DOCSLIB.ORG

By DNA Microarrays

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
By DNA Microarrays BBRC Biochemical and Biophysical Research Communications 322 (2004) 347–354 www.elsevier.com/locate/ybbrc Genome-scale identification of conditionally essential genes in E. coli by DNA microarrays Xin Tonga, John W. Campbellb,Ga´bor Bala´zsia, Krin A. Kaya, Barry L. Wannerc, Svetlana Y. Gerdesb, Zolta´n N. Oltvaia,* a Department of Pathology, Northwestern University, Chicago, IL 60611, USA b Integrated Genomics Inc., Chicago, IL 60612, USA c Department of Biological Sciences, Purdue University, West Lafayette, IN 47907, USA Received 9 July 2004 Available online 6 August 2004 Abstract Identifying the genes required for the growth or viability of an organism under a given condition is an important step toward understanding the roles these genes play in the physiology of the organism. Currently, the combination of global transposon muta- genesis with PCR-based mapping of transposon insertion sites is the most common method for determining conditional gene essen- tiality. In order to accelerate the detection of essential gene products, here we test the utility and reliability of a DNA microarray technology-based method for the identification of conditionally essential genes of the bacterium, Escherichia coli, grown in rich med- ium under aerobic or anaerobic growth conditions using two different DNA microarray platforms. Identification and experimental verification of five hypothetical E. coli genes essential for anaerobic growth directly demonstrated the utility of the method. How- ever, the two different DNA microarray platforms yielded largely non-overlapping results after a two standard deviations cutoff and were subjected to high false positive background levels. Thus, further methodological improvements are needed prior to the use of DNA microarrays to reliably identify conditionally essential genes on genome-scale. Ó 2004 Elsevier Inc. All rights reserved. Keywords: Essential gene; Transposon mutagenesis; DNA microarray; E. coli; Aerobic and anaerobic conditions With the rapidly increasing numbers of fully se- In recent years, a number of new experimen- quenced genomes, there is an increasing need for a com- tal approaches have been developed to determine gen- prehensive understanding of the roles of the thousands ome-wide gene essentiality. These include systematic of genes that make each organism unique. However, knockouts in Saccharomyces cerevisiae [2,3] and Caenor- the function of more than 35% of the genes in even habditis elegans [4], RNA interference in C. elegans [5], the most closely studied model organisms, such as Esch- and genetic footprinting in several microorganisms erichia coli, remains poorly understood, while their indi- [1,6,7]. Standard genetic footprinting consists of three vidual analysis represents a substantial challenge. An main steps that include random transposon mutagenesis important step toward understanding the function of of a large number of cells, selective outgrowth of the uncharacterized genes is to identify which gene plays mutagenized population, and determination of transpo- an essential role in cell growth and survival, and under son insertion sites in the genome using PCR and gel elec- what conditions such genes are essential [1]. trophoresis [8,9]. Although this is a rather precise, semi- automatic analysis, transposon insertions are detected individually using position-specific PCR primers fol- * Corresponding author. Fax: +1 312 503 8240. lowed by electrophoretic resolution of the amplification E-mail address: [email protected] (Z.N. Oltvai). products on agarose gels. Thus, the readout phase of 0006-291X/$ - see front matter Ó 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2004.07.110 348 X. Tong et al. / Biochemical and Biophysical Research Communications 322 (2004) 347–354 this process is time- and labor-intensive, which substan- LB agar containing 3.2mM sodium sulfide, using Resazurin (0.2mg/ tially limits the utility of the approach. 