-negative S. salivarius strain by oral transmission.
promising results; a reduction of salivary S. mutans counts and So far, no studies have been conducted to determine the host
6,7
a reduced caries risk was found in most studies. range of this plasmid or whether there is transmission to other
S. salivarius, one of the predominant commensal bacteria oral streptococci or even to potential pathogens.
of the oral cavity, is known to produce bacteriocins and No resistance against the bacteriocins produced by orally
bacteriocin-like inhibitory substances, which makes administrated S. salivarius K12 have been reported so far. In
S. salivarius strains promising candidates for the development our study, no intrinsic resistance of S. moorei CCUG 39336
of oral probiotics against oral infectious diseases. It has against S. salivarius K12 could be detected, although there was
already been shown that S. salivarius can antagonise the action a decrease in sensitivity when S. moorei CCUG 39336 was
of Streptococcus pyogenes, the main etiological agent of bacterial repeatedly exposed to S. salivarius K12 over 10 passages.
Please cite this article in press as: Masdea L, et al. Antimicrobial activity of Streptococcus salivarius K12 on bacteria involved in oral malodour.
Archives of Oral Biology (2012), doi:10.1016/j.archoralbio.2012.02.011
AOB-2765; No. of Pages 7
6 a r c h i v e s o f o r a l b i o l o g y x x x ( 2 0 1 2 ) x x x – x x x
Further studies are needed to determine if resistances might 2. Loesche WJ, Kazor C. Microbiology and treatment of
halitosis. Periodontol 2000 2002;28:256–79.
also occur in vivo.
3. Kazor CE, Mitchell PM, Lee AM, Stokes LN, Loesche WJ,
In contrast to the situation with antibiotics in which there
Dewhirst FE, et al. Diversity of bacterial populations on the
is currently no antibiotic in clinical use to which resistance has
tongue dorsa of patients with halitosis and healthy patients.
not developed, bacteriocin resistance does not yet pose a
J Clin Microbiol 2003;41:558–63.
serious problem. However, cross-resistance between bacter- 4. Burton JP, Chilcott CN, Moore CJ, Speiser G, Tagg JR. A
iocins have been observed and thought to represent a general preliminary study of the effect of probiotic Streptococcus
mechanism of resistance, and this emphasises the need for salivarius K12 on oral malodour parameters. J Appl Microbiol
34,35 2006;100:754–64.
efficient and safe probiotics.
5. Reid G, Jass J, Sebulsky MT, McCormick JK. Potential uses of
probiotics in clinical practice. Clin Microbiol Rev 2003;16: 658–72.
5. Conclusions
6. Nase L, Hatakka K, Savilahti E, Saxelin M, Ponka A, Poussa T,
et al. Effect of long-term consumption of a probiotic
In conclusion, our study demonstrated that the bacteriocin- bacterium, Lactobacillus rhamnosus GG, in milk on dental
caries and caries risk in children. Caries Res 2001;35:412–20.
producing strain S. salivarius K12 displayed antimicrobial
7. Ahola AJ, Yli-Knuuttila H, Suomalainen T, Poussa T,
activities against several halitosis bacteria including S. moorei,
Ahlstro¨ m A, Meurman JH, et al. Short-term consumption of
which has recently been found to be a major contributor to oral
probiotic-containing cheese and its effect on dental caries
malodour. Additionally, the type strain S. moorei CCUG 39336 did
risk factors. Arch Oral Biol 2002;47:799–804.
not seem to have a natural resistance against S. salivarius K12, 8. Comelli EM, Guggenheim B, Stingele F, Neeser JR. Selection
and there was only a slight decrease in sensitivity after repeated of dairy bacterial strains as probiotics for oral health. Eur J
exposure to S. salivarius K12. Based on these results, S. salivarius Oral Sci 2002;110:218–24.
9. Montalto M, Vastola M, Marigo L, Covino M, Graziosetto R,
K12 might be an interesting and valuable candidate for the
Curigliano V, et al. Probiotic treatment increases salivary
development of an antimicrobial therapy to treat oral malodour.
counts of lactobacilli: a double-blind, randomized,
controlled study. Digestion 2004;69:53–6.
10. Twetman S, Stecksen-Blicks C. Probiotics and oral health
Funding
effects in children. Int J Paediatr Dent 2008;18:3–10.
11. Horz HP, Meinelt A, Houben B, Conrads G. Distribution and
None. persistence of probiotic Streptococcus salivarius K12 in the
human oral cavity as determined by real-time quantitative
polymerase chain reaction. Oral Microbiol Immunol 2007;22:126–30.
Competing interests
12. Ross KF, Ronson CW, Tagg JR. Isolation and characterization
of the lantibiotic salivaricin A and its structural gene salA
None declared. from Streptococcus salivarius 20P3. Appl Environ Microbiol
1993;59:2014–21.
13. Upton M, Tagg JR, Wescombe P, Jenkinson HF. Intra- and
Ethical approval interspecies signaling between Streptococcus salivarius and
Streptococcus pyogenes mediated by SalA and SalA1 lantibiotic
peptides. J Bacteriol 2001;183:3931–8.
Not required.
14. Tagg JR, Dierksen KP. Bacterial replacement therapy:
adapting ‘germ warfare’ to infection prevention. Trends
Biotechnol 2003;21:217–23.
Acknowledgments 15. Haraszthy VI, Gerber D, Clark B, Moses P, Parker C,
Sreenivasan PK, et al. Characterization and prevalence of
Solobacterium moorei associated with oral halitosis. J Breath
The authors would like to thank E. Filipuzzi and I. Schweizer
Res 2008;2:017002.
for their skilful technical assistance, V. Haraszthy (University
16. Tagg JR, Bannister LV. Fingerprinting beta-haemolytic
at Buffalo, School of Dental Medicine, Buffalo, N.Y.) for the
streptococci by their production of and sensitivity to
clinical isolates of Solobacterium moorei, J. Tagg (Department of bacteriocine-like inhibitors. J Med Microbiol 1979;12:397–411.
Microbiology and Immunology, University of Otago, Dunedin, 17. R Development Core Team. R: a language and environment for
New Zealand) for the strains S. salivarius K12 and S. salivarius statistical computing. Vienna, Austria: R Foundation for
Statistical Computing; 2011.
MU and dipl. math A. Scho¨ tzau (Basel, Switzerland) for his
18. Jack RW, Tagg JR, Ray B. Bacteriocins of Gram-positive
expert help with statistical analysis. The authors declare no
bacteria. Microbiol Rev 1995;59:171–200.
potential conflicts of interest with respect to the authorship
19. Cotter PD, Hill C, Ross RP. Bacteriocins: developing innate
and/or publication of this article. immunity for food. Nat Rev Microbiol 2005;3:777–88.
20. Cleveland J, Montville TJ, Nes IF, Chikindas ML. Bacteriocins:
safe, natural antimicrobials for food preservation. Int J Food
Microbiol 2001;71:1–20.
r e f e r e n c e s
21. Chatterjee C, Paul M, Xie L, van der Donk WA. Biosynthesis
and mode of action of lantibiotics. Chem Rev 2005;105:
633–84.
1. Scully C, el-Maaytah M, Porter SR, Greenman J. Breath odor: 22. De Vuyst L, Leroy F. Bacteriocins from lactic acid bacteria:
etiopathogenesis, assessment and management. Eur J Oral production, purification, and food applications. J Mol
Sci 1997;105:287–93. Microbiol Biotechnol 2007;13:194–9.
Please cite this article in press as: Masdea L, et al. Antimicrobial activity of Streptococcus salivarius K12 on bacteria involved in oral malodour.
Archives of Oral Biology (2012), doi:10.1016/j.archoralbio.2012.02.011
AOB-2765; No. of Pages 7
a r c h i v e s o f o r a l b i o l o g y x x x ( 2 0 1 2 ) x x x – x x x 7
23. Gillor O, Etzion A, Riley MA. The dual role of bacteriocins 30. Wescombe PA, Upton M, Renault P, Wirawan RE, Power D,
as anti- and probiotics. Appl Microbiol Biotechnol 2008;81: Burton JP, et al. Salivaricin 9, a new lantibiotic produced by
591–606. Streptococcus salivarius. Microbiology 2011;157:1290–9.
24. Meurman JH. Probiotics: do they have a role in oral medicine 31. Guglielmetti S, Taverniti V, Minuzzo M, Arioli S, Stuknyte
and dentistry? Eur J Oral Sci 2005;113:188–96. M, Karp M, et al. Oral bacteria as potential probiotics for
25. Paster BJ, Olsen I, Aas JA, Dewhirst FE. The breadth of the pharyngeal mucosa. Appl Environ Microbiol
bacterial diversity in the human periodontal pocket and 2010;76:3948–58.
other oral sites. Periodontol 2000 2006;42:80–7. 32. Wescombe PA, Burton JP, Cadieux PA, Klesse NA, Hyink O,
26. Hillman JD, Brooks TA, Michalek SM, Harmon CC, Snoep JL, Heng NC, et al. Megaplasmids encode differing
van Der Weijden CC. Construction and characterization of combinations of lantibiotics in Streptococcus salivarius. Anton
an effector strain of Streptococcus mutans for replacement Van Leeuw 2006;90:269–80.
therapy of dental caries. Infect Immun 2000;68:543–9. 33. Hyink O, Wescombe PA, Upton M, Ragland N, Burton JP,
27. Hillman JD, Mo J, McDonell E, Cvitkovitch D, Hillman CH. Tagg JR. Salivaricin A2 and the novel lantibiotic salivaricin
Modification of an effector strain for replacement therapy of B are encoded at adjacent loci on a 190-kilobase
dental caries to enable clinical safety trials. J Appl Microbiol transmissible megaplasmid in the oral probiotic strain
2007;102:1209–19. Streptococcus salivarius K12. Appl Environ Microbiol
28. Tagg JR. Prevention of streptococcal pharyngitis by anti- 2007;73:1107–13.
Streptococcus pyogenes bacteriocin-like inhibitory substances 34. Gravesen A, Ramnath M, Rechinger KB, Andersen N, Jansch
(BLIS) produced by Streptococcus salivarius. Indian J Med Res L, Hechard Y, et al. High-level resistance to class IIa
2004;119 Suppl.:13–6. bacteriocins is associated with one general mechanism in
29. Wescombe PA, Heng NC, Burton JP, Chilcott CN, Tagg JR. Listeria monocytogenes. Microbiology 2002;148:2361–9.
Streptococcal bacteriocins and the case for Streptococcus 35. Naghmouchi K, Kheadr E, Lacroix C, Fliss I. Class I/Class IIa
salivarius as model oral probiotics. Future Microbiol bacteriocin cross-resistance phenomenon in Listeria
2009;4:819–35. monocytogenes. Food Microbiol 2007;24:718–27.
Please cite this article in press as: Masdea L, et al. Antimicrobial activity of Streptococcus salivarius K12 on bacteria involved in oral malodour.
Archives of Oral Biology (2012), doi:10.1016/j.archoralbio.2012.02.011 Journal of Applied Microbiology ISSN 1364-5072
ORIGINAL ARTICLE A preliminary study of the effect of probiotic Streptococcus salivarius K12 on oral malodour parameters J.P. Burton1, C.N. Chilcott1, C.J. Moore1, G. Speiser2 and J.R. Tagg3
1 BLIS Technologies, Center for Innovation, University of Otago, Dunedin, New Zealand 2 Breezecare Systems, Sydney, Australia 3 Department of Microbiology and Immunology, University of Otago, Dunedin, New Zealand
Keywords Abstract halitosis, oral malodour, probiotics, Streptococcus salivarius. Aims: To determine whether dosing with bacteriocin-producing Streptococcus salivarius following an antimicrobial mouthwash effects a change in oral Correspondence malodour parameters and in the composition of the oral microbiota of subjects Jeremy Burton, BLIS Technologies Ltd, Centre with halitosis. for Innovation, University of Otago, PO Box Materials and Results: Twenty-three subjects with halitosis undertook a 3-day 56, Dunedin 9001, New Zealand. regimen of chlorhexidine (CHX) mouth rinsing, followed at intervals by the E-mail: [email protected] use of lozenges containing either S. salivarius K12 or placebo. Assessment of 2005/0706: received 20 June 2005, revised the subjects’ volatile sulphur compound (VSC) levels 1 week after treatment 20 July 2005 and accepted 12 September initiation showed that 85% of the K12-treated group and 30% of the placebo 2005 group had substantial (>100 ppb) reductions. The bacterial composition of the saliva was monitored by culture and PCR-denaturing gradient gel electro- doi:10.1111/j.1365-2672.2006.02837.x phoresis (PCR-DGGE). Changes in the PCR-DGGE profiles occurred in most subjects following K12 treatment. In vitro testing showed that S. salivarius K12 suppressed the growth of black-pigmented bacteria in saliva samples and also in various reference strains of bacteria implicated in halitosis. Conclusions: Administration of bacteriocin-producing S. salivarius after an oral antimicrobial mouthwash reduces oral VSC levels. Significance and Impact of the Study: The outcome of this preliminary study indicates that the replacement of bacteria implicated in halitosis by colon- ization with competitive bacteria such as S. salivarius K12 may provide an effective strategy to reduce the severity of halitosis.
studies have indicated that Porphyromonas gingivalis, Introduction Prevotella intermedia, Fusobacterium nucleatum, Micro- Halitosis, more commonly known as oral malodour, monas micros, Campylobacter rectus, Eikenella corrodens afflicts up to half the adult human population to various and Treponema denticola, as well as various species of degrees (Rosenberg 1996; Yaegaki and Coil 2000). Bacteroides, Desulfovibrio and Eubacterium are largely Although generally not considered to be a medical con- responsible for the production of the VSC that are the cern, it certainly can confer a significant social stigma principal contributors to halitosis (De Boever and (Rosenberg 2002). The most common oral malodour Loesche 1995; Khaira et al. 2000; Loesche and Kazor compounds are by-products of the metabolism of oral 2002). One recent nonculture based study has shown that bacteria, especially anaerobes, located on the dorsum of certain oral bacterial species are relatively prevalent in the tongue (Scully et al. 1997; Loesche and Kazor 2002). subjects who are healthy, whereas other species predom- Volatile sulphur compounds (VSC), valeric acid, butyric inate in individuals who are afflicted with halitosis. Atop- acid and putrescine are thought to contribute to the obium pavulum, Eubacterium sulci, Fusobacterium odour (Loesche and Kazor 2002). Previous culture-based periodonticum, Dialister species, Solobacterium moorei and
ª 2006 The Authors 754 Journal compilation ª 2006 The Society for Applied Microbiology, Journal of Applied Microbiology 100 (2006) 754–764 J.P. Burton et al. Effect of S. salivarius K12 on halitosis certain uncharacterized Streptococcus species were relat- composition of the oral microbiota after the administra- ively common in subjects with halitosis (Kazor et al. tion of a short oral antimicrobial treatment followed by 2003). By contrast, Streptococcus salivarius, Rothia muci- daily dosing with S. salivarius K12 for a total of 2 weeks laginosa and an uncharacterized species of Eubacterium, and (ii) evaluation of the inhibitory activity in vitro of were more commonly detected in healthy individuals (Ka- bacteriocin-producing S. salivarius strains against bacterial zor et al. 2003). species implicated in halitosis. Various strategies have been developed for either the prevention or at least the alleviation of halitosis. Current Materials and methods treatments focus on either nonselective anti-bacterial treatment to reduce the total numbers of oral bacteria or Subjects, pretreatment, probiotic instillation and sample the use of agents that mask or neutralize the odour. These collection protocols typically require complex and expensive physical or chemical therapy to be carried out daily Subjects who considered that they may have halitosis were and generally only provide short-term benefit, as the initially screened for the levels of VSC in their oral cavity malodour-causing oral bacteria quickly recover to their air samples (breath scores) using a halimeter (Interscan former numbers as soon as the treatment is stopped. Corp., Chatsworth, CA, USA) based on the average of None of the protocols described to date incorporate a three readings. The average subject age was 43Æ3 years step in which a beneficial bacterial population is intro- with a range of 18–69 years. Ten females and 13 males duced to help counter the proliferation of odiferous participated. All measurements were taken in the morning species. It is our view that probiotics, defined by the prior to the subjects eating, drinking, smoking or using WHO as ‘live microorganisms which when administered any oral care. Subjects having VSC scores higher than in adequate amounts confer a health benefit on the host’ 200 ppb on two separate visits were recruited into the may have beneficial application to the reduction of halito- study. Each gave informed consent according to an sis (Reid 2005). Probiotics have had some success when approved protocol by the Otago Ethics Committee. Thir- applied to the intestinal tract and vagina after antibiotic teen subjects received the active treatment. Ten subjects therapy and for the management of infections in which it (treated the same as the test group but having no bacteria is perceived that there is an ‘imbalance’ of the normal in their lozenges) were included to determine the effect of microbiota allowing unregulated growth of ‘problematic’ the pretreatment protocol on VSC readings. All subjects micro-organisms (Cadieux et al. 2002; Reid et al. 2003). undertook a mechanical and chemical oral cleansing Additionally, there is a growing body of evidence that treatment which consisted of brushing their teeth and probiotics can stimulate host immunity, occupy potential tongue for 2 min using toothpaste (Colgate Total, pathogen colonization sites and interrupt host–pathogen Colgate, Sydney, Australia), then using a plastic tongue ‘cross-talking’ (Connolly et al. 2003; Freitas et al. 2003; scraper for 30 s, followed by 2 min brushing of their teeth Gill 2003; Valeur et al. 2004). and tongue with 2Æ0% chlorhexidine (CHX) mouth gel The aim of the present study was to alleviate halitosis (Colgate Perioguard) and finally a 30 s CHX rinse (0Æ2% by pre-emptively colonizing the oral cavity with a com- CHX in 10% ethanol). At 2-h intervals, over the next 8 h, petitive commensal bacterium following a short course of the subjects sucked a lozenge containing either >1 · 109 mechanical and chemical treatment to reduce the num- colony forming units (CFU) of S. salivarius K12Str (a vari- ) bers of odour-causing organisms and possibly provide ant of strain K12 resistant to 100 lgml 1 streptomycin; additional attachment sites for the colonizing strain. BLIS Technologies Ltd, Dunedin, New Zealand) or a Streptococccus salivarius appears to have excellent creden- placebo lozenge containing no bacteria. The lozenges took tials as an oral probiotic. It is known to be a pioneer c. 5 min to dissolve by sucking. On days 2 and 3 the colonizer of oral surfaces and is a numerically predomin- subjects brushed their teeth and tongue in the morning ant nondisease-associated member of the oral microbiota with Colgate (Total) toothpaste and then rinsed with of ‘healthy’ humans (Carlsson et al. 1970; Kazor et al. CHX, followed by the taking of K12 lozenges as on day 1. 2003). This species has only a very limited capability for Subsequently, the subjects refrained from any use of producing VSC (Yoshida et al. 2003) and thus is unlikely CHX, but took a lozenge morning and night after normal to contribute significantly to oral malodour. Streptococcus oral care for 2 weeks in the case of the active group. salivarius K12 is known to produce at least two lantibiotic At each pretreatment visit and 1 and 2 weeks (for the bacteriocins, salivaricin A (Ross et al. 1993; Upton et al. test group) after treatment initiation the subjects were 2001) and salivaricin B (Tagg and Dierksen 2003). The tested for VSC levels and saliva samples were taken (prior present pilot study had two specific objectives: (i) assess- to taking the morning lozenge). Two subjects (S1 and S3) ment of the impact on halitosis parameters and on the in the active group were sampled more frequently and
ª 2006 The Authors Journal compilation ª 2006 The Society for Applied Microbiology, Journal of Applied Microbiology 100 (2006) 754–764 755 Effect of S. salivarius K12 on halitosis J.P. Burton et al. continued to take two lozenges a day for 28 days. These template for PCR. Re-amplification was conducted using subjects provided additional samples at days 4, 11, 21, 28 the same primers, but without the ‘GC-clamps’ (Walter and also 2 weeks after completing their courses of K12 et al. 2000). Sequences of the re-amplified fragments were administration. Three subjects (S4, S8 and S12) in the test determined by the dideoxy chain termination method group who had responded positively to the treatment (Sequencing Facility, Center for Gene Research, University were recalled 6 weeks later to determine the effect of of Otago). Analysis of the partial 16S rRNA sequences CHX treatment alone on their breath scores. These sub- was conducted using Genbank and the BLAST algorithm. jects were asked to repeat the 3-day CHX regimen (but Identities of sequences were determined on the basis of without taking lozenges) and 7 days after commencing the highest score. this protocol their VSC levels were assessed. Repeated measures anova with a Tukey–Kramer post-test of VSC Inhibitory activities of S. salivarius strains against known readings on the active treatment was used to determine odiferous bacteria differences before and after treatment. To determine the significance of the variation of individual time points The inhibitory spectra of S. salivarius strains were estab- between the active and placebo groups a Mann–Whitney lished by the use of deferred antagonism test, essentially unpaired t-test was used. as described previously (Tagg and Bannister 1979). In brief, a 1-cm wide diametric streak culture of S. salivarius (test strain) was inoculated onto blood agar–calcium Culture analysis carbonate medium. Following incubation in a 5% CO2 in Saliva samples were immediately diluted 10-fold in sterile air atmosphere, for 24 h at 37 C, the macroscopic cell phosphate-buffered saline (PBS, pH 7Æ5) and then vortex growth was removed with a glass slide and any residual mixed for 5 s. Fifty-microlitre aliquots were spiral plated cells on the agar surface were killed by exposure to chlo- onto Mitis-salivarius agar (Difco) for S. salivarius enu- roform vapours for 30 min. The agar surface was then meration and on Mitis-salivarius agar containing strepto- aired for 30 min. Bacterial strains implicated in halitosis ) mycin (100 lgml 1, Sigma, MO, USA) to specifically (referred to as indicator strains) were pregrown for 48 h enumerate S. salivarius K12. Incubation was in a 5% CO2 on blood agar–calcium plates under anaerobic conditions. in air atmosphere for 24 h at 37 C. Several colonies of the indicator strain were suspended in 3 ml of Todd Hewitt broth and this was used to inoculate at right angles across the line of the original streak culture Extraction of bacterial DNA from saliva samples, with the use of a swab. After incubation for 48 h in an PCR-DGGE anaerobic environment at 37 C, the extent of inhibition The cells from 400 ll samples of saliva (diluted to 1 ml of each indicator strain was recorded. The scoring system by mixing with phosphate-buffered saline, PBS, pH 7Æ5) for the recording of inhibition was as follows: a negative were harvested by centrifugation (10 000 · g, 5 min) and sign ()) denotes no inhibition of the indicator strain; a total DNA was extracted using Instagene Matrix (Bio-Rad positive symbol (+) indicated that there was partial inhi- Laboratories, Hercules, Ca) according to the manufac- bition of the indicator growth on the plate where the test turer’s instructions. PCR reactions were carried out in bacterium had previously been grown; two positive sym- 0Æ2 ml tubes in a thermocycler (Eppendorf Mastercycler, bols (++) denoted complete inhibition of the indicator Hamburg, Germany). The bacterial DGGE PCR primers strain growth in the vicinity of where the test strain had and amplification conditions have been previously des- grown; three positive symbols (+++) indicated inhibition cribed and tested on clinical samples (Walter et al. 2000; of the indicator strains beyond the producer growth zone. Burton and Reid 2002; Rudney et al. 2003). Preparation of DGGE gel gradients and electrophoresis Inhibition of salivary black-pigmented bacteria by procedures were according to the manufacturer’s guide- S. salivarius strains lines for the CBS Scientific DGGE apparatus (Del Mar, CA, USA). A 100% denaturing solution was taken as a To test the inhibitory activity of known S. salivarius K12 ) mixture of 7 mol l 1 urea and 40% formamide. The con- bacteriocins against black-pigmented bacteria implicated centrations of polyacrylamide and denaturant were 8% in halitosis, strains K12 (salivaricin A and salivaricin B and 40–55% respectively. Gels were run at 70 V for producer) and MU (salivaricin nonproducer) were 15Æ5 h. Fragments of interest were excised from the gels swabbed from master plates to cover one half (semicircle) using sterile scalpel blades, washed once in 1x PCR buffer of blood agar–calcium carbonate plates. Following incu- and incubated in 20 ll of the same buffer overnight at bation for 18 h at 37 C under 5% CO2 in air conditions, 4 C. Five microlitres of the buffer solution was used as the bacterial growth was removed using cotton-tipped
ª 2006 The Authors 756 Journal compilation ª 2006 The Society for Applied Microbiology, Journal of Applied Microbiology 100 (2006) 754–764 J.P. Burton et al. Effect of S. salivarius K12 on halitosis swabs and chloroform vapours were used to kill any before treatment (Fig. 1). Although the VSC readings of remaining bacteria. An agar overlay (15 ml per plate) the control group were slightly higher for the second comprising (per l), 30 g trypticase soy broth (BBL), 15 g pretreatment samples, the difference was not significant. agar (BBL) and (added just prior to pouring) 50 ml of One week after commencing treatment with placebo defibrinated human blood and 10 ml of vancomycin lozenges (bacteria free) the mean VSC reading of these ) stock solution (14 mg ml 1) were then added to the subjects had decreased, but not significantly when com- ) plates. Serial 10-fold dilutions (to 10 4) of saliva samples pared with the pretreatment readings (data not shown). from two subjects were spiral plated in duplicate onto the The VSC readings of the test group were significantly double-layer agar plates. Following anaerobic incubation lower than those of the placebo group when tested at at 37 C for 72 h the counts of black-pigmented bacteria 7 days (Table 2). were recorded for the respective test and control halves of Two subjects (S1 and S3) remained on active treatment the plates. for 28 days and generally yielded reduced VSC levels (Fig. 2). Upon ceasing K12 treatment, one of these sub- jects (S1) returned to pretreatment halitosis levels, while Results the VSC levels of subject 3 remained relatively low. Three other test subjects (S4, S8 and S12) who had experienced Effect of treatment protocol on VSC readings The VSC readings of 11 of the 13 subjects in the test Table 2 Difference between active treatment vs placebo group group had decreased by more than 100 ppb when halimeter readings at corresponding time points measured at 7 days, and eight of these subjects contin- ued to exhibit reduced levels at day 14 (Fig. 1 and Sample time P-value Table 1). The mean day 7 reading was significantly Day 0 (baseline reading 1) 0Æ2917 lower than the baseline readings at days 0 and 1. The Day 1 (baseline reading 2) 0Æ7844 VSC readings of the 10 subjects in the control group Day 7 0Æ0080** were similar to that of the subjects in the active group Day 14 ND
ND, not determined. 450 Number given in bold denotes significance. 400 350 300 500 S1 250 450 400 200 350
VSC (ppb) 150 300 100 250 50 200 VSC (ppb) 0 150 Day 0 Day 1 Day 7 Day 14 100 50 0 Figure 1 Mean volatile sulphur compound (VSC) levels of mouth air 1 4 7 11 14 21 28 Post from subjects and before and after treatment with either Strepto- Day coccus salivarius K12 or placebo. , Active; h, the Placebo
500 S3 450 Table 1 Significance of halimeter readings of the active treatment 400 group between time points 350 300 Comparison time points P-value 250 200 Day 0 vs day 1 >0Æ05 VSC (ppb) 150 Day 0 vs day 7 <0Æ05* 100 Day 0 vs day 14 >0Æ05 50 Day 1 vs day 7 <0Æ05* 0 1 4 7 11 14 21 28 Post Day 1 vs day 14 >0Æ05 Day 7 vs day 14 >0Æ05 Day
Underlining denotes sample times when subjects are on active treat- Figure 2 Volatile sulphur compound (VSC) levels of mouth air from ment. Numbers in bold denote significance. subjects (S1 and S3) over 28 days and after treatment.
ª 2006 The Authors Journal compilation ª 2006 The Society for Applied Microbiology, Journal of Applied Microbiology 100 (2006) 754–764 757 Effect of S. salivarius K12 on halitosis J.P. Burton et al. substantial drops in their VSC readings while on the act- standard deviation) salivary counts for S. salivarius were: ive treatment were re-evaluated 6 weeks later. The VSC 4Æ4 · 107 (6Æ8 · 107) (for initial screen); 4Æ5 · 107 (6Æ2 · levels of two of these subjects (S4 and S8) had increased 107) (just prior to commencing treatment); 6Æ1 · 107 significantly (532 and 298 ppb respectively) when com- (7Æ8 · 107) (after 7 days of treatment); and 6Æ1 · 107 pared with treatment levels (as low as 128 and 126 ppb (6Æ6 · 107) (after 14 days). Mean cell counts of strain respectively). By contrast, the third subject (S12) appeared K12 were 1Æ8 · 107 (4Æ9 · 107), 5Æ8 · 107 (1Æ4 · 107) ) to have maintained relatively reduced VSC levels CFU ml 1, respectively, at days 7 and 14 after commen- (216 ppb). All three subjects were then treated with CHX cing treatment. (but not with the lozenges containing the S. salivarius) for 3 days to determine whether the use of CHX alone DGGE analysis had any impact on their VSC levels. No significant reduc- tion could be detected at day 7. The saliva samples prior to treatment generally had sim- ilar DNA banding profiles, especially with respect to the predominant fragments (Fig. 3). Sequence similarities for Culture data some of the major fragments are listed in Table 3. Most Streptococcus salivarius K12 was detected in the saliva of of the DGGE profiles changed after treatment. The basic each subject in the active group when tested at days 7 profiles of subjects who either did or did not maintain and 14. There was a slight though not significant increase low VSC readings at day 14 were in general quite similar. ) in total S. salivarius CFU ml 1 of saliva. The mean (and However, one feature, was that the subjects who main-
(a) (b) (c) K12 1 345671089 11 1213 21K12 4 8 91310 12 K12 3 567 11
1 2
3
Figure 3 Denaturing gradient gel electrophoresis (DGGE) of 16S rRNA amplicons from bacterial DNA in subjects’ saliva samples: (a) prior to treat- ment, (b) eight subjects exhibiting a decrease of volatile sulphur compounds at day 14 and (c) five subjects not having a decrease in volatile sul- phur levels at day 14. Numbers on gel figure denote fragments excised, re-amplified and sequenced. Closest DNA homologies are presented in Table 3.
ª 2006 The Authors 758 Journal compilation ª 2006 The Society for Applied Microbiology, Journal of Applied Microbiology 100 (2006) 754–764 J.P. Burton et al. Effect of S. salivarius K12 on halitosis
Table 3 BLAST analysis of bacterial V2-V3 16S rRNA sequences of excised fragments Fragment Most related bacterial % identity and Accession from denaturing gradient gel electrophoresis in gels species match bp searched number gels 1 Prevotella veroralis ATCC 33779 99 (150) L16473 2 Prevotella melaninogenica ATCC 25845 97 (154) L16469 3 Veillonella dispar 98 (172) AF439639 4 Prevotella veroralis ATCC 33779 99 (150) L16473 5 Prevotella melaninogenica ATCC 25845 100 (152) L16469 6 Veillonella dispar 95 (172) AF439639 7 Neisseria pharyngis NCTC 4590 98 (152) X74893 8 Prevotella pallens 98 (167) Y13106 9 Prevotella veroralis ATCC 33779 99 (152) L16473 10 Prevotella melaninogenica ATCC 25845 100 (152) AY323525 11 Veillonella dispar 99 (171) AF439639 tained low readings typically had a more predominant B producers in that it failed to inhibit the Streptococcus band in the position corresponding to S. salivarius ampli- anginosis indicator strain. Streptococcus salivarius MU (sal- cons. Other than for subject 23, who had a different pro- ivaricin A-negative, salivaricin B-negative) did not inhibit file in each sample, the subjects in the control group did any of the indicator strains tested. not exhibit any substantial changes in their DGGE pro- files when tested 7 days after completion of the treatment Inhibitory activity of salivaricin-producing S. salivarius protocols (data not shown). against black-pigmented bacteria present in saliva The DGGE profiles of subjects 1 and 3 were tracked for 28 days (Fig. 4). Subject 1 did not show any immedi- Blood agar vancomycin medium (semiselective for ate profile change after the CHX and K12 treatment, black-pigmented bacteria) in which one half of the agar other than the appearance of a fragment presumed to be had been impregnated with both salivaricin A and sali- S. salivarius K12. However, the profile of this subject varicin B was used to detect inhibitory action against changed dramatically in the day 11 and day 14 samples. black-pigmented bacteria. Dilutions of saliva from two After this, the DGGE profile returned to one which was subjects were spiral plated onto the various selective similar to that detected originally. By contrast, the DGGE media. The nonbacteriocin-impregnated half of the agar profiles of subject 3 changed immediately after the treat- acted as a control. The numbers of black-pigmented ment commenced. A fragment which migrated similarly bacteria grown from the saliva were decreased by 92% to that representative of S. salivarius K12 became pre- for subject A and 62% for subject B (compared to con- dominant at this time. However, as with subject 1, there trol counts), on agar that had been impregnated with appeared to be major changes in the composition of the both salivaricin A and salivaricin B (Table 5, Fig. 5). By microbiota at days 11 and 14. By days 21, 28 and in the contrast, the pregrowth of a salivaricin-negative strain post-K12 treatment sample the microbiota appeared to on the test agar effected only a small decrease in the have changed again, to a profile more similar to that pre- numbers of colonies of black-pigmented colonies in the sent at day 7. samples from subject A and even appeared to effect an increase in the numbers of these colonies for subject B. Five representative black-pigmented colonies were Inhibitory activity of salivaricin-producing S. salivarius picked from the control half of one of the bacteriocin- against halitosis-associated species impregnated plates and the DNA was extracted, ampli- Streptococcus salivarius strains known to produce salivari- fied by PCR and sequenced. The sequences of the 16S cin A and/or salivaricin B showed inhibitory activity only rDNA PCR products from each of these corresponded against Gram-positive halitosis-associated species in most closely to Prevotella sp. oral clone BE073 (closely deferred antagonism tests (Table 4). The strongest inhibi- related to Prevotella melaninogenica, 99% 152 bp, tion was given by strain K12, which produces both sali- AF385551). varicin A and salivaricin B. Streptococcus salivarius strain NR (salivaricin B producer) exhibited similar activity to Discussion strain K12, except for its somewhat weaker activity against Eubacterium saburreum. Streptococcus salivarius It is evident that the use of antimicrobials for treatment 20P3 (salivaricin A producer) differed from the salivaricin of dental infections may also nonspecifically deplete the
ª 2006 The Authors Journal compilation ª 2006 The Society for Applied Microbiology, Journal of Applied Microbiology 100 (2006) 754–764 759 Effect of S. salivarius K12 on halitosis J.P. Burton et al.
Subject 1 Subject 3
Sample K12 1 4 7 11 14 21 28 Post K12 1 4 7 11 14 21 28 Post
8
7 4 5 9 10
6 11
Figure 4 Denaturing gradient gel electrophoresis (DGGE) of 16S rRNA amplicons from two subjects (S1 and S3). Numbers on gel figure denote fragments excised, re-amplified and sequenced. Closest DNA homologies are presented in Table 3.
Table 4 Deferred antagonism inhibition of representatives of certain bacterial species implicated in halitosis by bacteriocin-producing Strepto- coccus salivarius
Inhibition of species implicated in halitosis
Micrococcus Eubacterium Micromonas Porphyromonas Prevotella S. salivarius Bacteriocin/ luteus I1 Streptococcus saburreum micros gingivalis Porphyromonas intermedia strain s produced (control) anginosis T29 ATCC 33271 ATCC 33270 ATCC 33277 gingivalis W50 ATCC 25611
K12 Salivaricin A +++ +++ +++ +++ ))) Salivaricin B NR Salivaricin B +++ +++ ++ +++ ))) 20P3 Salivaricin A +++ ) ++ )) ) ) MU Neg Nonproducer ))))) ) ) levels of some bacterial species perceived to be of benefit ronment typically is left to chance as the melee of to the ‘balance’ of the ecosystem. In such postantimicro- residual microbes start to repopulate their depleted envi- bial states the replenishment of the bacterial micro-envi- ronment. Sometimes harmless commensals will prosper.
ª 2006 The Authors 760 Journal compilation ª 2006 The Society for Applied Microbiology, Journal of Applied Microbiology 100 (2006) 754–764 J.P. Burton et al. Effect of S. salivarius K12 on halitosis
Table 5 Effect of bacteriocin-producing vs nonproducing Strepto- persistence of Streptococcus salivarius K12 was detected in coccus salivarius on growth of black-pigmented anaerobes in saliva the post-treatment saliva samples (days 7 and 14) specimens obtained from each subject. S. salivarius strain and CFU ml)1 of black-pigmented When considering the use of probiotics as infection pre- colony morphology ventatives, favourable characteristics include occupation of tissue sites that would otherwise be taken up by potentially Subject K12 Control half MU Neg Control half undesirable organisms, production of antibacterial com- A1Æ4 · 105 1Æ7 · 106 1Æ8 · 106 2Æ2 · 106 pounds and (possibly) stimulation of the immune defences B3Æ0 · 106 7Æ9 · 106 5Æ4 · 106 2Æ6 · 106 of the host (Hinode et al. 2003). Strain K12 produces at least two lantibiotic bacteriocins that are inhibitory to rep- resentative strains of several species of Gram-positive bac- teria implicated in halitosis. Although strain K12 did not appear to inhibit reference strains of Prevotella and Porphy- romonas in vitro, when fresh saliva was plated onto media on which strain K12 had previously been grown (leading to the deposition of salivaricin A and salivaricin B), the growth of black-pigmented bacteria identified as Prevotella species was inhibited. Studies in our laboratory have shown that salivaricin A is bacteriostatic, whereas, salivaricin B is bacteriocidal in its mode of action (Ross et al. 1993; Upton et al. 2001; Tagg and Dierksen 2003; Tagg 2004). The lim- ited data presented here with pure isolates and with bac- teria present in saliva indicate that inhibition is probably greater when the two salivaricins are present in combina- tion. The production of each of these salivaricins appears to be auto-inducible and moreover they both seem capable of stimulating homologous bacteriocin production by indi- genous oral S. salivarius populations in vivo. Thus, admin- istration of strain K12 may also boost salivaricin levels in a subject’s saliva by cross-stimulating salivaricin production by pre-existing members of the indigenous microbiota and Figure 5 Example of inhibitory effect of Streptococcus salivarius K12 may have benefit without actually colonizing the host. (right half) on colonies of black-pigmented bacteria grown from a Measurement of VSC levels showed that most subjects saliva sample. displayed significant improvement when tested 7 and 14 days after the commencement of K12 treatment. Two However, under certain circumstances, potentially patho- subjects (S1 and S3) who kept using K12 lozenges for genic bacteria may flourish. In the present study, a CHX 28 days generally maintained lower VSC readings than mouth rinse pretreatment was used. Chlorhexidine is gen- they had prior to commencing treatment, indicating that erally considered to be an effective, though relatively lowered VSC levels might be achieved by persistent indiscriminate, antimicrobial for the short-term relief of administration of K12 lozenges (Fig. 2). Although only halitosis. However, rather than relying solely upon natural two subjects were studied in depth, the data obtained microbial succession to repopulate the mouth, instillation indicated that if S. salivarius was adopted as a halitosis of a harmless oral commensal (S. salivarius K12) was used treatment, the optimal dosing requirements could differ to exert some control over the process (De Boever and from subject to subject. Some may require only occa- Loesche 1995; Kazor et al. 2003; Tagg and Dierksen sional dosing, while others may require a more regular 2003). The attempted introduction of probiotic strains to maintenance regimen, as is common practice with other other established microbial habitats, such as the colon, probiotics. In this study, we cannot exclude the possibility rarely achieves long-term persistence or colonization by that some of the malodour was from primary sources the candidate micro-organisms (Tannock et al. 2000). other than the tongue. Indeed, it is conceivable that some Often, however, even the brief presence and putative of the subjects who showed little change in their mal- metabolic activity of the transitory probiotic micro-organ- odour parameters may have had nonoral halitosis. Addi- isms appears to aid the restoration of a ‘beneficial’ micro- tionally, those subjects who did not experience any environment (Burton et al. 2003). In the present study, significant change in their halitosis parameters may
ª 2006 The Authors Journal compilation ª 2006 The Society for Applied Microbiology, Journal of Applied Microbiology 100 (2006) 754–764 761 Effect of S. salivarius K12 on halitosis J.P. Burton et al. require a more potent antimicrobial treatment (e.g. a lon- For a certain group of bacteria to be detected by ger or stronger CHX treatment or use of a broad-spec- DGGE amongst a complex population it must represent trum antibiotic) to achieve adequate initial depletions of a substantial proportion of that population (Muyzer their populations of halitosis-associated bacteria (Pratten and Smalla 1998). Thus, some ‘minority’ micro-organ- et al. 1998; McBain et al. 2003). isms which may nevertheless exert considerable influ- Chlorhexidine is a potent antimicrobial compound and ence on the composition or metabolism of the has been shown to be extremely effective when used daily microbiota may not be detected. Indeed the species for the treatment of halitosis (Rosenberg et al. 1992; van reported here appear to be constituents of the ‘normal’ Steenberghe et al. 2001; Quirynen et al. 2002; Winkel oral microbiota (Kazor et al. 2003; Mager et al. 2003). et al. 2003; Young et al. 2003). Previous studies on the However, a wide variety of micro-organisms have been effect of CHX on the oral microbiota have shown in implicated in halitosis (Loesche and Kazor 2002) and some cases that bacterial populations recover to pretreat- while some aetiologically significant species may be ment levels within 24 h (Schiott et al. 1970). The control identified, it is also likely that other organisms may be group subjects (using bacteria-free lozenges) had a slight, collectively responsible for the shift from a normal sac- though nonsignificant reduction in their malodour charolytic bacterial population to one which is largely parameters indicating that there may have been a slight proteolytic (De Boever and Loesche 1995). The micro- residual benefit either from CHX treatment or from the bial agents of halitosis may also be minor components sucking of lozenges. Interestingly, CHX treatment of sub- of a so-called ‘healthy’ oral microbiota. Alternatively, a ject 1 had not altered the VSC level when tested 1 day consortium of phylogenetically diverse, but metabolically after ceasing treatment. However, the VSC levels had similar organisms may change the micro-environment. decreased by day 7 (3 days of K12 treatment only) but Given the complexity of the oral microbiota implicated returned to high levels when tested 2 weeks after ceasing in halitosis (Kazor et al. 2003), it appears that tools S. salivarius K12 treatment. Also, three recalled subjects such as DGGE, generally considered suitable for monit- from the study who had experienced successful resolution oring complex microbial consortia may not have suffi- of symptoms during the treatment protocol, failed to cient sensitivity to detect some of the critical bacterial show any decrease in their VSC levels when tested 4 days changes. Further studies from information obtained after using just CHX. with gene libraries for most oral bacterial species or Microbial culture analysis was performed on saliva strains, cultured or not (Kazor et al. 2003) may enable samples, as previous studies have shown that the compo- more in depth analysis. sition of the salivary microbiota is representative of that Although the majority of the small number of sub- found on the dorsal and lateral surfaces of the tongue jects in the active group in this pilot study had a (Mager et al. 2003). More than 600 species of bacteria favourable outcome, more extensive double blind, pla- have been detected in the oral microbiota (Kazor et al. cebo-controlled studies are now required. From the 2003). The DGGE profiles obtained in the present study data presented here, it appears, however, that the appli- represent only some of the most prevalent members of cation of probiotic therapy using Streptococcus salivarius the salivary populations and indeed similar fragment K12 following antimicrobial pretreatment may alleviate patterns were obtained for each subject prior to treat- some forms of halitosis. Also, given that Streptococcus ment. Fragments corresponding to Prevotella veroralis, salivarius has a numerical, yet benign predominance P. melaninogenica and Veillonella dispar sequences pre- in the mouth, the impact of competitive (bacteriocin- dominated in these subjects. Although there were changes producing) S. salivarius on other oral diseases merits in the DGGE profiles after treatment, it was difficult to further investigation. determine whether there was a correlation between band- ing pattern and a clinical state indicative of halitosis or References health. One striking observation, however, was the more prominent appearance of DNA fragments representing Burton, J.P. and Reid, G. (2002) Evaluation of the bacterial S. salivarius in samples from the subjects who experienced vaginal flora of 20 postmenopausal women by direct a reduction in VSC levels (Fig. 3). For the two subjects (Nugent score) and molecular (polymerase chain reaction who were sampled more frequently, some interesting and denaturing gradient gel electrophoresis) techniques. associations were noted. For example, both subjects had J Infect Dis 186, 1770–1780. VSC levels that temporarily ‘spiked’ at either day 14 (S3) Burton, J.P., Cadieux, P.A. and Reid, G. (2003) Improved or day 21 (S1) corresponding to saliva samples in which understanding of the bacterial vaginal microbiota of S. salivarius fragments were less pronounced in the DGGE women before and after probiotic instillation. Appl Environ gels (Fig. 4). Microbiol 69, 97–101.
ª 2006 The Authors 762 Journal compilation ª 2006 The Society for Applied Microbiology, Journal of Applied Microbiology 100 (2006) 754–764 J.P. Burton et al. Effect of S. salivarius K12 on halitosis
Cadieux, P., Burton, J., Gardiner, G., Braunstein, I., Bruce, Reid, G. (2005) The importance of guidelines in the develop- A.W., Kang, C.Y. and Reid, G. (2002) Lactobacillus strains ment and application of probiotics. Curr Pharm Des 11, and vaginal ecology. J Am Med Assoc 287, 1940–1941. 11–16. Carlsson, J., Grahnen, H., Jonsson, G. and Wikner, S. (1970) Reid, G., Jass, J., Sebulsky, M.T. and McCormick, J.K. (2003) Early establishment of Streptococcus salivarius in the mouth Potential uses of probiotics in clinical practice. Clin Micro- of infants. J Dent Res 49, 415–418. biol Rev 16, 658–672. Connolly, E., Valeur, N., Engel, P., Carbajal, N. and Ladefoged, Rosenberg, M. (1996) Clinical assessment of bad breath: cur- K. (2003) In situ colonisation and immunomodulation by rent concepts. J Am Dent Assoc 127, 475–482. the probiotic Lactobacillus reuteri (ATCC 55730) in the Rosenberg, M. (2002) The science of bad breath. Sci Am 286, human gastrointestinal tract. Clin Nutr 22, S57. 72–79. De Boever, E.H. and Loesche, W.J. (1995) Assessing the contri- Rosenberg, M., Gelernter, I., Barki, M. and Bar-Ness, R. bution of anaerobic microflora of the tongue to oral malo- (1992) Day-long reduction of oral malodor by a two-phase dor. J Am Dent Assoc 126, 1384–1393. oil:water mouthrinse as compared to chlorhexidine and Freitas, M., Tavan, E., Cayuela, C., Diop, L., Sapin, C. and placebo rinses. J Periodontol 63, 39–43. Trugnan, G. (2003) Host-pathogens cross-talk. Indigenous Ross, K.F., Ronson, C.W. and Tagg, J.R. (1993) Isolation and bacteria and probiotics also play the game. Biol Cell 95, characterization of the lantibiotic salivaricin A and its 503–506. structural gene salA from Streptococcus salivarius 20P3. Gill, H.S. (2003) Probiotics to enhance anti-infective defences Appl Environ Microbiol 59, 2014–2021. in the gastrointestinal tract. Best Pract Res Clin Gastro- Rudney, J.D., Pan, Y. and Chen, R. (2003) Streptococcal diver- enterol 17, 755–773. sity in oral biofilms with respect to salivary function. Arch Hinode, D., Fukui, M., Yokoyama, N., Yokoyama, M., Oral Biol 48, 475–493. Yoshioka, M. and Nakamura, R. (2003) Relationship Schiott, C.R., Loe, H., Jensen, S.B., Kilian, M., Davies, R.M. between tongue coating and secretory-immunoglobulin A and Glavind, K. (1970) The effect of chlorhexidine mouth- level in saliva obtained from patients complaining of oral rinses on the human oral flora. J Periodontal Res 5, 84–89. malodor. J Clin Periodontol 30, 1017–1023. Scully, C., el-Maaytah, M., Porter, S.R. and Greenman, J. Kazor, C.E., Mitchell, P.M., Lee, A.M., Stokes, L.N., Loesche, (1997) Breath odor: etiopathogenesis, assessment and W.J., Dewhirst, F.E. and Paster, B.J. (2003) Diversity of management. Eur J Oral Sci 105, 287–293. bacterial populations on the tongue dorsa of patients with van Steenberghe, D., Avontroodt, P., Peeters, W., Pauwels, M., halitosis and healthy patients. J Clin Microbiol 41, 558– Coucke, W., Lijnen, A. and Quirynen, M. (2001) Effect of 563. different mouthrinses on morning breath. J Periodontol 72, Khaira, N., Palmer, R.M., Wilson, R.F., Scott, D.A. and Wade, 1183–1191. W.G. (2000) Production of volatile sulphur compounds in Tagg, J.R. (2004) Prevention of streptococcal pharyngitis by diseased periodontal pockets is significantly increased in anti-Streptococcus pyogenes bacteriocin-like inhibitory sub- smokers. Oral Dis 6, 371–375. stances (BLIS) produced by Streptococcus salivarius. Indian Loesche, W.J. and Kazor, C. (2002) Microbiology and treat- J Med Res 119 (Suppl), 13–16. ment of halitosis. Periodontol 2000 28, 256–279. Tagg, J.R. and Bannister, L.V. (1979) ‘Fingerprinting’ beta-hae- Mager, D.L., Ximenez-Fyvie, L.A., Haffajee, A.D. and Socransky, molytic streptococci by their production of and sensitivity S.S. (2003) Distribution of selected bacterial species on in- to bacteriocine-like inhibitors. J Med Microbiol 12, 397–411. traoral surfaces. J Clin Periodontol 30, 644–654. Tagg, J.R. and Dierksen, K.P. (2003) Bacterial replacement McBain, A.J., Bartolo, R.G., Catrenich, C.E., Charbonneau, D., therapy: adapting ‘germ warfare’ to infection prevention. Ledder, R.G. and Gilbert, P. (2003) Effects of a chlorhexi- Trends Biotechnol 21, 217–223. dine gluconate-containing mouthwash on the vitality and Tannock, G.W., Munro, K., Harmsen, H.J., Welling, G.W., antimicrobial susceptibility of in vitro oral bacterial ecosys- Smart, J. and Gopal, P.K. (2000) Analysis of the fecal tems. Appl Environ Microbiol 69, 4770–4776. microflora of human subjects consuming a probiotic prod- Muyzer, G. and Smalla, K. (1998) Application of denaturing uct containing Lactobacillus rhamnosus DR20. Appl Environ gradient gel electrophoresis (DGGE) and temperature gra- Microbiol 66, 2578–2588. dient gel electrophoresis (TGGE) in microbial ecology. Upton, M., Tagg, J.R., Wescombe, P. and Jenkinson, H.F. Antonie Van Leeuwenhoek 73, 127–141. (2001) Intra- and interspecies signaling between Strepto- Pratten, J., Barnett, P. and Wilson, M. (1998) Composition coccus salivarius and Streptococcus pyogenes mediated by and susceptibility to chlorhexidine of multispecies biofilms SalA and SalA1 lantibiotic peptides. J Bacteriol 183, of oral bacteria. Appl Environ Microbiol 64, 3515–3519. 3931–3938. Quirynen, M., Avontroodt, P., Soers, C., Zhao, H., Pauwels, Valeur, N., Engel, P., Carbajal, N., Connolly, E. and Ladefoged, M., Coucke, W. and van Steenberghe, D. (2002) The effic- K. (2004) Colonization and immunomodulation by Lacto- acy of amine fluoride/stannous fluoride in the suppression bacillus reuteri ATCC 55730 in the human gastrointestinal of morning breath odour. J Clin Periodontol 29, 944–954. tract. Appl Environ Microbiol 70, 1176–1181.
ª 2006 The Authors Journal compilation ª 2006 The Society for Applied Microbiology, Journal of Applied Microbiology 100 (2006) 754–764 763 Effect of S. salivarius K12 on halitosis J.P. Burton et al.
Walter, J., Tannock, G.W., Tilsala-Timisjarvi, A., Rodtong, S., Yaegaki, K. and Coil, J.M. (2000) Examination, classification, Loach, D.M., Munro, K. and Alatossava, T. (2000) Detec- and treatment of halitosis; clinical perspectives. J Can Dent tion and identification of gastrointestinal Lactobacillus spe- Assoc 66, 257–261. cies by using denaturing gradient gel electrophoresis and Yoshida, Y., Negishi, M., Amano, A., Oho, T. and Nakano, Y. species-specific PCR primers. Appl Environ Microbiol 66, (2003) Differences in the betaC-S lyase activities of viri- 297–303. dans group streptococci. Biochem Biophys Res Commun Winkel, E.G., Roldan, S., Van Winkelhoff, A.J., Herrera, D. 300, 55–60. and Sanz, M. (2003) Clinical effects of a new mouthrinse Young, A., Jonski, G. and Rolla, G. (2003) Inhibition of orally containing chlorhexidine, cetylpyridinium chloride and produced volatile sulfur compounds by zinc, chlorhexidine zinc-lactate on oral halitosis. A dual-center, double-blind or cetylpyridinium chloride – effect of concentration. Eur J placebo-controlled study. J Clin Periodontol 30, 300–306. Oral Sci 111, 400–404.
ª 2006 The Authors 764 Journal compilation ª 2006 The Society for Applied Microbiology, Journal of Applied Microbiology 100 (2006) 754–764 Diversity of Bacterial Populations on the Tongue Dorsa of Patients with Halitosis and Healthy Patients
C. E. Kazor, P. M. Mitchell, A. M. Lee, L. N. Stokes, W. J. Loesche, F. E. Dewhirst and B. J. Paster J. Clin. Microbiol. 2003, 41(2):558. DOI: 10.1128/JCM.41.2.558-563.2003.
Downloaded from Updated information and services can be found at: http://jcm.asm.org/content/41/2/558
These include: REFERENCES This article cites 34 articles, 15 of which can be accessed free at: http://jcm.asm.org/content/41/2/558#ref-list-1 http://jcm.asm.org/
CONTENT ALERTS Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more» on June 17, 2014 by guest on June 17, 2014 by guest
Information about commercial reprint orders: http://journals.asm.org/site/misc/reprints.xhtml To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/ JOURNAL OF CLINICAL MICROBIOLOGY, Feb. 2003, p. 558–563 Vol. 41, No. 2 0095-1137/03/$08.00ϩ0 DOI: 10.1128/JCM.41.2.558–563.2003 Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Diversity of Bacterial Populations on the Tongue Dorsa of Patients with Halitosis and Healthy Patients C. E. Kazor,1 P. M. Mitchell,2 A. M. Lee,2 L. N. Stokes,2 W. J. Loesche,1 F. E. Dewhirst,2,3 and B. J. Paster2,3* Department of Microbiology and Immunology, School of Medicine, University of Michigan, Ann Arbor, Michigan,1 and Department of Molecular Genetics, The Forsyth Institute,2 and Department of Oral and Developmental Biology, Harvard School of Dental Medicine,3 Boston, Massachusetts
Received 5 August 2002/Returned for modification 9 November 2002/Accepted 21 November 2002
The primary purpose of the present study was to compare the microbial profiles of the tongue dorsa of Downloaded from healthy subjects and subjects with halitosis by using culture-independent molecular methods. Our overall goal was to determine the bacterial diversity on the surface of the tongue dorsum as part of our ongoing efforts to identify all cultivable and not-yet-cultivated species of the oral cavity. Tongue dorsum scrapings were analyzed from healthy subjects with no complaints of halitosis and subjects with halitosis, defined as an organoleptic score of 2 or more and volatile sulfur compound levels greater than 200 ppb. 16S rRNA genes from DNA isolated from tongue dorsum scrapings were amplified by PCR with universally conserved bacterial primers and cloned into Escherichia coli. Typically, 50 to 100 clones were analyzed from each subject. Fifty-one strains isolated from the tongue dorsa of healthy subjects were also analyzed. Partial sequences of approximately 500
bases of cloned inserts from the 16S rRNA genes of isolates were compared with sequences of known species http://jcm.asm.org/ or phylotypes to determine species identity or closest relatives. Nearly complete sequences of about 1,500 bases were obtained for potentially novel species or phylotypes. In an analysis of approximately 750 clones, 92 different bacterial species were identified. About half of the clones were identified as phylotypes, of which 29 were novel to the tongue microbiota. Fifty-one of the 92 species or phylotypes were detected in more than one subject. Those species most associated with healthy subjects were Streptococcus salivarius, Rothia mucilaginosa, and an uncharacterized species of Eubacterium (strain FTB41). Streptococcus salivarius was the predominant species in healthy subjects, as it represented 12 to 40% of the total clones analyzed from each healthy subject. Overall, the predominant microbiota on the tongue dorsa of healthy subjects was different from that on the
tongue dorsa of subjects with halitosis. Those species most associated with halitosis were Atopobium parvulum, on June 17, 2014 by guest a phylotype (clone BS095) of Dialister, Eubacterium sulci, a phylotype (clone DR034) of the uncultivated phylum TM7, Solobacterium moorei, and a phylotype (clone BW009) of Streptococcus. On the basis of our ongoing efforts to obtain full 16S rRNA sequences for all cultivable and not-yet-cultivated species that colonize the oral cavity, there are now over 600 species.
