Virginia Commonwealth University VCU Scholars Compass
Theses and Dissertations Graduate School
2008
Inflammation-associated gene egulationr in primary astrocytes, glial tumors and cellular differentiation
Katarzyna Marta Wilczynska Virginia Commonwealth University
Follow this and additional works at: https://scholarscompass.vcu.edu/etd
Part of the Biochemistry, Biophysics, and Structural Biology Commons
© The Author
Downloaded from https://scholarscompass.vcu.edu/etd/1113
This Dissertation is brought to you for free and open access by the Graduate School at VCU Scholars Compass. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of VCU Scholars Compass. For more information, please contact [email protected].
© Katarzyna Marta Wilczynska 2008
All Rights Reserved
INFLAMMATION-ASSOCIATED GENE REGULATION IN PRIMARY
ASTROCYTES, GLIAL TUMORS AND CELLULAR DIFFERENTIATION
A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy at Virginia Commonwealth University.
by
KATARZYNA MARTA WILCZYNSKA M.Sc., Jagiellonian University, Poland, 2003
Director: TOMASZ KORDULA, Ph.D. Associate Professor, Department of Biochemistry and Molecular Biology
Virginia Commonwealth University Richmond, Virginia May, 2008 ii
Acknowledgements
I would like to express my greatest gratitude to those whom I was lucky to meet on my path through life, and who have undeniably contributed to this huge endeavor for a doctoral degree.
First of all, I would like to thank Dr. Aneta Kasza, my Master’s thesis mentor, who has encouraged me to pursue a scientific career towards a doctoral degree by showing me with her own example that one can have it all.
It will be difficult for me to find the words to thank Tomek, my mentor and friend, who has guided me patiently throughout my graduate study to teach me everything he could about science and life, and who showed me how to enjoy one’s work and believe in oneself. It is him who has nurtured my need for scientific independence and has awakened my desire to discover.
My special thank you goes to Sunita, Lauren and Magda for being awesome and supportive friends and creating an unforgettable atmosphere in the lab day by day. I would like to also thank my labmates: Sandeep, Silvina, Weilli, and Basia for collaborative work environment and help in demanding situations.
I would like to also express my gratitude and owe for Dr. Sarah Spiegel, who has been a real inspiration and a role model in all aspects of life, and whom I will remember for ever. iii
I would like to thank my graduate student committee members: Dr. Lloyd, Dr.
Gil, and Dr. Rao, for their time and involvement to refine my scientific qualifications, and for being helpful and understanding in difficult situations. Especially, I feel deeply thankful to Carmen, who has been extremely supportive and motivating and whom I have always admired for the idealistic approach to life and science.
Last, but not least I would like to thank cordially my dearest husband for his love and trust, without whom I would not be even writing this thesis, who has been extremely supportive, helpful and always there. I would like to also thank my dearest grandma, the most incredible woman I have ever met, who has loved me unconditionally, has always believed in me and encouraged me to take the challenges which I thought were beyond my reach.
“Where There Is a Will There Is a Way”
