Establishment of Developmental Gene Silencing by Ordered Polycomb Complex Recruitment in Early Zebrafish Embryos

bioRxiv preprint doi: https://doi.org/10.1101/2021.03.16.435592; this version posted March 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

1 Establishment of Developmental Gene Silencing by

2 Ordered Polycomb Complex Recruitment in Early Zebrafish Embryos

4 Graham J.M. Hickey1, Candice Wike1, Xichen Nie1, Yixuan Guo1, Mengyao Tan1, Patrick

5 Murphy1,2 and Bradley R. Cairns1*

7 1Howard Hughes Medical Institute, Department of Oncological Sciences and Huntsman Cancer

8 Institute, University of Utah School of Medicine, Salt Lake City, UT 84112, USA

9 2Department of Biomedical Genetics, Wilmot Cancer Center, University of Rochester School of

10 Medicine, Rochester, NY 14641, USA

12 *Correspondence: [email protected]

17 Abstract:

18 Vertebrate embryos achieve developmental competency during zygotic genome activation

19 (ZGA) by establishing chromatin states that silence yet poise developmental genes for

20 subsequent lineage-specific activation. Here, we reveal how developmental gene poising is

21 established de novo in preZGA zebrafish embryos. Poising is established at promoters and

22 enhancers that initially contain open/permissive chromatin with ‘Placeholder’ nucleosomes

23 (bearing H2A.Z, H3K4me1, and H3K27ac), and DNA hypomethylation. Silencing is initiated by

24 the recruitment of Polycomb Repressive Complex 1 (PRC1), and H2Aub1 deposition by

25 catalytic Rnf2 during preZGA and ZGA stages. During postZGA, H2Aub1 enables Aebp2-

26 containing PRC2 recruitment and H3K27me3 deposition. Notably, preventing H2Aub1 (via Rnf2

27 inhibition) eliminates recruitment of Aebp2-PRC2 and H3K27me3, and elicits transcriptional

28 upregulation of certain developmental genes during ZGA. However, upregulation is independent

29 of H3K27me3 – establishing H2Aub1 as the critical silencing modification at ZGA. Taken

30 together, we reveal the logic and mechanism for establishing poised/silent developmental genes

31 in early vertebrate embryos.

34 Impact Statement:

35 De novo polycomb domains are formed in zebrafish early embryos by focal histone H2Aub1

36 deposition by Rnf2-PRC1 – which imposes transcription silencing – followed by subsequent

37 recruitment of Aebp2-PRC2 and H3K27me3 deposition.

40 Introduction

41 Early vertebrate embryos initiate embryonic/zygotic transcription, termed zygotic genome

42 activation (ZGA), and must distinguish active housekeeping genes from developmental genes,

43 which must be temporarily silenced, but kept available for future activation (Chan et al., 2019;

44 Lindeman et al., 2011; Murphy et al., 2018; Potok et al., 2013; Vastenhouw et al., 2010).

45 Developmental gene promoters in early embryos are packaged in ‘active/open’ chromatin –

46 which can involve a combination of histone variants (e.g. H2A.Z), open/accessible chromatin

47 (via ATAC-seq), permissive histone modifications (e.g. H3K4me1/2/3, H3K27ac), and (in

48 vertebrates) focal DNA hypomethylation (Akkers et al., 2009; Bogdanovic et al., 2012; Chan et

49 al., 2019; Jiang et al., 2013; Lindeman et al., 2011; Murphy et al., 2018; Potok et al., 2013;

50 Vastenhouw et al., 2010). As H3K9me3 and H3K27me3 are very low or absent at ZGA, it

51 remains unknown how developmental gene silencing occurs at ZGA within an apparently

52 permissive chromatin landscape, and how subsequent H3K27me3 is established at

53 developmental genes during postZGA stages.

55 We addressed these issues in zebrafish, which conduct full ZGA at the tenth synchronous cell

56 cycle of cleavage stage (~3.5 hours post fertilization (hpf), ~2000 cells)(Schulz et al., 2019).

57 Prior to ZGA (preZGA), zebrafish package the promoters and enhancers of housekeeping genes

58 and many developmental genes with chromatin bearing the histone variant H2afv (a close

59 orthologue of mammalian H2A.Z, hereafter termed H2A.Z(FV)), and the ‘permissive’

60 modifications H3K4me1 and H3K27ac (Murphy et al., 2018; Zhang et al., 2018); a combination

61 termed ‘Placeholder’ nucleosomes – as they hold the place where poising/silencing is later

62 imposed (Murphy et al., 2018). Curiously, at ZGA in zebrafish, (and also in mice and humans),

63 silent developmental gene promoters also contain H3K4me3, a mark that normally resides at

64 active genes (Dahl et al., 2016; Lindeman et al., 2011; Liu et al., 2016; Vastenhouw et al., 2010;

65 Xia et al., 2019; Zhang et al., 2016). After ZGA, developmental genes progressively acquire

66 H3K27me3 via deposition by Polycomb Repressive Complex 2 (PRC2) (Lindeman et al., 2011;

67 Liu et al., 2016; Vastenhouw et al., 2010; Xia et al., 2019). Therefore, the central issues are how

68 developmental genes bearing Placeholder nucleosomes and H3K4me3 are transcriptionally

69 silenced during preZGA and ZGA stages in the absence of H3K27me3, and how subsequent

70 H3K27me3 is focally established during postZGA (Figure 1 - figure supplement 1A).

72 Results

73 H2Aub1 is Present in PreZGA Zebrafish Embryo Chromatin

74 First, we sought a repressive histone modification that might explain how developmental genes

75 are silenced at ZGA. We examined zebrafish embryos at preZGA (2.5 hpf, ~256 cells), ZGA (3.5

76 hpf ~2000 cells) and postZGA (4.3 hpf, >4K cells) – and confirmed very low-absent H3K27me3

77 (Figure 1 - figure supplement 1B) (Lindeman et al., 2011; Vastenhouw et al., 2010) and

78 H3K9me3 absence (Laue et al., 2019) during preZGA and ZGA, but revealed the presence of

79 histone H2A monoubiquitination at lysine 119 (termed hereafter H2Aub1), a repressive mark

80 deposited by the Polycomb Repressive Complex 1 (PRC1) (Figure 1A, B, one of three biological

81 replicates is displayed) (de Napoles et al., 2004; Kuroda et al., 2020; Wang et al., 2004).

82 Notably, zebrafish sperm lacked H2Aub1 whereas oocytes displayed H2Aub1 (Figure 1B; Figure

83 1 - figure supplement 1C; Figure 1 - figure supplement 2A). Current antibodies were not

84 designed to distinguish H2A.Z(FV)ub1 from H2Aub1, so hereafter we refer to the epitope as

85 H2Aub1.

87 Developmental Promoters Acquire Placeholder, Rnf2, and H2Aub1 During PreZGA

88 To localize H2Aub1 we conducted chromatin immunoprecipitation (ChIP) experiments at

89 preZGA, ZGA and postZGA (replicate structures for Figure 1 - figure supplement 2B-D), and

90 examined promoters (Figure 1) and enhancers (Figure 2). For all ChIP experiments, 2-3

91 biological replicates were conducted, which involved isolating different batches of zebrafish

92 embryos. To more finely examine ZGA, we conducted additional ChIP profiling of Placeholder

93 nucleosomes at ZGA (3.5 hpf), which complemented our prior profiling at preZGA (2.5 hpf) and

94 postZGA (4.3 hpf) (Murphy et al., 2018) (replicate structure for Figure 1- figure supplement 2E,

95 F). Interestingly, we found H2Aub1 highly co-localized at gene promoters and enhancers with

96 Placeholder nucleosomes, H3K27ac (Zhang et al., 2018) (Figure 1C), and ATAC-seq sensitive

97 chromatin (Figure 1 - figure supplement 2L, two biological replicates) during preZGA and ZGA

98 stages. However, during postZGA, high levels of H2Aub1 overlap with only a portion of

99 Placeholder-bound loci, an observation explored further, below.

100

101 Rnf2 is the sole zebrafish ortholog of Ring1a and Ring1b/Rnf2, the mutually-exclusive E3

102 ligases within mammalian PRC1, which adds monoubiquitin (ub1) to H2A and H2A.Z (de

103 Napoles et al., 2004; Le Faou et al., 2011; Wang et al., 2004). Rnf2 ChIP-seq at preZGA, ZGA

104 and postZGA revealed striking co-incidence with H2Aub1, and clustering by Rnf2 occupancy

105 revealed five promoter chromatin types, which differed in Rnf2, H2Aub1, and H3K27me3

106 enrichment, and gene ontology (Figure 1C; Figure 1 - figure supplement 2G-K). Regions with

107 high H2Aub1 and Rnf2 involve broad clustered loci encoding developmental transcription

108 factors (cluster 1, e.g hoxaa) or narrow solo/dispersed developmental transcription factors

A M ZGA

hpf: 2.5 3.5 4.3 24 API D H2Aub1 ub1 H2 A H3 20 µm ge e r M C

Clusters Pre ZGA ZGA Post ZGA DNAme H2A.Z(FV) H3K4me1 H3K27ac Rnf2 H2Aub1 H2A.Z(FV) H3K4me1 Rnf2 H2Aub1 H2A.Z(FV) H3K4me1 H3K27ac Rnf2 H2Aub1 H3K27me3 H3K4me3 1 2 3

14396 Promoter regions 5

-2Kb TSS +2Kb Fraction DNAme Log2(ChIP/Input) 0 0.5 1 −2.5 0 2.5 D Cluster 1 50 kb Cluster 2; vsx2 20 kb Cluster 3; prdx2 5 kb Cluster 4; gtf3ab 5 kb H2A.Z(FV) 0-1.64 0-1.64 0-1.64 0-1.64 H3K4me1 0-0.34 0-0.34 0-0.34 0-0.34 H3K27ac 0-2.11 0-2.11 0-2.11 0-2.11 Rnf2 0-6.86 0-6.86 0-6.86 0-6.86 preZGA H2Aub1 0-2.23 0-2.23 0-2.23 0-2.23 H2A.Z(FV) 0-8.55 0-8.55 0-8.55 0-8.55 H3K4me1 0-1.36 0-1.36 0-1.36 0-1.36 0-11.0 0-9.56 0-2.60 0-9.93

ZGA Rnf2 H2Aub1 0-0.36 0-0.47 0-0.40 0-0.41 H2A.Z(FV) 0-0.67 0-0.67 0-0.67 0-0.67 H3K4me1 0-3.00 0-3.00 0-3.00 0-3.00 H3K27ac 0-2.78 0-2.78 0-2.78 0-2.78 Rnf2 0-26.0 0-17.0 0-2.44 0-20.0 0-21.0 0-21.0 H2Aub1 0-21.0 0-21.0 H3K27me3 0-9.31 0-9.31 0-9.31 0-9.31 postZGA 0-1.50 0-1.50 0-2.53 0-2.53 H3K4me3 0-1.00 0-1.00 DNAme 0-1.00 0-1.00

hoxaa locus vsx2 lin52 pomt2 dtd2 rnaseh2a prdx2 junba gtf3ab lnx2a

bHLHE41 Figure 1: PRC1 occupancy and activity precedes H3K27me3 CLOCK

TF motif TEAD1 in promoters TEAD1 MYNN BMYB CREB Gata2 CTCF Ronin USF1 TFE3 Cdx2 cMyc OCT

E NRF NFY F O ETS YY1 TBP Maz Atf1 H o S o

Atf establishment at promoters. (A) Detection of H2Aub1 and histone H3 X x x (control) in chromatin extracts by western blot, prior to (2.5 hpf), during (3.5 hpf), following (4.3hpf) ZGA, and 24 hpf. (B) Nuclear H2Aub1 1 immunofluoresence in zebrafish sperm, oocytes (egg), and embryos

2 prior to (2.5 hpf), during (3.5 hpf), and following (4.3hpf) ZGA. Bottom row: the dashed square indicates the field of view in upper panels. (C) 3 K-means clustering of whole-genome bisulfite sequencing (WGBS, for

4 DNAme) and ChIP-seq (histone modifications/variant) at promoters (UCSC refseq). DNAme heatmap displays WGBS fraction methylated Promoter Cluster 5 scores (note: red color indicates regions that lack DNAme). ChIP-seq heatmaps display log2(ChIP/input) scores. (D) Genome browser 1.0x10-3 20 -4 screenshots of ChIP-seq enrichment at representative genes from the 7.5x10 Pvalue 40 % of loci 5.0x10-4 60 indicated K-means clusters in panel (C). (E) Transcription factor motif 2.5x10-4 80 enrichment from HOMER (Heinz et al., 2010) at promoter clusters from (C). B (which wasnotcertifiedbypeerreview)istheauthor/funder,whohasgrantedbioRxivalicensetodisplaypreprintinperpetuity.Itmade loading control. 1of3biologicalreplicates isshown. exposure probingforH2Aub1. Middle:longexposureprobingforH2Aub1.Bottom:histone H3 from zebrafishsperm(left) or24hpfembryos(right)wereusedforwesternblotting. Top: short rows. (C)H2Aub1isundetectedby westernblotinzebrafishsperm.Varying amountsofprotein Bottom row:thedashed squareindicatesdenotesthefieldofviewforcorresponding top3 shown. NoH3K27me3staining wasobservedinembryosatpreZGA (2.5hpf)orZGA (3.5hpf). immunofluorescence inzebrafishembryosfollowing ZGA (4.3hpf).1of3biologicalreplicatesis guish geneclassespriortozygoticgenomeactivation (ZGA).(B)NuclearH3K27me3detectionby sent thepossibleexistenceofhistonemodifications, activating(A?)orsilencing(S?)thatdistin- and housekeepinggeneactivationisachievedin earlyvertebrateembryos.Questionmarksrepre- (A) A modelillustratingthecurrentknowledgegapsregardinghow developmentalgenesilencing Figure 1–figuresupplement1:Profilingofhistone marksinzebrafishembryosandsperm. Merge H3K27me3 DAPI Merge bioRxiv preprint 2.5 hpf doi: A Development