100ml) as a redox indicator [19]. DNA microarrays have been used for genome-wide Construction of E. coli MG1655 microarrays. We used two different microarrays for the experiments. For the construction of the first set of monitoring of gene expression [10], DNA copy-number microarrays, unique cDNA fragments corresponding to each predicted changes [11], and the detection of DNA–protein interac- ORF of E. coli MG1655 were produced by PCR amplification from tion [12]. Recently, several attempts to accelerate the genomic DNA. To ensure that each primer pair would amplify the transposon insert detection phase of genetic footprinting most unique 200–350 base pair region within each ORF, the PCR by utilizing DNA microarrays for detecting transposon amplification product sequences were compared with all others in the genome by BLAST analysis [20]. Sequences producing the minimum E insertions have been reported [13–15]. The general strat- values, relative to all other ORFs in E. coli, were selected. Of the 4485 egy involves digesting transposon-mutagenized genomic E. coli ORFs listed in the ERGO database [21], unique primers were DNA and adding a linker to the end of the DNA frag- found for 4442 ORFs (sequences available upon request). Most of the ments to serve as a priming site for subsequent PCR remaining ORFs represent genes that are shorter than 240bp. Thus, amplification. DNA sequences within the transposon each predicted ORF of E. coli MG1655 was represented by a fragment predicted to minimally cross-hybridize with other E. coli MG1655 serve as the corresponding matching primer sites. sequences. These fragments varied in length from 200 to 350bp, with a Mutagenized genomic DNAs from different growth con- median length of 300bp. ditions are fluorescently labeled and compared by After two rounds of PCR amplification the final products were hybridization to DNA microarrays. purified on 384-well format ArrayIt PCR purification Kits (TeleChem In this study, we report the results of a genetic foot- International). PCR products were resuspended in 15ll spotting buffer (3· SSC (1· SSC is 0.15M NaCl plus 0.015M sodium citrate), 1.5M printing approach to identify E. coli MG1655 genes that betaine) and printed in triplicate onto amino-alkylsilane coated slides are selectively essential under aerobic vs. anaerobic (Sigma) with an OmniGrid arrayer (Gene Machines) equipped with growth conditions by using two different custom-built Telechem SMP3 split pins. The DNA was cross-linked to the slides E. coli DNA microarrays. Our results demonstrate that with UV light and baked in a vacuum oven at 60°C for at least two although this approach provides high throughput read- hours. Residual salt and unbound DNA were removed by rinsing the slides with 0.5% sodium dodecyl sulfate and water. The slides were out of putative essential and non-essential genes, the stored desiccated at RT until use. assortment of essentiality is affected by the large number The second set of microarrays containing full-length E. coli ORFs of false positive data points. However, the procedure did was printed as previously described [22] and was augmented to contain allow us to hypothesize that the genes for a number of stable RNAs as well as various other controls, e.g., E. coli genomic hypothetical proteins were essential for anaerobic DNA. Generation of sample RNA. Five micrograms of mutagenized growth, some of which were confirmed experimentally. genomic DNA was partially digested with HinP1 I or HpyCH4 IV Thus, although the method lacks precision it can be use- (New England Biolabs), 0.5llof10U/ll for 15min at 37°C. Frag- ful for discovering conditionally essential genes. ments from both enzymesÕ digestion (larger than 500bp) were purified from a 1.2% agarose gel with a QIAquick Gel Extraction Kit (Qiagen). The resulting size-selected, purified DNA fragments were ligated to a Y-shaped adaptor modified from Badarinarayana et al. [13] (CGG Materials and methods ACGCTACGTCCGTGTTGTCGGTCCTG and ACTACGCACCG GACGAGACGTAGCGTC) using T4 DNA ligase (Invitrogen) at Bacterial strain, growth conditions, and transposon mutagenesis. 