-grandma
iv
Table of Contents Page
Acknowledgements...... ii
List of Figures ...... ix
List of Abbreviations ...... xi
Abstract...... xix
Chapter
1 INTRODUCTION...... 1
1.1. Inflammation in the brain...... 1
1.2. Metalloproteinases and their inhibitors (MMPs/TIMPs)...... 2
1.3. TIMP-1 ...... 4
1.4. Alpha-1-antichymotrypsin (ACT)...... 8
1.5. Inteurleukin 1 (IL-1)...... 10
1.6. MAPK pathway...... 12
1.7. Oncostatin M (OSM)...... 13
1.8. JAK/STAT pathway...... 14
1.9. Inflammation in cancer...... 16
1.10. Classification of neurological tumors...... 17
1.11. Glioblastoma ...... 19
1.12. STAT3 in GBM...... 20
1.13. Oligodendroglioma...... 21 v 1.14. Gliomagenesis ...... 22
1.15. Differentiation of astrocytes...... 24
1.16. Nuclear Factor I...... 26
2 A NOVEL MECHANISM OF TISSUE INHIBITOR OF
METALLOPROTEINASES-1 ACTIVATION BY INTERLEUKIN-1
IN PRIMARY HUMAN ASTROCYTES...... 31
2.1. Abstract ...... 31
2.2. Introduction ...... 33
2.3. Materials and Methods ...... 35
2.3.1. Cell culture...... 35
2.3.2. Cytokines and Cell Stimulation...... 35
2.3.3 RNA Preparation and Northern Blot Analysis...... 36
2.3.4. Quantitative PCR...... 36
2.3.5. Synthetic Oligonucleotides...... 36
2.3.6. Plasmid Construction ...... 38
2.3.7. Transient Transfections ...... 39
2.3.8. Down-regulation with siRNA ...... 40
2.3.9. Nuclear Extract Preparation and EMSA ...... 40
2.3.10. Western Blotting...... 40
2.4. Results ...... 42 vi 2.4.1. Activation of TIMP-1 expression by IL-1 requires ongoing
transcription and is mediated by multiple signaling cascades...... 42
2.4.2. Identification of the IL-1 regulatory elements of the TIMP-1
gene...... 47
2.4.3. Identification of regulatory elements binding IL-1-induced
factors...... 50
2.4.4. Critical role of p65 in regulating TIMP-1 gene expression...... 54
2.4.5. TIMP-1 expression is not activated by IL-1 in many gliomas due
to the aberrant activation of either NF-κB or ATF-2...... 59
2.5. Discussion ...... 64
3 CONSTITUTIVELY ACTIVE STAT3 PROMOTES THE GROWTH
OF OLIGODENDROGLIOMA TUMORS...... 72
3.1. Abstract ...... 72
3.2. Introduction ...... 74
3.3. Materials and Methods ...... 77
3.3.1. Cell Culture ...... 77
3.3.2. Clinical Samples...... 77
3.3.3. Cytokines and Cell Stimulation...... 78
3.3.4. RNA Preparation and Quantitative PCR...... 78
3.3. 5. Plasmids and Transient or Stable Transfections...... 78
3.3.6. Western Blotting...... 79 vii 3.3.7. Gene Knock-down by si RNA...... 80
3.3.8. Cell Proliferation Assay ...... 80
3.3.9. Lentiviral transductions of HOG cells...... 81
3.4. Results ...... 83
3.4.1. Pro-inflammatory cytokines are highly expressed in the
oligodendroglioma tumors...... 83
3.4.2. Oligodendroglioma HOG and schwannoma T265 cells express
pro-inflammatory cytokines and chemokines ...... 86
3.4.3. ACT and COX-2 as inflammatory markers in OD tumors...... 89
3.4.4. NF-κB and STAT3 regulate ACT expression in
oligodendroglioma HOG and schwannoma T265 cells...... 95
3.4.5. Constitutive activation of STAT3 in oligodendroglioma...... 96
3.4.6. Effect of pro-inflammatory cytokines on proliferation and
apoptosis of oligodendroglioma HOG cells ...... 99
3.4.7. Activated STAT3 enhances the proliferation of HOG cells...... 102
3.5. Discussion ...... 106
4 NUCLEAR FACTOR I REGULATES GENE EXPRESSION DURING
ASTROCYTE DIFFERENTIATION………………………………...115
4.1. Abstract ...... 115
4.2. Introduction ...... 117
4.3. Materials and Methods ...... 121 viii 4.3.1. Human embryonic stem cell culture...... 121
4.3.2. Generation of Neural Progenitors...... 121
4.3.3. Differentiation of astrocytes and oligodendrocytes...... 122
4.3.4. Downregulation of Target Genes ...... 122
4.3.5. RNA isolation and Quantitative PCR...... 123
4.3.6. Immunocytochemistry...... 123
4.3.7. Western Blotting...... 124
4.3.8. Glutamate Uptake Assay ...... 124
4.4. Results ...... 126
4.4.1. Generation of neural progenitors...... 126
4.4.2. Neural progenitors as a model for astrocyte differentiation...... 129
4.4.3. Expression of NFI isoforms in stem cells and neural progenitors. .
...... 135
4.4.4. Generation of astrocytes...... 136
4.4.5. NFI expression is sequential during astrocyte differentiation ..139
4.4.6. NFI-C and NFI-X control astrocyte-specific gene expression..142
4.5. Discussion ...... 144
5 GENERAL DISCUSSION ...... 150
Literature cited ...... 157
VITA ...... 175 ix List of Figures Page
Figure 2.1: IL-1 upregulates the expression of TIMP-1 mRNA in human astrocytes...... 43
Figure 2.2: Effect of inhibitors on IL-1-activated expression of TIMP-1 mRNA...... 45
Figure 2.3: Identification of the IL-1-responsive elements of the TIMP-1 gene...... 48
Figure 2.4: Identification of functional AP-1, ATF-2, and NF-κB elements within the -4.2 to -0.8 fragment of the TIMP-1 gene...... 52
Figure 2.5: AP-1, ATF-2, and NF-κB bind to the regulatory elements of TIMP-1 gene in human astrocytes...... ….55
Figure 2.6: Activation of p65 is indispensable for the IL-1 response of the TIMP-1 gene.
...... 57
Figure 2.7: Analysis of IL-1-activated signaling and TIMP-1 expression in human gliomas...... 60
Figure 2.8: Model of the activation of the TIMP-1 gene in human astrocytes...... 67
Figure 3.1: Pro-inflammatory cytokines are highly expressed in oligodendroglioma tumors...... 84
Figure 3.2: IL-1 induces the expression of pro-inflammatory cytokines and chemokines in oligodendroglioma and schwannoma cells ...... 87
Figure 3.3: Oligodendroglioma tumors and cells express ACT and COX-2...... 90
Figure 3.4: NF-κB and STAT3 regulate ACT expression in oligodendroglioma and schwannoma cells...... 93
Figure 3.5: STAT3 is activated in oligodendroglioma ...... 97 x Figure 3.6: Pro-inflammatory cytokines affect proliferation and apoptosis of oligodendroglioma cells...... 100
Figure 3.7: OSM-activated STAT3 regulates the proliferation of HOG cells...... 103
Figure 3.8: Proposed model of inflammation within an oligodendroglioma tumor...... 112
Figure 4.1: BG01V embryonic stem cells differentiate into neural progenitors...... 127
Figure 4.2: Characterization of gene expression patterns in generated neural progenitors...
...... 130
Figure 4.3: Differentiation of neural progenitors into astrocytes ...... 133
Figure 4.4: Characterization of gene expression patterns in differentiated astrocytes. ...137
Figure 4.5: NFI-C and NFI-X regulate the expression of GFAP and SPARCL1 during astrocyte differentiation...... 140
xi
LIST OF ABBREVIATIONS
ABC ATP-binding cassette
ACT alpha-1-antichymotrypsin
AD Alzheimer’s disease
AP-1 activator protein-1
APC antigen-presenting cell
Astr primary human astrocytes
ATF-2 activating transcription factor-2
Bax BCL2-associated X protein
BBB blood-brain barrier
BCA bicinchoninic acid
Bcl-2 B-cell lymphoma 2
Bcl-XL Basal cell lymphoma-extra large
BFABP brain fatty acid-binding protein
bFGF basic fibroblast growth factor
BLBP brain lipid binding protein
BMP-2 bone morphogenic protein-2
BTSC brain tumor stem cells
C/EBP CCAAT/enhancer binding protein
CAT chloramphenicol acetyltransferase xii
CBP/p300 CREB binding protein cDNA complementary DNA
CLC cardiotrophin-like cytokine
CNS central nervous system
CNTF cilliary neurotrophic factor
COX-2 cyclooxygenase-2
CREB cAMP response element-binding
CSF cerebro-spinal fluid
CT-1 cardiotrophin-1
CTD C-terminal domain
DC dendritic cell
DMEM Dulbecco’s modification of Eagle’s medium
DPBS Dulbecco’s phosphate buffered saline
EAE experimental autoimmune encephalitis
ECM extracellular matrix
EDTA ethylene diamine tetraacetic acid
EGF epidermal growth factor
EGFR EGF receptor
EMSA electromobility shift assay
ERK extracellular signal-regulated kinase xiii
ESC embryonic stem cells
FBS fetal bovine serum
GAPDH glyceraldehyde-3-phosphate dehydrogenase
GAS IFN-γ activation sequence
GBM glioblastoma multiforme
GFAP glial fibrillary acidic protein
GFP green fluorescent protein
GLAST glutamate aspartate transporter
GM-CSF granulocyte-macrophage colony stimulating factor
GS glutamine synthase
HAD HIV-1-associated dementia hCG human chorionic gonadotropin
HES hairy and enhancer of split
HIF-1 hypoxia-inducible factors
HOG human oligodendroglioma
IKK IκB kinase
IL-1, 3, 6, 8, 11 Interleukin-1, 3, 6, 8, 11
IL-1R IL-1 receptor
IL-1RAcP IL-1 receptor accessory protein iNOS inducible nitric oxide synthase xiv
IRAK IL-1 receptor associated kinase
IκBα inhibitor of NF-κB α
JAK Janus kinase
JNK c-Jun N-terminal kinase
KO knock-out
KSR knockout serum replacement
LBP-1 leading binding protein-1
LIF leukemia inhibitory factor
LIFR LIF receptor
LOH loss of heterozygosity
LPS lipopolysaccharide
M&M Materials and Methods
MAPK (MEK) mitogen-activated protein kinase
MAPKK (MKK) mitogen-activated protein kinase kinase
MAPKKK (MKKK) mitogen-activated protein kinase kinase kinase
MBP myelin basic protein
Mcl-1 myeloid cell leukemia sequence 1
MCP-1 monocyte chemotactic protein-1
MDM2 mouse double minute 2
MEF mouse embryonic fibroblasts xv
MIP1 macrophage inflammatory protein-1
MMP matrix metalloproteinase mRNA messenger RNA
MS multiple sclerosis
MT-MMP membrane type MMP
Myd88 myeloid differentiation primary response protein-88
NF(M) neurofilament M
NFI nuclear factor-I
NF-κB nuclear factor kappa B
NIK NF-κB inducing kinase
NK natural killer
NO nitric oxide
NP neural progenitors
Oct4 octamer-4
OD oligodendroglioma
Olig2 oligodendrocyte lineage transcription factor 2
OSM oncostatin M
OSMR OSM receptor
PAI-1 plasminogen activator inhibitor-1
PARP-1 poly (ADP-ribose) polymerase-1 xvi
PAS plasminogen activator system
PBS phosphate buffered saline
PD Parkinson’s disease
PDGF platelet-derived growth factor
Pea3 polyomavirus enhancer activator 3
PGE2 prostaglandin E2
PI3K phosphoinositide Kinase-3
PIAS protein inhibitors of activated
PKC protein kinase C
PLZF promyelocytic leukemia zinc finger protein
PMA phorbol 12-myristate 13-acetate
PMSF phenylmethanesulphonylfluoride
PNS peripheral nervous system
PTEN phosphatase and tensin homology
PTP1B protein-tyrosine-phosphatase 1B qPCR quantitative polymerase chain reaction
RB retinoblastoma
RBP-Jκ recombination signal binding protein for immunoglobulin kappa J
S100B S100 calcium binding protein B
SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis xvii
Serpin serine proteinase inhibitors
SH2 Src-homology-2
SH2P SH2-containing phosphatase
RUNX runt related transcription factor
SHH Sonic Hedgehog shRNA short hairpin RNA siRNA small interfering RNA
SOCS suppressors of cytokine signaling
Sox-2 SRY-box containing gene 2
SP1 specificity protein 1
SPARCL1 secreted acidic cysteine rich glycoprotein-like 1
SRE serum response element
STAT signal transducers and activators of transcription
TAB TAK-binding protein 1
TACE tumor necrosis factor alpha converting enzyme
TAK1 transforming growth factor β−activating kinase-1
TAM tumor-associated macrophages
TCA trichloroacetic acid
TGFβ transforming growth factor β
TIMP tissue inhibitor of metalloproteinases xviii
TNFα tumor necrosis factor α
TRAF6 TNF receptor associated factor-6 uPA urokinase plasminogen activator
UTE upstream TIMP-1 element
UTR untranslated region
VEGF vascular endothelial growth factor
WHO World Health Organization xix
Abstract
INFLAMMATION-ASSOCIATED GENE REGULATION IN PRIMARY
ASTROCYTES, GLIAL TUMORS AND CELLULAR DIFFERENTIATION
By Katarzyna Marta Wilczynska, M.Sc.
A Dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy at Virginia Commonwealth University.
Virginia Commonwealth University, 2008
Major Director: Tomasz Kordula, Ph.D. Associate Professor, Department of Biochemistry and Molecular Biology
This dissertation elucidates several independent molecular mechanisms that function in astrocytes and glial tumor cells, and suggest that developmental and inflammatory signals may contribute to the development of brain tumors. First, we analyzed the mechanism of TIMP-1 activation in astrocytes and glioblastoma cells.
TIMP-1 expression is activated by IL-1, which is the major neuroinflammatory cytokine, via simultaneous activation of IKK/NF-κB and MEK3/6/p38/ATF-2 pathways in primary xx
human astrocytes. In contrast to astrocytes, TIMP-1 is expressed at lower levels in glioblastomas, and is not regulated by IL-1 due to either dysfunctional IKK/NF-κB or
MEK3/6/p38/ATF-2 activation. Thus, we propose a novel mechanism of TIMP-1 regulation, which ensures an increased supply of the inhibitor after tissue injury to limit the ECM degradation. This mechanism does not operate in gliomas, and may in part explain the increased invasiveness of glioma cells.
Inflammation has been associated with the development of several cancers, including glioblastoma multiforme. However, it has not been linked to other brain tumors. Here we show for the first time that inflammation is associated with oligodendroglioma tumors as pro-inflammatory cytokines, such as OSM, IL-6, MCP1,
MIP1α, and MIP1β and inflammatory markers, such as ACT and COX-2, were expressed at higher levels in oligodendroglioma samples. In addition, cytokine-induced STAT3 signaling, but not NF-κB, is highly activated in the oligodendroglioma patients.
Moreover, OSM promotes oligodendroglioma cell proliferation in vitro, and this effect is mediated through STAT3. In summary, oligodendroglioma tumors secrete and respond to inflammatory mediators, with OSM being the major cytokine that activates STAT3 to promote the growth of tumor cells, and express ACT and COX-2 as a hallmark of ongoing inflammation.
Since STAT3 promotes the growth of oligodendroglioma, as well as glioblastoma cells, and also regulates gliogenesis, we studied molecular mechanisms of this process in xxi
an in vitro differentiation model. We turn our attention to the NFI family of transcription factors since they have recently emerged as novel regulators of the development of vertebral neocortex. We developed a stem cell-neural progenitor-astrocyte differentiation model, in which the generated astrocytes were characterized by proper morphology, increased glutamate uptake, and expression of early and late astrocyte markers.
Moreover, we found that NFI-X and NFI-C but not NFI-A or NFI-B, control the expression of GFAP and SPARCL1, the markers of terminal differentiation of astrocytes.
In summary, the three mechanisms of gene regulation we studied, provided new insights into astrocyte biology, with the important implications for understanding the basis leading to the development and progression of brain tumors.
1
CHAPTER 1
INTRODUCTION
1.1. Inflammation in the brain.
Inflammation involves recruitment and activation of circulating leukocytes, including macrophages, neutrophils, dendritic cells (DC), natural killer cells (NK) and T lymphocytes from the blood vessels to the sites of injury. This process is accompanied by expression of integrins, adhesion molecules, extracellular proteinases, and secretion of chemokines and cytokines. In normal, physiological conditions, inflammation is self- limiting, as it is followed by an anti-inflammatory response leading to its resolution and
restoration of the homeostasis. However, sustained inflammation is the major contributor
to numerous diseases, including rheumatoid arthritis, psoriasis, inflammatory bowel
disease, autoimmune and cardiovascular diseases, diabetes, and cancer (44).
In the past, the brain was considered an immune-privileged site due to the
presence of the blood/brain barrier, which effectively controls the passage of selected
cells and molecules from the blood into the brain. More recently this dogma has been
reevaluated, as critical data emerged indicating that inflammation is the primary response
of the central nervous system (CNS) to injury, infection, and disease (134, 207).
Alzheimer’s and Parkinson’s diseases, stroke, depression, schizophrenia, epilepsy,
multiple sclerosis, and traumatic brain injury are all associated with inflammation in the
brain (134). They share a common histopathological response, termed as the reactive
2
astrogliosis, which is characterized by a presence of reactive astrocytes and activated microglia (19, 147). These cells are capable of secreting and responding to pro- inflammatory cytokines and growth factors, which results in their proliferation and migration to the site of inflammation and subsequent repopulation of affected tissue.
Interleukin-1 (IL-1), Interleukin-6 (IL-6), and Tumor Necrosis Factor α (TNFα) are the major inflammatory cytokines involved in the inflammatory process in the brain. They induce the expression of inflammation-associated enzymes, including inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2), which produce additional inflammatory mediators such as nitric oxide (NO), and prostaglandins (PGE2), respectively. Pro-inflammatory cytokines further exert their effects by controlling the expression of genes encoding integrins, adhesion molecules, proteinases and their corresponding inhibitors to enable cell migration and extracellular matrix (ECM) remodeling.
1.2. Metalloproteinases and their inhibitors (MMPs/TIMPs).
Turnover of extracellular matrix (ECM) occurs in normal development, morphogenesis, reproduction processes, tissue remodeling, wound healing, and angiogenesis (26, 211). There are many types of proteinases that participate in ECM remodeling, including serine, cysteine, aspartic, and metallo-proteinases. The metallo- proteinases (MMP) (33) not only degrade the matrix but modulate the activity and release of biologically active molecules, as well. They constitute a big family of 24 members 3
divided into four major groups: collagenases, gelatinases, stromelysins, and membrane type MMPs (MT-MMPs). They are either extracellular or membrane-bound enzymes, which require both a zinc atom and zymogen activation for their enzymatic activity.
MMP concentrations are regulated at the transcriptional level by cytokines, growth factors and hormones, while their enzymatic activity is strictly controlled by α2-
macroglobulin and specific tissue inhibitors of metalloproteinases (TIMPs) (67). In fact, a
balance must be maintained between MMP activity and inhibition in a healthy tissue,
while any deviation from it leads to arthritis, tumor cell invasion and metastasis,
periodontal disease, neurodegenerative disorders, atherosclerosis, and fibrosis. In the
brain, MMPs and TIMPs are linked to synaptic plasticity, neuronal activity, and spatial
learning. Indeed, expression of MMPs and TIMPs has been described in the cerebellum
and the hippocampus and specific MMP substrates such as dystroglycan, integrins and
neurotrophins have been identified in the brain (105). Moreover, MMPs and TIMPs are
involved in brain tumor invasion and spreading, and are up-regulated during
inflammation (95, 102).