Housekeeping genes Developmental genes 3.5 hpf Identify ZGA https://doi.org/10.1101/2021.03.16.435592 Pre ZGA

Z ? Z 4.3 hpf Off available undera marking Differential

Developmental

A S Housekeeping 20µm 10µm H3K27me3

Activating mark Silencing mark genes

genes CC-BY 4.0Internationallicense C ZGA ; this versionpostedMarch16,2021. A S Z ? Z ? DNA hypomethylation Z Z

Z H3K4me3 H3K4me1 H2A.Z(FV) On Off sperm Post ZGA . A ? ? Z S Z Z Z 24 hpf The copyrightholderforthispreprint Explain Off On α-H3 long exposure α-H2Aub1 short exposure α-H2Aub1 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.16.435592; this version posted March 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

A B C D E Sperm H2Aub1 ChIP-qPCR 2.5 hpf H2Aub1 ChIP-seq 3.5 hpf H2Aub1 ChIP-seq 4.3 hpf H2Aub1 ChIP-seq 3.5 hpf H2A.Z(FV) ChIP-seq 0.15 1.0 input .rep3 rep1 rep2 input rep1 rep2 0.10 input rep1 rep2 input rep1 rep2 inpu t

f rep2 rep2 rep2 o rep2 0.0

% 0.05 rep1 rep1 rep1 rep1 0.00 rep3 1.0 1.0 1.0 1.0 1.0 1 input isl1 input input input pax6a vsx1 idh3g pcf1 lman2 0.0 0.0 0.8 0.0 0.0 Gene Promoter

3.5 hpf H3K4me1 ChIP-seq 2.5 hpf Rnf2 ChIP-seq 3.5 hpf Rnf2 ChIP-seq 4.3 hpf Rnf2 ChIP-seq F G H I Input rep1 rep2 input rep1 rep2 rep3 input rep1 rep2 rep3 input rep1 rep2 rep2 rep3 rep3 rep2 rep2 rep2 rep1 rep1 1.0 1.0 rep1 1.0 rep1 1.0 input Input input input 0.0 0.0 0.0 0.0 J 9 preZGA ZGA postZGA 8 **** **** **** L ATAC-seq ATAC-seq ATAC-seq 7 **** 1 **** 2 **** 6 Rnf2 preZGA 3 **** **** 5 **** **** **** **** **** **** **** **** Rnf2 ZGA **** 4 **** **** **** 4 **** **** **** **** Rnf2 postZGA **** **** 3 **** **** H2Aub1 preZGA 2 H2Aub1 ZGA 1 H2Aub1 postZGA 5 0 H3K27me3 postZGA log2(ChIP/Input ) -1 -2 -3 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5 -2Kb TSS +2Kb Log2(ATAC/Input) Promoter Cluster # −2 0 2 Minor wave; K # of M 10 kb 10 kb 5 kb Cluster # GO Term genes P-value Minor wave pou5f3 Minor wave H2A.Z(FV) 0-1.64 0-1.64 0-650 1 Regulation of transcription 272 3.00E-177 H3K4me1 0-0.34 0-0.34 0-650 Developmental process 298 5.61E-114 H3K27ac 0-2.11 0-2.11 0-650 Rnf2 0-6.86 0-6.86 0-650 Regulation of dev. process 100 7.53E-15 preZGA 0-2.23 0-2.23 0-650 H2Aub1 2 Regulation of transcription 164 1.34E-12 H2A.Z(FV) 0-8.55 0-8.55 0-650 Signal transduction 202 6.55E-12 H3K4me1 0-1.36 0-1.36 0-650 0-2.03 0-9.05 0-650 3 Cellular metabolic process 364 9.38E-07 ZGA Rnf2 Cellular localization 89 2.51E-05 H2Aub1 0-0.30 0-0.37 0-650 H2A.Z(FV) 0-0.67 0-0.67 0-650 0-3.00 0-3.00 4 Metabolic process 1152 4.15E-17 H3K4me1 0-650 Intracellular transport 190 2.37E-11 H3K27ac 0-2.78 0-2.78 0-650 Rnf2 0-16.0 0-16.0 0-650 GPCR signaling pathway 405 2.77E-30 0-21.0 0-21.0 0-650 5 H2Aub1 Sensory perception 212 2.69E-26 H3K27me3 0-9.31 0-9.31 0-650 postZGA Signal transduction 1105 5.08E-16 H3K4me3 0-2.53 0-2.53 0-650 DNAme 0-1.00 0-1.00 0-1

nanog pou5f3 (oct4) mir-430 locus Figure 1 – figure supplement 2: ChIP replicate structures. (A) ChIP-qPCR of H2Aub1 of indicated gene promoters in zebrafish sperm. No H2Aub1 enrichment was detected at developmental gene promoters (pax6a, vsx1, isl1) in sperm. Housekeeping gene promoters (idh3g, pcf11, lman2) were used as negative control regions. Three biological replicates were conducted. (B-I) Genome-wide correlation matrices of indicated ChIP-seq replicates and input from zebrafish embryos at the indicated developmental timepoints. Heatmap matrices display Pearson correlation coefficients (B-D, G-I) or Spearman correlation coefficients (E, F). (J) Violin plots of ChIP-seq enrichment levels at promoter K-means clusters displayed in Figure 1C. A 1Kb window flanking the TSS was utilized to collect mean log2(ChIP/Input) data. Unpaired t-test with Welch's correction was performed in GraphPad Prism version 8.3.1. Asterisks represent P values that are less than 0.0001. (K) GO-term analysis of promoter clusters in Figure 1C. Top GO terms (enriched gene categories) for the promoter clusters are shown, along with the number of genes (#) and the P-value for enrichment. GO-term analysis was performed with DAVID (Huang da et al., 2009). (L) Heatmaps of ATAC-seq at UCSC RefSeq promoters. K-means clusters from Figure 1C were used to plot data. (M) Genome browser screenshots of representative genes involved in the minor wave of zygotic transcription with ChIP-seq enrichment from clusters in Figure 1C. bioRxiv preprint doi: https://doi.org/10.1101/2021.03.16.435592; this version posted March 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

109 (cluster 2, e.g. vsx2) (Figure 1C, D; GO analysis for Figure 1 - figure supplement 2K). In counter

110 distinction, loci bearing Placeholder and low-moderate levels of H2Aub1 and low Rnf2 largely

111 constitute housekeeping/metabolic genes, with either broad (cluster 3, e.g. prdx2) or narrow

112 (cluster 4, e.g. gtf3ab) H3K4me3 and H3K27ac occupancy at postZGA (Figure 1C, D; Figure 1 –

113 figure supplement 2K). Notably, ‘minor wave’ ZGA genes (genes transcribed at 2.5hr), including

114 those for pluripotency (e.g. nanog, pou5f3/oct4), bear marking similar to housekeeping genes,

115 and the robustly-transcribed mir430 locus appears markedly enriched in H3K27ac at preZGA

116 (Figure 1 - figure supplement 2M) (Chan et al., 2019). Finally, cluster 5 promoters contain

117 DNAme, and lack Placeholder, H2Aub1 and Rnf2. Thus, over the course of ZGA, loci with

118 Placeholder nucleosomes resolve into two broad classes of loci: developmental genes with high

119 PRC1 and H2Aub1 (clusters 1&2), and housekeeping (or ‘minor wave’) genes that lack

120 substantial PRC1 and H2Aub1, but contain high H3K4me3 and H3K27ac at postZGA (clusters

121 3&4) (Figure 1C, D; Figure 1 - figure supplement 2J, K).

122

123 H3K27me3 Establishment Occurs During PostZGA, and Only at Locations Pre-marked

124 with High Rnf2 and H2Aub1

125 We find robust H3K27me3 deposition occurring during postZGA at promoters marked during

126 preZGA with high Rnf2 and H2Aub1, specifically at clusters 1 and 2 (Figure 1C, D).

127 Furthermore, as embryos transition from preZGA to postZGA, H3K27ac diminishes at

128 developmental loci, whereas housekeeping genes (clusters 3 and 4 Figure 1C, D) retain strong

129 H3K27ac and become active. During postZGA, developmental genes acquire the combination of

130 low-moderate H3K4me3 and high H3K27me3, termed ‘bivalency’ (Azuara et al., 2006;

131 Bernstein et al., 2006). Interestingly, promoters that become bivalent postZGA involve those pre-

132 marked with higher relative Rnf2 and H2Aub1, whereas promoters with high H3K27ac, high

133 H3K4me3 and low-absent H3K27me3 postZGA involve those pre-marked with lower relative

134 Rnf2 and H2Aub1 (Figure 1C, D; Figure 1 - figure supplement 2J). This observation raised the

135 possibility that high H2Aub1 levels may help recruit PRC2 to subsequently deposit H3K27me3.

136

137 To identify candidate transcription factors (TFs) that might bind selectively at the promoters of

138 particular clusters, we analyzed the DNA sequences flanking the TSS (500bp) at each cluster

139 using the motif finding program, HOMER (Figure 1E) (Heinz et al., 2010). Largely non-

140 overlapping motifs were identified for TF binding sites at clusters linked to developmental

141 versus housekeeping genes (Figure 1E, clusters 1&2 versus 3&4; partitioned by H2Aub1/Rnf2

142 levels). Here, the strong enrichment of motifs for homeodomain-containing TFs (and other

143 families) in clusters 1 and 2 provides candidate factors that may help recruit PRC1 to

144 developmental loci. DNA methylated promoters at ZGA (cluster 5) represent a large and

145 heterogeneous set of genes, which are activated in particular cell types later in development.

146

147 Enhancer Poising Parallels Features and Factors at Promoters

148 Analysis of enhancer regions revealed features that were similar to those at developmental

149 promoters (Figure 2). Specifically, enhancers with high H2Aub1 and Rnf2 during preZGA and

150 ZGA acquired robust H3K27me3 during post ZGA (Figure 2A, B; Figure 2 – figure supplement

151 1A). Enhancers with low/absent Rnf2 and H2Aub1 failed to attract robust H3K27me3 at

152 postZGA, instead bearing high levels of H3K27 acetylation (Figure 2A, B; Figure 2 - figure

153 supplement 1A). Candidate TF binding sites were enriched at enhancers (Figure 2C), and these

154 sites overlapped partly with those enriched at promoters, consistent with the expectation that the

A Pre ZGA ZGA Post ZGA DNAme H2A.Z(FV) H3K4me1 H3K27ac Rnf2 H2Aub1 H2A.Z(FV) H3K4me1 Rnf2 H2Aub1 H2A.Z(FV) H3K4me1 H3K27ac Rnf2 H2Aub1 H3K27me3 1 2 3

5 27109 enhancer regions

-2Kb +2Kb Fraction DNAme Log2(ChIP/Input) 0 0.5 1 −2.5 0 2.5 Cluster 1 20 Kb Cluster 2 10 Kb Cluster 3 10 Kb Cluster 4 5 Kb B H2A.Z(FV) 0-1.50 0-2.45 0-2.49 0-1.41 H3K4me1 0-0.13 0-0.19 0-0.29 0-0.29 H3K27ac 0-1.73 0-2.40 0-1.71 0-1.75 Rnf2 0-7.83 0-3.09 0-1.02 0-1.15 preZGA H2Aub1 0-2.37 0-1.70 0-1.57 0-1.73 H2A.Z(FV) 0-9.44 0-13.0 0-10.0 0-19.0 H3K4me1 0-1.32 0-3.63 0-2.69 0-2.94 0-11.0 0-5.35 0-2.71 0-3.06 ZGA Rnf2 0-0.36 H2Aub1 0-0.60 0-0.35 0-0.47 H2A.Z(FV) 0-0.77 0-1.45 0-1.20 0-0.91 H3K4me1 0-2.20 0-5.30 0-4.91 0-4.30 H3K27ac 0-0.83 0-15.0 0-2.56 0-6.60 Rnf2 0-23.0 0-3.50 0-1.87 0-2.23 H2Aub1 0-3.50 0-4.72 0-2.14 0-3.22 0-9.77 0-3.26 0-1.66 0-4.89 postZGA H3K27me3 DNAme 0-1.00 0-1.00 0-1.00 0-1.00 phox2bb hmgn3 Chr14: 16,744,221-16,924,083 Chr23: 31,411,677-31,450,054 Chr7: 29,340,428-29,370,812 Chr17: 23,193,389-23,212,365 Closest TSS: phox2bb Closest TSS: hmgn3 Closest TSS: rorab Closest TSS: rasgrp3 Distance to TSS: 22.1 Kb Distance to TSS: 23.6 Kb Distance to TSS: 51.1 Kb Distance to TSS: 73.8 Kb

ZGA postZGA postZGA C KLF14 Nanog Nanog H3K27ac SOX D EOMES 1 Rbpj Nanog 2 Maz CTCF 3 Atf E NFIL % of loci Cluster 5 5 Kb HLF 25 H2A.Z(FV) 0-12.0 SMAD 50 ZGA Nanog 0-12.0 4 0-1.12 ETS H2A 75 .Z(FV) 0-14.0 RFX H3K27ac E2F H3K4me1 0-6.78 GATA Nanog 0-5.76 TEAD postZGA DNAme 0-1.10