Halitosis, or oral malodor, is a common complaint of up to malodorous compounds as by-products of their metabolism one-third of the general population and a large concern for the including VSCs and short-chain organic acids such as valeric many individuals whom it affects (6, 19). Halitosis can arise acid, butyric acid, putrescine, and skatole (16). Species that from a variety of sources including the sinuses, gastrointestinal produce such malodorous compounds include Treponema den- tract, ingested food, lungs, and, most frequently, the oral cav- ticola, Porphyromonas gingivalis, Prevotella intermedia, Tan- ity. Oral production of malodorous substances is most com- nerella forsythensis, Porphyromonas endodontalis, and Eubacte- monly associated with by-products of bacterial metabolic deg- rium species (25, 26). radation and occurs on oral surfaces, in periodontal pockets, Halitosis has been correlated with the presence and severity and especially on the dorsal tongue surface. These products of periodontal disease and by the amount of coating on the result from microbial fermentation of proteins, peptides, and tongue (3, 20, 21). Various methods of detecting and quanti- mucins found in saliva, blood, gingival crevicular fluid, lysed fying oral odor have been proposed, including organoleptic neutrophils, desquamated epithelial cells, and any residual odor rating schemes (smelling the breath) (27, 29, 35) and food retained on the oral surfaces (16). The most conspicuous analytical techniques involving gas chromatography, mass malodorous compounds are termed volatile sulfur compounds spectrometry, and cryo-osmoscopy. Rosenberg and colleagues (VSCs), with hydrogen sulfide, methyl mercaptan, and di- (28) have reported on the use of a portable sulfide monitor methyl sulfide accounting for roughly 90% of the VSCs (32). called a Halimeter (Interscan, Chatsworth, Calif.) to quanti- Many oral bacteria, especially gram-negative anaerobic species tate the levels of VSCs in mouth breath and have shown that found in the subgingival plaque, produce a diverse array of these levels significantly correlate with the measurements made by organoleptic odor rating schemes. In individuals with oral malodor, tongue-coating samples have been shown to * Corresponding author. Mailing address: The Forsyth Institute, 140 hydrolyze N-benzoyl-DL-arginine-2-naphthylamide (BANA) Fenway, Boston, MA 02115. Phone: (617) 456-7716. Fax: (617) 456- (2, 4, 11, 21). Since the BANA test detects an arginine hydro- 7737. E-mail: [email protected]. lase produced by proteolytic bacteria, this test provides addi-
558 VOL. 41, 2003 TONGUE BACTERIA IN HALITOSIS AND HEALTHY PATIENTS 559
TABLE 1. Clinical parameters of study population Sample collection. Samples were collected by scraping the tongue surface from the vallate papilla area to the anterior tongue border with a sterile wooden Volatile sulfur BANA test Subject Organoleptic Tongue tongue depressor. All tongue scrapings were used directly for clonal analysis as Odor status compound result for clone scorea coating described below. Strains were isolated from some samples on either ETSA concn (ppb)b tongue medium (enriched Trypticase soy agar to which hemin, menadione, nitrate, and Malodor M1 3 350 ϩϩ/Ϫ lactate were added to support growth of oral species) or MM10 medium (1/10 M2 4 411 ϩϪ dilution of ETSA medium) (17). M3 3 452 ϩϩ/Ϫ Sample lysis. Pure cultures or tongue scrapings were directly suspended in 50 M4 4 642 ϩϩ/Ϫ l of 50 mM Tris buffer (pH 7.6)–1 mM EDTA (pH 8)–0.5% Tween 20. Pro- M5 4 346 ϩϪ teinase K (200 g/ml) was added. The samples were then heated at 55°Cfor2h. M6 4 749 ϩϩ Proteinase K was inactivated by heating at 95°C for 5 min. Amplification of 16S rRNA cistrons by PCR and purification of PCR products. Healthy H1 1 87 ϪϪ The 16S rRNA genes (rDNAs) were amplified under standard conditions with a H2 2 160 ϩϩ/Ϫ universal primer set (forward primer, 5Ј-GAG AGT TTG ATY MTG GCT H3 2 144 ϩϪ CAG; reverse primer, 5Ј- GAA GGA GGT GWT CCA RCC GCA) (22). H4 2 113 ϪϪ Primers were synthesized commercially (Operon Technologies, Alameda, Calif.). H5 2 132 Ϫϩ/Ϫ PCR was performed in thin-walled tubes with a Perkin-Elmer 9700 thermocycler. One microliter of the DNA template was added to a reaction mixture (final a A score of Ն2 is associated with malodor. volume, 50 l) containing 20 pmol of each primer, 40 nmol of deoxynucleoside Downloaded from b Ͼ A level of 200 ppb is associated with malodor (Halimeter; Interscan Cor- triphosphates, and1UofTaq 2000 polymerase (Stratagene, La Jolla, Calif.) in poration). buffer containing Taqstart antibody (Sigma Chemical Co.). In a hot-start proto- col, the samples were preheated at 95°C for 8 min, followed by amplification under the following conditions: denaturation at 95°C for 45 s, annealing at 60°C tional information on the bacterial flora associated with mal- 45 s, and elongation for 1.5 min, with an additional 5 s for each cycle. A total of odor. 30 cycles were performed; this was then followed by a final elongation step at Effective treatments of oral malodor consist of reducing the 72°C for 10 min. The results of PCR amplification were examined by electro- bacterial load on the tongue and teeth through twice-daily phoresis in a 1% agarose gel. DNA was stained with ethidium bromide and visualized under short-wavelength UV light. tooth brushing with fluoride toothpaste and daily tongue de- Cloning procedures. Cloning of PCR-amplified DNA was performed with the http://jcm.asm.org/ bridement with a toothbrush or other mechanical device, alone TOPO TA cloning kit (Invitrogen, San Diego, Calif.) according to the instruc- or in combination with the use of antimicrobial mouth rinses tions of the manufacturer. Transformation was done with competent Escherichia such as chlorhexidine (4, 11, 33, 36). coli TOP10 cells provided by the manufacturer. The transformed cells were then Although the bacteria of the tongue have been implicated as plated onto Luria-Bertani agar plates supplemented with kanamycin, and the plates were incubated overnight at 37°C. The colonies were then placed into 40 a major source of odor production in subjects with halitosis, l of 10 mM Tris. One microliter was used as the template to determine the the bacterial composition of the tongue is still not well char- correct sizes of the inserts in a PCR with an M13 (Ϫ40) forward primer and an acterized. Studies of cultivable tongue microbiota have been M13 reverse primer. The sizes of the inserts (approximately 1,500 bp) were limited by the difficulties of in vitro growth techniques, the low determined by PCR with flanking vector primers, followed by electrophoresis on a 1% agarose gel. Prior to sequencing of the fragments, the PCR-amplified 16S on June 17, 2014 by guest percentage of recovery of total organisms, and the inadequacy rDNA fragments were purified and concentrated with Microcon 100 (Amicon), of microbial identification (7, 10). For example, Kazor et al. followed by use of the QIAquick PCR purification kit (Qiagen). (10) were able to recover only up to 30% of the viable micro- 16S rRNA sequencing. Purified DNA from the PCR was sequenced with an bial count using a growth medium supplemented with human ABI Prism cycle sequencing kit (BigDye Terminator Cycle Sequencing kit with blood and saliva. These findings suggest that much of the AmpliTaq DNA Polymerase FS; Perkin-Elmer). The primers used for sequenc- ing have been reported previously (22). Quarter dye chemistry was used with 80 tongue microbiota has not yet been cultivated, necessitating M primers and 1.5 l of PCR product in a final volume of 20 l. Cycle the use of molecular approaches to better characterize the sequencing was performed with an ABI 9700 instrument, with 25 cycles of tongue microflora. denaturation 96°C for 10 s, annealing, and extension at 60°C for 4 min. The Using culture-independent molecular methods, we had pre- sequencing reactions were run on an ABI 377 DNA sequencer. 16S rRNA sequencing and data analysis of unrecognized inserts. A total of viously detected over 500 species or phylotypes in the subgin- 741 clones with the insert of the correct size of approximately 1,500 bases were gival plaque of healthy subjects and subjects with periodontal analyzed (typically, 50 to 100 per subject). In addition, 51 strains from healthy diseases (22), dental plaque in children with rampant caries subjects without halitosis were analyzed. A sequence of approximately 500 bases (1), and noma (24). Other investigators have used similar tech- was obtained first to determine identity or approximate phylogenetic position. niques to determine the bacterial diversity of saliva (31), den- Full sequences of about 1,500 bases were obtained by using five to six additional sequencing primers (22) for those species deemed novel. For identification of toalveolar abscesses (5), and subgingival plaque of a subject closest relatives, the sequences of the unrecognized inserts were compared to the with gingivitis (12). The purpose of this study was to determine 16S rRNA gene sequences of over 4,000 microorganisms in our database and the bacterial diversity on the tongue dorsum and to compare over 50,000 sequences in the Ribosomal Database Project (18) and GenBank the predominant bacteria (including not-yet-cultivated species) databases. Programs for data entry, editing, sequence alignment, secondary structure comparison, similarity matrix generation, and phylogenetic tree con- that are present on the surface of the tongue dorsa of subjects struction were written by F. E. Dewhirst (23). The similarity matrices were with and without oral malodor. corrected for multiple base changes at single positions by the method of Jukes and Cantor (9). Similarity matrices were constructed from the aligned sequences by using only those sequence positions for which data were available for 90% of MATERIALS AND METHODS the strains tested. Phylogenetic trees were constructed by the neighbor-joining Subject population. Halitosis in healthy adult subjects with self-reported ha- method of Saitou and Nei (30). TREECON, a software package for the Mi- litosis (n ϭ 6) was confirmed by an organoleptic rating of 2 or more and VSC crosoft Windows environment, was used for the construction and drawing of measurements greater than 200 ppb (Table 1). BANA hydrolysis (BANA Test; evolutionary trees (34). OraTec Corp, Manassas, Va.) was also determined (Table 1), since positive We are aware of the potential creation of 16S rDNA chimera molecules during scores by the BANA test have previously been associated with a component of the PCR (14). The percentage of chimeric inserts in 16S rRNA libraries ranged oral malodor (2, 4, 11, 21). Five healthy subjects without evidence of halitosis from 1 to 15%. Chimeric sequences were identified by using the Chimera check were used as controls. program of the Ribosomal Database Project, treeing analysis, or base signature 560 KAZOR ET AL. J. CLIN.MICROBIOL. Downloaded from http://jcm.asm.org/ on June 17, 2014 by guest VOL. 41, 2003 TONGUE BACTERIA IN HALITOSIS AND HEALTHY PATIENTS 561
TABLE 2. Percentage of prevalent species or phylotypes on tongue dorsum
% Clones from:
Species or phylotype Healthy subjects (no. of clones analyzed) Halitosis subjects (no. of clones analyzed)
H1 (102) H2 (51) H3 (68) H4 (65) H5 (76) M1 (50) M2 (56) M3 (46) M4 (81) M5 (78) M6 (47) Atopobium parvulum 36 4851a Cryptobacterium curtum 19 Dialister sp. clone BS095 4 8 2 Eubacterium sulci 24 46 Fusobacterium periodonticum 5 24 Granulicatella adiacens 8 21 5 14 42774 Neisseria flavescens 47 24 Rothia mucilaginosa 64310 54 Streptococcus infantis 1 29654 420 1 Streptococcus parasanguis 27 18 7 32 8 18 92794 Streptococcus pneumoniae 1 10 3 Streptococcus salivarius 41 24 26 12 12 56 Downloaded from Streptococcus sp. clone BW009 4119 Streptococcus strain HalT4-E3 1 2 24 86 Veillonella parvula/V. dispar 36311 22 2 10 1
No. of species detected 21 22 18 16 16 16 29 15 26 28 12 % of total detected 85 60 76 76 69 68 20 71 68 59 88
a Values in boldface indicate that the species comprised at least 10% of the tongue microbiota.
analysis. Species identifications of the chimeras were obtained, but the partial over half of which we cannot presently cultivate. At the time of http://jcm.asm.org/ sequences were not included in the phylogenetic analysis for tree construction. this publication, a list of 630 species or phylotypes of the oral Nucleotide sequence accession numbers. The complete 16S rDNA sequences of clones representing novel phylotypes defined in this study, the sequences of cavity was compiled. The creation of a website is in progress; known species not reported previously, and published sequences are available for however, an updated version of this list can be obtained from electronic retrieval from the EMBL, GenBank, and DDBJ nucleotide sequence the corresponding author. databases under the accession numbers shown in Fig. 1. The number of species or phylotypes that were detected in each subject ranged from 12 to 29, with 16 to 21 species or phylotypes in tongue samples from subjects without malodor RESULTS AND DISCUSSION and from 12 to 29 species or phylotypes in tongue samples on June 17, 2014 by guest A phylogenetic tree of the prevalent species and phylotypes from subjects with malodor (Table 2). The bacterial profiles for detected on the surface of the tongue dorsum for each of the each of these subjects are depicted in the colored columns of subjects is shown in Fig. 1. Collectively, the overall bacterial boxes in Fig. 1. Those species most associated with health were diversity of the tongue dorsum is striking: 92 different bacterial Streptococcus salivarius, Rothia mucilaginosa (Stomatococcus taxa or phylotypes belonging to six bacterial phyla. Only 38, or mucilaginosus), and an uncharacterized, cultivable species of about 40%, of the total number were identified as known Eubacterium (strain FTB41) (Fig. 1 and Table 2). The 15 most species. Consequently, about 60% of the total were identified prevalent species or phylotypes are listed in Table 2, where as phylotypes. As shown in Fig. 1, 29 of these phylotypes were they comprise 60 to 85% of the total clones in subjects without unique to the tongue dorsum, in that they were not found from malodor and 20 to 88% of the total clones in subjects with the sequence analysis of over 6,000 clones from other oral sites, malodor. A prevalent species is defined as a species that was including the subgingival plaque of healthy subjects and sub- detected in at least three subjects. It is noteworthy that S. jects with, periodontitis, acute necrotizing ulcerative gingivitis, salivarius was by far the most predominant species detected in and refractory periodontitis (22); the supragingival plaque of healthy subjects: in one subject (subject H1), S. salivarius rep- children with rampant caries (1); or advanced noma lesions resented more than 40% of the detectable species. In contrast, (24); nor were they found on or in crevicular epithelial cells of S. salivarius was detected in only one of the subjects with healthy subjects and subjects with periodontitis (13). In our halitosis and was detected at very low levels. ongoing studies, we have detected over 300 novel phylotypes Those species most associated with halitosis were Atopobium and 200 known species in oral sites. At present, we estimate parvulum, Eubacterium sulci, Fusobacterium periodonticum,a that over 700 bacterial species are present in the oral cavity, phylotype (clone BS095) of Dialister, a phylotype (clone
FIG. 1. Phylogenetic tree of bacterial species or phylotypes of six phyla identified from the tongue dorsa of healthy subjects and subjects with halitosis. The information presented includes bacterial species or phylotype clone and sequence accession numbers. Novel phylotypes are defined as those taxa that are Ͻ98.5 to 99% similar in sequence comparisons to their closest relatives. Species or phylotypes detected only on the tongue dorsum and not at any other oral site are highlighted in red. Color-coordinated characters indicate health status category or some other site at which each species was identified. Bar, 5% difference in nucleotide sequence. ANUG, acute necrotizing ulcerative gingivitis; NUP, necrotizing ulcerative periodontitis. 562 KAZOR ET AL. J. CLIN.MICROBIOL.
BW009) of Streptococcus, a phylotype (clone DR034) of the 3. De Boever, E. H., M. DeUzeda, and W. J. Loesche. 1994. Relationship uncultivated phylum TM7 (8), and Solobacterium moorei (Fig. between volatile sulfur compounds, BANA-hydrolyzing bacteria and gingival health in patients with and without complaints of oral malodor. J. Clin. Dent. 1 and Table 2). Note that in most of the samples, several 4:114–119. species or phylotypes represented a significant proportion of 4. De Boever, E. H., and W. J. Loesche. 1995. Assessing the contribution of anaerobic microflora of the tongue to oral malodor J. Am. Dent. Assoc. the total (Table 2). Although some species were not detected 126:1384–1393. in all subjects, they were the predominant species in one or 5. Dymock, D., A. J. Weightman, C. Scully, and W. G. Wade. 1996. Molecular more samples. For example, Cryptobacterium curtum was de- analysis of microflora associated with dentoalveolar abscess. J. Clin. Micro- biol. 34:537–542. tected in only one of the samples from a subject with halitosis, 6. Frexinos, J., P. Denis, H. Allemand, S. Allouche, F. Los, and G. Bonnelye. but it represented about 20% of the clones analyzed in that 1998. Descriptive study of digestive functional symptoms in the French subject. Other species, such as Granulicatella (Abiotrophia) general population. Gastroenterol. Clin. Biol. 22:785–791. 7. Hartley, M. G., M. A. El-Maaytah, C. McKenzie, and J. Greenman. 1996. adiacens, Streptococcus parasanguis, Streptococcus infantis, and The tongue microbiota of low odour and malodorous individuals. Microb. Veillonella spp., were commonly detected in most of the sam- Ecol. Health Dis. 9:215–223. 8. Hugenholtz, P., C. Pitulle, K. L. Hershberger, and N. R. Pace. 1998. Novel ples (Table 2). division level bacterial diversity in a Yellowstone hot spring. J. Bacteriol. The tongue dorsum harbors a highly diverse, yet character- 180:366–376. istic, bacterial population. In healthy subjects, S. salivarius was 9. Jukes, T. H., and C. R. Cantor. 1969. Evolution of protein molecules, p.
21–132. In H. N. Munro (ed.), Mammalian protein metabolism, vol. 3. Downloaded from by far the predominant species. In contrast, S. salivarius was Academic Press, Inc., New York, N.Y. typically absent from subjects with halitosis. Although bacteria 10. Kazor, C. E., J. R. Flowers, J. Stoll, and W. J. Loesche. 1999. Oral malodor: other than S. salivarius appeared to be associated with halito- defining the normal tongue flora. J. Dent. Res. 78:421. 11. Kozlovsky, A., D. Gordon, I. Gelernter, W. J. Loesche, and M. Rosenberg. sis, it is not known if they are directly involved in oral malodor. 1994. Correlation between the BANA test and oral malodor parameters. J. Cultural studies have associated R. mucilaginosa with malodor Dent. Res. 73:1036–1042. 12. Kroes, I., P. W. Lepp, and D. A. Relman. 1999. Bacterial diversity within the (7) and S. salivarius and Veillonella parvula or Veillonella dispar human subgingival crevice. Proc. Natl. Acad. Sci. USA 96:14547–14552. as common healthy tongue organisms (C. E. Kazor and W. J. 13. Levin, I. M., C. N. Lau, S. S. Socransky, A. D. Haffajee, L. Martin, J. L. Loesche, unpublished data). Galvin, S. K. Boches, B. J. Paster, and F. E. Dewhirst. 1999. Cultivable and
uncultivable species on or in gingival epithelial cells. J. Dent. Res. 78:453. http://jcm.asm.org/ On the basis of our sequence analyses, the tongue dorsum 14. Liesack, W., H. Weyland, and E. Stackebrandt. 1991. Potential risk of gene possesses a unique microbiota: about one-third of the bacterial amplification by PCR as determined by 16S rDNA analysis of a mixed- population was found only on the tongue and not in or on the culture of strict barophilic bacteria. Microb. Ecol. 21:191–198. 15. Loesche, W. J., W. A. Bretz, D. Kerschensteiner, J. A. Stoll, S. S. Socransky, surfaces of other oral sites. However, a sample of sufficient size P. P. Hujoel, and D. E. Lopatin. 1990. Development of a diagnostic test for (e.g., in a large clinical trial) is necessary to provide the power anaerobic periodontal infections based on plaque hydrolysis of benzoyl-DL- arginine naphthylamide. J. Clin. Microbiol. 28:1551–1559. to detect differences in microbial compositions to identify 16. Loesche, W. J., and C. E. Kazor. 2002. Microbiology and treatment of more precisely those species that are associated with halitosis halitosis. Periodontology 2000 28:256–279. and health. Such studies will be accomplished by using 16S 17. Loesche, W. J., and S. A. Syed. 1973. The predominant cultivable flora of carious plaque and carious dentine. Caries Res. 7:201–216. rRNA-based oligonucleotide probes in checkerboard DNA- 18. Maidak, B. L., J. R. Cole, T. G. Lilburn, C. T. Parker, Jr., P. R. Saxman, R. J. on June 17, 2014 by guest DNA hybridization assays (1) or eventually by using oligonu- Farris, G. M. Garrity, G. J. Olsen, T. M. Schmidt, and J. M. Tiedje. 2001. cleotide microarrays. The RDP-II (Ribosomal Database Project). Nucleic Acids Res. 29:173–174. 19. Miyazaki, H., S. Sakao, K. Yasuhiro, and T. Tadamichi. 1995. Oral malodor It has been suggested that the majority of cases of oral in the general population of Japan, p. 119–136. In M. Rosenberg (ed.), Bad malodor are due to bacterial proteolytic activity in the mouth, breath research perspectives. Ramot Publishing, Tel Aviv, Israel. such as might be measured by the BANA test (16). Since 20. Morita, M., and H. L. Wang. 2001. Association between oral malodor and adult periodontitis: a review. J. Clin. Periodontol. 28:813–819. known BANA test-positive oral species typically found in sub- 21. Morita, M., and H. L. Wang. 2001. Relationship between sulcular sulfide gingival plaque, i.e., P. gingivalis, T. denticola, T. forsythensis, levels and oral malodor in subjects with periodontal disease. J. Periodontol. 72:79–84. and various Capnocytophaga species, were not detected (15), 22. Paster, B. J., S. K. Boches, J. L. Galvin, R. E. Ericson, C. N. Lau, V. A. other tongue bacterial species are likely responsible for the Levanos, A. Sahasrabudhe, and F. E. Dewhirst. 2001. Bacterial diversity in BANA reaction of the tongue coating. Now that we have human subgingival plaque. J. Bacteriol. 183:3770–3783. 23. Paster, B. J., and F. E. Dewhirst. 1988. Phylogeny of campylobacters, identified additional predominant bacterial species present on wolinellas, Bacteroides gracilis, and Bacteroides ureolyticus by 16S rRNA the tongue dorsa of individuals with halitosis, it would be of sequencing. Int. J. Syst. Bacteriol. 38:56–62. interest to examine the ability of these other cultivable species 24. Paster, B. J., W. A. Falkler, Jr., C. O. Enwonwu, E. O. Idigbe, K. O. Savage, V. A. Levanos, M. A. Tamer, R. L. Ericson, C. N. Lau, and F. E. Dewhirst. to hydrolyze the BANA substrate and to produce VSCs and 2002. Predominant bacterial species and novel phylotypes in advanced noma other by-products that may contribute to the clinical presen- lesions. J. Clin. Microbiol. 40:2187–2191. 25. Persson, S., R. Claesson, and J. Carlsson. 1989. The capacity of subgingival tation of malodor. species to produce volatile sulfur compounds in human serum. Oral Micro- biol. Immunol. 4:169–172. ACKNOWLEDGMENTS 26. Persson, S., M. B. Edlund, R. Claesson, and J. Carlsson. 1990. The forma- tion of hydrogen sulfide and methylmercaptan by oral bacteria. Oral Micro- biol. Immunol. 5:195–201. This study was supported by NIH grants DE12465 and DE11443 27. Pitts, G., R. Pianotti, T. W. Feary, J. McGuiness, and T. Masurat. 1981. The from the National Institute of Dental and Craniofacial Research. in vivo effects of an antiseptic mouthwash on odor-producing microorgan- isms. J. Dent. Res. 60:1891–1896. REFERENCES 28. Rosenberg, M., G. V. Kulkarni, A. Bosy, and C. A. McCulloch. 1991. Re- producibility and sensitivity of oral malodor measurements with a portable 1. Becker, M. R., B. J. Paster, E. J. Leys, M. L. Moeschberger, S. G. Kenyon, sulfide monitor. J. Dent. Res. 70:1436–1440. J. L. Galvin, S. K. Boches, F. E. Dewhirst, and A. L. Griffen. 2002. Molecular 29. Rosenberg, M., I. Septon, I. Eli, R. Bar-Ness, I. Gelernter, S. Brenner, and analysis of bacterial species associated with early childhood caries. J. Clin. J. Gabbay. 1991. Halitosis measurement by an industrial sulphide monitor. J. Microbiol. 40:1001–1009. Periodontol. 62:487–489. 2. Bosy, A., G. V. Kulkarni, M. Rosenberg, and C. A. McCulloch. 1994. Rela- 30. Saitou, N., and M. Nei. 1987. The neighbor-joining method: a new method tionship of oral malodor to periodontitis: evidence of independence in dis- for reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406–425. crete subpopulations. J. Periodontol. 65:37–46. 31. Sakamoto, M., M. Umeda, I. Ishikawa, and Y. Benno. 2000. Comparison of VOL. 41, 2003 TONGUE BACTERIA IN HALITOSIS AND HEALTHY PATIENTS 563
the oral bacterial flora in saliva from a healthy subject and two periodontitis 34. Van de Peer, Y., and R. De Wachter. 1994. TREECON for Windows: a patients by sequence analysis of 16S rDNA libraries. Microbiol. Immunol. software package for the construction and drawing of evolutionary trees for 44:643–652. the Microsoft Windows environment. Comput. Appl. Biosci. 10:569–570. 32. Tonzetich, J. 1971. Direct gas chromatographic analysis of sulphur com- 35. Yaegaki, K., and J. M. Coil. 2000. Examination, classification, and treatment pounds in mouth air in man. Arch. Oral Biol. 16:587–597. of halitosis; clinical perspectives. J. Can. Dent. Assoc. 66:257–261. 33. Tonzetich, J., and S. K. Ng. 1976. Reduction of malodor by oral cleansing 36. Yaegaki, K., and K. Sanada. 1992. Biochemical and clinical factors influenc- procedures. Oral Surg. Oral Med. Oral Pathol. 42:172–181. ing oral malodor in periodontal patients. J. Periodontol. 63:783–789. Downloaded from http://jcm.asm.org/ on June 17, 2014 by guest Genome Sequence of the Lantibiotic Bacteriocin Producer Streptococcus salivarius Strain K12
Caroline Barretto, Pablo Alvarez-Martin, Francis Foata, Pierre Renault and Bernard Berger J. Bacteriol. 2012, 194(21):5959. DOI: 10.1128/JB.01268-12.
Downloaded from Updated information and services can be found at: http://jb.asm.org/content/194/21/5959
These include: REFERENCES This article cites 18 articles, 9 of which can be accessed free at: http://jb.asm.org/content/194/21/5959#ref-list-1 http://jb.asm.org/ http://jb.asm.org/
CONTENT ALERTS Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more» on June 17, 2014 by guest on June 17, 2014 by guest
Information about commercial reprint orders: http://journals.asm.org/site/misc/reprints.xhtml To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/ GENOME ANNOUNCEMENT
Genome Sequence of the Lantibiotic Bacteriocin Producer Streptococcus salivarius Strain K12
Caroline Barretto,a Pablo Alvarez-Martin,a Francis Foata,a Pierre Renault,b and Bernard Bergera Nestec Ltd., Nestlé Research Center, Lausanne, Switzerland,a and Institut National de la Recherche Agronomique, Jouy en Josas, Franceb
Streptococcus salivarius is a prevalent commensal species of the oropharyngeal tract. S. salivarius strain K12 is an isolate from the saliva of a healthy child, used as an oral probiotic. Here, we report its genome sequence, i.e., the full sequence of the 190-kb megaplasmid pSsal-K12 and a high-quality draft 2.2-Gb chromosomal sequence.
treptococcus salivarius is an early colonizer of the human oral Comparative analysis of pSsal-K12 and the only previously char- Scavity and remains a prominent member of the oropharyngeal acterized S. salivarius megaplasmid, pSsal-M18, isolated from the Downloaded from tract of “healthy” humans (13). S. salivarius is a heterogeneous probiotic strain M18 (10), revealed 54% alignment of the pre- species, and rare cases of strains associated with human infections dicted genes. The high-quality draft genome sequence of this pro- have been reported (4, 16). Some commensal strains of S. sali- biotic S. salivarius strain will contribute to our understanding of varius are also used as probiotics for oral and upper respiratory the role of this species in the oropharyngeal ecology of human tract health (9, 17, 18), since they are producers of a particularly health. diverse range of lantibiotic bacteriocins with a broad spectrum Nucleotide sequence accession numbers. This whole-genome against several streptococcal pathogens (18). project has been deposited at DDBJ/EMBL/GenBank under the Streptococcus salivarius strain K12 (Blis Technologies Ltd.) was accession number ALIF00000000. The version described in this http://jb.asm.org/ isolated from the saliva of a healthy child (repository reference paper is the first version, ALIF01000000. ATCC BAA-1024). It was reported to be a colonizer of the oral ACKNOWLEDGMENTS mucosa of infants and adults (11, 15), to be effective against hali- tosis (1), and to downregulate the innate immune responses of We thank Jeremy Burton from Blis Technologies Ltd. for providing the human epithelial cells (5). Its safety and human tolerance were strain and Deborah Moine for preparing the genomic DNA and for help- ful discussions. We acknowledge Fasteris SA and 454 Life Sciences for also assessed (2, 3), and it received self-affirmed generally recog- performing the sequencing and IG Assets for performing the automatic nized as safe (GRAS) status from the United States Food and Drug annotation. on June 17, 2014 by guest Administration in 2011. Here, we make available its genome se- Nestlé and Blis Technologies have a research agreement. quence, i.e., the full sequence of the megaplasmid coding for two This work was funded by Nestec Ltd. salivaricins (12) and a high-quality draft chromosomal sequence. REFERENCES The genome sequence of S. salivarius strain K12 was deter- mined using the 454 GS-FLX sequencer (Roche Diagnostics) and 1. Burton JP, Chilcott CN, Moore CJ, Speiser G, Tagg JR. 2006. A prelim- inary study of the effect of probiotic Streptococcus salivarius K12 on oral Solexa HiSeq (Illumina, Inc.). The chromosome reads were as- malodour parameters. J. Appl. Microbiol. 100:754–764. sembled into 95 contigs with Newbler (14), providing 44-fold cov- 2. Burton JP, et al. 2011. Evaluation of safety and human tolerance of the erage. Contigs were aligned with the complete genome sequence oral probiotic Streptococcus salivarius K12: a randomized, placebo- of S. salivarius strain JIM8777 (8) using the mummer package (6). controlled, double-blind study. Food Chem. Toxicol. 49:2356–2364. 3. Burton JP, Wescombe PA, Moore CJ, Chilcott CN, Tagg JR. 2006. Gaps were closed by PCR, followed by Sanger sequencing of the Safety assessment of the oral cavity probiotic Streptococcus salivarius K12. products and primer walking. The K12 chromosome sequence Appl. Environ. Microbiol. 72:3050–3053. currently comprises six contigs. The remaining genomic gaps con- 4. Conte A, et al. 2006. Streptococcus salivarius meningitis and sphenoid tain copies of highly repetitive serine-rich motifs of putative trans- sinus mucocele. Case report and literature review. J. Infect. 52:e27–e30. 5. Cosseau C, et al. 2008. The commensal Streptococcus salivarius K12 membrane proteins. The estimated length of the chromosome is downregulates the innate immune responses of human epithelial cells and 2,241,913 bp, with a GC content of 38.9%. The length of the plas- promotes host-microbe homeostasis. Infect. Immun. 76:4163–4175. mid is 185,045 bp, with a GC content of 34.4%. 6. Delcher AL, et al. 1999. Alignment of whole genomes. Nucleic Acids Res. Automated annotation carried out by IG Assets using a propri- 27:2369–2376. etary pipeline revealed 6 rRNA operons and 57 tRNA genes. It 7. Delorme C, et al. 2011. Complete genome sequence of the clinical Strep- tococcus salivarius strain CCHSS3. J. Bacteriol. 193:5041–5042. indicated 2,089 protein-coding sequences (CDS) on the chromo- 8. Guedon E, et al. 2011. Complete genome sequence of the commensal some, of which 1,710 (82%) were annotated with known biolog- Streptococcus salivarius strain JIM8777. J. Bacteriol. 193:5024–5025. ical functions and 379 (18%) encode hypothetical proteins. The megaplasmid pSsal-K12 contains 164 CDS, of which 69 (42%) were annotated with known biological functions and 95 (68%) Received 20 July 2012 Accepted 17 August 2012 encode hypothetical proteins. Address correspondence to Caroline Barretto, [email protected], Comparative genomics within S. salivarius showed that out of or Bernard Berger, [email protected]. 2,089 genes predicted on the chromosome of K12, 1,801, 1,777, Copyright © 2012, American Society for Microbiology. All Rights Reserved. and 1,760 align with the genome of the commensals JIM8777 (8) doi:10.1128/JB.01268-12 and M18 (10) and the clinical isolate CCHSS3 (7), respectively.
November 2012 Volume 194 Number 21 Journal of Bacteriology p. 5959–5960 jb.asm.org 5959 Genome Announcement
9. Guglielmetti S, et al. 2010. Oral bacteria as potential probiotics for the 14. Margulies M, et al. 2005. Genome sequencing in microfabricated high- pharyngeal mucosa. Appl. Environ. Microbiol. 76:3948–3958. density picolitre reactors. Nature 437:376–380. 10. Heng NC, et al. 2011. Genome sequence of the bacteriocin-producing 15. Power DA, Burton JP, Chilcott CN, Dawes PJ, Tagg JR. 2008. oral probiotic Streptococcus salivarius strain M18. J. Bacteriol. 193:6402– Preliminary investigations of the colonisation of upper respiratory 6403. tract tissues of infants using a paediatric formulation of the oral pro- 11. Horz HP, Meinelt A, Houben B, Conrads G. 2007. Distribution and biotic Streptococcus salivarius K12. Eur. J. Clin. Microbiol. Infect. Dis. persistence of probiotic Streptococcus salivarius K12 in the human oral 27:1261–1263. cavity as determined by real-time quantitative polymerase chain reaction. 16. Srinivasan V, et al. 2012. Using PCR-based detection and genotyping to Oral Microbiol. Immunol. 22:126–130. trace Streptococcus salivarius meningitis outbreak strain to oral flora of 12. Hyink O, et al. 2007. Salivaricin A2 and the novel lantibiotic salivaricin B radiology physician assistant. PLoS One 7:e32169. doi:10.1371/ are encoded at adjacent loci on a 190-kilobase transmissible megaplasmid journal.pone.0032169. in the oral probiotic strain Streptococcus salivarius K12. Appl. Environ. 17. Tagg JR, Dierksen KP. 2003. Bacterial replacement therapy: adapting Microbiol. 73:1107–1113. ‘germ warfare’ to infection prevention. Trends Biotechnol. 21:217–223. 13. Kazor CE, et al. 2003. Diversity of bacterial populations on the tongue 18. Wescombe PA, et al. 2006. Megaplasmids encode differing combinations dorsa of patients with halitosis and healthy patients. J. Clin. Microbiol. of lantibiotics in Streptococcus salivarius. Antonie Van Leeuwenhoek 90: 41:558–563. 269–280. Downloaded from http://jb.asm.org/ on June 17, 2014 by guest
5960 jb.asm.org Journal of Bacteriology Food and Chemical Toxicology xxx (2011) xxx–xxx
Contents lists available at ScienceDirect
Food and Chemical Toxicology
journal homepage: www.elsevier.com/locate/foodchemtox
Evaluation of safety and human tolerance of the oral probiotic Streptococcus salivarius K12: A randomized, placebo-controlled, double-blind study ⇑ J.P. Burton a, , S. Cowley b, R.R. Simon c, J. McKinney d, P.A. Wescombe a, J.R. Tagg a,e a BLIS Technologies Ltd., Centre for Innovation, University of Otago, Dunedin, New Zealand b Clinical Development Associates Inc., Richmond, VA, United States c Cantox Health Sciences International, An Intertek Company, Mississauga, ON, Canada d National Clinical Research, Richmond, Inc., Richmond, VA, United States e Department of Microbiology and Immunology, University of Otago, Dunedin, New Zealand article info abstract
Article history: Streptococcus salivarius is naturally a predominant member of the human oropharynx and the commercial Received 2 May 2011 probiotic strain K12 has been consumed for more than a decade. The present study examines the health Accepted 10 June 2011 responses of human volunteers to oral ingestion of high doses of S. salivarius K12. Available online xxxx A randomized group of 53 subjects received a dose of 1 Â 1010 cfu S. salivarius K12 (N = 25) or placebo (N = 28) for 28 days, followed by a 28-day wash out period. Blood, urine and saliva samples were col- Keywords: lected at baseline and following treatment and analyzed, while the oral and gastrointestinal tolerance Streptococcus salivarius K12 of the subjects to the dosing regimen was determined by use of questionnaires. Adverse events (AE)s Probiotics were recorded for both groups. Safety No statistically significant differences between the probiotic and placebo treated groups were detected in either the blood clinical chemistry or hematology results (P > 0.05). The questionnaire responses of the subjects indicated that both treatments were well tolerated. The frequency and intensity of AEs was sim- ilar in the two groups. This data demonstrates that the daily ingestion of S. salivarius K12 over a 28-day period does not adversely affect the human host and supports the safety of its oral delivery in a food-based carrier. Ó 2011 Elsevier Ltd. All rights reserved.
1. Introduction and has been detected in various non-pasteurized indigenous fer- mented milk products (Callon et al., 2004; Martin et al., 2007; Until recently, the usage of probiotics by humans has almost Ongol and Asano, 2009; Pesic-Mikulec, 2005). Heightened interest exclusively focused on the derivation of benefits through the inges- in the probiotic potential of S. salivarius stems from (i) its numeri- tion of microbes originally obtained from intestinal sources. cal predominance in the oropharynx, (ii) the production by some However, with the more widespread acceptance of the potential strains of a particularly diverse array of anti-competitor molecules for probiotic intervention to also effect heath benefits for non- [bacteriocins and bacteriocin-like inhibitory substances (BLIS)] and intestinal body sites, there has come the increased application of (iii) demonstrations of its beneficial application to the relief or con- effector strains of species that are indigenous to alternative target trol of various upper respiratory tract ailments including strep sore tissues, in order to obtain more specific and enduring benefits. throat, otitis media and halitosis for which strain S. salivarius K12 Addressing safety concerns presents a major obstacle to the probi- has been applied (Burton et al., 2006a; Dierksen and Tagg, 2000; otic application of microorganisms that do not already have an Wescombe et al., 2009). extensive history of use in traditional fermented products, even if The safety testing of chemicals is typically performed with use they are widely considered to be common and innocuous inhabit- of well-substantiated animal toxicity models. However, for the ants of the normal human indigenous microbiota. The species safety assessment of probiotics, validated animal models do not Streptococcus salivarius is best known as a numerically-predomi- exist, and hazard characterization of a probiotic microorganism nant member of the human oral and nasopharyngeal indigenous must be determined through the application of well-designed ran- microbiota. However, it is also common in human breast milk domized placebo-controlled studies in healthy human subjects (Shane et al., 2010; Vankerckhoven et al., 2008). The safety criteria for probiotics must also include affirmation that the organism is ⇑ Corresponding author. Address: BLIS Technologies Ltd., Centre for Innovation, not routinely implicated in non-opportunistic infections and that University of Otago, PO Box 56, Dunedin 9054, New Zealand. Tel.: +64 3 4793061; fax: +64 3 4798954. it does not exchange virulence or antibiotic resistance determi- E-mail address: [email protected] (J.P. Burton). nants with other organisms (Shane et al., 2010; WHO, 2002). The
0278-6915/$ - see front matter Ó 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.fct.2011.06.038
Please cite this article in press as: Burton, J.P., et al. Evaluation of safety and human tolerance of the oral probiotic Streptococcus salivarius K12: A random- ized, placebo-controlled, double-blind study. Food Chem. Toxicol. (2011), doi:10.1016/j.fct.2011.06.038 2 J.P. Burton et al. / Food and Chemical Toxicology xxx (2011) xxx–xxx
first safety study of S. salivarius K12 (Burton et al., 2006b) assessed naires or their baseline physical examination that they may potentially have its propensity to cause disease according to (i) its content of known some underlying compromised health condition. Examples of these conditions in- clude subjects with unstable metabolic diseases/disorders, heart failure or a history virulence factors and antibiotic resistance determinants, (ii) its of endocarditis, immune-compromisation or prior gastrointestinal surgery. Also ex- genetic and biochemical stability over time and under various cluded were individuals using antibiotics in the 3 months prior to study initiation, propagation conditions, and (iii) whether any proliferation of or at any time during the study, frequent users of alcohol or over the counter lax- deleterious organisms occurs when S. salivarius K12 is adminis- atives and consumers of herbal-based supplements (but not vitamin supplements) tered to humans. A second safety study reported toxicological or prescription drugs that may potentially have influenced the biomarkers mea- sured in the study. and predicted-genotoxicity analyses of strain K12 and observations of adverse events (AE)s occurring either acutely or for up to a 2.3. Examination of physical condition and vital signs month following the dosing of animals. Also documented was the natural occurrence of strain K12-like bacteriocin-producing S. Subject evaluations were performed at initial screening (week-1), baseline salivarius in humans (Burton et al., 2010). The current study (week 0), the end of the 28-day treatment period (week 4) and at the final recovery focuses specifically upon the interaction of S. salivarius K12 with visit (week 8). Documented demographic characteristics of the study population in- cluded medical and surgical histories, alcohol and tobacco use and methods of con- humans and more specifically it assesses the propensity of strain traception (for females of childbearing age). Abbreviated physical examinations K12 to effect health parameters and occurrence of AE’s when taken were conducted at baseline and at the end of treatment. Parameters recorded in- at 10 times the conventionally recommended dose. cluded the subjects’ vital signs (heart rate, systolic and diastolic blood pressure, While products containing S. salivarius K12 have now been sold respiratory rate and temperature) as well as any detectable abnormalities of the for more than a decade with no verified product related AEs skin, eyes, ears, nose and throat, heart, lungs, abdomen, musculoskeletal system, lymph nodes and nervous system. Vital signs were obtained at each examination reported, there have been no controlled human safety studies session. The subjects’ dietary compliance and use of alcohol was also regularly as- conducted to specifically document the lack of occurrence of AEs. sessed throughout the study period. The oral cavity was inspected at each visit for In practice this is not unusual, since most studies of probiotics have abnormalities of the pharynx, tongue, teeth, gums and oral mucosa to document to date been predominantly efficacy-focused, with only a second- any adverse or unusual changes that may potentially have been associated with consumption of the test material. ary emphasis on safety. The aim of the present study was to evaluate the probiotic 2.4. Preparation of test material S. salivarius K12 for its safety and tolerability when ingested in high doses by a group of closely-monitored human subjects. Included The S. salivarius K12 cultures were grown in an ISO 22000 (ISO standards for was sequential documentation of the clinical chemistry, hematol- food safety) quality-accredited facility. The S. salivarius K12 powder was blended ogy and urinalysis parameters of the K12-treated subjects to deter- with the commonly utilized food grade carriers, trehalose and maltodextrin and fla- mine whether the values obtained extended beyond normal limits vorings and then packaged into sachets under GMP conditions. Each sachet con- tained 1.1 Â 1010 cfu S. salivarius K12, which is 10 times the usual recommended or differed significantly from the findings in the placebo group. dose. The placebo differed only in containing no K12 powder. The active and pla- Additionally, the number, duration and intensity of AEs reported cebo preparations were identical in appearance and taste. Cell counts were obtained was closely monitored, as well as the perception of quality of life by an independent laboratory (Cawthron Institute, Nelson, NZ) just prior to com- through questionnaires focused particularly upon the subjects’ oral mencement of the study. At the end of the study any unopened sachets were re- turned and tested to re-establish the identity and cell count of the test organism. and gastrointestinal health.
2.5. Subject randomization and dosing 2. Materials and methods Allocation concealment was performed by an off-site statistician who generated 2.1. Study design active and placebo numerical sequences. Subjects who met the inclusion criteria were randomly allocated to the placebo or probiotic treatment group in a 1:1 ratio The objective of the study was to assess the safety and potential impact on irrespective of sex. The participants were instructed to, each day at breakfast, con- health parameters, oral and intestinal tolerance of human subjects to S. salivarius sume the entire contents of a sachet after mixing into a half glass (4 oz.) of cold K12. The double-blinded, placebo-controlled study included 56 male and female water. The taking of each dose throughout the 28-day treatment period was self-re- subjects randomized into two treatment groups (probiotic or placebo). The subjects corded in a diary. Compliance was monitored by contacting each subject by tele- were screened to determine whether they met the inclusion criteria 7 days prior to phone two weeks after delivery of the sachets and by the return of all unused commencement of the 28-day test period, followed by further monitoring at sachets at the end of the treatment period (compliance was considered acceptable 56 days, following a 28-day wash out period. A variety of biological samples includ- if P80% of the doses had been taken). ing blood, urine and saliva were taken at various time points from the participants for analysis and described later in this section. The study monitor performed regular 2.6. Analysis of samples monitoring visits to the clinical research facility. The Copernicus Group Indepen- dent Review Board, NC, reviewed and approved the protocol and informed consent 2.6.1. Blood documents, in accordance with US Food and Drug Administration guidelines, ICH Fasting blood samples were obtained by venipuncture both at the screening Harmonized Tripartite Guideline, Guideline For Good Clinical Practice E6(R1). Study visit and upon completion of treatment (week 4). If any abnormalities were de- design assistance was provided by Cantox (Missussagua, ON) and the study was au- tected at the week 4 visit, additional samples were obtained at the final recovery dited by Clinical Development Associates, Inc. (Richmond, VA) and conducted under visit (week 8) for re-testing. The blood was sent to LabCorp (Burlington, NC) for cGCP compliance consistent with the principles in the declaration of Helsinki at analysis of serum chemistry and liver function tests (glucose, BUN, creatinine, so- National Clinical Research Inc (NCR, Richmond, VA). dium, potassium, chloride, calcium, albumin, globulin, bilirubin, alkaline phospha- tase, aspartate aminotransferase (AST) alanine aminotransferase (ALT) and 2.2. Subject inclusion hematology: white blood cell (WBC) count, red blood cell (RBC) count, hemoglobin, hematocrit, mean corpuscular volume (MCV), mean corpuscular hemoglobin Strict study entry criteria were assessed with regards to the physical and phys- (MCH), mean corpuscular hemoglobin concentrations (MCHC), platelets, neutro- iological health status of the subjects prior to enrollment into the study. Healthy phils, lymphocytes, monocytes, eosinophils and basophils. male and non-pregnant female volunteers, between the ages of 18 and 60, with a body mass index in the range of 18.5–35 kg/m2 and no known food allergies or 2.6.2. Urine intolerances were eligible for recruitment. All clinical chemistry, hematology and Urine samples were evaluated for clarity, color, specific gravity, pH, protein, oc- urinalysis parameters and vital signs (blood pressure, respiratory rate, temperature, cult blood, and leukocyte esterase. Urine pregnancy testing for women of child- heart rate) were required to be within clinically acceptable ranges. bearing potential was also undertaken (beta-hCG) at baseline and at the end of Subjects were excluded if they had used probiotic food products (e.g., yogurt, treatment. acidophilus milk, or other food products containing the word probiotic in the label- ing) within the previous month or at any time during the trial. Usage of traditional fermented foods like regular yogurt, cured meats and cheeses was acceptable. 2.6.3. Saliva Certain subjects were excluded if it was considered on the basis of either their med- Non-stimulated saliva samples (1 mL; all subjects) were obtained at weeks 0, 4 ical history, their responses to the oral and gastrointestinal tolerance question- and 8. The samples were snap-frozen at À20 °C and then stored at À70 °C.
Please cite this article in press as: Burton, J.P., et al. Evaluation of safety and human tolerance of the oral probiotic Streptococcus salivarius K12: A random- ized, placebo-controlled, double-blind study. Food Chem. Toxicol. (2011), doi:10.1016/j.fct.2011.06.038 J.P. Burton et al. / Food and Chemical Toxicology xxx (2011) xxx–xxx 3
2.7. Quantitative PCR detection of S. salivarius K12 26–December 14, 2010 (27 subjects were randomized to the probi- otic group [5 males and 22 females, P = 0.035] and 29 to the pla- Total DNA was extracted from each 1 mL saliva from those in the probiotic cebo group [13 males and 16 females, P > 0.05]). The numbers of group aliquot using the PureLink™ genomic DNA kit (Invitrogen) as per the manu- facturer’s instructions for gram-positive bacteria. DNA was eluted from the column subjects completing the study were 25 (probiotic group) and 28 in 100 ll of elution buffer. A 1/10 dilution was made of each DNA extract (to reduce (placebo group) (Fig. 1). Progress of all participants was tracked the effect of PCR inhibitors) before use in a specific real time PCR assay to quantitate through the study during enrollment, allocation, follow up and the number of K12 colony-forming units (cfu)/mL of saliva. The standard curve was analysis phases and was based on the CONSORT reporting method made using a dilution series of DNA extracted from a culture of S. salivarius K12 for which the corresponding count as cfu/mL was determined by plating onto Columbia (Schulz et al., 2010). The subjects were 20–60 years of age with an Agar Base (CAB) agar. Real-time PCR was run on a Fast 7500 machine (Applied Bio- average of 39.7 for the probiotic and 37.2 for the controls (P > 0.05). systems) using a standard amplification protocol and with the S. salivarius K12-spe- The average height, weight, BMI, race, and history of tobacco and cific primers, Sea1 midL: CGG CAA AAC CAA AGC TAG AG and Sea1 midR: ACG TGG alcohol use was not statistically significantly different between TTT TTG GGG GTT AG. These primers target part of the gene sharing homology with the two groups (P > 0.05). surface exclusion protein SeaI on the megaplasmid of strain K12 (Hyink et al., 2007). These primers have been validated against megaplasmid containing S. salivarius, K12 seeded and normal saliva samples.’’ 3.2. Analysis of oral and gastrointestinal health questionnaires
2.8. Oral and gastrointestinal tolerance monitoring The subjects were asked to assess their oral health through a series of questionnaires at baseline, end of treatment and at the Assessment of oral and gastrointestinal health using self-reported questionnaires end of the washout period. The questionnaire results indicated that was performed at weeks 0, 4 and 8. Assessment of the condition of the teeth, mouth, gums and freshness of the breath was based upon a 10-point severity visual analog the perception by the participants was that regardless of whether scale (VAS). General gastrointestinal health, including the presence and severity of they were taking the probiotic or placebo there was no significant pain, bloating, gastric reflux, nausea, vomiting, diarrhea, and gas/flatulence was als- change in the condition of their teeth, the freshness of their breath orated also rated using a 10-point severity VAS. No oral and gastrointestinal health or the extent of gum bleeding at the end of either the treatment VAS questionnaires specific to healthy subjects and consistent with the objectives phase or wash out phase when compared to their baseline values of the present study could be identified in the literature, but the adopted question- naires were modeled upon some used in previous studies (CDC, 2009; Treiber et al., (P > 0.05). The only question answered showing a marginally sig- 2004) and these were approved by an Independent Ethics Board. nificant difference was tooth sensitivity, which was reduced for the probiotic group when compared to the placebo group at the 2.9. Adverse events monitoring end of the treatment period (À0.39 AU compared to baseline, P = 0.080) and then was further reduced at the end of the washout Documentation of any surgical, dental or medical procedures and the concom- period (À0.79 AU compared to baseline P = 0.013). Reanalysis itant use of medications were collected throughout the study. AEs were recorded accounting for sex distribution resulted in a non-significant result throughout the study at each clinic visit and by follow up telephone call at two weeks after commencing treatment. An AE is defined as any adverse health-related (P > 0.05). occurrence (sign, symptom, illness, abnormal laboratory value, or other medical The subjects were asked to assess their own gastrointestinal event) experienced by a person participating in a clinical study, whether or not it health through a series of questionnaires at baseline, end of treat- is considered directly related to the prescribed treatment, and which either appears ment and at the end of the washout period. The results for abdom- or worsens during the course of the study, or within a specified period of time fol- lowing completion of treatment. Information describing the AE collected for assess- inal pain complaints, bloating, gastric reflux, nausea, vomiting, ment and documentation included the following: date of onset/resolution, intensity diarrhea and flatulence were not significantly different between (a decrease or increase of the intensity), seriousness and causal relationship to the two treatment groups at the various assessment points study treatment or study conduct (as determined by the physician). Any AE that oc- throughout the study (P > 0.05). There was however, a significant curred was followed to resolution or until determined to be clinically insignificant difference (P = 0.006) between the probiotic and placebo groups by the physician. after the treatment period because those in the placebo group felt that their general gastrointestinal health had declined over the 2.10. Study monitoring, data collection and statistical analysis period, whereas the average response for those in the probiotic The study was monitored regularly for regulatory compliance, protocol adher- group had remained relatively stable. ence and completeness of data collection by a clinical research organization, Clinical Development Associates, Inc. (Richmond, VA). The data were collected in case re- 3.3. Adverse events port forms and verified with source documents at the clinic. Data on each case re- port form was entered into a Microsoft Access database and then transferred into SAS version 9.2 (SAS Institute, Cary, NC) for statistical analysis. All data manage- No serious AEs were observed in either the probiotic or placebo ment and statistical analyses were performed by Clinical Development Associates, group. Thirty-seven percent of the subjects in the probiotic group, Inc. (Richmond, VA). compared to the 51.7% of subjects in the placebo group, had at least Demographic and baseline data were analyzed by treatment group. Differences one non-serious AE recorded during the treatment or washout between the treatment groups were assessed by t-tests for continuous variables and by chi square tests for categorical variables. Changes from baseline in each response periods. The type of AE appeared to be relatively evenly distributed on the oral and gastrointestinal health 10-point VAS questionnaires was analyzed in low numbers among the 18 categories that were coded (data not by an analysis of covariance that included the effects of treatment group and base- shown). Table 1 shows the severity of all AEs by intensity during line assessment as a covariate. AEs were summarized according to the first occur- the entire study. No AEs were reported as severe in intensity in rence of each AE; hence subjects with multiple occurrences of the same event the probiotic group. Two AEs of severe intensity (but not serious) were only counted once. AEs were also summarized according to their relationship to treatment (possible, probable, or highly probable), the incidence of serious AEs, were recorded for subjects in the placebo group, but overall the and the intensity. Changes from baseline in vital signs and in each laboratory var- small numbers of AEs recorded by subjects in the probiotic and iable were analyzed by an analysis of covariance that included the effects of treat- placebo groups were mostly of a mild nature. One AE was not ment group and baseline assessment as a covariate. coded in the probiotic group and was due to lumbar pain from an accidental fall. Only one of the severe AEs (in the placebo group) 3. Results occurred during the treatment phase (data not shown). Table 2 shows the summary of all AE occurring during the treatment phase 3.1. Study population of the study for both groups. Table 3 summarizes all of the AEs potentially relating to treatment, (i.e. AE considered possibly, prob- Of 67 volunteers initially screened for eligibility, 56 healthy ably or highly probably related to treatment) and Table 4 docu- subjects were subsequently enrolled in the study from October ments the intensity of these AEs. The number of AEs coinciding
Please cite this article in press as: Burton, J.P., et al. Evaluation of safety and human tolerance of the oral probiotic Streptococcus salivarius K12: A random- ized, placebo-controlled, double-blind study. Food Chem. Toxicol. (2011), doi:10.1016/j.fct.2011.06.038 4 J.P. Burton et al. / Food and Chemical Toxicology xxx (2011) xxx–xxx
Fig. 1. Flow chart of the study subjects accounted through the study.
Table 1 Table 2 Summary of all adverse events by intensity. Summary of adverse events – treatment phase
Adverse event Probiotic (N = 27) Placebo (N = 29) Adverse event Probiotic (N = 27) Placebo (N = 29) Mild Mod. Severe Mild Mod. Severe Number with at least one AE 8 (29.6%) 11 (37.9%) Abdominal pain 2 (7.4%) 0 (0%) Abdominal pain 2 0 0 0 0 0 Anxiety 0 (0%) 1 (3.4%) Anxiety 0 0 0 0 1 0 Appetite increased 1 (3.7%) 0 (0%) Appetite increased 1 0 0 0 0 0 Asthma 0 (0%) 1 (3.4%) Asthma 0 0 0 0 0 1 Dizziness 0 (0%) 1 (3.4%) Cough increased 0 0 0 1 0 0 Dyspepsia 1 (3.7%) 1 (3.4%) Dizziness 0 0 0 0 1 0 Flatulence 1 (3.7%) 0 (0%) Dyspepsia 1 0 0 2 0 0 Gastroenteritis 0 (0%) 2 (6.9%) Flatulence 1 0 0 0 0 0 Headache 1 (3.7%) 1 (3.4%) Gastroenteritis 0 0 0 0 2 0 Herpes simplex 1 (3.7%) 0 (0%) Headache 0 1 0 0 0 1 Infection 3 (11.1%) 2 (6.9%) Herpes simplex 1 0 0 0 0 0 Myalgia 0 (0%) 1 (3.4%) Infection 3 0 0 3 1 0 Rhinitis 0 (0%) 3 (10.3%) Myalgia 0 0 0 1 0 0 Vaginitis 0 (0%) 2 (6.9%) Nausea 1 0 0 1 0 0 Vomiting 0 (0%) 1 (3.4%) Rhinitis 1 0 0 3 0 0 Not coded 1 (3.7%) 0 (0%) Vaginitis 1 0 0 2 0 0 Vomiting 0 0 0 0 1 0 N = Number of subjects. Not coded 1 0 0 0 0 0 Total 13 1 0 13 6 2
N = Number of subjects. (heart rate, systolic BP, diastolic BP, respiration rate or oral temper- with consumption of either the probiotic or placebo appeared low ature) for the subjects receiving either the probiotic or placebo and the number of these AEs considered possibly attributable to treatment (Table 5). the treatments was very low (Table 3). During the washout phase, there were also a limited number of AEs reported, but these were 3.5. Effect on clinical hematology, chemistry and urinalysis parameters almost exclusively described as mild (data not shown) and these reactions were considered unlikely to be treatment-related. Comparison of the end of treatment hematology results to the baseline values in the two groups of subjects showed that there 3.4. Vital signs changes was no statistically significant difference (P > 0.05) for WBC, RBC, hemoglobin, hematocrit, MCV, MCH, MCHC, platelets, neutrophils, There were no statistically significant changes (P > 0.05) be- lymphocytes, monocytes, EOS and basophils. Comparisons are tween the baseline and end of treatment vital signs measurements presented in Table 6.
Please cite this article in press as: Burton, J.P., et al. Evaluation of safety and human tolerance of the oral probiotic Streptococcus salivarius K12: A random- ized, placebo-controlled, double-blind study. Food Chem. Toxicol. (2011), doi:10.1016/j.fct.2011.06.038 J.P. Burton et al. / Food and Chemical Toxicology xxx (2011) xxx–xxx 5
Table 3 Table 5 Summary of all adverse events related to treatment.a Baseline and change from baseline in vital signs.
Adverse event Probiotic (N = 27) Placebo (N = 29) Assessment Probiotic Placebo (N = 25) (N = 28) Number with at least one related AE 2 (7.4%) 2 (6.9%) Anxiety 0 (0%) 1 (3.4%) Heart rate (bpm) Baseline 71.0 ± 10.2 71.2 ± 9.7 Dizziness 0 (0%) 1 (3.4%) mean ± std Dyspepsia 1 (3.7%) 1 (3.4%) Change at end of treatment Flatulence 1 (3.7%) 0 (0%) Meana 1.0 1.8 P-value 0.72 N = Number of subjects. Difference (95% 0.8 (À3.8, 5.5) a Events considered possible, probable, or highly probable related to treatment. CI) Systolic BP (mm Hg) Baseline 117.1 ± 11.0 118.0 ± 10.7 mean ± std Change at end of treatment Table 4 Meana 0.5 2.0 Summary of adverse events by intensity – treatment phase. P-value 0.640 Adverse event Probiotic (N = 27) Placebo (N = 29) Difference (95% 1.5 (À4.9, 7.9) CI) Mild Mod. Severe Mild Mod. Severe Diastolic BP Baseline 75.9 ± 6.6 74.6 ± 7.8 Abdominal pain 2 0 0 0 0 0 (mm Hg) mean ± std Anxiety 0 0 0 0 1 0 Change at end of treatment a Appetite increased 1 0 0 0 0 0 Mean 2.2 2.1 Asthma 0 0 0 0 0 1 P-value 0.976 Dizziness 0 0 0 0 1 0 Difference (95% 0.1 (À3.5, 3.6) Dyspepsia 1 0 0 1 0 0 CI) Flatulence 1 0 0 0 0 0 Respiration rate Baseline 14.7 ± 1.8 13.8 ± 1.7 Gastroenteritis 0 0 0 0 2 0 (bpm) mean ± std Headache 0 1 0 0 0 1 Change at end of treatment a Herpes simplex 1 0 0 0 0 0 Mean À0.5 À0.1 Infection 3 0 0 2 0 0 P-value 0.506 Myalgia 0 0 0 1 0 0 Difference (95% À0.4 (À1.5, 0.7) Rhinitis 0 0 0 3 0 0 CI) Vaginitis 0 0 0 2 0 0 Oral temp. (°F) Baseline 98.0 ± 0.5 98.0 ± 0.5 Vomiting 0 0 0 0 1 0 mean ± std Not coded 1 0 0 0 0 0 Change at end of treatment a Total 10 1 0 9 5 2 Mean 0.2 0.2 P-value 0.949 N = Number of subjects. Difference (95% 0.0 (À0.35, 0.33) CI)
N = Number of subjects. a Adjusted for baseline. The end of treatment chemistry results of the two groups when compared to the baseline values also showed no statisti- cally significant differences (P > 0.05) for glucose, BUN, creati- 4. Discussion nine, sodium, potassium, chloride, calcium, albumin, globulin, bilirubin, alkaline phosphatase, AST or ALT. Comparisons are pre- Streptococcus salivarius is a predominant human commensal of sented in Table 7. the oropharynx and can constitute a large proportion of the total In the urine, there was a significant difference in specific gravity bacterial population inhabiting this region (Kononen et al., 2002). (P < 0.05) between the probiotic and placebo groups, with the pla- It is also predominant in human breast milk (Dalidowitz, 2005; cebo group showing a small increase (0.006 AU, Table 8). However, Heikkila and Saris, 2003). The persistent natural exposure of hu- both values were well within normal limits for healthy humans mans to large numbers of indigenous S. salivarius from just after (1.005–1.030, LabCorp). The difference in urine pH and other val- birth until death supports the proposition that re-exposure to this ues were not statistically different (P > 0.05). bacterium from external sources is likely to be non-hazardous, whether effected by natural transmission from other human hosts or by exposure to probiotic preparations (Favier et al., 2002; 3.6. Quantitative PCR (qPCR) detection of S. salivarius K12 levels in Kononen et al., 2002; Park et al., 2005; Preza et al., 2009). This saliva study supports the view that S. salivarius K12 is not pathogenic or toxicologically active when regularly ingested in large numbers At baseline, the mean qPCR-derivedcell count for K12-like bac- over a period of 28 days. By use of qPCR it was shown that, follow- teria in the subjects’ saliva specimens was 1.84 Â 103 cfu/ml (Table ing its delivery in the described format strain, K12 is cleared from 9). Approximately half of the saliva samples had estimates of the oral cavity by natural processes during the course of a 28-day K12-like bacteria that were at least a logarithmic unit lower than wash out period. the mean value (data not shown). These estimates are at the lower Clinical studies are usually powered in the design stage of plan- level of the detection limit of the qPCR system (approximately ning such that they will adequately measure a desired change in 1 Â 103 cfu/ml of saliva) and can be considered negligible or the clinical endpoint at a predetermined level of statistical confidence. background associated with a complex clinical sample. On the In most cases, a study will have one or two primary endpoints, day after taking their last K12 dose the average salivary count of which makes selection of sample size relatively easy to estimate. K12-like bacteria had increased to 5.24 Â 103 cfu/ml and in some In this case however, the primary endpoint is safety, which poten- subjects the estimates were as high as 6.19 Â 104cfu/ml. By the tially involves a very large number of clinical chemistry, hematol- end of the washout period the mean count of K12-like bacteria ogy and other endpoints, thereby complicating the calculation of had declined to 1.61 Â 103 cfu/ml, a value similar to baseline sample size. Interestingly, there are relatively few human studies levels. specifically detailing clinical chemistry or hematology endpoints
Please cite this article in press as: Burton, J.P., et al. Evaluation of safety and human tolerance of the oral probiotic Streptococcus salivarius K12: A random- ized, placebo-controlled, double-blind study. Food Chem. Toxicol. (2011), doi:10.1016/j.fct.2011.06.038 6 J.P. Burton et al. / Food and Chemical Toxicology xxx (2011) xxx–xxx
Table 6 Baseline and change from baseline in hematology data.