TIMP-1, -2, -3, -4 (tissue inhibitors of metalloproteinases) are four relatively
small proteins of 20-30 kDa, sharing approximately ~40% sequence similarity and
containing 12 conserved cysteine residues (26). Their N-terminal domain binds non-
covalently to the active zinc-binding site of the MMPs and is necessary, and sufficient,
for the inhibition (73). In most cases different TIMPs are capable of inhibiting most of 4
the MMPs, but each TIMP is also capable of specific binding to a specific MMP at a site distinct from the active site. In fact, TIMPs inhibit the catalytic enzyme site through the
N-terminal domain alone (100), but they specifically interact with the target by their C- terminal domains. Therefore, there are certain differences in specificity, for example
TIMP-2, -3, but not TIMP-1 are effective inhibitors of MT-MMPs while TIMP-3 is the only one to inhibit tumor necrosis factor α converting enzyme (TACE).
1.3. TIMP-1.
Human TIMP-1 is an inducible glycoprotein, composed of 184 amino acids with an apparent molecular mass ranging from 28.4 to 34 kDa. In contrast, TIMP-2 is a non- glycosylated protein expressed constitutively in most of the tissues whereas TIMP-3 is a non-glycosylated protein bound tightly to ECM components that promotes the detachment of transformed cells. TIMP-4 is expressed at high levels in the human heart and has been shown to cause apoptosis (26). Human TIMP-1 gene is located on the X chromosome at Xp11.3-11.23 and encodes a 0.9 kb mRNA (9). The TIMP-1 promoter is conserved between rodents and humans and it lacks a classical TATA box. It contains functional binding sites for activator protein 1 (AP-1), polyoma enhancer A binding protein-3 (Pea3), and signal transducers and activators of transcription (STATs) located within a 22 bp serum response element (SRE), as well as binding site for specificity protein 1 (SP-1) and leader-binding protein-1 (LBP-1) (9, 122). In addition, there is an upstream TIMP-1 element (UTE-1) in the vicinity of the SRE, which binds runt-related 5
transcription factors RUNX (15, 197). All these regulatory elements contribute to TIMP-
1 up-regulation by multiple stimuli such as phorbol esters, TGFβ, EGF, retinoids, IL-6,
OSM and LIF (22, 84, 196).
Interestingly, TIMPs have multiple functions independent of their MMP inhibiting activity. In fact, TIMP-1 was discovered as an erythroid-potentiating factor
(57) and was shown to have growth and survival-promoting activity for normal and transformed cells (73, 86, 124). TIMP-1 was later isolated from cartilage as an antiangiogenic factor (144) and, therefore, it is believed that TIMPs inhibit cellular invasion, tumorigenesis, metastasis, and angiogenesis. In addition, TIMP-1 and TIMP-2 suppress the apoptosis of mouse B cells and melanoma cells (81, 199). These effects of
TIMP-1 are exerted through its binding to an unidentified receptor and a number of signalling cascades. For example, Ras and Raf-1, which regulate cell proliferation and apoptosis, are activated upon TIMP-1 stimulation in osteosarcoma cells (205). Moreover,
TIMP-1 displays its anti-apoptotic and pro-survival activity by the activation of PI3K,
Bad phosphorylation, and Bcl-XL release in erythroid, myeloid, human breast epithelial, and Burkitt’s lymphoma cells (124). TIMP-1 was also reported to activate MAPKs, including p38 and ERK1/2 in various cell types (130, 162). More recent studies revealed that TIMP-1 induced hematopoietic cell differentiation through activation of the
MEKK1/MEK6/P38a signalling pathway as a downstream target of caspase-3 (48). More importantly, TIMP- 1 can be found in the nucleus of gingival and human fetal lung 6
fibroblasts (216), and it also binds to the cell surface and translocates to the nucleus of
MCF-7 breast carcinoma cells (172). As suggested, TIMP-1 could inhibit nuclear MMPs, such as MMP-11, to prevent cleavage of nuclear membrane proteins, and thus exert an anti-apoptotic effect. In addition, TIMP-1 was demonstrated to interact with the transcriptional repressor promyelocytic leukemia zinc finger protein (PLZF), an interaction that blocks PLZF-mediated apoptosis (170).
It has been shown that TIMPs are expressed in a cell-, time- and site-specific manner. TIMP-1, for example is regulated developmentally in rats, as its expression is low during embryogenesis, increases just before birth and later decreases during the postnatal period (67). TIMP-1 has also been shown to possess divergent functions different from MMP inhibition and tissue remodeling as it is involved in stimulation of gonadal steroidogenesis, apoptosis, neuroprotection, angiogenesis, changes in cell morphology and glioma malignancy. It plays crucial neuroprotective role in the CNS through the maintenance of the blood-brain barrier (BBB). TIMP-1 not only inhibits
MMPs to prevent BBB and tissue damage, but protects neurons against cytotoxic effects of glutamate-induced calcium influx, as well. In addition, TIMP-1 is involved in synaptic mechanisms underlying learning and memory, particularly those related to the hippocampus (32). Knock-out studies revealed that TIMP-1 KO mice have impaired learning and memory but paradoxically are resistant to excitoxicity and do not undergo the typical mossy fiber sprouting observed in wild type mice (104). 7
It has been also shown that TIMP-1 increases during the acute inflammation in the brain, which is associated with the reactive astrogliosis (102). Therefore, elevated
TIMP-1 levels are observed in experimental autoimmune encephalitis (EAE), Parkinson’s
Disease (PD), Multiple Sclerosis (MS), viral infection, and brain tumors. However, in chronic inflammation conditions such as HIV-1-associated dementia (HAD), TIMP-1 levels are significantly reduced in the cerebro-spinal fluid (CSF) and the brain tissue of patients (192). These findings suggest that TIMP-1 is secreted as part of an attempted tissue repair mechanism and may be protective during acute inflammation. On the contrary, a prolonged exposure to pro-inflammatory stimuli leads to the failure of TIMP-
1 production followed by extensive tissue damage, which causes neuronal malfunction and disease.
It was observed that TIMP-1 levels are also elevated in neurinomas and meningiomas suggesting that TIMP’s trophic activity may enhance the malignancy of certain types of tumors (67). In fact, high TIMP-1 levels are also correlated with glioma malignancy. In contrast, the more aggressive CNS tumors express lower levels of TIMPs than either benign tumors or normal brain. In addition, overexpression of TIMP-1, -2, -3 reduced tumor cell growth while recombinant TIMP-1 decreased glioma cell invasion.
Given the versatility of functions of TIMP-1, it is unclear whether this protein is beneficial or detrimental to the growth and progression of brain tumors. Our data suggest 8
that TIMP-1 may not be beneficial for glioblastoma progression and likely plays a neuroprotective role during astrogliosis-associated conditions in the brain (Chapter 2).
IL-1 is the major neuro-inflammatory cytokine linked to at least eight major diseases in the brain involving inflammatory responses in which astrocytes are the key players (204). Therefore, we investigated whether IL-1 is directly responsible for the
TIMP-1 gene up-regulation in human primary astrocytes. As a result, we identified a novel mechanism of TIMP-1 gene up-regulation by IL-1 in these cells. Interestingly, this mechanism is not functional in glioblastoma cells (Chapter 2).
1.4. Alpha-1-antichymotrypsin
Alpha-1-antichymotrypin (ACT) is a glycoprotein with a molecular weight of 55-
66 kDa, which belongs to the serpin family (serine proteinase inhibitors). Serpins are present in the plasma at physiological conditions and are drastically elevated in response to acute inflammation. They are synthesized in the liver upon cytokine stimulation, and they protect against extensive tissue damage by inhibiting leukocyte-derived proteases
(191). ACT inhibits the activity of cathepsin G and chymases released from neutrophils and mast cells, respectively (88). In addition, ACT inhibits cell-bound chymotrypsin-like enzymes and thus reduces the cytotoxic activity of natural killer cells (97). It is expressed in multiple tissues, including liver, heart, lungs, kidney, brain, breast and prostate. The
ACT gene has been classified as a type II positive acute phase gene according to its regulatory pattern in the liver (114). 9
In the brain, it is part of a ‘cerebral’ acute phase response as its levels are elevated in response to pro-inflammatory stimuli during inflammation-associated diseases such as
Alzheimer’s disease (AD) (135). ACT expression is induced by the pro-inflammatory cytokines belonging to the IL-6 family that activate the signal transducers and activators of transcription proteins (STATs) (117). Precisely, STAT3 homodimers bind the two cis- elements in the promoter of the act gene, located at –125 to –117 and –95 to – 87 upstream of the ACT transcription start site. Moreover, ACT expression is also triggered by cytokines from the IL-1 family, namely IL-1 and TNFα in primary human astrocytes and U373 glioblastoma cells (116). These cytokines exert their stimulatory effect through activation of nuclear factor kappa B (NF-κB) and activator protein 1 (AP-1) transcription factors, which subsequently bind to the astrocyte-specific enhancer located –13 kbp upstream of the ACT transcription start site.