TF Motif BMYB HIF−1b Pvalue 5 Tgif 1.0x10-3 Chr3: 61,270,013-61,310,021 IRF1 Closest TSS: zgc:113295 -4 27109 enhancer regions MafF 7.5x10 Distance to TSS: 13.7 Kb ZFX -4 OCT 5.0x10 6 PRDM -4 Ahr 2.5x10 CDX FOX -2Kb +2Kb HOX Log2(ChIP/Input) 1 2 3 4 5 6 Cluster 0 2 Figure 2: PRC1 occupancy and activity precedes H3K27me3 at enhancers. (A) K-means clustering of WGBS (for DNAme) and ChIP-seq at enhancers (postZGA H3K4me1 peak summits located outside of promoters). DNAme heatmap displays WGBS fraction methylated scores (note: red color indicates regions that lack DNAme). ChIP-seq heatmaps display log2(ChIP/input) scores. (B) Genome browser screenshots of ChIP-seq enrichment at representative loci from the indicated K-means clusters in (A). (C) Transcription factor motif enrichment from HOMER (Heinz et al., 2010) at enhancer clusters from (A). (D) Features of an enhancer cluster with exceptionally high H3K27ac and Nanog binding. K-means clusters generated in (A) were utilized to plot heatmaps of Nanog and H3K27ac. (E) A genome browser screenshot depicting Nanog and H3K27ac ChIP enrichment at a DNA-methylated enhancer from cluster 5 in (D). bioRxiv preprint doi: https://doi.org/10.1101/2021.03.16.435592; this version posted March 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

A Cluster 1 50 Kb Cluster 2 10 Kb Cluster 3 20 Kb Cluster 4 5 Kb 0-1.01 0-0.82 0-1.05 H2A.Z(FV) 0-0.20 H3K4me1 0-0.25 0-0.31 H3K27ac 0-1.41 0-1.51 0-2.36 Rnf2 0-6.25 0-1.03 0-0.53 preZGA H2Aub 0-2.00 0-1.22 0-1.20 H2A.Z(FV) 0-12.0 0-7.57 0-6.68 H3K4me1 0-1.71 0-1.19 0-1.22 0-11.0 0-2.39 0-1.96 ZGA Rnf2 H2Aub 0-0.38 0-0.23 0-0.30 H2A.Z(FV) 0-0.73 0-0.62 0-0.64 H3K4me1 0-3.01 0-3.96 0-2.33 H3K27ac 0-4.53 0-3.65 0-3.00 Rnf2 0-16.0 0-2.25 0-1.16 H2Aub 0-11.0 0-13.0 0-2.61 postZGA H3K27me3 0-8.02 0-1.57 0-0.92 DNAme 0-0.93 0-1.00 0-1.00

Chr7; 68,164,341-68,330,256 tubb1 kat5b Closest TSS: hnf4b Chr6; 49,854,706-49,894,274 Chr5; 65,998,218-66,077,563 Chr17; 38516355-38540098 Distance to TSS: 562.7 Kb Closest TSS: tubb1 Closest TSS: kat5b Closest TSS: sptb Distance to TSS: 18.0 Kb Distance to TSS: 44.5 Kb Distance to TSS: 93.9 Kb

B C preZGA ZGA postZGA # of ATAC-seq ATAC-seq ATAC-seq Cluster # GO Term genes P-value 1 Regulation of transcription 151 2.21E-30 2 1 Anatomical structure development 163 4.01E-14 3 Biological adhesion 80 7.07E-10 2 Regulation of gene expression 368 7.52E-07 Regulation of response to stimulus 212 8.57E-06 4 3 Cell adhesion via plasma membrane 25 1.70E-09 Regulation of transcription 167 2.62E-04 Regulation of RNA metabolic process 546 1.78E-07 4 Biological adhesion 109 2.68E-06 5 Regulation of cellular metabolic process 744 7.28E-06

5 Developmental process 517 5.09E-18 27109 enhancer regions Regulation of metabolic process 380 1.43E-08 6 Anatomical structure morphogenesis 356 7.36E-13 6 Regulation of nervous system dev. 110 8.35E-12 Regulation of RNA metabolic process 497 3.09E-11 -2Kb +2Kb Log2(ATAC/Input) D −2 0 2 Cluster 5 Cluster 5 5 Kb 5 Kb H2A.Z(FV) 0-2.87 0-0.90 0-59.0 0-59.0 preZGA ATAC-seq 0-8.87 H2A.Z(FV) 0-10.0 Nanog 0-7.67 0-11.0 0-103 ZGA ATAC-seq 0-139 H2A.Z(FV) 0-1.12 0-0.90 0-8.05 0-4.49 H3K27ac H3K4me1 0-4.20 0-5.10 Nanog 0-2.93 0-7.20 ATAC-seq 0-139 0-139 postZGA DNAme 0-1.00 0-1.00

Chr1: 13,813,231-13,826,282 Chr25: 33,649,303-33,658,935 Closest TSS: mir2185-1 Closest TSS: foxb1a Distance to TSS: 44.0 Kb Distance to TSS: 13.9 Kb Figure 2 – figure supplement 1: Additional examples of ChIP enrichment at enhancers. (A) Genome browser screenshots of ChIP-seq enrichment at representative enhancer loci from enhancer K-means clusters in Figure 2A. (B) GO-term analysis of enhancer clusters in Figure 1C. Top GO terms (enriched gene categories) for the nearest genes to the enhancer clusters are shown, along with the number of genes (#) and the P-value for enrichment. GO-term analysis was performed with DAVID (Huang da et al., 2009). (C) Heatmaps of ATAC-seq at H3K4me1 peak summits. K-means clusters from Figure 2A were used to plot data. (D) Genome browser screenshots of representative ATAC-seq and ChIP-seq enrichment at enhancer cluster 5 from Figure 2A & 2D. bioRxiv preprint doi: https://doi.org/10.1101/2021.03.16.435592; this version posted March 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

155 factors that recruit histone modifiers to promoters and enhancers partially overlap. Taken

156 together, enhancers acquire H3K27me3 during postZGA in proportion to their levels of Rnf2 and

157 H2Aub1 during preZGA and ZGA, consistent with our observations at promoters.

158

159 A Unique Enhancer Class with High H3K27ac and DNA Methylation

160 Curiously, enhancer cluster 5 (Figure 2A) was unique – displaying high H3K4me1, very high

161 H3K27ac, and open chromatin (via ATAC-seq analysis; Figure 2 - figure supplement C, D) – but

162 bore DNA methylation – an unusual combination given the typical strong correlation between

163 high H3K4me1 and DNA hypomethylation. Notably, Nanog binding sites were highly enriched

164 solely at cluster 5, and Nanog ChIP-seq during ZGA and postZGA (Xu et al., 2012) showed

165 Nanog occupancy highly and selectively enriched at cluster 5 relative to other enhancer clusters

166 (Figure 2C-E). Thus, cluster 5 enhancers may utilize Nanog and H3K27ac to open and poise

167 these DNA methylated enhancers for later/subsequent transition to an active state. Consistent

168 with this notion, GO analysis of cluster 5 enriches for terms related to developmental and

169 signaling processes (p-value; 5.1E-18) (Figure 2 - figure supplement 1B).

170

171 The PRC2 Component Aebp2 is Co-incident with Rnf2 and H2Aub1 at Developmental

172 Loci

173 The pre-marking of developmental genes with H2Aub1 and Rnf2-PRC1 prior to H3K27me3

174 establishment raised the possibility of a ‘non-canonical’ (nc) mode of recruitment, involving

175 ncPRC1 action (H2Aub1 addition) followed by the recruitment of PRC2 (ncPRC2) – via

176 H2A/Zub1 recognition – to deposit H3K27me3. This mode and order of recruitment has

177 precedent in Drosophila and in mammalian ES cell cultures, with the Aebp2 and Jarid2 protein

178 components of ncPRC2 recognizing H2Aub1 and both targeting and facilitating H3K27me3

179 addition (Blackledge et al., 2014; Blackledge et al., 2020; Cooper et al., 2014; Cooper et al.,

180 2016; Kalb et al., 2014; Kasinath et al., 2021; Tamburri et al., 2020). We then addressed whether

181 establishment of H3K27me3 during postZGA is mediated by the non-canonical Aebp2-PRC2

182 complex at loci pre-marked with H2Aub1. Interestingly, Aebp2 protein levels were very low

183 during preZGA and ZGA stages, but robustly detected postZGA (Figure 3A), without a large

184 increase in aebp2 transcript levels (Figure 3 - figure supplement 1A). Aebp2 ChIP-seq during

185 postZGA revealed a remarkably high coincidence of Aebp2 with H2Aub1, Rnf2 and H3K27me3

186 at promoters (Figure 3B, C; Figure 3 - figure supplement 1B-D) and at enhancers (Figure 3D, E,

187 Figure 3 - figure supplement 1E). Taken together, these results suggest that translational

188 upregulation and/or protein stability enables Aebp2 protein accumulation postZGA – enabling

189 the ‘reading/binding’ of H2Aub1, and H3K27me3 deposition during postZGA by PRC2.

190

191 Loss of H2Aub1 via Rnf2 Inhibition Prevents Aebp2 Localization and H3K27me3

192 Deposition

193 To functionally test whether H2Aub1 recruits Aebp2-PRC2 for de novo establishment of

194 H3K27me3 at developmental genes, we utilized the RNF2 inhibitor, PRT4165 (Chagraoui et al.,

195 2018; Ismail, McDonald, Strickfaden, Xu, & Hendzel, 2013; Zhu et al., 2018). PRT4165 is a

196 small molecule inhibitor of Rnf2 that has previously been shown to strongly reduce H2Aub1

197 modification, but not to affect the activity of related H2A E3 ligases such as Rnf8 and Rnf168

198 (Chagraoui et al., 2018; Ismail et al., 2013; Zhu et al., 2018). In each of three biological

199 replicates, PRT4165 treatment (150µM) from the 1-cell stage onward largely eliminated H2Aub1

200 by 4hpf (ZGA) (Figure 4A, B), and conferred a developmental arrest that resembled untreated 4

Promoters A ZGA B Post ZGA 2.5hpf 3.5hpf 4.3hpf Rnf2 H2Aub1 Aebp2 K27me3 1

ge 10 µm 2

e r 3 M

4 API D ebp2

A 5

20 µm 14396 Promoter regions ge

e r Log2(ChIP/Input)

M −2.5 0 2.5 -2Kb TSS +2Kb

C Promoters Cluster 1 50 kb Cluster 2; vsx2 20 kb 0-26.0 0-17.0 Rnf2 0-3.42 H2Aub1 0-3.59 0-15.0 0-9.67 Aebp2 0-9.31 0-6.36

postZGA H3K27me3 hoxaa locus vsx2 lin52 pomt2 dtd2

Cluster 3; prdx2 5 kb Cluster 4; gtf3ab 20 kb Rnf2 0-2.51 0-17.0 H2Aub1 0-3.55 0-18.0 0-3.70 0-8.68 Aebp2 0-4.02 0-6.91

postZGA H3K27me3

rnaseh2a prdx2 junba gtf3ab lnx2a pdx1

D Enhancers Post ZGA Enhancers H3K4me1 Rnf2 H2Aub1 Aebp2 H3K27me3 E 1 Cluster 1 5 kb Cluster 2 10 Kb 0-23.0 0-3.76 2 Rnf2 H2Aub1 0-21.0 0-5.13 Aebp2 0-13.0 0-2.52 3 H3K27me3 0-9.77 0-3.40 0-2.20 0-5.36 postZGA H3K4me1 phox2bb hmgn3 4 Chr14;16,744,221-16,924,083 Chr23: 31,413,998-31,450,124 Closest TSS: phox2bb Closest TSS: hmgn3 Distance to TSS: 22.1 Kb Distance to TSS: 23.6 Kb

5 Cluster 3 5 Kb 5 Kb 0-2.32 Cluster 4 Rnf2 0-2.00 27109 enhancer regions 0-6.18 0-13.0 H2Aub1 0-4.13 Aebp2 0-3.05 0-1.79 0-4.89 6 H3K27me3 0-5.01 0-4.30 postZGA H3K4me1 Log2(ChIP/Input) Chr7:29,344,675-29,365,255 Chr17;23,193,367-23,213,415 Closest TSS: rorab Closest TSS: rasgrp3 −2.5 0 2.5 -2Kb +2Kb Distance to TSS: 51.1 Kb Distance to TSS: 73.8 Kb

Figure 3: Aebp2-PRC2 mediates de novo H3K27me3 at loci pre-marked by H2Aub1. (A) Nuclear Aebp2 detection by immunofluoresence in postZGA zebrafish embryos (4.3 hpf). No Aebp2 staining was detected at preZGA (2.5 hpf) or ZGA (3.5 hpf). Bottom row: the dashed square indicates the field of view in upper panels. 1 of 3 biological replicates is shown. (B) Aebp2 binding at promoters during postZGA overlaps and scales with occupancy of Rnf2, H2Aub1, and H3K27me3. Promoter clusters from Figure 1C were utilized to plot heatmaps. (C) Genome browser screenshots of ChIP-seq at representative promoter loci from clusters in (B). (D) Aebp2 binding at enhancers during postZGA overlaps with occupancy of Rnf2, H2Aub1, and H3K27me3. Enhancer clusters from Figure 2A were utilized to plot heatmaps. (E) Genome browser screenshots of ChIP-seq enrichment at representative enhancer loci from clusters in (D). bioRxiv preprint doi: https://doi.org/10.1101/2021.03.16.435592; this version posted March 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

A RNA-seq B postZGA Aebp2 ChIP-qPCR C rnf2 8 input rep3 rep1 rep2 100 aebp2 rep2 6 rep1 inpu t

f 4 FPK M

50 o

% rep3 2 1.0 input 0 0 1 0.0 isl1 2.25 hpf 3 hpf 4.3 hpf vsx1 pax6a idh3gpcf1lman2 Developmental Stage