16°C overnight. Escherichia coli strain MG1655 (FÀ, kÀ, ilvG, rfb50, rph1) [16] was used After the Y-shaped adaptor was ligated to the transposon-mutag- throughout this work. Generation of the transposon mutant library enized DNA fragments, the DNA was re-digested with PflM I (New and outgrowth of the mutagenized population were performed, as England Biolabs), 1llof8U/ll for 1h at 37°C. A 1ll aliquot of the described [17]. Briefly, a transposon library was constructed by incu- digest was used as template in two separate PCRs containing 0.5lM bating transposon DNA EZ::TN<KAN-2> with the hyperactive Tn5 the adaptor primer (ACTACGCACCGGACGA) and 0.5lM of one of EZ::TN transposase [18] (Epicentre Technologies) to form a transpo- the transposon-specific primers (primer 1: GTTCCGTGGCAAAG some complex, which was subsequently transformed to electrocompe- CAAAAGTTCAA or primer 2: CCGACATTATCGCGAGCCC tent E. coli cells by electroporation. Cultures were immediately diluted ATTTAT), 0.2mM dNTP mix, PCR buffer (Invitrogen), and 0.5llof with LB-based rich medium with supplements, incubated at 37°C for 5U/ll Taq polymerase (Invitrogen). Cycling conditions were 95°C for 40min, and then used to inoculate a BIOFLO 2000 fermentor (New 1min; 25 cycles of 94°C for 30s, 55°C for 30s, and 72°C for 1min; and Brunswick Scientific) containing the same medium supplemented with 72°C for 5min. Two microliters of the undiluted PCR was used as kanamycin (10lg/ml). For aerobic growth, dissolved oxygen was held template
Load more

Recommended publications
  • Part Ii - Molecular Biology
    PART II - MOLECULAR BIOLOGY Module VII Nature of Genetic Materials Modern concept of gene (Cistron, muton, recon, viral genes). Brief account of the following-- Split genes (introns and exons), Junk genes, Pseudogenes, Overlapping genes, Transposons The term gene was introduced by Johanssen in 1909. Prior to him Mendel had used the word factor for a specific, distinct, particulate unit of inheritance that takes part in expression of a trait. Johanssen has defined gene as an elementary unit of inheritance which can be assigned to a particular trait. Morgan’s work suggested gene to be the shortest segment of chromosome which can be separated through crossing over, can undergo mutation and influence expression of one or more traits. Presently, a gene is defined as a unit of inheritance composed of a segment of DNA or chromosome situated at a specific locus (gene locus) which carries coded information associated with a specific function and can undergo crossing over as well as mutation. A gene is: A unit of genetic material which is able to replicate, It is a unit of recombination, i.e., capable of undergoing crossing over, A unit of genetic material which can undergo mutation, A unit of heredity connected with somatic structure or function that leads to a phenotypic expression. Modern concept of gene (Cistron, muton, recon, viral genes). After the discovery of DNA, the gene has been defined as cistron, recon and muton. The classical gene is the smallest unit that could undergo a mutational change. A gene further divided into smaller units of function, mutation and recombination.
    [Show full text]
  • 5 Complementation Analysis: How Many Genes Are Involved?
    Genetic Techniques for Biological Research Corinne A. Michels Copyright q 2002 John Wiley & Sons, Ltd ISBNs: 0-471-89921-6 (Hardback); 0-470-84662-3 (Electronic) 5 Complementation Analysis: How Many Genes are Involved? Complementation analysis is used to determine whether two independent mutations arealterations in the same gene; that is, they are alleles, orare alterations in different genes. In essence, a complementation analysis is a functional test used to define a gene. If a researcher has isolated anumber of mutants with a similar phenotype, the next question asked is: ‘How many genes have I identified?’. If there are 10 mutant strains, are they each in different genes, does each mutant carry a different mutation (allele) in the same gene, or something in between such as two genes one with six alleles and the otherwith four alleles? Complementation analysis will help answer this question. Seymour Benzer’s study of the rZZ locus of phage T4 is a most elegant example of the power of complementation analysis (Benzer, 1955). Benzer had several hundred mutations that gave the same phenotype, large plaques on one host strain of E. coli and no plaques on another host strain, and mapped to the same region of the T4 chromosome. Using the host strain in which rll mutants formed no plaques, he found that when host cells were coinfected with different mutant pairs some pairs produced a normal phage burst while others did not. Those that produced a normal burst he concluded were in different functional genetic units that he called cistrons, a term that is synonymous with gene.