Laboratory test Probiotic (N = 25) Placebo (N = 28) WBC Baseline mean ± std 7.12 ± 1.90 6.53 ± 1.86 Change at end of treatment Meana À0.25 À0.07 P-value 0.586 Difference (95% CI) À0.19 (À0.88, 0.50) RBC Baseline mean ± std 4.58 ± 0.37 4.72 ± 0.47 Change at end of treatment Meana À0.01 À0.02 P-value 0.811 Difference (95% CI) 0.01 (À0.09, 0.11) Hemoglobin Baseline mean ± std 13.9 ± 1.2 13.9 ± 1.4 Change at end of treatment Meana 0.0 À0.05 P-value 0.790 Difference (95% CI) 0.05 (À0.3, 0.4) Hematocrit Baseline mean ± std 41.9 ± 3.0 42.1 ± 3.6 Change at end of treatment Meana À0.4 À0.7 P-value 0.541 Difference (95% CI) 0.3 (À0.7, 1.4) MCV Baseline mean ± std 91.7 ± 5.9 89.5 ± 5.3 Change at end of treatment Meana À0.8 À1.2 P-value 0.221 Difference (95% CI) 0.4 (À0.3, 1.1) MCH Baseline mean ± std 30.5 ± 2.4 29.6 ± 2.1 Change at end of treatment Meana 0.0 0.0 P-value 0.853 Difference (95% CI) 0.0 (À0.3, 0.3) MCHC Baseline mean ± std 33.2 ± 1.1 33.1 ± 0.8 Change at end of treatment Meana 0.3 0.4 P-value 0.520 Difference (95% CI) À0.1 (À0.5, 0.3) Platelets Baseline mean ± std 291.5 ± 57.9 279.1 ± 65.8 Change at end of treatment Meana 1.9 5.0 P-value 0.731 Difference (95% CI) À3.1 (À21.2, 14.9) Neutrophils Baseline mean ± std 58.8 ± 9.0 57.5 ± 8.2 Change at end of treatment Meana À2.7 À2.7 P-value 0.993 Difference (95% CI) 0.0 (À3.4, 3.4) Lymphs Baseline mean ± std 30.6 ± 8.7 31.4 ± 7.5 Change at end of treatment Meana 2.2 2.3 P-value 0.966 Difference (95% CI) À0.1 (À3.0, 3.1) Monocytes Baseline mean ± std 7.68 ± 1.97 8.54 ± 2.12 Change at end of treatment Meana 0.14 0.13 P-value 0.973 Difference (95% CI) 0.01 (À0.63, 0.66) Eos Baseline mean ± std 2.36 ± 1.93 2.00 ± 0.82 Change at end of treatment Meana 0.42 0.34 P-value 0.814 Difference (95% CI) 0.08 (À0.59, 0.66) Baso Baseline mean ± std 0.56 ± 0.58 0.46 ± 0.51 Change at end of treatment Meana À0.02 0.05 P-value 0.570 Difference (95% CI) À0.07 (À0.32, 0.18)
N = Number of subjects. a Adjusted for baseline.
and we are not aware of any validated reports documenting the Toxicity studies conducted under controlled conditions using minimum numbers of subjects needed to measure the clinically in-bred strains of rodents, may not require large numbers of ani- and statistically-significant changes in a wide variety of parame- mals (Festing and Altman, 2002). Unfortunately, these models are ters in a safety study. not validated for probiotics (Shane et al., 2010) as the bacterial
Please cite this article in press as: Burton, J.P., et al. Evaluation of safety and human tolerance of the oral probiotic Streptococcus salivarius K12: A random- ized, placebo-controlled, double-blind study. Food Chem. Toxicol. (2011), doi:10.1016/j.fct.2011.06.038 J.P. Burton et al. / Food and Chemical Toxicology xxx (2011) xxx–xxx 7
Table 7 Baseline and change from baseline in chemistry data.
Laboratory test Probiotic (N = 25) Placebo (N = 28) Glucose Baseline mean ± std 89.1 ± 9.0 91.5 ± 9.3 Change at end of treatment Meana 2.4 1.6 P-value 0.742 Difference (95% CI) 0.8 (À3.9, 5.5) BUN Baseline mean ± std 12.3 ± 2.8 12.3 ± 3.9 Change at end of treatment Meana 0.8 0.6 P-value 0.794 Difference (95% CI) 0.2 (À1.3, 1.7) Creatinine Baseline mean ± std 0.82 ± 0.15 0.85 ± 0.15 Change at end of treatment Meana 0.00 0.01 P-value 0.587 Difference (95% CI) À0.01 (À0.05, 0.03) Sodium Baseline mean ± std 139.0 ± 2.0 139.8 ± 2.4 Change at end of treatment Meana À0.1 À0.2 P-value 0.867 Difference (95% CI) 0.1 (À1.0, 1.1) Potassium Baseline mean ± std 4.14 ± 0.25 4.10 ± 0.31 Change at end of treatment Meana À0.11 À0.03 P-value 0.337 Difference (95% CI) À0.08 (À0.24, 0.08) Chloride Baseline mean ± std 102.8 ± 2.8 102.9 ± 1.7 Change at end of treatment Meana À0.72 À0.29 P-value 0.450 Difference (95% CI) À0.43 (À1.57, 0.71) Calcium Baseline mean ± std 9.3 ± 0.4 9.4 ± 0.3 Change at end of treatment Meana À0.12 À0.15 P-value 0.680 Difference (95% CI) 0.03 (À0.11, 0.17) Albumin Baseline mean ± std 4.38 ± 0.34 4.36 ± 0.25 Change at end of treatment Meana À0.05 À0.07 P-value 0.740 Difference (95% CI) 0.02 (À0.10, 0.13) Globulin Baseline mean ± std 2.63 ± 0.34 2.73 ± 0.39 Change at end of treatment Meana 0.01 À0.02 P-value 0.571 Difference (95% CI) 0.03 (À0.07, 0.13) Bilirubin Baseline mean ± std 0.49 ± 0.2 0.49 ± 0.22 Change at end of treatment Meana 0.00 À0.04 P-value 0.436 Difference (95% CI) 0.04 (À0.06, 0.14) AlkPhos Baseline mean ± std 59.4 ± 12.6 66.4 ± 16.0 Change at end of treatment Meana 2.0 1.4 P-value 0.843 Difference (95% CI) 0.5 (À4.8, 5.9) AST Baseline mean ± std 20.9 ± 5.5 21.0 ± 9.8 Change at end of treatment Meana 0.6 0.7 P-value 0.962 Difference (95% CI) À0.1 (À3.9, 3.7) ALT Baseline mean ± std 19.0 ± 7.3 20.3 ± 13.1 Change at end of treatment Meana À0.3 0.7 P-value 0.555 Difference (95% CI) À1.0 (À4.4, 2.4)
N = Number of subjects. a Adjusted for baseline.
strains used as probiotics are often host species-specific. Adults cult to detect significant changes in clinical endpoints because randomly recruited from the general population are more geneti- the expected level of variance in humans will be greater than in cally heterogeneous than the subjects used in an animal model. in-bred animals. Few previous studies provide specific guidance Although the use of human subjects is of course consistent with concerning the planning of clinical safety studies. Wolf and the proposed specific application of the probiotic, it is more diffi- colleagues (Wolf et al., 1998) assessed the safety of a Lactobacillus
Please cite this article in press as: Burton, J.P., et al. Evaluation of safety and human tolerance of the oral probiotic Streptococcus salivarius K12: A random- ized, placebo-controlled, double-blind study. Food Chem. Toxicol. (2011), doi:10.1016/j.fct.2011.06.038 8 J.P. Burton et al. / Food and Chemical Toxicology xxx (2011) xxx–xxx
Table 8 Baseline and change from baseline in urinalysis data.
Laboratory test Probiotic (N = 25) Placebo (N = 28) Specific gravity Baseline mean ± std 1.015 ± 0.009 1.016 ± 0.007 Change at end of treatment Meana 0.001 0.006 P-value 0.041 Difference (95% CI) À0.005 (À0.009, À0.0002) pH Baseline mean ± std 5.60 ± 0.79 5.52 ± 0.76 Change at end of treatment Meana À0.29 À0.20 P-value 0.536 Difference (95% CI) À0.09 (À0.39, 0.20)
N = Number of subjects. a Adjusted for baseline.
Table 9 the literature for monitoring subjects taking probiotics. It can be Quantification of S. salivarius K12 in saliva samples from subjects that received the anticipated that as the use of probiotics broadens beyond a pri- probiotic treatment. mary focus on those of intestinal origins the type of study required Treatment phase Meancfu/ml to evaluate the occurrence of AE will also change to reflect the dif-
Baseline phase ± std 1.8 Â 103 (1.7 Â 103) ferences in targeting. The development in the present study of a Mean at end treatment phase ± std 5.2 Â 103 (1.3 Â 104) specific set of questionnaires incorporating an oral focus, was an Mean at end of washout phase ± std 1.6 Â 103 (1.6 Â 103) attempt to provide a more robust and qualitative monitoring of AEs reflective of strain K12’s natural habitat and the target tissues that this probiotic was considered most likely to interact with and reuteri probiotic strain in an HIV-infected population by analyzing impact upon. various standard toxicological markers. They had earlier conducted a pilot study (Wolf et al., 1995) to assist with the derivation of the 5. Conclusion number of subjects required to see a difference in the levels of pro- biotic cells recovered from stool samples, but the calculations did A single daily dose of strain K12 ten times its conventional daily not factor in other clinical end points or other biological markers dose taken over 28 days was used to demonstrate safety and toler- of safety. A conservative approach led them to recruit 36 subjects ability in this study. Previous toxicology studies in animals did not to be given either probiotic or control preparations. However, gi- indicate any dose-dependent effects of multiple dosing (Burton ven their HIV status this cannot be considered a normal population et al., 2010). Multiple dose studies can be useful to show that an and disease marker progression may have been aberrant. In a more adverse effect is treatment-related, with the intensity increasing recent study (Wind et al., 2010) incorporating 17 test (probiotic- in direct proportion to dose. However, the self-reporting by sub- utilizing) subjects and 17 controls, clinical significance was jects on the occurrences of AEs and the documentation in question- claimed, but no details were given of how this was calculated. In naires relating to their oral and gastrointestinal health combined the present study, 53 subjects were randomized into either probi- with the results of blood chemistry, hematology and other clinical otic or placebo groups. This relatively larger sample size when assessments clearly show that S. salivarius K12 is well tolerated by compared to other previously published studies was to increase humans, even when taken in doses considered to be 10-fold the the sensitivity of the study in order to heighten the chances of usual recommended daily intake. detecting any clinically-significant changes in the wide range of defined safety parameters. Conflict of Interest The length of previously reported probiotic safety studies has been around 21 days, with the active dosing phase often followed Authors J.P. Burton, P.A. Wescombe and J.R. Tagg are employees by a similar period for washout (Wind et al., 2010; Wolf et al., of BLIS Technologies Ltd. 1995, 1998). Shane et al. (2010), when discussing the optimal length of such studies, indicated that there is not a priori preferred exposure time because this will depend upon the disease that the Acknowledgements probiotic treatment is targeting; for example, diarrhea may only last a few days and there may be little point testing beyond the Dr. Gene Heyman (Consultant, Clinical Development Associates, usual period of use. One typical application of S. salivarius K12 Inc.) for the statistical analysis of the human clinical data. Staff at (when attempting to achieve oral colonization) is for as little as National Clinical Research – Richmond, Inc. for conducting this three days, but smaller individual doses are also sometimes taken study, Mrs. Janet McLay, Mr. Murray Kennedy, Mrs. Vidya Kulkarni, on a daily basis for extended time periods (months) either for col- Dr. Chris Chilcott and Dr. Stephen Lorimer of BLIS Technologies Ltd. onization maintenance or in supplements that may also contain for the preparation and quality assurance of the test material. Mr. additional conventional probiotic strains of lactobacilli or bifido Grant Washington - Smith BLIS Technologies Ltd. for study design bacteria. assistance. We are grateful to the Ministry for Science and Innova- In this study the examination of the subjects for their vital signs tion of the New Zealand Government for providing funding assis- and physical condition showed no significant difference between tance for this project. those taking probiotic and placebo, and this was supported by examination of the content of the questionnaires completed by References the subjects. Validated quality of life questionnaires such as the Burton, J., Chilcott, C., Wescombe, P., Tagg, J., 2010. Extended safety data for the oral IBS-QOL questionnaire used with subjects specifically suffering cavity probiotic Streptococcus salivarius K12. Probiot. Antimicro. Prot. 2, 135– irritable bowel syndrome (Drossman et al., 2000) do not exist in 144.
Please cite this article in press as: Burton, J.P., et al. Evaluation of safety and human tolerance of the oral probiotic Streptococcus salivarius K12: A random- ized, placebo-controlled, double-blind study. Food Chem. Toxicol. (2011), doi:10.1016/j.fct.2011.06.038 J.P. Burton et al. / Food and Chemical Toxicology xxx (2011) xxx–xxx 9
Burton, J.P., Chilcott, C.N., Moore, C.J., Speiser, G., Tagg, J.R., 2006a. A preliminary Pesic-Mikulec, D., 2005. Microbiological study of fresh white cheese. Appl. Ecol. study of the effect of probiotic Streptococcus salivarius K12 on oral malodour Environ. Res. 4, 129–134. parameters. J. Appl. Microbiol. 100, 754–764. Preza, D., Olsen, I., Willumsen, T., Grinde, B., Paster, B.J., 2009. Diversity and site- Burton, J.P., Wescombe, P.A., Moore, C.J., Chilcott, C.N., Tagg, J.R., 2006b. Safety specificity of the oral microflora in the elderly. Eur. J. Clin. Microbiol. Infect. Dis. assessment of the oral cavity probiotic Streptococcus salivarius K12. Appl. 28, 1033–1040. Environ. Microbiol. 72, 3050–3053. Schulz, K.F., Altman, D.G., Moher, D., Group, C., 2010. CONSORT 2010 statement: Callon, C., Millet, L., Montel, M.C., 2004. Diversity of lactic acid bacteria isolated updated guidelines for reporting parallel group randomized trials. Ann. Intern. from AOC Salers cheese. J. Dairy Res. 71, 231–244. Med. 152, 726–732. CDC, 2009. National Health and Nutrition Examination Survey 2007–2008. Shane, A.L., Cabana, M.D., Vidry, S., Merenstein, D., Hummelen, R., Ellis, C.L., Documentation, Codebook, and Frequencies. Oral Health. Heimbach, J.T., Hempel, S., Lynch, S.V., Sanders, M.E., Tancredi, D.J., 2010. Guide Dalidowitz, C., 2005. Fortified breast milk safety. J. Am. Diet. Assoc. 105, 1572–1573. to designing, conducting, publishing and communicating results of clinical Dierksen, K.P., Tagg, J., 2000. The influence of indigenous bacteriocin-producing studies involving probiotic applications in human participants. Gut. Microbes. Streptococcus salivarius on the acquisition of Streptococcus pyogenes by primary 1, 243–253. school children in Dunedin, New Zealand. Streptococ. Streptococ. Dis. Enter. Treiber, G., Schwabe, M., Ammon, S., Walker, S., Klotz, U., Malfertheiner, P., 2004. New Millen., 81–85. Dyspeptic symptoms associated with Helicobacter pylori infection are Drossman, D., Patrick, D., Whitehead, W., Toner, B., Diamant, N., Hu, Y., 2000. influenced by strain and host specific factors. Aliment. Pharmacol. Ther. 19, Further validation of the IBS-QOL: a disease specific quality of life 219–231. questionnaire. Am. J. Gastroenterol. 95, 999–1007. Vankerckhoven, V., Huys, G., Vancanneyt, M., Snauwaert, C., Swings, J., Klare, I., Favier, C.F., Vaughan, E.E., De Vos, W.M., Akkermans, A.D., 2002. Molecular Witte, W., Van Autgaerden, T., Chapelle, S., Lammens, C., Goossens, H., 2008. monitoring of succession of bacterial communities in human neonates. Appl. Genotypic diversity, antimicrobial resistance, and virulence factors of human Environ. Microbiol. 68, 219–226. isolates and probiotic cultures constituting two intraspecific groups of Festing, M.F., Altman, D.G., 2002. Guidelines for the design and statistical analysis of Enterococcus faecium isolates. Appl. Environ. Microbiol. 74, 4247–4255. experiments using laboratory animals. ILAR J. 43, 244–258. Wescombe, P.A., Heng, N.C., Burton, J.P., Chilcott, C.N., Tagg, J.R., 2009. Streptococcal Heikkila, M.P., Saris, P.E., 2003. Inhibition of Staphylococcus aureus by the bacteriocins and the case for Streptococcus salivarius as model oral probiotics. commensal bacteria of human milk. J. Appl. Microbiol. 95, 471–478. Future Microbiol. 4, 819–835. Hyink, O., Wescombe, P.A., Upton, M., Ragland, N., Burton, J.P., Tagg, J.R., 2007. WHO, 2002. Guidelines for the Evaluation of Probiotics in Food Joint FAO/WHO Salivaricin A2 and the novel lantibiotic salivaricin B are encoded at adjacent loci Working Group Report on Drafting Guidelines for the Evaluation of Probiotics in on a 190-kilobase transmissible megaplasmid in the oral probiotic strain Food. Food and Agriculture Organization of the United Nations World Health Streptococcus salivarius K12. Appl. Environ. Microbiol. 73, 1107–1113. Organisation, London, Canada. Kononen, E., Jousimies-Somer, H., Bryk, A., Kilp, T., Kilian, M., 2002. Establishment of Wind, R.D., Tolboom, H., Klare, I., Huys, G., Knol, J., 2010. Tolerance and safety of the streptococci in the upper respiratory tract: longitudinal changes in the mouth potentially probiotic strain Lactobacillus rhamnosus PRSF-L477: a randomised, and nasopharynx up to 2 years of age. J. Med. Microbiol. 51, 723–730. double-blind placebo-controlled trial in healthy volunteers. Br. J. Nutr. 104, Martin, R., Heilig, H.G., Zoetendal, E.G., Jimenez, E., Fernandez, L., Smidt, H., 1806–1816. Rodriguez, J.M., 2007. Cultivation-independent assessment of the bacterial Wolf, B.W., Garleb, K.A., Ataya, D.G., Casas, I.A., 1995. Safety and tolerance of diversity of breast milk among healthy women. Res. Microbiol. 158, 31–37. Lactobacillus reuteri in healthy adult male subjects. Microb. Ecol. Health Dis. 8, Ongol, M.P., Asano, K., 2009. Main microorganisms involved in the fermentation of 41–50. Ugandan ghee. Int. J. Food Microbiol. 133, 268–291. Wolf, B.W., Wheeler, K.B., Ataya, D.G., Garleb, K.A., 1998. Safety and tolerance of Park, H.K., Shim, S.S., Kim, S.Y., Park, J.H., Park, S.E., Kim, H.J., Kang, B.C., Kim, C.M., Lactobacillus reuteri supplementation to a population infected with the human 2005. Molecular analysis of colonized bacteria in a human newborn infant gut. J. immunodeficiency virus. Food Chem. Toxicol. 36, 1085–1094. Microbiol. 43, 345–353.
Please cite this article in press as: Burton, J.P., et al. Evaluation of safety and human tolerance of the oral probiotic Streptococcus salivarius K12: A random- ized, placebo-controlled, double-blind study. Food Chem. Toxicol. (2011), doi:10.1016/j.fct.2011.06.038 Probiotics & Antimicro. Prot. (2010) 2:135–144 DOI 10.1007/s12602-010-9045-4
Extended Safety Data for the Oral Cavity Probiotic Streptococcus salivarius K12
J. P. Burton • C. N. Chilcott • P. A. Wescombe • J. R. Tagg
Published online: 19 May 2010 Ó Springer Science + Business Media, LLC 2010
Abstract Previous studies of the bacteriocin-producing humans and the information presented here, it is concluded Streptococcus salivarius K12 monitored a variety of that S. salivarius K12 is safe for human consumption. intrinsic strain characteristics of potential relevance to its application as an oral probiotic in humans. These included Keywords Streptococcus salivarius Á Safety Á BLIS Á the content of antibiotic resistance and virulence determi- Bacteriocins Á Probiotics nants, the production of deleterious metabolic by-products and its genetic stability. In the present study, we examined additional safety factors including the responses of rats to Introduction either short- or long-term oral dosing with strain K12 preparations. In addition, the potential genotoxicity of In recognition of the fact that possibly any bacterium, strain K12 was tested using a bacterial reverse mutation including those with a history of traditional application assay. To determine the occurrence and concentrations in either as probiotics or in the dairy industry, has the human saliva of S. salivarius having the same bacteriocin potential to cause disease in compromised individuals phenotype as strain K12, saliva samples from 780 children prompted the Food and Agriculture Organisation of the were evaluated. The level of dosing with strain K12 United Nations in 2002 to recommend that each bacterial required to achieve oral cavity colonization levels similar strain newly proposed for application as a food additive to those occurring naturally for this type of bacteriocin- should be separately and specifically evaluated for its producing S. salivarius was established using 100 human safety [30]. Streptococcus salivarius K12, a producer of subjects. Following the oral instillation of lyophilized two unique anti-microbial bacteriocins, has now been S. salivarius K12 cells in these subjects, its persistence was commercially marketed as an oral health-enhancing pro- not at levels higher than those found naturally for this type biotic for almost a decade. To date, its principal proposed of bacterium. The various sets of data obtained in this study applications are to effect a reduction in the occurrence and/ showed no evidence of genotoxicity and no acute or sub- or severity of halitosis, otitis media and streptococcal acute toxicity effects associated with strain K12. Based on pharyngitis [29]. It has been known for some time that the previously published data, the long history of use by S. salivarius (also known as S. salivarius subspecies sali- varius) is one of the most numerically predominant bac- terial species naturally present in the oral cavity and upper respiratory tract of humans. Indeed, it is a pioneer member of the indigenous microbiota, usually becoming established J. P. Burton (&) Á C. N. Chilcott Á P. A. Wescombe in the mouth, nasopharynx and intestinal tract within hours BLIS Technologies Ltd, Dunedin, New Zealand of birth [6]. Since S. salivarius typically occurs at levels of e-mail: [email protected] ca. 1 9 107 colony-forming units (CFU) per mL of saliva and ca. one litre of saliva is produced each day, most J. R. Tagg 10 Department of Microbiology and Immunology, University people will consume more than 10 CFU of these bacteria of Otago, Dunedin, New Zealand daily. It is less widely realized that breast-feeding infants 123 136 Probiotics & Antimicro. Prot. (2010) 2:135–144 also regularly consume S. salivarius, since it is commonly Materials and Methods present in mothers’ breast milk [13, 18]. S. salivarius is closely related to Streptococcus thermo- Strain K12 Test Preparations philus (S. salivarius subspecies thermophilus), a bacterium widely used in dairy food production. In fact, it is difficult to S. salivarius K12 is a probiotic bacterium used for oral differentiate the two subspecies by modern molecular cavity applications, predominantly in single strain formu- methodologies such as 16S rRNA gene comparisons (99% lations. S. salivarius K12 is a Gram-positive coccus with a ? similarity) [2, 11], 16-23S rRNA [20], rnpB[16] and growth preference for micro aerophilic conditions. It pro- MLSA [3]. There is also substantial documentation of the duces two well-characterized bacteriocin molecules, sali- presence of S. salivarius (shown by molecular methodolo- varicin A and salivaricin B, and this relatively uncommon gies not to be S. thermophilus) in some starter cultures for phenotype, in conjunction with conventional biochemical traditional fermented milks and in certain raw milk Euro- and molecular identification techniques, provides an pean cheeses [1, 5, 17, 19, 21, 23, 24, 28]. The Food Stan- important marker for strain identification purposes. Com- dards Authority of Australia and New Zealand regard mercial batches of the bacterium are produced by fer- S. salivarius as a traditional and non-novel food and in the mentation as pure cell masses consisting solely of USA the National Nutritional Foods Association (now S. salivarius K12 under an ISO22000 management system. NPA) has listed S. salivarius as an ingredient in use in the It is freeze-dried together with a maltodextrose sugar lyo- USA before 1994 on the FDA website (www.fda.gov). protectant to assist in maintaining its shelf life stability and Strain K12 was originally isolated from the saliva of a to achieve the target concentrations of 1.5 9 1011 colony- healthy child. It does not produce known deleterious met- forming units (CFU) per gram. The actual concentration of abolic by-products such as D-lactate (Unpublished data). strain K12 in these preparations (herein referred to as BLIS Its antibiogram is similar to that of most other naturally K12) varies only slightly from batch to batch. occurring S. salivarius isolates and features the absence of resistance to any commonly used clinically relevant anti- biotics [4]. Strain K12 has tested negative for various kinds Bacterial Reverse Mutation Test of the genes associated with virulence that recognized pathogenic streptococci carry [4]. A feature of strain K12 is The mutagenic effects of BLIS K12 were investigated in its apparent biochemical and genetic stability, both fol- the bacterial reverse mutation test, using the plate incor- lowing serial laboratory subculture and during long-term poration method with Salmonella typhimurium tester carriage in the human host [4]. When strain K12 was strains TA98, TA100, TA102, TA1535 and TA1537 at five co-cultured with human epithelial cells and gene expres- concentrations and in triplicate. This study was Quality sion monitored, it appeared to have stimulated expression Assurance monitored to assure compliance with the of epithelial cell genes involved in homeostasis and cellular requirements of the OECD Principles of Good Laboratory repair [7]. It was also found that strain K12 is well tolerated Practice and was conducted by RDDT Laboratories, by the human host and maintained on the epithelial surface, Bundoora, Victoria, Australia. The bacterial reverse while actively providing protection against inflammation mutation test is one of the three standard genotoxicity tests and apoptosis induced by pathogens [7, 8, 25]. Previous accepted by international regulatory authorities [10, 12, safety evaluations of Streptococcus salivarius K12 have 22]. The test identifies substances having the potential to focused upon the examination of various intrinsic traits of induce point mutations in microorganisms. A parallel test is the bacterium. The aim of the current study was to examine also performed in the presence of metabolic activation to several additional factors of relevance to the safety mimic the in vivo metabolic activity of liver enzymes, appraisal of the bacterium and also to further assess whe- which may convert pro-mutagens to mutagens. The fol- ther any potentially detrimental responses occur following lowing compounds were used as positive controls for the either acute or prolonged exposure to strain K12 in other individual tester strains: 9-aminoacridine; benzo(a)pyrene; biological systems. To that end, we have investigated cumene hydroperoxide; cyclophosphamide monohydrate; viable K12 cells for (a) their potential mutagenicity in vitro 2-nitroflourene and sodium azide. These compounds are (b) their impact on specific health parameters when fed to either directly functional mutagens or metabolically acti- rats in both acute- and subacute toxicity tests and (c) the vated pro-mutagens, and they are all standard reference colonization levels achieved following dosing of human articles for the test. The test compound (BLIS K12) for- subjects and comparison of these levels with the naturally mulation was prepared in sterile water at 50 mg/mL to occurring levels of strain K12-like S. salivarius found in provide the working solution for the designated upper limit healthy humans. dose (5 mg) applied to the test plates.
123 Probiotics & Antimicro. Prot. (2010) 2:135–144 137
Acute Oral Toxicity in Rats On Day 1, all of the rats were weighed and blood samples taken from 3 males and 3 females in each group. The toxicity of S. salivarius K12 was initially investigated On each of Days 7, 14 and 21, this process was repeated when fed orally to Sprague–Dawley rats in a single bolus at but without using animals tested in the previous week. On three defined dosages. The principal purpose of this was to Day 28, all of the surviving animals were weighed and establish dose–response relationships and the approximate urine samples collected wherever possible. Ten male and lethal dose as a preliminary to subsequent multi-dose tox- ten female rats from each group were sacrificed on Day 28 icity testing. The study was conducted by Estendart Ltd, via anaesthetic overdose followed by cardiac puncture. Palmerston North, New Zealand in a GLP-compliant facil- Blood samples were taken and post-mortems performed. ity conforming to OECD guideline 407. Fifty-nine rats were Full histopathology was conducted according to the regu- divided into five groups. Groups 1, 2 and 3 were dosed with latory requirements on two male and two female rats from 1.25 9 108, 1.67 9 109 and 8 9 1010 CFU of K12 cells, both the high-dose group and the control group. Eye respectively (equivalent to 7.5 mg, 100 mg and 5 g of BLIS examinations were performed by an accredited veterinary K12 per kg body weight). Group 4 was treated with lyo- ophthalmologist. Following sacrifice of half of the animals protectant only (an equivalent amount to that given to Group on Day 28, the remaining 10 male and 10 female rats from 1). Group 5 received sterile saline. One rat in each group each group entered the recovery phase of the study. These was sacrificed at 48-h post-treatment to determine whether animals were weighed on Days 35, 42, 49 and 56. On Day the BLIS K12 administration had resulted in septicaemia or 56, all of the surviving animals were examined, weighed, acute bacterial infection of the heart valves or pharyngeal bled and combined (per group) urine samples were col- tissues. For 14 days after the treatment was given, the rats lected, prior to sacrifice and post-mortem. were examined twice daily and their health scores recorded. Blood samples were examined for bilirubin, haematocrit, Daily food consumption was recorded, and at the end of the platelet count, alkaline phosphatase (ALP), alanine amino- study, all of the rats were necropsied and biochemical and transferase (ALT), aspartate aminotransferase (AST), eryth- haematological profiles determined. The tissues of four rats rocyte indices, albumin, WBC count, creatinine, bilirubin, from each group were examined histologically for gross haemoglobin, differential, total protein, glucose, RBC count, abnormalities and for signs of cancer induction. urea, triglycerides and cholesterol. Urine samples were examined for the following: colour/turbidity, urobilinogen, Subacute Oral Toxicity in Rats occult blood, bilirubin, specific gravity, electrolytes creati- nine, pH, glucose, sediment, protein, ketones and nitrites. The 28-day study in rats, also conducted by Estendart Ltd, Histopathological examinations were conducted on all rep- was to investigate BLIS K12 for subacute toxicity and was resentative organs from two males and two females from the designed to comply with the requirements stated in the high-dosage group and the control group on days 28 and 56 standards of GLP according to OECD 407. Cognizance was and from the low- and medium-treatment groups on Day 29. also given to FDA 21 CFR guidelines and EPA 40 CFR The representative organs sent for examination were as fol- Section 160.12. One hundred and seventy rats (85 males and lows: oesophagus, jejunum, lymph nodes, pancreas, brain, 85 females) ranked by weight and sex were randomly allo- duodenum, eyes, heart (including aorta), kidneys, liver, cated into four groups consisting of 20 males and 20 females. reproductive organs, skeletal muscle, spleen, stomach, A fifth group of 5 males and 5 females was established for the bladder, ileum, lungs, skin and thymus. All samples were purposes of tissue and blood collection on Day 0 in order to uniformly collected and weighed. Some technical variance establish baseline parameters for all of the animals. in tissue sampling occurs for tissues not sampled in their The administration of BLIS K12 was carried out at the entirety. same levels as the acute single dosing study and was desig- The statistical analysis of the data sets included calcu- nated as low, medium and high. Group 1 animals received lation of group means, standard deviations and standard low-dose BLIS K12. This dose is equivalent to that typically errors. The statistical package used for calculation of given to humans in current over-the-counter probiotic ANOVA, graphical analysis of probabilities and testing of products (7.5 mg of freeze-dried powder/kg body weight). the null and alternate hypotheses was NCSS 2001. Group 2 received medium-dose BLIS K12 (100 mg/kg), a dose considered capable of producing minimal acute toxicity Natural Levels of S. salivarius Producing K12-Like effects. Group 3 received high-dose BLIS K12 (5 g/kg), the Bacteriocin Activity maximum dose required to meet toxicity testing regulatory requirements. Group 4 was a control receiving lyoprotectant To determine the natural occurrence of K12-like S. sali- only, at a level equivalent to that present in the low-dose varius (strains producing both salivaricin A and salivari- BLIS K12 preparations. cin B), saliva specimens from a previous study involving 123 138 Probiotics & Antimicro. Prot. (2010) 2:135–144
780 Dunedin school children (5–12 years) were utilized treatment. The subjects were questioned about potential [12]. These samples had been stored frozen at -80°. The adverse reactions during the treatment period. Saliva study reported the normal distribution of BLIS-producing samples were tenfold serially diluted in PBS and plated S. salivarius and the effect that these bacteria had on on Mitis- salivarius agar containing streptomycin at
S. pyogenes acquisitions during the course of a 10-month (100 lg/mL) and incubated in 5% CO2—supplemented air period of observation [9]. Streptococcus salivarius from at 37 °C for 18 h. subjects’ saliva samples that had been found to display inhibitory profiles the same as that given by S. salivarius K12 (i.e. the very unique bacteriocin P-type 777) were Results tested for their numbers of K12-like S. salivarius [27]. S. salivarius counts (colony-forming units per mL) were Bacterial Reverse Mutation Test obtained by spiral-plating tenfold serial dilutions in phosphate-buffered saline (PBS) of the saliva onto Mitis- In the bacterial reverse mutation test, BLIS K12 showed no salivarius agar (Difco, MD) and then incubating the plates mutagenic effect against test strains TA98, TA100, TA102, in 5% CO2 –supplemented air at 37 °C for 18 h. To TA1535 and TA1537 over the evaluated concentration determine the proportion of K12-like S. salivarius in the range of up to 5 mg/plate, either in the absence or presence samples, 100 individual colonies from each individual of metabolic activation (data not shown). subject, having typical S. salivarius ‘gum drop’ mor- phology were picked and stabbed by sterile toothpicks, Oral Acute Toxicity in Rats into freshly seeded lawn cultures of Micrococcus luteus I1 and Streptococcus constellatus I3 on BACa [Columbia No abnormal findings were detected in any of the tested Agar Base (Becton–Dickinson) supplemented with 5% (v/ animals. Of the parameters measured, none provided any v) human blood and 0.1% (w/v) calcium carbonate] to evidence of an adverse effect as a result of the animals detect BLIS-production. K12-like S. salivarius produce a being treated by gavage with a single bolus of BLIS K12 at highly indicative clear inhibition of growth of both indi- three different dosage levels. Daily health scores and food cators in this simultaneous antagonism assay. Represen- consumption were unaffected by BLIS K12 dosing. No tative colonies producing this type of inhibitory activity infection or tissue abnormalities were evident at 48 h or at were then further tested for their P-type profiles against 14 days (end of study). There was no evidence of cancer nine standard indicators using the deferred antagonism induction at 14 days. All of this is indicative that BLIS assay [27] and for species identification using the API K12 (i.e. the combination of Streptococcus salivarius K12 Strep 20 kit (bioMe´rieux). PCR confirmation of the and lyoprotectant) does not have an acute toxic effect when presence of the salivaricin B structural gene was done orally administered to rats. with use of salB-specific primers [15]. Subacute Toxicity in Rats Colonization Levels in the Oral Cavity Health Scores To determine the dose of lyophilized S. salivarius K12 in lozenges required to achieve colonization of human sub- From examination of the group (or subgroup) mean health jects, the following study was conducted. Ethical approval scores (data not shown), it was evident that none of the test was from the Lower South Ethics Committee. One hundred or control groups of animals demonstrated any detectable healthy adults (40 male, 60 female; mean age of 19 years) health change throughout the 28-day test period. were randomly assigned to groups taking lozenges con- taining, either Group 1 (1.5 9 109), Group 2 (1.1 9 108), Organ Weights Group 3 (2 9 107), Group 4 (1 9 106) or Group 5 (7 9 104) CFU of S. salivarius K12 per lozenge. The Differences in the weights of the liver, lungs, thymus, skin, S. salivarius K12 used in this experiment was uniquely intestine, pancreas and lymph nodes between the test and marked with resistance to the antibiotic streptomycin in control animals were all within a relatively small range order to aid its specific enumeration in saliva specimens. (results not shown), and any differences could be accoun- The subjects (n = 20 per group) took one lozenge each ted for by technical variations in tissue procurement. The morning after brushing their teeth for 14 days. Saliva data indicated that both the sex and body weight of the samples were taken just prior to commencement of the animals influenced heart size, but the different dosing study and then 1 day following the completion of the schedules did not (p = 0.771).
123 Probiotics & Antimicro. Prot. (2010) 2:135–144 139
Gross Pathology corticosteroid effect on muscle. During periods of stress, there is normally an increase in corticosteroid levels and No gross pathological abnormalities were found in animals the handling procedures on day 0 were the likely cause of in any of the groups to indicate that administration of BLIS this elevation. By the third week of the test however, these K12 had any subacute toxicity or other adverse effects handling-related effects may have been substantially (Table 1). The only abnormality was an accessory con- reduced or eliminated for the animals in the test groups. On joined spleen found in one rat (from the low dose female the other hand, the test group means for AST and ALT had group) sacrificed at Day 28. This finding appeared unre- increased markedly by Day 56 (Table 2) and exceeded lated to BLIS K12 dosing. both the CCAC and Day 0 ranges. The fact that the rats receiving lyoprotectant only (Group 4) and low K12 dose Biochemistry (Group 1) also experienced marked elevation of AST and ALT indicates that this was not strain K12 related. Ageing The mean values of creatinine, urea, total bilirubin, glucose and fatty change to the liver can often cause these and especially of AST and ALT appeared higher for the increased levels. Baseline values are more reflective of the control (Day 0) animals than were the corresponding val- colony, strain and husbandry of the rats undergoing testing. ues for the test groups at Day 28 (Table 2). The means of In combination with the CCAC reference values, they the other biochemistry markers for the test groups at Day provide approximate upper and lower limits for normal 28 were either below or within the range of the reference values of the serum biochemistry and provide suitable CCAC values or the range of values for the Day 0 animals. markers for comparison. In the case of the rats in the Creatinine and urea levels can be elevated as a result of a present study, the baseline values of AST and ALT were
Table 1 Gross pathology of rats after repeated oral treatments for 28 days Group Low dose Med dose High dose Lyoprotectant (carrier) Dose (mg/kg) 7.5 100 5000 0 Sex M FM FM FM F No. animals examined 10 10 10 10 10 10 9 10
Brain No abnormal findings 10 10 10 10 10 10 9 10 Abnormal findings 0 0 0 0 0 0 0 0 Heart No abnormal findings 10 10 10 10 10 10 9 10 Abnormal findings 0 0 0 0 0 0 0 0 Kidneys No abnormal findings 10 10 10 10 10 10 9 10 Abnormal findings 0 0 0 0 0 0 0 0 Liver No abnormal findings 10 10 10 10 10 10 9 10 Abnormal findings 0 0 0 0 0 0 0 0 Duodenum, Jejunum, Ileum, Oesophagus No abnormal findings 10 10 10 10 10 10 9 10 Abnormal findings 0 0 0 0 0 0 0 0 Lungs No abnormal findings 10 10 10 10 10 10 9 10 Abnormal findings 0 0 0 0 0 0 0 0 Lymph nodes No abnormal findings 10 10 10 10 10 10 9 10 Abnormal findings 0 0 0 0 0 0 0 0 Spleen No abnormal findings 10 9 10 10 10 10 9 10 Abnormal findings 0 1 0 0 0 0 0 0
123 140 Probiotics & Antimicro. Prot. (2010) 2:135–144
Table 2 Subacute toxicity study: biochemistry values CCAC 1993 Group 1 Group 2 Group 3 Group 4 Day 0 baseline Reference reference
Serum biochemistry comparison of group means (day 28) AST (IU/L) 39–262 96.8±5.95 86.5±6.08 108.6±6.87 108.47±8.75 367.9±32.87 ALP (IU/L) 46–264 82.8±7.49 79.9±10.06 66.3±7.01 68.16±9.06 62.6±14.67 Total protein (g/L) 70±11.0 81.6±1.34 81.1±2.17 84.6±1.36 84.8±1.25 73.5±0.94 Creatinine (mmol/L) 44±5 51.3±1.68 49.7±1.91 55.7±1.98 54.3±2.36 69.2±10.73 Urea (mmol/L) 14.64±10 7.1±0.17 7.2±0.24 6.9±0.23 7.1±0.20 8.8±0.98 Total bilirubin(mmol/l) 3.5±0.20 1.9±0.11 1.6±0.11 2.2±0.13 2.0±0.11 2.8±0.18 Albumin (g/L) 47.0±12.0 46.5±1.14 45.9±1.63 47.3±1.36 48.4±1.25 38.2±1.07 Cholesterol (mmol/L) 1.8±0.58 2.5±0.10 2.5±0.13 2.7±0.16 2.7±0.11 2.2±0.13 Glucose (mmol/L) 6.2±2.50 2.9±0.28 2.9±0.26 2.7±0.64 2.1±0.38 3.8±0.03 Triglyceride (mmol/L) – 3.8±0.33 3.9±0.38 2.6±0.41 2.3±0.18 1.2±0.01 ALT (IU/L) 32.0±18.0 47.5±3.06 44.5±2.45 46.3±3.67 42.3±3.83 117.5±14.62 Serum biochemistry comparison of group means (day 56) AST (IU/L) 39–262 634.0±265.63 564.5±207.64 343.0±121.78 585.1±258.58 367.9±32.87 ALP (IU/L) 46–264 72.1±5.49 75.8±7.61 70.4±6.75 99.2±27.68 62.6±14.67 Total protein (g/L) 70±11.0 81.6±1.34 81.1±2.17 82.7±2.69 84.8±1.25 73.5±0.94 Creatinine (mmol/L) 44±5 54.0±2.55 49.0±1.66 49.2±1.77 47.7±1.94 69.2±10.73 Urea (mmol/L) 14.64±10 7.7±0.26 7.4±0.21 7.5±0.20 7.2±0.23 8.8±0.98 Total bilirubin (mmol/l) 3.5±0.20 2.1±0.09 2.2±0.08 2.0±0.18 2.4±0.16 2.8±0.18 Albumin (g/L) 47.0±12.0 44.3±1.49 43.8±1.10 44.2±1.39 44.2±1.55 38.2±1.07 Cholesterol (mmol/L) 1.8±0.58 2.5±0.12 2.4±0.09 2.6±0.13 2.4±0.12 2.2±0.13 Glucose (mmol/L) 6.2±2.50 6.5±2.20 7.2±2.59 4.1±0.93 6.8±2.72 3.8±0.03 Triglyceride (mmol/L) – 3.2±0.29 2.8±0.22 3.3±0.25 3.1±0.28 1.2±0.01 ALT (IU/L) 32.0±18.0 653.5±352.98 366.1±138.08 195.7±81.48 592.2±362.89 117.5±14.62 Group 1 received 7.5 mg/kg b.w., Group 2 received 100 mg/kg b.w., Group 3 received 5 g/kg b.w., Group 4 received lyoprotectant only both markedly elevated compared to the CCAC reference shown) indicated statistical equivalence for all parameters range and so the relatively low values for AST and ALT for within groups on Days 7, 21 and 56. For Day 14, only the all groups of rats in the study (irrespective of strain K12 value for mean corpuscular volume (MCV) failed to show dosing) at Day 28 and raised levels at Day 56 appear statistical equivalence. MCV variance however is only unrelated to strain K12 administration. considered to be of significance if accompanied by marked changes in other RBC characteristics. Haematology Body Weights The mean baseline (Day 0) and test group haematological values at Day 28 (Table 3) were all within the ranges of the The body weight changes in the male and female sub- reference values. The ANOVA for the haematology groups of animals within the various treatment groups parameter comparison between the groups indicates that showed strong equivalence throughout the dosing period there was no significant difference between the various (Table 4). At no time did any one particular treatment treatments and dosages. The mean values for all parameters group demonstrate a major variance in body weight. In the within the groups demonstrated statistical equivalence case of the male subgroups, only the high-dose treatment except for MCV, MCHC and eosinophils. The red cell group (Group 3) appeared to experience an overall increase descriptive values of MCV and MCHC are only significant in body weight greater than that of the other groups when if major changes had occurred in other red blood cell compared over the entire duration of the test. By the end of characteristics and/or significant changes in RBC numbers. the treatment period, the other male groups appeared to Variance as a result of eosinophil numbers is a common have reduced this weight differential. By the end of the finding. Similar comparative analysis of the data for the feeding regime, all subgroups had experienced a normal blood samples obtained at Days 7, 14, 21 and 56 (data not weight gain pattern. The animals in all groups consumed a
123 Probiotics & Antimicro. Prot. (2010) 2:135–144 141
Table 3 Subacute study: haematology values (day 28) Reference Group 1 Group 2 Group 3 Group 4 Baseline
Haematological comparison of group means HCT (L/L) .41–.51 0.46±0.01 0.47±0.01 0.47±0.02 0.45±0.01 0.42±0.02 Hb (g/L) 132–164 145.45±2.99 146.74±3.29 143.71±4.33 139.63±3.19 133.40±5.20 RBC (91012/L) 6.59–9.07 8.06±0.23 8.04±0.19 7.94±0.25 7.66±0.20 7.12±0.31 MCV (fl) 53–65 57.25±0.75 57.95±0.58 59.59±0.49 59.05±0.54 58.90±0.91 MCH (pg) 16.5–21.3 18.10±0.25 18.32±0.22 18.12±0.14 18.26±0.18 18.70±0.26 MCHC (g/L) 303–347 313.80±3.16 314.16±3.11 304.71±1.97 309.47±1.88 318.70±3.34 WBC (9109/L) 4.6–15.3 8.16±0.91 8.17±1.23 6.99±0.88 6.41±0.72 6.10±1.11 SEG (9109/L) 0–4.93 0.79±0.15 0.68±0.17 0.69±0.11 0.53±0.08 0.53±0.14 LYMPH(9109/L) 3.1–11.1 7.04±0.82 7.17±1.14 6.02±0.79 5.65±0.64 5.21±0.90 MONO(9109/L) 0–1 0.23±0.04 0.26±0.05 0.22±0.03 0.17±0.03 0.24±0.12 EOSIN(9109/L) 0–.42 0.12±0.03 0.05±0.02 0.06±0.02 0.05±0.02 0.13±0.04 RETIC (9109/L) 191.40±9.84 192.74±11.96 176.12±12.78 200.00±10.73 164.10±19.00 Group 1: low dose 7.5 mg/kg b.w Group 2: medium dose 100 mg/kg b.w. Group 3: high dose 5 g/kg b.w. Group 4: lyoprotectant only
Table 4 Subacute study Day 0 Day 7 Day 14 Day 21 Day 28
Male body weights over duration of test Group 1 536.90±9.50 549.21±8.94 559.37±9.32 574.10±9.57 588.06±10.72 Group 2 539.08±11.70 552.71±11.74 562.26±12.35 574.65±12.60 588.28±12.89 Group 3 551.59±8.44 572.85±8.60 585.67±9.04 604.43±9.54 612.40±11.01 Group 4 533.99±8.30 546.26±8.36 551.83±8.76 569.78±9.52 586.36±9.34 Female body weights over duration of test Group 1 335.98±6.31 339.18±6.12 338.24±6.43 346.19±5.94 348.95±6.47 Group 2 328.13±5.77 330.57±6.07 329.12±6.77 331.75±7.12 337.00±7.21 Group 3 333.09±5.26 336.96±5.60 336.74±6.55 341.71±7.45 347.40±7.64 Group 4 329.63±4.79 332.43±5.01 329.18±5.61 333.45±5.35 336.41±5.44 Group 1 low dose 7.5 mg/kg b.w Group 2: medium dose 100 mg/kg b.w. Group 3: high dose: 5 g/kg b.w. Group 4: lyoprotectant only consistent amount of feed, and there was an ca. 90% degree significant variations between the samples. The urine of of confidence that each animal received its assigned dosage animals completing the test was slightly more acidic than for each of the 28 treatment days. that of the Day 0 animals, a difference attributed to dietary influences rather than being an adverse response to treat- Histopathology ment. The only other difference was the slightly higher red blood cell counts in the urine of the treated animals. The No consistent group-related or BLIS K12 concentration- difference was minor, and there were no other indicators of dependent histopathological abnormalities were detected. cystitis development in the treated animals (i.e. no casts, Ophthalmologic examinations of 50% of the animals pre- bacteria or white cells in the urine). dosing, at the end of the treatment period and at the end of the recovery period revealed no significant changes. Natural Levels of Streptococcus salivarius with the K12 Bacteriocin Type Urinalysis The data from our previous study of the distribution of Urine samples were taken from animals terminated on Day streptococcal BLIS activities in Dunedin schoolchildren 56 and pooled for each group to produce representative indicated that 14 (1.8%) of 780 subjects had BLIS activity samples (Table 5). A similarly pooled sample was taken of P-type 777 (consistent with that given by S. salivarius from the baseline (Day 0) animals. There were no K12) when samples of their total salivary streptococcal
123 142 Probiotics & Antimicro. Prot. (2010) 2:135–144
Table 5 Urinalysis: Day 56 compared to baseline Group Untreated Low dose Medium dose High dose Lyoprotectant Day 0 Day 56 Day 56 Day 56 Day 56
Characteristics Colour Light yellow Light yellow Light yellow Light yellow Light yellow Turbidity Slight Slight Slight Moderate Moderate Specific gravity 1.046 1.046 1.038 1.040 1.055 pH867 66 Protein ??? ??? ??? ??? ??? Glucose Negative Negative Negative Negative Negative Ketones Negative Negative Negative Negative Negative Urobilinogen Normal Normal Normal Normal Normal Bilirubin Negative Negative Negative Negative Negative Blood ?? ??? ??? ??? ??? White cells/Hpf Negative Negative Negative Negative Negative Red cells/Hpf \5 5 to 10 5 to 10 10 to 20 5 to 10 Epithelial cells ??? ?? Crystals Negative Negative Negative Negative Negative Casts Negative Negative Negative Negative Negative Bacteria Negative Negative Negative Negative Negative Debris Negative Slight Slight Moderate Moderate
populations (grown on Mitis-salivarius agar) had been Table 6 Effect of S. salivarius K12 dose on oral persistence tested for inhibitory activity. It has been our experience Dose (cfu/ K12 cell counts in K12 cell counts in (results not shown) that in order for BLIS activity to be lozenge) saliva (cfu/mL) mean saliva (cfu/mL) range detected in such deferred antagonism tests of mixed 9 5 5 streptococcal populations, the inhibitory bacteria need to 1.5 9 10 2.6 9 10 0–1.6 9 10 represent at least ca. 10% of the total bacteria present in the 1.1 9 108 4.5 9 104 0–1.6 9 105 sample. Saliva samples were available for retesting from 2.0 9 107 1.0 9 104 0–6.9 9 104 nine of the original 14 subjects who had displayed com- 1.0 9 106 5.3 9 103 0–9.0 9 103 posite P-type 777 activity. P-type 777 isolates were 7.0 9 104 ND ND detected at levels of 61–100% of the total S. salivarius ND not detectable population in the saliva specimens from eight of these subjects (results not shown). The original S. salivarius in colonization levels with the dose administered. The counts obtained for these saliva specimens were in the levels of colonization achieved did not exceed the levels range 1.0 - 1.9 9 107 CFU/mL. Representative P-type observed naturally. No adverse reactions to dosing or col- 777 isolates from each of the eight subjects were estab- onization were reported by the subjects. lished (by API test) to be S. salivarius and by PCR to be salB positive. Three saliva specimens obtained over a 10-month period from the healthy schoolchild who was the Discussion original source of strain K12 showed this characteristic P-type 777 strain to be consistently present at a level of ca. The bacterial reverse mutation assay was used to evaluate 1.2 9 107 CFU/mL as the predominant S. salivarius whether Streptococcus salivarius K12 cells have mutagenic member of this subject’s oral microbiota. properties. The study was performed both as a requisite component of the toxicological safety assessment for a Persistence in the Oral Cavity natural product as well as to investigate any inherent mutagenic properties of the bacterium. BLIS K12 induced The counts (CFU) of strain K12 consumed daily by sub- no mutagenic effect in any of the test strains over the jects and the levels present in their saliva 24 h after concentration range tested. 14 days dosing are shown in Table 6. The correlation In the acute toxicity study, the haematological values, coefficient (r) = 0.9958 indicates a proportional increase gross pathology and health scores were all normal. There 123 Probiotics & Antimicro. Prot. (2010) 2:135–144 143 was no evidence of an induced toxic response in animals Conclusions given BLIS K12 compared to those receiving control doses. The means of the various biochemistry parameters Probiotics are becoming increasingly available and pop- of the test group were all within the range for the CCAC ular as dietary supplements and functional foods, and it reference values and those of the Day 0 (baseline values). is mandatory that any new strains should be rigorously No significant differences were found in the treatment tested for their safety, irrespective of whether they are of groups for the haematology and organ weight assessments. species that are generally regarded as safe (GRAS). Weight gain analyses demonstrated a strong equivalence Probiotic safety guidelines to date have largely been amongst all male subgroups and all female subgroups focussed upon the evaluation of intestinal strains [30]. It examined over the duration of the test. The overall finding seems intuitively unlikely that probiotic strains that were was that S. salivarius K12, when administered as a single selected de novo for their ability to promote gastroin- bolus to rats, did not evoke any dose-related toxicity. The testinal health will be as effective as oral microbiota- absence of toxicity, even at the highest dosage of 5 g/kg derived probiotics in their abilities to compete with oral body weight, indicates that the typical recommended pathogens or to beneficially interact with host oral tis- treatment dose of just 7.5 mg/kg in humans is unlikely to sues [26]. For example, strains of gastrointestinal tract- exert any toxicological effect and that the no observable derived lactobacilli have had variable effects on the effects limit (NOEL) in the rat is as high as 5 g/kg body levels of Streptococcus mutans when used as probiotics, weight. and moreover the strong implication of involvement of The results of the subacute toxicity study showed that lactobacilli with the progression of dental caries lesions the haematological, gross pathology and health scores were means that the pathogenic potential of these strains must normal in the treated animals. No induced or adverse be carefully addressed [14]. responses were found in the animals receiving BLIS K12 S. salivarius is predominant within the normal healthy when compared to those receiving the control material. The microbiota of the saliva, mouth and oropharynx of infants means of the biochemistry values for the test group were all and adults. Humans typically swallow 500–1,500 mL of within the range provided by the CCAC reference values saliva a day containing ca.19 107 cfu/mL of S. saliva- and those of the control animals sacrificed on Day 0. rius. In addition, S. salivarius is commonly present in ANOVA performed for haematology, biochemistry and breast milk and in certain types of dairy food, and indeed it organ weights indicated that there was no significant dif- is particularly closely related to the dairy streptococcus, ference between the treatment groups, though the AST and S. thermophilus. Although S. thermophilus is GRAS, ALT values were higher than reference values and no other S. salivarius has not yet received this formal recognition. indicators of infection appeared elevated. Weight gain The long, close and safe relationship of S. salivarius K12 analysis demonstrated a strong equivalence amongst all with humans has been recognized in Australia and New male subgroups and all female subgroups examined over Zealand where it is approved for use in food. S. salivarius the duration of the test. The overall finding of the study was K12 is inhibitory to bacteria implicated in otitis media, that S. salivarius K12, when administered as a repeat streptococcal sore throat and halitosis and is increasingly dosage treatment to rats, did not demonstrate any dosage- utilized as a probiotic to help reduce the occurrence of dependent toxic effects. The absence of toxicity even at the these conditions. The data presented here and in other highest repeat dosage of 5 g/kg body weight indicates that studies support that S. salivarius K12 is safe for human it is unlikely that BLIS K12 when repeatedly administered consumption. It is not genotoxic, does not cause disease or to humans long-term in daily doses of 7.5 mg/kg would toxicity in animals and when instilled in humans in daily have any adverse toxicological effect. doses of 1 9 109 CFU, it does not persist at levels higher Of the 780 school children studied, only approximately than found for closely similar S. salivarius populations 2% had composite oral streptococcal populations display- naturally occurring in the human host. ing the same bacteriocin profile (P-type 777) that charac- terizes strain K12. The numbers of S. salivarius K12 in the Conflicts of interest and disclosures The Ames test and Animal saliva of subjects showed greater persistence with regard to studies were performed by independents. JB, CC and PW are employees of BLIS Technologies Ltd. the numbers of subjects and bacterial cell numbers with increasing dose. The standard human dose resulted in the persistence of the K12 in the oral cavity of subjects tested References at numbers which would not to be considered elevated when compared with the levels of bacteriocin-producing 1. Abdelgadir WS, Hamad SH, Jakobsen MPLM (2001) Charac- S. salivarius having the same bacteriocin phenotype as terisation of the dominant microbiota of Sudanese fermented milk strain K12 found naturally in some people. Rob. International Dairy Journal 11:63–70 123 144 Probiotics & Antimicro. Prot. (2010) 2:135–144
2. Bentley RW, Leigh JA, Collins MD (1991) Intrageneric structure 17. Kurwijila L (2005) Technologies for enhancing value addition, of Streptococcus based on comparative analysis of small-subunit quality and safety of milk produced by smallholder farmers in rRNA sequences. Int J Syst Bacteriol 41:487–494 Africa. In: Proceedings of the 4th AACAA and 31st TSAP 3. Bishop CJ, Aanensen DM, Jordan GE, Kilian M, Hanage WP, Annual Meeting Spratt BG (2009) Assigning strains to bacterial species via the 18. Martın R, Langa S, Reviriego C, Marin ML, Olivares M, Boza J, internet. BMC Biol 7:3 Jimenez L, Fernandez J, Xaus J, Rodriguez JM (2004) The 4. Burton JP, Wescombe PA, Moore CJ, Chilcott CN, Tagg JR commensal microflora of human milk: new perspectives for food (2006) Safety assessment of the oral cavity probiotic Strepto- bacteriotherapy and probiotics. Trends Food Sci Technol 15:121– coccus salivarius K12. Appl Environ Microbiol 72:3050–3053 127 5. Callon C, Millet L, Montel MC (2004) Diversity of lactic acid 19. Mogensen G, Salminen S, O’Brien J, Ouwehand A, Holzapfel W, bacteria isolated from AOC Salers cheese. J Dairy Res 71:231– Shortt C, Fonden R, Miller GD, Donohue D, Playne M, Crit- 244 tenden R, Bianchi Salvadori B, Zink R (2002) Health benefits and 6. Carlsson J, Grahnen H, Jonsson G, Wikner S (1970) Early safety evaluation of certain food components. Food microor- establishment of Streptococcus salivarius in the mouth of infants. ganisms—health benefits, safety evaluation and strains with J Dent Res 49:415–418 documented history of use in foods. Int Dairy Federation (IDF) 7. Cosseau C, Devine DA, Dullaghan E, Gardy JL, Chikatamarla A, 4–20 Gellatly S, Yu LL, Pistolic J, Falsafi R, Tagg J, Hancock RE 20. Mora D, Ricci G, Guglielmetti S, Daffonchio D, Fortina MG (2008) The commensal Streptococcus salivarius K12 downreg- (2003) 16S–23S rRNA intergenic spacer region sequence varia- ulates the innate immune responses of human epithelial cells and tion in Streptococcus thermophilus and related dairy streptococci promotes host-microbe homeostasis. Infect Immun 76:4163–4175 and development of a multiplex ITS-SSCP analysis for their 8. Devine DA, Pistolic J, Abouserwel A, Saha S, Percival R, Han- identification. Microbiology 149:807–813 cock EM (2009) Presented at the IADR, Miami, Florida, USA 21. Obodai M, Dodd CE (2006) Characterization of dominant mic- 9. Dierksen KP, Tagg J (2000) The influence of indigenous bacte- robiota of a Ghanaian fermented milk product, nyarmie, by cul- riocin-producing Streptococcus salivarius on the acquisition of ture- and nonculture-based methods. J Appl Microbiol 100:1355– Streptococcus pyogenes by primary school children in Dunedin, 1363 New Zealand. In: Martin DRTJ (ed) Streptococci and streptococcal 22. OECD (1997) OECD guideline for the testing of chemicals (471): diseases entering the new millennium. Securacopy, Auckland, pp Bacterial Reverse Mutation Test 81–85 23. Ongol MP, Asano K (2009) Main microorganisms involved in the 10. EPA posting date. EPA Health Effects Test Guidelines OPPTs fermentation of Ugandan ghee. Int J Food Microbiol 870.5100 Bacteria Reverse Mutation Test. [Online.] 24. Pesic-Mikulec D (2005) Microbiological study of fresh white 11. Farrow JA, Collins MD (1984) DNA base composition, DNA- cheese applied ecology and environmental research. 4:129–134 DNA homology and long-chain fatty acid studies on Streptococcus 25. Riani C (2009) Effects of oral streptococci and selected probiotic thermophilus and Streptococcus salivarius. J Gen Microbiol 130: bacteria on the pathogen Streptococcus pyogenes: viability, bio- 357–362 films, molecular functions, and virulence traits. der Univesitat 12. FDA/CFSAN (2003) Bacterial reverse mutation test. In: Toxi- Rostock, Rostock cological principles for the safety assessment of food ingredients, 26. Tagg J, Burton JP, Wescombe P, Chilcott C (2008) Streptococci FDA/CFSAN Office of Food Additive Safety Redbook 2000: as effector organisms for probiotic and replacement therapy. In: IV.C.1.a Versalovic J, Wilson M (eds) Therapeutic microbiology: probi- 13. Heikkila MP, Saris PE (2003) Inhibition of Staphylococcus aureus otic and related strategies. American Society for Microbiology, by the commensal bacteria of human milk. J Appl Microbiol USA 95:471–478 27. Tagg JR, Bannister LV (1979) ‘‘Fingerprinting’’ beta-haemolytic 14. Hillman JD, McDonell E, Hillman CH, Zahradnik RT, Soni MG streptococci by their production of and sensitivity to bacteriocine- (2009) Safety assessment of ProBiora3, a probiotic mouthwash: like inhibitors. J Med Microbiol 12:397–411 subchronic toxicity study in rats. Int J Toxicol 28:357–367 28. Van Hoorde K, Verstraete T, Vandamme P, Huys G (2008) 15. Hyink O, Wescombe PA, Upton M, Ragland N, Burton JP, Tagg Diversity of lactic acid bacteria in two Flemish artisan raw milk JR (2007) Salivaricin A2 and the novel lantibiotic salivaricin B Gouda-type cheeses. Food Microbiol 25:929–935 are encoded at adjacent loci on a 190-kilobase transmissible 29. Wescombe PA, Heng NC, Burton JP, Chilcott CN, Tagg JR megaplasmid in the oral probiotic strain Streptococcus salivarius (2009) Streptococcal bacteriocins and the case for Streptococcus K12. Appl Environ Microbiol 73:1107–1113 salivarius as model oral probiotics. Future Microbiol 4:819–835 16. Innings A, Krabbe M, Ullberg M, Herrmann B (2005) Identifi- 30. WHO (2002) Guidelines for the evaluation of probiotics in food. cation of 43 Streptococcus species by pyrosequencing analysis of Food and Agriculture Organization of the United Nations, World the rnpB gene. J Clin Microbiol 43:5983–5991 Health Organisation, Geneva
123 APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Apr. 2006, p. 3050–3053 Vol. 72, No. 4 0099-2240/06/$08.00ϩ0 doi:10.1128/AEM.72.4.3050–3053.2006 Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Safety Assessment of the Oral Cavity Probiotic Streptococcus salivarius K12 Jeremy P. Burton,1,2* Philip A. Wescombe,1 Chris J. Moore,1 Chris N. Chilcott,1 and John R. Tagg1,2 BLIS Technologies Ltd.1 and Department of Microbiology and Immunology, University of Otago,2 Dunedin, New Zealand
Received 11 October 2005/Accepted 9 January 2006
Streptococcus salivarius is a prominent member of the oral microbiota and has excellent potential for use as a probiotic targeting the oral cavity. In this report we document safety data relating to S. salivarius K12, including assessment of its antibiogram, metabolic profiles, and virulence determinants, and we examine the microbial composition of saliva following the dosing of subjects with K12.