Promoters D Cluster 1 50 Kb Cluster 1 25 Kb Rnf20-44.0 0-42.0 H2Aub10-27.0 0-22.0 Aebp20-16.0 0-17.0 0-9.59 0-9.69

postZGA H3K27me3

hoxba locus hoxda locus

E Enhancers Cluster 1 50 Kb Cluster 1 50 Kb 0-17.0 0-16.0 Rnf2 0-6.35 0-11.0 H2Aub1 0-9.41 0-9.43 Aebp2 0-7.65 0-9.22 H3K27me3 0-2.00 0-3.32 postZGA H3K4me1 sox6 chr7; 26,946,455-27,199,887 Chr7; 68176228_68,300,077 Closest TSS: sox6 Closest TSS: hnf4b Distance to TSS: 38.0 Kb Distance to TSS: 562.7 Kb

Figure 3 – figure supplement 1: ChIP profiling of Aebp2 in postZGA embryos. (A) Abundance of aebp2 mRNA in early zebrafish embryos measured by RNA-sequencing. Increased Aebp2 protein levels from preZGA to postZGA observed in Figure 4A are not explained by increased aebp2 mRNA levels (black bars). Levels of rnf2 mRNA are plotted for comparison (grey bars). RNA-seq data was collected from http://www.ebi.ac.uk/gxa/experiments/E-ERAD-475. (B) Aebp2 ChIP-qPCR demonstrates enrichment of Aebp2 at developmental gene promoters (pax6a, vsx1, isl1) in postZGA stage embryos (4.3 hpf). Housekeeping gene promoters (idh3g, pcf11, lman2) were used as negative control regions. Note: promoter regions assayed here are either robustly marked by H2Aub1 (pax6a, vsx1, isl1) or lack H2Aub1 (idh3g, pcf11, lman2). Three biological replicates were conducted for ChIP. For qPCR, three technical replicates were conducted on each ChIP biological replicate. (C) Genome wide correlation matrix of Aebp2 ChIP-seq replicates and input from postZGA (4.3 hpf) zebrafish embryos. Heatmap matrix displays Pearson correlation coefficients. (D) Genome browser screenshots of representative promoters with ChIP-seq enrichment demonstrating binding of Aebp2 at promoters bearing Rnf2, H2Aub1, and H3K27me3 at post ZGA (4.3 hpf). (E) Genome browser screenshots of representative enhancers with ChIP-seq enrichment demonstrating binding of Aebp2 at enhancers bearing Rnf2, H2Aub1, and H3K27me3 at post ZGA (4.3 hpf). bioRxiv preprint doi: https://doi.org/10.1101/2021.03.16.435592; this version posted March 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

201 hpf embryos (Figure 4 - figure supplement 1A). To determine whether the loss of H2Aub1

202 conferred loss of Aebp2 genomic targeting we performed ChIP experiments on Aebp2 in

203 PRT4165-treated and DMSO-treated embryos (3 biological replicates per condition).

204 Remarkably, developmental loci that normally display high Aebp2 in untreated or DMSO-treated

205 embryos lost Aebp2 binding following PRT4165 treatment (Figure 4C, clusters 1, 3, & 5; Figure

206 4 - figure supplement 1B, C). Curiously, PRT4165 treatment also conferred limited new/ectopic

207 Aebp2 peaks (Figure 4C, clusters 4, 6, 7,8), however our profiling of H3K27me3 following

208 PRT4165 treatment (3 biological replicates) revealed that new/ectopic Aebp2 sites did not

209 acquire H3K27me3 (Figure 4 - figure supplement 2B). Importantly, treatment with PRT4165

210 eliminated or strongly reduced H3K27me3 at virtually all loci normally occupied by H3K27me3

211 (Figure 4D, Figure 4 - figure supplement 1D), a conclusion supported by our use of a ‘spike-in’

212 control involving Drosophila nuclei bearing H3K27me3-marked regions in all 3 replicates per

213 condition. Curiously, a small number of ectopic H3K27me3 peaks were observed in the

214 PRT4165 treatment, however these loci were not bound by Aebp2 (Figure 4 - figure supplement

215 2B). Taken together, H2Aub1 deposition by Rnf2 during preZGA is required for the recruitment

216 of Aebp2 and subsequent de novo deposition of H3K27me3 postZGA at developmental loci.

217

218 To determine whether H2Aub1 impacts transcriptional repression of developmental genes at

219 ZGA, we performed RNA sequencing (3 biological replicates per condition) on 4hpf embryos

220 that were either vehicle-treated (DMSO) or PRT4165-treated from the 1-cell stage onward

221 (Figure 4 - figure supplement 1E), and identified both up- and downregulated genes (Figure 4E).

222 PRT4165-upregulated and downregulated genes (>3-fold, p-value <0.01) were both enriched in

223 developmental factors, but the number of genes associated with upregulated GO-terms were

A Western blot Add PRT4165 C D or DMSO ChIP-seq, RNA-seq Aebp2 ChIP-seq H3K27me3 ChIP-seq DMSO PRT4165 DMSO PRT4165 1 1 1 cell stage sphere stage (4 hpf) 2

3 2 preZGA postZGA B 3 H2Aub1 4 hpf 4 4 100 100% 5 4 4 DMSO PRT4165 6 5 H2Aub1 50 7 0 0 % of Contro l 4.61% 6 H3 0 8 Log2(ChIP/Input) Log2(ChIP/Input) T4165 -4 -4 DMSO PR

10 kb 10 kb 10 kb E F 0-0.59 RNA-seq H2A.Z(FV) 0-1.11 0-1.64 0-0.30 0-0.30 0-0.22

25 H3K4me1 0-2.49 0-1.22 H3K27ac 0-1.95 0-6.97 0-4.84 0-3.87 Rnf2 0-1.84 0-2.23 preZGA H2Aub1 0-2.27 0-11.0 0-11.0 0-7.18 20 H2A.Z(FV) 0-1.52 0-2.69 0-1.43 H3K4me1 cdx4 0-11.0 0-9.56 0-7.43

ZGA Rnf2 0-0.60 0-0.47 0-0.70

alue) H2Aub1 15 0-1.04 H2A.Z(FV) 0-0.80 0-0.45 0-3.70 0-2.90 0-2.90 tbx1 H3K4me1 0-7.21 0-1.23 six3b H3K27ac 0-1.00 her9 0-26.0 0-18.0 0-7.91 10 Rnf2 vsx1 0-20.0 0-18.0 0-18.0 −log10(p v myf5 H2Aub1 0-5.20 0-4.55 0-4.53 fezf2 DMSO Aebp2 meox1 0-5.20 0-4.55 0-4.53

5 hoxb7a PRT4165 Aebp2 vsx2 0-2.24 0-1.07 0-1.49

postZGA DMSO H3K27me3 hoxc8a 0-2.24 0-1.07 0-1.49 hoxa9a PRT4165 H3K27me3 0-2.09 0-3.31 0-1.49 H3K4me3 0-8.50 0-2.50 0 0-4.33 DMSO RNAseq 0-8.50 0-2.50 PRT4165 RNAseq 0-4.33 0-1.00 0-1.00 0-1.00 −10 −5 0 5 10 DNAme log2FoldChange fezf2 vsx2 her9

Figure 4: Catalytic activity of PRC1 is required for aebp2 binding, H3K27me3 establishment, and transcriptional repression of developmental genes. (A) Experimental design of drug treatments to inhibit Rnf2 activity. Embryos at the 1-cell stage were added to media containing either PRT4165 (150 μM) or DMSO and raised until 4 hpf. (B) PRT4165 treatment of embryos confers bulk loss of H2Aub1 at 4hpf. Left: western blot for H2Aub1 in 4hpf embryos treated with DMSO (vehicle) or 150 μM PRT4165 (Rnf2 inhibitor). Right: quantification western blot in left panel. (C) Impact of H2Aub1 removal on Aebp2 genomic localization. K-means clustering of Aebp2 ChIP-seq enrichment at all loci with called peaks in embryos (4 hpf) treated from the 1-cell stage with either DMSO or 150 μ M PRT4165. (D) Impact of H2Aub1 removal on H3K27me3 genomic localization. K-means clustering of Aebp2 ChIP-seq enrichment at all loci with called peaks in embryos (4 hpf) treated from the 1-cell stage with either DMSO or 150 μM PRT4165. (E) Impact of Rnf2 inhibition on gene expression. Volcano plot of RNA-seq data from PRT4165-treated versus untreated embryos (4hpf). Green and Red data points signify transcripts with P-values <0.01 and at least a 3-fold change (increase or decrease) in expression, respectively. Marquee upregulated genes encoding developmental transcription factors are labelled. (F) Genome browser screenshots of representative developmental genes which, upon Rnf2 inhibition, lose Aebp2 binding and H3K27me3 marking, and become transcriptionally active. bioRxiv preprint doi: https://doi.org/10.1101/2021.03.16.435592; this version posted March 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

A B 4hpf Aebp2 ChIP-qPCR 6 DMSO DMSO PRT4165 PRT4165 4 inpu t 4 hpf Wash out f o

% 2

5.3 hpf 0 1 isl1 pax6a vsx1 idh3g pcf1 lman2 C D DMSO Aebp2 ChIP-seq PRT4165 Aebp2 ChIP-seq DMSO H3K27me3 ChIP-seq PRT4165 H3K27me3 ChIP-seq

input2input1input3rep2rep1rep3 input1input2input3rep3rep1rep2 input2input1input3rep3rep1rep2 rep1rep2rep3input2input1input3 rep3 rep2 rep2 input3 rep1 rep1 rep1 input1 rep2 rep3 rep3 input2 1.0 1.0 1.0 1.0 input3 input3 input3 rep3 input1 input2 input1 rep2 input2 input1 input2 rep1 0.0 0.0 0.0 0.0

RNA-seq E F Upregulated Gene GO Term # of genes P-value

DMSO_rep2DMSO_rep1DMSO_rep3PRT4165_rep3PRT4165_rep1PRT4165_rep2 regulation of transcription 118 1.71E-7 PRT4165_rep2 anatomical structure development 159 2.86E-7 PRT4165_rep1 1.0 PRT4165_rep3 Downregulated Gene GO Term # of genes P-value DMSO_rep3 DMSO_rep1 regulation of embryonic development 17 9.34E-10 transmembrane receptor signaling 1.8E-9 DMSO_rep2 20 0.0 multicellular organismal development 49 5.15E-9

Figure 4 – figure supplement 1: Replicate structures of ChIP-seq and RNA-seq experiments involving drug treatments. (A) Treatment of zebrafish embryos with PRT4165 (150 μM) beginning at the 1 cell stage results in developmental arrest at 4hpf. Removal of PRT4165 at 4 hpf failed to restore normal developmental progression to embryos (lower right, “Wash out”). (B) Aebp2 ChIP-qPCR in postZGA (4 hpf) embryos treated with DMSO (black bars) or PRT4165 (150 μM, red bars). Binding of Aebp2 to developmental gene promoters (pax6a, vsx1, isl1) is lost upon PRC1 inhibition. (C) Genome wide correlation matrices of Aebp2 ChIP-seq replicates and input from postZGA (4 hpf) zebrafish embryos treated with DMSO (left) or PRT4165 (150 μM , right). Heatmap matrices display Pearson correlation coefficients. (D) Genome wide correlation matrices of H3K27me3 ChIP-seq replicates and input from postZGA (4 hpf) zebrafish embryos treated with DMSO or PRT4165 (150 μM, right). Heatmap matrices display Pearson correlation coefficients. (E) Genome wide correlation matrix of RNA-seq replicates from postZGA (4 hpf) zebrafish embryos treated with DMSO or PRT4165. Heatmap matrix displays Pearson correlation coefficients. (F) GO-terms associated with upregulated & downregulated transcripts depicted in figure 4E. GO-term analysis was performed with DAVID (Huang da et al., 2009). bioRxiv preprint doi: https://doi.org/10.1101/2021.03.16.435592; this version posted March 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

5 kb 0-2.50 H2A.Z(FV) A 0-0.20 K4me1 0-1.45 H3K27ac Rnf20-6.29 0-2.29 preZGA H2Aub1 0-10.0 H2A.Z(FV) 0-1.44 K4me1 0-11.0

ZGA Rnf2 0-0.56 H2Aub1 0-0.90 H2A.Z(FV) 0-2.10 K4me1 0-0.54 H3K27ac 0-36.0 Rnf2 0-23.0 H2Aub10-5.44 DMSO Aebp2 0-5.44 PRT4165 Aebp20-1.72 postZGA DMSO H3K27me30-1.72

PRT4165 H3K27me30-0.79 H3K4me30-6.00 DMSO RNAseq0-6.00 PRT4165 RNAseq 0-1.00 DNAme

six3b six2b

Ectopic Aebp2 binding after H2Aub1 Ectopic H3K27me3 peaks B loss also lack H3K27me3 lack Aebp2 binding C 5 kb 10 kb 0-0.84 0-1.17 H2A.Z(FV) 0-0.24 0-0.15 RNA-seq K4me1 0-1.73 0-0.69 H3K27ac Up regulated upon Rnf2 inhibition 0-2.00 0-2.00 Rnf2 (2627)

preZGA 0-1.70 0-1.70 H2Aub1 H2A.Z(FV) 0-7.84 0-2.57 1142 K4me1 0-1.51 0-1.88 0-5.35 0-5.35 ZGA Rnf2 0-0.80 0-0.80 H2Aub1 1485 0-0.63 0-0.38 H2A.Z(FV) 0-2.93 0-3.10 K4me1 0-1.09 0-1.09 H3K27ac 0-3.50 0-3.50 Rnf2 0-4.72 0-4.72 H2Aub1 0-2.54 0-0.98 DMSO Aebp2 6364 0-2.54 0-0.98 PRT4165 Aebp2 0-2.00 0-23.0 postZGA DMSO H3K27me3 0-2.00 0-23.0 PRT4165 H3K27me3 0-1.52 0-1.32 H3K4me3 0-4.84 0-4.00 DMSO RNAseq 0-4.84 0-4.00 PRT4165 RNAseq ChIP-seq 0-1.00 0-1.00 DNAme Promoters marked by H2Aub1 (8952) ap1s3a pcdh15a