In the CNS, the ACT gene expression was demonstrated in astrocytes and brain endothelial cells in addition to glioblastoma cells (116, 117). Since ACT is such an excellent marker of local inflammation in the brain, we used it to assess whether inflammation is associated with oligodendroglioma tumors (Chapter 3).
1.5. Interleukin-1 (IL-1).
Interleukin-1 (IL-1) is a pleiotropic cytokine, activating variable signalling pathways in different cell types. It is implicated in inflammation, stress responses, tumorigenesis, invasiveness and metastasis of cancer cells, and angiogenesis. In a healthy 10
brain, IL-1 is expressed at low levels by resident brain cells. It is implicated in a slow- wave sleep, and modulation of synaptic plasticity. In addition, it is involved in neuroendocrine responses and appetite suppression by mediating leptin actions in the brain. More importantly, IL-1 is associated with responses to local and systemic insults as its expression dramatically increases in response to injury or infection. Thus IL-1 is believed to be the major mediator of neuroimmune responses and is mainly produced by microglia, the brain resident macrophages. However, astrocytes, neurons, oligodendrocytes, cerebrovascular cells and circulating immune cells that invade the brain during inflammatory conditions also produce IL-1 (76, 103, 174, 204).
IL-1 is a family of three closely related proteins: agonists IL-1α and IL-1β, and an antagonist IL-1ra (3, 23, 138, 190). They all bind to two IL-1 receptors: type I receptor
(IL-1RI) that signals through NF-κB and MAPK pathways, and type II receptor (IL-1RII) that lacks the intracellular domain and does not initiate any signal transduction (21, 56,
70). Binding of IL-1α or IL-1β to IL-1RI initiates the formation of a complex with IL-1 receptor accessory protein (IL-1RAcP). This causes recruitment of a cytosolic adaptor, myeloid differentiation primary response protein-88 (Myd88), which attracts IL-1 receptor associated kinase (IRAK). Hyperphosphorylated IRAK subsequently interacts with an E3 ubiquitin ligase TNF receptor associated factor-6 (TRAF6), transforming growth factor β- activating kinase-1 (TAK1), and a regulatory TAK1-binding subunit
(TAB1, 2, 3). Subsequently, a complex consisting of TRAF6-TAK1-TAB1-TAB2-TAB3 11
dissociates into the cytoplasm, where TAK1 is activated through auto-polyubiquitination of TRAF6 and auto-phosphorylation. In fact, the TAB proteins are required for ubiquitin- dependent activation of TAK1 by TRAF6. TAK1, as a member of the mitogen-activated protein kinase kinase kinase (MAPKKK) family, subsequently phosphorylates mitogen- activated protein kinase kinases MKK3/6, MKK4/7, which leads to the activation of p38 and JNK, respectively. On the other hand, TAK1 also phosphorylates the IκB kinase
(IKK). The IKK complex consists of two catalytic subunits IKKα and IKKβ and an essential regulatory subunit NEMO/IKKγ. Activated IKKβ phosphorylates a cytoplasmic inhibitor of NF-κB α (IκBα), which results in its ubiquitination and subsequent degradation by the proteasome. This releases the bound NF-κB transcription factor
(p50/p65) and results in its nuclear localization and DNA binding. The p65 subunit also undergoes several post-translational modifications such as phosphorylation, acetylation, and prolyl isomerization that affect transcriptional activity of target genes. The rapid activation and nuclear translocation of cytoplasmic NF-κB (p50/p65) is often referred to as the ‘classical’ or ‘canonical’ pathway. It occurs in response to inflammatory cytokines such as tumor necrosis factor (TNF)-α and IL-1, or activation of a T-cell receptor by lipopolysaccharide (LPS). IKKα can also be phosphorylated by NF-κB inducing kinase
(NIK), another target of TAK1, which leads to the activation of the alternative (non- canonical) NF-κB pathway. IKKα dimer phosphorylates the p100 NF-κB subunit, induces its proteolysis, leading to the formation of a p52/RelB complex that binds to κB 12
sites of target genes. Thus, stimuli that activate both the canonical and non-canonical pathways lead to the activation of different sets of subunits of the NF-κB complex, which results in the activation of various target genes.
1.6. MAPK pathway.
Mitogen-activated protein kinases (MAPK) are a family of serine/threonine protein kinases widely conserved among eukaryotes that are involved in the regulation of multiple cellular processes including proliferation, differentiation, mobility and death
(106, 140). MAPK signaling cascades are organized hierarchically into three-tiered modules, activated by subsequent phosphorylation. Mitogens and cytokines act on a receptor and trigger a cascade by recruiting the MAPK kinase kinase (MAPKKK), which is the first, membrane, proximal component of the cascade. Subsequently, MAPKKKs phosphorylate MAPK kinases (MAPKK), which in turn phosphorylate MAPKs that eventually target transcription factors. There are several standard MAPK cascades, namely the Raf-MEK1/2-ERK1/2 pathway, the TAK-MKK3/6-p38 pathway, the
MEKK1,4-MKK4/7-JNK pathway, and the MEKK2,3-MEK5-ERK5 pathway. They are generally activated by various stimuli in response to stress, cytokines, growth factors, and mitogens. 13
1.7. Oncostatin M (OSM).
Oncostatin M (OSM) belongs to the IL-6 family of cytokines, which also include interleukin-6 (IL-6), interleukin-11 (IL-11), cilliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), cardiotrophin-1 (CT-1), and cardiotrophin-like cytokine
(CLC).
OSM is a secreted glycoprotein, expressed mainly by cells of monocytic origin such as monocytes, macrophages and microglia, but also in neutrophils, T cells, osteoblasts, Kaposi’s sarcoma cells, dendritic cells, and normal testis (37). Its expression is induced by granulocyte-macrophage colony stimulating factor (GM-CSF), interleukin-
3 (IL-3), human chorionic gonadotropin (hCG), HIV-1 infection, LPS, PMA, as well as prostaglandin E2 (PGE2). OSM signals through the type I (gp130/LIFR), and type II
(gp130/OSMRβ) receptor complexes. OSΜ activates STAT1, 3, 5, ERK1/2 and p38, but not JNK. In addition, OSM-activated signaling can be negatively regulated by SOCS3 and PIAS3.
OSM is a cytokine with both pro- and anti-inflammatory actions (37). It is associated with the initiation of host defense, as it is expressed by activated T cells, macrophages and microglia. In the CNS, OSM is not detected in the normal brain; however, its immunoreactivity is positive in MS and HAD patients, where it is localized to activated microglia, hypertrophic astrocytes and infiltrating leukocytes. OSM stimulates the expression of IL-6, MCP-1 and TIMP-1 in astrocytes and brain endothelial 14
cells, and elevates the expression of MMP-1, -3 in astrocytes. Moreover, OSM regulates the expression of the urokinase plasminogen activator (uPA) and the plasminogen activator inhibitor-1 (PAI-1), which contribute to cell invasion and tissue remodeling.
Anti-inflammatory actions of OSM have been demonstrated in the mouse EAE model, where OSM proved to have protective effects.