Certain lactic acid bacteria (LAB) have had a long history of isms. Consideration should also be given to the evolutionary consumption by humans, either as probiotics or in traditional origins of probiotic candidates as an indicator of the potential foods. Proposals for the use of nontraditional species in hu- for them to carry particular virulence determinants. For exam- mans generally evoke greater concern about potential adverse ple, the genus Streptococcus includes many species that are effects than proposals for LAB probiotics (11, 12). Neverthe- largely commensals of the mucosal membranes of the upper less, even species generally regarded as safe and with long respiratory tract, and some species commonly cause disease. histories of application can still potentially cause infection in The antibiograms of three samples of strain K12 were tested humans. Recent indications are that some of the more exciting by the antibiotic disk sensitivity method (conducted according new probiotic developments will include a shift in focus toward to CLSI [formerly NCCLS] standards) to determine whether strains having both their origins and primary mucosal targets in they exhibited any differences in profile. Strains tested were (i) tissues other than the intestinal tract (5). the original isolate (K12-J89), stored at Ϫ70°C for 15 years, (ii) Although there have been some attempts to use intestinally a laboratory stock culture (K12-Lab) that had been subcul- derived bacteria such as lactobacilli for oral cavity probiotics, it tured every 2 weeks for 3 years, and (iii) a commercially pre- appears more likely that bacteria isolated directly from the oral pared batch (K12-BN21) of freeze-dried cells. The antibio- microbiota will be efficacious for such purposes (5). Strepto- grams of the K12 isolates did not differ following long-term coccus salivarius K12 (isolated from the saliva of a healthy storage, recurrent in vitro propagation, or commercial lyoph- child) is a probiotic intended for use in the oral cavity. Strain ilization (Table 1). Streptococcus salivarius K12 was assessed to K12 has had a 5-year history of commercial application as a be moderately resistant to both gentamicin and ofloxacin. probiotic in New Zealand, with approximately 150,000 doses Eight additional S. salivarius isolates from different individuals administered to date. Its in vitro antimicrobial activity against were also tested for sensitivity to gentamicin and ofloxacin to Streptococcus pyogenes and various bacterial species incrimi- help determine the level of resistance to these antibiotics in the nated in the etiology of halitosis appears to be due to the general S. salivarius population. Each displayed moderate lev- production of lantibiotic bacteriocins (14, 18, 21). Streptococ- els of resistance to gentamicin and ofloxacin, similar to that of cus salivarius is a prominent member of the oral microbiota of strain K12 (Table 1). Thus, S. salivarius K12 is sensitive to a “healthy” humans and is closely related to Streptococcus ther- variety of commonly utilized antibiotics, including several that mophilus (3), a benign organism used in the manufacture of are routinely used for the control of upper respiratory tract yogurt. Streptococcus salivarius is known to be a pioneer colo- infections. The low levels of gentamicin and ofloxacin resis- nizer of infants, who typically acquire it from their mothers shortly after birth (7, 10, 19). As with lactobacilli, there have been occasional reports of infections involving S. salivarius, TABLE 1. Antibiotic disk sensitivities of S. salivarius isolates though their occurrence (even in adverse medical conditions) Inhibition zone size (mm) for: is extremely low (1, 2, 6, 8, 16, 20, 23). Antibiotic Strain K12 lineage What safety considerations should apply to a probiotic in- (concn [g]) tended for application in the oral cavity? Many of the require- K12- K12- K12- HD ToveR #6 K30 HA HB HC K26R a b c ments for intestinal probiotics are relevant here, for example, J89 Lab BN21 whether the bacterium exhibits (i) antibiotic resistance, (ii) Penicillin (10) 34 34 39 34 29 26 26 26 27 27 28 metabolic activities potentially adversely affecting the host, or Amoxicillin (10) 35 32 35 35 28 26 29 26 26 28 27 Ofloxacin (5) 18d 18d 15d 18d 19d 17d 16d 16d 18d 16d 18d (iii) inhibitory activity against other commensal microorgan- Tetracycline (30) 28 27 26 28 27 27 22 27 28 28 27 Erythromycin (15) 30 30 31 30 28 29 26 28 29 27 27 Gentamicin (10) 15d 14d 14d 15d 15d 16d 14d 12d 12d 12d 14d Clindamycin (2) 29 26 28 29 28 26 26 29 30 28 25
* Corresponding author. Mailing address: BLIS Technologies, Cen- a Original isolate. tre for Innovation, University of Otago, P.O. Box 56, Dunedin, New b Routinely subcultured isolate. Zealand. Phone: 64 3 479 3061. Fax: 64 3 479 8954. E-mail: jeremy c Isolate from commercial batch. [email protected]. d Moderately resistant.
3050 VOL. 72, 2006 SAFETY OF S. SALIVARIUS K12 3051
TABLE 2. API 20 Strep and API 50CH positive reactions for Streptococcus salivarius K12 cultures
Reaction of: Test K12-J89a K12-Labb K12-BN21c API 20 Strepd Acetoin production ϩϩ ϩ -Glucosidase ϩϩ ϩ Alkaline phosphatase ϩϩ ϩ Leucine aminopeptidase ϩϩ ϩ D-Lactose ϩϩ ϩ D-Trehalose ϩϩ ϩ Inulin ϩϩ ϩ D-Raffinose ϩϩ ϩ
API 50CH D-Galactose ϩϩ ϩ D-Glucose ϩϩ ϩ D-Fructose ϩϩ ϩ D-Mannose ϩϩ ϩ N-Acetylglucosamine ϩϩ ϩ Arbutine ϩϩ ϩ Salicin ϩϩ ϩ D-Cellobiose ϩϩ ϩFIG. 1. Streptococcus salivarius K12 (even-numbered lanes) and S. D-Maltose ϩϩ ϩpyogenes SF370 (odd-numbered lanes) amplification products resulting D-Lactose ϩϩ ϩfrom PCR using specific primers for the sagA (lanes 2 and 3), scpA D-Saccharose ϩϩ ϩ(lanes 5 and 6), smez-2 (lanes 8 and 9), speB (lanes 11 and 12), and D-Trehalose ϩϩ ϩemm (lanes 14 and 15) genes. Lanes 1 and 17, 1-kb marker (Gibco). Inulin ϩϩ ϩ D-Raffinose ϩϩ ϩ D-Tagatose ϩϩ ϩ phenotypic expression of metabolites and fermentation path- a Original isolate. ways represents stable characteristics of this strain. The ability b Routinely subcultured isolate. c Isolate from commercial batch. of S. salivarius K12 to lyse red blood cells was tested on three d The API 20 Strep code for all three isolates was 5060470. media: (i) human blood agar (BaCa, consisting of Columbia agar base with 5% [vol/vol] human blood; Fort Richard Lab- oratories, New Zealand), (ii) sheep blood agar (Columbia agar tance in strain K12 were similar to those of a series of natural base with 5% [vol/vol] defibrinated sheep blood), and (iii) S. salivarius isolates, indicating that they are intrinsic resis- buffered (pH 7.5) CNA-P agar (Difco) with 5% defibrinated tances. sheep blood (9). In each case, no hemolytic activity was de- In order to determine the metabolic profile of strain K12 tected. and its stability, the API 20 Strep and API 50CH systems For the detection of known streptococcal virulence determi- (bioMe´rieux, Marcy-l’Etoile, France) were utilized. None of nants, chromosomal DNA was extracted from cultures of S. the fermentation or enzymatic reactions of S. salivarius K12 are salivarius strain K12 and S. pyogenes strain SF370 (M-serotype indicative of deleterious effects for the human host (Table 2). 1, genome strain) using the DNeasy tissue kit (QIAGEN, Va- Additionally, the metabolic profiles given by strain K12 follow- lencia, CA). The presence of streptococcal virulence genes in ing either recurrent propagation or commercial processing SF370 and K12 was assessed using the specific primers de- were identical to that of the original isolate, indicating that the scribed in Table 3. Amplicons from S. pyogenes strain SF370
TABLE 3. Primers used to amplify streptococcal virulence genes
Virulence determinant Gene designation Primer name Primer sequence (5Ј–3Ј) Amplicon size (bp) Reference Streptolysin S sagA sagA Fwd ATTGAGCTAGCCTTGTCCTTGT 1,164 This study sagB Rev GTATTCCGCAAAATCTCTAACG
C5a peptidase scpA scpA Fwd CGGGTATCATGGGACTGTTGC 1,259 This study scpA Rev TTGCCGATGTTGCGACTTC
SMEZ-2 smez-2 smez-2 Fwd GGACGAATATGCAGCCAATGA 332 This study smez-2 Rev GTATGAAAAACCAGTCTACCAC
SPE-B speB speB Fwd TGACGCTAACGGTAAAGAAAACA 819 This study speB Rev GCCGCCACCAGTACCAAGAGC
M-protein emm M-all Fwd TATTSGCTTAGAAAATTAA 961 13 M-all Rev GCAAGTTCTTCAGCTTGTTT 3052 BURTON ET AL. APPL.ENVIRON.MICROBIOL.
TABLE 5. Detection of specific microorganisms in saliva of individuals prior to and in the days following dosing with Streptococcus salivarius K12a
No. of subjects in which the indicated class of microbe was detected/total Maximum no. of subjects at the following CFU/ml Organism(s) sampling time: detected in any single Day Day Day Day Predosing sample 3 7 14 28
S. salivarius K12-like 2/14 13/14 12/14 9/14 4/14 NAd BLISc profile S. salivarius K12-like 2/14 7/14 7/14 3/14 1/14 NA BLIS profile Ͼ50% S. mutansb 9/14 11/14 9/14 11/14 9/13 6.3e5 S. mutans Ͼ1e4 4/14 4/14 4/14 5/14 4/14 NA CFU/ml S. mutans Ͼ1e5 2/14 2/14 1/14 1/14 1/14 NA CFU/ml Lactobacilli 6/14 5/14 4/14 7/14 2/14 2.8e5 Candida 1/14 NDe 1/14 1/14 1/14 4.4e4 Coliforms 1/14 2/14 0/14 1/14 0/14 140 Pseudomonas 11/14 8/14 10/14 9/14 5/14 100 Staphylococcus aureus 3/14 4/14 1/14 2/14 2/14 1,000 FIG. 2. Autoradiographs of Southern blots hybridized with ampli- cons of the different streptococcal virulence factors (given at the bot- a Subjects included 4 males and 10 females; mean age, 19 years. tom). Lanes containing HindIII-digested DNA from S. pyogenes SF370 b P values for time point differences for S. mutans counts were not significant are labeled SF370. Lanes containing HindIII-digested DNA from S. (Ͼ0.5 by nonparametric analysis of variance). salivarius strain K12 are labeled K12. c BLIS, bacteriocin-like inhibitory substance. d NA, not applicable. e ND, not determined. DNA were labeled with digoxigenin and then used to probe Southern blots resulting from HindIII digestion of K12 and SF370 chromosomal DNA. None of the selected virulence gluconate to reduce the population levels of existing oral mi- factor genes were detected in strain K12 by PCR or Southern crobiota. At 2-h intervals for 8 h, the subjects sucked a lozenge hybridization (Fig. 1 and 2). Unfortunately, there is as yet no containing ca. 1 ϫ 109 CFU of S. salivarius K12 (BLIS K12 genome sequence available for S. salivarius to facilitate an ThroatGuard). This protocol was repeated on days 2 and 3. No in-depth bioinformatics analysis for other potential virulence adverse symptoms were reported by any of the subjects. Microbial genes. However, the annotated genome sequence of the closely populations in the saliva specimens were evaluated. Saline dilu- related organism S. thermophilus was recently published, and tions were plated in duplicate on the following media: Mitis- genes demonstrated in other species to be involved in virulence Salivarius agar (Difco) (for S. salivarius); CHROMagar Candida, were either nonfunctional or absent in S. thermophilus (4). CHROMagar ECC (for Escherichia coli and coliforms), and Preliminary work in our laboratory has shown that S. salivarius CHROMagar Staph aureus (all from CHROMagar Microbiology, K12 has an sbcD homologue similar to that in S. thermophilus. Paris, France); Pseudomonas isolation medium (Fort Richard An interesting difference between streptococci considered Laboratories); TSYCSB selective medium (for Streptococcus pathogenic and dairy streptococci is the presence of sbc genes mutans) (22); and BaCa. The majority of pathogens and op- in the latter. These products reduce the efficiency of recombi- portunistic microorganisms tested for in the saliva were those nation, effectively stabilizing the genome (4). suggested for the assessment of adverse effects of chemother- A study approved by the Otago Ethics Committee was con- apy on the oral microbiota (15). Total counts of Streptococcus ducted to determine whether the use of the K12 strain by salivarius and facultatively anaerobic bacteria remained stable humans altered the composition of the oral microbiota. Saliva throughout the study (Table 4). Examination of the saliva of samples were collected from 14 individuals 24 h prior to the subjects dosed with S. salivarius K12 for 3 days indicated that commencement of the colonization protocol and periodically there was no overt change in its microbial composition. The during the study. On the following day, each subject brushed bacteriocin-like inhibitory substance activity of representative his or her teeth and rinsed with 10 ml of 0.2% chlorhexidine S. salivarius isolates was determined as described previously
TABLE 4. Counts of facultatively anaerobic bacteria and S. salivarius in saliva of individuals prior to and in the days following dosing with S. salivarius K12a
Mean CFU/ml (SD) at the following time of sampling: Maximum CFU/ml Organism(s) detected in any Predosing Day 3 Day 7 Day 14 Day 28 single sample Facultatively 3.11e7 (2.4e7) 3.09e7 (2.1e7) 3.98e7 (2.3e7) 3.93e7 (2.9e7) 3.32e7 (2.1e7) 1.1e8 anaerobic bacteria S. salivarius 1.54e7 (2.4e7) 7.80e6 (1.3e7) 1.33e7 (1.1e7) 6.58e6 (5.9e6) 7.2e6 (7.1e6) 7.7e7
a Subjects included 4 males and 10 females; mean age, 19 years. P values for time point differences for counts of facultatively anaerobic bacteria and S. salivarius were not significant (Ͼ0.5 by nonparametric analysis of variance). VOL. 72, 2006 SAFETY OF S. SALIVARIUS K12 3053
(17). Two subjects had S. salivarius organisms in their oral 8. Corredoira, J. C., M. P. Alonso, J. F. Garcia, E. Casariego, A. Coira, A. cavities that exhibited bacteriocin profiles similar to that of Rodriguez, J. Pita, C. Louzao, B. Pombo, M. J. Lopez, and J. Varela. 2005. Clinical characteristics and significance of Streptococcus salivarius bactere- strain K12 prior to the taking of the course of K12 lozenges. mia and Streptococcus bovis bacteremia: a prospective 16-year study. Eur. After 2 days of lozenge taking, 13 of the 14 subjects had S. J. Clin. Microbiol. Infect. Dis. 24:250–255. 9. Dierksen, K. P., N. L. Ragland, and J. R. Tagg. 2000. A new alkaline salivarius populations in which more than 1% exhibited strain pH-adjusted medium enhances detection of -hemolytic streptococci by K12-like inhibitory activity, but by day 28, this was reduced to minimizing bacterial interference due to Streptococcus salivarius. J. Clin. only 4 subjects (Table 5). These bacteriocin-producing cell Microbiol. 38:643–650. 10. Favier, C. F., E. E. Vaughan, W. M. De Vos, and A. D. Akkermans. 2002. lines appeared in some cases to persist in the oral cavity for Molecular monitoring of succession of bacterial communities in human neo- more than 1 month after the completion of the course. Strep- nates. Appl. Environ. Microbiol. 68:219–226. tococcus salivarius K12 isolates obtained from the saliva of 5 11. Franz, C. M., M. E. Stiles, K. H. Schleifer, and W. H. Holzapfel. 2003. Enterococci in foods—a conundrum for food safety. Int. J. Food Microbiol. subjects at day 14 were tested by API 20 Strep and 50CH kits, 88:105–122. and no metabolic profile changes were detected. 12. Lund, B., and C. Edlund. 2001. Probiotic Enterococcus faecium strain is a possible recipient of the vanA gene cluster. Clin. Infect. Dis. 32:1384–1385. The data presented in this study, demonstrating the absence 13. Podbielski, A., B. Melzer, and R. Lutticken. 1991. Application of the poly- of adverse reactions in subjects actively ingesting S. salivarius merase chain reaction to study the M protein(-like) gene family in beta- K12, combined with the results of analysis of the biochemical, hemolytic streptococci. Med. Microbiol. Immunol. (Berlin) 180:213–227. 14. Ross, K. F., C. W. Ronson, and J. R. Tagg. 1993. Isolation and character- antibiogram, and virulence gene profiles of this bacterium, ization of the lantibiotic salivaricin A and its structural gene salA from indicate that it has very low pathogenic potential and is un- Streptococcus salivarius 20P3. Appl. Environ. Microbiol. 59:2014–2021. likely to cause disease in healthy humans. 15. Sandham, H. J. 1994. Criteria for the assessment of adverse effects of chemotherapy on the oral microflora. J. Dent. Res. 73:692–694. 16. Smith, A., M. S. Jackson, and H. Kennedy. 2004. Antimicrobial susceptibility REFERENCES of viridans group streptococcal blood isolates to eight antimicrobial agents. 1. Afek, S., A. D. Sperber, and Y. Almog. 2004. Carcinoma of the colon pre- Scand. J. Infect. Dis. 36:259–263. senting as Streptococcus salivarius sepsis. J. Clin. Gastroenterol. 38:86–87. 17. Tagg, J. R., and L. V. Bannister. 1979. “Fingerprinting” beta-haemolytic 2. Ahmed, R., T. Hassall, B. Morland, and J. Gray. 2003. Viridans streptococ- streptococci by their production of and sensitivity to bacteriocine-like inhib- cus bacteremia in children on chemotherapy for cancer: an underestimated itors. J. Med. Microbiol. 12:397–411. problem. Pediatr. Hematol. Oncol. 20:439–444. 18. Tagg, J. R., and K. P. Dierksen. 2003. Bacterial replacement therapy: adapt- 3. Bentley, R. W., J. A. Leigh, and M. D. Collins. 1991. Intrageneric structure ing ‘germ warfare’ to infection prevention. Trends Biotechnol. 21:217–223. of Streptococcus based on comparative analysis of small-subunit rRNA se- 19. Tagg, J. R., V. Pybus, L. V. Phillips, and T. M. Fiddes. 1983. Application of quences. Int. J. Syst. Bacteriol. 41:487–494. inhibitor typing in a study of the transmission and retention in the human 4. Bolotin, A., B. Quinquis, P. Renault, A. Sorokin, S. D. Ehrlich, S. Kulakaus- mouth of the bacterium Streptococcus salivarius. Arch. Oral Biol. 28:911–915. kas, A. Lapidus, E. Goltsman, M. Mazur, G. D. Pusch, M. Fonstein, R. 20. Trautmann, M., P. M. Lepper, and F. J. Schmitz. 2002. Three cases of Overbeek, N. Kyprides, B. Purnelle, D. Prozzi, K. Ngui, D. Masuy, F. Hancy, bacterial meningitis after spinal and epidural anesthesia. Eur. J. Clin. Mi- S. Burteau, M. Boutry, J. Delcour, A. Goffeau, and P. Hols. 2004. Complete crobiol. Infect. Dis. 21:43–45. sequence and comparative genome analysis of the dairy bacterium Strepto- 21. Upton, M., J. R. Tagg, P. Wescombe, and H. F. Jenkinson. 2001. Intra- and coccus thermophilus. Nat. Biotechnol. 22:1554–1558. interspecies signaling between Streptococcus salivarius and Streptococcus pyo- 5. Burton, J., C. Chilcott, and J. Tagg. 2005. The rationale and potential for the genes mediated by SalA and SalA1 lantibiotic peptides. J. Bacteriol. 183: reduction of oral malodour using Streptococcus salivarius probiotics. Oral 3931–3938. Dis. 11:29–31. 22. Van Palenstein Helderman, W. H., M. Ijsseldijk, and J. H. Huis in ’t Veld. 6. Cannon, J. P., T. A. Lee, J. T. Bolanos, and L. H. Danziger. 2005. Pathogenic 1983. A selective medium for the two major subgroups of the bacterium relevance of Lactobacillus: a retrospective review of over 200 cases. Eur. Streptococcus mutans isolated from human dental plaque and saliva. Arch. J. Clin. Microbiol. Infect. Dis. 24:31–40. Oral Biol. 28:599–603. 7. Carlsson, J., H. Grahnen, G. Jonsson, and S. Wikner. 1970. Early establish- 23. Watanakunakorn, C., and J. Pantelakis. 1993. Alpha-hemolytic streptococ- ment of Streptococcus salivarius in the mouth of infants. J. Dent. Res. 49: cal bacteremia: a review of 203 episodes during 1980–1991. Scand. J. Infect. 415–418. Dis. 25:403–408. INFECTION AND IMMUNITY, Sept. 2008, p. 4163–4175 Vol. 76, No. 9 0019-9567/08/$08.00ϩ0 doi:10.1128/IAI.00188-08 Copyright © 2008, American Society for Microbiology. All Rights Reserved.
The Commensal Streptococcus salivarius K12 Downregulates the Innate Immune Responses of Human Epithelial Cells and Promotes Host-Microbe Homeostasisᰔ† Celine Cosseau,1 Deirdre A. Devine,2# Edie Dullaghan,3# Jennifer L. Gardy,1 Avinash Chikatamarla,1 Shaan Gellatly,1 Lorraine L. Yu,1 Jelena Pistolic,1 Reza Falsafi,1 John Tagg,4 and Robert E. W. Hancock1* Centre for Microbial Diseases and Immunity Research, University of British Columbia, Vancouver, Canada1; Department of Oral Biology, Leeds Dental Institute, University of Leeds, Leeds, United Kingdom2; Inimex Pharmaceuticals, Vancouver, Canada3; and Department of Microbiology and Immunology, University of Otago, Dunedin, New Zealand4
Received 11 February 2008/Returned for modification 25 March 2008/Accepted 3 July 2008
Streptococcus salivarius is an early colonizer of human oral and nasopharyngeal epithelia, and strain K12 has reported probiotic effects. An emerging paradigm indicates that commensal bacteria downregulate immune responses through the action on NF-B signaling pathways, but additional mechanisms underlying probiotic actions are not well understood. Our objective here was to identify host genes specifically targeted by K12 by
comparing their responses with responses elicited by pathogens and to determine if S. salivarius modulates Downloaded from epithelial cell immune responses. RNA was extracted from human bronchial epithelial cells (16HBE14O- cells) cocultured with K12 or bacterial pathogens. cDNA was hybridized to a human 21K oligonucleotide-based array. Data were analyzed using ArrayPipe, InnateDB, PANTHER, and oPOSSUM. Interleukin 8 (IL-8) and growth-regulated oncogene alpha (Gro␣) secretion were determined by enzyme-linked immunosorbent assay. It was demonstrated that S. salivarius K12 specifically altered the expression of 565 host genes, particularly those involved in multiple innate defense pathways, general epithelial cell function and homeostasis, cytoskel- etal remodeling, cell development and migration, and signaling pathways. It inhibited baseline IL-8 secretion iai.asm.org and IL-8 responses to LL-37, Pseudomonas aeruginosa, and fl agellin in epithelial cells and attenuated Gro␣ secretion in response to fl agellin. Immunosuppression was coincident with the inhibition of activation of the NF-B pathway. Thus, the commensal and probiotic behaviors of S. salivarius K12 are proposed to be due to the organism (i) eliciting no proinfl ammatory response, (ii) stimulating an anti-infl ammatory response, and by guest on August 26, 2008 (iii) modulating genes associated with adhesion to the epithelial layer and homeostasis. S. salivarius K12 might thereby ensure that it is tolerated by the host and maintained on the epithelial surface while actively protecting the host from infl ammation and apoptosis induced by pathogens.
Bacteria within the resident communities that colonize mu- therapeutic and prophylactic strategy for many inflammatory cosal sites outnumber cells of the human body by 10-fold. Such diseases and infections (39). For example, certain strains of populations are diverse as well as numerous; for example, lactobacilli have been suggested to improve mucosal immunity around 700 taxa are normal inhabitants of the human mouth as well as reduce the symptoms caused by a range of condi- (1). Remarkably, these potentially overwhelming populations tions, including Helicobacter pylori infections, cancer, and in- coexist with the host, with harmful effects occurring only if the flammatory bowel diseases (12). Clinical trials with humans immune status is altered or there is a loss of control of epithe- and animal studies have demonstrated the probiotic properties lial cell sensing and discriminatory systems. It is now generally of commensal bacteria in the oral cavity in the reduction of accepted that this endogenous microflora possesses immuno- dental caries, otitis media, and Streptococcus pyogenes infection modulating capacities. Furthermore, some resident commensal (47). bacteria have been shown to provide significant benefit to the Certain fundamental questions emerge when considering host by blocking pathogen colonization and by influencing the interactions between epithelial tissues and commensal micro- normal development of cell structure and the immune system bial populations. A major issue concerns the ability of epithe- (5, 19, 29). This concept of beneficial bacteria has led to the lial cells to distinguish between nonpathogenic and pathogenic advent of probiotics, the administration of viable microorgan- stimuli, ensuring that resident bacteria do not elicit harmful isms that confer health benefits to the host. Manipulation of inflammatory responses, while the host maintains efficient host the resident microflora using probiotics has become a realistic defenses against pathogens. Some studies have indicated that pathogenic and nonpathogenic bacteria initiate different intra- cellular signaling pathways and innate immune responses in * Corresponding author. Mailing address: Centre for Microbial Dis- eases and Immunity Research, University of British Columbia, Van- epithelial cells (7, 16, 27, 35). The mechanisms that allow couver, Canada. Phone: (604) 263-6718. Fax: (604) 822-6041. E-mail: commensal organisms to be tolerated by epithelial tissues are [email protected]. imperfectly understood, and their dissection has only recently † Supplemental material for this article may be found at http://iai begun, mainly through the study of interactions at the intesti- .asm.org/. # These authors contributed equally to this work. nal barrier. A number of studies have suggested that tolerance ᰔ Published ahead of print on 14 July 2008. largely involves specific, active processes causing a functional
4163 4164 COSSEAU ET AL. INFECT.IMMUN.
modulation of immunity. Some implicate an alteration in Toll- Purified LPS samples were quantified using an assay for the core sugar 2-keto- like receptor (TLR) signaling (38), while others have demon- 3-deoxyoctosonic acid (KDO assay) and then resuspended in endotoxin-free strated suppression by commensals of inflammatory responses water (Sigma-Aldrich, St. Louis, MO). Flagellin was purchased from Invivogen (San Diego, CA) and stored as recommended by the manufacturer. The inhibitor in epithelial cells through the inhibition of the NF- B pathway Bay 11-7085 was purchased from Biomol International (Plymouth Meeting, PA). (8, 24, 34, 48) or through the secretion of IL-10 cytokines (13). Tissue culture and coincubation conditions. The simian virus 40-transformed, Less well studied are the mechanisms by which some commen- immortalized human bronchial epithelial cell line 16HBE14O- was a gift from D. sal organisms are probiotic in function, contributing in addi- Gruenert (University of California, San Francisco). Cells were grown in cell culture flasks (Costar, Cambridge, MA) at 37°C in a 5% CO2 atmosphere in tional beneficial ways to epithelial cell function and host-mi- minimal essential medium (MEM) with Earle’s salts (Invitrogen, Burlington, crobe homeostasis. Canada) containing 10% fetal bovine serum (FBS) and 2 mM L-glutamine We aimed to further understand the behavior of epithelial (complete MEM). They were passaged by treating the monolayer with trypsin- cells in response to the commercially developed probiotic bac- EDTA (Invitrogen, Burlington, Canada) at 37°C for 5 min to dissociate the cells terium Streptococcus salivarius K12 (20). This commensal bac- from the flask. Detached cells were transferred to a 50-ml centrifuge tube containing 20 ml complete MEM and then centrifuged for 5 min at 1,000 ϫ g. terium is one of the earliest colonizers of epithelial surfaces in The supernatant was discarded, and cells were resuspended in complete MEM. the human mouth and nasopharynx. It is reported to be pro- A 75-cm2 flask was seeded with 5 ϫ 105 viable cells in 25 ml complete MEM tective against pathogens causing throat infections, otitis me- and incubated at 37°C in 5% CO2. Cells were used at passage numbers dia, pouchitis (47), and oral malodor (4). The protective effects between 6 and 15. To generate confluent monolayer cultures for experiments investigating inter- of S. salivarius K12 are related in part to the production of leukin 8 (IL-8) and growth-regulated oncogene alpha (Gro␣) secretion, salivaricin A2 and salivaricin B, two lantibiotics (antimicrobial 16HBE14O- cells were seeded in 24-well plates (Sarstedt, Newton, NC) at a ϫ 5 peptides) with inhibitory activities toward most Streptococcus density of 1 10 cells/well. They were grown for 48 h at 37°C in 5% CO2 in complete MEM. Confluent cells were then coincubated with LL-37 (25 g/ml
pyogenes strains (22). Nevertheless, the host response to S. Downloaded from salivarius K12, which might contribute to its commensal or and 40 g/ml) with or without S. salivarius K12, P. aeruginosa PAO1 with or without S. salivarius K12, and flagellin with or without S. salivarius K12 (pre- probiotic properties, has not yet been studied. To this end, we mixed prior to being added to the cells). Mid-exponential-phase broth cultures of examined the ability of S. salivarius K12 to modulate human bacteria were used at multiplicities of infection (MOI) of 50 viable bacteria per epithelial cell immune responses. Through microarray-based cell, and incubation was in MEM with Earle’s salts containing 2 mM L-glutamine analyses and enzyme-linked immunosorbent assay (ELISA), but without FBS. The NF-B inhibitor Bay 11-7085 (40 M) was added to the epithelial cells 30 min prior to the addition of flagellin and then incubated for
we examined the responses of human bronchial epithelial cells iai.asm.org 24 h. Supernatants were collected after coincubation for up to 48 h at 37°C in 5% to S. salivarius K12 and compared these to the responses elic- ϫ CO2. They were centrifuged at 10,000 g for 2 min to remove bacteria and cell ited by other gram-positive and gram-negative organisms, in- debris and were stored at Ϫ20°C until required. cluding opportunists and pathogens. We found that S. saliva- To generate polarized cell cultures, 16HBE14O- cells were seeded in six-well rius K12 downregulated inflammatory responses by inhibiting permeable Transwell plates (Corning Life Science, Corning, NY) at a density of by guest on August 26, 2008 ϫ 5 ϫ 5 1.5 10 to 3.75 10 cells/well. Cells were grown in complete MEM plus the NF- B pathway, actively stimulated beneficial pathways, penicillin-streptomycin (50 units/ml) (Invitrogen, Burlington, Canada) at 37°C in
including type I and II interferon responses, and exerted sig- 5% CO2 until they were polarized (14 days). Polarization was monitored by nificant effects on the cytoskeleton and adhesive properties of measuring the trans-epithelial cell resistance with a Millicell electrical resistance the host cell. Taken together, these data provide a better un- system (Millipore, Billerica, MA). Medium was replaced every other day with derstanding of how this probiotic commensal bacterium is tol- fresh medium, and the night before an experiment, it was replaced with fresh complete MEM without antibiotics. erated by epithelial cells and contributes actively to the host The release of IL-8 induced by P. aeruginosa or flagellin in the presence or defense process. absence of S. salivarius was assessed using polarized 16HBE14O- cells. The medium was replaced with MEM with Earle’s salts containing 2 mM L-glutamine but without FBS. P. aeruginosa, with or without being premixed with S. salivarius MATERIALS AND METHODS (both at an MOI of 50), was applied to the apical surfaces of the polarized Bacterial strains and growth conditions. S. salivarius K12 was isolated from 16HBE14O- cells, and supernatants were collected following coculture at 37°C in BLIS probiotic lozenges (BLIS Technologies, Dunedin, New Zealand) by crush- a 5% CO2 atmosphere for 6 h. Flagellin (0.5 g/ml and 1 g/ml) was added to ing them into Todd-Hewitt broth (THB) (BD Difco, Franklin Lakes, NJ). Serial the apical surfaces of 16HBE14O- cells that had already been cocultured with S. dilutions were inoculated onto Mitis salivarius agar (BD Difco, Franklin Lakes, salivarius (MOI, 50) for 2 h. Following the addition of flagellin, the cells were ϫ NJ) and incubated at 37°C in a 5% CO2 atmosphere. Pure cultures were stored further incubated for 5 h and supernatants were collected, centrifuged at 10,000 at Ϫ80°C in dimethyl sulfoxide (7%, vol/vol), and experimental cultures were g for 2 min, and stored at Ϫ20°C until required. routinely maintained by weekly passage on Mitis salivarius agar at 37°C in 5% For experiments to determine the global gene responses of epithelial cells,
CO2. For all experiments, broth cultures of S. salivarius K12 were generated by mid-exponential-phase broth cultures of bacteria were added to the apical sur- inoculating fresh THB with an overnight THB culture (diluted 1:10) and incu- faces of polarized cells at an MOI of 50 viable bacteria per cell. 16HBE14O-
bating them at 37°C in 5% CO2 until the mid-exponential phase of growth. epithelial cells and bacteria were incubated together for1hincomplete MEM. Pseudomonas aeruginosa strains PAO1, PAK, and PAK’s fliC- flagellin-negative The supernatants containing the bacteria were then replaced by fresh sterile mutant were grown overnight in Luria-Bertani (LB) agar (BD Difco, Franklin medium, and cells were incubated for a further 3 h, after which they were lysed Lakes, NJ) at 37°C, inoculated (1:10) in BM2-glucose minimal medium contain- with RLT lysis buffer supplemented with -mercaptoethanol (RNeasy mini kit, ing 20 mM Mg2ϩ, and grown until mid-exponential phase at 37°C for further with RNase-Free DNase treatment [Qiagen, Hilden, Germany]). Lysates were experiments. For microarray experiments, Salmonella enterica subsp. enterica stored at Ϫ80°C until extraction of the RNA was performed. serovar Typhimurium SL1344 and Staphylococcus aureus ATCC 29213 were Clonetics primary normal human bronchial epithelial (pnHBE) cells were grown overnight at 37°C on Mueller-Hinton broth. purchased from Cambrex BioScience Inc. (Walkersville, MD) and were cultured Biological reagents. The human cationic peptide LL-37 (LLGDFFRKSKEK and maintained in bronchial epithelial growth medium (BEGM; Cambrex Bio- IGKEFKRIVQRIKDFFRNLVPRTES), was synthesized using F-moc chemistry Science Inc.), according to the manufacturer’s instructions. BEGM is a basal at the Nucleic Acid/Protein Synthesis Unit, UBC, and purified by high-perfor- medium (Cambrex BioScience Ltd.) supplemented with bronchial epithelial cell mance liquid chromatography. The synthetic peptide was resuspended in endo- SingleQuots growth factors and supplements (Cambrex BioScience Ltd.) and is toxin-free water and stored at Ϫ20°C until further use. Lipopolysaccharide (LPS) used as a serum substitute optimized for the growth and appropriate differenti- from overnight broth cultures of P. aeruginosa H103 was highly purified free of ation of these primary cells. SingleQuots includes human epidermal growth proteins and lipids as described previously (9). Isolated LPS pellets were ex- factor, triiodothyronine, bovine pituitary extract, epinephrine, transferrin, insu- tracted with a 2:1 chloroform-methanol solution to remove contaminating lipids. lin, hydrocortisone, gentamicin-amphotericin, and retinoic acid. In accordance VOL. 76, 2008 HOST GENE REGULATION BY THE COMMENSAL S. SALIVARIUS 4165
with the manufacturer’s instructions, cells were cultured in complete BEGM to TABLE 1. Sequences of primers used for qPCR 85 to 90% confluence in 100% humidity and 5% CO at 37°C and were used 2 Ј Ј Ј Ј between passages 2 and 3. Gene product Forward primer (5 –3 ) Reverse primer (3 –5 ) Normal primary adult keratinocytes were obtained from Cascade Biologics HAMP CATGTTCCAGAG ACGTCTTGCAGCACA (Portland, OR). Cells were maintained in Epilife medium with 0.65 M calcium GCGAAGGA TCCC (Cascade Biologics, Portland, OR) supplemented with the human keratinocyte TRIP4 GGTTGACCACAC GATCCTGGATTCGCAA growth supplement (Cascade Biologics) (contains bovine pituitary extract, bo- AGGTGCAG CTGG vine insulin, hydrocortisone, bovine transferrin, and human epidermal growth LNX TCTAAAGGTCAAC CACGCATCACAGTCA factor) at 37°C in a 5% CO2 atmosphere according to the manufacturer’s in- GGGATGGA GCCAC structions and were used between passages 2 and 6. Primary keratinocytes were PKIG GATGCGACAGGC GAGTCTCCCTGGATGT seeded into tissue culture-treated 24-well plates (Corning Life Sciences, Acton, ATGATGG CAGGG 2 MA) at a density of 7,000 cells per cm and were cultivated in supplemented ELMO1 ACACGTGTGGCC TGGCCACCTTGACGA EpiLife medium until they attained the desired level of confluence. GTTTACG TGTC RNA extraction, amplification, and hybridization to DNA microarrays. RNA FRDA CCATCCAGTGGAC TTAGTGAGCTCTGCG was extracted from 16HBE14O- cells using an RNeasy Mini kit, treated with CTAAGCG GCCA RNase-free DNase (Qiagen, Hilden, Germany), and eluted in RNase-free water DUSP14 CCAGCACTGCTCA CCTCCACCAAGGAATC (Ambion, Austin, TX) according to the manufacturers’ instructions. RNA was CTTAGGACTT CAAA then processed as previously described by Mookherjee et al. (33). Briefly, RNA GAPDH GAAACTGTGGCG GTCGCTGTTGAAGTCA concentration, integrity, and purity were assessed with an Agilent 2100 Bioana- TGATGG GAGG lyzer using RNA 6000 Nano kits (Agilent Technologies, Palo Alto, CA). RNA IL-8 GACCACACTGCG CTTCTCCACAACCCTC was (reverse) transcribed with the incorporation of amino-allyl-UTP using the CCAACAC TGCAC MessageAmpII amplification kit (Ambion, Austin, TX) according to the manu- IL-6 AATTCGGTACATC GGTTGTTTTCTGCCAG facturer’s instructions, and then column purified and eluted in nuclease-free CTCGACGG TGCC
water. Column-purified samples were labeled with the monofunctional dyes RBP1 TGGAAGGTGTGG GGGATCCTGGCTCAC Downloaded from cyanine-3 and cyanine-5 (Amersham Biosciences) according to the manufactur- TCTGCAAG ACATC er’s instructions and then purified using the Mega Clear kit (Ambion, Austin, IL1RL1 TGGAAGGTGTGG GGGATCCTGGCTCAC TX). Yield and fluorophore incorporation were measured using a 35 UV– TCTGCAAG ACATC visible-light fluorometer (PerkinElmer Life and Analytical Sciences, Welles- ley, MA). Microarray slides were printed with the human genome 21K Array-Ready
oligonucleotide set (Qiagen, Hilden, Germany) at the Jack Bell Research Center iai.asm.org ␣ ␣ (Vancouver, BC, Canada). Slides were prehybridized for 45 min at 48°C in ELISA assays for IL-8 and Gro detection. IL-8 and Gro secretion were prehybridization buffer containing 5ϫ SSC (1ϫ SSC is 0.15 M NaCl plus 0.015 detected using commercially available ELISA kits (BioSource International, M sodium citrate; Ambion, Austin, TX), 0.1% (wt/vol) sodium dodecyl sulfate Montreal, Canada, and eBioscience, San Diego, CA, respectively) as per the (SDS), and 0.2% (wt/vol) bovine serum albumin. Equivalent amounts (20 pmol) manufacturers’ directions. All assays were performed in triplicate. The concen- tration of IL-8 or Gro␣ in the culture medium was determined by establishing by guest on August 26, 2008 of cyanine-labeled samples from control and treated cells were then mixed and standard curves with serial dilutions of recombinant human IL-8 or Gro␣. To hybridized on the array slides in Ambion SlideHyb buffer 2 (Ambion, Austin, determine if there was any extracellular breakdown of IL-8 mediated by S. TX) for 18 h at 37°C in a hybridization oven. Following hybridization, the slides salivarius K12, IL-8 (0 to 500 pg/ml culture medium) was incubated with the were washed twice in 1ϫ SSC–0.1% SDS for 5 min at 65°C and then twice in 1ϫ bacteria (1.0 ϫ 106 to 1.5 ϫ 107 CFU/ml) for 6 h, and the amount of the SSC and 0.1ϫ SSC for 3 min each at 42°C. Slides were centrifuged for 5 min at remaining IL-8 was determined by ELISA. 1,000 ϫ g, dried, and scanned using the ScanArray Express software and scanner Western immunoblotting. Cytoplasmic and nuclear proteins were extracted (scanner and software by Packard BioScience [PerkinElmer] BioChip Technol- and immunoblotted to test for nuclear translocation of p65 NF-B as described ogies, Wellesley, MA), and the images were quantified using ImaGene (Bio- previously (33). Briefly, pnHBE cells were seeded at 3,500 cells/cm2 into 60- by Discovery, El Segundo, CA). 15-mm petri dishes (VWR International, West Chester, PA) and were grown to Analysis of DNA microarrays. Microarray analysis was performed utilizing confluence, and BEBM was changed every other day. When confluent, cells were results from four biological repeats for S. salivarius K12, S. aureus, and P. stimulated for 30 min with flagellin (1 g/ml) in the presence and absence of S. aeruginosa (two technical repeats per each biological assay) and from five bio- salivarius K12 (MOI, 50:1). Cells were detached by incubation with 0.025% logical repeats for Salmonella serovar Typhimirium. Assessment of slide quality, (wt/vol) trypsin–0.01% EDTA, followed by washing and resuspension in ice-cold normalization, detection of differential gene expression, and statistical analysis phosphate-buffered saline. Nuclear and cytoplasmic proteins were extracted us- were conducted with the Web-based analysis tool ArrayPipe (18) (www ing the NE-PER nuclear- and cytoplasmic-extraction reagent kit (Pierce, Rock- .pathogenomics.ca/arraypipe/) as previously described by Mookherjee et al. (33). ford, IL) according to the manufacturer’s instructions and were stored at Ϫ80°C. Differentially expressed genes were then analyzed using InnateDB, a highly Following protein determination using the bicinchoninic acid assay (Pierce, curated database containing biomolecules and their interactions (http://www Rockford, IL), 3 g of extracts was resolved by 7.5% SDS-polyacrylamide gel .innatedb.com) (28b), PANTHER (30), and oPOSSUM (21). Genes that were electrophoresis and transferred to immunoblot polyvinylidene difluoride mem- differentially expressed in response to all treatments were clustered manually, branes (Bio-Rad, Hercules, CA). Membranes were probed with antibodies spe- with each cluster representing a set of genes with a distinct pattern of response cific either to the p65 subunits of NF-B (Cell Signaling Technology, Danvers, to a group of treatments, indicating potential coregulation. MA) or to the H2AX histone (R&D Systems, Minneapolis, MN) as the loading qPCR validation. Differential gene expression identified by microarray anal- control. Primary antibodies were diluted according to the manufacturer’s instruc- ysis was validated by quantitative real-time PCR (qPCR) as previously described tions in TBST (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, and 0.01%, vol/vol, by Mookherjee et al. (33). The SuperScript III Platinum two-step quantitative Tween 20) containing 5% (wt/vol) skim milk powder. Following reaction with reverse transcription-PCR kit with Sybr green (Invitrogen, Burlington, Canada) horseradish peroxidase (HRP)-conjugated secondary antibodies, anti-rabbit– was used according to the manufacturer’s directions in the ABI Prism 7000 HRP antibody for the detection of p65 (Cell Signaling Technology Inc., Danvers, sequence detection system (Applied Biosystems, Foster City, CA). Briefly, 1 g MA), or anti-mouse–HRP antibody for the detection of H2AX histone (Amer- of total RNA was reverse transcribed in a 20-l reaction volume for 50 min at sham, Piscataway, NJ), membranes were developed using a chemiluminescence 42°C, and the reaction was terminated by incubating the mixture for 5 min at peroxidase substrate (Sigma Aldrich) according to the manufacturer’s instruc- 85°C; then the RNA was digested for 30 min at 37°C with RNase H. The PCR tions. was conducted in a 12.5-l reaction volume containing 2.5 l of the 1/10-diluted LDH assay for cytotoxicity estimation. The levels of lactate dehydrogenase cDNA template. A melting curve was performed to ensure that any product (LDH) in supernatants were assayed in triplicate using a colorimetric cytotoxicity detected was specific to the desired amplicon. Changes (n-fold) were calculated detection kit (Roche, Mannheim, Germany). As a positive control for maximum after normalization to endogenous GAPDH (glyceraldehyde-3-phosphate dehy- LDH release, cells were treated with 1% Triton X-100 (Sigma, Oakville, Can- drogenase) and by using the comparative threshold cycle method. The quanti- ada), resulting in complete cell lysis, while LDH release in nontreated cells was tative reverse transcription-PCR primers are included in Table 1. used as a negative control. Medium alone was used to assess background (0%). 4166 COSSEAU ET AL. INFECT.IMMUN.
relationship between genes differentially expressed across each condition. Incubation in the presence of S. salivarius led to the differential expression of 660 genes, and Salmonella serovar Typhimurium, S. aureus, and P. aeruginosa caused differential expression of 397, 323, and 367 genes, respectively. S. saliva- rius-stimulated 16HBE14O- cells showed an approximately 5:2 ratio of upregulated to downregulated genes, whereas under the other three conditions, the number of downregulated genes greatly exceeded the number of those upregulated. In- terestingly, the response to S. salivarius was most similar to the response to P. aeruginosa, with 60 genes in common (versus 11 and 16 for Salmonella and Staphylococcus, respectively). FIG. 1. Venn diagram illustrating the overlap of differentially ex- Clustering of genes. The 1,530 genes were then clustered pressed genes across the four conditions studied. manually based on their changes in expression across each condition. This resulted in 14 clusters. Clusters 1 through 8 contained genes differentially expressed under only one of the The percent cytotoxicity was calculated as follows: (experimental value Ϫ neg- four conditions: clusters 1, 3, 5, and 7 contained upregulated ative-control value)/(positive-control value Ϫ negative-control value) ϫ 100. genes, and clusters 2, 4, 6, and 8 contained downregulated Growth of S. salivarius with 16HBE14O- cells. To determine the growth prop- genes in response to S. salivarius, Salmonella serovar Typhi- erties of S. salivarius on the epithelial cell surface, 16HBE14O- cells were seeded 4 in 96-well plates (Sarstedt, Newton, MA) at 1 ϫ 10 cells/well. They were grown murium, S. aureus, and P. aeruginosa, respectively. Clusters 9 to Downloaded from for 48 h in complete MEM at 37°C in 5% CO2. S. salivarius bacteria grown in 14 contained genes that were up- or downregulated under two THB until mid-exponential phase were then added to the cells at an MOI of 50. or more conditions. Each of clusters 9 to 15 was further divided Cells and bacteria were cocultured at 37°C in 5% CO2 and MEM with Earle’s into subclusters (9.1 and 9.2, etc.). Details of the clustering salts containing 2 mM L-glutamine but without FBS. Bacterial growth was mon- itored by measuring the optical density at 600 nm using a plate reader (Tecan, data and the cluster to which each gene belongs are found in Salzburg, Austria). the last column of the supplemental material. Ϯ Statistical analysis. ELISA and qPCR results were expressed as means Validation of array gene expression analysis by qPCR. To iai.asm.org standard errors of the means. The two-tail-distribution unpaired Student t test confirm the results of the array gene expression analysis, genes was used, and P values are indicated in Results. For the recalculation of pathway with significant differential expression in response to S. saliva- overrepresentation, immune-related pathways with P values above 0.05 were selected, and reviews providing more-complete schematics of these pathways rius were selected for validation. Furthermore, to confirm the by guest on August 26, 2008 were identified from the literature. Using these more-complete lists of the genes/ specific aspect of the clustering analysis, we compared the proteins involved in a pathway rather than the original PANTHER lists, signif- validated results to results obtained with P. aeruginosa (Table icance values were recalculated using the same binomial test procedure imple- 2). We confirmed the expression data of genes with roles that mented by PANTHER. Microarray data accession number. Raw microarray data have been deposited seemed to be particularly relevant in the context of host-mi- in ArrayExpress under accession number E-FPMI-13. crobe interactions (iron and isoprenoid metabolism, cytoskel- etal remodeling, receptor signaling and protein kinase activi- ties, and immune function). We also validated the expression RESULTS data of IL-6 and IL-8 proinflammatory cytokines. As indicated Global array analysis. We examined the effects of S. saliva- by the array analysis, P. aeruginosa was able to activate the rius K12 on global gene expression in 16HBE14O- cells. To gene expression of IL-6 and IL-8, whereas S. salivarius K12 did highlight the responses that were specific to this organism, and not influence the expression of these genes. therefore potentially important in its commensal and probiotic Overrepresented function and process analysis of differen- activities, we compared gene responses to S. salivarius with tially expressed genes. Differentially expressed genes were those initiated by other gram-positive and gram-negative next examined in the contexts of molecular function, bio- pathogens and opportunistic pathogens. logical process, and pathway membership. Each of clusters 1 Polarized 16HBE14O- cells were stimulated with S. saliva- through 8 was subjected to the “compare gene lists” tool at rius K12, S. aureus, P. aeruginosa, or Salmonella serovar Typhi- the PANTHER database site (30). The lists were compared murium for 1 h. Over this period, S. salivarius K12 did not grow to the NCBI Homo sapiens genes reference set, without the significantly but adhered efficiently to the epithelial cells, and Bonferroni correction. Functions and processes were noted many remained associated with the cells following stringent as overrepresented in a particular cluster if the analysis washing with phosphate-buffered saline (data not shown). Ex- returned a P value equal to or less than 0.01 and if at least tracted RNA was used to probe human 21K oligonucleotide- two genes annotated with that function/process were found based DNA microarrays. Statistically significantly differentially in the cluster. Overrepresented function and process terms expressed genes, with a change of at least 1.5-fold and a Stu- are shown in Table 3. dent t test P value of Յ0.06, were extracted using the Web- In the S. salivarius experiment, uniquely upregulated genes based analysis tool ArrayPipe (18). appeared to be involved primarily in homeostatic activities and A total of 1,530 unique genes were differentially expressed are perhaps critical to maintaining the commensal host-mi- under one or more conditions. A list of these genes, including crobe interaction. Overrepresented homeostatic functions in- accession numbers, descriptions, levels of change, and P val- cluded transcription and translation, protein trafficking, and ues, is provided in the supplemental material. VENNY (36) exocytosis, as well as nucleoside and phosphate metabolism. was used to create a Venn diagram (Fig. 1) illustrating the No such increase in a homeostatic response was evident in VOL. 76, 2008 HOST GENE REGULATION BY THE COMMENSAL S. SALIVARIUS 4167
TABLE 2. qPCR validation of array expression data in response to Streptococcus salivarius K12 and Pseudomonas aeruginosaa
qPCR fold Array fold Gene name (function) Organism P value P value change Ϯ SD change HAMP (iron metabolism) S. salivarius 2.0 Ϯ 0.7 Ͻ0.01 2.1 0.03 P. aeruginosa 1.0 Ϯ 0.6 0.68 1.1 0.9
FRDA (iron metabolism) S. salivarius 2.0 Ϯ 0.5 Ͻ0.01 3.1 0.05 P. aeruginosa 1 Ϯ 0.5 0.35 Ϫ1.2 0.34
PKIG (protein kinase activity) S. salivarius 2.3 Ϯ 0.8 0.02 4.8 Ͻ0.01 P. aeruginosa 1.4 Ϯ 0.6 0.11 1.2 0.19
DUSP14 (protein kinase activity) S. salivarius 2.1 Ϯ 0.4 0.03 6.4 0.01 P. aeruginosa 0.9 Ϯ 0.3 0.07 1.9 0.02
TRIP4 (immune activities) S. salivarius 3 Ϯ 1.0 Ͻ0.01 2.0 0.00 P. aeruginosa 1.1 Ϯ 0.5 0.81 1.1 0.3
IL1RL1 (receptor signaling activity) S. salivarius 2.0 Ϯ 0.6 Ͻ0.01 2.1 0.05 P. aeruginosa 1.1 Ϯ 0.2 0.69 1.1 0.64
RBP1 (isoprenoid metabolism) S. salivarius 3.4 Ϯ 0.3 Ͻ0.01 6.3 0.01 Ϯ P. aeruginosa 1.3 0.4 0.46 1.7 0.09 Downloaded from
TMOD4 (actin filament-based process) S. salivarius 2.2 Ϯ 0.6 Ͻ0.01 7.6 0.02 P. aeruginosa 1.5 Ϯ 0.7 0.96 1.8 0.17
IL-8 (inflammation) S. salivarius 1.1 Ϯ 0.2 0.75 1.6 0.07 P. aeruginosa 3.0 Ϯ 1.2 Ͻ0.01 4.6 Ͻ0.01 iai.asm.org IL-6 (inflammation) S. salivarius 1.2 Ϯ 0.3 0.96 Ϫ1.1 0.89 P. aeruginosa 2.4 Ϯ 0.9 Ͻ0.01 2.3 Ͻ0.01
a Genes with significant differential expression in response to S. salivarius were chosen for validation by qRT-PCR. These data were compared with gene expression
in response to P. aeruginosa. The qPCR and array data presented are the results of a minimum of three biological repeats and two technical repeats. A two-tail- by guest on August 26, 2008 distribution unpaired Student t test was performed; the P values for the array and qPCR analysis are indicated.
responses to the other three bacteria studied. A large number Salmonella serovar Typhimurium, 21/24 in S. aureus, and 16/23 of transcription factors were also upregulated by the commen- in P. aeruginosa). A similar trend was observed when transcrip- sal bacterium. Downregulated genes included several genes tion factors were examined. In S. salivarius, 44 transcription implicated in cytoskeleton-related functions. Together with the factors were upregulated versus nine that were downregulated. upregulated cytoskeleton-related genes in cluster 1, this may In the other three organisms, the numbers of up- and down- indicate a remodeling of the epithelium in response to S. sali- regulated transcription factors were roughly equivalent (15 varius that promotes a commensal interaction at the epithelial up/16 down, 16 up/14 down, 15 up/15 down in Salmonella surface. Upon closer examination, a downregulation of several serovar Typhimurium, S. aureus, and P. aeruginosa, respec- adhesin genes was noted in both the Salmonella serovar Ty- tively). Finally, when cytoskeletal and cytoskeleton-related on- phimurium and P. aeruginosa experiments, which may be re- tologies (e.g., actin, microtubule, and cell structure, etc.) were lated to a sloughing response in which the epithelium is desta- grouped together, S. salivarius exposure led to the upregula- bilized in order to shed pathogenic bacteria. tion of 29 cytoskeletal genes and the downregulation of only Because overrepresentation analysis may miss important 14, and P. aeruginosa exposure led to the up- and downregu- trends, molecular functions and biological processes were ex- lation of 12 and 6 genes, respectively. Salmonella serovar Ty- amined more closely. A high-level functional annotation was phimurium and S. aureus, however, showed markedly different assigned to each gene by manually inspecting its PANTHER patterns (14 up/13 down and 9 up/10 down, respectively). ontologies. For example, genes directly annotated with adhe- Overrepresented-pathway analysis of differentially ex- sion ontologies as well as those with adhesion-like ontologies pressed genes. A similar analysis was then performed using the (e.g., tight junction, extracellular matrix, and cadherin) were PANTHER pathway ontology; however, the significance combined into a larger group annotated simply as “adhesion.” threshold was raised to a P of Յ0.05. The only pathway When functions were examined from this broader perspective, overrepresented in upregulated S. salivarius genes was the several interesting trends emerged. nicotinic acetylcholine signaling pathway, which was, interest- One hundred two genes were noted as having an adhesion- ingly, overrepresented in downregulated P. aeruginosa genes. related function. In cells exposed to S. salivarius, 45 of these Downregulated S. salivarius genes were also enriched for the genes were differentially expressed: 23 were upregulated and proapoptotic Fas signaling and transforming growth factor  12 were downregulated. In the other three organisms, however, pathways, all of which suggest an attenuation of inflammation the majority of adhesion genes were downregulated (28/37 in in response to the commensal bacterium. 4168 COSSEAU ET AL. INFECT.IMMUN.