Figure 4 – figure supplement 2: Loss of H2Aub1 results in disrupted Aebp2 localization, H3K27me3 marking and transcriptional de-repression. (A) Genome browser screenshots of representative de-repressed genes upon PRC1 inhibition. Both six3b and six2b are bound by Rnf2 and marked by H2Aub1 from preZGA onward. At postZGA these genes normally attract binding by Aebp2 and acquire H3K27me3. Inhibition of Rnf2 (via PRT4165) causes failed Aebp2 binding, and prevention of H3K27me3 establishment. Notably, six3b is precociously expressed upon loss of H2Aub1. (B) Genome browser screenshots of representative loci that gain ectopic Aebp2 binding (left) or H3K27me3 marking (right) upon PRC1 inhibition. Ectopic binding events for Aebp2 or H3K27me3 appear to be mutually exclusive. Dotted boxes denote region of ectopic binding or marking by Aebp2 or H3K27me3, respectively. (C) Approximately 16.6% of genes normally silenced by H2Aub1 promoter marking are transcriptionally upregulated upon inhibition of Rnf2. Venn diagram displays the overlap between the gene promoters normally marked by H2Aub1 and protein coding genes that are transcriptionally upregulated (p-value <0.001, >1.5 fold change) after Rnf2 inhibiton. Here H2Aub1 marked promoters are defined as regions +/-2Kb from transcription start sites and having peak(s) called by MACS2 (Feng et al., 2012) (q-value cutoff 0.01) of H2Aub1 from 4.3 hpf H2Aub1 ChIP-seq. bioRxiv preprint doi: https://doi.org/10.1101/2021.03.16.435592; this version posted March 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

224 substantially greater than downregulated GO-terms (Figure 4 - figure supplement 1F). Here,

225 ~16.6% of H2Aub1-marked protein coding genes were upregulated, which may reflect the

226 availability at ZGA of an opportunistic activator, following H2Aub1 loss (Figure 4 - figure

227 supplement 2C). Affected genes include those in clustered loci (e.g. Hox genes) where the effect

228 was moderate, as well as non-clustered/solo formats where the effect of PRT4165 was more

229 pronounced (Figure 4E, F; Figure 4 - figure supplement 2A). Taken together, these results

230 strongly suggest that H2Aub1 represses developmental genes during preZGA and ZGA,

231 independent of H3K27me3, and that the absence of H2Aub1 renders developmental genes

232 susceptible to precocious activation following ZGA, which confers developmental arrest prior to

233 gastrulation.

234

235 Discussion

236 Our work reveals that developmental gene silencing in early zebrafish embryos is established

237 through sequential recruitment and activity of PRC1 and PRC2 complexes, respectively, to

238 otherwise open/permissive loci bearing Placeholder nucleosomes (Figure 5). Placeholder

239 nucleosomes contain H3K4me1 and the histone variant H2A.Z(FV), are installed by the

240 chromatin remodeler SRCAP during preZGA (Murphy et al., 2018), and are focally pruned to

241 small regions by the chaperone Anp32e (Kobor et al., 2004; Krogan et al., 2003; Mao et al.,

242 2014; Obri et al., 2014; Wang et al., 2016). Here, our reanalysis of published data confirms that

243 H3K27ac is an additional component of Placeholder nucleosomes during preZGA (Zhang et al.,

244 2018). Functional studies reveal that Placeholder nucleosomes prevent DNAme where they are

245 installed, and are utilized to reprogram the DNAme patterns during cleavage stage. Therefore,

246 from a ‘permissive’ Placeholder platform during preZGA, two very different

247 chromatin/transcriptional states are attained at ZGA: active or poised (Murphy et al., 2018).

248

249 Our work suggests that the initial poised state at developmental genes and enhancers involves the

250 imposition of polycomb-based silencing upon the permissive states established by Placeholder

251 nucleosomes. Specifically, we observe H2Aub1 addition by Rnf2/PRC1 during preZGA and

252 ZGA to confer initial transcriptional silencing at developmental loci – which is subsequently

253 read by the Aebp2/PRC2 complex to add H3K27me3 after ZGA (Figure 5). Prior work in ES

254 cells has provided an in vitro parallel in which PRC1 activity (H2Aub1 addition) can precede

255 PRC2 recruitment at certain loci (Blackledge et al., 2014; Blackledge et al., 2020; Cooper et al.,

256 2014; Cooper et al., 2016; Kalb et al., 2014; Tamburri et al., 2020; Tavares et al., 2012), which

257 has been termed ‘non-canonical’ order of recruitment, to contrast with prior data showing the

258 reverse/canonical order (Wang et al., 2004). Furthermore, and consistent with our work, human

259 AEBP2 and JARID2 have recently have been shown to directly bind H2Aub1 and stimulate

260 PRC2 activity in the presence of H3K4 methylation (Kasinath et al., 2021), and a similar

261 mechanism may be utilized to establish bivalency after ZGA in zebrafish.

262

263 Our work also clarifies and extends prior work in zebrafish which showed that an incross of

264 zebrafish heterozygous for an rnf2 loss-of-function truncation mutation yielded a pleitropic

265 terminal phenotype at 3 days post fertilization (dpf), coincident with the loss of rnf2 RNA.

266 Notably, loss of rnf2 at 3 dpf was associated with partial upregulation of certain developmental

267 genes, but H3K27me3 remained fully present, showing that Rnf2 is not required for H3K27me3

268 maintenance (Chrispijn et al., 2019). However, progression of rnf2 mutants to 3 dpf may have

A Establishment of developmental gene repression by PRC1 PRC2 Aebp2 Jarid2

Ub Off Ub Off Ub Poised PRC1 PRC1 PRC1 TF Z TF Z TF Z Z Z Z

Aebp2 PRC2 Loss of PRC2 PRC1 inhibition Jarid2 recruitmentAAAAA Loss of H2Aub1 AAAAA

Ub Off Ub RNA Transcriptional PRC1 PRC1 pol II TF Z TF Z De-repression Z Z

Pre ZGA Genome Activation Post ZGA

Ub H2A K119Ub1 (PRC1) H3K27ac H3K27me3 (PRC2) H3K4me1

Z H2A.Z(FV) H3K4me3 DNA hypomethylation TF Putative PRC1-interacting transcription factor

Figure 5: Model for Polycomb-mediated establishment of developmental gene silencing during zebrafish embryogenesis. (A) Prior to ZGA, Rnf2-PRC1 is recruited by transcription factors (TF) to promoters (shown) and enhancers (not shown) of developmental genes bearing Placeholder nucleosomes (H2A.Z(FV), H3K4me1, H3K27ac). Rnf2-PRC1 deposition of H2Aub1 recruits Aebp2-PRC2 to catalyze H3K27me3 addition. H2Aub1 ablation (via Rnf2 inhibition) eliminates Aebp2-PRC2 recruitment and prevents H3K27me3 establishment. Notably, H2Aub1 loss causes precocious transcription of certain developmental genes after ZGA, identifying H2Aub1 as a critical component of silencing at ZGA. bioRxiv preprint doi: https://doi.org/10.1101/2021.03.16.435592; this version posted March 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

269 relied on maternally-inherited WT rnf2 RNA or protein to provide the initial establishment of

270 gene silencing and H3K27me3, raising the possibility that rnf2 is actually essential at a much

271 earlier developmental stage. Our use of the Rnf2 inhibitor, PRT4165, during preZGA and ZGA

272 stages reveals the necessity for Rnf2 activity for the establishment of developmental gene

273 silencing, for subsequent H3K27me3 addition, and for progression of zebrafish development

274 beyond the ZGA stage. Importantly, developmental gene upregulation is not is attributable to

275 H3K27me3 loss, as maternal zygotic ezh2 mutant zebrafish embryos do not precociously activate

276 developmental genes during ZGA, and they progress through gastrulation without H3K27me3

277 (Rougeot et al., 2019; San et al., 2016; San et al., 2019). Notably, although upregulation of

278 developmental genes in the presence of PRT4165 is clear, this involves ~16.6% of the

279 developmental gene repertoire occupied by H2Aub1/Rnf2. Here, we suggest that tissue-specific

280 activators for the majority of developmental genes are not present at ZGA.

281

282 One curiosity arising from our work is why zebrafish utilize the non-canonical PRC1 complex,

283 which adds monoubiquitination to H2A/H2A.Z(FV), rather than canonical PRC1 complex,

284 which compacts chromatin for initial developmental gene silencing. Here, we speculate that the

285 rapid (~16 minute) cell cycles that characterize the preZGA cleavage state – coupled to the need

286 for continual DNA replication during cleavage stage – are not compatible with the compaction

287 conferred by canonical PRC1 (Gao et al., 2012; Grau et al., 2011; Lau et al., 2017). Furthermore,

288 the necessary substrate to recruit canonical PRC1 to chromatin, H3K27me3, is absent in preZGA

289 embryos. Instead, the use of the repression modes conducted by non-canonical PRC1 addition of

290 H2Aub1 – which antagonizes RNA Pol II transcriptional initiation or bursting, may help confer

291 silencing without conferring a compaction that might impede DNA replication (Dobrinić et al.,

292 2020; Stock et al., 2007). However, once embryos exit cleavage stage, the cell cycle greatly

293 lengthens, and Aebp2-PRC2 complexes add H3K27me3 to loci – which may then enable

294 canonical PRC1 to localize to and conduct compaction. Future studies are necessary to address

295 this possible temporal order and role for canonical PRC complexes.

296

297 Here, we observe that developmental or housekeeping gene promoters attract either a high or low

298 level PRC1 binding, respectively. How ncPRC1 is recruited to CpG islands in ES cells is

299 partially understood, as the ncPRC1 subunit Kdm2b helps recruit ncPRC1 to CpG islands of

300 developmental genes. In this context, Kdm2b binds to hypomethylated CpGs via the CxxC motif,

301 (Blackledge et al., 2014; Farcas et al., 2012; He et al., 2013; Wu et al., 2013). However, ncPRC1

302 is recruited robustly to only a minority of Kdm2b-bound CpG islands, implying that additional

303 factors are needed to specify recruitment of ncPRC1 to CpG islands of developmental genes.

304 Here, we speculate that particular transcription factors, such as the candidates in Figures 1E and

305 2C, are likewise utilized in cooperation with zebrafish Kdm2b to enable strong focal recruitment

306 of Rnf2-PRC1 to Placeholder-occupied developmental loci. In contrast, the candidate

307 transcription factors at housekeeping genes would recruit MLL complexes to implement H3K4

308 methylation, and not Rnf2-PRC1. Finally, we expect our work here will motivate work to

309 explore whether mammals likewise initially utilize Ring1a/Rnf2-associated PRC1 complexes to

310 add H2Aub1 to help establish developmental gene poising and regulation, and specify particular

311 regions for subsequent marking by H3K27me3.

312

313 Materials and Methods

314 Zebrafish Husbandry

315 Wild type Tübingen zebrafish were maintained as described (Westerfield, 2007). All

316 experiments involving zebrafish were approved by University of Utah IACUC (Protocol 20-

317 04011). Embryos were scored for developmental staged as described (Kimmel et al., 1995).

318

319 Acid Extraction of Nuclear Proteins

320 200 embryos were added to 1.5 ml tubes and washed twice with cold PBS. 800 µl of Mild Cell

321 Lysis Buffer (10 mM Tris-HCl pH 8.1, 10 mM NaCl, 0.5 NP-40, 2X protease inhibitors) was

322 applied to embryos and incubated on ice for 5 minutes. Embryos were homogenized by passing

323 through a 20 gauge syringe several times. Samples were briefly centrifuged to bring down

324 chorions. Supernatants were transferred to fresh tubes and centrifuged at 1300 X g for 5 minutes

325 at 4ºC. Pelleted nuclei were washed twice with cold Mild Cell Lysis Buffer. Nuclei were

326 resuspended to a final volume of 800 µl in cold Mild Cell Lysis Buffer and supplemented with

327 10 µl of sulfuric acid (18.4M). Samples were sonicated for 10 seconds (1 second on, 0.9 seconds

328 off) at 30% output using a Branson sonicator. Proteins were extracted for 30 minutes at 4ºC on a

329 rotator. 160 µl of 100% trichloroacetic acid was added and proteins were allowed to precipitate

330 for 30 minutes on ice. Samples were centrifuged at 13000 rpm for 5 minutes at 4ºC. Protein

331 pellets were washed with 800 µl of cold acidified acetone, and centrifuged again at 13000 rpm

332 for 5 minutes at 4ºC. Protein pellets were washed with 800 µl of cold acetone, and centrifuged

333 again at 13000 rpm for 5 minutes at 4ºC. Supernatant was discarded and pellets were dried at

334 37ºC for 5 minutes. Dried protein pellets were resuspended in 2X Laemli sample buffer and

335 boiled for 8 minutes. Samples were then used for western blotting. Bands were quantified in

336 Image J (Schneider et al., 2012).

337

338 Immunohistochemistry & DAPI staining

339 Standard protocol for immunohistochemistry was followed as described (Fernández et al., 2013;

340 Zhang et al., 2018). Three biological replicates were performed for each immunohistochemistry

341 experiment. Briefly, 30 embryos were collected at appropriate time points and fixed with fresh

342 4% paraformaldehyde (Electron Microscopy, Cat # 50980487) in 1xPBS at room temperature for

343 12 hours. Droplets of glacial acetic (100%, Merck, Cat # 1000560001) or DMSO (final

344 concentration 0.5%, Sigma) were added 5–10 sec after initiation of the fixation. Chorions were

345 manually removed from fixed embryos with forceps and dechorionated embryos were

346 dehydrated in methanol and stored at -20ºC. For immune-staining, embryos were rehydrated into

347 PB3T (1xPBS with 0.3% TritonX-100, and then incubated in blocking agent (1% BSA, 0.3 M

348 glycine in PB3T). Embryos were incubated with primary antibodies diluted in blocking agent

349 overnight at 4°C. Primary antibodies were removed and embryos were washed extensively with

350 PB3T. Embryos were next incubated with appropriate secondary antibodies in the dark followed

351 by extensive washes in PB3T. Primary antibodies used for immune-staining are listed below.