Increased levels of OSM have also been detected in some brain tumors, including astroglioma, glioblastoma multiforme and pituitary adenoma, when compared to the non- neoplastic brain biopsy samples (118). The role of OSM in these tumors is ambiguous, since it exerts both, growth promoting and inhibitory effects (38). For example, OSM inhibits the growth of human glioma cells in vitro and tumor formation in vivo. On the other hand, it stimulates the expression of VEGF, and hence it is pro-angiogenic, which correlates with glioma progression.
The roles of OSM in the development and progression of other brain tumors have not been described. Therefore, we investigated the effects of OSM and OSM-activated
JAK/STAT pathway in the growth of oligodendroglioma tumors (Chapter 3).
1.8. JAK/STAT pathway.
IL-6 family of cytokines is a group of neuropoietic factors with pluripotent and redundant biological functions in cell proliferation, apoptosis, migration, and cellular differentiation. This is mainly due to the fact that they all share a signal transducer receptor subunit, the gp130 protein, which heterodimerizes with specific receptor 15
subunits upon ligand binding (128, 159). This leads to the activation of the Janus kinases
(Jak1, Jak2, Jak3, Tyk2), which phosphorylate tyrosine residues of the gp130 protein and attract Src-homology-2 (SH-2) domain containing signaling molecules, including STATs.
Having bound to the receptor complex, STATs are phosphorylated, dimerize and translocate to the nucleus to bind to the specific IFN-γ activation sequence (GAS) elements and activate gene transcription. There are seven STAT proteins identified in mammals: STAT1, STAT2, STAT3, STAT4, STAT5a, STAT5b, and STAT6. All except for STAT2 form homodimers. In addition, STAT1 with STAT2, and STAT1 with STAT3 heterodimerize, and several STATs can form tetramers. Not only does the tyrosine phosphorylation of STATs enable DNA binding but allows them to remain in the nucleus, as well. In fact, STATs require facilitated transport into the nucleus through binding to importin-α5, and they remain there until the phosphorylation mark is removed by nuclear phosphatases, such as TC45.
Moreover, there are a few negative regulators of JAK/STAT signaling (128).
These include cytoplasmic tyrosine phosphatases, such as SH2-containing phosphatase
(SHP1, SHP2), and protein-tyrosine-phosphatase 1B (PTP1B), which target both the receptor and kinase phosphorylation sites. Another group of cytoplasmic inhibitors are suppressors of cytokine signaling (SOCS), which bind to the receptors and Jaks to block further STAT activation. These cytokine-induced proteins can also cause ubiquitin- proteasome mediated degradation of the receptor protein and associated signaling 16
molecules. Protein inhibitors of activated STATs (PIAS) constitute another level of negative STAT regulation in the nucleus. PIAS proteins interact with tyrosine- phosphorylated STATs and block their DNA-binding, thus inhibiting gene activation.
Taking all these positive and negative regulators into consideration, activation versus inhibition of the JAK/STAT signaling is crucial to their variable biological functions.
IL-6 family of cytokines can also activate MAPK pathways through the gp130 protein (89). In this case, activated Jak1 and Jak2 phosphorylate SHP2, which acts as a docking target for the adaptor protein Grb2. Grb2 is complexed with GTP-exchange factor SOS that interacts with Ras, which in turn, recruits Raf and activates a MAPK pathway.
A typical inflammatory response involves the activation of NF-kB, Jak/Stat and
MAPK signalling pathways due to the presence of the proinflammatory cytokines of the
IL-1 and IL-6 families, growth factors, and other mitogens.
1.9. Inflammation in cancer.
Normal inflammation is self-limiting, as it is followed by an anti-inflammatory response. However, persistent and excessive presence of pro-inflammatory stimuli and/or failure of systems to resolve the inflammatory response result in chronic inflammation.
Indeed, chronic inflammation contributes to tumor development and progression by creating tumor-supporting microenvironment rich in inflammatory cells, cytokines, growth and survival factors, facilitating genomic instability, and promoting angiogenesis 17
(44, 129, 193). The mediators produced by inflammatory cells regulate the growth of fibroblasts, neoplastic and endothelial cells. Later during tumor progression, neoplastic cells divert inflammatory mechanism to favor their growth and development and subvert anti-tumor immune cell functions. Therefore, chronic inflammation caused by a parasite, bacterial or viral infection is the main driving force of anaplastic progression. There are many examples of chronic inflammatory diseases that lead to cancer. The strongest evidence is found for colon cancer that is associated with inflammatory bowel diseases.
In addition, infection with the hepatits C virus predisposes to liver carcinoma, schistosomiasis increases the risk of bladder and colon cancers and Helicobacter Pylori is a well-established carcinogen in the gastric cancer (44). Chronic inflammation is also associated with necrotic centers of glioblastoma tumors in the brain (166, 200). Since nothing is known about the role of inflammation in the biology of oligodendroglioma tumors, we investigated whether inflammatory mediators are produced in these tumors and whether they affect the oligodendroglioma growth (Chapter 3).
1.10. Classification of neurological tumors.
Neuroectodermal (neurological) tumors include all tumors that originate from the cells of the central or peripheral nervous system (PNS). Based on the histology, cytogenetic, and molecular genetic profiling, the World Health Organization (WHO) classifies tumors into four grades: I, II, III and IV, which reflect their degree of 18
malignancy (112). Histological features of malignancy include high cellularity, cellular pleomorphism, mitotic activity, microvascular proliferation, and necrosis.
Brain tumors constitute less than 2% of all malignant neoplasms (112). However, many of them affect children and are a second cause of death after leukemias. Since they affect the brain, they are devastating for patients and highly expensive to treat (127).
Tumors of neuroepithelial tissue are responsible for nearly half of all brain tumor incidences, and they include astrocytic, oligodendroglial, ependymal, neuronal, pineal, embryonal, choroid plexus tumors and mixed gliomas. Glial tumors are the most common in adults, as glial cells retain the ability to proliferate throughout life, while neurons become post-mitotic past the development stages. Glial tumors are classified in subgroups according to whether they display differentiated features of astrocytes, oligodendrocytes or ependymal cells (218). In fact, glioblastomas and astrocytomas constitute ~30%, and oligodendrogliomas ~4% of all reported brain tumors, which ranks them second and third, respectively in terms of incidence after meningioma.
Schwannoma and neurofibroma are the two most common glial tumors in the
PNS (218). They are considered benign and classified as grade I according to WHO guidelines. Schwannoma is a neural crest derived tumor that is clonal in origin and possesses morphological and molecular features of Schwann cells. In contrast, neurofibroma is a heterogenous tumor composed of cells of different origin, including schwann cells, fibroblasts, neurons and others. 19
1.11. Glioblastoma.
There is a great variety of astrocytic tumors, which are widely represented by glioblastomas, the most aggressive and fatal type of brain tumor (127). Pilocytic astrocytoma, grade I is benign and can be surgically removed, whereas grade II diffuse astrocytoma, is of low malignancy and requires long-term clinical treatments. Anaplastic astrocytoma, grade III, is malignant and leads to the patient’s death within a few years, while glioblastoma multiforme (GBM), grade IV is highly malignant and causes death within months. In fact, GBM is the most malignant form of a glial neoplasm, and it carries the worst clinical prognosis among primary brain tumors in adults. Neither of the approaches, including diagnostic imaging, neurosurgery, radiation therapy, and chemotherapy manages to significantly improve the accurate prognosis or patient’s survival. However, there are several molecular markers that help to characterize these tumors (136). These include mutations in the p53 tumor suppressor and retinoblastoma
(RB) (25%), EGF receptor (EGFR) amplification or overexpression (~40-60% of cases), mutations of the phosphatase and tensin homology gene (PTEN) (30%), deletion or inactivation of cyclin-dependent kinase inhibitors p16INK4a/p19ARF (30-40%),
amplification or overexpression of transformed 3T3 cell double minute 2 (MDM2) gene
(10-50%), and loss of heterozygosity (LOH) on the chromosome 10 in 50-80% of cases.