    [Show full text]
  • Molecular Biology and Applied Genetics
    MOLECULAR BIOLOGY AND APPLIED GENETICS FOR Medical Laboratory Technology Students Upgraded Lecture Note Series Mohammed Awole Adem Jimma University MOLECULAR BIOLOGY AND APPLIED GENETICS For Medical Laboratory Technician Students Lecture Note Series Mohammed Awole Adem Upgraded - 2006 In collaboration with The Carter Center (EPHTI) and The Federal Democratic Republic of Ethiopia Ministry of Education and Ministry of Health Jimma University PREFACE The problem faced today in the learning and teaching of Applied Genetics and Molecular Biology for laboratory technologists in universities, colleges andhealth institutions primarily from the unavailability of textbooks that focus on the needs of Ethiopian students. This lecture note has been prepared with the primary aim of alleviating the problems encountered in the teaching of Medical Applied Genetics and Molecular Biology course and in minimizing discrepancies prevailing among the different teaching and training health institutions. It can also be used in teaching any introductory course on medical Applied Genetics and Molecular Biology and as a reference material. This lecture note is specifically designed for medical laboratory technologists, and includes only those areas of molecular cell biology and Applied Genetics relevant to degree-level understanding of modern laboratory technology. Since genetics is prerequisite course to molecular biology, the lecture note starts with Genetics i followed by Molecular Biology. It provides students with molecular background to enable them to understand and critically analyze recent advances in laboratory sciences. Finally, it contains a glossary, which summarizes important terminologies used in the text. Each chapter begins by specific learning objectives and at the end of each chapter review questions are also included.
    [Show full text]
  • Regulatory Interplay Between Small Rnas and Transcription Termination Factor Rho Lionello Bossi, Nara Figueroa-Bossi, Philippe Bouloc, Marc Boudvillain
    Regulatory interplay between small RNAs and transcription termination factor Rho Lionello Bossi, Nara Figueroa-Bossi, Philippe Bouloc, Marc Boudvillain To cite this version: Lionello Bossi, Nara Figueroa-Bossi, Philippe Bouloc, Marc Boudvillain. Regulatory interplay be- tween small RNAs and transcription termination factor Rho. Biochimica et Biophysica Acta - Gene Regulatory Mechanisms , Elsevier, 2020, pp.194546. 10.1016/j.bbagrm.2020.194546. hal-02533337 HAL Id: hal-02533337 https://hal.archives-ouvertes.fr/hal-02533337 Submitted on 6 Nov 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Regulatory interplay between small RNAs and transcription termination factor Rho Lionello Bossia*, Nara Figueroa-Bossia, Philippe Bouloca and Marc Boudvillainb a Université Paris-Saclay, CEA, CNRS, Institute for Integrative Biology of the Cell (I2BC), 91198, Gif-sur-Yvette, France b Centre de Biophysique Moléculaire, CNRS UPR4301, rue Charles Sadron, 45071 Orléans cedex 2, France * Corresponding author: [email protected] Highlights Repression
    [Show full text]
  • Polymorphisms of the 5' Leader Cistron of the Human Beta2- Adrenergic Receptor Regulate Receptor Expression
    Polymorphisms of the 5' leader cistron of the human beta2- adrenergic receptor regulate receptor expression. D W McGraw, … , L A Kramer, S B Liggett J Clin Invest. 1998;102(11):1927-1932. https://doi.org/10.1172/JCI4862. Research Article Cellular expression of the beta2-adrenergic receptor (beta2AR) is controlled in part by a 19-amino acid peptide that regulates mRNA translation. This peptide is encoded by a short open reading frame, termed the 5' leader cistron (5'LC), which is 102 bp upstream of the beta2AR coding block. In 176 normal subjects we found a single nucleotide polymorphism resulting in either Arg (previously denoted wild-type) or Cys at position 19 of this peptide. Allele frequencies were 0.37 for Arg and 0.63 for Cys. To determine if these variants altered beta2AR expression, COS-7 cells were transfected with polymorphic constructs consisting of 1,989 bp encompassing the 5'LC and the beta2AR coding block exactly as found in the human gene. beta2AR density, as determined by [125I]CYP radioligand binding, was 72% higher in cells transfected with the 5'LC-Cys19 construct as compared with those transfected with the 5'LC-Arg19 construct and 110% higher when a cotransfection technique with a luciferase construct was used to control for transfection efficiency. Levels of the two mRNA transcripts were not different, confirming in vitro studies that the upstream peptide regulates receptor expression at the translational level. In human airway smooth muscle cells that natively express beta2AR, receptor expression was approximately twofold higher in those bearing the Cys versus the Arg polymorphism, confirming the phenotype in a relevant cell type.