352 Secondary antibodies used were donkey α-rabbit IgG-488 at 1:500 (Life Technologies, Cat # A-

353 21206). DAPI was used at 1:1000 as a nuclear counterstain. The yolk cells were removed from

354 embryo and embryo was mounted on glass slide with ProLong Gold Antifade mounting media

355 (Thermo Fisher, Cat# P-36931) and a 2.0mm square coverslip sealed with nail polish. Samples

356 were stored at 4°C until imaged.

357

358 Imagining of Zebrafish Embryos

359 Images were acquired on a Leica SP8 White Light laser confocal microscope. Image processing

360 was completed using Nikon NIS-Elements multi-platform acquisition software with a 40X/1.10

361 Water objective. Fiji (ImageJ, V 2.0.0-rc-69/1.52p) was utilized to color DAPI channel to cyan,

362 GFP color remained green. Confocal images are max projections of Z stacks taken 0.5µm apart

363 for a total of the embryo ~7-12 µm.

364

365 Primary Antibodies

366 The following antibodies were utilized in for the present study: anti-H2Aub1 (Cell Signaling

367 Technology Cat# 8240; RRID:AB_10891618), anti-Rnf2 (Cell Signaling Technology Cat# 5694;

368 RRID:AB_10705604), anti-H2A.Z (Active Motif Cat# 39113; RRID:AB_2615081), anti-

369 H3K4me1 (Active Motif Cat# 39297; RRID:AB_2615075), anti-Aebp2 (Cell Signaling

370 Technology Cat# 14129; RRID: AB_2798398), anti-H3K27me3 (Active Motif Cat# 39155;

371 RRID: AB_2561020), anti-H3 (Active Motif Cat# 39763; RRID: AB_2650522).

372

373 ChIP-Seq in Zebrafish Embryos

374 Embryo Fixation

375 Approximately 1.5 million cells were used for each ChIP replicate. Embryos were allowed to

376 progress to the desired developmental stage and then transferred to 1.5 ml microcentrifuge tubes

377 (~200 embryos per tube). Chorions were removed enzymatically by treatment with pronase

378 1.25mg/ml in PBS). Dechorionated embryos were gently washed twice with PBS to remove

379 pronase. Samples were fixed with 1% formaldehyde (Electron Microscopy Sciences, Cat#

380 15712) for 10 minutes at room temperature with end over end rotation. Fixation was quenched

381 with 130 mM glycine for five minutes at room temperature. Samples were centrifuged for five

382 minutes at 500 x g at 4oC. Supernatant was discarded and cell pellets were washed twice with ice

383 cold PBS. Cell pellets were frozen with liquid nitrogen and stored at -80ºC.

384

385 Nuclei Isolation and Lysis

386 1 ml of Mild Cell Lysis Buffer (10 mM Tris-HCl pH 8.1, 10 mM NaCl, 0.5 NP-40, 2X

387 proteinase inhibitors) was applied to cell pellets from 1000 embryos and rotated at 4ºC for 10

388 minutes. Samples were centrifuged at 1300 X g for 5 minutes at 4ºC. Supernatant was discarded

389 and nuclei pellets were resuspended in 1 ml Nuclei Wash Buffer (50 mM Tris-HCl pH 8.0, 100

390 mM NaCl, 10 mM EDTA, 1% SDS, 2X protease inhibitors) and rotated at room temperature for

391 10 minutes. Samples were centrifuged at 1300 X g for 5 minutes at 4ºC to pellet nuclei.

392 Supernatant was discarded and nuclei pellets were resuspended in 100 µl of Nuclei Lysis Buffer

393 (50 mM Tris-HCl pH 8.0, 10 mM EDTA, 1% SDS, 2X proteinase inhibitors). Samples were

394 incubated on ice for 10 minutes. 900 µl of IP Dilution Buffer (16.7mM Tris-HCl pH 8.1, 167mM

395 NaCl, 1.2mM EDTA, 0.01% SDS, 1.1% Triton X-100, 2X proteinase inhibitors) was added to

396 samples.

397

398 Chromatin Sonication

399 Nuclear lysates were sonicated with a Branson Digital Sonifier with the following settings: 10

400 second duration (0.9 seconds ON, 0.1 seconds OFF), 30% amplitude. 7 sonication cycles were

401 performed. Samples were placed in an ice bath for at least 1 minute between each sonication

402 cycle. Sonicated samples were centrifuged at 14,000 rpm, 4ºC, for 10 minutes to pellet insoluble

403 material. Supernatants were transferred to new tubes. A portion of the sample was set aside to

404 confirm optimal chromatin shearing by agarose gel electrophoresis.

405

406 Preclear

407 20 µl of Dynabeads (Invitrogen) were blocked with 0.5mg/ml BSA in PBS. Blocked Dynabeads

408 were subsequently applied to each sonicated sample and rotated for 1 hour at 4ºC. Samples were

409 placed on a magnet stand for 1 minute and precleared supernatant was transferred to a new tube.

410 5% of the sample was removed and stored at -80ºC as input. Antibody and fresh 1X protease

411 inhibitors were added to each sample. Samples were rotated overnight at 4ºC.

412

413 Pulldown

414 Samples were centrifuged at 14,000 rpm, 4ºC, for 5 minutes to pellet insoluble material.

415 Supernatants were transferred to new tubes. 50 µl of Dynabeads (Invitrogen) were blocked with

416 BSA 5mg/ml in PBS. Blocked Dynabeads were subsequently applied to each sample and rotated

417 for 6 hours at 4ºC.

418

419 Stringency Washes

420 All wash buffers were kept ice cold during stringency washes. Samples were washed 8 times

421 with RIPA Buffer (10 mM Tris-HCl pH 7.5, 140 mM NaCl, 1mM EDTA, 0.5 mM EGTA, 1%

422 Triton X-100, 0.1% SDS, 0.1% sodium deoxycholate, 2X protease inhibitors), 2 times with LiCl

423 Buffer (10mM Tris-HCl pH 8.0, 1 mM EDTA, 250 mM LiCl, 0.5% NP-40, 0.5% sodium

424 deoxycholate, 2X protease inhibitors), 2 times with TE Buffer (10mM Tris-HCl pH 8.0, 1 mM

425 EDTA, 2X protease inhibitors).

426

427 Elution and Reversing Crosslinks

428 100 µl of Elution Buffer (10 mM Tris-HCl pH8.0, 5 mM EDTA, 300 mM NaCl, 0.1% SDS) was

429 added to beads. 2ul of RNase A (Thermo Fisher, Cat #EN531) was added to each ChIP and input

430 sample and incubated at 37ºC for 30 minutes with gentle agitation. 10 µl of Proteinase K

431 (Thermo Fisher, Cat # 25530049) was added to each sample and incubated at 37ºC for 1 hour

432 with gentle agitation. Crosslinks were reversed overnight at 65ºC with gentle agitation. ChIP

433 DNA was purified with a Qiagen MinElute PCR Purification kit (Cat #28004).

434

435 ChIP-seq Library Construction & Sequencing

436 ChIP seq libraries were prepared using NEBNext ChIP-Seq Library Prep Reagent Set for

437 Illumina (New England BioLabs, Cat # E6240). High throughput sequencing was performed on

438 Illumina HiSeq 2500 for single-end 50 bp reads or Illumina NovaSeq 6000 for paired-end 50 bp

439 reads.

440

441 ChIP-rx-seq in Zebrafish Embryos

442 ChIP-rx was adapted from (Orlando et al., 2014) for H3K27me3 ChIP in zebrafish embryos

443 treated with DMSO or PRT4165. Crosslinked Drosophila melanogaster

444 S2 cells (ATCC Cat# CRL-1963) were spiked into resuspended zebrafish embryo pellets at a

445 ratio of 5:1 (zebrafish cells : S2 cells). ChIP-rx was subsequently performed in the same way as

446 described above.

447

448 ChIP in Zebrafish Sperm

449 ChIP in zebrafish sperm was conducted as described (Murphy et al., 2018).

450

451 qPCR

452 qPCR was carried out using 2X SsoAdvanced Universal SYBR Green Supermix (Biorad Cat #

453 #1725270) and a Biorad CFX real time thermal cycler.

454

455 Oligonucleotides

456 See Table S1 for oligonucleotides used for ChIP-qPCR

457

458 RNA-Seq

459 Total RNA was harvested from zebrafish embryos with a Qiagen Allprep kit (Cat #80204). The

460 Invitrogen DNA-free DNA removal kit (Cat # AM1906 ) was subsequently used to remove

461 contaminating DNA from RNA samples. Intact poly(A) RNA was purified from total RNA

462 samples (100-500 ng) with oligo(dT) magnetic beads and stranded mRNA sequencing libraries

463 were prepared as described using the Illumina TruSeq Stranded mRNA Library Preparation Kit

464 (RS-122-2101, RS-122-2102). Purified library quality was assessed on an Agilent Technologies

465 2200 TapeStation using a D1000 ScreenTape assay (Cat # 5067-5582 and 5067-5583). The

466 molarity of adapter-modified molecules was defined by quantitative PCR using the Kapa

467 Biosystems Kapa Library Quant Kit (Cat # KK4824). Individual libraries were normalized to 5

468 nM and equal volumes were pooled in preparation for Illumina sequence analysis. High

469 throughput sequencing for RNAseq was performed on an Illumina HiSeq 2500. RNA-seq data

470 displayed in Figure 3 – figure supplement 1A was collected from

471 http://www.ebi.ac.uk/gxa/experiments/E-ERAD-475. We would like to thank the Busch-

472 Nentwich lab for providing RNA-seq data used in Figure 3 – figure supplement 1A.

473

474

475 ChIP-seq Analysis

476 ChIP-seq Fastq files were aligned to Zv10 using Novocraft Novoalign with the following

477 settings: -o SAM -r Random. SAM files were processed to BAM format, sorted, and indexed

478 using Samtools (Li et al., 2009). ChIP-seq replica correlation was assessed with deepTools

479 (Ramírez et al., 2016). Briefly, BAM files were read normalized with deeptools bamCoverage

480 with the --normalizeUsingRPKM flag. Deeptools multiBigwigSummary bins, and

481 plotCorrelation were used to generate genome-wide correlation matrices for assessing replica

482 correlation. ChIP-seq peak calling was accomplished using MACS2 with the following settings:

483 callpeak -g 1.4e9 -B -q 0.01 -SPMR (Zhang et al., 2008). Called peaks were annotated in R with

484 the ChIPseeker package (Team, 2020; Yu et al., 2015). Output bedgraph files from MACS2 were

485 processed into bigwig files with UCSC Exe Utilities bedGraphToBigWig (Kent et al., 2010).

486 Resulting bigwig files were loaded into IGV for genome browser snapshots of ChIP-seq

487 enrichment (Thorvaldsdóttir et al., 2012). Heatmaps of ChIP-seq enrichment at promoter and

488 enhancer regions were made with deepTools (Ramírez et al., 2016). A bed file of Zebrafish zv10

489 UCSC RefSeq genes from the UCSC Table Browser was utilized for plotting heat maps of ChIP

490 enrichment at promoters (Karolchik et al., 2004). Genes residing on unmapped chromosomal

491 contigs were excluded. Enhancer heatmaps utilized a bed file of postZGA H3K4me1 ChIP-seq

492 (Bogdanovic et al., 2012) peak summits that had been filtered to exclude promoters and

493 unmapped chromosomal contigs. ChIP-seq peaks were annotated by using the Bioconductor

494 package ‘ChIPseeker’ in R (Yu et al., 2015). Gene ontology analysis was performed with

495 DAVID (Huang da et al., 2009).

496

497 Violin plot of ChIP-seq enrichment at promoters

498 Log2(ChIP/input) data for promoter regions (+/-1Kb from TSS) of interest was collected from

499 processed bigwig files by utilizing the program Bio-ToolBox ‘get_datasets.pl’

500 (https://metacpan.org/pod/distribution/Bio-ToolBox/scripts/get_datasets.pl). Collected data was

501 plotted in violin format. Unpaired t-tests with Welch's correction were utilized to determine

502 statistical differences in ChIP enrichment between promoter K-means clusters. Violin plot and

503 statistical analysis (Figure 1 – figure supplement 2J) were performed in GraphPad Prism version

504 8.3.1. using GraphPad Prism version 8.3.1 for MacOS, GraphPad Software, San Diego,

505 California USA, www.graphpad.com.

506

507 DNA Motif Analysis

508 HOMER was utilized for identifying putative transcription factor binding motifs present at

509 promoters and enhancers (Heinz et al., 2010). The following parameters were used on bed files

510 of promoters and enhancers of interest: findMotifsGenome.pl danRer10 -size -250,250. Known

511 Motifs (as opposed to de novo motifs) from HOMER were presented in figures 1 & 2.

512

513 ChIP-seq analysis involving drug treatments

514 Analysis of ChIP-seq experiments involving drug treatments was performed by utilizing the

515 Multi-Replica Macs ChIPSeq Wrapper

516 (https://github.com/HuntsmanCancerInstitute/MultiRepMacsChIPSeq).