As a result of these genetic alterations, activation of signalling pathways such as PI3K- 20
Akt, Ras-MAPK and JAK/STAT leads to uncontrolled cellular proliferation and escape from apoptosis, which promotes tumor growth and progression.
1.12. STAT3 in GBMs.
The STAT3 transcription factor is the most commonly observed member of the
STAT family to be present in a constitutively activated state in many tumors (93, 212).
The role of STAT3 in development, proliferation, angiogenesis, and survival of tumor cells is well documented. In fact, it is constitutively activated in both the tumor cells and immune cells within the tumor microenvironment. Its role is to facilitate communication between tumor cells and diverse immune-cell subsets, leading to the suppression of the innate and adaptive anti-tumor responses.
STAT3 is constitutively activated in 90% of glioblastomas, including both the primary tumor samples from patients and GBM cell lines. Its persistent activation is due to either an autocrine IL-6 signaling (166) or increased expression of the EGF receptor
(69), and it can be further stimulated by other cytokines, including IL-4 (167). The overall anti-apoptotic effects of STAT3 are exerted through activation of anti-apoptotic genes such as Bcl-2, Bcl-XL, and Mcl-1 (166). In fact, it was shown that inhibition of constitutively active STAT3 with a general Jak inhibitor AG490 or a dominant negative of STAT3, suppresses proliferation and induces apoptosis of glioblastoma cells through reducing the steady state levels of these pro-survival proteins. Moreover, a novel, specific inhibitor of STAT3, WP1066, induces the apoptosis of several glioblastoma cell lines by 21
activation of Bax and suppression of c-myc, Bcl-XL, and Mcl-1, and inhibits the growth of subcutaneous tumors (99). Therefore, STAT3 is a candidate therapeutic target in malignant gliomas.
1.13. Oligodendroglioma.
Oligodendroglioma is the second most common neuroepithelial neoplasm, accounting for ~4% of primary brain tumors (113). It can be classified as grade II
(oligodendroglioma), which is defined as “a well-differentiated, diffusely infiltrating tumor of adults that is typically located in the cerebral hemispheres and composed predominantly of cells morphologically resembling oligodendroglia”. It can also be characterized as anaplastic oligodendroglioma, grade III, which is defined as “an oligodendroglioma with focal or diffuse histological features of malignancy and a less favorable prognosis”. Most oligodendrogliomas manifest in the adult age groups with a peak incidence between the 4th and 5th decades. The most common symptoms include
seizures, headaches, paralysis, visual loss, papilledema, ataxia, abnormal reflexes and
meningismus. The vast majority of these tumors occur in the supratentorial brain,
including the frontal, temporal, parietal and occipital lobes. Surgical resection is the
mainstay of initial treatment, which is followed by radio- and/or chemotherapy (201).
The median postoperative survival period for patients with grade II oligodendroglioma
ranges from 3-17 years. However, for patients with anaplastic oligodendroglioma who
received surgical and radiotherapy treatments, a median survival time varies only from 10 22
months to 3.9 years. More importantly, 70% of patients with oligodendroglioma have a loss of 1p and 19q regions of chromosomes and respond favorably to chemotherapy treatment with procarbazine, lomustine and vincristine by increasing the survival rates
(101). Interestingly, these losses of heterozygosity are speculated to result in the loss of
DNA repair mechanisms, which together with the p53-mediated apoptosis lead to tumor cell death upon administration of the alkylating agents. Therefore, the genetic profile of oligodendroglioma can be useful for guiding the treatment and predicting the outcome. In contrast to glioblastoma and astrocytoma, oligodendroglioma specific molecular markers have not been identified thus far.
1.14. Gliomagenesis.
So far, the research on glial tumorigenesis has raised more questions than answers
(218). The most current view focuses on cancer stem cells that are found in brain tumors and are believed to be responsible for gliomagenesis. However, the dedifferentiation theory cannot be ignored, as gliomas do show morphological and molecular characteristics of differentiated cells. Astrocytoma and glioblastoma, for example, are believed to derive from the astrocytic cell lineage because of glial fibrillary acidic protein
(GFAP) expression (202), which is expressed in differentiated astrocytes. In addition, there is an inverse relationship between the number of GFAP-positive cells and the aggressive behavior of gliomas. The high grade GBMs often express low levels of GFAP, and are characterized by an increased proliferation rate and invasiveness, whereas the low 23
grade astrocytomas have high levels of GFAP and decreased cell growth rates and invasion.
On the other hand, some astrocytomas also express brain fatty acid-binding protein (B-FABP), a marker of radial glial cells that are precursors of astrocytes (71).
Moreover, GBM has been reported to express neuronal markers suggesting that it may develop from neural stem cells. To further support this notion, a subtype of tumor cells with characteristics of stem cells such as self-renewal and multipotency, have recently been identified in GBMs (213). These cells, named brain tumor stem cells (BTSC) (185), express neural progenitor cell markers: nestin and CD133 (14). In addition, when compared to their CD133-negative equivalents, they are radio- and chemo- resistant, and they have higher expression levels of ABC transporters (11).
During normal brain development, terminally differentiated astrocytes undergo an anti-proliferative and senescent/apoptotic phase (195). However, it is possible that due to genetic and signalling alterations, progenitor cells escape from the astrocyte differentiation pathway, evade the apoptosis thus proliferating uncontrollably and generate glial tumors. Therefore, it is of high importance to understand the mechanisms regulating astrocyte differentiation.
1.15. Differentiation of astrocytes.
Astrocytes are critical for many pathological states of the brain (19, 147), such as neuroinflammation associated with neurodegenerative diseases and the development and 24
progression of glial tumors. However, the mechanisms controlling astrocyte differentiation and gene expression are poorly understood. The data accumulated over the years suggest that several signaling pathways are critical for astrocyte differentiation
(and expression of astrocyte-specific markers), involving the activation of Smads, JAK-
STAT pathway, the Notch signaling, and the Nuclear Factor-1 (NFI) family of transcription factors (143).
During the vertebrate embryonic development, neurons are generated first, which is followed by glia. This neurogenic-to-gliogenic transition phase occurs on day E18 in mice, with neurons generated during days E12-E18, astrocytes appearing on day E18 and peaking in the neonatal period, whereas oligodendrocytes develop postnatally (179).
During the process of astrogliogenesis, several marker genes have emerged as characteristic for differentiating astrocytes. These include: glial fibrillary acidic protein
(GFAP) (62), glutamate transporter (GLAST) (182), glutamine synthase (GS), inflammatory secreted protein S100B (219), osteonectin (SPARCL) (141), antigen CD44
(131), brain lipid binding protein (BLBP), and brain fatty acid binding protein (B-FABP)
(121). These markers provide useful tools to study gliogenesis.
The gliogenesis is likely induced by the activation of the JAK-STAT signaling pathway in neural precursors in response to neuron-derived cardiotrophin-1 (CT-1) (12).
In fact, mice lacking subunits of the CT-1 receptor, LIFR or gp130, show substantial deficits in astrocyte generation. Moreover, ectopic expression of CNTF, which signals via 25
LIFR and gp130, induces premature astrocyte formation. CT-1, CNTF and LIF mediate their effects through STAT3, which is believed to be critical in this process (158) (87).
Cytokines of the IL-6 family cooperate with bone morphogenic protein-2 (BMP-2) (152,
210), which in turn signals through Smad1. Subsequently, Smad1 can form a complex with STAT3, bridged by the coactivator p300, which is followed by synergistic induction of astrogliogenesis (152). Although STAT3 is strongly suggested to play an instructive role in astrogliogenesis, neural-specific conditional knockout of STAT3 does not affect astrocyte generation, suggesting that other STATs may functionally substitute for
STAT3.