    [Show full text]
  • STRUCTURE of the Trpc CISTRON SPECIFYING INDOLEGLYCEROL PHOSPHATE SYNTHETASE, and ITS LOCALIZATION in the TRYPTOPHAN OPERON of ESCHERICHIA COLP
    STRUCTURE OF THE trpC CISTRON SPECIFYING INDOLEGLYCEROL PHOSPHATE SYNTHETASE, AND ITS LOCALIZATION IN THE TRYPTOPHAN OPERON OF ESCHERICHIA COLP OLIVER H. SMITH Department of Biology, Marquette University, Milwaukee, Wisconsin 53233 Received March 22, 1967 HE definition of an operon (JACOBand MONOD1961) implies that it consti- Ttutes a unit of both gene structure and gene expression. In Escherichia coli the synthesis of the enzymes specific to the tryptophan pathway has been shown to be coordinate (ITOand CRAWFORD1965) and subject to polarized regulation ( SOMERVILLEand YANOFSKY1965; YANOFSKYand ITO1966). These observations have confirmed that the earlier reported closely linked sequence of trp genes (YANOFSKYand LENNOX1959) constitute an operon. Since this latter report the complete sequence of enzymatic reactions in tryptophan synthesis by E. coli, under the control of five structural genes (A-E),has been elucidated (e.g. see YANOFSKYand ITO1966). YANOFSKYet al. (1 964) have reported that the E. coli trpA and B genes which determine the a and j3 subunits of tryptophan synthetase are adjacent. One of the purposes of this stud:y was to determine whether the trpC gene and the other genes of the tryptophan toperon were directly adjacent to one another. The enzyme indoleglycerol phosphate (InGP) synthetase is the gene product of the trpC locus (SMITHand YANOFSKY1960; SMITH1965). The single poly- peptide chain of which InGP synthetase consists has recently been purified to homogeneity in the ultracentrifuge ( CREIGHTONand YANOFSKY1966; SMITH, unpublished) and shown to carry out the following consecutive reactions in tryptophan biosynthesis: (1) Phosphoribosyl anthranilic acid (PRA) -1- (0-Carboxylphenylamino) -1-deoxyribu- lose 5-phosphate (CDRP) (2) CDRP- InGP This report offers evidence that the ability to catalyze each of the above reactions is altered by mutations affecting different parts of the InGP synthetase poly- peptide chain.
    [Show full text]
  • Seymour Benzer and T4 Rii Running the Map Into the Ground
    GENERAL ARTICLE Seymour Benzer and T4 rII Running the Map into the Ground R Jayaraman One of the goals of genetics is to understand genes in as much detail as possible. For instance, with respect to a given gene, one would like to know its chromosomal location, its physical and genetic size, its neighbours, the number of mutations/ alleles defining the gene, the order of mutations, the genetic/ physical distance between them, etc. Thus, rather than focus- R Jayaraman is an ing on the whole genome, one focuses on the finer details of a Emeritus Professor of given genetic segment. The exercise of probing such details is Molecular Biology at the School of Biological called ‘fine structure genetic analysis’. There are several Sciences, Madurai pioneers who have contributed enormously to this area in Kamaraj University, many bacterial and phage systems. Two stalwarts, Seymour Madurai, where he taught BenzerandCharles Yanofsky,standpreeminentamong them. and carried out research in the area of microbial In the following pages I present briefly Benzer’s outstanding genetics for three decades. workonthefinestructureofthe rII region of bacteriopage T4. These path-breaking studies contributed significantly to our understanding of the structure, organization and function of genes. Seymour Benzer (1921–2007) is hailed as a scientist who, “more than any other single individual, enabled geneticists adapt to the molecular age” [1]. After graduating from Brooklyn College with a degree in physics, he went to Purdue University, Lafayette, Indiana, to continue his education in physics. His work at Purdue on germanium semiconductors was a forerunner to the invention of the transistor by Brattain, Bardeen and Shockley, a work which fetched them the Nobel Prize.