TABLE 3. Selected overrepresented PANTHER molecular functions and biological processes in clusters 1 to 8b
Cluster Organism and regulationa Molecular function(s) Biological processes Pathway(s) 1 Streptococcus salivarius1 Other G protein modulator, mRNA transcription, exocytosis, Nicotinic acetylcholine receptor transcription factor, actin- transport, phosphate signaling binding cytoskeletal metabolism, segment protein, helicase, lyase, specification, other chaperones neurotransmitter release, muscle contraction 2 Streptococcus salivarius2 Serine/threonine protein Signal transduction, cell TGF- signaling, FAS signaling, kinase, cytoskeletal structure and motility, cell G protein signaling, protein, double-stranded adhesion, transport, cell presenilin, P53 by glucose DNA binding protein proliferation and deprivation, ATP synthesis differentiation, phospholipid metabolism, developmental processes, natural killer cell- mediated immunity 3 Salmonella serovar Typhimurium1 None at a P of Ͻ0.01 Inhibition of apoptosis, Inflammation, apoptosis developmental processes, cell signaling, Toll receptor structure and motility, signaling, Ras, integrin nitrogen metabolism, cell signaling,
proliferation and insulin/IGF-MAPKK/MAPK, Downloaded from differentiation angiotensin II-stimulated signaling, EGF receptor signaling 4 Salmonella serovar Typhimurium2 Cadherin receptor G Cell adhesion, developmental Cadherin signaling, G protein protein modulator processes, G protein- signaling, Wnt signaling, axon mediated signaling, guidance mediated by
neurogenesis vasoconstriction/ semaphorins, inflammation, iai.asm.org dilation Parkinson’s disease, histamine H1 receptor-mediated signaling, methylcitrate cycle 5 Staphylococcus aureus1 None at a P of Ͻ0.01 mRNA transcriptional Ras, oxidative-stress response, regulation EGF receptor signaling, by guest on August 26, 2008 apoptosis signaling, B-cell activation, T-cell activation 6 Staphylococcus aureus2 Immunoglobulin receptor Cell surface receptor-mediated Blood coagulation, lipoate family, defense/immunity signal transduction, neuronal biosynthesis protein, serine protease activities inhibitor, extracellular matrix, apolipoprotein 7 Pseudomonas aeruginosa1 Receptor, chemokine, JNK cascade, macrophage- Apoptosis signaling, interleukin cytokine, basic helix-loop- mediated immunity, NF-B signaling, oxidative-stress helix transcription factor, cascade, apoptosis, cell response, blood coagulation, interleukin proliferation and Wnt signaling, angiogenesis, differentiation, cytokine- and presenilin, PDGF signaling, chemokine-mediated signaling VEGF signaling pathway, calcium-mediated signaling, granulocyte- mediated immunity, T-cell- mediated protein phosphorylation, MAPKKK cascade, homeostasis 8 Pseudomonas aeruginosa2 Extracellular matrix, Signal transduction, cell Cadherin signaling, Wnt cadherin, guanyl- adhesion, developmental signaling, nicotinic nucleotide exchange processes, transport, neuronal acetylcholine receptor factor, voltage-gated activities signaling, muscarinic potassium channel, acetylcholine receptor 2 and 4 acetylcholine receptor, signaling, endogenous ion channel cannabinoid signaling, 5-hydroxytryptamine biosynthesis, metabotropic glutamate receptor group ii, presenilin, G protein signaling
a 1 signifies that genes in this cluster were upregulated;2 signifies that genes in this cluster were downregulated. b EGF, epidermal growth factor; IGF, insulin-like growth factor; JNK, Jun N-terminal kinase; MAPKKK, MAPK kinase kinase; TGF, transforming growth factor; VEGF, vascular endothelial growth factor. VOL. 76, 2008 HOST GENE REGULATION BY THE COMMENSAL S. SALIVARIUS 4169
In contrast, the genes upregulated by the three pathogenic upregulated in response to the two gram-negative pathogens. bacteria all showed an overrepresentation of proapoptotic The IL-10 receptor IL10RA was downregulated in two of the pathways, inflammatory pathways, the oxidative stress re- pathogens, indicating a potential dampening of IL-10’s anti- sponse, and platelet-derived growth factor (PDGF) signal- inflammatory effects. Interestingly, all three pathogens caused ing. The Wnt signaling pathway, which may play a role in cell the downregulation of the gamma interferon receptor adhesion, was frequently found among downregulated patho- IFNGR1, which Mycobacterium tuberculosis has previously gen genes, which is again consistent with an increase in epi- been shown to downregulate as an immune evasion strategy thelial sloughing in response to pathogenic organisms. (45). Immune functions among differentially expressed genes. Alteration of the interferon signaling pathway. Because The unique differentially expressed genes were next compared many pathway databases such as PANTHER are incomplete, to the InnateDB nonredundantly curated list of 5,570 genes pathway overrepresentation analysis can miss important known to be involved in the immune response. Of the 1,530 trends. Many pathways are missing (PANTHER, for example, unique differentially expressed genes, 495 were noted as play- lists gamma interferon signaling but not alpha or beta inter- ing a role in immunity (see the supplemental material). The feron), and many are missing key genes/proteins. Therefore, proportions of up- and downregulated immune genes under certain pathways that were initially not reported as being sig- each condition were similar to the proportions among all nificantly overrepresented in our analysis were examined in genes, with the exception of the P. aeruginosa stimulation greater detail to determine whether they were being signifi- genes, of which more immune genes were upregulated than cantly differentially expressed in response to S. salivarius. downregulated. Of the pathways examined in greater detail in this fashion,
Notably, no cytokines or chemokines were upregulated in one—the unified interferon signaling pathway (including al- Downloaded from response to S. salivarius, although the cytokine receptor CCR1 pha, beta, and gamma interferon signaling)—jumped from a P was upregulated. Uniquely upregulated immune gene products value of Ͼ0.05 to P value of 1.49EϪ05, making it the most in S. salivarius-stimulated 16HBE14O- cells included the al- significantly overrepresented pathway in the data set. pha-2-macroglobulin homolog A2ML1, which acts as an extra- In this pathway (Fig. 2), type I or type II interferons signal cellular protease inhibitor, potentially indicating a proactive through their receptors via JAK1 and TYK2. STAT1 and -2
response to pathogen-secreted proteases, and whose homolog are recruited, which together with IRF9, leads to the expres- iai.asm.org has also been shown to be important for the transport of sion of genes downstream of interferon stimulated response cytokines; the apoptotic protection factor BNIP1; the epider- elements. Other branches of the system exist, including (i) a mal growth factor receptor, which has been shown to nega- branch that leads from JAK1/TYK2 to the p38 pathway, with tively regulate TLR2 expression in epithelial cells, thereby MAP3K1, MAP2K3, and MAP2K6 as intermediates, and (ii) a by guest on August 26, 2008 attenuating the immune response (31); the hepcidin antimi- branch in which STAT5 is phosphorylated and binds CRKL, crobial peptide (HAMP); the anti-inflammatory alpha inter- both of which are translocated to the nucleus, where they feron IFNA2, as well as IRF9, an alpha interferon-responsive induce the expression of genes downstream of gamma inter- transcription factor important in the antiviral response; LY96, feron activated site elements (37). In response to S. salivarius, required for TLR4 responsiveness to LPS (44); MAP4K4, a 16HBE14O- cells upregulated the expression of several of kinase encoded upstream of several pathways, including those these genes (IFNA2, TYK2, MAP3K1, CRKL, IRF9). Fur- of Jun N-terminal protein kinase and extracellular signal-reg- thermore, the p38 pathway activated by type I interferon sig- ulated kinase (ERK); MAST2 (MAST205), an inhibitor of naling is known to result in the activation of a number of NF-B (51); the transcription factor NFE2 (NRF2), which is transcription factors, including CREB, the binding sites for known to activate a variety of antioxidant genes (40) (reactive which were significantly overrepresented in S. salivarius-re- oxygen species are known activators of the proinflammatory sponsive genes (see Discussion). Through the p38 pathway, NF-B pathway, and thus NFE2’s activity may extend to inhi- genes with antiviral and cytokine modulation properties are bition of this proinflammatory pathway); NUAK1 (ARK5), activated (37), while genes regulated by interferon stimulated protective against apoptosis (46); SKIL (SNON), an enhancer response element and gamma interferon activated site regions of TGFB1 signaling (41); TNFRSF6B (tumor necrosis factor are overwhelmingly skewed toward host defense. decoy receptor 3), which protects cells against Fas- and Immediate early gene expression is often controlled by cyclic LIGHT-mediated apoptosis (17); and TYK2, required for al- AMP (cAMP)-dependent protein kinase A (PKA) signaling, pha interferon signaling (32). which results in the transcription of CREB-responsive genes. Notably, downregulated genes included the immunoglobulin S. salivarius not only stimulated the expression of several of and Fc receptors FCAR and FCRLB; the cytokines and cyto- these CREB-responsive genes but also upregulated the expres- kine receptor CXCL14, IL-26, and ILRL1; and TRAF3IP2, a sion of protein kinase inhibitor G, an inhibitor of PKA signal- known activator of NF-B signaling (28). ing that can rapidly turn off the expression of these genes (6). Genes that were not differentially expressed in response to Transcription factor binding site analysis. By examining the S. salivarius but were altered under two or more of the other transcription factor binding sites present in the upstream re- conditions were also examined. CFLAR was upregulated in gions of the differentially expressed genes, the potential path- response to both Salmonella and Staphylococcus; it has been ways governing these changes in expression could be inferred. shown to activate the NF-B pathway (23) and, when overex- Promoter regions of the differentially expressed genes were pressed, leads to the repression of Fas-mediated apoptosis in submitted to oPOSSUM (21), which identifies overrepresented macrophages and a potential increase in inflammation. CCL20 transcription factor binding sites in these regions using the (MIP3-alpha), a potent dendritic cell chemoattractant, was vertebrate profiles from the JASPAR database (3). Default 4170 COSSEAU ET AL. INFECT.IMMUN. Downloaded from
FIG. 2. Impact of S. salivarius on interferon signaling pathways. Underlined genes were upregulated by S. salivarius K12 alone. IFNA/B, alpha/beta interferon; IFNG, gamma interferon; IFNAR, alpha interferon receptor; IFNGR, gamma interferon receptor; ISRE, interferon stimulated response element; GAS, gamma interferon activated site; GEF, guanine nucleoside exchange factor; CRKL, CRK-like protein. iai.asm.org parameters were used to search the regions 500 bp upstream that the bacterium caused no extracellular breakdown of the from the transcription start sites. The top 10 overrepresented cytokine (data not shown), confirming that the observed transcription factor binding sites according to both the Z-score changes in levels of IL-8 are due to the suppression of by guest on August 26, 2008 and Fisher score were retrieved, duplicates were removed, and secretion. the resulting list is shown in Table 4. Attenuation by S. salivarius of IL-8 secretion induced in Strikingly, binding sites for the NF-B family of transcrip- 16HBE14O- cells by infl ammatory mediators.The ability of S. tion factors were found to be overrepresented in two of the salivarius K12 to attenuate proinflammatory responses induced three pathogen-stimulated gene sets yet not in the genes dif- by factors known to induce IL-8 secretion by epithelial cells, ferentially expressed in response to S. salivarius, indicating that namely, P. aeruginosa cells, endotoxin, flagellin, and LL-37, was pathways converging on NF-B were either not active or lim- next examined. Flagellin and LPS did not adversely affect the ited in their activity in response to the commensal bacterium, 16HBE14O- cells, while P. aeruginosa and LL-37 exerted some again contributing to the anti-inflammatory properties of S. cytotoxic effects, as indicated by measuring LDH release from salivarius. cells incubated with the bacteria for6horwith LL-37 for 24 h Reduction of baseline IL-8 secretion by S. salivarius K12 in (ϳ15% increase over the baseline LDH release) (data not polarized 16HBE14O- cells. A number of findings in the mi- shown). croarray analyses pointed strongly toward S. salivarius K12 P. aeruginosa induced the release of IL-8 from polarized having anti-inflammatory activities, particularly in influencing 16HBE14O- cells after6hofincubation. When S. salivarius pathways converging on NF-B. Therefore, we examined the was also included, IL-8 secretion was significantly attenuated ability of this organism to modulate the inflammatory response (P Ͻ 0.002) (Fig. 3D). Bacterial flagellin and LPS have been in the human bronchial epithelial cell line 16HBE14O-. IL-8 shown to be especially immunostimulatory, causing the up- secretion was analyzed, as this chemokine is one of the major regulation and secretion of IL-8 through interactions with mediators of the inflammatory responses of several cell types, TLR5 and TLR4, respectively (43). Salmonella serovar Typhi- functioning to recruit neutrophils to the site of infection. S. murium flagellin (0.5 g/ml and 1 g/ml), applied to the apical salivarius had no cytotoxic effects on 16HBE14O- cells, as surfaces of polarized 16HBE14O- cells for 5 h, stimulated IL-8 indicated by measuring LDH release from cells incubated with secretion in a dose-dependent manner compared with what the bacteria for up to 48 h (data not shown). S. salivarius K12 occurred with nonstimulated cells. This secretion was signifi- exerted an anti-inflammatory effect on the epithelium by sig- cantly attenuated (P Ͻ 0.001) in the presence of S. salivarius nificantly downregulating the secretion of IL-8. Basal IL-8 se- K12 (Fig. 3E); when increases above the basal levels of IL-8 cretion of S. salivarius K12-infected epithelia was reduced to secretion are considered, then K12 reduced P. aeruginosa-in- 40% compared to that of uninfected epithelia after 6 h of duced IL-8 secretion by 62% and secretion induced by 1.0 incubation (Fig. 3D) and to 55% and 82% of the baseline level g/ml flagellin was suppressed by 75%. P. aeruginosa LPS did after 24 and 48 h of coincubation, respectively (Fig. 3A and B). not induce the release of IL-8 from the 16HBE14O- cell line Coincubation of IL-8 protein with S. salivarius K12 indicated (data not shown), a response typical of epithelial cells. VOL. 76, 2008 HOST GENE REGULATION BY THE COMMENSAL S. SALIVARIUS 4171
TABLE 4. Most overrepresented transcription factor binding sites 25 g/ml LL37 was reduced by more than 80% after 24 h and a in the promoter regions of the differentially expressed genes 48 h of incubation in the presence of S. salivarius K12. Simi- Organism TFBS Z-score larly, K12 caused 70% (24 h) and 80% (48 h) suppression of IL-8 secretion above basal levels when cells were stimulated S. salivarius CREB1 5.84 with 40 g/ml LL37. Evi1 18.7 FOXI1 6.45 Attenuation by S. salivarius of IL-8 secretion induced in Foxq1 8.35 primary normal human bronchial epithelial cells and primary MEF2A 5.53 keratinocytes by P. aeruginosa. P. aeruginosa PAK stimulated NHLH1 5.23 pnHBE cells to secrete 318 pg/ml (over baseline secretion) RXR-VDR 9.50 Sox5 6.47 IL-8. This response was entirely due to flagellin, as a fliC- SRY 9.29 negative mutant strain did not induce IL-8 secretion at all. When S. salivarius was also included, IL-8 secretion was re- Salmonella serovar E2F1 7.33 duced to only 5.1 pg/ml (Fig. 4A). This result indicates that S. Typhimurium FOXF2 5.55 salivarius exerted a considerable anti-inflammatory effect on Myf 4.24 NF-B 7.10 the pnHBE cells. Similar experiments performed on primary NFKB1 5.90 keratinocytes also demonstrated that S. salivarius downregu- REL 5.05 lated IL-8 secretion in response to PAK and flagellin (Fig. 4B), RELA 8.80 further indicating that this phenomenon occurs in multiple Staf 5.28 epithelial cell types. ␣ S. aureus Foxd3 7.56 Attenuation by S. salivarius of 16HBE14O- cell Gro secre- Downloaded from Gfi 9.463 tion induced by fl agellin.Gro␣ (CXCL1) is an inducible neu- HNF1A 9.38 trophil chemotactic factor synthesized in epithelial tissues dur- Lhx3 6.921 ing inflammation. This chemokine was first identified as a Nkx2-5 11.97 NKX3-1 5.597 melanoma growth-stimulatory factor and has further been Prrx2 7.153 shown to stimulate a number of biological responses, including
RORA 10.54 chemotaxis, angiogenesis, and growth regulation. Flagellin iai.asm.org Sox5 8.026 stimulated the release of Gro␣ from 16HBE14O- cells. Coin- TBP 7.152 Foxd3 7.56 cubation of 16HBE14O- with flagellin and the NF- B inhibitor Bay 11-7085 reduced the secretion of Gro␣ to below the back- P. aeruginosa Foxa2 9.56 ground level, demonstrating that Gro␣ production is induced by guest on August 26, 2008 Foxd3 10.2 in 16HBE14O- cells in response to flagellin in an NF-B- FOXI1 10.3 dependent manner (Fig. 5). Coincubation of flagellin with S. Gfi 10.3 ␣ MEF2A 8.26 salivarius K12 attenuated Gro secretion by 56%, thus indi- NF-B 3.69 cating the ability of S. salivarius to inhibit the NF-B pathway Nkx2-5 9.26 (Fig. 5). Pax4 24.3 S. salivarius inhibited NF-B P65 subunit translocation into REL 6.30 RXR-VDR 7.58 the nucleus. pnHBE14 stimulation with flagellin (1 g/ml) for Sox5 8.62 30 min induced the translocation of the P65 subunit of NF-B SRF 6.53 into the nucleus, further confirming the proinflammatory effect SRY 9.07 of this TLR agonist. The addition of S. salivarius alone to a Transcription factor binding sites (TFBS) in bold were unique to that par- pnHBE cells resulted in no nuclear translocation of the sub- ticular experimental condition. NF-B and its subunits are underlined. A Z-score unit, and K12 greatly reduced flagellin-induced P65 transloca- of greater than 5 is considered to be statistically significant. For P. aeruginosa, NF-B was also included, since an alternative statistical test (Fisher’s exact test) tion (Fig. 6). This confirms the ability of S. salivarius K12 to suggested a P value of 0.036. inhibit the activation of the NF-B pathway.
DISCUSSION Human cathelicidin LL-37, a cationic host defense peptide expressed primarily by neutrophils and epithelial cells, is up- The ability of epithelial cells to sense the external environ- regulated under conditions of inflammation and is a known ment and communicate this information to the local immune immunomodulatory peptide that leads to the upregulation of system, thereby initiating appropriate responses, is essential chemokines while suppressing the expression of most proin- for the maintenance of health and prevention of the develop- flammatory cytokines (33). When added with S. salivarius to ment of chronic inflammatory diseases. Our studies have 16HBE14O- cell supernatants, LL-37 delayed the exponential- shown that an oral probiotic commensal strain of S. salivarius phase growth of the bacteria but did not kill them (Fig. 3C). As is able to inhibit inflammatory responses in human bronchial previously demonstrated (2), the addition of 25 and 40 g/ml epithelial cells by downregulating the NF-B pathway. This is LL-37 alone to 16HBE14O- cells for 24 and 48 h stimulated consistent with an emerging paradigm that indicates the down- IL-8 release from these cells in a dose-dependent manner (Fig. regulation of epithelial immune responses by commensal bac- 3A and B). S. salivarius significantly attenuated LL-37-medi- teria (8, 13, 24, 38, 48). Not only did S. salivarius K12 inhibit ated IL-8 secretion (Fig. 3). When increases above the basal baseline synthesis of IL-8, but it also suppressed IL-8 secretion levels of IL-8 secretion are considered, then IL-8 induction by when cells were stimulated with pathogenic P. aeruginosa, Sal- 4172 COSSEAU ET AL. INFECT.IMMUN. Downloaded from iai.asm.org by guest on August 26, 2008
FIG. 3. Streptococcus salivarius K12 downregulates IL-8 release from human bronchial epithelial cells (16HBE14O-) in response to LL-37, Pseudomonas aeruginosa, endotoxin, and flagellin. IL-8 release from 16HBE14O- cells was monitored after incubation with LL-37 (A and B), with P. aeruginosa (D), and with flagellin (E) in the presence (black bars) or absence (gray bars) of S. salivarius (MOI, 50). LL-37 was incubated with cells for either 24 h (A) or 48 h (B). Growth properties of S. salivarius on 16HBE14O- cells in the presence of LL-37 (25 and 40 g/ml) was monitored (C). P. aeruginosa (MOI, 50) was incubated with cells for 6 h. S. salivarius was incubated for 2 h before flagellin (0.5 and 1 g/ml) was added and further incubated for 5 h (7 h of total incubation). The data are the result of a minimum of three biological repeats and two technical repeats. A two-tail-distribution, unpaired Student t test was performed (**,PϽ 0.01; *, P Ͻ 0.05). OD600, optical density at 600 nm.
monella serovar Typhimurium flagellin, or the immunomodu- latory host defense peptide LL-37. Most previous studies have focused on IL-8 and IL-6 responses, but here it was demon- strated that this commensal bacterium was able to attenuate Gro␣ secretion, consistent with the gene expression data of Tien et al. (48). Functional genomic analyses further identified a role for S. salivarius K12 in the specific modulation of genes associated with innate response pathways as well as general epithelial cell function and homeostasis. This may help to ex- plain the beneficial probiotic activities of S. salivarius K12 and its potential role in the maintenance of host-microbe ho- FIG. 4. Streptococcus salivarius downregulates IL-8 secretion from primary normal human bronchial epithelial cells and primary keratino- meostasis. cytes. IL-8 release from pnHBE cells (A) or primary keratinocytes (B) was The IL-8 secretion pathways activated by the stimuli em- monitored after incubation with P. aeruginosa PAK, the PAK fliC-nega- ployed in this study have been characterized. LL-37-induced tive mutant, or flagellin (1 g/ml) in the presence (black bars) or absence IL-8 production in 16HBE14O- cells is mediated through the (gray bars) of S. salivarius K12. Conditions were as follows: S. salivarius was added to the cells at the same time as P. aeruginosa (MOI, 50:1) or phosphorylation and activation of the mitogen-activated pro- flagellin, and the cells were incubated for 6 h. **, P Ͻ 0.01. tein kinases (MAPKs) ERK1/2 and p38 (2). P. aeruginosa LPS, VOL. 76, 2008 HOST GENE REGULATION BY THE COMMENSAL S. SALIVARIUS 4173
FIG. 6. S. salivarius inhibits NF-B P65 subunit translocation into FIG. 5. Streptococcus salivarius K12 downregulates Gro␣ release the nucleus. Western blotting of P65 NF-B subunits was performed from human bronchial epithelial (16HBE14O-) cells in response to with nuclear extracts of 16HBE14O- cells following their incubation flagellin by inhibiting the NF-B signaling pathway. Gro␣ release from with 1 g/ml flagellin or S. salivarius (MOI, 50:1) or with S. salivarius 16HBE14O- cells was monitored after they were incubated with flagel- (MOI, 50:1) plus 1 g/ml flagellin. Reaction with antibody against lin (1 g/ml) and compared with the level in the control. 16HBE14O- histone H2AX was used as a loading control. Results are representa- cells were incubated with S. salivarius (MOI, 50) (black bars), with the tive of three independent experiments. NF-B inhibitor Bay 11-7085 (40 M) (hatched bars), or nothing (gray bars). Conditions were as follows. S. salivarius was added to the epi- thelial cells 2 h prior to the addition of flagellin (0.5 and 1 g/ml) and incubated for 24 h (26 h of total incubation). The NF-B inhibitor Bay 11-7085 (40 M) was added to the epithelial cells 30 min prior to the commensal organism. This comparative analysis confirmed the addition of flagellin, and then the cells were incubated for 24 h. **, P Ͻ immunosuppressive properties of S. salivarius K12 toward 0.01; , P Ͻ 0.05. * genes stimulated through the NF- B signaling pathway, in that Downloaded from NF-B binding sites were overrepresented in the promoter regions of pathogen-modulated genes but not in those modu- pilin, flagellin, peptidoglycan, and virulence factors have been lated by the commensal S. salivarius, even though this com- shown to activate MAP kinases (p38 and ERK1/2) and the mensal contains such TLR agonists as lipoteichoic acid, pep- NF-B pathway to induce IL-8 secretion (14, 49, 50, 53). We tidoglycan, and CpG DNA.
further showed that flagellin stimulates Gro␣ release from The nicotinic acetylcholine pathway was also overrepre- iai.asm.org 16HBE14O- cells through NF-B activation and that this re- sented in S. salivarius-treated cells but not in pathogen-treated sponse was attenuated in the presence of S. salivarius. Our cells. This pathway has been noted for its anti-inflammatory demonstration (Fig. 6) that S. salivarius K12 likely exerted its potential, mediated through the suppression of IB phos- anti-inflammatory effects through inhibiting NF-B activation phorylation and subsequent inhibition of NF-B-induced by guest on August 26, 2008 in 16HBE14O- human bronchial epithelial cells is consistent transcription (52). CREB binding sites were significantly over- with the results of analogous studies of another commensal in represented in S. salivarius-responsive genes but not in patho- human colon adenocarcinoma cells (HT29) (11). gen-treated cells; CREB is a transcription factor whose activity To emphasize the very different nature of the response elic- has been related to anti-inflammatory properties (10). Innat- ited by this commensal, we compared the patterns of global eDB was further used to identify immune functions among transcriptional responses of epithelial cells stimulated with S. differentially expressed genes. S. salivarius is able to modulate salivarius with responses elicited by selected gram-positive and the expression of regulators central to multiple innate response gram-negative pathogens. Only a limited number of studies pathways. Notably, the most broadly affected pathway was the have examined transcriptional responses to commensal organ- interferon signaling system. The IFN pathway is recognized as isms (16, 19), but comparisons with pathogens were retrospec- a central mediator of the immune response, with pleiotropic tive rather than done in parallel. Comparison of two analyses properties such as antiviral and antitumor activities, the acti- by the same group indicated that the commensals Streptococcus vation of microbicidal effector functions, leukocyte trafficking, gordonii and Fusobacterium nucleatum (16) promoted a more priming of the LPS response, and anti-inflammatory effects restrained response than the periodontopathogens Porphy- (42). Our analyses, consistent with direct measurements of romonas gingivalis and Aggregatibacter actinomycetemcomitans secreted cytokines, also indicated that S. salivarius K12 did not (15). However, both P. gingivalis and A. actinomycetemcomi- initiate the synthesis of proinflammatory cytokines or chemo- tans (except the JP2 clone) are opportunistic, rather than kines, nor did the organism regulate genes involved in re- frank, pathogens in the mouth, as they resemble commensals sponses to such molecules. This absence of induced cytokine in their genetic diversity, acquisition, and population structures host responses to probiotic bacteria was also reported in a (25). Unlike with these studies, it was demonstrated here that study comparing the cytokine expression profiles elicited by the S. salivarius K12 induced widespread and quite different alter- probiotic bacteria Bifi dobacterium infantis 35624 and Lactoba- ations in gene expression from those induced by the tested cillus salivarius to responses elicited by Salmonella serovar Ty- pathogens and opportunistic pathogens in regulating the ex- phimurium UK1 (35). pression of 660 genes, of which 565 were specifically regulated Other oral commensal strains have been shown to differen- by this commensal bacterium. It was observed that larger num- tially induce or repress cytokine release in oral keratinocytes bers of S. salivarius K12 than of P. aeruginosa bacteria re- (16, 26), thus indicating that commensal organisms can have mained associated with the 16HBE14O- cells, and this may in different impacts on the immune responses in host cells. This part have contributed to the more extensive gene expression underlines the complex and dynamic host response that may changes observed. However, this observation also underlines result from interaction with a complex bacterial community as the noninflammatory nature of the immune response to this it occurs in vivo. Our recent data (unpublished) indicate that 4174 COSSEAU ET AL. INFECT.IMMUN. many commensal streptococci isolated from the tongue are, REFERENCES like S. salivarius K12, capable of suppressing the immune re- 1. Aas, J. A., B. J. Paster, L. N. Stokes, I. Olsen, and F. E. Dewhirst. 2005. sponses of epithelial cells, further emphasizing that this as a Defining the normal bacterial flora of the oral cavity. J. Clin. Microbiol. 43:5721–5732. significant phenomenon that may contribute to host-microbe 2. Bowdish, D. M., D. J. Davidson, D. P. Speert, and R. E. W. Hancock. 2004. homeostasis and that it is not just a property of a few well- The human cationic peptide LL-37 induces activation of the extracellular signal-regulated kinase and p38 kinase pathways in primary human mono- studied commensal or probiotic bacteria. The phenomenon is cytes. J. Immunol. 172:3758–3765. also not unique to the responses of the 16HBE14O- cell line, 3. Bryne, J. C., E. Valen, M. H. Tang, T. Marstrand, O. Winther, I. da Piedade, as we observed similar effects on primary bronchial epithelial A. Krogh, B. Lenhard, and A. Sandelin. 2007. JASPAR, the open access database of transcription factor-binding profiles: new content and tools in cells and primary keratinocytes, and our recent data demon- the 2008 update. Nucleic Acids Res. doi:10.1093/nar/gkm955. strated the same effect on the responses of a dysplastic oral 4. Burton, J. P., C. N. Chilcott, C. J. Moore, G. Speiser, and J. R. Tagg. 2006. A preliminary study of the effect of probiotic Streptococcus salivarius K12 on keratinocyte cell line derived from the tongue. 16HBE14O- oral malodour parameters. J. Appl. Microbiol. 100:754–764. cells therefore represent a well-characterized, consistent, and 5. Cebra, J. J. 1999. Influences of microbiota on intestinal immune system robust model of the responses of epithelial cells to bacteria development. J. Immunol. 69:1046S–1051S. 6. Chen, X., J. C. Dai, S. A. Orellana, and E. M. Greenfield. 2005. Endogenous that are isolated from a variety of anatomical sites (ranging protein kinase inhibitor gamma terminates immediate-early gene expression from the mouth and skin to the respiratory tract and intestine). induced by cAMP-dependent protein kinase (PKA) signaling: termination depends on PKA inactivation rather than PKA export from the nucleus. In addition to modulating immune and innate defense re- J. Biol. Chem. 280:2700–2707. sponses, analysis of gene clusters further identified a role for S. 7. Chung W. O., and B. A. Dale. 2004. Innate immune response of oral and salivarius K12 in the specific modulation of genes associated foreskin keratinocytes: utilization of different signaling pathways by various bacterial species. Infect. Immun. 72:352–358. with homeostatic functions such as transcription and transla- 8. Collier-Hyams, L. S., V. Sloane, B. C. Batten, and A. S. Neish. 2005. Cutting tion, protein trafficking and exocytosis, and nucleoside and edge: bacterial modulation of epithelial signaling via changes in neddylation Downloaded from phosphate metabolism. A significant effect on genes with ad- of cullin-1. J. Immunol. 175:4194–4198. 9. Darveau, R. P., and R. E. W. Hancock. 1983. Procedure for isolation of hesion and cytoskeleton-related functions was specifically ob- bacterial lipopolysaccharides from both smooth and rough Pseudomonas served in response to S. salivarius K12. These observations aeruginosa and Salmonella typhimurium strains. J. Bacteriol. 155:831–838. 10. Fraser, D. A., M. Arora, S. S. Bohlson, E. Lozano, and A. J. Tenner. 2007. indicate that this organism exerts a significant effect on the Generation of inhibitory NFkappaB complexes and phosphorylated cAMP adhesive and structural properties of 16HBE14O- cells, a re- response element-binding protein correlates with the anti-inflammatory ac- sponse that may act to strengthen the interactions between tivity of complement protein C1q in human monocytes. J. Biol. Chem. iai.asm.org 282:7360–7367. commensals and the host and may help in maintaining tight 11. Frick, J. S., K. Fink, F. Kahl, M. J. Niemiec, M. Quitadamo, K. Schenk, and junctions of cells on epithelial surfaces. I. B. Autenrieth. 2007. Identification of commensal bacterial strains that modulate Yersinia enterocolitica and dextran sodium sulfate-induced inflam- Therefore, we suggest that the commensal and probiotic matory responses: implications for the development of probiotics. Infect. by guest on August 26, 2008 behaviors of S. salivarius K12 may be due to the organism Immun. 75:3490–3497. eliciting, in epithelial cells, (i) a response that is not proinflam- 12. Geier, M. S., R. N. Butler, and G. S. Howarth. 2007. Inflammatory bowel disease: current insights into pathogenesis and new therapeutic options; matory; (ii) the dysregulation of genes involved in signal trans- probiotics, prebiotics and synbiotics. Int. J. Food Microbiol. 115:1–11. duction cascades central to multiple innate response pathways 13. Grangette, C., S. Nutten, E. Palumbo, S. Morath, C. Hermann, J. Dewulf, B. Pot, T. Hartung, P. Hols, and A. Mercenier. 2005. Enhanced antiinflamma- which modulate the general defense response after interacting tory capacity of a Lactobacillus plantarum mutant synthesizing modified with microbes and immunostimulatory molecules; (iii) the reg- teichoic acids. Proc. Natl. Acad. Sci. USA 102:10321–10326. ulation of genes that mediate a downregulation of the NF-B 14. Guillot, L., S. Medjane, K. Le-Barillec, V. Balloy, C. Danel, M. Chignard, and M. Si-Tahar. 2004. Response of human pulmonary epithelial cells to pathway, resulting in the attenuation of some innate immunity lipopolysaccharide involves Toll-like receptor 4 (TLR4)-dependent signaling pathways involved in the proinflammatory responses of epithe- pathways: evidence for an intracellular compartmentalization of TLR4. J. Biol. Chem. 279:2712–2718. lial cells; and (iv) the specific modulation of genes associated 15. Handfield, M., J. J. Mans, G. Zheng, M. C. Lopez, S. Mao, A. Progulske-Fox, with general epithelial cell functions and homeostasis and ad- G. Narasimhan, H. V. Baker, and R. J. Lamont. 2005. Distinct transcrip- hesive and structural cellular properties. Through modulation tional profiles characterize oral epithelium-microbiota interactions. Cell Mi- crobiol. 7:811–823. of these physiological responses and innate defenses, we pro- 16. Hasegawa, Y., J. J. Mans, S. Mao, M. C. Lopez, H. V. Baker, M. Handfield, pose that S. salivarius K12 ensures not only that it is tolerated and R. J. Lamont. 2007. Gingival epithelial cell transcriptional responses to commensal and opportunistic oral microbial species. Infect. Immun. 75: by the host but also that it promotes cellular health and ho- 2540–2547. meostasis and may therefore protect host tissues from damage 17. Hayashi, S., Y. Miura, T. Nishiyama, M. Mitani, K. Tateishi, Y. Sakai, A. caused by other immunostimulatory cells and products. Hashiramoto, M. Kurosaka, S. Shiozawa, and M. Doita. 2007. Decoy recep- tor 3 expressed in rheumatoid synovial fibroblasts protects the cells against Fas-induced apoptosis. Arthritis Rheum. 56:1067–1075. 18. Hokamp, K., F. M. Roche, M. Acab, M. E. Rousseau, B. Kuo, D. Goode, D. ACKNOWLEDGMENTS Aeschliman, J. Bryan, L. A. Babiuk, R. E. W. Hancock, and F. S. Brinkman. 2004. ArrayPipe: a flexible processing pipeline for microarray data. Nucleic Acids Res. 32:W457–W459. We gratefully acknowledge the support of Genome BC and Genome 19. Hooper, L. V., M. H. Wong, A. Thelin, L. Hansson, P. G. Falk, and J. I. Prairie for the Pathogenomics of Innate Immunity research program. Gordon. 2001. Molecular analysis of commensal host-microbial relationships C.C. was a recipient of a CCFF (Canadian Cystic Fibrosis Foundation) in the intestine. Science 291:881–884. fellowship. D.A.D. was a recipient of funds from the Society for Gen- 20. Horz, H. P., A. Meinelt, B. Houben, and G. Conrads. 2007. Distribution and eral Microbiology, the Foundation for Canadian Studies (United King- persistence of probiotic Streptococcus salivarius K12 in the human oral cavity dom), and the Leverhulme Trust. J.L.G. was supported by the Cana- as determined by real-time quantitative polymerase chain reaction. Oral dian Institutes for Health Research, Sanofi Pasteur, and the Michael Microbiol. Immunol. 22:126–130. 21. Ho Sui, S. J., D. L. Fulton, D. J. Arenillas, A. T. Kwon, and W. W. Wasser- Smith Foundation for Health Research. R.E.W.H. was supported by a man. 2007. oPOSSUM: integrated tools for analysis of regulatory motif Canada Research Chair award. over-representation. Nucleic Acids Res. 35:W245–W252. We are grateful to Patrick Taylor for technical support and to 22. Hyink, O., P. A. Wescombe, M. Upton, N. Ragland, J. P. Burton, and J. R. Philipp Wescombe and Karsten Hokamp for assistance and advice. Tagg. 2007. Salivaricin A2 and the novel lantibiotic salivaricin B are encoded VOL. 76, 2008 HOST GENE REGULATION BY THE COMMENSAL S. SALIVARIUS 4175
by adjacent loci on a 190-kb transmissible megaplasmid in the oral probiotic Lyons, J. Bienenstock, L. O’M ahony, and F. Shanahan. 2006. Functional strain Streptococcus salivarius K12. Appl. Environ. Microbiol. 73:1107–1113. modulation of human intestinal epithelial cell responses by Bifi dobacterium 23. Kataoka, T., and J. Tschopp. 2004. N-terminal fragment of c-FLIP(L) pro- infantis and Lactobacillus salivarius. Immunology 118:202–215. cessed by caspase 8 specifically interacts with TRAF2 and induces activation 36. Oliveros, J. C. 2007. VENNY. An interactive tool for comparing lists with of the NF-B signaling pathway. Mol. Cell. Biol. 24:2627–2636. Venn Diagrams. http://bioinfogp.cnb.csic.es/tools/venny/index.html. 24. Kelly, D., J. I. Campbell, T. P. King, G. Grant, E. A. Jansson, A. G. Coutts, 37. Platanias, L. C. 2005. Mechanisms of type-I- and type-II-interferon-medi- S. Pettersson, and S. Conway. 2004. Commensal anaerobic gut bacteria ated signalling. Nat. Rev. Immunol. 5:375–386. attenuate inflammation by regulating nuclear-cytoplasmic shuttling of 38. Rakoff-Nahoum, S., J. Paglino, F. Eslami-Varzaneh, S. Edberg, and R. PPAR-gamma and RelA. Nat. Immunol. 5:104–112. Medzhitov. 2004. Recognition of commensal microflora by toll-like receptors 25. Kilian, M., E. V. G. Frandsen, D. Haubek, and K. Poulsen. 2006. The is required for intestinal homeostasis. Cell 118:229–241. etiology of periodontal disease revisited by population genetic analysis. Peri- 39. Reid, G., J. Jass, M. T. Sebulsky, and J. K. McCormick. 2003. Potential uses odontol. 2000 42:158–179. of probiotics in clinical practice. Clin. Microbiol. Rev. 16:658–672. 26. Krisanaprakornkit, S., J. R. Kimball, A. Weinberg, R. P. Darveau, B. W. 40. Rubin, R. N., L. Navon, and P. A. Cassano. 2004. Relationship of serum Bainbridge, and B. A. Dale. 2000. Inducible expression of human beta- antioxidants to asthma prevalence in youth. Am. J. Respir. Crit. Care Med. defensin 2 by Fusobacterium nucleatum in oral epithelial cells: multiple 169:393–398. signaling pathways and role of commensal bacteria in innate immunity and 41. Sarker, K. P., S. M. Wilson, and S. Bonni. 2005. SnoN is a cell type-specific the epithelial barrier. Infect. Immun. 68:2907–2915. mediator of transforming growth factor-beta responses. J. Biol. Chem. 280: 27. Krisanaprakornkit, S., J. R. Kimball, and B. A. Dale. 2002. Regulation of 13037–13046. human beta-defensin-2 in gingival epithelial cells: the involvement of mito- 42. Schroder, K., P. J. Hertzog, T. Ravasi, and D. A. Hume. 2004. Interferon- gen-activated protein kinase pathways, but not the NF-kappaB transcription gamma: an overview of signals, mechanisms and functions. J. Leukoc. Biol. factor family. J. Immunol. 168:316–324. 75:163–189. 28. Li, X., M. Commane, H. Nie, X. Hua, M. Chatterjee-Kishore, D. Wald, M. 43. Sha, Q., A. Q. Truong-Tran, J. R. Plitt, L. A. Beck, and R. P. Schleimer. 2004. Haag, and G. R. Stark. 2000. Act1, an NF-kappa B-activating protein. Proc. Activation of airway epithelial cells by toll-like receptor agonists. Am. J. Natl. Acad. Sci. USA 97:10489–10493. Respir. Cell Mol. Biol. 31:358–364. 28b.Lynn, D. J., G. L. Winsor, C. Chan, N. Richard, M. R. Laird, A. Barsky, J. L. 44. Shimazu, R., S. Akashi, H. Ogata, Y. Nagai, K. Fukudome, K. Miyake, and Gardy, F. M. Roche, T. H. W. Chan, N. Shah, R. Lo, M. Naseer, J. Que, M. M. Kimoto. 1999. MD-2, a molecule that confers lipopolysaccharide respon- Yau, M. Acab, D Tulpan, M. Whiteside, A. Chikatamarla, B. Mah, T. M. siveness on Toll-like receptor 4. J. Exp. Med. 189:1777–1782. Downloaded from Munzner, K. Hokamp, R. E. W. Hancock, and F. S. L. Brinkman. Facilitating 45. Singhal, A., A. Jaiswal, V. K. Arora, and H. K. Prasad. 2007. Modulation of systems level analyses of the mammalian innate immune response. Mol. Syst. gamma interferon receptor 1 by Mycobacterium tuberculosis: a potential Biol., in press. immune response evasive mechanism. Infect. Immun. 75:2500–2510. 29. Mazmanian, S. K., C. H. Liu, A. O. Tzianabos, and D. L. Kasper. 2005. An immunomodulatory molecule of symbiotic bacteria directs maturation of the 46. Suzuki, A., G. Kusakai, A. Kishimoto, Y. Shimojo, S. Miyamoto, T. Ogura, host immune system. Cell 122:107–118. A. Ochiai, and H. Esumi. 2004. Regulation of caspase-6 and FLIP by the 30. Mi, H., N. Guo, A. Kejariwal, and P. D. Thomas. 2007. PANTHER version AMPK family member ARK5. Oncogene 23:7067–7075. 6: protein sequence and function evolution data with expanded representa- 47. Tagg, J. R., and K. P. Dierksen. 2003. Bacterial replacement therapy: adapt- tion of biological pathways. Nucleic Acids Res. 35:D247–D252. ing ‘germ warfare’ to infection prevention. Trends Biotechnol. 21:217–223. iai.asm.org 31. Mikami, F., H. Gu, H. Jono, A. Andalibi, H. Kai, and J. D. Li. 2005. 48. Tien, M. T., S. E. Girardin, B. Regnault, L. Le Bourhis, M. A. Dillies, J. Y. Epidermal growth factor receptor acts as a negative regulator for bacterium Coppee, R. Bourdet-Sicard, P. J. Sansonetti, and T. Pedron. 2006. Anti- nontypeable Haemophilus influenzae-induced Toll-like receptor 2 expres- inflammatory effect of Lactobacillus casei on Shigella-infected human intes- sion via an Src-dependent p38 mitogen-activated protein kinase signaling tinal epithelial cells. J. Immunol. 176:1228–1237. pathway. J. Biol. Chem. 280:36185–36194. 49. Travassos, L. H., L. A. Carneiro, S. E. Girardin, I. G. Boneca, R. Lemos, by guest on August 26, 2008 32. Minegishi, Y., M. Saito, T. Morio, K. Watanabe, K. Agematsu, S. Tsuchiya, M. T. Bozza, R. C. Domingues, A. J. Coyle, J. Bertin, D. J. Philpott, and H. Takada, T. Hara, N. Kawamura, T. Ariga, H. Kaneko, N. Kondo, I. Tsuge, M. C. Plotkowski. 2005. Nod1 participates in the innate immune response to A. Yachie, Y. Sakiyama, T. Iwata, F. Bessho, T. Ohishi, K. Joh, K. Imai, K. Pseudomonas aeruginosa. J. Biol. Chem. 280:36714–36718. Kogawa, M. Shinohara, M. Fujieda, H. Wakiguchi, S. Pasic, M. Abinun, 50. Walsh, D. E., C. M. Greene, T. P. Carroll, C. C. Taggart, P. M. Gallagher, H. D. Ochs, E. D. Renner, A. Jansson, B. H. Belohradsky, A. Metin, N. S. J. O’N eill, and N. G. McElvaney. 2001. Interleukin-8 up-regulation by Shimizu, S. Mizutani, T. Miyawaki, S. Nonoyama, and H. Karasuyama. neutrophil elastase is mediated by MyD88/IRAK/TRAF-6 in human bron- 2006. Human tyrosine kinase 2 deficiency reveals its requisite roles in mul- chial epithelium. J. Biol. Chem. 276:35494–35499. tiple cytokine signals involved in innate and acquired immunity. Immunity 51. Xiong, H., H. Li, Y. Chen, J. Zhao, and J. C. Unkeless. 2004. Interaction of 25:745–755. TRAF6 with MAST205 regulates NF-B activation and MAST205 stability. 33. Mookherjee, N., K. L. Brown, D. M. Bowdish, S. Doria, R. Falsafi, K. J. Biol. Chem. 279:43675–43683. Hokamp, F. M. Roche, R. Mu, G. H. Doho, J. Pistolic, J. P. Powers, J. Bryan, 52. Yoshikawa, H., M. Kurokawa, N. Ozaki, K. Nara, K. Atou, E. Takada, H. F. S. Brinkman, and R. E. W. Hancock. 2006. Modulation of the TLR- Kamochi, and N. Suzuki. 2006. Nicotine inhibits the production of proin- mediated inflammatory response by the endogenous human host defense flammatory mediators in human monocytes by suppression of I-kappaB peptide LL-37. J. Immunol. 176:2455–2464. phosphorylation and nuclear factor-kappaB transcriptional activity through 34. Neish, A. S., A. T. Gewirtz, H. Zeng, A. N. Young, M. E. Hobert, V. Karmali, nicotinic acetylcholine receptor alpha7. Clin. Exp. Immunol. 146:116–123. A. S. Rao, and J. L. Madara. 2000. Prokaryotic regulation of epithelial 53. Zhang, Z., J. P. Louboutin, D. J. Weiner, J. B. Goldberg, and J. M. Wilson. responses by inhibition of IkappaB-alpha ubiquitination. Science 289:1560– 2005. Human airway epithelial cells sense Pseudomonas aeruginosa infection 1563. via recognition of flagellin by Toll-like receptor 5. Infect. Immun. 73:7151– 35. O’H ara, A. M., P. O’R egan, A. Fanning, C. O’M ahony, J. Macsharry, A. 7160.
Editor: A. J. Ba¨umler Elevated levels of interferon gamma in human saliva following ingestion of Streptococcus salivarius K12
Chilcott CN1, Crowley L2, Kulkarni V1, Jack RW2, McLellan AD2, Tagg JR2 1BLIS Technologies Ltd, Centre for Innovation 2Department of Microbiology and Immunology, University of Otago, Dunedin Introduction
Users of the oral probiotic, Streptococcus salivarius K12 (BLIS K12 Throat Guard), reported that taking the bacterial lozenges at the onset of flu-like symptoms appeared to help prevent further development of the symptoms. Interferon gamma (IFN- ) is known to contribute to non-specific immunity against many intracellular bacteria and viruses. In previous studies it has been reported that IFN- can be detected in saliva samples during viral infections at concentrations up to 25 pg/ml (1). Research in our lab has shown that human and murine leukocyte preparations produced IFN- when exposed to S. salivarius K12 cells.
Methods and Results
Materials and Methods Results Dosage regime Interferon was not detected in the saliva samples until after 8 h. Between 22- and 139 pg of Four adult subjects took twelve BLIS K12 interferon gamma was detected in the 24 h Throat Guard lozenges (four lozenges every samples (Fig. 1). two hours) Saliva collection and preparation One ml of unstimulated saliva was collected from the subjects before taking the lozenges and 6, 8, 10, 14 and 24 hours later. Saliva samples were frozen until processed. Ten µl of complete protease inhibitor (Roche) was added per ml of saliva. The saliva samples were treated by adding 20 µl 2.5M NaCl and 20 µl 1.5 M sodium acetate to 200 µl of saliva. The samples were incubated on ice for 30 minutes. The saliva was then centrifuged for 5 min at 10,000 rpm, and the supernatant collected for testing. Figure 1.Detection of interferon gamma in saliva following ingestion of Streptococcus salivarius K12 Interferon gamma ELISA assay During a viral infection the virus titre has Interferon gamma was detected in the saliva been shown to increase during the first samples using an ELISA kit (BD two days. An increase in the production of Biosciences). One hundred µl of saliva interferon during this time then leads to a sample supernatant was added to each well. decrease in the viral titre. The ELISA assay was conducted according to the manufacturer’s protocol. The induction of interferon gamma by ingestion of S. salivarius K12 may help in References preventing further development of the symptoms, by reducing the viral titre.
(1) Spear GT, Alves MR, Cohen MH, Bremer J, Landay AL. (2005). Relationship of HIV Acknowledgements RNA and cytokines in saliva from HIV- infected individuals. FEMS Immunol. Med. Special thanks go to the participants in this study Microbiol.45(2):129-136. Clinical, Cosmetic and Investigational Dentistry Dovepress open access to scientific and medical research
Open Access Full Text Article ORIGI NAL R ESEARCH Cariogram outcome after 90 days of oral treatment with Streptococcus salivarius M18 in children at high risk for dental caries: results of a randomized, controlled study
Francesco Di Pierro1 Abstract: Dental caries is the most common chronic disease of childhood. Cariogram is a Alberto Zanvit2 well-recognized algorithm-based software program based on different caries-related risk fac- Piero Nobili2 tors and intended to aid clinicians in performing more objective and consistent dental caries Paolo Risso3 risk assessments. This type of approach precedes the diagnosis of caries and allows the dentist Carlo Fornaini4 to identify at-risk patients and then take appropriate preventive measures before caries develop further. One of the etiological factors favoring the development of dental caries is the mutans 1Scientific Department, Velleja streptococci. These acidogenic dental plaque inhabitants can be effectively antagonized by Research, 2Stomatology Institute, Milan, Italy; 3Department of Health the activity of bacteriocins released by the probiotic Streptococcus salivarius M18 (salivarius Science, University of Genoa, Genoa, M18). Moreover, salivarius M18 after colonizing the human oral mucosa produces the enzymes Italy; 4Teleo Laboratory, Faculty of Dentistry, University of Nice, Nice, dextranase and urease that are able to counteract plaque formation and saliva acidity, respectively. France Seventy-six subjects at high risk of dental caries were randomized and then either treated or not treated for 90 days with an oral formulation containing the oral probiotic salivarius M18 (Carioblis®). The results indicate that the use of salivarius M18 increases the chances of avoid- ing new dental caries development in children, and its application could be proposed as a new tool in the dentist’s armory to be adopted in subjects considered at high risk on the basis of their Cariogram outcome. Keywords: BLIS M18, caries prediction, dextranase, urease, Streptococcus mutans, Streptococcus sobrinus, plaque, salivary pH, bacteriocins
Introduction Dental caries is the most common chronic disease of childhood and its prevalence continues to increase in many populations worldwide.1,2 It is a multifactorial disease mainly caused by interactions between mutans streptococci, especially Streptococcus mutans and Streptococcus sobrinus, and individual caries risk factors, such as saliva composition, fluoride exposure, and dietary habits.3 Despite dental caries being pre- ventable and the many major technological advances in dentistry in recent years,4 dental caries remains a very diffuse and unsolved medical problem. Being a pathology sustained by microbial pathogens, treatments using conventional antistreptococcal antibiotics can be effective in the short term to reduce dental plaque levels and to decrease counts of the mutans streptococci. However, as most antibiotics have relatively Correspondence: Francesco Di Pierro Scientific Department, Velleja Research, broad-spectrum antimicrobial activity, they indiscriminately destroy both commensal Viale Lunigiana 23, 20125 Milan, Italy and potentially harmful bacteria and thereby create population imbalances within the Tel +39 34 9552 7663 Email [email protected] microflora.5 This outcome could be a consequence of using well-known natural or
submit your manuscript | www.dovepress.com Clinical, Cosmetic and Investigational Dentistry 2015:7 107–113 107 Dovepress © 2015 Di Pierro et al. This work is published by Dove Medical Press Limited, and licensed under Creative Commons Attribution – Non Commercial (unported, v3.0) License. The full terms of the License are available at http://creativecommons.org/licenses/by-nc/3.0/. Non-commercial uses of the work are permitted without any further http://dx.doi.org/10.2147/CCIDE.S93066 permission from Dove Medical Press Limited, provided the work is properly attributed. Permissions beyond the scope of the License are administered by Dove Medical Press Limited. Information on how to request permission may be found at: http://www.dovepress.com/permissions.php Di Pierro et al Dovepress synthetic antibiotics and also of using new herbal medicines University of Malmö, based on nine different caries-related endowed with antibiotic activity.6,7 It is now becoming clear risk factors, along with physician judgment, intended to aid that the severity of some oral pathologies, including dental clinicians in performing more objective and consistent dental caries, otitis media, halitosis, and streptococcal pharyngoton- caries risk assessments.31 The performance of the program sillitis, can be related to the development of oral microbiota has been validated in preschool children, schoolchildren, disequilibria. The application of oral probiotics to help restore young adults, and the elderly.32–38 a balanced microbiota and thereby improve oral health is a relatively new concept.8 Some putative commensal bacteria Materials and methods have been assessed for their ability to help prevent dental Subjects and criteria caries. Some initial studies based on the use of intestinal Seventy-six children (aged 6–17 years) classified as high probiotics have reported a reduction in levels of S. mutans risk on the basis of the Cariogram results performed at and apparently fewer dental caries.9,10 However, because these day 0 (chance to avoid new cavities ,25) were included in strains have limitations in terms of their colonization of oral this randomized, controlled study after informed consent tissues, a new generation of probiotic strains sourced from was obtained from their parents. Exclusion criteria were the human oral cavity and belonging to commensal species diagnosis of heart, respiratory, renal, liver, or intestinal dis- known to have extremely low pathogenic potential has more ease, or undergoing current therapy with antibiotics and/or recently been developed. In this regard, a key species is corticosteroids for the prevention/treatment of recurrent Streptococcus salivarius and the oral probiotic identified as bacterial pathologies, such as cystitis, pharyngotonsillitis, strain K12 has been the most thoroughly studied in terms of and acute otitis media, or to counteract allergic reactions its bacteriocin production, oral colonization, and oral per- and/or asthma. According to the protocol, occasional use of sistence and also its efficacy in counteracting halitosis, oral acetaminophen or ibuprofen for fever and/or pain control and candidosis, pharyngotonsillitis, and acute otitis media.11–22 of physician-prescribed antibiotics was allowed. During the Streptococcus salivarius M18 (salivarius M18) (IDA clas- use of antibiotics, treated children were asked to stop using sification: DSM 14865),23 a strain originally isolated from a the salivarius M18-based product. As there were no drop- healthy female adult subject during a specific search for an outs, all the 76 children (38 children in the treated group and oral commensal strain capable of inhibiting mutans strep- 38 in the control, untreated group) attended the follow-up tococci, has subsequently been shown to have relatively examination performed after 90 days and were included in broad spectrum bacteriocin-like inhibitory substance (BLIS) the statistical analysis. activity against S. mutans and S. sobrinus and to produce both dextranase and urease enzymes, the activities of which Study scheme could potentially help limit the progression of dental caries This randomized, controlled study was conducted in the by reducing plaque accumulation and plaque acidification, field of routine clinical practice in the area of Milan (Italy) respectively.24–26 The whole genome of strain salivarius M18 between March and September 2014, in agreement with the has been published recently, and its bacteriocin repertoire criteria set by the Declaration of Helsinki and the Milan Ethi- includes the megaplasmid-encoded salivaricin A2, salivaricin cal Board gave the approval for this study. The parents of all MPS, and salivaricin 9, and the chromosomally encoded the participants in the study were informed of the trial meth- salivaricin M.23,24,27 Recent trials have revealed, along with ods and signed the consent and privacy-policy documents its safety and tolerability profiles, the capability of salivarius giving the authorization to publish the results. As shown in M18 to colonize and persist in the human oral cavity,28 to Figure 1, 76 of the 100 children analyzed were considered reduce plaque formation and to lower S. mutans counts in eligible for enrollment and were randomly assigned to be colonized primary-school-aged children,29 and to reduce both supplemented once a day for 3 months with the test product moderate and severe gingivitis and periodontitis in adults.30 (treated group; n=38) or not to receive any treatment (con- On the basis of these biochemical, microbiological, and clini- trol group; n=38). Randomization was carried out using the cal findings, we determine whether the oral and daily use of sealed envelope system. After 90 days, 76 children attended the strain salivarius M18 affects or modifies the Cariogram the follow-up examination and were subjected to their second outcome after 90 days of treatment in children at high risk Cariogram test. Every 15 days, during the study, all of the of developing new dental caries. Cariogram is an algorithm- enrolled subjects were in contact with the dentists responsible based software program developed in Sweden in 1997 by the for the study to report their medical condition and specific
108 submit your manuscript | www.dovepress.com Clinical, Cosmetic and Investigational Dentistry 2015:7 Dovepress Dovepress Role of BLIS M18 in Cariogram
Cariogram test No treatment n=38
Day 0: 1.Cariogram test Day 30 Day 60 performed on n=100 Day 90 N=38 2.Enrolled subjects at high risk (n=76) N=38 Day 90 3.Randomization Day 30 Day 60 procedure (n=76)
Streptococcus salivarius M18 Cariogram test n=38
Figure 1 Scheme of the study.
study parameters such as probiotic tolerability and dosing Acceptable adherence was considered to be the administration compliance, as well as to enable documentation of the occur- of not less than 95% of the allocated tablets. rence of any side effects possibly linked to the treatment. The subjects were also provided with the possibility of daily Mutans, saliva, and plaque access to the physicians responsible for the study. To evaluate the presence of S. mutans, the GC Saliva-Check Mutans test (monoclonal antibody-based) was used. As Tested product regards saliva, to evaluate pH and quantity, the GC Saliva- Salivarius M18 (IDA classification: DSM 14865), also Check Buffer test was used. In order to obtain the samples of named by the manufacturer as BLIS M18 (BLIS Technolo- saliva for the analysis of mutans streptococci, the saliva secre- gies, Dunedin, New Zealand), was formulated as slowly tion rate (mL/min), and buffer capability, paraffin-stimulated dissolving oral tablets by SIIT (Trezzano S/N, Italy) and whole saliva was collected from all children. The presence of notified as nutritional supplement to the Italian Ministry dental plaque was assessed by using the GC Plaque Indicator of Health as Carioblis® by Omeopiacenza (Pontenure, test. All kits are supplied by GC Europe, Leuven, Belgium. Italy), according to the provisions of law 169 of 2004, on July 19, 2013 (notification number 69163). The prepara- Study objectives tion of Carioblis® used in our research contained no less The principal objectives for the study were 1) to establish the than 1 billion colony-forming units (CFU)/tablet of strain safety and tolerability profiles of the salivarius M18-based salivarius M18. product in children at high risk of developing new dental caries and 2) to evaluate in the same children whether any Treatment protocol Cariogram modifications occurred after 90 days of treatment Starting from day 0 to 90, one tablet of Carioblis® was with the salivarius M18-based product. administered to each subject every night, just before sleep. The tablet was allowed to slowly dissolve in the oral cavity, Statistical analysis without biting or swallowing. Saliva production is typically To study the null hypothesis of no effect of treatment on reduced in the evening hours and this improves the effective- Carioblis® for each clinical variable, and for a global summa- ness of oral colonization. Only for the very first treatment, tion, we applied the two-tailed Wilcoxon test for matched pairs the administration of the tablet was preceded, approximately with signed ranks. To study the effect of Carioblis® therapy on 30 minutes before, by the use of a chlorhexidine-based (0.2%) Cariogram scores, using averaged clinical variables, we used mouthwash. This procedure improves the efficacy of oral the two-tailed Fisher’s exact test. Statistical software JMP® colonization by BLIS M18 by creating bacteria-depleted 10 for Mac OS X (SAS Institute Inc., Cary, NC, USA) was niches in the oral tissues. In order to evaluate the level of used, and the threshold for statistical significance was 95%. subject adherence to the established protocol, the subjects To calculate the caries risk of a group of subjects (results are were asked to return any unused product boxes and tablets. shown in Table 1 and Figure 2), we used the average value of
Clinical, Cosmetic and Investigational Dentistry 2015:7 submit your manuscript | www.dovepress.com 109 Dovepress Di Pierro et al Dovepress
Table 1 Cariogram values (at day 0 and day 90) calculated using the average value of the items listed Treatment, Actual chance to Diet (%) Bacteria (%) Susceptibility (%) Circumstances time period avoid new cavities (%) (%) Salivarius M18, day 0 20 17 29 23 11 Salivarius M18*, day 90 70 7 7 9 7 Untreated, day 0 20 17 29 23 11 Untreated, day 90 37 11 26 16 10 Note: ll values of , day are significant P ,0.01) vs treatment M18, day 0. Abbreviation: Salivarius M18, Streptococcus salivarius M18. any single items of the Cariogram and considered equal to 0 if the treated group a statistically significant reduction, by more the decimal values stands between 0.1 and 0.4 and equal to 1 if than 30%, in the global Cariogram outcome. No statistical the decimal values were between 0.5 and 0.9. The Cariogram difference was observed in the control group (Table 3). By software used the Java Internet 2004 version. analyzing every individual parameter of the Cariogram results in the salivarius M18 treated group (Table 4) one observes Results that, other than for “caries experience”, “related diseases”, This randomized and controlled study has been carried out and “clinical judgment”, all of the parameters are improved. on 76 children at high risk of new dental caries development. Some improvements are probably due to a better control of Thirty-eight of these subjects were treated for 90 days with the aspects of diet (diet content and frequency) or changes Carioblis® (a S. salivarius M18-based product) and the others in oral hygiene and/or in prophylaxis (fluoride program) and served as controls (untreated group). There was no dropout, cannot be linked to the treatment, with clear evidence. Others, therefore all of the children were considered eligible for the such as “plaque amount”, “mutans streptococci”, and “buf- statistical analysis. As shown in Table 2, no statistical dif- fer capacity” could be a direct consequence of the treatment ferences existed between the two groups in terms of sex and because salivarius M18 releases bacteriocins able to kill age. Ninety days of treatment with strain M18 produced in mutans streptococci, and dextranase and urease enzymes,
Salivarius M18 treated group (day 0) Salivarius M18 treated group (day 90)
11 20 7 Chance to avoid new cavities 9 Circumstances 23 Susceptibility 7 17 70 Bacteria Diet 7 29
Untreated group (day 0) Untreated group (day 90)
11 10 20
16 23 37
17
26 29 11
Figure 2 Graphical representation of Cariogram values (%) calculated using the average value of the items listed. Abbreviation: Salivarius M18, Streptococcus salivarius M18.