517

518 RNA-seq analysis

519 RNA-seq fastq files were aligned to Zv10 using STAR (Dobin et al., 2012) with the following

520 settings: --runMode alignReads --twopassMode Basic --alignIntronMax 50000 --outSAMtype

521 BAM SortedByCoordinate --outWigType bedGraph --outWigStrand Unstranded --

522 clip3pAdapterSeq AGATCGGAAGAGCACACGTCTGAACTCCAGTCA. The resulting sorted

523 BAM files were subsequently indexed using Samtools (Li et al., 2009). FeatureCounts was

524 utilized to collect count data for zv10 genes via the following command: -T 16 -s 2 –

525 largestOverlap (Liao et al., 2013). Count data for all replicates across experimental conditions

526 were combined into a single count matrix in R (Team, 2020). This count matrix was

527 subsequently used to identify differentially expressed genes with the R package DESeq (Anders

528 et al., 2010). RNA-seq replica correlation was assessed with deepTools (Ramírez et al., 2016).

529 Briefly, BAM files were read normalized with deeptools bamCoverage with the --

530 normalizeUsingRPKM flag (Ramírez et al., 2016). Deeptools multiBigwigSummary bins, and

531 plotCorrelation were used to generate genome-wide correlation matrices for assessing replica

532 correlation (Ramírez et al., 2016).

533

534 Reprocessed ChIP-seq Datasets

535 PreZGA H2Az & preZGA H3K4me1 ChIP-seq data (Murphy et al., 2018) (GEO: GSE95033),

536 postZGA H3K4me1 ChIP-seq data (Bogdanovic et al., 2012) (GEO: GSE68087), preZGA &

537 postZGA H3K27ac ChIP-seq data (Zhang et al., 2018) (GEO: GSE114954), postZGA H3K4me3

538 & H3K27me3 ChIP-seq data (Zhang et al., 2014) (GEO: GSE44269) and Nanog ChIP-seq (Xu et

539 al., 2012) (GEO: GSE34683) were downloaded from the Gene Expression Omibus and

540 reprocessed as described above.

541

542 Whole Genome Bisulfite Sequencing Analysis

543 WGBS from Potok et al., 2013 (DRA/SRA: SRP020008) was processed as described (Murphy et

544 al., 2018).

545

546 Data Access

547 All sequencing datasets generated in this study have been deposited at the Gene Expression

548 Omnibus under the accession number GSE168362.

549

550 Drug Treatments

551 PRT4165 (Tocris Cat #5047) was dissolved in DMSO at a concentration of 50 mM. PRT4165

552 was further diluted to a working concentration of 150 µM in embryo water and mixed

553 vigorously. Zebrafish embryos were collected and immediately placed in embryo water

554 containing 150 µM PRT4165 (or DMSO) and allowed to develop to 4 hpf.

555 Target promoter Direction Sequence (5’à3’) pax6a Forward ctccggatccgaatcacaaaactagtcc

pax6a Reverse caaaggggtttgcaatctctcacaacc

vsx1 Forward cccgtcatggtggcagtttc

vsx1 Reverse gacagtgggatgatctgctggt

isl1 Forward gtctcccatgtcaagaaagtaaggcg

isl1 Reverse gccactttcccaccttcacagat

idh3g Forward cagcaagcgaacactgaccttgt

idh3g Reverse gcagttgggaaatacagcaaaggtacg

pcf11 Forward cgatcgtttcagagcagccaataag

pcf11 Reverse gtccgtcgtactttagcagagactg

lman2 Forward cccgtccgttatatctgaatatacggaag

lman2 Reverse ctcgtaaaatgccggtgtgtcac

556

557 Table S1.

558 Oligonucleotide sequences used for ChIP-qPCR for amplifying promoter regions.

559

560

561 Acknowledgements:

562 We thank Brian Dalley and the Huntsman Cancer Institute High-Throughput Sequencing Shared

563 Resource for sequencing data. We thank Tim Parnell, Chongil Yi, and Jingtao Guo for helpful

564 discussions regarding bioinformatic analysis. We thank David Grunwald and Rodney Stewart for

565 providing helpful feedback during manuscript preparation. We thank all current and former

566 members of the Cairns lab for their perspectives on this project. B.R.C. is an investigator with

567 the Howard Hughes Medical Institute. C.W. was funded by the T32 Developmental Biology

568 Training Grant (59202072), 4DNucleome (NIH Common Fund) NBR - 92275293 S9001779,

569 and HFSP RGP0025/2015. Imaging was performed at the University of Utah Microscopy Core

570 (1S10RR024761-01). Financial support was received from the Howard Hughes Medical

571 Institute and the Huntsman Cancer Institute core facilities (CA24014).

572

573

574 Competing interests:

575 All authors declare no competing interests.

576

577 References

578 579 Akkers, R. C., van Heeringen, S. J., Jacobi, U. G., Janssen-Megens, E. M., Francoijs, K. J.,

580 Stunnenberg, H. G., & Veenstra, G. J. (2009). A hierarchy of H3K4me3 and H3K27me3

581 acquisition in spatial gene regulation in Xenopus embryos. Dev Cell, 17(3), 425-434.

582 doi:10.1016/j.devcel.2009.08.005

583 Anders, S., & Huber, W. (2010). Differential expression analysis for sequence count data. Nature

584 Precedings. doi:10.1038/npre.2010.4282.1

585 Azuara, V., Perry, P., Sauer, S., Spivakov, M., Jørgensen, H. F., John, R. M., . . . Fisher, A. G.

586 (2006). Chromatin signatures of pluripotent cell lines. Nature Cell Biology, 8(5), 532-

587 538. doi:10.1038/ncb1403

588 Bernstein, B. E., Mikkelsen, T. S., Xie, X., Kamal, M., Huebert, D. J., Cuff, J., . . . Lander, E. S.

589 (2006). A bivalent chromatin structure marks key developmental genes in embryonic

590 stem cells. Cell, 125(2), 315-326. doi:10.1016/j.cell.2006.02.041

591 Blackledge, Neil P., Farcas, Anca M., Kondo, T., King, Hamish W., McGouran, Joanna F.,

592 Hanssen, Lars L. P., . . . Klose, Robert J. (2014). Variant PRC1 Complex-Dependent

593 H2A Ubiquitylation Drives PRC2 Recruitment and Polycomb Domain Formation. Cell,

594 157(6), 1445-1459. doi:https://doi.org/10.1016/j.cell.2014.05.004

595 Blackledge, N. P., Fursova, N. A., Kelley, J. R., Huseyin, M. K., Feldmann, A., & Klose, R. J.

596 (2020). PRC1 Catalytic Activity Is Central to Polycomb System Function. Mol Cell,

597 77(4), 857-874 e859. doi:10.1016/j.molcel.2019.12.001

598 Bogdanovic, O., Fernandez-Minan, A., Tena, J. J., de la Calle-Mustienes, E., Hidalgo, C., van

599 Kruysbergen, I., . . . Gomez-Skarmeta, J. L. (2012). Dynamics of enhancer chromatin

600 signatures mark the transition from pluripotency to cell specification during

601 embryogenesis. Genome Res, 22(10), 2043-2053. doi:10.1101/gr.134833.111

602 Chagraoui, H., Kristiansen, M. S., Ruiz, J. P., Serra-Barros, A., Richter, J., Hall-Ponselé, E., . . .

603 Porcher, C. (2018). SCL/TAL1 cooperates with Polycomb RYBP-PRC1 to suppress

604 alternative lineages in blood-fated cells. Nature Communications, 9(1), 5375.

605 doi:10.1038/s41467-018-07787-6

606 Chan, S. H., Tang, Y., Miao, L., Darwich-Codore, H., Vejnar, C. E., Beaudoin, J. D., . . .

607 Giraldez, A. J. (2019). Brd4 and P300 Confer Transcriptional Competency during

608 Zygotic Genome Activation. Dev Cell, 49(6), 867-881 e868.

609 doi:10.1016/j.devcel.2019.05.037

610 Chrispijn, N. D., Elurbe, D. M., Mickoleit, M., Aben, M., de Bakker, D. E. M., Andralojc, K. M.,

611 . . . Kamminga, L. M. (2019). Loss of the Polycomb group protein Rnf2 results in

612 derepression of tbx-transcription factors and defects in embryonic and cardiac

613 development. Sci Rep, 9(1), 4327. doi:10.1038/s41598-019-40867-1

614 Cooper, S., Dienstbier, M., Hassan, R., Schermelleh, L., Sharif, J., Blackledge, Neil P., . . .

615 Brockdorff, N. (2014). Targeting Polycomb to Pericentric Heterochromatin in Embryonic

616 Stem Cells Reveals a Role for H2AK119u1 in PRC2 Recruitment. Cell Reports, 7(5),

617 1456-1470. doi:https://doi.org/10.1016/j.celrep.2014.04.012

618 Cooper, S., Grijzenhout, A., Underwood, E., Ancelin, K., Zhang, T., Nesterova, T. B., . . .

619 Brockdorff, N. (2016). Jarid2 binds mono-ubiquitylated H2A lysine 119 to mediate

620 crosstalk between Polycomb complexes PRC1 and PRC2. Nature Communications, 7(1),

621 13661. doi:10.1038/ncomms13661

622 Dahl, J. A., Jung, I., Aanes, H., Greggains, G. D., Manaf, A., Lerdrup, M., . . . Klungland, A.

623 (2016). Broad histone H3K4me3 domains in mouse oocytes modulate maternal-to-

624 zygotic transition. Nature, 537(7621), 548-552. doi:10.1038/nature19360

625 de Napoles, M., Mermoud, J. E., Wakao, R., Tang, Y. A., Endoh, M., Appanah, R., . . .

626 Brockdorff, N. (2004). Polycomb Group Proteins Ring1A/B Link Ubiquitylation of

627 Histone H2A to Heritable Gene Silencing and X Inactivation. Developmental Cell, 7(5),

628 663-676. doi:https://doi.org/10.1016/j.devcel.2004.10.005

629 Dobin, A., Davis, C. A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., . . . Gingeras, T. R.

630 (2012). STAR: ultrafast universal RNA-seq aligner. Bioinformatics, 29(1), 15-21.

631 doi:10.1093/bioinformatics/bts635

632 Dobrinić, P., Szczurek, A. T., & Klose, R. J. (2020). PRC1 drives Polycomb-mediated gene

633 repression by controlling transcription initiation and burst frequency. bioRxiv,

634 2020.2010.2009.333294. doi:10.1101/2020.10.09.333294

635 Farcas, A. M., Blackledge, N. P., Sudbery, I., Long, H. K., McGouran, J. F., Rose, N. R., . . .

636 Klose, R. J. (2012). KDM2B links the Polycomb Repressive Complex 1 (PRC1) to

637 recognition of CpG islands. eLife, 1, e00205. doi:10.7554/eLife.00205

638 Fernández, J., & Fuentes, R. (2013). Fixation/Permeabilization: New Alternative Procedure for

639 Immunofluorescence and mRNA In Situ Hybridization of Vertebrate and Invertebrate

640 Embryos. Developmental Dynamics, 242(5), 503-517.

641 doi:https://doi.org/10.1002/dvdy.23943

642 Gao, Z., Zhang, J., Bonasio, R., Strino, F., Sawai, A., Parisi, F., . . . Reinberg, D. (2012). PCGF

643 Homologs, CBX Proteins, and RYBP Define Functionally Distinct PRC1 Family

644 Complexes. Molecular Cell, 45(3), 344-356. doi:10.1016/j.molcel.2012.01.002

645 Grau, D. J., Chapman, B. A., Garlick, J. D., Borowsky, M., Francis, N. J., & Kingston, R. E.

646 (2011). Compaction of chromatin by diverse Polycomb group proteins requires localized

647 regions of high charge. Genes & Development, 25(20), 2210-2221.

648 doi:10.1101/gad.17288211

649 He, J., Shen, L., Wan, M., Taranova, O., Wu, H., & Zhang, Y. (2013). Kdm2b maintains murine

650 embryonic stem cell status by recruiting PRC1 complex to CpG islands of developmental

651 genes. Nature Cell Biology, 15(4), 373-384. doi:10.1038/ncb2702

652 Heinz, S., Benner, C., Spann, N., Bertolino, E., Lin, Y. C., Laslo, P., . . . Glass, C. K. (2010).

653 Simple Combinations of Lineage-Determining Transcription Factors Prime cis-

654 Regulatory Elements Required for Macrophage and B Cell Identities. Molecular Cell,

655 38(4), 576-589. doi:https://doi.org/10.1016/j.molcel.2010.05.004

656 Huang da, W., Sherman, B. T., & Lempicki, R. A. (2009). Systematic and integrative analysis of

657 large gene lists using DAVID bioinformatics resources. Nat Protoc, 4(1), 44-57.