    [Show full text]
  • Downloaded October, 2015) 83
    bioRxiv preprint doi: https://doi.org/10.1101/522607; this version posted January 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Induction of an alternative 5’ leader enhances translation of Inpp5e and resistance to oncolytic virus infection Huy-Dung Hoang1,Δ, Tyson E. Graber1,2,Δ, Jian-Jun Jia1, Nasana Vaidya1, Victoria Gilchrist1, Wencheng Li3, Christos G. Gkogkas4, Maritza Jaramillo5, Seyed Mehdi Jafarnejad6, and Tommy Alain1* 1 Children's Hospital of Eastern Ontario Research Institute, Department of Biochemistry, Microbiology and Immunology, University of Ottawa, Ottawa, Ontario, Canada 2 Department of Biochemistry and Goodman Cancer Center, McGill University, Montreal, Quebec, Canada 3 Department of Biochemistry and Molecular Biology, Rutgers New Jersey Medical School, Newark, NJ, USA 4 Centre for Discovery Brain Sciences, University of Edinburgh, Edinburgh, UK. 5 INRS Institut Armand-Frappier Research Centre, Laval, Quebec, Canada 6 Centre for Cancer Research and Cell Biology, The Queen’s University of Belfast, Belfast, UK *correspondence: Tommy Alain Children’s Hospital of Eastern Ontario Research Institute 401 Smyth Road Ottawa, Ontario, Canada Δ These authors contributed equally to this work. Short Title: Oncolytic viruses trigger an innate RNA translation response ABSTRACT variant that lacks repressive upstream open reading frames (uORFs) within its 5’ leader and is consequently Residual cell-intrinsic innate immunity in cancer cells efficiently translated. Furthermore, we show that INPP5E hampers infection with oncolytic viruses. mRNA contributes to antiviral immunity by altering virus translation is an important component of innate attachment. These findings uncover a role for immunity, yet the targeted cellular mRNAs remain ill- translational control through alternative 5’ leader defined.
    [Show full text]
  • Degradation of Mrna Mk2 and Enhanced Transcription Termination Before the Galk Gene
    Two-level inhibition of galK expression by Spot 42: Degradation of mRNA mK2 and enhanced transcription termination before the galK gene Xun Wang, Sang Chun Ji1, Heung Jin Jeon, Yonho Lee, and Heon M. Lim2 Department of Biological Sciences, College of Biological Sciences and Biotechnology, Chungnam National University, Daejeon 305-764, Republic of Korea Edited by Sankar Adhya, National Institutes of Health, National Cancer Institute, Bethesda, MD, and approved May 11, 2015 (received for review December 29, 2014) The Escherichia coli gal operon has the structure Pgal-galE-galT- that there is an independent molecular mechanism other than galK-galM. During early log growth, a gradient in gene expression, transcription termination that operates to regulate galK expression named type 2 polarity, is established, as follows: galE > galT > galK > (1) and that the regulation of the amount of mK2 determines the galM. However, during late-log growth, type 1 polarity is established polarity type. in which galK is greater than galT,asfollows:galE > galK > galT > Small RNAs (sRNAs) in bacteria bind to their target mRNA galM. We found that type 2 polarity occurs as a result of the down- molecules and regulate their expression. Often, the binding of an regulation of galK, which is caused by two different molecular mech- sRNA to a target mRNA is mediated by Hfq, a homo-hexameric, anisms: Spot 42-mediated degradation of the galK-specific mRNA, bacterial Sm-like protein (3). In the case of an sRNA whose mK2, and Spot 42-mediated Rho-dependent transcription termination binding site on the target mRNA overlaps with the Shine- at the end of galT.
    [Show full text]
  • Identification and Characterization of RP1 Tra1 Cistrons Involved in Pilus Function and Plasmid Mobilization
    JOURNAL OF BACTERIOLOGY, Jan. 1993, p. 448-456 Vol. 175, No. 2 0021-9193/93/020448-09$02.00/0 Copyright © 1993, American Society for Microbiology Identification and Characterization of RP1 Tral Cistrons Involved in Pilus Function and Plasmid Mobilization S. T. FONGt AND VILMA A. STANISICH* Department ofMicrobiology, La Trobe University, Bundoora 3083, Australia Received 21 January 1992/Accepted 6 November 1992 Transfer-defective mutants of the Tral region of RP1 were isolated. Complementation studies involving stable heterozygotes combined with the mapping of TnS insertion mutations revealed two pilus cistrons, pi4 and pilB, at positions 46.9 to 48.2 kb and 46.0 to 46.4 kb, respectively. All pilB mutants were Dps- (i.e., resistant to donor-specific phages PR4 and PRR1), whereas piL4 mutants were Dps- (promoter-proximal mutations), Dps+'- (sensitive only to PR4 [more centrally located mutations]), or Dps' (sensitive to both phages [promoter-distal mutations]). The correlation between the site mutated and the Dps phenotype, together with the finding that certain Dps+ piL4 mutants continued to mobilize nonconjugative plasmids, suggested that piL4 is bifunctional, contributing both to pilus function (at the promoter-proximal end) and to RP1 mobilization. It was also shown that the 43.5- to 49.5-kb region that includes pilA and pilB encodes all of the Tral pilus functions required for propagation of donor-specific phages and hence, probably, for pili that are active in conjugation. Finally, three cistrons that specifically affect RP1 mobilization were identified. Two of these, mobA and mobB, occur immediately anticlockwise to oriT and probably correspond to the traJ and traI genes characterized by other workers.