110 submit your manuscript | www.dovepress.com Clinical, Cosmetic and Investigational Dentistry 2015:7 Dovepress Dovepress Role of BLIS M18 in Cariogram
Table 2 Characteristics* of the enrolled children Table 4 Cariogram: outcome of individual parameters in the Salivarius M18-treated Untreated salivarius M18-treated group (n=38) group (n=38) group (n=38) Day 0* Day 90* P Males, n 25 21 Caries experience 2.7±0.5 (3) 2.7±0.5 (3) ns Age of males 11.2±3.2 12.1±2.9 Related diseases 0.0±0.2 (0) 0.1±0.2 (0) ns Females, n 13 17 Diet, content 1.9±1.0 (2) 1.4±0.7 (1) ,0.05 Age of females 11.5±3.6 11.8±3.8 Diet, frequency 1.4±0.8 (1) 1.2±0.5 (1) ,0.05 Notes: Nonsignificant differences between groups; age expressed in years ± standard Plaque amount 2.0±0.8 (2) 1.0±0.6 (1) ,0.01 deviation. Mutans streptococci 2.7±0.5 (3) 0.7±0.8 (0) ,0.01 Abbreviation: Salivarius M18, Streptococcus salivarius M18. Fluoride program 2.4±0.7 (2) 1.8±0.5 (2) ,0.01 Saliva secretion , which are capable of counteracting plaque formation and 1.7±0.9 (2) 1.2±1.1 (1) 0.05 Buffer capacity 0.0±0.2 (0) 0.0±0.0 (0) ,0.05 increasing saliva pH, respectively. Noteworthy, “plaque Clinical judgment 1.1±0.4 (1) 1.0±0.2 (1) ns control” and “mutans streptococci” were reduced by approxi- Note: *Data expressed as mean ± standard deviation (median). mately 50% and 75%, respectively. By contrast, as shown in Abbreviations: ns, not significant;salivarius M18, Streptococcus salivarius M18. Table 5, the untreated group did not show the same type of improvement and the only statistically significant changes are be effective in evaluating such a risk.39 Cariogram is based on due to a better control of diet, oral hygiene, and prophylactic a set of nine pathological and protective factors, in addition approach. The Cariogram software was uniquely imple- to the professional judgment of the expert dentist. Among mented to calculate the caries risk of individual subjects. these factors, the likely most relevant variable in caries risk Nevertheless, we have exploited the algorithm of the Cario- prediction is “caries experience” and, as a matter of fact, a gram software and used the average value of any single items strong relationship has been shown between caries experience of the Cariogram to calculate the caries risk of a group of and caries risk profile.40,41 Apparently, microbial tests, aimed subjects. This nonvalidated procedure allows construction at evaluating the presence of mutans streptococci, do not seem of an image representative of the likely impact that a treat- to be equally relevant. This could be because, in the presence ment can have on a group of patients. As shown in Table 1 of fluoride, along with an appropriate diet in terms of quality and Figure 2, treatment with the strain M18-based product and quantity, a high number of mutans streptococci may be significantly improves the “chances of avoiding new dental tolerated without causing significant harm to the teeth.42 caries”, from 20 to 70, reduces the parameter “bacteria”, Fluoride is not the only potentially protective factor in the from 29 to 7, and reduces the “susceptibility”, from 23 to 9. presence of an abundance of deleterious streptococci. Within No relevant variations were evident in the untreated group. the oral microbiota, populations of mutans streptococci can Finally, in Table 6, the M18-based treatment demonstrated a indeed be balanced by the presence of antagonizing bacteria. very good safety profile with no treatment-related side effects Among these, a particularly important role is thought to be and no subject dropout. Tolerability was assessed as “good” played by S. salivarius, one of the most prevalent of the com- and “very good” in 35 of the 38 subjects and overlapping mensal oral bacteria. Different strains of S. salivarius have results were obtained with regard to compliance.
Discussion Table 5 Cariogram: outcome of individual parameters in the Caries risk assessment is an important tool assisting the dentist untreated group (n=38) in obtaining a better understanding of the dental profile of a Day 0* Day 90* P patient. The Cariogram software has been clinically proven to Caries experience 2.8±0.5 (3) 2.8±0.6 (3) ns Related diseases 0.1±0.2 (0) 0.2±0.2 (0) ns Diet, content 2.0±1.0 (2) 1.3±0.4 (1) ,0.01 Diet, frequency 1.3±0.8 (1) 1.1±0.7 (1) ,0.05 Table 3 Global Cariogram outcome at day 0 and day 90 Plaque amount 2.0±0.9 (2) 2.1±0.7 (2) ns Salivarius M18-treated Untreated Mutans streptococci 2.6±0.5 (3) 2.5±0.6 (3) ns group (n=38) group (n=38) Fluoride program 2.3±0.7 (2) 1.6±0.7 (1) ,0.01 Day 0** 15.9±2.6 (16) 16.3±2.9 (16) Saliva secretion 1.8±0.9 (2) 1.4±1.2 (1) ,0.05 Day 90** 11.1±2.0 (11)* 14.4±3.2 (14) Buffer capacity 0.2±0.2 (0) 0.2±0.2 (0) ns % vs day 0 30.2 11.7 Clinical judgment 1.2±0.4 (1) 1.2±0.1 (1) ns Notes: *P,0.01 vs day 0; **data expressed as mean ± standard deviation (median). Note: *Data expressed as mean ± standard deviation (median). Abbreviation: Salivarius M18, Streptococcus salivarius M18. Abbreviation: ns, not significant.
Clinical, Cosmetic and Investigational Dentistry 2015:7 submit your manuscript | www.dovepress.com 111 Dovepress Di Pierro et al Dovepress
Table 6 Tolerability, compliance, and side effects in children of the dental examination. This type of diagnosis precedes (n=38) treated for 90 days by oral route with Streptococcus then the diagnosis of caries, allowing dentist to intercept the salivarius M18 as reported by themselves and/or parents and at-risk patient and take the appropriate preventive measures established by dentists responsible for the study to intercept the development of tooth decay. Tolerability Compliance Side effects Very good n=30 n=32 None Good n=5 n=6 None Acknowledgment Acceptable n=3 n=0 None The authors thank Dr J Tagg for suggestions and review of Unacceptable n=0 n=0 None the paper.
Disclosure been shown capable of counteracting the growth of mutans F Di Pierro is the Scientific Director of Velleja Research, the 8 streptococci and, of these, the strongest clinical potential has company that developed the finished product tested in this 29,30 been shown by strain M18. On this basis, we decided to study. The other authors report no other conflicts of interest test the capability of salivarius M18 to modify the Cariogram in this work. outcome. According to our results, 90 days treatment with this oral probiotic has increased the chances of avoiding new References cavities in children. This outcome is considered attributable 1. Bagramian RA, Garcia-Godoy F, Volpe AR. The global increase in dental to the specific anticariogenic characteristics of strain M18 caries. A pending public health crisis. Am J Dent. 2009;22:3–8. that, after colonizing the oral mucosa, is able to release 2. Vachirarojpisan T, Shinada K, Kawaguchi Y, Laungwechakan P, Somkote T, Detsomboonrat P. Early childhood caries in children bacteriocins, limiting the growth of S. mutans and S. sobri- aged 6–19 months. Community Dent Oral Epidemiol. 2004;32(2): nus, and the enzymes dextranase and urease, catalyzing the 133–142. 3. Selwitz RH, Ismail AI, Pitts NB. Dental caries. Lancet. 2007;369: breakdown of dextran (aiding solubilization of plaque) and the 51–59. hydrolysis of urea (increasing saliva pH). The present study 4. Shah N, Bansal N, Logani A. Recent advances in imaging technologies does contain some bias: 1) it is not a blinded study; 2) there in dentistry. World J Radiol. 2014; 6(10):794–807. 5. ten Cate JM, Zaura E. The numerous microbial species in oral bio- is no placebo group; 3) the control group comprises untreated films: how could antibacterial therapy be effective? Adv Dent Res. subjects; and 4) the number of enrolled subjects is rather 2012;24(2):108–111. 6. Silva JP, Castilho AL, Saraceni CH, Díaz IE, Paciencia ML, Suffredini IB. small. Nevertheless, this study represents one of the pioneer Anti-Streptococcal activity of Brazilian Amazon Rain Forest plant attempts to analyze the significance of salivarius M18 in extracts presents potential for preventive strategies against dental caries. dental practice. If these preliminary results can be confirmed J Appl Oral Sci. 2014;22(2):91–97. 7. Brighenti FL, Salvador MJ, Delbem AC, et al. Systematic screen- with a larger number of subjects and in double-blind clinical ing of plant extracts from the Brazilian Pantanal with antimicrobial conditions, the practical application of strain M18 could be activity against bacteria with cariogenic relevance. Caries Res. 2014;48(5):353–360. proposed in the future as a new tool in the dentist’s armory, 8. Wescombe PA, Hale JD, Heng NC, Tagg JR. Developing oral probi- along with the already available strategies (eg, anticaries diets, otics from Streptococcus salivarius. Future Microbiol. 2012;7(12): fluoride, and oral hygiene) to be adopted in subjects consid- 1355–1371. 9. Caglar E, Sandalli N, Twetman S, Kavaloglu S, Ergeneli S, Selvi S. ered at high risk on the basis of their Cariogram outcome. On Effect of yogurt with Bifidobacterium DN-173 010 on salivary mutans the basis of the calculated risk to develop new dental caries, streptococci and lactobacilli in young adults. Acta Odontol Scand. 2005;63:317–320. subjects are divided into three groups: low, medium, and 10. Nase L, Hatakka K, Savilahti E, et al. Effect of long-term consumption high. Depending on these groups, the fundamental aspects of a probiotic bacterium, Lactobacillus rhamnosus GG, in milk on dental of primary prevention are applied to different extents for caries and caries risk in children. Caries Res. 2001;35:412–420. 11. Tagg JR. Prevention of streptococcal pharyngitis by anti-Streptococcus protocol and rigor: light in those at low risk, moderate in pyogenes bacteriocin-like inhibitory substances (BLIS) produced by those at intermediate risk, and close and manifold in high- Streptococcus salivarius. Indian J Med. 2004;119:13–16. 12. Hyink O, Wescombe PA, Upton M, Ragland N, Burton JP, Tagg JR. risk individuals. Certainly, in patients defined at high risk, but Salivaricin A2 and the novel lantibiotic salivaricin B are encoded at possibly also in those of intermediate risk, the addition of a adjacent loci on a 190-kilobase transmissible megaplasmid in the oral protocol incorporating the administration of the salivarius probiotic strain Streptococcus salivarius K12. Appl Environ Microbiol. 2007;73(4):1107–1113. M18 could be crucial to addressing and further reducing the 13. Sharma S, Verma KK. Skin and soft tissue infection. Indian J Pediatr. risk of tooth-decay receptivity. The caries risk is configured as 2001;68(Suppl 3):S46–S50. 14. Wescombe PA, Burton JP, Cadieux PA, et al. Megaplasmids encode dif- the predisposition of an individual to be affected by the carious fering combinations of lantibiotics in Streptococcus salivarius. Antonie pathology, regardless of the fact of presenting caries at the time Van Leeuwenhoek. 2006;90(3):269–280.
112 submit your manuscript | www.dovepress.com Clinical, Cosmetic and Investigational Dentistry 2015:7 Dovepress Dovepress Role of BLIS M18 in Cariogram
15. van Zon A, van der Heijden GJ, van Dongen TM, Burton MJ, 28. Burton JP, Wescombe PA, Macklaim JM, et al. Persistence of the oral Schilder AG. Antibiotics for otitis media with effusion in children. probiotic Streptococcus salivarius M18 is dose dependent and mega- Cochrane Database Syst Rev. 2012;9:CD009163. plasmid transfer can augment their bacteriocin production and adhesion 16. Power DA, Burton JP, Chilcott CN, Dawes PJ, Tagg JR. Preliminary characteristics. PLoS One. 2013;8(6):e65991. investigations of the colonisation of upper respiratory tract tissues of 29. Burton JP, Drummond BK, Chilcott CN, et al. Influence of the probiotic infants using a paediatric formulation of the oral probiotic Streptococcus Streptococcus salivarius strain M18 on indices of dental health in salivarius K12. Eur J Clin Microbiol Infect Dis. 2008;27(12): children: a randomized double-blind, placebo-controlled trial. J Med 1261–1263. Microbiol. 2013;62(Pt 6):875–884. 17. Horz HP, Meinelt A, Houben B, Conrads G. Distribution and persistence 30. Litty S, Nagarathna D, Merline V. Probiotics in periodontal therapy. of probiotic Streptococcus salivarius K12 in the human oral cavity as Int J Pharm Bio Sci. 2015;6(1):242–250. determined by real-time quantitative polymerase chain reaction. Oral 31. Bratthall D, Hänsel PG. Cariogram: a multifactorial risk assessment Microbiol Immunol. 2007;22(2):126–130. model for a multifactorial disease. Community Dent Oral Epidemiol. 18. Burton JP, Wescombe PA, Moore CJ, Chilcott CN, Tagg JR. Safety 2005;33:256–264. assessment of the oral cavity probiotic Streptococcus salivarius K12. 32. Holgerson PL, Twetman S, Stecksèn-Blicks C. Validation of an age- Appl Environ Microbiol. 2006;72(4):3050–3053. modified caries risk assessment program (Cariogram) in preschool 19. Burton JP, Cowley S, Simon RR, McKinney J, Wescombe PA, Tagg JR. children. Acta Odontol Scand. 2009;67:106–112. Evaluation of safety and human tolerance of the oral probiotic Strepto- 33. Hänsel Petersson G, Twetman S, Bratthall D. Evaluation of a computer coccus salivarius K12: a randomized, placebo-controlled, double-blind program for caries risk assessment in schoolchildren. Caries Res. study. Food Chem Toxicol. 2011;49(9):2356–2364. 2002;36:327–340. 20. Di Pierro F, Adami T, Rapacioli G, Giardini N, Streitberger C. 34. Campus G, Cagetti MG, Sale S, Carta G, Lingström P. Cariogram Clinical evaluation of the oral probiotic Streptococcus salivarius validity in schoolchildren: a two-year follow-up study. Caries Res. K12 in the prevention of recurrent pharyngitis and/or tonsillitis 2012;46:16–22. caused by Streptococcus pyogenes in adults. Expert Opin Biol Ther. 35. Petersson GH, Isberg PE, Twetman S. Caries risk assessment in school 2013;13(3):339–343. children using a reduced Cariogram model without saliva tests. BMC 21. Di Pierro F, Donato G, Fomia F, et al. Preliminary pediatric clinical Oral Health. 2010;19(10):5. evaluation of the oral probiotic Streptococcus salivarius K12 in preventing 36. Zukanović A. Caries risk assessment models in caries prediction. Acta recurrent pharyngitis and/or tonsillitis caused by Streptococcus pyogenes Med Acad. 2013;42:198–208. and recurrent acute otitis media. Int J Gen Med. 2012;5:991–997. 37. Alian AY, McNally ME, Fure S, Birkhed D. Assessment of caries 22. Di Pierro F, Colombo M, Zanvit A, Risso P, Rottoli AS. Use of risk in elderly patients using the Cariogram model. J Can Dent Assoc. Streptococcus salivarius K12 in the prevention of streptococcal and viral 2006;72:459–463. pharyngotonsillitis in children. Drug Healthc Patient Saf. 2014;6:15–20. 38. Celik EU, Gokay N, Ates M. Efficiency of caries risk assessment in 23. Chilcott CN, Tagg JR. Antimicrobial composition. United States patent young adults using Cariogram. Eur J Dent. 2012;6:270–279. US 7226590. 2007. 39. Tellez M, Gomez J, Ellwood R, Ismail AI. Evidence on existing caries 24. Heng NC, Haji-Ishak NS, Kalyan A, et al. Genome sequence of the risk assessment systems: are they predictive of future caries? Community bacteriocin producing oral probiotic Streptococcus salivarius strain Dent Oral Epidemiol. 2013;41(1):67–78. M18. J Bacteriol. 2011;193:6402–6403. 40. Campus G, Cagetti MG, Sacco G, Benedetti G, Strohmenger L, 25. Chen YY, Clancy KA, Burne, RA. Streptococcus salivarius urease: Lingström P. Caries risk profiles in Sardinian schoolchildren using genetic and biochemical characterization and expression in a dental Cariogram. Acta Odontol Scand. 2009;67(3):146–152. plaque streptococcus. Infect Immun. 1996;64:585–592. 41. Hänsel Petersson G, Twetman S, Bratthall D. Evaluation of a computer 26. Ohnishi Y, Kubo S, Ono Y, et al. Cloning and sequencing of the gene program for caries risk assessment in schoolchildren. Caries Res. coding for dextranase from Streptococcus salivarius. Gene. 1995;156: 2002;36(5):327–340. 93–96. 42. Baehni PC, Guggenheim B. Potential of diagnostic microbiology for 27. Wescombe PA, Upton M, Renault P, et al. Salivaricin 9, a new lantibiotic treatment and prognosis of dental caries and periodontal diseases. Crit produced by Streptococcus salivarius. Microbiology. 2011;157: Rev Oral Biol Med. 1996;7(3):259–277. 1290–1299.
Clinical, Cosmetic and Investigational Dentistry Dovepress Publish your work in this journal Clinical, Cosmetic and Investigational Dentistry is an international, tion and preference will be highlighted. The manuscript management peer-reviewed, open access, online journal focusing on the latest clini- system is completely online and includes a very quick and fair peer- cal and experimental research in dentistry with specific emphasis on review system, which is all easy to use. Visit http://www.dovepress. cosmetic interventions. Innovative developments in dental materials, com/testimonials.php to read real quotes from published authors. techniques and devices that improve outcomes and patient satisfac-
Submit your manuscript here: http://www.dovepress.com/clinical-cosmetic-and-investigational-dentistry-journal
Clinical, Cosmetic and Investigational Dentistry 2015:7 submit your manuscript | www.dovepress.com 113 Dovepress European Archives of Paediatric Dentistry https://doi.org/10.1007/s40368-020-00512-2
ORIGINAL SCIENTIFIC ARTICLE
In vitro inhibitory efect of two commercial probiotics on chromogenic actinomycetes
E. Gobbi1 · M. A. De Francesco2 · G. Piccinelli2 · A. Caruso2 · E. Bardellini3 · A. Majorana3
Received: 22 May 2019 / Accepted: 29 January 2020 © European Academy of Paediatric Dentistry 2020
Abstract Purpose Black extrinsic discoloration is a common clinical and aesthetic problem. This study aims to evaluate the potential in vitro antagonistic activity of two commercial probiotics, Streptococcus salivarius M18 and Lactobacillus reuteri ProDentis, against microorganisms associated with black stains. Methods Streptococcus salivarius M18 and Lactobacillus reuteri were tested against Aggregatibacter actinomycetemcomitans and Actinomyces naeslundiiusing their cell-free fermentative broth in a planktonic growth inhibition test. Results Both probiotic cell-free supernatants showed the ability to reduce the pathogenic bacteria growth in a dose-dependent way. Streptococcus salivarius M18 showed a stronger antimicrobial activity than Lactobacillus reuteri ProDentis against the two indicator strains used. A. naeslundi was less susceptible to the probiotic activity of both S. salivarius and L. reuteri compared to A. actinomycetemcomitans. Conclusions The obtained results demonstrate a potent antagonistic ability of probiotics to reduce the growth of microorganisms associated with black tooth stains. Therefore, these strains could be evaluated for a therapeutic use against dental pigmentations.
Keywords Aggregatibacter actinomycetemcomitans · Actinomyces naeslundii · Streptococcus salivarius M18 · Lactobacillus reuteri · Black stain
Introduction et al. 1999; Reid and Beeley 1976). Previous culture-based studies have indicated an association between black tooth Black extrinsic discoloration is a common clinical and stain and chromogenic bacteria. While at first periodontal aesthetic problem in childhood. Both primary and permanent bacteria, such as Porphyromonas gingivalis, Prevotella teeth can be affected, with a reported prevalence of 1–20% intermedia and Prevotella melaninogenica were reported to (Ronay and Attin 2011). Black stain (BS) is considered a be closely related to BS (Soukos et al. 2005), traditional and special form of dental plaque unique for its insoluble iron molecular examinations have proposed Actinomycetes as salts and high calcium and phosphate contents (Hattab an etiological factor in the production of black pigment. Specifically, Aggregatibacter actinomycetemcomitans and Actinomyces naeslundii are reported as significantly * E. Bardellini predominant cultivable microorganisms found in patients [email protected] with BSs (Saba et al. 2006; Li et al. 2015; Heinrich-Weltzien et al. 2014). 1 Agrifood and Environmental Microbiology Platform (PiMiAA-AgroFood Lab), Department of Molecular Current treatments focus on mechanical removal of the and Translational Medicine, University of Brescia, Brescia, stains, which are hard to be removed by daily tooth brushing Italy and are prone to resurface after professional scaling (Hattab 2 Department of Molecular and Translational Medicine, et al. 1999). Therefore, further research on prevention and University of Brescia, Brescia, Italy therapy of BSs is needed. 3 Department of Medical and Surgical Specialities, Probiotic bacteria are live microbial food supplements Radiological Sciences and Public Health, Dental School, that confer a health benefit on humans (de Vrese and Dental Clinic, University of Brescia, p.le Spedali Civili 1, Schrezenmeir 2008). Their use to effect an improvement in 25 133 Brescia, Italy
Vol.:(0123456789)1 3 European Archives of Paediatric Dentistry oral health is a relatively undeveloped strategy and it has (BLIS Technologies, Dunedin, New Zealand), distributed been investigated for prevention and treatment of dental as Carioblis® by Omeopiacenza (Pontenure, Italy), and caries, periodontal disease and for halitosis (Meurman 2005; Lactobacillus reuteri (1 × 108 CFU) strains DSM17938 Twetman and Stecksén-Blicks 2008; Allaker and Stephen and ATCC PTA5289 (Prodentis; BioGaia, Lund, Sweden) 2017; Teughels et al. 2011). were used as probiotic strains. Two types of oral bacteria To the best of our knowledge, no report on the were used to test the antibacterial effect of these probiotic introduction of beneficial bacterial population to help strains: Aggregatibacter actinomycetemcomitans DSM- counter the proliferation of chromogenic species can be 13386 (DSMZ, Braunschweig, Germany) and Actinomyces found in the published literature so far. Generally, probiotic naeslundii DSM-11123 (DSMZ, Braunschweig, Germany). activity is considered to influence the balance among the They were cultured using Schaedler agar with vitamin K many species of commensal flora in the oral cavity. It is our and 5% Sheep Blood (BD bioscience, Sparks, MD, USA) in view that probiotics may have beneficial applications in the anaerobic conditions. reduction of BSs by inhibiting the proliferation of the BS associated bacteria, as demonstrated in vivo in a clinical Antimicrobial activity of S. salivarius and L. reuteri trial (Bardellini et al. 2020), still the reasons why a probiotic against oral bacteria intake inhibits the formation of BS requires further studies. Among probiotics, Streptococcus salivarius possesses Bacterial strains were stored in tryptic soy broth (TSB) excellent credentials as an oral probiotic (Tagg and Dierksen medium with 20% of glycerol at − 80 °C and used as 2003; Burton et al. 2011). It is a pioneer colonizer of the required. Bacterial isolates (Streptococcus salivarius human oral cavity and produces bacteriocins, ribosomally and Lactobacillus reuteri) from frozen stock were grown synthesized proteinaceous antibiotics typically encoded overnight and 500 μl was then subcultured in brain heart by megaplasmid-borne loci (Wescombe et al. 2006). More infusion (BHI) medium (BD bioscience, Sparks, MD, USA) specifically, the strain S. salivarius M18 has been shown for 48 h at 37 °C in anaerobic conditions. The bacterial to colonize and persist in the human oral cavity (Burton, suspensions were centrifuged at 4 °C for 10 min at 12.000xg Wescombe et al. 2013b), to reduce plaque formation (Burton and sterilized by filtration trough a 0.22 mm Millipore filter and Drummond et al. 2013a) and to reduce gingivitis (Merck Millipore, Milano, Italy). and periodontitis (Litty et al. 2015) Another probiotic A test of the antibacterial properties of this medium was is Lactobacillus reuteri, an obligate heterofermentative performed in accordance with recommendations from the resident in the gastrointestinal tract in humans (Itsaranuwat Clinical and Laboratory Standards Institute (CLSI) (2012, et al. 2003) which is reported to produce antimicrobial 2016). A serial dilution was performed starting with 180 μl substances with a broad-spectrum activity (Talarico of cell-free supernatants (CFS) of S. salivarius and L. reuteri et al. 1988; Ganzle et al. 2000), and it is effective against in BHI medium to reach a proportion range of 10–90%. Streptococcus mutans (Caglar et al. 2008), as well as against A. actinomycetemcomitans and A. naeslundii culture periodontal pathogens (Vivekananda et al. 2010; Vicario suspensions were diluted using fresh sterile BHI medium, et al. 2013). so that the turbidity was equal to that of a McFarland 0.5 To be able to display a probiotic effect against BSs standard. Afterwards, 20 μl of each bacterial suspension a bacterium must compete with chromogenic bacteria, was inoculated in each well of a 96-well plate up to a final thus reducing the level of their colonization. The purpose volume of 200 μl. BHI medium without inoculum and of this study was to evaluate the inhibitory effects of BHI medium with only the indicator bacteria were used as two commercially available probiotics Streptococcus negative and positive control, respectively. The plate was salivarius M18 and Lactobacillus reuteri Prodentis on then incubated for 24 h at 37 °C in an anaerobic chamber. growth inhibition of chromogenic bacteria, specifically A. Bacterial growth was measured at a wavelength of 600 nm actinomycetemcomitans and A. naeslundii, using their cell- using a microplate spectrometer. The entire experiment was free fermentative broth in a planktonic growth inhibition performed three times with three independent repetitions. test. Statistical analysis
Materials and methods The primary outcome of this study was the bacterial growth mean of A. actinomycetemcomitans and A. naeslundii Bacteria and bacterial culture culture suspensions evaluated when grown separately in BHI (controls) and in BHI added with different dilutions of Streptococcus salivarius M18 (IDA classification: DSM CFS of S. salivarius or L. reuteri. Two hierarchical models 14,865), also named by the manufacturer as BLIS M18 were built, one for each culture, to estimate bacterial growth
1 3 European Archives of Paediatric Dentistry
(measured 3 times per dilution, from 10 to 90%) in relation and higher (Fig. 1a) with a significant reduction of the A. to dilution (from 10 to 90%) and “CASES” (control, CFS actinomycetemcomitans’ growth (p value = 0.001) and a of S. salivarius, CFS of L. reuteri). Because normality complete growth inhibition at 90%. Differently, anti- A. assumptions were rejected, logarithm transformation was actinomycetemcomitans activity of L. reuteri occurred performed and estimates were than back-transformed to at CFS concentrations higher than 60% (p value = 0.001) the original unit of measurement. Results are reported as (Fig. 1a). estimates and 95% confidence intervals. All analyses were Anti-A. naeslundii activity of S. salivarius M18 occurred performed assuming a significance level of 5% using the at concentrations higher than 40% with a complete growth statistical software R (version 3.4.2). inhibition at 90% (Fig. 1b), while anti-A. naeslundii activity of L. reuteri occurred at a concentration of 80% without reaching a complete growth inhibition at 90% (Fig. 1b). Both Results S. salivarius M18 and L. reuteri significantly reduced the A. naeslundii growth ranging between the concentrations Antibacterial activity of Streptococcus salivarius M18 of 40% (p value < 0.040) and of 70% (p value < 0.0001), and Lactobacillus reuteri respectively.
The effect of the two probiotics on the chromogenic actinomycetes’ growth was explored by adding increasing Discussion concentration of single CFS of the 48-h-old probiotic cultures to the culture medium of the actinomycetes. BSs are characteristic pigmented deposits that may occur Anti-A. actinomycetemcomitans activity of S. salivarius at any age but seem to peak in childhood with a decrease in M18 occurred drastically at CFS concentrations of 40% prevalence during pubescence and adulthood. Even if not
Fig. 1 Antibacterial activity of Streptococcus salivarius M18 determinations (n = 9, average + 95% confidence interval). Asterisks and Lactobacillus reuteri ProDentis against Aggregatibacter are used to denote relevant comparisons and statistical significance as actinomycetemcomitans (a) and Actinomyces naeslundii (b). CFS, follows: *p = 0.001, **p = 0.0002, ***p ≤ 0.0001 cell-free supernatant. Each point represents the mean of three
1 3 European Archives of Paediatric Dentistry correlated with caries, BS represents an aesthetic problem, This is corroborated by many reports showing that especially in the parents’ eyes. Lactobacilli can produce organic acids, H2O2 and Probiotics are generally defined as microorganisms that bacteriocins (Cintas et al. 2001) while S. salivarius M18 confer a health benefit on humans by establishing a balance releases into saliva copious quantities of bacteriocins and between beneficial and pathogenic bacteria (Koll et al. 2008; enzymes as dextranase and urease (Heng et al. 2011). Li et al. 2015; Krasse et al. 2006). Their use is a relatively Additional research is required to verify the mechanism of undeveloped strategy for prevention and treatment of caries antibacterial activity found here and if and which probiotic and periodontitis (de Vrese and Schrezenmeir 2008). metabolites are eventually produced in vitro and in vivo BSs too are associated with a segregation of microbial during the interactions studied in this work and what is their communities in the oral cavity (Krasse et al. 2006), thus this role in the oral cavity for preventing BSs. approach has been considered as potentially beneficial in the This study ascertained in vitro the potential antagonistic prevention and treatment of BSs and applied for the first time activity of two commercial products, Streptococcus in a clinical trial (Bardellini et al. 2020). salivarius M18 and Lactobacillus reuteri ProDentis: these This short note is a preliminary contribution to unravel strains are to be considered for a therapeutic use against the underlying mechanisms. The study was undertaken to dental pigmentations. compare the in vitro efficiencies of two commercial probiotic products, including that used in the above mentioned clinical Acknowledgements The Authors are grateful to Dr Veronica Cappa for the statistical support. trial, against planktonic oral actinomycetes which are commonly reported as associated to BSs. Compliance with ethical standards Both probiotics show antagonistic capacity, as their fermentative broth was able to significantly reduce the Conflict of interest The Authors declare that they have no conflict of growth of the tested bacterial strains. Notably, in this interest. study Streptococcus salivarius M18 showed a stronger antimicrobial activity than Lactobacillus reuteri ProDentis Ethical approval This study did not involve any human participants or animals. against the two indicator strains used. Furthermore, this study shows that A. naeslundi is less susceptible to Informed consent This study did not need informed consent from the the probiotic activity of both S. salivarius and L. reuteri patients, being an in vitro study. compared to A. actinomycetemcomitans, whose growth is completely inhibited at high cell-free fermentative broth concentrations. This study also indicates a dose- dependent inhibiting activity of the two probiotics as higher References the concentrations of their fermentative broth used in the experiments, the higher was the reduction of the bacterial Allaker RP, Stephen AS. Use of probiotics and oral health. Curr Oral indicators growth. Health Rep. 2017;4:309–18. Streptococcus Salivarius The activities of S. salivarius and L. reuteri against Bardellini E, Amadori A, Gobbi E, et al. Does strain M18 assumption make black stains disappear in children? these actinomycetes have already been reported, although Oral Health Prev Dent. 2020 (in press). strains and culture media may differ and generally the Burton JP, Cowley S, Simon RR, et al. Evaluation of safety and human pathogenic bacteria were in association to periodontal tolerance of the oral probiotic Streptococcus salivarius K12: a diseases (Teughels et al. 2013; Kang et al. 2011; Twetman randomized, placebo-controlled, double-blind study. Food Chem Toxicol. 2011;49:2356–64. et al. 2009). Burton JP, Drummond BK, Chilcott CN, et al. Influence of the probiotic The nature of the antimicrobial activity exerted by the Streptococcus salivarius strain M18 on indices of dental health in two probiotics in this work remains unclear. Because in children: a randomized double-blind, placebo-controlled trial. J this study, pH evaluation of CFS was not performed, the Med Microbiol. 2013a;62:875–84. Burton JP, Wescombe PA, Macklaim JM, et al. Persistence of the oral presented data do not support whether the inhibition is probiotic Streptococcus salivarius M18 is dose dependent and due to some secreted metabolite, present in the cell-free megaplasmid transfer can augment their bacteriocin production supernatants of S. salivarius and L. reuteri or due to organic and adhesion characteristics. PLoS ONE One. 2013b;8:e65991. acids production, which could contribute to reducing the Caglar E, Kuscu OO, Cildir SK, et al. A probiotic lozenge administered medical device and its effect on salivary mutans streptococci and number of indicator bacteria. However, some previous lactobacilli. Int J Paediatr Dent. 2008;18:35–9. studies demonstrated that the acidic environment provided Cintas LM, Casaus MP, Herranz C, et al. Bacteriocins of lactic acid by Lactobacillus strains can directly affect their antibacterial bacteria. Food Sci Tech Int. 2001;7:281–305. activities against S. mutans (Lin et al. 2015; Keller et al. Clinical and Laboratory Standards Institute. Methods for antimicrobial susceptibility testing of anaerobic bacteria. Approved standard- 2011). Therefore, the role of the acids produced by probiotic Eight Edition, CLSI document M11-A8. Wayne: Clinical and strains on bacterial growth is still unclear. Laboratory Standards Institute; 2012.
1 3 European Archives of Paediatric Dentistry
Clinical and Laboratory Standards Institute. Methods for dilution Ronay V, Attin T. Black stain-a review. Oral Health Prev Dent. antimicrobial susceptibility tests for bacteria that grow aerobically, 2011;9:37–45. M7–A10. Wayne: Clinical and Laboratory Standards Institute; Saba C, Solidani M, Berlutti F, et al. Black stains in the mixed 2016. dentition: a PCR microbiological study of the etiopathogenic de Vrese M, Schrezenmeir J. Probiotics, prebiotics, and synbiotics. Adv bacteria. J Clin Pediatr Dent. 2006;30:219–24. Biochem Eng Biotechnol. 2008;111:1–66. Soukos NS, Som S, Abernethy AD, et al. Phototargeting oral Ganzle MG, Holtzel A, Walter J, et al. Characterization of reutericyclin black-pigmented bacteria. Antimicrob Agents Chemother. produced by Lactobacillus reuteri LTH2584. Appl Environ 2005;49:1391–6. Microbiol. 2000;66:4325–33. Tagg JR, Dierksen KP. Bacterial replacement therapy: adapting Hattab FN, Qudeimat MA, AlRimawi HS. Dental discoloration: an ‘germ warfare’ to infection prevention. Trends Biotechnol. overview. J Esthet Restor Dent. 1999;11:291–310. 2003;21:217–23. HeinrichWeltzien R, Bartsch B, Eick S. Dental caries and microbiota Talarico TL, Casas IA, Chung TC, et al. Production and isolation of in children with black stain and non-discoloured dental plaque. reuterin, a growth inhibitor produced by Lactobacillus reuteri. Caries Res. 2014;48:118–25. Antimicrob Agents Chemother. 1988;32:1854–8. Heng NCK, HajiIshak NS, Kalyan A, et al. Genome sequence of the Teughels W, Loozen G, Quirynen M. Do probiotics offer opportunities bacteriocin-producing oral probiotic Streptococcus salivarius to manipulate the periodontal oral microbiota? J Clin Periodontol. Strain M18. J Bacteriol. 2011;193:6402–3. 2011;38:159–77. Itsaranuwat P, Al-Haddad KSH, Robinson RK. The potential Teughels W, Durukan A, Ozcelik O, et al. Clinical and microbiological therapeutic benefits of consuming ‘health promoting’ effects of Lactobacillus reuteri probiotics in the treatment of fermented dairy products: a brief update. Int J Dairy Technol. chronic periodontitis: a randomized placebo-controlled study. J 2003;56:203–10. Clin Periodontol. 2013;40:1025–35. Kang MS, Oh JS, Lee HC, et al. Inhibitory effect of Lactobacillus Twetman S, Stecksén-Blicks C. Probiotics and oral health effects in reuteri on periodontopathic and cariogenic bacteria. J Microbiol. children. Int J Paediatr Dent. 2008;18:3–10. 2011;49:193–9. Twetman S, Derawi B, Keller M, et al. Short-term effect of chewing Keller MK, Hasslof P, Stecksen-Blicks C, et al. Co-aggregation and gums containing probiotic Lactobacillus reuteri on the levels of growth inhibition of probiotic lactobacilli and clinical isolates inflammatory mediators in gingival crevicular fluid. Acta Odontol of mutans streptococci; an in vitro study. Acta Odontol Scand. Scand. 2009;67:19–24. 2011;69:263–8. Vicario M, Santos A, Violant D, et al. Clinical changes in periodontal Koll P, Mandar R, Marcotte H, et al. Characterization of oral subjects with the probiotic Lactobacillus reuteri Prodentis: a lactobacilli as potential probiotics for oral health. Oral Microbiol preliminary randomized clinical trial. Acta Odontol Scand. Immunol. 2008;23:139–47. 2013;71:813–9. Krasse P, Carlsson B, Dahl C, et al. Decreased gum bleeding and Vivekananda MR, Vandana KL, Bhat KG. Effect of the probiotic reduced gingivitis by the probiotic Lactobacillusreuteri. Swed Lactobacilli reuteri (Prodentis) in the management of periodontal Dent J. 2006;30:55–60. disease: a preliminary randomized clinical trial. J Oral Microbiol. Li Y, Zhang Q, Zhang F, et al. Analysis of the microbiota of black stain 2010;2:5344. in the primary dentition. PLoS ONE One. 2015;10:e0137030. Wescombe PA, Burton JP, Cadieux PA, et al. Megaplasmids encode https ://doi.org/10.1371/journ al.pone.01370 30. differing combinations of antibiotics in Streptococcus salivarius. Lin X, Chen X, Chen Y, et al. The effect of five probiotic lactobacilli Antonie Van Leeuwenhoek Van Leeuwenhoek. 2006;90:269–80. strains on the growth and biofilm formation of Streptococcus mutans. Oral Dis. 2015;21:e128–e134134. Publisher’s Note Springer Nature remains neutral with regard to Litty S, Nagarathna D, Merline V. Probiotics in periodontal therapy. jurisdictional claims in published maps and institutional affiliations. Int J Pharm Bio Sci. 2015;6:242–50. Meurman JH. Probiotics: do they have a role in oral medicine and dentistry? Eur J Oral Sci. 2005;113(3):188–96. Reid JS, Beeley JA. Biochemical studies on the composition of gingival debris from children with black extrinsic tooth stain. Caries Res. 1976;10:363–9.
1 3
Does Streptococcus Salivarius Strain M18 Assumption Make Black Stains Disappear in Children?
Elena Bardellinia / Francesca Amadorib / Emanuela Gobbic / Anna Ferrid / Giulio Contie / Alessandra Majoranaf
Purpose: This randomised controlled study evaluated the effectiveness of an oral probiotic, Streptococcus salivarr- ius M18 (SsM18), in children with black stains (BSs) in order to counteract their reformation. Materials and Methods: Fifty-eight children (aged 4–10 years) presenting with BSs were enrolled. They were randomly divided into two groups: group A (n = 29) included children who were given the test product containing SsM18 once a day for 3 months; group B (n = 29) included children who did not receive any treatment. Before beginning the study, all the children underwent professional removal of BSs. The assessment of BSs was done after 3 months (T1) and after 6 months (T2). Results: Four patients (1 belonging to group A and 3 to group B) were excluded from the study because they started antibiotic therapy. After 3 months (T1), BSs were detected in 6 of the 28 children (21.2%) from group A and in 13 out of the 26 (50%) children from group B (p < 0.05). After 6 months (T2), BSs were detected in 9 out of the 28 (32.1%) children from group A and in 14 of the 26 (53.8%) children from group B (p > 0.05). Conclusions: BSs formation in children could be prevented by administering S. salivarius M18. Key words: child, pigmentation, probiotics, teeth
Oral Health Prev Dent 2020; 18: 161–164. Submitted for publication: 22.8.2018; accepted for publication: 18.09.2018 doi: 10.3290/j.ohpd.a43359
lack extrinsic discolouration is a common clinical and phosphate.19,20 Various studies have reported higher con- Baesthetic problem in childhood.10,11,14–16,18 Both pri- sumptions of foods rich in iron, such as vegetables, dairy mary and permanent teeth can be affected, with a reported products and eggs, or water with a high concentration of prevalence of 1–20%.17,21 Black stains (BSs) are hard to iron in children with BSs. Early ultrastructural examinations remove by simply brushing one’s teeth, and tend to reform of BSs demonstrated that these deposits consist of micro- after professional cleaning. The mechanism of BS formation organisms embedded in an intermicrobial matrix.25 Chromo- is still unclear. BSs contain insoluble ferric salt, most likely genic Gram-positive bacteria are currently considered the a ferric sulphide, and has a high content of calcium and most important aetiological factor in the production of black pigmentation. The ferric sulphide might be formed by the reaction between hydrogen sulphide, produced by bacterial a Associate Professor, Department of Medical and Surgical Specialities, Radio- activity and the iron present in saliva or gingival exudates. logical Sciences and Public Health, Dental School, University of Brescia, Bres- cia, Italy. Wrote the manuscript. Traditional bacteriological examinations have implicated Ac- b Fellowship, Department of Medical and Surgical Specialities, Radiological Scii- tinomycetes as the predominant cultivable microorganism ences and Public Health, Dental School, University of Brescia, Brescia, Italy. found in BSs. Li et al17 performed a study using next-generr- Collected the data and drafted the manuscript. ation sequencing of the bacterial 16S rRNA gene to evalu- c Associate Professor, Department of Molecular and Translational Medicine, Pii- ate the oral microbiota in children with and without BSs. MiAA, University of Brescia, Brescia, Italy. Revised the manuscript for microbii- ological content. Children with BSs had a significantly lower salivary microbi- d Fellowship, Department of Medical and Surgical Specialities, Radiological Scii- ota diversity compared to other children. Actinomyces were ences and Public Health, Dental School, University of Brescia, Brescia, Italy. more abundant in plaque samples of children with BSs. Al- Collected the data and helped to draft the manuscript. terations in quantity of other species might provide an envi- e Fellowship, Department of Oral Surgery, University Vita-Salute San Raffaele, ronment that enables BS formation and deposition onto the Milan, Italy. Collected the data and helped with the data analysis. enamel surface. The application of oral probiotics to help f Full Professor, Department of Medical and Surgical Specialities, Radiological Sciences and Public Health, Dental School, University of Brescia, Brescia, restore a balanced microbiota and thereby improve oral Italy. Revised the manuscript for intellectual content. health is a relatively new concept. Streptococcus salivarius M18 (SsM18) (IDA classification: DSM 14865),7,8 a strain Correspondence: Elena Bardellini, Dental Clinic, p.le Spedali Civili 1, 25 133 Brescia (Italy). Tel: 00-39-030-3995780; Fax 00-39-030303194; originally isolated from a healthy female subject during a E-mail: [email protected] specific search for an oral commensal strain capable of in-
Vol 18, No 2, 2020 161 Bardellini et al hibiting mutans streptococci, has subsequently been shown The children’s levels of oral hygiene were clinically as- to have a relatively broad spectrum bacteriocin-like inhibi- sessed according to the criteria of simplified oral hygiene tory substance (BLIS) activity against S. mutans and S. sob- index (OHI-s) by Greene and Vermillion12 with a mouth mirr- rinus. It also produces both dextranase and urease en- ror and explorer, during the first visit (T0), after 3 months zymes which can respectively reduce plaque accumulation (T1) and after 6 months (T2). and its acidification. Recent clinical trials have revealed, along with its safety and tolerability profiles, SsM18’s abil- Tested Products ity to colonise and remain in the human oral cavity,6,8 S. salivarius M18 (IDA classification: DSM 14865), also where it lowers S. mutans counts in primary-school-aged named by the manufacturer as BLIS M18 (BLIS Technolo- children and reduces severe gingivitis and periodontitis in gies, Dunedin, New Zealand), was formulated as a slowly adults.5,8 dissolving oral tablet by SIIT (Trezzano S/N, Italy) and noti- fied as a nutritional supplement to the Italian Ministry of Health as Carioblis by Omeopiacenza (Pontenure, Italy), ac- MATERIALS AND METHODS cording to the provisions of law 169 of 2004, on 19 July 2013 (notification number 69163). The preparation of Cari- Sample Selection oblis used in our research contained no less than 1 billion Children between the ages of 4 and 10 years who pre- colony-forming units (CFU)/tablet of S. salivarius strain sented with extrinsic black teeth stains on examination at M18. the Pediatric Dentistry Department of the Dental Clinic of the University of Brescia, in the period from January 2016 Treatment Protocol to December 2016, were enrolled. BSs were evaluated Starting from day 0 to 90, one tablet of Carioblis was ad- based on the presence of pigmented dark lines parallel to ministered to each subject every night, just before going to the gingival margin or an incomplete coalescence of dark sleep. The tablet was allowed to slowly dissolve in the oral dots, rarely extending beyond the cervical third of the cavity, without biting or swallowing. Saliva production is crown.4,13,18 The exclusion criteria were oral diseases (eg, typically reduced in the evening hours and this improves the dental caries, periodontitis, salivary gland disorders, oral effectiveness of oral colonisation. mucosal diseases, and others), orthodontic treatment, In order to evaluate the level of subject adherence to the chronic diseases (eg, respiratory diseases, diabetes, epi- established protocol, the subjects were asked to return any lepsy, celiac diseases), pharmacologic treatment (eg, anti- unused product boxes and tablets. Acceptable adherence biotics, corticosteroids). Occasional use of paracetamol or was considered to be the administration of not less than ibuprofen for fever or pain control was allowed. 95% of the allocated tablets.
Study Design Ethical Considerations This study was designed as a randomised controlled study. All patients were informed about the research and signed The patients were randomly divided by a computer code into an informed consent form to take part. The study protocol two groups. Group A (treated group) included children who was approved by the local Ethics Committee and performed were given the tested product (a tablet containing SsM18) according to the Declaration of Helsinki. once a day for 3 months; group B (control group) included children who did not receive any treatment. Before beginning the study, all the children had their RESULTS teeth professionally cleaned with an abrasive paste to re- move BSs. After polishing, a professional fluoride treatment Characteristics of the Patients was administered by the application of fluoride foam. They Among the 1227 children seen at the Pediatric Dentistry also received instructions on oral hygiene. The roll-on tech- Department, a total of 68 patients (26 females and nique was chosen as it is easier to learn and less time- 32 males) showed BSs, of which 58 met the inclusion cri- consuming compared to other complex teethbrushing tech- teria (Fig 1). They were randomly assigned to two groups: niques. Each child was given a new toothbrush and fluoride group A (n = 29) and group B (n = 29). The mean age of toothpaste at the beginning of the study. The children were the total sample was 7.0 + 1.35 years. There were no diff- forbidden to drink tea, fruit juice and other beverages con- ferences (p > 0.05) between the clinical and demographic taining tannin during the period of the study. The subjects characteristics of the two groups; therefore, the two groups also had the possibility to communicate daily with the physi- were homogeneous (Table 1). During the study, 4 patients cians responsible for the study in order to report their med- (1 belonging to group A and 3 to group B) were excluded ical conditions, probiotic tolerability or any possible side because they started antibiotic therapy. effects linked to the probiotics. The assessment of BSs was done by two calibrated clin- Clinical Evaluation of OHI-s icians after 3 months (T1) and after 6 months (T2). The No differences in the mean of OHI-s were observed between presence of BSs was recorded as ‘present’ or ‘absent’ in- group A and group B, neither at T0, nor at T1. A statistically dependently from the number of teeth affected. significant difference (p < 0.05) between the mean of the
162 Oral Health & Preventive Dentistry Bardellini et al
ENROLMENT
Patients (4–10 years-old) with black stains (n = 68)
Patient with caries Excluded (n = 7) Patients with orthodontic treatment
Excluded (n = 3)
Patients with black stains (n = 58)
Excluded from analysis (antibiotic therapy during the study) (n = 4)
Analysed (n = 54)
Fig 1 Enrolment flow-chart.
Table 1 Demographic and clinical characteristics of the patients
Group A Group B Total (n = 28) (n = 26) (n = 54)
Male:Female 18:10 14:12 32:22
Mean age (range) 7.1 + 1.4 (4–10) 6.8 + 1.3 (4–10) 7.0 + 1.35 (4–10)
Mean + SD.
OHI-s in group A (1.06 + 1.16) and in group B (1.94 + 1.27) Table 2 Presence of BSs (number of patients) and was found at T2 (Table 2). OHI-s values (mean + SD) at T0, T1 and T2 in the group A and in the group B Clinical Evaluation of BSs After 3 months (T1), BSs were detected in 6 of the 28 chil- GROUP A GROUP B dren (21.2%) from group A and in 13 out of the 26 (50%) (n = 28) (n = 26) children from group B (p < 0.05). After 6 months (T2), BSs Black stains were detected in 9 out of the 28 (32.1%) children from (no. of patients) group A and in 14 of the 26 (53.8%) children from group B T0 0 0 - (p > 0.05) (Table 2). T1 613 p = 0.02*
T2 9 14 p = 0.1 DISCUSSION OHI values BSs are characteristic pigmented deposits that may occur (mean + SD) at any age but seem to peak in childhood with a decrease T0 1.95 + 0.97 1.67 + 1.15 p = 0.3 in prevalence during pubescence and adulthood.21 Even if not correlated with caries, BSs represent an aesthetic prob- T1 1.77 + 1.23 1.81 + 1.17 p = 0.4 lem, especially in the parents’ eyes. Nevertheless, BSs can T2 1.06 +1.16 1.94 + 1.27 p = 0.02 * be an annoyance for the dental hygienist, especially when *ANOVA test, p value < 0.05. they are deposited on roughened or pitted areas of the
Vol 18, No 2, 2020 163 Bardellini et al tooth. Currently, removal through professional oral cleaning considered a smart nutraceutical tool to counteract BSs is the only treatment but they tend to reform despite good formation. personal oral care. Prevention of BSs could be a new chal- lenge for the clinician. This study evaluated the efficacy of S. salivarius M18 in REFERENCES the prevention of the reformation of BSs in children. A limit 1. Antonic V, Stojadinovic A, Zhang B, Izadjoo MJ, Alavi M. Pseudomonas of this study was that the control group did not assume a aeruginosa induces pigment production and enhances virulence in a placebo tablet. However, before the beginning of the study, white phenotypic variant of Staphylococcus aureus. Infect Drug Resist all the children belonging both to the study group and to the 2013;6:175–186. 2. Barbour A, Philip K. Variable characteristics of bacteriocin-producing control group underwent a professional oral hygiene pro- Streptococcus salivarius strains isolated from Malaysian subjects. PLoS cess, received instruction on oral care and were forbidden One 2014;18:9:e100541. to drink any beverages able to stain their teeth. 3. Bradshaw DJ, Marsh PD, Watson GK, Allison C. Role of Fusobacteriun nu- cleatum and coaggregation in anaerobe survival in planktonic and biofilm Our results show that the assumption of S. salivarius oral microbial communities during aeration. Infect Immun M18 for 3 months significantly reduced the reformation of 1998;66:4729–4732. BSs in children for that period without affecting its manifes- 4. Brook AH, Smith RN, Lath DJ. The clinical measurement of tooth colour and stain. Int Dent J 2007;57:324–330. tation in the successive quarter. No differences in terms of 5. Burton JP, Drummond BK, Chilcott CN, Tagg JR, Thomson WM, Hale JD, level of personal oral hygiene were found between the two et al. Influence of the probiotic Streptococcus salivarius strain M18 on in- groups during the first 3 months. During the succeeding dices of dental health in children: a randomized double-blind, placebo- controlled trial. J Med Microbiol 2013;62:875–884. 3 months, the oral hygiene was significantly better main- 6. Burton JP, Wescombe PA, Macklaim JM, Chai MH, Macdonald K, Hale JD, tained by the children belonging to group A, possibly due to et al. Persistence of the oral probiotic Streptococcus salivarius M18 is the major compliance of the patients who participated to dose dependent and megaplasmid transfer can augment their bacteriocin production and adhesion characteristics. PLoS One 2013;8:e65991. the active phase of the study. 7. Chilcott CN, Tagg JR. Antimicrobial composition. United States patent US The reason why a probiotic intake of S. salivarius M18 – 7226590, 2007. which causes a new oral bacterial equilibrium – inhibits the 8. Di Pierro F, Zanvit A, Nobili P, Risso P, Fornaini C. Cariogram outcome formation of BSs should be further studied. after 90 days of oral treatment with Streptococcus salivarius M18 in chil- dren at high risk for dental caries: results of a randomized, controlled BSs are different than other forms of dental plaque due study. Clin Cosmet Investig Dent 2015;7:107–113 to their content of insoluble iron salts and high levels of 9. Di Pierro F. Probiotics to prevent tooth decay. Nutrafood 2016;15:79–82. calcium and phosphate.13,18,25 A possible reason for this 10. Garcia Martin JM, Gonzalez Garcia M, Seoane Leston J. Prevalence of black stain and associated risk factors in preschool children. Pediatr Int condition might be a different, characteristic and relatively 2013;55:355–359. stable oral microflora. Various studies reported the associ- 11. Gasparetto A, Conrado CA, Maciel SM, Miyamoto EY, Chicarelli M, ation between BSs and Actinomycetes.12,18,23 The over- Zanata RL. Prevalence of black tooth stains and dental caries in Brazilian schoolchildren. Braz Dent J 2003;14:157–161. growth of Leptotrichia and Fusobacterium, belonging to the 12. Green JC, Vermillion JR. The simplified oral hygiene index. J Am Dent bacterial phylum Fusobacteria, in plaque might be a cofac- Assoc 1964;68:7–13. tor to the formation of these pigmentations.18,22,24 Fuso- 13. Hattab FN, Qudeimat MA, Al-Rimawl HS. Dental discoloration: an over- bacterium spp. can co-aggregate with black-pigmented an- view. J Esthet Restor Dent 1999;11:291–310 14. Heinrich-Weltzien R, Monse B, Van Palestein HW. Black stain and dental aerobes (Porphyromonas gingivalis and Prevotella caries in Filipino schoolchildren. Community Dent Oral 2009;37:182–187. 3,18 nigrescens). Similarly, co-infecting or co-culturing Pseu- 15. Koch MJ, Bove M, Schroff J, Perlea P, Garcia-Godoy F, Staehle HJ. Black domonas aeruginosa can also induce pigment production stain and dental caries in schoolchildren in Potenza, Italy. ASDC J Dent Child 2001;68(5–6):353–355. from Staphylococcus aureus.1,18However, how microbial as- 16. Koleoso DC, Shaba OP, Isiekwe MC. Extrinsic tooth discolouration in semblies in both saliva and plaque are linked to pigment 11–16-year-old Nigerian children. Odontostomatol Trop 2004;27:29–34. production (represented by black extrinsic stain) and to low 17. Li Y, Zhang Q, Zhang F, Liu R, Liu H, Chen F. Analysis of the microbiota of levels of caries remains largely unknown. black stain in the primary dentition. PLoS One 2015;10:e0137030. 18. Li Y, Zou CG, Fu Y, Li Y, Zhou Q, Liu B, et al. Oral microbial community The S. salivarius strain M18 exhibits a particular bacte- typing of caries and pigment in primary dentition. BMC Genomics riocin and enzymatic profile, secreting A2, 9, MPS and M. 2016;17:558. bacteriocins together with urease and dextranase en- 19. Reid JS, Beeley JA, MacDonald DG. Investigation into black extrinsic zymes.26 Salivaricin A2, MPS and 9 are all plasmid-encoded tooth stain. J Dent Res 1977;56:895–899. 20. Reid JS, Beeley JA, MacFarlane TW. A study of the pigment produced by and capable of inhibiting the growth of Streptococcus pyo- Bacterioides melaninogenicus. J Dent Res 1976;55:1130. genes. Salivaricin A2 and 9 are endowed with antipyogenes 21. Ronay V, Attin T. Black stain – a review. Oral Health Prev Dent activity. Salivaricin MPS is active against Corynebacterium 2011;9:37–45. 22. Saba C, Solidani M, Berlutti F, Vestri A, Ottolenghi L, Polimeni A. Black spp. and against Streptococcus sanguinis, which is relevant stains in the mixed dentition: a PCR microbiological study of the etio- for the balance of the oral microbiota.2 M18 is directly pathogenic bacteria. J Clin Pediatr Dent 2006;30:219–224. active against Actinomyces naeslundiii and Actinomyces vis- 23. Slots J. The microflora of black stain on human primary teeth. Eur J Oral cosus.5,9 Sci 1974;82:484–490. 24. Takashima Y, Matsumi Y, Yamasaki Y, Hirano K, Yanagida K, Fujita K, et Salivaricin M is responsible for inhibiting mutans Strepto- al. Black pigmentation in primary dentition: case report and literature re- coccii and Actinomyces26; this could possibly be the mech- view. Pediatric Dental J 2014;24:184–188. anism which prevents the reformation of BSs. 25. Thelaide J, Slots J, Fejerskov O. The ultrastructure of black stain on human primary teeth. Scand J Dent Res 1973;81:528–532. Even if further studies on a wider sample of patients are 26. Wescombe PA, Hale JDF, Heng NCK, Tagg JR. Developing oral probiotics still needed, based on our results, the M18 strain can be form Streptococcus salivarius. Future Microbiol 2012;7:1355–1371.
164 Oral Health & Preventive Dentistry Int J Pharm Bio Sci 2015 Jan; 6(1): (P) 242 - 250
Research Article Pharmaceutics
International Journal of Pharma and Bio Sciences ISSN 0975-6299
PROBIOTICS IN PERIODONTAL THERAPY
LITTY SCARIYA*1, NAGARATHNA D.V2 AND MERLINE VARGHESE1
1 Post Graduate Student, Department of Periodontics, A.J Institute of Dental Sciences, Mangalore, India. 2 Professor, Department of Periodontics, A. J Institute of Dental Sciences, Mangalore, India.
ABSTRACT
To partially assess the efficacy of probiotic lozenges, in the treatment of periodontal disease. Material and methods: Twenty eight subjects, of both sexes, were selected and divided into 4 groups (2 test groups and 2 control groups).The test group was instructed to consume probiotic lozenges whereas the control group did not receive any probiotic product. Clinical parameters such as plaque index, gingival index, modified sulcular bleeding index and probing pocket depth were recorded and assessed at baseline, day 15, 30, 45 and day 60. The Test group showed significant reduction in all parameters when compared to that of Control group. After stopping probiotic administration on day 30, the test group showed a significant increase in all the clinical parameters except probing pocket depth on day 45 and day 60. Conclusions: The results show that probiotic lozenges were efficacious in reducing both moderate to severe gingivitis and moderate periodontitis.
KEY WORDS: Probiotics, Gingivitis, Periodontitis
LITTY SCARIYA *Corresponding author Post Graduate Student, Department of Periodontics, A.J Institute of Dental Sciences, Mangalore, India.
This article can be downloaded from www.ijpbs.net P- 242 Int J Pharm Bio Sci 2015 Jan; 6(1): (P) 242 - 250
INTRODUCTION
The World Health Organization defines MATERIALS AND METHODS probiotics as “living organisms, principally bacteria that are safe for human consumption (i) Materials used and when ingested in sufficient quantities, Lozenges containing not less than 100 have beneficial effects on human health, million Streptococcus salivarius bacteria per ”1 beyond the basic nutrition . The concept tablet were imported from BLIS th of probiotics dates back to the 20 Technologies Ltd, Dunedin New Zealand. century when Ukrainian bacteriologist and Nobel laureate, Elie Metchnikoff laid down the (ii) Methods of Randomisation of Subjects scientific foundation of probiotic. He This study was conducted on 28 subjects proposed that Bulgarian people had longer between the age of 20 and 60 years of longevity due to fermented milk containing age. Subjects were selected from those viable bacteria. The term ‘probiotics’, the attending the Department of Periodontics, antonym for the term antibiotics, was A.J Dental College and Hospital, introduced in 1965 by Lilly and Stillwell as Mangalore. Subjects were selected on the substances produced by microorganisms basis of the following criteria by examining which promote the growth of other the periodontium. 1 microorganisms . Probiotic therapy has been studied extensively in a variety of Inclusion criteria systemic indications and medical disorders 1. Good general health and age ranges and have also been introduced in the field between 20 to 60years of periodontal healthcare. The discovery of 2. Not participated in any clinical trial the role of free radicals in cancer, during the previous 4 weeks diabetes, cardiovascular diseases, and other 3. No ongoing antibiotic treatment chronic diseases, including periodontal 4. Only individuals with moderate and disease has led to the emergence of severe gingivitis, and moderate antioxidants as prophylactic and therapeutic periodontitis 2 agents . The development of resistance to antibiotics has raised the possibility of a Exclusion criteria return to the pre-antibiotic dark ages. 1. Individuals with systemic disease Here, probiotics provide an effective predisposing to periodontitis. alternative way, which is economical and 2. Individuals with probing pocket depth more 3 natural to combat periodontal disease . The than 6mm. aim of this study was to evaluate the 3. Presence of tooth with grade II or grade III efficacy of orally administered probiotic mobility or abscess formation. lozenges in the treatment of chronic gingival 4. Pregnancy or breastfeeding and periodontal disease by evaluating 5. Physical or mental handicaps that may changes in monitored clinical parameters. interfere with an adequate oral hygiene. Lozenges containing Streptococcus salivarius 6. History of drug abuse were selected because of their innate 7. Allergies capacity to bind and persist on the tongue dorsum. Some strains of Streptococcus Groups salivarius release into saliva, copious The selected subjects were divided into quantities of bacteriocins that could provide four groups, with 7 subjects in each group. a targeted way of removing deleterious bacteria making them a more effective Group1:Test probiotic organism. They also regularly Seven male subjects with gingival index produce the enzymes dextranase and score 3 or 2 with periodontal pocket less urease, which could help reduce dental than 6 mm treated with probiotic lozenges. plaque accumulation and acidification, 4 respectively . Group2:Test
Seven female subjects with gingival index
This article can be downloaded from www.ijpbs.net P- 243 Int J Pharm Bio Sci 2015 Jan; 6(1): (P) 242 - 250 scores 3 or 2 with periodontal pocket less The patients were also instructed on how than 6 mm treated with probiotic lozenges. to brush and floss effectively. Participants in the test group were instructed to bring Group3:Control the remaining lozenges during their visits Seven male subjects with gingival index to the hospital. A count of the remaining scores 3 or 2 with periodontal pocket less lozenges was taken to monitor whether the than 6mm treated without probiotic lozenges. subjects were regularly consuming the lozenges. Clinical parameters were Group4:Control obtained for all the subjects on day 0 Seven female subjects with gingival index (Baseline); day 15, day 30, day 45, and scores 3 or 2 with periodontal pocket less day 60. All 7 subjects in each group were than 6mm treated without probiotic analysed. At the end of the study period, lozenges. The participants were briefed in 6 M18 tablets were returned to BLIS detail regarding the study. The proposed Technologies Ltd New Zealand for quality study was reviewed by the ethical assurance testing. committee of the institution and clearance was obtained. An informed consent was RESULTS obtained from each subject before conducting the trial. Preselected participants The following clinical parameters were were scheduled for a dental examination. The assessed in all subjects during each visit. subjects were allotted into groups by a 1. Supragingival plaque was scored by second post graduate student, while the Plaque Index (P.I) (Silness and clinician conducting the clinical examinations Loe1964). was not informed whether subjects were 2. The Gingival Index (G.I) (Loe and actively taking the lozenges or not. The Silness 1963) was scored. test group subjects were instructed to 3. Bleeding on probing by The Modified store the lozenges in a refrigerator, as Sulcular Bleeding Index (mSBI) by recommended by the manufacturer. Mombelli et al 1987.