658 doi:10.1038/nprot.2008.211

659 Ismail, I. H., McDonald, D., Strickfaden, H., Xu, Z., & Hendzel, M. J. (2013). A Small Molecule

660 Inhibitor of Polycomb Repressive Complex 1 Inhibits Ubiquitin Signaling at DNA

661 Double-strand Breaks. Journal of Biological Chemistry, 288(37), 26944-26954.

662 doi:10.1074/jbc.M113.461699

663 Jiang, L., Zhang, J., Wang, J.-J., Wang, L., Zhang, L., Li, G., . . . Liu, J. (2013). Sperm, but Not

664 Oocyte, DNA Methylome Is Inherited by Zebrafish Early Embryos. Cell, 153(4), 773-

665 784. doi:https://doi.org/10.1016/j.cell.2013.04.041

666 Kalb, R., Latwiel, S., Baymaz, H. I., Jansen, P. W. T. C., Müller, C. W., Vermeulen, M., &

667 Müller, J. (2014). Histone H2A monoubiquitination promotes histone H3 methylation in

668 Polycomb repression. Nature Structural & Molecular Biology, 21(6), 569-571.

669 doi:10.1038/nsmb.2833

670 Karolchik, D., Hinrichs, A. S., Furey, T. S., Roskin, K. M., Sugnet, C. W., Haussler, D., & Kent,

671 W. J. (2004). The UCSC Table Browser data retrieval tool. Nucleic Acids Research,

672 32(suppl_1), D493-D496. doi:10.1093/nar/gkh103

673 Kasinath, V., Beck, C., Sauer, P., Poepsel, S., Kosmatka, J., Faini, M., . . . Nogales, E. (2021).

674 JARID2 and AEBP2 regulate PRC2 in the presence of H2AK119ub1 and other histone

675 modifications. Science, 371(6527), eabc3393. doi:10.1126/science.abc3393

676 Kent, W. J., Zweig, A. S., Barber, G., Hinrichs, A. S., & Karolchik, D. (2010). BigWig and

677 BigBed: enabling browsing of large distributed datasets. Bioinformatics, 26(17), 2204-

678 2207. doi:10.1093/bioinformatics/btq351

679 Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., & Schilling, T. F. (1995). Stages of

680 embryonic development of the zebrafish. Dev Dyn, 203(3), 253-310.

681 doi:10.1002/aja.1002030302

682 Kobor, M. S., Venkatasubrahmanyam, S., Meneghini, M. D., Gin, J. W., Jennings, J. L., Link, A.

683 J., . . . Rine, J. (2004). A Protein Complex Containing the Conserved Swi2/Snf2-Related

684 ATPase Swr1p Deposits Histone Variant H2A.Z into Euchromatin. PLOS Biology, 2(5),

685 e131. doi:10.1371/journal.pbio.0020131

686 Krogan, N. J., Keogh, M.-C., Datta, N., Sawa, C., Ryan, O. W., Ding, H., . . . Greenblatt, J. F.

687 (2003). A Snf2 Family ATPase Complex Required for Recruitment of the Histone H2A

688 Variant Htz1. Molecular Cell, 12(6), 1565-1576. doi:https://doi.org/10.1016/S1097-

689 2765(03)00497-0

690 Kuroda, M. I., Kang, H., De, S., & Kassis, J. A. (2020). Dynamic Competition of Polycomb and

691 Trithorax in Transcriptional Programming. Annual review of biochemistry, 89, 235-253.

692 doi:10.1146/annurev-biochem-120219-103641

693 Lau, M. S., Schwartz, M. G., Kundu, S., Savol, A. J., Wang, P. I., Marr, S. K., . . . Kingston, R.

694 E. (2017). Mutation of a nucleosome compaction region disrupts Polycomb-mediated

695 axial patterning. Science, 355(6329), 1081-1084. doi:10.1126/science.aah5403

696 Laue, K., Rajshekar, S., Courtney, A. J., Lewis, Z. A., & Goll, M. G. (2019). The maternal to

697 zygotic transition regulates genome-wide heterochromatin establishment in the zebrafish

698 embryo. Nature Communications, 10(1), 1551. doi:10.1038/s41467-019-09582-3

699 Le Faou, P., Volkel, P., & Angrand, P. O. (2011). The zebrafish genes encoding the Polycomb

700 repressive complex (PRC) 1. Gene, 475(1), 10-21. doi:10.1016/j.gene.2010.12.012

701 Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., . . . Genome Project Data

702 Processing, S. (2009). The Sequence Alignment/Map format and SAMtools.

703 Bioinformatics, 25(16), 2078-2079. doi:10.1093/bioinformatics/btp352

704 Liao, Y., Smyth, G. K., & Shi, W. (2013). featureCounts: an efficient general purpose program

705 for assigning sequence reads to genomic features. Bioinformatics, 30(7), 923-930.

706 doi:10.1093/bioinformatics/btt656

707 Lindeman, L. C., Andersen, I. S., Reiner, A. H., Li, N., Aanes, H., Ostrup, O., . . . Collas, P.

708 (2011). Prepatterning of developmental gene expression by modified histones before

709 zygotic genome activation. Dev Cell, 21(6), 993-1004. doi:10.1016/j.devcel.2011.10.008

710 Liu, X., Wang, C., Liu, W., Li, J., Li, C., Kou, X., . . . Gao, S. (2016). Distinct features of

711 H3K4me3 and H3K27me3 chromatin domains in pre-implantation embryos. Nature,

712 537(7621), 558-562. doi:10.1038/nature19362

713 Mao, Z., Pan, L., Wang, W., Sun, J., Shan, S., Dong, Q., . . . Zhou, Z. (2014). Anp32e, a higher

714 eukaryotic histone chaperone directs preferential recognition for H2A.Z. Cell Research,

715 24(4), 389-399. doi:10.1038/cr.2014.30

716 Murphy, P. J., Wu, S. F., James, C. R., Wike, C. L., & Cairns, B. R. (2018). Placeholder

717 Nucleosomes Underlie Germline-to-Embryo DNA Methylation Reprogramming. Cell,

718 172(5), 993-1006 e1013. doi:10.1016/j.cell.2018.01.022

719 Obri, A., Ouararhni, K., Papin, C., Diebold, M.-L., Padmanabhan, K., Marek, M., . . . Hamiche,

720 A. (2014). ANP32E is a histone chaperone that removes H2A.Z from chromatin. Nature,

721 505(7485), 648-653. doi:10.1038/nature12922

722 Orlando, David A., Chen, Mei W., Brown, Victoria E., Solanki, S., Choi, Yoon J., Olson,

723 Eric R., . . . Guenther, Matthew G. (2014). Quantitative ChIP-Seq Normalization Reveals

724 Global Modulation of the Epigenome. Cell Reports, 9(3), 1163-1170.

725 doi:https://doi.org/10.1016/j.celrep.2014.10.018

726 Potok, M. E., Nix, D. A., Parnell, T. J., & Cairns, B. R. (2013). Reprogramming the maternal

727 zebrafish genome after fertilization to match the paternal methylation pattern. Cell,

728 153(4), 759-772. doi:10.1016/j.cell.2013.04.030

729 Ramírez, F., Ryan, D. P., Grüning, B., Bhardwaj, V., Kilpert, F., Richter, A. S., . . . Manke, T.

730 (2016). deepTools2: a next generation web server for deep-sequencing data analysis.

731 Nucleic Acids Research, 44(W1), W160-W165. doi:10.1093/nar/gkw257

732 Rougeot, J., Chrispijn, N. D., Aben, M., Elurbe, D. M., Andralojc, K. M., Murphy, P. J., . . .

733 Kamminga, L. M. (2019). Maintenance of spatial gene expression by Polycomb-mediated

734 repression after formation of a vertebrate body plan. Development, 146(19).

735 doi:10.1242/dev.178590

736 San, B., Chrispijn, N. D., Wittkopp, N., van Heeringen, S. J., Lagendijk, A. K., Aben, M., . . .

737 Kamminga, L. M. (2016). Normal formation of a vertebrate body plan and loss of tissue

738 maintenance in the absence of ezh2. Sci Rep, 6, 24658. doi:10.1038/srep24658

739 San, B., Rougeot, J., Voeltzke, K., van Vegchel, G., Aben, M., Andralojc, K. M., . . . Kamminga,

740 L. M. (2019). The ezh2(sa1199) mutant zebrafish display no distinct phenotype. PLoS

741 One, 14(1), e0210217. doi:10.1371/journal.pone.0210217

742 Schneider, C. A., Rasband, W. S., & Eliceiri, K. W. (2012). NIH Image to ImageJ: 25 years of

743 image analysis. Nature Methods, 9(7), 671-675. doi:10.1038/nmeth.2089

744 Schulz, K. N., & Harrison, M. M. (2019). Mechanisms regulating zygotic genome activation.

745 Nature Reviews Genetics, 20(4), 221-234. doi:10.1038/s41576-018-0087-x

746 Stock, J. K., Giadrossi, S., Casanova, M., Brookes, E., Vidal, M., Koseki, H., . . . Pombo, A.

747 (2007). Ring1-mediated ubiquitination of H2A restrains poised RNA polymerase II at

748 bivalent genes in mouse ES cells. Nature Cell Biology, 9(12), 1428-1435.

749 doi:10.1038/ncb1663

750 Tamburri, S., Lavarone, E., Fernandez-Perez, D., Conway, E., Zanotti, M., Manganaro, D., &

751 Pasini, D. (2020). Histone H2AK119 Mono-Ubiquitination Is Essential for Polycomb-

752 Mediated Transcriptional Repression. Mol Cell, 77(4), 840-856 e845.

753 doi:10.1016/j.molcel.2019.11.021

754 Tavares, L., Dimitrova, E., Oxley, D., Webster, J., Poot, R., Demmers, J., . . . Brockdorff, N.

755 (2012). RYBP-PRC1 Complexes Mediate H2A Ubiquitylation at Polycomb Target Sites

756 Independently of PRC2 and H3K27me3. Cell, 148(4), 664-678.

757 doi:https://doi.org/10.1016/j.cell.2011.12.029

758 Team, R. C. (2020). R: A Language and Environment for Statistical Computing. Retrieved from

759 https://www.R-project.org/

760 Thorvaldsdóttir, H., Robinson, J. T., & Mesirov, J. P. (2012). Integrative Genomics Viewer

761 (IGV): high-performance genomics data visualization and exploration. Briefings in

762 Bioinformatics, 14(2), 178-192. doi:10.1093/bib/bbs017

763 Vastenhouw, N. L., Zhang, Y., Woods, I. G., Imam, F., Regev, A., Liu, X. S., . . . Schier, A. F.

764 (2010). Chromatin signature of embryonic pluripotency is established during genome

765 activation. Nature, 464(7290), 922-926. doi:10.1038/nature08866

766 Wang, F., Ranjan, A., Wei, D., & Wu, C. (2016). Comment on “A histone acetylation switch

767 regulates H2A.Z deposition by the SWR-C remodeling enzyme”. Science, 353(6297),

768 358-358. doi:10.1126/science.aad5921

769 Wang, H., Wang, L., Erdjument-Bromage, H., Vidal, M., Tempst, P., Jones, R. S., & Zhang, Y.

770 (2004). Role of histone H2A ubiquitination in Polycomb silencing. Nature, 431(7010),

771 873-878. doi:10.1038/nature02985

772 Wang, L., Brown, J. L., Cao, R., Zhang, Y., Kassis, J. A., & Jones, R. S. (2004). Hierarchical

773 Recruitment of Polycomb Group Silencing Complexes. Molecular Cell, 14(5), 637-646.

774 doi:https://doi.org/10.1016/j.molcel.2004.05.009

775 Westerfield, M. (2007). The Zebrafish Book: 5th Edition: A Guide for the Laboratory Use of

776 Zebrafish (University of Oregon Press).

777 Wu, X., Johansen, Jens V., & Helin, K. (2013). Fbxl10/Kdm2b Recruits Polycomb Repressive

778 Complex 1 to CpG Islands and Regulates H2A Ubiquitylation. Molecular Cell, 49(6),

779 1134-1146. doi:https://doi.org/10.1016/j.molcel.2013.01.016

780 Xia, W., Xu, J., Yu, G., Yao, G., Xu, K., Ma, X., . . . Sun, Y.-P. (2019). Resetting histone

781 modifications during human parental-to-zygotic transition. Science, 365(6451), 353-360.

782 doi:10.1126/science.aaw5118

783 Xu, C., Fan, Zi P., Müller, P., Fogley, R., DiBiase, A., Trompouki, E., . . . Zon, Leonard I.

784 (2012). Nanog-like Regulates Endoderm Formation through the Mxtx2-Nodal Pathway.

785 Developmental Cell, 22(3), 625-638. doi:https://doi.org/10.1016/j.devcel.2012.01.003

786 Yu, G., Wang, L.-G., & He, Q.-Y. (2015). ChIPseeker: an R/Bioconductor package for ChIP

787 peak annotation, comparison and visualization. Bioinformatics, 31(14), 2382-2383.

788 doi:10.1093/bioinformatics/btv145

789 Zhang, B., Wu, X., Zhang, W., Shen, W., Sun, Q., Liu, K., . . . Xie, W. (2018). Widespread

790 Enhancer Dememorization and Promoter Priming during Parental-to-Zygotic Transition.

791 Molecular Cell, 72(4), 673-686.e676. doi:https://doi.org/10.1016/j.molcel.2018.10.017

792 Zhang, B., Zheng, H., Huang, B., Li, W., Xiang, Y., Peng, X., . . . Xie, W. (2016). Allelic

793 reprogramming of the histone modification H3K4me3 in early mammalian development.

794 Nature, 537(7621), 553-557. doi:10.1038/nature19361

795 Zhang, Y., Liu, T., Meyer, C. A., Eeckhoute, J., Johnson, D. S., Bernstein, B. E., . . . Liu, X. S.

796 (2008). Model-based analysis of ChIP-Seq (MACS). Genome Biol, 9(9), R137.

797 doi:10.1186/gb-2008-9-9-r137

798 Zhang, Y., Vastenhouw, N. L., Feng, J., Fu, K., Wang, C., Ge, Y., . . . Liu, X. S. (2014).

799 Canonical nucleosome organization at promoters forms during genome activation.

800 Genome Research, 24(2), 260-266. doi:10.1101/gr.157750.113

801 Zhu, S., Zhao, D., Yan, L., Jiang, W., Kim, J.-S., Gu, B., . . . Cao, Q. (2018). BMI1 regulates

802 androgen receptor in prostate cancer independently of the polycomb repressive complex

803 1. Nature Communications, 9(1), 500. doi:10.1038/s41467-018-02863-3

804