    [Show full text]
  • Working with Molecular Genetics Chapter 1. Fundamental Properties of Genes CHAPTER 1 FUNDAMENTAL PROPERTIES of GENES Species
    Working with Molecular Genetics Chapter 1. Fundamental Properties of Genes CHAPTER 1 FUNDAMENTAL PROPERTIES OF GENES Species share many traits in common from generation to generation. The bluebird nestlings in the box in my yard will look much like their parents when they are full-grown. The tomato plants that we set out will produce fruits that look, and hopefully taste, like those of their parents. Observable features of organisms, like color, size, and shape, comprise their phenotype. Adult male bluebirds share the phenotype of blue wings and a red breast. A phenotype can be determined by inherited factors, by the environment, and often by both. For example, you are similar to your parents in many aspects of your appearance, your intelligence, and your susceptibility to some diseases, but you are not identical to them in all aspects of these traits. These three traits are clearly the product of both inherited and environmental factors. Considering appearance, I have crooked lower teeth and thinning gray hair, just like my father, but unlike me, neither of my parents has a scar on their knee from a childhood cut. The hair phenotype is inherited, whereas scars are from environmental influences. Quantitative studies show that intellectual capacity is about equally influenced by genetic and environmental factors. Susceptibility to diabetes is partially inherited, but a viral infection may trigger the autoimmune response at its core. The genetic determinants of the inherited component of a phenotype are called genes. The set of genes that make up an organism is its genotype. In practice, we will consider only a small subset of the genes in an organism, which comprise a partial genotype.
    [Show full text]
  • Noncoding RNA Control of the Making and Breaking of Sugars
    Downloaded from genesdev.cshlp.org on October 3, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW Noncoding RNA control of the making and breaking of sugars Boris Görke1 and Jörg Vogel2,3 1Department of General Microbiology, Georg August University Göttingen, D-37077 Göttingen, Germany; 2RNA Biology Group, Max Planck Institute for Infection Biology, D-10117 Berlin, Germany Noncoding RNA regulators have been implicated in al- drate transporters or of intracellular glycolytic metabo- most all imaginable cellular processes. Here we review lites. These cues modulate the synthesis of intracellular how regulatory small RNAs such as Spot42, SgrS, GlmY, signaling molecules such as cAMP, or the activity of and GlmZ and a cis-encoded ribozyme in glmS mRNA protein kinases, which in turn control the activity of control sugar metabolism. Besides discussing the physi- global regulatory proteins; e.g., Crp (cAMP receptor pro- ological implications, we show how the study of these tein) in enteric bacteria or cAMP-controlled protein ki- molecules contributed to our understanding of the nase A in eukaryotic cells (Deutscher 2008; Gancedo mechanisms and of general principles of RNA-based 2008; Görke and Stülke 2008). regulation. These include the post-transcriptional re- Once inside the cell, carbohydrates enter a central pression or activation of gene expression within poly- metabolic pathway i.e., glycolysis, the pentose phos- cistronic mRNAs; novel ribonucleoprotein complexes phate pathway, or the Krebs (TCA) cycle. Flux through composed of small RNA, Hfq, and/or RNase E; and the these pathways must be tightly coordinated with all hierarchical action of regulatory RNAs. other processes in the cell to avoid deleterious accumu- lation or depletion of metabolites.
    [Show full text]