4. Probing pocket depth (PPD) measured Study protocol using Williams Periodontal Probe. The study period was 60 days. Subjects in Group1 and Group2, after initial scaling Data Analysis and root planning, were instructed to The data was tabulated in Microsoft excel consume 2 lozenges containing and analysed using SPSS (Statistical Streptococcus salivarius M18 every day for Product and Service Solutions)version-16. the next 30 days. Subjects in Group 3 The comparison between test and control and Group 4 were not instructed to group in each category (PI-plague index, consume any lozenges but underwent GI-gingival index, mSBI-modified sulcular scaling and root planning. bleeding index, PD-probing pocket depth) Participants in Group1 and Group2 were at each interval was done using an directed to place one lozenge in their oral independent T test. The level of cavity for few minutes after brushing their significance was set to p< 0.05 (where ‘p’ teeth once in the morning and in the is the probability value). evening, allowing the tablet to dissolve.
This article can be downloaded from www.ijpbs.net P- 244 Int J Pharm Bio Sci 2015 Jan; 6(1): (P) 242 - 250
Plaque Index Comparision Between Test And Control Group
Graph 1 Plaque index Comparison between Control and Test Group
Graph 1 shows the plaque index (PI) score of PI in the test group on day 45 scores for both test and control group at and day 60, whereas in the control group baseline, day 15, day 30 day, 45 and day there was a continuous increase in the 60. The mean score in Test and Control mean score from day 15 to day 30, day groups were almost similar at base line. 45 and day 60 respectively. There was no On day 15 the mean score was reduced in statistically significant difference between both groups. At day 30 the mean plaque the plaque index scores of test and index score of the Test group was control group at baseline and day 15 significantly lower when compared to that (p>0.05). The difference between two group of the control group for which there was on day 30 day 45 and 60 was statistically an increase in the score compared to day significant (p<0.001). 15. There was an increase in the mean
Gingival Index Comparison Between Test And Control Group
Graph 2 Gingival Index Comparison between Control and Test Group
This article can be downloaded from www.ijpbs.net P- 245 Int J Pharm Bio Sci 2015 Jan; 6(1): (P) 242 - 250
Graph 2 shows the gingival index scores 15. The Test group showed a significant for both test and control groups at reduction in GI mean score on day 30 baseline, day 15 day 30 day 45 and day when compared to that of the control 60. There was no statistically significant group which showed an increased GI difference between the two groups at score when compared to day 15. Similarly baseline and day 15. The difference to the plaque index results, the mean GI between the two groups on day 30, day 45, score showed an increase on day 45 and and day 60 was significantly higher day 60 in the Test group after stopping (p<0.001). The mean score of GI in the the administration of probiotic lozenges. test and control group at baseline were The control group showed an increase in similar. There was a reduction in the mean score from day 15 to day 30, day mean score of GI for both groups on day 45 and day 60 respectively.
Modified Sulcular Bleeding Index Comparion Between Test And Control Group.
Graph 3 Modified Sulcular Bleeding Index Comparison between Control Group and Test Group.
Graph 3 shows the modified sulcular seen to decrease on day 15. The mean bleeding index (mSBI) scores for both the mSBI score of the control group shows a test and control group at baseline, day 15, sharp increase on day 30, day 45 and day 30, day 45 and day 60. The mean day 60. There was no statistically mSBI score for the test group has significant difference between the two continued to reduce from baseline to day groups at baseline. On day 15 the 30 during the time the tablets were difference between the 2 groups was administered after which the mean mSBI significant (p=0.017). The difference between scores are observed to increase. Although the two groups on day 30, day 45 and the control group’s mean mSBI score are day 60 was significantly high (p<0.001).
This article can be downloaded from www.ijpbs.net P- 246 Int J Pharm Bio Sci 2015 Jan; 6(1): (P) 242 - 250
Probing Pocket Depth Comparison Between Test And Control
Graph 4 Probing Pocket Depth Comparison Between Test Group and Control Group
Graph 4 shows the Probing Pocket Depth reported a reduction of clinical symptoms (PPD) scores for both the test and control caused by gingivitis after the use of group at baseline, day 15, day 30, day 45 chewing gum containing Lactobacillus and day 60. The mean score PPD at reuteri for two weeks.11Krasse et al. baseline were similar in the Test and the documented the effects of probiotic Control groups and on day 15 both group microorganism Lactobacillus reuteri for a 2 showed a slight reduction in mean score week period during which gingival which can be credited to scaling and root inflammation was significantly reduced12. It planning. On day 30, the Test group was also demonstrated that probiotic showed greater reduction in scores when bacteria accumulated in microbial biofilms compared to that of Control group which thus replacing or reducing pathogenic may be due to probiotic lozenges but on bacteria13. Ishikawa et al14 and Matsuoka et day 45 and day 60 there was no increase al15 demonstrated that the use of probiotic or decrease in mean score of both pills containing L.salivarius significantly groups. There was no statistically significant reduced the concentration of the difference between the PPD scores of test periopathogenic bacterium P.gingivalis in and control group at baseline and day 15 saliva and subgingival plaque in healthy (p>0.05). The difference between the two volunteers. Shimauchi et al16 documented a groups on day 30, day 45 and day 60 reduced concentration of was statistically significant (p<0.05). periodontopathogenic bacteria after administration of probiotic Lactobacilli over DISCUSSION a period of weeks, which was associated 17 with improved periodontal conditions . It is well known that the effect of professional Probiotic bacteria, generally regarded as cleaning of teeth is effective in short term safe, may favour periodontal health if they treatment of gingivitis. In the present study are able to establish themselves in oral there was no difference in mean scores biofilm and inhibit pathogen growth and between the Test and Control group at metabolism5. Various studies on effects of base line. On day 15 both the groups probiotic therapy showed positive results for showed a reduction in PI, GI, mSBI, and gastrointestinal disorders as well as for caries PD. This may be because scaling and root associated riskfactors6,7,8,9,10. However, there planning was carried out in both groups. A are only a few studies which have patient’s ability to maintain oral hygiene investigated the influence of probiotics on may also be a factor. But on day 30, the gingivitis or periodontitis. Twetman et al.
This article can be downloaded from www.ijpbs.net P- 247 Int J Pharm Bio Sci 2015 Jan; 6(1): (P) 242 - 250 test group exhibited a greater reduction in 15 to day 30, 45 and 60. PPD remained their PI score than did the control group. constant on day 30, day 45 and day 60. Similar results were obtained in a study Despite the effect of professional cleaning, conducted by Shimauchi et al16. The test the reduction in all indexes was stronger subjects also showed a significant and significantly better than the control reduction in the GI score when compared group in subjects supplemented with to the control group. Similar results were probiotics lozenges. obtained in a study conducted by Krasse et al12, Shimauchi et al16 , Della Riccia et QUALITY ASSURANCE TEST al18. In the case of the mSBI, a significant The test report concludes that the levels of reduction in the score on day 30 was Streptococcus salivarius M18 in the tablet observed in the test group when compared may not have been optimal during the to the control. On day 45 and day 60, the entire course of the trial, although it is score increased, i.e. the number of bleeding likely that there should still be enough live site increased as soon as the probiotic intake probiotic bacteria to impact on the oral was stopped. Similar observations were seen health of the test subjects. in the study by Twetman et al11. On day 30, a significant beneficial effect of the probiotic CONCLUSION treatment was observed for the PPD based on comparison with the control Limitations of this study are as follows: group. Similar findings were reported in 1. Microbial analysis not carried out. the study conducted by Matsuoka et al15, 2. All lozenges were not refrigerated. Shimauchi et al16 In general, beneficial 3. Study was not restricted to any particular effects from a probiotic will only take social strata. place as long as the probiotic is applied. 4. Cell count conducted on sample tablets Therefore probiotic therapy should not be after the study period found that levels seen as a treatment that permanently of S. salivarius M18 may not have alters the oral microbiota as evidence been optimal during the entire course indicates they are not able to sustain a of the trial. Despite some of these shift to a stable non-pathogenic limitations, the reduction in all indices microbiota19. This observation is supported monitored was seen to be stronger and by the present study with beneficial effects significantly better in all subjects that being most obvious during the actual were supplemented with probiotic M18 dosing phase for all parameters monitored. tablets than in the control group who The reduction in all clinical parameters in were not administered with any the Test group appear to be due to probiotic. This study concludes that administration of the probiotic lozenges. Streptococcus salivarius M18 may be Once the administration of probiotic potentially useful as an aid in improving lozenge was stopped all the clinical the oral health of periodontal patients. parameters (PI, GI, mSBI) showed Further studies including microbial increases in their mean scores although analysis need to be performed to generally they remained lower than the confirm the initial findings of this report. corresponding scores for the control group The effect of probiotics on different with the exception of PPD, which almost strata’s of Indian society and the remained constant. It was not possible to survivability of Streptococcus salivarius determine why mean PPD scores M18 bacteria in different climatic remained constant after an initial reduction. conditions such as that found in India, The mean score of all the clinical also need to be further probed. parameters (PI, GI, mSBI) except PPD increased in the control group from day
This article can be downloaded from www.ijpbs.net P- 248 Int J Pharm Bio Sci 2015 Jan; 6(1): (P) 242 - 250
ACKNOWLEDGEMENT
The authors are thankful to BLIS Technologies Ltd, Dunedin, New Zealand, for providing the probiotic lozenges.
REFERENCES
1. Sandeep Lawande. Probiotics for orthodontic patients during daily management of periodontal disease: a consumption of yoghurt containing novel therapeutic strategy.J Pharmacol, 2 probiotic bacteria. Eur J Orthod,31: 407- (4):41-46,(2012). 411,(2009). 2. AditiMathur,LalitMathur, BalajiManohar, 11. Twetman S, Derawi B, Keller M, Ekstrand HemantMathur, Rajesh Shankarapillai, K, Yucel-Lindberg T and Stecksen-Blicks et al. Antioxidant therapy as C. Short-term effect of chewing gums monotherapy or as an adjunct to containing probiotic Lactobacillus reuteri treatment of periodontal disease. J on the levels of inflammatory mediators in Indian Soc Periodontol, 17(1):21-24, gingival crevicular fluid. (2013). ActaOdontolScand67: 19-24, (2009). 3. Anirban Chatterjee,Hirak Bhattacharya, 12. Krasse P, Carlsson B, Dahl C, Paulsson AbhishekKandwal. Probiotics in A, Nilsson A and Sienkiewicz G. periodontal health and disease-review.J Decreased gum bleeding and reduced Indian Soc Periodontol, 15(1): 23-28, gingivitis by the probiotic (2011). Lactobaccilusreuteri. Swed Dent J ,30: 4. Jeremy P.Burton, Philip A.Wescombe, 55-60, (2006). Jean M.Macklaim, Melissa H.C.Chai, 13. Tsubura S, Mizunuma H, Ishikawa S, Kyle MacDonald,et al. Persistance of Oyake I, Okabayashi M, Katoh K et al. the oral probiotic Streptococcus The effect of Bacillus subtilis mouth salivarius M18 is dose dependent and rinsing in patients with periodontitis. megaplasmid transfer can augment their EurJClinMicrobiol Infect Dis ,28: 1353- bacteriocin production and adhesion 1356, (2009). characteristics. PLOS ONE ,8(6):e65991, 14. Ishikawa H, Aiba Y, Nakanishi M, Ohhashi (2013). Y and Koga Y. Suppression of periodontal 5. Iva Stamatova and Jukka H. Meurman. pathogenic bacteria in the saliva of Probiotic: Health benefits in the mouth humans by the Administration of Am J Dent, 22(6):329-338, (2009). Lactobacillus salivarius TI2711. Journal of 6. Broekaert IJ and Walker WA. Probiotics the Japanese Society of Periodontology and chronic disease. J ,45: 105-112, (2003). ClinGastroenterol,2006; 40: 270-274, 15. Matsuoka T, Sugano N, Takigawa S, (2006). Takane M, Yoshimura N, Ito K et al. Effect 7. Cremonini F, Di Caro S, Nista EC, of oral Lactobacillus salivarius TI 2711 Bartolozzi F, Capelli G, Gasbarrini G et al. (LS1) administration on periodontopathic Meta-analysis: the effect of probiotic bacteria in subgingival plaque. Journal of administration on antibiotic-associated the Japanese Society of Periodontology diarrhoea. Aliment PharmacolTher ,48: 315-324, (2006). ,16:1461-1467,(2002). 16. Shimauchi H, Mayanagi G, Nakaya S, 8. D'Souza AL, Rajkumar C, Cooke J and Minamibuchi M, Ito Y, Yamaki K et al. Bulpitt CJ. Probiotics in prevention of Improvement of periodontal condition by antibiotic associated diarrhoea: meta- probiotics with Lactobacillus salivarius analysis. BMJ ,324:1361, (2002). WB21: a randomized, double-blind, 9. Kligler B and Cohrssen A. Probiotics. Am placebo-controlled study. J FamPhysician ,78:1073-1078, (2008). ClinPeriodontol ,35: 897-905, (2008). 10. Cildir SK, Germec D, Sandalli N, Ozdemir 17. Slawik Sabina, Staufenbiel Ingmar, FI, Arun T, Twetman S et al. Reduction of SchilkeReinhard, Nicksch Sonja, salivary Mutans streptococci in Weinspach Knut. Probiotics affect the
This article can be downloaded from www.ijpbs.net P- 249 Int J Pharm Bio Sci 2015 Jan; 6(1): (P) 242 - 250
clinical parameters of experimental update. J Oral Health Comm Dent ,4:35- gingivitis in humans. European Journal 37,(2010). of Clinical Nutrition, 65: 857-863, ( 2011). 22. Shivkumar,gopinath. Probiotics in 18. Della Riccia DN, Bizzini F, Perilli MG, periodontology. Indian Journal of Polimeni A, Trinchieri V, Amicosante G, et Multidisciplinary Dentistry ,1(6):315-320, al. Anti-inflammatory effects of (2011). Lactobacillus brevis (CD2) on periodontal 23. Dr.J.Bhuvaneswarri, Dr.V.Ramya, disease. Oral Dis, 13:376–385, (2007). Dr.Manisundar, Dr.Preethi.Probiotics 19. TeughelsW,LoozenG,Quirynen M. Do and Its Implications In Periodontal probiotics offer opportunities to Therapy-A Review. Indian J MedSci , manipulate the periodontal oral 2(5):11-15, (2012). microbiota?.J ClinPeriodontol 24. Jeremy P. Burton, Bernadette K. ,38(11):159-177,(2011). Drummond, Chris N. Chilcott, John R. 20. Perkrasse, BirgittaCarlsson, Carina Dahl, Tagg, W. Murray Thomson et al .The Annette Paulsson, Asa Nilsson, et al. influence of the Decreased gum bleeding and reduced probioticStreptococcussalivarius M18, on gingivitis by the probiotic Lactobacillus indices of dentalhealth in children: a reuteri. SWED DENT J , 30(2):55-56 randomised double-blind placebo- (2005). controlled trial. Journal of Medical 21. Vivek Gupta, Bhavana Gupta. Probiotics Microbiology Papers in Press ( 2013). and periodontal disease: a current
This article can be downloaded from www.ijpbs.net P- 250 Journal of Medical Microbiology (2013), 62, 875–884 DOI 10.1099/jmm.0.056663-0
Influence of the probiotic Streptococcus salivarius strain M18 on indices of dental health in children: a randomized double-blind, placebo-controlled trial
Jeremy P. Burton,1,2 Bernadette K. Drummond,3 Chris N. Chilcott,1 John R. Tagg,1,4 W. Murray Thomson,5 John D. F. Hale1 and Philip A. Wescombe1
Correspondence 1BLIS Technologies Ltd, Centre for Innovation, University of Otago, Dunedin, New Zealand Philip A. Wescombe 2Canadian Research and Development Centre for Probiotics, Lawson Health Research Institute, [email protected] St Joseph’s Health Care, London, Ontario, Canada 3School of Dentistry, University of Otago, Dunedin, New Zealand 4Department of Microbiology and Immunology, University of Otago, Dunedin, New Zealand 5Oral Sciences, Faculty of Dentistry, University of Otago, Dunedin, New Zealand
The prevalence of dental caries continues to increase, and novel strategies to reverse this trend appear necessary. The probiotic Streptococcus salivarius strain M18 offers the potential to confer oral health benefits as it produces bacteriocins targeting the important cariogenic species Streptococcus mutans, as well as the enzymes dextranase and urease, which could help reduce dental plaque accumulation and acidification, respectively. In a randomized double-blind, placebo- controlled study of 100 dental caries-active children, treatment with M18 was administered for 3 months and the participants were assessed for changes to their plaque score and gingival and soft-tissue health and to their salivary levels of S. salivarius, S. mutans, lactobacilli, b-haemolytic streptococci and Candida species. At treatment end, the plaque scores were significantly (P50.05) lower for children in the M18-treated group, especially in subjects having high initial plaque scores. The absence of any significant adverse events supported the safety of the probiotic treatment. Cell-culture analyses of sequential saliva samples showed no differences between the probiotic and placebo groups in counts of the specifically enumerated oral micro- organisms, with the exception of the subgroup of the M18-treated children who appeared to have been colonized most effectively with M18. This subgroup exhibited reduced S. mutans counts, indicating that the anti-caries activity of M18 probiotic treatments may be enhanced if the Received 22 December 2012 efficiency of colonization is increased. It was concluded that S. salivarius M18 can provide oral Accepted 26 February 2013 health benefits when taken regularly.
INTRODUCTION for dental caries, the mutans streptococci (MS) – a cluster of acidogenic, dental plaque-inhabiting streptococcal Dental caries is the most common chronic disease of species – are still recognized as major constituents of most childhood and, despite major technological advances and active dental caries lesions. Of the various MS species, it is the introduction of many new initiatives by the dental Streptococcus mutans and Streptococcus sobrinus that have profession, its prevalence continues to increase in many been principally implicated in dental caries development in populations worldwide (Bagramian et al., 2009). humans. Dental caries imposes a major health and Expression of the disease is characterized initially by economic burden internationally, and a wide variety of dissolution of the mineral portion of the tooth (white approaches for its control has been developed and applied, spot lesions), progressing to localized destruction of the with varying degrees of success. Treatments using conven- enamel and dentine, and followed ultimately by inflam- tional anti-streptococcal antimicrobials can be effective in mation of the pulp and periapical tissues if left untreated. the short-term to reduce dental plaque levels and to Whilst recent research indicates a multi-species aetiology decrease counts of MS, but, as most therapeutic antibiotics Abbreviations: BLIS, bacteriocin-like inhibitory substance; MS, mutans have relatively broad-spectrum antimicrobial activity, they streptococci; OHI-S, simplified Oral Hygiene Index. indiscriminately destroy both commensal and potentially
056663 G 2013 SGM Printed in Great Britain 875 J. P. Burton and others harmful bacteria and thereby create population imbalances 1987). However, unless stable non-cariogenic natural within the microflora. In addition, conventional antimi- variants of these strains can be derived, their acceptance crobial treatments are often unpalatable for young and application for dental caries control seems unlikely to children, resulting in poor compliance and thereby gain either regulatory or public acceptance (Hillman et al., compromising the likelihood of demonstrating beneficial 1990, 1998). outcomes. S. salivarius is a numerically predominant, exclusively The use of probiotics to effect an improvement in oral human, oral streptococcal species that is not known to health without impacting negatively on the normal oral have any disease associations in healthy humans. microbiota is a relatively new concept. Conventionally, Previously, S. salivarius TOVE-R (Tanzer et al., 1985a, b) probiotics – defined by the World Health Organization as has been shown capable of effecting a reduction in dental ‘live organisms which, when administered in adequate caries in animal models, but this strain had only relatively amounts confer a health benefit on the host’ – have almost weak bacteriocin activity in vitro (Wescombe et al., 2011, exclusively been bacteria of intestinal origin, and their 2006). Heightened interest in the probiotic potential of S. application has largely been targeted at relieving maladies salivarius stems from the recognition that some strains of the gastrointestinal tract. However, because it is now produce a particularly diverse array of bacteriocins, becoming clear that many human illnesses are related together with the demonstration that the application of either directly (for example, dental caries and periodontal strain K12, the prototype of S. salivarius probiotics, can disease) or indirectly (for example, cardiovascular disease) help control a variety of upper respiratory tract ailments to the development of oral microbiota disequilibria; new including streptococcal sore throat, otitis media and ways of reducing the disease burden imposed by these halitosis (Burton et al., 2006a, 2006b, 2011b; Wescombe dysfunctional microbial populations are being investigated et al., 2009). In addition, some S. salivarius strains have (Zarco et al., 2012). A variety of putative commensal been shown to produce the exoenzymes dextranase and bacteria have been assessed for their potential to prevent urease, the activities of which could potentially help limit dental caries. Studies based on use of the intestinal the progression of dental caries by reducing plaque probiotics Lactobacillus rhamnosus GG (Na¨se et al., 2001), accumulation and plaque acidification, respectively (Chen Lactobacillus reuteri ATCC 55739 and Bifidobacterium DN- et al., 1996; Li et al., 2000; Nascimento et al., 2009; Ohnishi 173 010 (Caglar et al., 2005) have each reported achieving et al., 1995). S. salivarius M18 (also referred to as strain reduced levels of S. mutans and, moreover, the children Mia or DSM 14685; Chilcott & Tagg, 2007), a strain taking L. rhamnosus GG developed fewer dental caries. originally isolated from a healthy adult subject during a Whilst these strains have shown some promise for the specific search for S. salivarius capable of inhibiting MS, prevention of dental caries, a new generation of probiotic has subsequently been shown to have relatively broad- strains sourced from the human oral cavity and belonging spectrum bacteriocin-like inhibitory substance (BLIS) to commensal species known to have extremely low activity against MS, and to produce both dextranase and pathogenic potential are now being developed. In this urease enzymes (Heng et al., 2011). The genome of M18 regard, a key species is Streptococcus salivarius, which has has recently been published, and its megaplasmid-encoded previously been investigated for its role in the prevention of bacteriocin repertoire includes salivaricin A, salivaricin M, pharyngitis caused by Streptococcus pyogenes (Dierksen & salivaricin MPS and salivaricin 9 (Chilcott & Tagg, 2007; Tagg, 2000), dental caries (Tanzer et al., 1985a, b), Heng et al., 2011; Wescombe et al., 2006, 2011). These periodontal disease (Guglielmetti et al., 2010; Teughels idiosyncratic characteristics of M18 make it an attractive et al., 2007) and halitosis (Burton et al., 2006a). candidate with potential application to the prevention and Many S. salivarius strains produce bacteriocins, which are treatment of dental disease. ribosomally synthesized antimicrobials that typically have a The present study provides a preliminary evaluation of S. narrow inhibitory spectrum directed against relatively salivarius M18 for its probiotic application to the closely related bacteria (Wescombe et al., 2009). In order prevention, or a reduction in the risk, of dental caries. to minimize widespread disruption within the oral The objective was to compare the influence on several microflora, bacteriocin-producing probiotics targeting readily measured indices of potential for dental caries MS are now under consideration as a replacement therapy activity in children who were given lozenges containing approach to the control of dental caries (Hillman et al., either M18 or placebo over a 3-month study period. 1987). Key characteristics of an effector strain for use in replacement therapy include: (i) the absence of virulence determinants, (ii) colonization capability, and (iii) the METHODS ability to competitively displace the target bacterium (Burton et al., 2011a). Perhaps not unexpectedly, the most Screening for antimicrobial activity. The spectrum of antimicro- bial activity of M18 was detected using the deferred antagonism common producers of anti-MS bacteriocins are other method, essentially as originally described by Tagg & Bannister strains of MS. Indeed, a number of S. mutans producing (1979). Briefly, an agar plate, comprising tryptic soy broth (BBL) strong anti-S. mutans activity have been identified as supplemented with 2 % yeast extract (Difco), 1 % CaCO3 and 0.7 % potential effectors of replacement therapy (Hillman et al., Bacto agar and adjusted to pH 6.5 before autoclaving (TSYCa), was
876 Journal of Medical Microbiology 62 Impact of S. salivarius M18 on children’s oral health seeded diametrically with a 1 cm wide inoculum of the test strain abnormalities such as ulceration, redness/inflammation, abscesses or from an 18 h culture of the producer strain grown on Columbia white patches. The surfaces examined were the lips, sulci, buccal blood agar base (Difco) supplemented with 5 % human blood using a mucosa, floor of the mouth, tongue, hard palate, soft palate and cotton swab. Following incubation for 18 h at 37 uCin5%CO2 in gingiva/alveolar processes. For analysis purposes, all abnormalities air, the culture growth was removed using a glass slide and the agar detected were treated as isolated events and the sum of abnormalities surface sterilized by exposure to chloroform vapour for 30 min, at each time point for each group was compared. followed by airing for a further 30 min. Indicator bacteria, from 18 h For the gingival health assessment, the Gingival Index of Loe & Silness Todd–Hewitt broth (Difco) cultures, were then inoculated with a (1963) was utilized. The appearance of the gingival tissues (colour, swab at right angles across the line of the original diametric streak inflammation, swelling or signs of bleeding) was recorded for six teeth culture of the test strain, and the plate was reincubated for 18 h at (the buccal aspects of the upper right second primary molar, upper 37 Cin5%CO in air. Zones of inhibition were scored as ‘2’ for no u 2 left second primary molar, upper right central incisor and lower left inhibition or ‘+’ where definite interference with the growth of the central incisor, and the lingual aspects of the lower left second indicator was evident. primary molar and lower right second primary molar). The categories and codes used were: normal gingivae, scoring 0; mild inflammation, Preparation of test material. Freeze-dried preparations of S. slight difference in colour or slight oedema, 1; moderate inflam- salivarius M18 cells were produced by the Microbial Fermentation mation, redness, oedema and glazing, 2; and severe inflammation, Unit (Fonterra, Palmerston North, New Zealand), an ISO 9001 manifesting as redness and oedema with signs of bleeding, 3. quality-accredited facility. The cell powder was blended with flavouring agents and the food-grade sugar substitutes trehalose and Plaque was scored using an adaptation of the simplified Oral Hygiene maltodextrin, prior to forming into lozenges by Good Manufacturing Index (OHI-S) of Greene & Vermillion (1964). The OHI-S has two Practice-certified Alaron Products (Nelson, New Zealand). Cell components, the Debris Index and the Calculus Index. Each of these counts were obtained just prior to commencement and at completion is based on numerical determinations representing the amount of of the study, and each lozenge was determined to contain 3.66109 debris or calculus on index tooth surfaces. The distribution of dental c.f.u. S. salivarius M18, a level that was maintained throughout the plaque was assessed following the use of a plaque-disclosing solution. 3 months of the active dosing period. The placebo differed only in The teeth scored were the same as those selected for the gingival containing additional sugar substitutes in place of the M18 cell health assessment. powder. The active and placebo preparations were identical in appearance and taste. Treatment protocol. On the first day of the study protocol, the children used a fluoride-containing toothpaste not containing any Participants. The study was approved by the Otago Ethics supplementary antibacterial agents and, under the supervision of a Committee (approval no. 02/09/099). Six schools with dental clinics dental therapist, brushed their teeth until all of their disclosed plaque on site were randomly selected. One hundred Dunedin schoolchildren had been removed. The dental therapist then flossed the children’s aged 5–10 years who had previously experienced dental caries (and teeth. With a second brush, the teeth were then brushed for 1 min had at least three dental restorations, including one placed within the using a 2 % chlorhexidine gel. Two hours later, the children were previous 12 months) were recruited into the study through their asked to suck two lozenges containing either S. salivarius M18 or the school dental clinics. Two saliva specimens were procured from each placebo. Two of the corresponding lozenges were also given to the child within a 2-week period and tested for their content of S. mutans children at the end of that school day. On days 2 and 3, the teeth were and BLIS-producing S. salivarius. The inclusion criteria for the brushed for a timed 1 min with 2 % chlorhexidine gel. Two hours treatment phase of the study were: (i) no natural strong BLIS- later, the children were given two lozenges and then another two producing S. salivarius detected, and (ii) .104 c.f.u. S. mutans ml21 lozenges just before they went home. Beyond day 3, a supply of the in at least one of the two pre-screen saliva samples. During the appropriate lozenges (plus toothpaste and toothbrushes) was recruitment phase, 18 children were excluded who were either lactose provided for home use, together with a sticker chart to encourage intolerant, allergic to dairy products, immunologically compromised and record compliance. The protocol required the children to suck or taking antibiotics. One hundred children meeting the selection two lozenges each day for 3 months, one after brushing the teeth in criteria were assigned randomly into two groups of 50 and the morning and one after teeth brushing at night. At 1, 3 and commenced the dosing programme; however, after exclusions due 7 months, the children’s mouths were examined and scored for to non-compliance or incomplete data collection, 40 (80 %) and 43 plaque distribution and clinical health as described above. Saliva (86 %) children, respectively, from each group completed the samples for analyses of dental caries indicator microbes (MS, probiotic- and placebo-dosing courses. The probiotic group com- lactobacilli and yeast) and S. salivarius (total count and probiotic prised 12 males and 28 females (mean age 8.5 years) and the placebo M18) were obtained pre-colonization and at 1, 2, 3 and 7 months. group had 21 males and 22 females (mean age 8.5 years). A Approximately 1 ml saliva was collected at each assessment. If the combination of count back of the number of lozenges returned and a child had difficulty salivating, he/she was asked to chew on a plastic sticker chart administered by the parents was used for the monitoring film (Parafilm) to stimulate saliva flow. of subject compliance. Parents/guardians were asked via telephone interview each month whether the children had experienced any ill Bacteriological analysis of saliva samples. Candida effects and these were recorded. Chromogenic agar (for Candida spp.) (Fort Richard Laboratories), Rogosa SL agar (BD Difco) (for lactobacilli) and Mitis Salivarius agar Clinical examinations. At the first visit, a dental therapist (whose (BD Difco) (for S. salivarius) were used. The MS selective medium assessment regimen had previously been calibrated) carried out a was TYCSB, as described by Van Palenstein Helderman et al. (1983). clinical examination and recorded the numbers of decayed, missing or CNA-P is a blood agar medium formulated to enhance the detection filled teeth and any new caries lesions that had occurred since the of haemolytic streptococci (Dierksen et al., 2000). Incubation was in child’s most recent school dental care visit. Also recorded at this visit air for 48 h (for Candida), in 5 % CO2 in air for 24 h (for S. (and at the 1-, 3- and 7-month visits) were data on soft-tissue health, salivarius) or was anaerobic (85 % N2,10%H2,5%CO2) for 48 h gingival health and dental plaque. (for MS or haemolytic streptococci). Saliva samples were serially diluted in sterile PBS in duplicate, and appropriate dilutions were Evaluation of soft-tissue health was based on the appearance of the plated in duplicate and cultivated under the appropriate conditions. oral mucosa and involved recording the presence of any tissue CNA-P medium was used to determine the number of b-haemolytic http://jmm.sgmjournals.org 877 J. P. Burton and others streptococci present in saliva samples; the numbers were graded from Table 1. Spectrum of antibacterial activity of strain M18 when 0 (no haemolytic colonies) to 4 (all colonies apparently b-haemolytic) tested by the deferred antagonism method on TSYCa agar (Dierksen et al., 2000). Streptex testing (Remel) established whether the haemolytic colonies on CNA-P were Lancefield group A (S. Indicator species No. strains inhibited/total tested pyogenes). Data were log10 transformed for analysis. To determine whether M18 had colonized in the child’s oral cavity, 80 represent- Actinomyces naeslundii 1/1 ative S. salivarius-like colonies from the Mitis Salivarius agar cultures Actinomyces viscosus 2/2 were sampled using toothpicks and tested for simultaneous Bacillus cereus 0/1 antagonism inhibitory activity against S. mutans OMZ 175 and Candida albicans 0/3 Micrococcus luteus I1, as described previously (Tagg & Bannister, 1979). The characteristic activity of M18 against these two indicators Clostridium perfringens 1/1 provides a specific presumptive identification of M18. In addition, Clostridium sporogenes 1/1 total streptococcal populations (taken from Mitis Salivarius agar) Corynebacterium diphtheriae 1/1 were tested for their deferred antagonism inhibitory profile (producer Enterobacter aerogenes 0/1 type) against a set of nine standard indicators, as described previously Enterococcus faecalis 1/3 (Tagg & Bannister, 1979), to further confirm the prevalence of M18 as Enterococcus hirae 1/2 a significant proportion of the oral salivary population. Escherichia coli 0/1 Haemophilus influenzae 2/3 Statistical analysis. Following the computation of univariate Klebsiella pneumoniae 0/1 descriptive statistics, bivariate associations were tested for statistical Lactobacillus acidophilus 1/1 significance using analysis of variance or Kruskal–Wallis tests (as appropriate, depending upon the distribution of the dependent Lactobacillus brevis 1/1 variable). Where the dependent variable was not normally distributed, Lactobacillus casei 1/1 it was log transformed prior to modelling. Linear regression Lactococcus lactis 1/1 modelling was used to examine the effect of the intervention while Listeria greyii 3/5 controlling for baseline status and putative confounding variables. Listeria monocytogenes 5/5 Micrococcus luteus 1/1 Moraxella catarrhalis 2/4 RESULTS Moraxella lacunata 1/1 Moraxella osloensis 1/2 Antimicrobial spectrum of S. salivarius M18 Porphyromonas gingivalis 0/2 Prevotella intermedia 0/2 To determine the potential applications of S. salivarius Proteus vulgatus 0/1 M18, an in vitro screen against a variety of bacterial species Rothia mucilagenosa 1/1 of significance for human health was carried out using the Staphylococcus aureus 3/6 deferred antagonism test (Table 1). In particular, repres- Staphylococcus cohnii 2/2 entative strains of a number of species identified as Staphylococcus hominus 1/1 causative agents of either dental caries or periodontal Staphylococcus saprophyticus 2/2 disease in humans were tested and those inhibited were: S. Staphylococcus simulans 0/0 mutans (11/11), Actinomyces naeslundii (1/1), Actinomyces Streptococcus agalactiae 2/2 viscosus (2/2), Enterococcus faecalis (1/1), Lactobacillus spp. Streptococcus mitis 1/1 (3/3) and S. sobrinus (1/1). Other important upper Streptococcus mutans 11/11 respiratory tract pathogens inhibited by M18 included all Streptococcus pneumoniae 8/8 S. pyogenes (causative agent of streptococcal sore throat), Streptococcus pyogenes 8/8 all Streptococcus pneumoniae (associated with pneumonia, Streptococcus rattus 0/1 meningitis and otitis media), half of the Moraxella Streptococcus salivarius 24/46 Streptococcus sanguis 0/1 catarrhalis (otitis media), both Streptococcus agalactiae Streptococcus sobrinus 1/1 (major cause of infant septicaemia) and half of the Streptococcus uberis 2/2 Staphylococcus aureus (regularly carried in the nasopharynx and a common source of community- and hospital- acquired infections) isolates. and 2, and the subjects were assessed as compliant if they consumed ¢75 % of the prescribed lozenges each month. Compliance and adverse reactions There were no significant differences in compliance rates Dosing with probiotics twice daily required a significant between the treatment and placebo groups. Participants commitment from the children, and therefore it was were excluded from the analysis if they failed to be assessed essential to determine the compliance rates in both the as compliant for both of the months monitored. Data for treatment and placebo arms of the trial. The chewable six participants were excluded from the treatment group strawberry lozenges proved to be a suitable delivery format, and two from the placebo group based on this compliance with compliance found to be .80 %. Compliance was criterion. Six participants dropped out of the study because monitored by the use of sticker charts and collecting and they did not like the taste of the lozenges; one was counting unused lozenges at the end of treatment months 1 eliminated because of protocol breaches, and four were lost
878 Journal of Medical Microbiology 62 Impact of S. salivarius M18 on children’s oral health to follow-up due to moving away. There were four cases of Table 3. Regression models for plaque score adverse reactions, as monitored by self-reporting using the monthly questionnaires: three were for the M18 group and B (95 % CI)* P value one was in the placebo group. None of the adverse events Plaque score at 1 month resulted in the participants leaving the trial, and none was Intercept 4.26 (2.12, 6.40) ,0.001 of a serious nature. Baseline plaque score 0.03 (20.21, 0.27) 0.816 Treatment groupD 21.12 (22.91, 0.67) 0.212 Plaque score at 3 months Colonization with M18 Intercept 5.86 (2.62, 9.10) 0.001 One of the major aims of this trial was to determine Baseline plaque score 0.27 (20.09, 0.64) 0.137 D whether dosing with M18 resulted in its persistent Treatment group 22.71 (25.4, 0.01) 0.050 Plaque score at 7 months colonization of the oral cavity, with assessments being Intercept 5.45 (2.64, 8.26) 0.001 made at day 3 and after 1, 2 and 3 months. In the M18- Baseline plaque score 20.03 (20.36, 0.30) 0.847 treated group, nine subjects retained M18 populations Treatment groupD 0.22 (22.27, 2.70) 0.859 comprising at least 5 % of their total salivary S. salivarius population at the 3-month time point. Furthermore, P- *B, regression coefficient; CI, confidence interval. typing of the 3-month samples of the total S. salivarius DReference category5control group. populations of these nine subjects showed that five gave inhibition profiles consistent with that given by pure cultures of M18. In addition to having their data evaluated together with that of the other members of the M18 this group also had relatively low preliminary plaque scores treatment group, the plaque scores and S. mutans counts (Table 2). Closer analysis of the M18 group showed that it for these nine apparently more highly colonized individuals contained fewer children falling into the high plaque score were also analysed separately to determine whether there category of ¢7 [n516 (40 %) for the M18 group versus might be additional oral health benefits associated with n526 (60 %) for the placebo group]. However, controlling colonization efficacy and persistence. for baseline plaque scores using linear regression estab- lished that the plaque scores after 3 months were significantly lower in the M18 group (Table 3). Effect on plaque Moreover, when the participants in the placebo and M18 Comparison of the total plaque scores of the two groups of groups who had high plaque scores (i.e. ¢7) at the subjects at the start of the study, after taking the lozenges beginning of the trial were followed separately, there was a for 1 and 3 months, and 4 months after dosing was strong difference between the two groups throughout the terminated (i.e. at 7 months) demonstrated that, by the treatment phase of the study, with 87.5 % of children in the end of the treatment period, there was a significant M18 treatment group maintaining lower plaque scores difference in mean plaque scores between the M18 group than their pre-treatment scores (defined as a decrease in and the placebo group (Table 2). As a consequence of the score of 3 or more), whilst only 44 % of those in the dental plaque treatment regimen given to all of the placebo group had lower plaque scores at the same time participants at the beginning of the study, there was also point (Fig. 1). a decrease in plaque scores between the start of the study While only small numbers of children were successfully and after 1 month for both groups. colonized with M18 during the study period, the plaque Although the plaque scores were lowest for the group scores of the nine who were well colonized showed a greater taking the M18 lozenges at all sampling points, it should be plaque reduction than both the entire M18- and placebo- noted that a disproportionate number of participants in treated groups. Indeed, the proportion of participants
Table 2. Summary data on plaque scores at each time point by group
Assessment time Mean (SD) P value
Treatment group (n540) Placebo (n543)
Baseline 6.0 (3.3) 6.9 (3.2) 0.182 1 month 3.4 (2.1) 4.1 (2.6) 0.175 3 months 5.3 (3.2) 7.0 (4.1) 0.022 7 months 4.7 (2.7) 4.4 (2.9) 0.852
http://jmm.sgmjournals.org 879 J. P. Burton and others
M18 colonized (n=4) Treatment (n=15) Placebo (n=24) 100
90 groups)* value (between 80 P 70 60 43) 50 5 n 40 Participants (%) 30
20 ) SD 10
13 40) Placebo (
Treatment month 5 n Soft-tissue frequency of abnormality
Fig. 1. Percentage of children for each group who had high pre- treatment plaque scores (¢7) and who demonstrated plaque score improvements of ¢3 at treatment months 1 and 3. having reduced plaque scores was much greater in the colonized group than for the placebo group or for those who were not well colonized with M18 (Fig. 1).
Gingival and soft-tissue health Analysis of the gingival health scores and soft-tissue scores showed no significant differences between the M18-treated value (between groups) Group mean (
children and the controls (Table 4). Whilst both scores P were low at the beginning of the trial, the soft-tissue scores were observed to decrease further for both groups over the course of the monitored period. 43) Treatment group ( 5 n
Salivary microbial levels Gingival score )
No significant differences between the treatment and SD placebo groups were observed in the mean S. mutans counts at any of the time points assessed (Table 5). 40) Placebo (
However, the five children who were identified as having 5 n been well colonized (by both the detection of M18-like colonies by the use of the simultaneous antagonism Group mean ( method and by having a total streptococcal P-type consistent with that of M18; i.e. P-type 677) tended to have lower S. mutans counts during the dosing phase when
compared with their baseline salivary S. mutans levels (Fig. Treatment group ( 2). The presence of S. pyogenes was monitored at the preliminary, 1-, 2- and 3-month time points by plating the saliva onto CNA-P medium. Haemolytic colonies were identified as S. pyogenes if they were positive for Lancefield serogroup A using a Streptex agglutination test. The rate of Summary data on gingival scores and soft-tissue frequency of abnormality at each time point by group S. pyogenes acquisition during the 3-month treatment phase for the M18 group was 17.9 % (seven new acquisitions) and Baseline1 month3 months7 months 2.2 (1.9) 1.5 (1.7) 2.1 (2.6) 2.4 (2.2) 2.0 (1.4) 1.7 (1.9) 2.3 (3.1) 1.8 (1.9) 0.328 0.641 0.548 0.354 0.7 (0.7) 0.4 (0.6) 0.2 (0.4) 0.1 (0.4) 0.5 (0.5) 0.4 (0.7) 0.3 (0.5) 0.1 (0.3) 0.321 0.629 0.919 0.550 Assessment time *Kruskal–Wallis test. for the placebo group was 25.6 % (ten new acquisitions). Table 4.
880 Journal of Medical Microbiology 62 Impact of S. salivarius M18 on children’s oral health
Table 5. Summary data on natural-logged S. mutans scores at each time point by group
Assessment time Mean (SD) P value
Treatment group (n540) Placebo (n543)
Baseline 1 10.7 (2.1) 10.6 (2.6) 0.868 Baseline 2 10.3 (2.4) 11.3 (2.4) 0.129 Day 3 8.9 (2.2) 9.8 (2.1) 0.061 1 Month 11.3 (2.5) 11.6 (2.8) 0.593 2 Months 11.4 (2.2) 11.7 (2.5) 0.490 3 Months 10.6 (2.3) 10.9 (2.7) 0.755 7 Months 10.4 (2.6) 11.4 (2.3) 0.156
The salivary levels of S. salivarius, lactobacilli, haemolytic indicates that this is a suitable format for use in primary- streptococci and Candida spp. did not differ substantially school-aged populations (5–12 years). Despite the high rate between the two groups (data not shown). of compliance, only 22 % of the children in the M18 group had detectable probiotic in their saliva at the end of the treatment period. This observation indicates that any DISCUSSION effects directly attributable to the presence of the probiotic are only likely to occur during the period of active dosing, Previous studies of the applicability of probiotics to the which is in contrast to S. salivarius strain K12, a probiotic prevention of dental caries have focused largely on the that has been shown to exhibit more persistent coloniza- testing of gastrointestinal tract strains that had initially tion of the human oral cavity (Horz et al., 2007). It is, been developed as probiotics to help counter gut ailments. however, noteworthy that, in the time period since the Here, we have provided evidence to support the use of S. present trial was conducted, significant improvements have salivarius strain M18 – a bacterium isolated from the been introduced to the production process for M18, human oral cavity and shown to have antibacterial activity resulting in considerably improved colonization efficacy against a number of clinically important human pathogens (J. P. Burton, unpublished data). – to reduce dental plaque accumulation in schoolchildren. In addition, the findings of this preliminary double-blind, In the present study, the primary clinical measure of placebo-controlled trial, which included the longitudinal clinical efficacy was the plaque score (as measured by the monitoring of the individuals’ soft-tissue and periodontal OHI-S), which has been ratified as an essentially valid clinical parameters, further attest to the safety of S. method for measuring oral hygiene in large epidemiolo- salivarius M18. gical studies (Broadbent et al., 2011). The plaque score was monitored for each participant prior to the start of dosing The treatment dosing regime of two lozenges per day, and then at months 1, 3 and 7. The significant plaque score taken morning and night after tooth brushing, was well difference between the M18 group and the placebo group tolerated by the individuals (compliance .80 %) and this observed at the end of the treatment phase (month 3) indicated that the regimen implemented during this study was efficacious for a reduction in dental plaque. However, M18 0500. Placebo no significant differences were observed at any of the other 0.40 time points between the two treatment groups, although
scores M18 colonized 0.30 both the placebo and M18 groups experienced a large 0.20 reduction at the 1-month time point compared with their
S. mutans 0.10 pre-treatment scores. The observed reduction in plaque 0.00 score at 1 month appeared to be due to the efficient plaque –0.10 removal carried out under the supervision of the dental –0.20
difference in hygienist as part of the initial pre-treatment regimen prior 10 –0.30 to beginning the trial. Both groups had similar plaque Log –0.40 scores at the 7-month time point, indicating that the 0930 60 0benefit of M18 treatment did not extend to 4 months past Treatment time (days) the termination of the probiotic treatment. However, for future studies, it would be beneficial to have examination
Fig. 2. Change in S. mutans scores (log10) from the pre-treatment time points closer to the end of active treatment to values for the total M18 group (n540), placebo group (n543) and determine the extent of any persistent benefit occurring subgroup (n55) that had detectable levels of M18 following post-treatment. An interesting observation was that, for the treatment (M18 colonized). subgroups with pre-treatment plaque scores of ¢7, 87.5 % http://jmm.sgmjournals.org 881 J. P. Burton and others of the M18 group and 44 % of the placebo group had of the mean numbers of S. mutans in those receiving M18 plaque score reductions of ¢3 from their pre-treatment probiotic treatment with those in the placebo group showed score at the end of treatment. This large difference between no significant difference. However, as the overall rates of the two groups indicates that M18 treatment may provide colonization were quite low, the subgroup of individuals greater benefit to individuals with existing high plaque known to have been colonized with M18 were compared for levels and may be most efficacious when used in their mean log reduction in S. mutans counts against both conjunction with a preliminary plaque removal procedure the placebo group and the entire M18 group. The M18 such as was implemented in the present study. Another colonized subgroup showed a larger decrease in S. mutans group of individuals who may derive benefit from counts than both the placebo group and the entire M18 probiotic-mediated plaque reduction are adults experi- group over the treatment period, indicating that the longer- encing gingival inflammation in whom the development of term establishment of an M18 population may be required periodontitis is closely linked to the level of plaque to impact significantly on the salivary levels of S. mutans.As accumulation (Broadbent et al., 2011). Further evidence the number of children in this colonized group was low supporting a potential role for M18 in the control of (n55), this observation must be considered preliminary and gingivitis comes from recent experiments by Adam et al. should now be supported by the conduct of further trials (2011) who investigated whether M18 could potentially using the improved fermentation and manufacturing impact on pathogen-induced pro-inflammatory cytokine procedures that have been developed more recently for expression in gingival fibroblasts. A variety of pathogens M18. Whilst it has been established that the presence of S. have been implicated in the development of both gingivitis mutans is an important risk factor for the development of and periodontitis, and the aetiology of these diseases is now dental caries, recent molecular studies have highlighted the strongly linked to the inflammatory response of the host importance of microbial consortia in the aetiology and cells to the bacterial pathogens (Fisher et al., 2010; Seymour & Gemmell, 2001). In earlier work, M18 was development of caries, and indeed S. mutans may simply act co-incubated with gingival fibroblasts both prior to and as a disease indicator organism, with its plaque predom- concomitantly with exposure to periodontal pathogens inance signifying that the oral conditions are changing to a such as Porphyromonas gingivalis, Aggregatibacter actino- more caries-active state (Marsh, 2003). mycetemcomitans and Fusobacterium nucleatum. Strain In previous studies, the impact of naturally occurring BLIS- M18 significantly inhibited the expression of the pro- producing S. salivarius on the acquisition of S. pyogenes has inflammatory cytokines IL-6 and IL-8 commonly asso- been determined to be of the order of a 47 % reduction in ciated with periodontitis, indicating that dosing with these new acquisitions (Dierksen & Tagg, 2000). In the present probiotics may potentially be useful in the treatment of study, 18 % of those in the M18 group experienced a new inflammatory periodontal diseases (Adam et al., 2011). acquisition of S. pyogenes during the treatment phase and The other clinical parameters examined in the present trial 26 % of the children in the placebo group experienced new were the soft-tissue and periodontal tissue scores. These acquisitions. Unfortunately, this analysis suffers from type outcomes were monitored largely to establish whether 2 error, as the numbers are too small. In order to there was evidence of any soft-tissue damage, ulcers or gum demonstrate statistical significance at this level of differ- disease developing as a result of the twice-daily probiotic ence, 100 individuals would have been required in each treatment regimen, thereby further monitoring and group. Nevertheless, the apparent difference in acquisition evaluating the safety of M18 and the efficacy of the observed (in spite of poor colonization efficacy occurring) delivery format for use in children. No significant may provide encouragement for the implementation of a difference was observed between the placebo or M18 larger trial investigating the protective effect of M18 against treatment group for either of these clinical parameters; S. pyogenes infections. indeed, for the soft-tissue scores, both groups showed some There were no significant differences in any of the other improvement over the course of the trial, a finding microbial indices that were measured [total Lactobacillus, providing some support for twice-daily oral dosing with Candida and S. salivarius c.f.u. (ml saliva)21].Thisis a probiotic preparation having a positive rather than a noteworthy, as large quantities of exogenous bacteria were detrimental general effect on oral health. This improve- instilled into the oral cavity twice daily for an extended ment may reflect either improved oral hygiene awareness period of time and yet there were no detectable population and/or be related to seasonal changes over the period of the shifts in these non-targeted microbes. Whilst the micro- trial. organisms quantified in the present study can constitute a S. mutans has long been considered one of the principal large proportion of the cultivatable population, it is clear that aetiological agents of dental caries, and this has also been the use of traditional microbiological culture technology supported by more modern molecular analyses (Kanasi does not suffice to detect relatively minor fluctuations in et al., 2010). In the present study, the inter- and intra- microbiota composition. In addition, the culture methodo- individual salivary levels of cultivable S. mutans appeared logy employed did not support detection of the occurrence of quite variable, a finding in part due to the difficulty of more subtle intra-species (strain-specific) population selective propagation of these bacteria. A direct comparison changes. Further studies are now being undertaken using,
882 Journal of Medical Microbiology 62 Impact of S. salivarius M18 on children’s oral health as a population analysis tool, higher-sensitivity, next-genera- expression in a dental plaque streptococcus. Infect Immun 64, 585– tion sequencing. 592. Chilcott, C. N. & Tagg, J. R. (2007). Antimicrobial composition. US In this study, we demonstrated that twice-daily dosing with Patent 7226590. the probiotic strain S. salivarius M18 is a safe and Dierksen, K. P. & Tagg, J. (2000). The influence of indigenous efficacious way of effecting a significant reduction in bacteriocin-producing Streptococcus salivarius on the acquisition of plaque formation in primary-school-aged children. In Streptococcus pyogenes by primary school children in Dunedin, New addition, whilst there was no overall reduction in S. Zealand. In Streptococci and Streptococcal Diseases Entering the New mutans carriage rates for the treatment group, the small Millenium, pp. 81–85. Edited by D. R. Martin & J. R. Tagg. Auckland: subgroup of individuals who demonstrated persistent Securacopy. colonization by the probiotic strain showed lower S. Dierksen, K. P., Ragland, N. L. & Tagg, J. R. (2000). A new alkaline mutans counts than their baseline scores, indicating that pH-adjusted medium enhances detection of b-hemolytic streptococci improved efficacy occurs when the probiotic strain is by minimizing bacterial interference due to Streptococcus salivarius. J Clin Microbiol 38, 643–650. established within the oral microbiota of the host. Fisher, M. A., Borgnakke, W. S. & Taylor, G. W. (2010). Periodontal disease as a risk marker in coronary heart disease and chronic kidney ACKNOWLEDGEMENTS disease. Curr Opin Nephrol Hypertens 19, 519–526. Greene, J. C. & Vermillion, J. R. (1964). The simplified oral hygiene We would like to acknowledge excellent technical support from index. J Am Dent Assoc 68, 7–13. Hannah Clark, Vidya Kulkarni, Chris Moore, Erin Isdale, Nikolai Guglielmetti, S., Taverniti, V., Minuzzo, M., Arioli, S., Stuknyte, M., Klesse and Megan Inglis. All funding for this trial was provided by Karp, M. & Mora, D. (2010). Oral bacteria as potential probiotics for BLIS Technologies Ltd. P. A. W. and J. D. F. H. are currently employed the pharyngeal mucosa. Appl Environ Microbiol 76, 3948–3958. by BLIS Technologies Ltd. J. R. T. was the founding scientist of the company and currently is a consultant, whilst C. N. C. and J. P. B. are Heng, N. C., Haji-Ishak, N. S., Kalyan, A., Wong, A. Y., Lovric, M., former employees. W. M. T. performed all statistical analysis of the Bridson, J. M., Artamonova, J., Stanton, J. A., Wescombe, P. A. & data and has no affiliation (financial or otherwise) with BLIS other authors (2011). Genome sequence of the bacteriocin- Technologies Ltd. producing oral probiotic Streptococcus salivarius strain M18. J Bacteriol 193, 6402–6403. Hillman, J. D., Dzuback, A. L. & Andrews, S. W. (1987). Colonization REFERENCES of the human oral cavity by a Streptococcus mutans mutant producing increased bacteriocin. J Dent Res 66, 1092–1094. Adam, E., Jindal, M., Seney, S., Summers, K., Hamilton, D. W., Hillman, J. D., Duncan, M. J. & Stashenko, K. P. (1990). Cloning and Hatibovic-Kofman, S. & Cadieux, P. A. (2011). Streptococcus salivarius expression of the gene encoding the fructose-1,6-diphosphate- K12 and M18 probiotics reduce periodontal pathogen-induced dependent L-(+)-lactate dehydrogenase of Streptococcus mutans. inflammation. In IADR/AADR/CADR 89th General Session and Infect Immun 58, 1290–1295. Exhibition, 16–19 March 2011, San Diego, CA, USA. Paper no. 150126. Hillman, J. D., Nova´ k, J., Sagura, E., Gutierrez, J. A., Brooks, T. A., Bagramian, R. A., Garcia-Godoy, F. & Volpe, A. R. (2009). The global Crowley, P. J., Hess, M., Azizi, A., Leung, K. & other authors (1998). increase in dental caries. A pending public health crisis. Am J Dent 22, Genetic and biochemical analysis of mutacin 1140, a lantibiotic from 3–8. Streptococcus mutans. Infect Immun 66, 2743–2749. Broadbent, J. M., Thomson, W. M., Boyens, J. V. & Poulton, R. (2011). Horz, H. P., Meinelt, A., Houben, B. & Conrads, G. (2007). Dental plaque and oral health during the first 32 years of life. JAm Distribution and persistence of probiotic Streptococcus salivarius Dent Assoc 142, 415–426. K12 in the human oral cavity as determined by real-time quantitative Burton, J. P., Chilcott, C. N., Moore, C. J., Speiser, G. & Tagg, J. R. polymerase chain reaction. Oral Microbiol Immunol 22, 126–130. (2006a). A preliminary study of the effect of probiotic Streptococcus Kanasi, E., Dewhirst, F. E., Chalmers, N. I., Kent, R., Jr, Moore, A., salivarius K12 on oral malodour parameters. J Appl Microbiol 100, Hughes, C. V., Pradhan, N., Loo, C. Y. & Tanner, A. C. (2010). Clonal 754–764. analysis of the microbiota of severe early childhood caries. Caries Res Burton, J. P., Wescombe, P. A., Moore, C. J., Chilcott, C. N. & Tagg, 44, 485–497. J. R. (2006b). Safety assessment of the oral cavity probiotic Li, Y. H., Chen, Y. Y. & Burne, R. A. (2000). Regulation of urease gene Streptococcus salivarius K12. Appl Environ Microbiol 72, 3050–3053. expression by Streptococcus salivarius growing in biofilms. Environ Burton, J. P., Wescombe, P. A., Cadieux, P. A. & Tagg, J. R. (2011a). Microbiol 2, 169–177. Beneficial microbes for the oral cavity: time to harness the oral Loe, H. & Silness, J. (1963). Periodontal disease in pregnancy. I. streptococci? Benef Microbes 2, 93–101. Prevalence and severity. Acta Odontol Scand 21, 533–551. Burton, J. P., Cowley, S., Simon, R. R., McKinney, J., Wescombe, P. A. Marsh, P. D. (2003). Are dental diseases examples of ecological & Tagg, J. R. (2011b). Evaluation of safety and human tolerance of the catastrophes? Microbiology 149, 279–294. oral probiotic Streptococcus salivarius K12: a randomized, placebo- Nascimento, M. M., Gordan, V. V., Garvan, C. W., Browngardt, C. M. & controlled, double-blind study. Food Chem Toxicol 49, 2356–2364. Burne, R. A. (2009). Correlations of oral bacterial arginine and urea Caglar, E., Sandalli, N., Twetman, S., Kavaloglu, S., Ergeneli, S. & catabolism with caries experience. Oral Microbiol Immunol 24, 89–95. Selvi, S. (2005). Effect of yogurt with Bifidobacterium DN-173 010 Na¨ se, L., Hatakka, K., Savilahti, E., Saxelin, M., Po¨ nka¨ , A., Poussa, T., on salivary mutans streptococci and lactobacilli in young adults. Acta Korpela, R. & Meurman, J. H. (2001). Effect of long-term Odontol Scand 63, 317–320. consumption of a probiotic bacterium, Lactobacillus rhamnosus GG, Chen, Y. Y., Clancy, K. A. & Burne, R. A. (1996). Streptococcus in milk on dental caries and caries risk in children. Caries Res 35, 412– salivarius urease: genetic and biochemical characterization and 420. http://jmm.sgmjournals.org 883 J. P. Burton and others
Ohnishi, Y., Kubo, S., Ono, Y., Nozaki, M., Gonda, Y., Okano, H., Van Palenstein Helderman, W. H., Ijsseldijk, M. & Huis in ’t Veld, J. H. Matsuya, T., Matsushiro, A. & Morita, T. (1995). Cloning and (1983). A selective medium for the two major subgroups of the sequencing of the gene coding for dextranase from Streptococcus bacterium Streptococcus mutans isolated from human dental plaque salivarius. Gene 156, 93–96. and saliva. Arch Oral Biol 28, 599–603. Seymour, G. J. & Gemmell, E. (2001). Cytokines in periodontal Wescombe, P. A., Burton, J. P., Cadieux, P. A., Klesse, N. A., Hyink, disease: where to from here? Acta Odontol Scand 59, 167–173. O., Heng, N. C., Chilcott, C. N., Reid, G. & Tagg, J. R. (2006). Tagg, J. R. & Bannister, L. V. (1979). ‘‘Fingerprinting’’ b-haemolytic Megaplasmids encode differing combinations of lantibiotics in streptococci by their production of and sensitivity to bacteriocine-like Streptococcus salivarius. Antonie van Leeuwenhoek 90, 269– inhibitors. J Med Microbiol 12, 397–411. 280. Tanzer, J. M., Kurasz, A. B. & Clive, J. (1985a). Inhibition of ecological Wescombe, P. A., Heng, N. C., Burton, J. P., Chilcott, C. N. & Tagg, J. R. emergence of mutans streptococci naturally transmitted between rats (2009). Streptococcal bacteriocins and the case for Streptococcus and consequent caries inhibition by Streptococcus salivarius TOVE-R salivarius as model oral probiotics. Future Microbiol 4, 819– infection. Infect Immun 49, 76–83. 835. Tanzer, J. M., Kurasz, A. B. & Clive, J. (1985b). Competitive Wescombe, P. A., Upton, M., Renault, P., Wirawan, R. E., Power, D., displacement of mutans streptococci and inhibition of tooth decay Burton, J. P., Chilcott, C. N. & Tagg, J. R. (2011). Salivaricin 9, a new by Streptococcus salivarius TOVE-R. Infect Immun 48, 44–50. lantibiotic produced by Streptococcus salivarius. Microbiology 157, Teughels, W., Newman, M. G., Coucke, W., Haffajee, A. D., Van Der 1290–1299. Mei, H. C., Haake, S. K., Schepers, E., Cassiman, J. J., Van Eldere, J. Zarco, M. F., Vess, T. J. & Ginsburg, G. S. (2012). The oral & other authors (2007). Guiding periodontal pocket recolonization: a microbiome in health and disease and the potential impact on proof of concept. J Dent Res 86, 1078–1082. personalized dental medicine. Oral Dis 18, 109–120.
884 Journal of Medical Microbiology 62 Persistence of the Oral Probiotic Streptococcus salivarius M18 Is Dose Dependent and Megaplasmid Transfer Can Augment Their Bacteriocin Production and Adhesion Characteristics
Jeremy P. Burton1,2,3*, Philip A. Wescombe6, Jean M. Macklaim4, Melissa H. C. Chai5, Kyle MacDonald3, John D. F. Hale6, John Tagg5, Gregor Reid1,2,3, Gregory B. Gloor4, Peter A. Cadieux2,3 1 Canadian Research and Development Centre for Probiotics, Lawson Health Research Institute, London, Ontario, Canada, 2 Division of Urology, Department of Surgery, Western University, London, Ontario, Canada, 3 Department of Microbiology and Immunology, Western University, London, Ontario, Canada, 4 Department of Biochemistry, Schulich School of Medicine and Dentistry, Western University, London, Ontario, Canada, 5 Department of Microbiology and Immunology, University of Otago, Dunedin, New Zealand, 6 BLIS Technologies Ltd, Centre for Innovation, University of Otago, Dunedin, New Zealand
Abstract Bacteriocin-producing probiotic Streptococcus salivarius M18 offers beneficial modulatory capabilities within the oral microbiome, apparently through potent inhibitory activity against potentially deleterious bacteria, such as Streptococcus pyogenes. The oral cavity persistence of S. salivarius M18 was investigated in 75 subjects receiving four different doses for 28 days. Sixty per cent of the subjects already had some inhibitor-producing S. salivarius in their saliva prior to probiotic intervention. Strain M18’s persistence was dependent upon the dose, but not the period of administration. Culture analysis indicated that in some individuals the introduced strain had almost entirely replaced the indigenous S. salivarius, though the total numbers of the species did not increase. Selected subjects showing either high or low probiotic persistence had their salivary populations profiled using Illumina sequencing of the V6 region of the 16S rRNA gene. Analysis indicated that while certain bacterial phenotypes were markedly modulated, the overall composition of the oral microbiome was not modified by the probiotic treatment. Megaplasmids encoding bacteriocins and adhesion factors were transferred in vitro to generate a transconjugant S. salivarius exhibiting enhanced antimicrobial production and binding capabilities to HEp-2 cells. Since no widespread perturbation of the existing indigenous microbiota was associated with oral instillation and given its antimicrobial activity against potentially pathogenic streptococci, it appears that application of probiotic strain M18 offers potential low impact alternative to classical antibiotic prophylaxis. For candidate probiotic strains having relatively poor antimicrobial or adhesive properties, unique derivatives displaying improved probiotic performance may be engineered in vitro by megaplasmid transfer.
Citation: Burton JP, Wescombe PA, Macklaim JM, Chai MHC, MacDonald K, et al. (2013) Persistence of the Oral Probiotic Streptococcus salivarius M18 Is Dose Dependent and Megaplasmid Transfer Can Augment Their Bacteriocin Production and Adhesion Characteristics. PLoS ONE 8(6): e65991. doi:10.1371/ journal.pone.0065991 Editor: Paul D. Cotter, Teagasc Food Research Centre, Ireland Received March 14, 2013; Accepted April 29, 2013; Published June 13, 2013 Copyright: ß 2013 Burton et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: The study was proposed by BLIS Technologies Ltd to gain further insight into the persistence properties of the organism. The company provided the lozenges for the study but did not fund the analysis of the samples collected at the university or the in vitro components of the study. Analysis and other experiments were supported by funds for University of Otago Post Graduates and by the Canadian Research and Development Centre for Probiotics at the Lawson Health Research Institute. The funders had some role in study design, assisted by providing personnel to collect raw data, but did not have a role in the analysis, decision to publish, or preparation of the manuscript (other than for final proof reading purposes). Competing Interests: The corresponding author was a former employee of the company BLIS Technologies Ltd that developed the M18 strain and supplied materials for parts of this study. The corresponding author is not a consultant for the company. JH, PW are current employees and JT is an advisor to this company. This does not alter the authors’ adherence to all the PLOS ONE policies on sharing data and materials. * E-mail: [email protected]
Introduction more than a few hours or days in the intestinal tract [1] or oral cavity [2], though there are some exceptions reported for the oral In the past, properties such as the impact of dose on probiotic cavity and vagina [3,4]. persistence and modulation of the microbiota have been less Bacterial pathogens tend to have specific virulence traits that frequently studied, as the major focus of probiotic research has facilitate their attachment and subsequent invasion, particularly been on achieving efficacious outcomes, often with the largest cost- of oral and intestinal tissue, even in the presence of a protective effective dosage regimen. Probiotics are often touted as being like layer of commensal bacteria, which themselves have adapted for small factories producing biologically active substances that benefit attachment and survival, yet, seldom do the same commensal the host, but as most probiotics rapidly transit through the oral and species become established in detectable numbers when digestive tracts following their ingestion, the likelihood of administered in probiotic formulations. This has led to the persistence at their principal target site is low. Previous studies suggestion that host factors influence the persistence of a have found that probiotic bacteria do not generally persist for microorganism newly introduced to an already established
PLOS ONE | www.plosone.org 1 June 2013 | Volume 8 | Issue 6 | e65991 Oral Persistence of Probiotic S. salivarius microbial ecosystem. Studies in which probiotic strains do not Materials and Methods persist have largely failed to elucidate whether this is because of colonisation resistance, damage to the probiotic strains during Subjects their preparation, host specific attachment incompatibilities, The protocol and consent documents were reviewed and dosage deficiencies or other mechanisms [5,6]. Interestingly, approved by the New Zealand Lower South Regional Ethics some probiotic bacteria do not appear to perform consistently Committee. Seventy-five subjects (average age of 19 years) were well in clinical studies and there appear to be often ill-defined recruited from a University class of approximately 200 students. factors relating to the manufacturing process that can influence All subjects were older than 18 years of age and gave informed the subsequent performance of a microorganism in vitro or in vivo written consent. The subjects were randomized and blinded to one [5,6,7]. In practice most probiotic strains have been propagated of four identical looking dosage groups (taking lozenges containing 6 7 8 9 in vitro many times prior to being used in scaled commercial 1610 (n=19), 1610 (n=20), 1610 (n=17) or 1610 (n=19) fermentations. During the course of serial passaging, bacteria colony-forming units [CFU] of Streptococcus salivarius M18 per dose). can slowly accumulate random mutations within their chromo- The subjects used one lozenge per day for 28 days after tooth somes or jettison rarely translated DNA [8,9]. ‘Muller’s rachet’ brushing. Samples (ca. 1 ml) of unstimulated saliva were obtained theory holds that asexual organisms (in this case bacteria kept in upon entry to the study and then each week at least 12 hours after pure culture that are not transferring or receiving DNA from lozenge treatment. their surrounding community), display genetic drift resulting in The saliva samples were serially diluted in phosphate buffered a loss of functions as a consequence of the gradual genetic saline (PBS) and 50 ml was spiral plated onto various agar media decline effected by random mutation [9,10]. including Columbia blood agar base, supplemented with 0.1% (w/ As a result of the oral microbiota being implicated in a variety of v) calcium carbonate and 5% (v/v) human blood [Fort Richards systemic conditions [11], attempts are being made to address these Laboratories, Ltd., Auckland, NZ] (BACa). Streptomycin (100 mg/ml) was added to facilitate detection of the marked through treating the oral cavity. The proximal location of the oral streptomycin resistant S. salivarius strain M18, and Mitis Salivarius cavity provides comparatively uncomplicated access for probiotics agar (MS, [Fort Richards Laboratories, Ltd.]) was used for the and for sampling to assess their impact. Studies have shown that general selection and enumeration of S. salivarius. Agar cultures the microbial composition of saliva is derived from a variety of oral were incubated for 18 hours in air supplemented with 5% CO at ecosystems, such as the dorsum of the tongue [12]. Streptococcus 2 37uC. Forty colonies having the characteristic S. salivarius salivarius has an innate capability of binding to and persisting on phenotype on the MS plate from each subject were picked into the tongue dorsum and some strains release into saliva copious a lawn culture of Micrococcus luteus I1 that had just been freshly quantities of bacteriocins that could provide a targeted way of inoculated on BACa. This indicator bacterium is known to be removing deleterious bacteria [4,13,14]. In vivo bacteriocin sensitive to a wide variety of streptococcal bacteriocin-like production is often cited as the principal means by which health inhibitory substances (BLIS). Streptococcus-like colonies that grew benefits are realised following the consumption of probiotic on BACa streptomycin (i.e. presumptive S. salivarius M18) were products [15,16]. The passage of these organisms through the picked into a freshly seeded BACa lawn culture of Streptococcus oral cavity and gut up-regulates bacteriocin production by mutans OMZ 175, an indicator strain uniquely sensitive to BLIS members of the host’s microbiota [17]. In order to achieve activities of strain M18 (Burton unpublished). Total S. salivarius sustained bacteriocin release, persistence of the probiotic bacteria populations from MS plates were also tested for bacteriocin like is likely necessary [18]. inhibitory substances by deferred antagonism testing [20]. To date, almost all of the bacteriocin-producing capability of S. salivarius appears attributable to genetic determinants localized on Streptococcus Salivarius Strains used in the Study a megaplasmid (size 160 to 220 kbp). Naturally occurring Strain M18 is used as probiotic and produces multiple transmission of these bacteriocin-encoding megaplasmids has been bacteriocins [19], and strain M182/2 is a megaplasmid-negative shown to occur both in vitro and in vivo. Their highly-flexible and thereby bacteriocin-deficient variant of strain M18, Strain propensity for acquisition, expression and de-commissioning of a M18K12p is a derivative of strain M18 that has been cured of its wide variety of bacteriocin loci may help account for the numerical original plasmid but now contains megaplasmid DNA acquired prominence of S. salivarius in the oral cavity and be a mechanistic from S. salivarius K12. Strain K12, the prototype S. salivarius basis for S. salivarius having a major role in the maintenance of a probiotic, produces a variety of megaplasmid-encoded bacteriocins balanced oral ecosystem. It has been suggested that S. salivarius including the lantibiotics salivaricin A and salivaricin B [8,21]. megaplasmids may function as repositories for bacteriocin Strain K122/2 is a megaplasmid-negative variant of strain K12. determinants acquired from a variety of oral species via Strain K12M18p is a derivative of the megaplasmid –negative strain transposition of IS elements [13]. Preliminary molecular analyses K122/2 now containing the strain M18 megaplasmid. Strain have indicated that these megaplasmids can also encode molecules JIM8777 (genome sequenced) [22], ATCC 7073T, JH (produces aiding host cell adhesion, without induction of antibiotic resistance multiple bacteriocins) [8], Min5 (produces multiple bacteriocins) [19]. [21], ToveR, ToveS [23,24], A-23-4 (salivaricin A only producer), The goal of the present study was to investigate the effect of NR [8,25] DB (non producer), 20P3 [21,26]. different dosage levels of Streptococcus salivarius M18 on the persistence of these bacteriocin-producing cells. Bacteriocin and DNA Purification and Sequence Analysis adhesion determinants have previously been identified on certain Total DNA was extracted from 500 ml of sample saliva pre- S. salivarius megaplasmids and the influence of inter-strain transfer incubated for 10 min at 37uC with 50 ml of 8.8 mmol/l of these on host cell adhesion and antimicrobial activity was dithiothreitol using the PureLinkTM genomic DNA kit (Invitrogen, evaluated using in vitro models for the purpose of tailoring Auckland, NZ) as per the manufacturer’s instructions for Gram- probiotic strains. positive bacteria. DNA was eluted from the column in 100 mlof elution buffer. The primers L-V6 (59-CAACGCGARGAACCT- TACC-39) and R-V6 (59-ACAACACGAGCTGACGAC-39)
PLOS ONE | www.plosone.org 2 June 2013 | Volume 8 | Issue 6 | e65991 Oral Persistence of Probiotic S. salivarius
+Spec were chosen to amplify the V6 hyper variable region of the 16S 37uCin5%CO2 in air. Colonies which grew on the BACa rRNA gene [27]. The following PCR reaction conditions were plate were considered to be recipient cells that had successfully used: 5 units Taq platinum: 1.7 mM MgCl, 210 mM dNTPs and acquired SalA-encoding DNA from the plasmid-containing donor 640 nM of each primer. A touchdown protocol was employed strain (i.e. they were putative plasmid recipients). These were also with: initial denaturation 94uC for 2 min; denaturation 94uC; checked for their bacteriocin-producing abilities (as described). annealing starting at 61uC and dropping with 1uC over 10 cycles with the remaining 15 cycles at 51uC; extension at 72uC; all for 45 Simultaneous Antagonism Testing of Recipient Strains seconds and a final elongation step for 2 min. A negative control with Transferred Megaplasmids including all ingredients but with water instead of DNA template, The testing for inhibitory activity of S. salivarius strains (K12, and a positive control with a lower limit of detectable DNA, were K122/2, M18, M182/2, M18K12p, K12M18p) against putative performed alongside all test reactions. PCR-products were used periodontal pathogens was carried out using the simultaneous when the negative control was free of PCR product and the antagonism method. All strains, except Porphymonas gingivalis and positive control amplified. A constant volume aliquot of each Porphymonas canoris were sub-cultured on BACa (Columbia Blood amplification product was run on a 1.5% (w/v) agarose gel to Agar Base [Difco, BD] supplemented with 0.1% (w/v) calcium determine the approximate amount of product and sent for carbonate, 5% (v/v) human blood [NZ blood service]), when sequencing at The Next-Generation Sequencing Facility (Illumina) required. P. gingivalis and P. canoris were sub-cultured on BACaHV in The Centre for Applied Genomics at the Hospital for Sick (BACa supplemented with 5 mg/ml hemin (Hemin chloride, Children, Toronto, Canada. Data analysis was performed as bovine [Sigma]) and 1 mg/ml menadione (Vitamin K [Sigma]). previously described [28]. 16S rRNA Operational Taxonomic Bacterial suspensions of P. gingivalis strains JK45, W50, P. intermedia Units seed sequences were deposited in NCBI Short Read Archive strains ATCC 25611 and BGBL and P. canoris strains P21 in 3 ml with the BioSample accession SAMN02055382. THB (Todd Hewitt Broth [Bacto, BD]) were used to make a lawn on blood-based agar (P. gingivalis strains were assessed on both In vitro Intra-species Transfer of Megaplasmids BACa and BACaHV and the remaining strains on BACa). The Using differences in sensitivity to antibiotics and bacteriocin of plates were incubated at 37uC, anaerobically for four days or until both megaplasmid donor and recipient strains, the transcongu- a confluent lawn was observed. gants were generated and confirmed by ERIC-PCR [8]. In brief, The simultaneous antagonism method was used to detect the the plasmid donor strain (M18 or K12) was grown on CNA-P agar ability of a producer strain (S. salivarius) to inhibit the growth of co- (a medium that represses salivaricin A [SalA] and salivaricin B seeded indicator strains. A lawn of P. intermedia, P. gingivalis or P. [SalB] production) [29] while the recipient strain (M182/2 or canoris on either BACaHV or BACa from cells suspended in 3 ml K122/2, plasmid-negative derivatives resistant to 500 mg/ml THB to a 0.5 McFarland Standard onto a fresh agar plate. Then a streptomycin or spectinomycin) in brain heart infusion (BHI) pure-producer colony, which was ‘picked’ and then ‘stabbed’ into (Difco, MD) for 18 h at 42uC in a candle jar. Plasmid donor cells the agar plate, already inoculated with the lawn. These were were collected on a sterile cotton swab and resuspended in 5 ml incubated anaerobically, at 37uC, for 2–4 days or until the lawn of fresh BHI. One milliliter of the plasmid recipient strain was added the indicator strain was confluent. The resulting zone diameter to the mixture and then incubated in a candle jar for 18 h at 42uC was recorded. (incubation above 37uC represses SalA and SalB production). Positive controls were included in all experiments and consisted Attachment of S. Salivarius Strains to HEp-2 Cells only of donor cells or recipient cells in 5 ml BHI. Samples of the Streptococcus salivarius strains were tested for their ability to bind control and test mixtures were taken at 0, 2, 4 and 18 h using a to the mammalian HEp-2 cells; M18, M182/2 (megaplasmid cotton swab that was dipped into the BHI culture and then used to deficient), M18K12p and K12M18P (as derived above with + swab the surface of a BACa Str plate. The plate was incubated for exchanged megaplasmids), K12, K122/2 (megaplasmid deficient), 18 h at 37uCin5%CO2 in air. JIM8777, ATCC7073, Min5, Tove R, Tove S and JH. To assess Subsequent selection for SalA- and spectinomycin-resistant adherence, HEp-2 cells (ATCC CCL23) were grown into a colonies was carried out as follows; Streptococcus salivarius A23-4, a monolayer in flat-bottomed 96-well plates while S. salivarius strains SalA producer (and therefore possesses the SalA immunity genes) of interest inoculated in 3 ml THB and incubated overnight, at was inoculated diametrically across a BACa plate and incubated 37uCin5%CO2 in air. Overnight bacterial cultures were spun in for 18 h at 37uCin5%CO2 in air. Visible bacterial growth was micro-centrifuge tubes for 5 minutes. The supernatant was removed the next day using the edge of a microscope slide, discarded and the cells were suspended in PBS before being following which the plate surface was exposed to chloroform centrifuged again for 5 minutes. Cells were resuspended in vapors for 30 min to kill residual producer cells. The plate was left Dulbecco’s Modified Eagle’s Medium (DMEM) [Invitrogen, to air for 1 h leaving only the deposited bacteriocin. A cotton swab Auckland, NZ] and diluted to 56105–56106 cells/ml. To obtain charged with growth from each BACa+Str plate was then used to an initial cell count, the samples were further diluted up to 1025 streak across the sterilized BACa plates and the plate incubated at and plated out using the Miles-Misra method technique (10 mlin 37uCin5%CO2 in air for 18 h. Thirty SalA-resistant colonies in triplicate per dilution per strain) onto 2YT agar plates [30]. The this region were picked off and stab-inoculated onto a BACa plate monolayers of HEp-2 cells were washed three times in PBS and pre-seeded with an Micrococcus luteus I1 lawn, which is highly then mixed with 100 ml of strain of interest into each well sensitive to antimicrobial activities. The lawn was seeded by containing HEp-2 cells. All tests were carried out in triplicate and charging a cotton swab with a I1 THB culture (18 h, 37uC, 5% incubated for 3 hours at 37uCin5%CO2 in air. The wells were CO2 in air) and creating a confluent lawn over the entire BACa then washed three times in PBS to remove non-adherent bacteria. plate. This was then incubated for 18 h at 37uCin5%CO2 in air. To dissociate the HEp-2 cells from the wells, 30 ml of 0.5 g/l Donor and recipient cells were stab- inoculated onto each plate as trypsin and 0.2 g/l EDTA solution was added to each well and positive and negative controls. SalA-resistant colonies which incubated for 30 minutes at 37uCin5%CO2 in air. Using an produced a detectable inhibition zone against I1 were then struck inverted microscope, cells were checked to ensure that most HEp- onto a BACa+Spec plate (100 mg/ml) and incubated for 18 h at 2 cells have been dissociated from the wells. Then 70 ml of THB
PLOS ONE | www.plosone.org 3 June 2013 | Volume 8 | Issue 6 | e65991 Oral Persistence of Probiotic S. salivarius was added to the wells and pipette used to dislodge the HEp-2 cells subjects had Streptococcus salivarius which produced antimicrobial from the walls. These were then plated using the Miles-Misra substances, which inhibited at least 3/9 indicator organisms, tested technique onto 2YT agar plates and incubated at 37uCin5% (data not shown). None of the subjects carried S. salivarius strains CO2 in air, overnight. For enumerating S. salivarius in cell- having inhibitory activity against Streptococcus mutans OMZ 175, an association assays, 2YT (yeast/tryptone) agar (2% (w/v) tryptone organism sensitive to the bacteriocin produced by strain M18, as [Bacto, BD], 1% (w/v) yeast extract [Bacto, BD], 1% (w/v) tested against 40 isolated S. salivarius colonies from each subject sodium chloride, 1.5% (w/v) bacteriological agar) was used. (data not shown). Percentage adherence for each strain was calculated by determin- ing the average number of CFU per dilution (as CFU/ml), this Streptococcus Salivarius M18 Oral Persistence Appears value was divided by the initial number of colonies/ml added to Partially Dose Dependent the corresponding well and then multiplied by 100. No differences in the total mean salivary S. salivarius (CFU/ml) for each subject was found from baseline during the course of Detection of Adhesion Factors dosing with strain M18 (Figure 2a). To enumerate strain M18, Twenty colonies from a fresh culture on solid media were saliva was plated on CABCa agar supplemented with 100 mg/ml individually resuspended in 300 ml of 0.85% (w/v) NaCl in 1.5 ml streptomycin. An average background level of approximately microfuge tubes and were DNA extracted. The genes encoding 16103 CFU/ml of naturally resistant S. salivarius was detected in cspA, cspB, orf 166 and orf 176 were investigated through PCR. the baseline samples (Figure 2b). However, after dosing with M18, The cspA and cspB products were amplified with primers (59-39), the levels of streptomycin resistant S. salivarius increased substan- cspA forward; GCC TAA CGC TAC GGA TAC TGC TAA T, tially, indicative of the strain’s presence within the salivary cspA reverse; ACT GCT CCT CCT GCC TGT GAA G, cspB microbiota. The exception was the lowest dosage group, which forward; CCA ACA TAA AGG GAC ACC AAC TAC GAG, only showed an increase in streptomycin resistant S. salivarius in the cspB reverse; CCC ATC CGG ATT AAC GCT ACC A. 4-week sample. Progressive increases in strain M18 dosage resulted Amplification utilised an initial denaturation step at 92uC for 2 in correspondingly greater proportions of streptomycin resistant S. minutes, annealing at 55uC for 2 minutes, followed by elongation salivarius in the salivary population. In the highest dosage group at 65uC for 5 minutes. This was followed by 32 cycles of (16109 CFU/dose/day), the putative M18 colonisation levels were denaturation at 92uC for 30 seconds, annealing at 55uC for 30 one log higher than in the other dosage groups. seconds and elongation at 65uC for 3 minutes. The PCR conditions for the amplification of orf 166 and orf 176 used The log counts showed that subjects who received higher primers Orf 166 forward; CGA GAG TTT GCT GCC ATA CA, probiotic dose retained higher numbers of M18 (Figure 3a). The Orf 166 reverse; GGC AAC ACC AGC GTT TTT AC, Orf 176 percentage of subjects having the M18 strain detected in their forward; CTT TCT CGA CAG TAA GGC GG and Orf 176 saliva increased with the dose quantity (Figure 3b). However, after reverse; TGA AAT TCC AAC TCC TTG CC and included an day seven, the salivary probiotic numbers did not appear to initial denaturation step at 94uC for 2 minutes, followed by 30 increase, despite further dosing. The trend was for the cell cycles of denaturation at 94uC for 30 seconds, then annealing at numbers to slowly track downwards. 55uC for 30 seconds and elongation at 72uC for 1 minute. This was followed by a final elongation step at 72uC for 5 minutes. V6 Region 16S rRNA Sequence Analysis of the Salivary Microbiota does not Indicate Major Perturbations by Co-aggregation Assay Probiotic Instillation To determine the ability of S. salivarius to co-aggregate with To determine whether instillation of an exogenous organism strains Porphyromonas gingivalis ATCC 33277, Aggregatibacter actino- influenced the composition of the salivary microbiota when mycetemcomitans V29523 and Fusobacterium nucleatum FH2, the S. persisting at different levels, six subjects that exhibited the most salivarius strains were inoculated into 10 ml THB and incubated at consistently low or high levels of M18 salivary levels had their 37uC, in 5% CO2 in air, overnight. The periodontal pathogen microbial composition examined in greater detail. The average strains were inoculated into THB and incubated at 37uC strain M18 salivary persistence levels were log 5.34 for the subjects anaerobically for 2–3 days. The bacteria were harvested by in the high persistence group compared to 4.15 for the those in the centrifugation at 30006g for 10 minutes and washed three times in low persistence group (P = 0.0026). 16S rRNA gene V6 region 1 ml volumes of aggregation buffer (0.121 g Tris, 0.022 g calcium amplification and sequencing yielded an average of 258, 210 chloride, 0.031 g hydrated magnesium chloride, 8.766 g sodium sequences per sample. These were consigned to 197 operational chloride/L) to ensure complete removal of culture medium. The taxonomic units (OTU) based upon grouping sequences using a cell suspensions were diluted 100-fold with aggregation buffer and 95% DNA sequence identity cutoff. The number of sequence 500 ml aliquots of each periodontal pathogen was individually reads per OTU was converted to the total proportion per sample. mixed with 500 ml of each of the test S. salivarius strains. The The first five OTU groups accounted for more than 50% of the turbidity of the mixtures were recorded at 15 minutes, 40 minutes total sequences and the top ten accounted for over 70% of and 8 hours, and given a score depending on the aggregation. sequence types. Analysis of the composition of all samples from the subjects indicated no significant ecological shifts in the microbiota Results following the probiotic dosing by weighted UniFrac analysis Indigenous S. salivarius Strains Commonly Produce (Figure 4 & 5). The relationships between the samples predom- inantly appeared to cluster by participant; that is, a subject’s Bacteriocins microbiota was most similar to itself at all time points than it was S. salivarius Sixty two per cent of subjects had BLIS-producing compared to any other subjects whether in either the ‘high’ or detected in their saliva prior to dosing and in 21% of these ‘low’ groups (Figure 5). individuals the BLIS producers represented .80% of the total S. salivarius population (Figure 1). Further analysis of this BLIS activity using the P-typing method [20] showed that 26% of
PLOS ONE | www.plosone.org 4 June 2013 | Volume 8 | Issue 6 | e65991 Oral Persistence of Probiotic S. salivarius
Figure 1. Total proportion of bacteriocin-like inhibitory substance producing Streptococcus salivarius in saliva samples in all subjects tested prior to probiotic treatment. doi:10.1371/journal.pone.0065991.g001
Megaplasmid Transfer Results in a Recipient Strain with K12 and M18 must harbour the BLIS activities against strains Hybrid Characteristics ATCC25611 and BGBL, as their plasmid-negative derivatives lost All the S. salivarius strains tested, except strain NR, had the ability to inhibit these same strains (Table 1). Inhibition of inhibitory activity against P. intermedia. The plasmids of strains P. gingivalis strains JK45, W50, and P. canoris strain P21 was media-
Figure 2. a. Streptococcus salivarius colony forming units obtained on Mitis Salivarius agar over duration of the study from the saliva of subjects that received differing doses of S. salivarius M18 (error bars denote ±SD). b. Streptococcus salivarius colony forming units obtained on Mitis Salivarius agar containing streptomycin as also used as a selective marker for the probiotic strain (error bars denote 6SD). doi:10.1371/journal.pone.0065991.g002
PLOS ONE | www.plosone.org 5 June 2013 | Volume 8 | Issue 6 | e65991 Oral Persistence of Probiotic S. salivarius
Figure 3. a. Mean number of S. salivarius M18 detected in saliva samples at different time points receiving different probiotic doses (error bars denote ±SD). b. Percentage of subjects with S. salivarius M18 detected in saliva samples. doi:10.1371/journal.pone.0065991.g003 dependent with inhibition on either BaCa or BaCaHV agar, M18 (Burton unpublished) and therefore all values were consid- depending on the indicator and producer strain (Table 1). After ered adherence. Previous studies have looked at S. salivarius prolonged incubation of the indicators (up to seven days), the adhesion to other bacteria and the host epithelium at the cellular zones of inhibition were no longer visible, indicating that the and molecular level [31,32]. To elucidate why the change of initially observed inhibitory activity may have been bacteriostatic. adhesion characteristics of the wild type strains and subsequent Some synergy between chromosomal and extra chromosomally change upon megaplasmid loss or acquisition, strains of S. salivarius encoded elements exist as after megaplasmid transfer some of the were evaluated by PCR for their presence or absence of genes antimicrobial activities were different in the transconjugants, for associated with these properties, namely cspA, cspB, orf 166 and orf example M18 and K12 wild type strains both inhibited strain 176 (Table 2). Strains positive for cspA also have cspB, but did not JK45 on BACa, but neither of the transconjugants displayed this necessarily possess orf 166 and orf 176. Strangely, cspA and cspB activity on the same media. were not detected for the K12M18p strain which may indicate modification or deletion post transfer of the megaplasmid in this Multiple Factors are Involved in the Attachment of M18 case. to Host and Bacterial Cells All S. salivarius strains co-aggregated to some extent with P. Neither M18 nor its megaplamid-cured derivative could adhere gingivalis ATCC 33277 (Table 3). Strain M18, containing the to HEp-2 cells. However, strain K12 (and its variant strains pSsalK12 plasmid had higher co-aggregation capability than including the megaplasmid deficient K122/2 and the transconju- either the parent or plasmid-free variant. None of the S. salivarius gant containing the M18 plasmid K12M18p), adhered well in vitro co-aggregated with A. aggregatibacter V29523, and only ATCC 7073 (Figure 6). Strain M18K12p had a relative adherence in excess of (a fibrillated S. salivarius strain used as a positive control) co- 400%, whereas, both the wild type and cured derivatives of strain aggregated with F. nucleatum FH2. M18 had adherence scores of fewer than 10%. Previous studies have shown that it is not possible for the HEp-2 cells to internalise
PLOS ONE | www.plosone.org 6 June 2013 | Volume 8 | Issue 6 | e65991 Oral Persistence of Probiotic S. salivarius
Figure 4. Each bar represents a single saliva sample and each cluster of bars is a single participant (starting at time 0 and sampled once a week for up to 4 weeks total). The colored segments represent the relative fraction of each bacterial taxon detected at 1% relative abundance or greater (twenty most predominant OTU shown). Sequences at less than 1% abundance have been included in the ‘‘remainder’’ fraction at the top of the bar (see color legend of bacterial taxa). doi:10.1371/journal.pone.0065991.g004
Discussion In the present study, BLIS-producing S. salivarius were shown to be a very common component of the indigenous salivary microbiota and indeed the majority of individuals yielded isolates displaying some inhibitory BLIS activity. Previous studies on pharyngitis, tonsillitis, dental caries and cystic fibrosis have shown a correlation between a reduction in the levels of potential bacterial pathogens and the presence of these ‘‘antagonistic’’ streptococcal commensals within the upper respiratory tract microbiota [33,34,35,36,37,38,39,40]. However, probiotic appli- cation of BLIS-producing bacteria for prevention of infection has been limited [14]. There is some evidence that these probiotic organisms can confer the same level of protection as naturally harboured strains [40,41,42]. While antimicrobial activities may not be the only mechanism involved in host protection by indigenous S. salivarius, achieving persistence of probiotics likely requires mimicking the natural conditions, which is likely to be important in conferring protection. Persistent low-level dosing did not appear to lead to cumulative increases in the proportion of the probiotic within the indigenous salivary population. However, the levels of persistence increased with higher doses. This has implications for the clinical applications of probiotics, which are often recommended to be given daily, because most do not colonize the host. Plus, their concentrations are invariably not high (apart from VSL#3 for inflammatory bowel disease), so they are often administered over the course of a day. The ability of a probiotic to persist at the target site likely allows the organism to have a greater impact on Figure 5. Diversity of the salivary microbiota and if either high the host. or low M18 probiotic persistence had a significant impact. Box The total number of S. salivarius detected in the saliva of an plots show weighted UniFrac distances. individual did not appear to be increased above the baseline level, doi:10.1371/journal.pone.0065991.g005 even when doses of up of 100 times the background levels of
PLOS ONE | www.plosone.org 7 June 2013 | Volume 8 | Issue 6 | e65991 Oral Persistence of Probiotic S. salivarius
Table 1. Simultaneous antagonism of S. salivarius wild type and modified strains against selected oral bacteria.
Simultaneous inhibition of indicator straina and agar type tested
P. intermedia P. gingivalis JK45 P. gingivalis W50 P. canoris P21 ATCC 25611 P. intermedia BGBL
Producer strain P-Type BACa BACaHV BACa BACaHV BACa BACaHV BACa BACa
K12 777 +++ +++ + + +++ +++ ++ + K122/2 000 2 +++++ +++ 22 M18 677 +++ +++ ++ + ++ +++ +++ ++ M182/2 000 22 + 22++ 22 M18K12p 777 2 ++ ++ + +++ +++ ++ + K12M18p 677 2 – ++ +++++ 2
adiameter of inhibition zones (mm) – ‘‘2’’, no inhibition; ‘‘+’’, #3 mm; ‘‘++’’, #5 mm, ‘‘+++’’, #7 mm. doi:10.1371/journal.pone.0065991.t001 indigenous S. salivarius were administered. This implies that there is The absence of such disturbances actually supports the safety of a limited capacity for the host to increase its microbiota species strain M18, as regulatory agencies view disruption of the load. It also raises the question of what mechanisms pathogens use, indigenous microbiota of healthy subjects as undesirable. and that are not present in probiotic or commensal strains, to Our group [8] has demonstrated the transfer of bacteriocin- integrate or by-pass the indigenous microbiota. encoding plasmids into indigenous oral S. salivarius strains. The In some subjects there clearly was a high level of persistence of present study has demonstrated the first in vitro transfer of the bacteriocin-producing probiotic strain. Indeed, in some bacteriocin-encoding megaplasmids between two strains of S. subjects a substantial proportion of the original S. salivarius salivarius. This opens up the possibility of creating tailor-made population was replaced. 16S rRNA gene sequence analysis of probiotic strains through the transmission of megaplasmids from subject’s samples with either high or low probiotic persistence did poorly-persisting, antimicrobial producing S. salivarius strains into not show remarkable change in the predominant microbial poor bacteriocin-producing but strongly persisting indigenous S. composition. This echoes the findings of McNulty et al. (2011) salivarius, strains potentially conferring better protection to the who showed that probiotic yogurt did not alter the gut microbiota host. [43]. The microbiota of the young adults tested here seemed to be Adhesion is an essential first step for any colonisation of the oral relatively robust with regards to perturbation by probiotic cavity since non-adherent bacteria will be rapidly washed away in instillation (Figure 4). While there were some bacterial types that the salivary flow. The binding of bacteria to tissue cells involves were significantly different in their proportions both compared to specific adhesins [44,45]. These include proteins that contain a pre samples and between the two persistence groups, these changes did not represent major perturbations of the microbiota. Table 2. The distribution of cspA, cspB, orf 166 and orf 176 in S. salivarius strains having differing adhesion capabilities to HEp-2 cells.
Relative adherence to HEp-2 cells Strains cspA cspB orf 166 orf 176 (%)
M18K12p ++++449 K12M18p 2222316 K12 + + + + 288 K122/2 2222254 JIM8777 222293 ATCC7073 222227 Min5 ++2 + 10 Tove-R 22225 M182/2 22223 M18 + + 221 Figure 6. Relative adhesive abilities of Streptococcus salivarius strains to HEp-2 cells with different megaplasmid combina- Tove-S ++2 + 1 tions. (Error bars denote 6SD, the method of Turkey was used for JH ++2 + 0 multiple comparisons (*p,0.05, **p,0.01, ***p,0.001) and signifi- cance shown where the K12 megaplasmid was inserted into non ‘‘+’’ indicates positive for the gene and ‘‘2’’ indicates negative for the gene. adherent M18 strain. Bolded strains are wild type. doi:10.1371/journal.pone.0065991.g006 doi:10.1371/journal.pone.0065991.t002
PLOS ONE | www.plosone.org 8 June 2013 | Volume 8 | Issue 6 | e65991 Oral Persistence of Probiotic S. salivarius
Table 3. The extent of co-aggregation of S. salivarius to periodontal organisms.
a S. salivarius strain Co-aggregation of periodontal pathogens as a function of time Aggregatibacter actinomycetemcomitans Fusobacterium nucleatum FH2 V29523 Porphyromonas gingivalis ATCC 33277
15 min 40 min 8 hr 15 min 40 min 8 h 15 min 40 min 8 h
ATCC 7073T (++)(++) +++ 222(++)(++) +++ M18 222222+ (+)(+) M18K12p 222222(++)(++) ++ M182/2 222222(2)(2) + K12 222222++ ++ ++ K12M18p 222222++ ++ ++ K122/2 222222+++++
‘‘–‘‘ Indicates no co-aggregation, evenly turbid suspension, ‘‘+’’’weak precipitation with evenly turbid supernatant, ‘‘++’’moderate precipitation with evenly turbid supernatant and evidence of flocculation ‘‘+++’’substantial precipitation with clear supernatant and some flocculation, () brackets indicates half-way between number of indicated ‘+’ and the number above it. doi:10.1371/journal.pone.0065991.t003
LPXTG motif (membrane anchor) near the C terminus [46], such degree of specificity between strains not due to fimbriae, as the as cspA and cspB (cell-surface protein A & B) [32]. Le´vesque et al. fimbriated K- strain, ATCC 25975 was unable to bind to F. [32] suggested that cspB may be associated with fimbriae, and thus nucleatum This finding was similar to that of Levesque et al. [52] could contribute to adhesion specificity, as fimbriae have been except in their case, a F. nucleatum strain co-aggregated with strain noted to be key components of the cell-to-surface and cell-to-cell ATCC 25975, as well as a fimbriae-negative mutant of strain adhesion of oral bacteria [47]. Another surface component, the ATCC 25975 called strain D37. This further rules out a role for fibrils are also important for adhesion of streptococci to oral fimbriae in coaggregation. surfaces and co-aggregation with other oral bacteria [31,48]. In conclusion, this study has shown that the persistence of a In the present study, CspA and CspB proteins were found to be probiotic S. salivarius strain in the mouth was dose dependent. This plasmid-encoded on M18 and K12, but was also detected the ability to persist could allow the probiotic the opportunity to more poorly adhering Tove-S, ATCC25975 and JH strains. Levesque effectively counter pathogens as well as inducing host gene et al. [32] suggested that the Orf176 protein might also be a expression pathways of homeostasis and cytoskeletal repair in the transcriptional regulator for cspA and cspB and also orf166, which K12p epithelial lining [54,55]. The use of high dose M18 to treat and encodes cell-surface protein [49]. Only strains M18 (with the prevent oral diseases, in comparison to antibiotics, warrants pSsalK12 megaplasmid) and wild-type K12 possessed all four further clinical testing with the hope of providing alternative genes. Orf166 may have a role in the adhesion of S. salivarius to option in dental practice. HEp-2 cells since strain M18K12p had a high relative adherence to HEp-2 cells but strain M18 showed poor adhesion. This suggests Acknowledgments that Orf166 helps to mediate the adhesion process and in future studies deficient derivatives may assist in determining this. The assistance of Jacqueline Widjaja, Chris Chilcott, Vidya Kulkarni and However, as strain K122/2 also adhered strongly to HEp-2 cells, Megan Inglis in the undertaking of these studies is greatly appreciated. so other factors must also promote K12 adhesion. Co-aggregation has been documented for strains of the oral Author Contributions cavity [50,51], including S. salivarius and periodontal pathogens Conceived and designed the experiments: JB PW JM MC KM JH JT GR [52]. It has been suggested that S. salivarius co-aggregation with GG PC. Performed the experiments: JB PW JM MC KM GG PC. potential pathogens may be a means of eradicating the reservoir of Analyzed the data: JB PW JM MC KM JH JT GR GG PC. Contributed the salivary anaerobes [53]. Of the S. salivarius strains tested here, reagents/materials/analysis tools: JB PW JM MC KM JT GR GG PC. only ATCC 7073 (a fimbriated K+ strain, carrying fibrils) was able Wrote the paper: JB PW JM MC KM JH JT GR GG PC. to co-aggregate with F. nucleatum. This is interesting as it implies a
References 1. Tannock GW, Munro K, Harmsen HJ, Welling GW, Smart J, et al. (2000) Fermentation Conditions Enables Identification of Bacterial Robustness Analysis of the fecal microflora of human subjects consuming a probiotic product Markers. PLoS One 7: e39053. containing Lactobacillus rhamnosus DR20. Appl Environ Microbiol 66: 2578–2588. 6. Bron PA, Wels M, Bongers RS, van Bokhorst-van de Veen H, Wiersma A, et al. 2. Caglar E, Topcuoglu N, Cildir SK, Sandalli N, Kulekci G (2009) Oral (2012) Transcriptomes Reveal Genetic Signatures Underlying Physiological colonization by Lactobacillus reuteri ATCC 55730 after exposure to probiotics. Variations Imposed by Different Fermentation Conditions in Lactobacillus Int J Paediatr Dent 19: 377–381. plantarum. PLoS One 7: e38720. 3. Burton JP, Cadieux PA, Reid G (2003) Improved understanding of the bacterial 7. Grzeskowiak L, Isolauri E, Salminen S, Gueimonde M (2011) Manufacturing vaginal microbiota of women before and after probiotic instillation. Appl process influences properties of probiotic bacteria. Br J Nutr 105: 887–894. Environ Microbiol 69: 97–101. 8. Wescombe PA, Burton JP, Cadieux PA, Klesse NA, Hyink O, et al. (2006) 4. Burton JP, Wescombe PA, Moore CJ, Chilcott CN, Tagg JR (2006) Safety Megaplasmids encode differing combinations of lantibiotics in Streptococcus assessment of the oral cavity probiotic Streptococcus salivarius K12. Appl Environ salivarius. Antonie Van Leeuwenhoek 90: 269–280. Microbiol 72: 3050–3053. 9. Sybesma W, Molenaar D, van Ijcken W, Venema K, Kort R (2013) Genome 5. van Bokhorst-van de Veen H, Lee IC, Marco ML, Wels M, Bron PA, et al. instability in Lactobacillus rhamnosus GG. Appl Environ Microbiol. (2012) Modulation of Lactobacillus plantarum Gastrointestinal Robustness by
PLOS ONE | www.plosone.org 9 June 2013 | Volume 8 | Issue 6 | e65991 Oral Persistence of Probiotic S. salivarius
10. Andersson DI, Hughes D (1996) Muller’s ratchet decreases fitness of a DNA- 34. Roos K, Hakansson EG, Holm S (2001) Effect of recolonisation with based microbe. Proc Natl Acad Sci U S A 93: 906–907. "interfering" alpha streptococci on recurrences of acute and secretory otitis 11. Offenbacher S, Beck JD, Moss K, Mendoza L, Paquette DW, et al. (2009) media in children: randomised placebo controlled trial. BMJ 322: 210–212. Results from the Periodontitis and Vascular Events (PAVE) Study: a pilot 35. Roos K, Holm SE, Grahn E, Lind L (1993) Alpha-streptococci as supplementary multicentered, randomized, controlled trial to study effects of periodontal treatment of recurrent streptococcal tonsillitis: a randomized placebo-controlled therapy in a secondary prevention model of cardiovascular disease. J Periodontol study. Scand J Infect Dis 25: 31–35. 80: 190–201. 36. Sanders CC, Nelson GE, Sanders WE (1977) Bacterial Interference. IV. 12. Aas JA, Paster BJ, Stokes LN, Olsen I, Dewhirst FE (2005) Defining the normal Epidemiological determinants of the antagonistic activity of the normal throat bacterial flora of the oral cavity. J Clin Microbiol 43: 5721–5732. flora against group A Streptococci. Infect Immun 16: 599–603. 13. Wescombe PA, Heng NC, Burton JP, Chilcott CN, Tagg JR (2009) 37. Bochkov IA, Semina NA (1981) [Role of Streptococcus salivarius in maintaining the Streptococcal bacteriocins and the case for Streptococcus salivarius as model ecologic balance of the human nasopharynx]. Zh Mikrobiol Epidemiol oral probiotics. Future Microbiol 4: 819–835. Immunobiol: 38–41. 14. O’Shea EF, Cotter PD, Ross RP, Hill C (2013) Strategies to improve the 38. Dierksen KP, Tagg J (2000) The influence of indigenous bacteriocin-producing bacteriocin protection provided by lactic acid bacteria. Curr Opin Biotechnol. Streptococcus salivarius on the acquisition of Streptococcus pyogenes by primary 15. Dobson A, Crispie F, Rea MC, O’Sullivan O, Casey PG, et al. (2011) Fate and school children in Dunedin, New Zealand. In: Martin DR, J T, editors. efficacy of lacticin 3147-producing Lactococcus lactis in the mammalian Streptococci and streptococcal diseases entering the new millenium. Auckland: gastrointestinal tract. FEMS Microbiol Ecol 76: 602–614. Securacopy. 81–85. 16. Corr SC, Li Y, Riedel CU, O’Toole PW, Hill C, et al. (2007) Bacteriocin production as a mechanism for the antiinfective activity of Lactobacillus salivarius 39. Filkins LM, Hampton TH, Gifford AH, Gross MJ, Hogan DA, et al. (2012) The UCC118. Proc Natl Acad Sci U S A 104: 7617–7621. Prevalence Of Streptococci And Increased Polymicrobial Diversity Associated 17. Dierksen KP, Moore CJ, Inglis M, Wescombe PA, Tagg JR (2007) The effect of With Cystic Fibrosis Patient Stability. J Bacteriol. ingestion of milk supplemented with salivaricin A-producing Streptococcus salivarius 40. Di Pierro F, Adami T, Rapacioli G, Giardini N, Streitberger C (2013) Clinical on the bacteriocin-like inhibitory activity of streptococcal populations on the evaluation of the oral probiotic Streptococcus salivarius K12 in the prevention of tongue. FEMS Microbiol Ecol 59: 584–591. recurrent pharyngitis and/or tonsillitis caused by Streptococcus pyogenes in adults. 18. Tagg JR, Dajani AS, Wannamaker LW (1976) Bacteriocins of gram-positive Expert Opin Biol Ther. bacteria. Bacteriol Rev 40: 722–756. 41. Masdea L, Kulik EM, Hauser-Gerspach I, Ramseier AM, Filippi A, et al. (2012) 19. Heng NC, Haji-Ishak NS, Kalyan A, Wong AY, Lovric M, et al. (2011) Genome Antimicrobial activity of Streptococcus salivarius K12 on bacteria involved in oral sequence of the bacteriocin-producing oral probiotic Streptococcus salivarius strain malodour. Arch Oral Biol 57: 1041–1047. M18. J Bacteriol 193: 6402–6403. 42. Ishijima SA, Hayama K, Burton JP, Reid G, Okada M, et al. (2012) Effect of 20. Tagg JR, Bannister LV (1979) ‘‘Fingerprinting’’ beta-haemolytic streptococci by Streptococcus salivarius K12 on the in vitro growth of Candida albicans and its their production of and sensitivity to bacteriocine-like inhibitors. J Med protective effect in an oral candidiasis model. Appl Environ Microbiol 78: 2190– Microbiol 12: 397–411. 2199. 21. Hyink O, Wescombe PA, Upton M, Ragland N, Burton JP, et al. (2007) 43. McNulty NP, Yatsunenko T, Hsiao A, Faith JJ, Muegge BD, et al. (2011) The Salivaricin A2 and the novel lantibiotic salivaricin B are encoded at adjacent loci impact of a consortium of fermented milk strains on the gut microbiome of on a 190-kilobase transmissible megaplasmid in the oral probiotic strain gnotobiotic mice and monozygotic twins. Sci Transl Med 3: 106ra106. Streptococcus salivarius K12. Appl Environ Microbiol 73: 1107–1113. 44. Jenkinson HF, Demuth DR (1997) Structure, function and immunogenicity of 22. Guedon E, Delorme C, Pons N, Cruaud C, Loux V, et al. (2011) Complete streptococcal antigen I/II polypeptides. Mol Microbiol 23: 183–190. genome sequence of the commensal Streptococcus salivarius strain JIM8777. 45. Whittaker CJ, Klier CM, Kolenbrander PE (1996) Mechanisms of adhesion by J Bacteriol 193: 5024–5025. oral bacteria. Annu Rev Microbiol 50: 513–552. 23. Kelstrup J (1981) Extracellular polysaccharides of smooth and rough variants of 46. Navarre WW, Schneewind O (1999) Surface proteins of gram-positive bacteria Streptococcus salivarius. Scand J Dent Res 89: 374–383. and mechanisms of their targeting to the cell wall envelope. Microbiol Mol Biol 24. Tanzer JM, Kurasz AB, Clive J (1985) Competitive displacement of mutans Rev 63: 174–229. streptococci and inhibition of tooth decay by Streptococcus salivarius TOVE-R. 47. Hamada S, Amano A, Kimura S, Nakagawa I, Kawabata S, et al. (1998) The Infect Immun 48: 44–50. importance of fimbriae in the virulence and ecology of some oral bacteria. Oral 25. Burton J, Chilcott C, Moore C, Speiser G, Tagg J (2006) A preliminary study of Microbiol Immunol 13: 129–138. the effect of probiotic Streptococcus salivarius K12 on oral malodour parameters. 48. Handley PS, Carter PL, Fielding J (1984) Streptococcus salivarius strains carry either Journal of applied microbiology 100: 754–764. fibrils or fimbriae on the cell surface. J Bacteriol 157: 64–72. 26. Upton M, Tagg JR, Wescombe P, Jenkinson HF (2001) Intra- and interspecies signaling between Streptococcus salivarius and Streptococcus pyogenes mediated by SalA 49. Daly KM, Upton M, Sandiford SK, Draper LA, Wescombe PA, et al. (2010) and SalA1 lantibiotic peptides. J Bacteriol 183: 3931–3938. Production of the Bsa lantibiotic by community-acquired Staphylococcus aureus 27. Hummelen R, Macklaim JM, Bisanz JE, Hammond JA, McMillan A, et al. strains. J Bacteriol 192: 1131–1142. (2011) Vaginal microbiome and epithelial gene array in post-menopausal 50. Foster JS, Kolenbrander PE (2004) Development of a multispecies oral bacterial women with moderate to severe dryness. PLoS One 6: e26602. community in a saliva-conditioned flow cell. Appl Environ Microbiol 70: 4340– 28. Gloor GB, Hummelen R, Macklaim JM, Dickson RJ, Fernandes AD, et al. 4348. (2010) Microbiome profiling by illumina sequencing of combinatorial sequence- 51. Postollec F, Norde W, de Vries J, Busscher HJ, van der Mei HC (2006) tagged PCR products. PLoS One 5: e15406. Interactive forces between co-aggregating and non-co-aggregating oral bacterial 29. Dierksen KP, Ragland NL, Tagg JR (2000) A new alkaline pH-adjusted medium pairs. J Dent Res 85: 231–234. enhances detection of beta-hemolytic streptococci by minimizing bacterial 52. Levesque C, Lamothe J, Frenette M (2003) Coaggregation of Streptococcus interference due to Streptococcus salivarius. J Clin Microbiol 38: 643–650. salivarius with periodontopathogens: evidence for involvement of fimbriae in the 30. Miles AA, Misra SS, Irwin JO (1938) The estimation of the bactericidal power of interaction with Prevotella intermedia. Oral Microbiol Immunol 18: 333–337. the blood. J Hyg (Lond) 38: 732–749. 53. Leblebicioglu B, Kulekci G, Ciftci S, Keskin F, Badur S (2009) Salivary detection 31. Handley PS, Harty DW, Wyatt JE, Brown CR, Doran JP, et al. (1987) A of periodontopathic bacteria and periodontal health status in dental students. comparison of the adhesion, coaggregation and cell-surface hydrophobicity Anaerobe 15: 82–86. properties of fibrillar and fimbriate strains of Streptococcus salivarius.JGen 54. Cosseau C, Devine DA, Dullaghan E, Gardy JL, Chikatamarla A, et al. (2008) Microbiol 133: 3207–3217. The commensal Streptococcus salivarius K12 downregulates the innate immune 32. Levesque C, Vadeboncoeur C, Frenette M (2004) The csp operon of Streptococcus responses of human epithelial cells and promotes host-microbe homeostasis. salivarius encodes two predicted cell-surface proteins, one of which, CspB, is Infect Immun 76: 4163–4175. associated with the fimbriae. Microbiology 150: 189–198. 55. Guglielmetti S, Taverniti V, Minuzzo M, Arioli S, Stuknyte M, et al. (2010) Oral 33. Roos K, Grahn E, Holm SE, Johansson H, Lind L (1993) Interfering alpha- bacteria as potential probiotic for the pharyngeal mucosa. Appl Environ streptococci as a protection against recurrent streptococcal tonsillitis in children. Microbiol. Int J Pediatr Otorhinolaryngol 25: 141–148.
PLOS ONE | www.plosone.org 10 June 2013 | Volume 8 | Issue 6 | e65991 JOURNAL OF BACTERIOLOGY, Nov. 2011, p. 6402–6403 Vol. 193, No. 22 0021-9193/11/$12.00 doi:10.1128/JB.06001-11 Copyright © 2011, American Society for Microbiology. All Rights Reserved.
Genome Sequence of the Bacteriocin-Producing Oral Probiotic Streptococcus salivarius Strain M18 Nicholas C. K. Heng,1* Nurul S. Haji-Ishak,1 Alaina Kalyan,1 Andrew Y. C. Wong,1 Marija Lovric´,1 Joanna M. Bridson,1 Julia Artamonova,1 Jo-Ann L. Stanton,2 Philip A. Wescombe,3 Jeremy P. Burton,3 Mary P. Cullinan,1 and John R. Tagg3,4 Sir John Walsh Research Institute, Faculty of Dentistry,1 and Department of Anatomy,2 University of Otago, Dunedin, New Zealand; BLIS Technologies Ltd., Centre for Innovation, Dunedin, New Zealand3; and Department of Microbiology and Immunology, University of Otago, Dunedin, New Zealand4
Received 12 August 2011/Accepted 12 September 2011
Streptococcus salivarius is a Gram-positive bacterial commensal and pioneer colonizer of the human oral cavity. Many strains produce ribosomally synthesized proteinaceous antibiotics (bacteriocins), and some strains have been developed for use as oral probiotics. Here, we present the draft genome sequence of the bacteriocin-producing oral probiotic S. salivarius strain M18.
The Gram-positive bacterium Streptococcus salivarius is a tococcus gordonii Hsa adhesin (9). The latter, which are con- pioneer colonizer of the human oral cavity, and large popula- spicuously absent in S. thermophilus, may aid S. salivarius in tions persist at this site for the host’s lifetime (12). S. salivarius colonizing oral surfaces. Automated annotation carried out by is the prototype species of the S. salivarius group, which in- the rapid annotations using subsystems technology (RAST) (1) cludes the important dairy species Streptococcus thermophilus and NCBI Prokaryotic Genomes Automatic Annotation Pipe- (6). Many S. salivarius strains produce ribosomally synthesized line (PGAAP) servers revealed 1,975 protein-coding se- proteinaceous antibiotics (bacteriocins; reviewed in reference quences (CDSs), six rRNA operons, and 68 tRNA genes. A 14), typically encoded by megaplasmid-borne loci (10). As S. variety of insertion sequences were identified, with ISSag8 and salivarius is generally associated with good oral health, several IS1193 being the most common. In addition, the chromosome bacteriocinogenic strains with proven safety records have been contains a locus (slm) specifying the production of a new developed as oral probiotics (2–4, 8, 12). anti-S. mutans lantibiotic bacteriocin designated salivaricin M. S. salivarius M18 (formerly strain Mia) is a megaplasmid- The S. salivarius M18 megaplasmid, pSsal-M18, is 183,037 carrying oral probiotic exhibiting broad-spectrum inhibitory bp long (GC content of 34.8%) and is the first completely activity against several streptococcal pathogens, notably the sequenced streptococcal megaplasmid. Of 172 CDSs anno- caries-causing Streptococcus mutans (10). In order to provide a tated by PGAAP, 16 belong to the known bacteriocin-encoding genetic basis for factors enhancing its probiotic candidature, loci for salivaricins A2 (11), 9 (13), and MPS (5, 14). Interest- e.g., bacteriocin repertoire and colonization-related genes, and ingly, there is a region of several open reading frames (ORFs) also to establish whether the strain is free of virulence factors (flanked by insertion sequences) nearly identical to chromo- and antibiotic resistance determinants, the S. salivarius M18 somal genes found in S. salivarius strains CCHSS3 and 57.I genome was sequenced by a whole-genome shotgun strategy (GenBank accession number CP002888), indicating gene ex- using a Roche GS-FLX pyrosequencer (7). Approximately 42.9 change between the chromosome and megaplasmid. The S. million base pairs (ϳ18-fold coverage) was assembled by salivarius M18 genome sequence will not only be useful for Roche GS de novo assembler (versions 1.1.03.24 and 2.3) into comparative genomics but is essential for the development of ϳ150 contigs. All putative chromosomal contigs were ordered a functional genomics platform facilitating molecular evolution relative to the megaplasmid-free S. salivarius CCHSS3 genome and ecological studies. sequence (GenBank accession number FR873481). Gap clo- Nucleotide sequence accession numbers. This Whole sures were achieved by direct Sanger-based sequencing of PCR Genome Shotgun project has been deposited at DDBJ/EMBL/ amplicons generated with specific primers designed for contig GenBank under accession number AGBV00000000. The version termini. described in this paper is the first version, AGBV01000000. The high-quality draft S. salivarius M18 chromosome se- quence currently comprises five supercontigs (2,142,944 bp; The M18 genome sequencing project was funded in part by grants GC content of 39.6%). The remaining genomic gaps contain from the Otago Medical Research Foundation (OMRF), the New multiple copies of large (Ͼ6-kb) genes encoding putative Zealand Dental Association Research Foundation, and the New Zea- land Lottery Grants Board. N.S.H.-I., A.K., A.Y.C.W., M.L., and highly repetitive serine-rich proteins homologous to the Strep- J.M.B. were recipients of University of Otago Faculty of Dentistry Summer Research Studentships. J.A. was an OMRF Summer Re- search Scholar.
* Corresponding author. Mailing address: Department of Oral Sci- REFERENCES ences, Faculty of Dentistry, University of Otago, P.O. Box 647, Dun- 1. Aziz, R. K., et al. 2008. The RAST Server: rapid annotations using subsys- edin 9054, New Zealand. Phone: 64 3 479-9254. Fax: 64 3 479-7078. tems technology. BMC Genomics 9:75. E-mail: [email protected]. 2. Burton, J. P. et al. 2011. Evaluation of safety and human tolerance of the
6402 VOL. 193, 2011 GENOME ANNOUNCEMENTS 6403
oral probiotic Streptococcus salivarius K12: a randomized, placebo-con- gene encoding the sialic acid-binding adhesin of Streptococcus gordonii DL1. trolled, double-blind study. Food Chem. Toxicol. 49:2356–2364. Infect. Immun. 70:1209–1218. 3. Burton, J. P., et al. 2010. Extended safety data for the oral cavity probiotic 10. Wescombe, P. A., et al. 2006. Megaplasmids encode differing combinations of Streptococcus salivarius K12. Probiotics Antimicrob. Prot. 2:135–144. lantibiotics in Streptococcus salivarius. Antonie Van Leeuwenhoek 90:269– 4. Burton, J. P., et al. 2006. Safety assessment of the oral cavity probiotic 280. Streptococcus salivarius K12. Appl. Environ. Microbiol. 72:3050–3053. 11. Wescombe, P. A., et al. 2006. Production of the lantibiotic salivaricin A and 5. Dodd, S. J. 1999. A saliva model to demonstrate Streptococcus salivarius its variants by oral streptococci and use of a specific induction assay to detect BLIS production and characterization of salivaricin MPS. M.S. thesis. Uni- their presence in human saliva. Appl. Environ. Microbiol. 72:1459–1466. versity of Otago, Dunedin, New Zealand. 12. Wescombe, P. A., et al. 2009. Streptococcal bacteriocins and the case for 6. Facklam, R. 2002. What happened to the streptococci: overview of taxo- Streptococcus salivarius as model oral probiotics. Future Microbiol. 4:819– nomic and nomenclature changes. Clin. Microbiol. Rev. 15:613–630. 835. 7. Heng, N. C. K., and J.-A. L. Stanton. 2010. Oral bacterial genome sequenc- 13. Wescombe, P. A., et al. 2011. Salivaricin 9, a new lantibiotic produced by ing using the high-throughput Roche Genome Sequencer FLX System. Streptococcus salivarius. Microbiology 157:1290–1299. Methods Mol. Biol. 666:197–218. 14. Wescombe, P. A., N. C. K. Heng, J. P. Burton, and J. R. Tagg. 2010. 8. Tagg, J. R., and K. P. Dierksen. 2003. Bacterial replacement therapy: adapt- Something old and something new: an update on the amazing repertoire of ing ‘germ warfare’ to infection prevention. Trends Biotechnol. 21:217–223. bacteriocins produced by Streptococcus salivarius. Probiotics Antimicrob. 9. Takahashi, Y., et al. 2002. Identification and characterization of hsa, the Prot. 2:37–45.