Notch signaling has also been involved in gliogenesis as it leads to activation of the transcription factor RBP-Jκ. RBP-Jκ promotes gliogenesis, only when the JAK-STAT pathway is turned on (77) (82). RBP-Jκ up-regulates the expression of primary target genes of Notch signaling, such as hairy and enhancer of split (HES) transcriptional repressor, which inhibits neurogenesis.
Recently, it became apparent that the NFI family of transcription factors can also play a role in brain development and specifically in gliogenesis (143). However, mechanisms linking NFI to previously characterized pathways and expression of astrocyte-specific genes are not known. Therefore, we tested a hypothesis that NFI is critical for expression of astrocyte marker genes and is thus required for astrogliogenesis
(Chapter 4). 26
1.16. Nuclear Factor I.
The phylogenetically conserved nuclear factor-1 (NFI) regulates the transcription of various cellular and viral proteins, in addition to adenoviral DNA replication (79). It comprises a family of DNA-binding proteins encoded by four genes in vertebrates: Nfia,
Nfib, Nfic, Nfix (80, 165). In mammals, the products of the four genes: NFI-A, NFI-B,
NFI-C and NFI-X are expressed in complex, overlapping patterns during embryogenesis, and their expression is developmentally regulated (34). This suggests that they may play an important role in regulating the tissue-specific gene expression during mammalian embryogenesis (163).
NFI factors share a highly homologous, conserved 220-aa N-terminal domain that is sufficient for dimerization, DNA-binding, and stimulation of adenovirus DNA replication in vitro (79). NFI proteins form homo- and hetero- dimers that bind to the dyad symmetric consensus sequence TTGGC(N)5GCCAA with apparently identical affinities. However, significant variation occurs within the C-terminal end of the NFI proteins, which encodes transcription regulation domains. In addition, transcripts of all four genes can be alternatively spliced, yielding as many as nine different proteins from each gene (5). Moreover, NFI can be differentially phosphorylated in various cell types and this modification affects its transcriptional activity (18).
NFI proteins have been implicated in both activation and repression of transcription in a gene-, promoter- and cell-type specific manner (35). Several 27
mechanisms of this regulation have been proposed (79). NFI-C was reported to activate transcription by a direct interaction with basal transcriptional machinery through a proline-rich transactivation domain that is homologous to the CTD repeat of the RNA polymerase II. On the other hand, the C-terminal proline-rich domain of NFI-C can also interact directly with histone H3. Another activation mechanism involves the repressive histone H1, which binds weakly to NFI-binding sites and competes for DNA binding.
Therefore binding of NFI removes the repressive histone and makes the chromatin accessible to other transcriptional regulators. Finally, NFI proteins were shown to recruit various co-activators, including p300/CBP and Ski (206). These data suggest that NFI-C can activate gene transcription by simultaneous removal of repressive histone H1 and recruitment of a co-activator associated with histone H3. Besides transcriptional activation by NFI, mechanisms of repression include direct competition with more potent transactivators for binding at adjacent or overlapping sites. Moreover, the C-terminal transcriptional regulation domains can function as repressors and recruit other co- repressor proteins, or interact directly with the basal transcriptional apparatus (36, 43).
All four NFI isoforms are expressed in many tissues, with particularly high levels of expression of NFI-A, NFI-B, and NFI-X in the developing neocortex (35). Binding sites for NFI factors are present in cellular genes expressed in multiple tissues, but also in genes expressed solely in brain, muscle, liver and other differentiated cell types (79).
There are several NFI-responsive genes in the brain, including GFAP (16), S100B (4), 28
and ACT in astrocytes (75), B-FABP in radial glial cells (18), MBP (myelin basic protein) in oligodendrocytes (98), and several neuronal genes (13, 151, 206). Moreover, we have recently found that NFI-X controls the expression of both, the ACT and GFAP genes in U373 glioma cells (75). Therefore, NFI proteins seem to be involved not only in development, but cellular differentiation as well.
Knock-out studies in mice have strengthened the role of NFI in the brain development. Disruption of either Nfia or Nfib gene causes late gestation neuroanatomical defects, including agenesis of the corpus callosum, size reduction in other forebrain commissures, and loss of specific midline glial populations (47, 184,
189). In addition, Nfib-deficient mice show aberrant hippocampus and pons formation, and defects in lung development. In contrast, disruption of Nfic results in early postnatal defects in tooth formation, including the loss of molar roots and aberrant incisor development (188). Loss of the Nfix gene is postnatally lethal, and leads to hydrocephalus, ventricle enlargement and agenesis of the corpus callosum (58).
Furthermore, NFI-X-deficient mice develop a deformation of the spine with kyphosis, due to a delay in ossification of vertebral bodies and a progressive degeneration of intervertebral disks. Moreover, NFI-X was shown to be critical for the replication of the
JC virus, which selectively infects glial cells (119). These data strongly indicate that NFI-
A, NFI-B and NFI-X proteins are involved in the function and development of the brain. 29
Recently, it has been elegantly demonstrated that the expression of both NFI-A and NFI-B is induced during the neurogenic-to-gliogenic transition (12). The knock- down of NFI-A prevented the expression of astroglial precursor markers, while the misexpression of NFI-A and NFI-B accelerated gliogenesis and migration of astroglial precursors into the grey matter. Surprisingly, NFI-A and NFI-B are also needed for the initial specification of oligodendroglial precursors, but NFI-A function is later compromised in differentiating oligodendrocytes by its direct interaction with Olig2.
Interestingly, NFI-A expression precedes that of NFI-B in a developing chick embryo, suggesting that a cascade of expression of NFI isoforms may exist with NFI-A expressed in early stages, followed by NFI-B, and ended with NFI-C and NFI-X. In fact, human multipotent neural progenitors express high levels of NFI-A and NFI-B, but not NFI-X, while progenitor-derived astrocytes express all three of these NFI isoforms. All of these data indicate that NFI-A and NFI-B are critical in the initial stages of gliogenesis; however, the functions of NFI-C and NFI-X are unclear.
Based on the facts that NFI-X is involved in the brain development, and is widely expressed in the developing neocortex, in addition to regulating the expression of ACT and GFAP genes in U373 glioma cells, we investigated whether it is required for terminal astrocyte differentiation (Chapter 4).
30
CHAPTER 2
A NOVEL MECHANISM OF TISSUE INHIBITOR OF
METALLOPROTEINASES-1 ACTIVATION BY INTERLEUKIN-1 IN PRIMARY
HUMAN ASTROCYTES
2.1. ABSTRACT
Reactive astrogliosis is the gliotic response to brain injury with activated astrocytes and microglia being the major effector cells. These cells secrete inflammatory cytokines, proteinases, and proteinase inhibitors that influence extracellular matrix (ECM) remodeling. In astrocytes, the expression of tissue inhibitor of metalloproteinases-1
(TIMP-1)1 is upregulated by interleukin-1 (IL-1), which is a major neuroinflammatory cytokine. We report that IL-1 activates TIMP-1 expression via both the IKK/NF-κB and
MEK3/6/p38/ATF-2 pathways in astrocytes. The activation of the TIMP-1 gene can be blocked by using pharmacological inhibitors, including BAY11-7082 and SB202190, overexpression of the dominant-negative inhibitor of NF-κB (IκBαSR), or by the knock- down of p65 subunit of NF-κB. Binding of activated NF-κB (p50/p65 heterodimer) and
ATF-2 (homodimer) to two novel regulatory elements located -2.7 and -2.2 kb upstream of
31
the TIMP-1 transcription start site respectively is required for full IL-1-responsiveness.
Mutational analysis of these regulatory elements and their weak activity when linked to the minimal tk promoter suggest that cooperative binding is required to activate transcription.
In contrast to astrocytes, we observed that TIMP-1 is expressed at lower levels in gliomas and is not regulated by IL-1. We provide evidence that the lack of TIMP-1 activation in gliomas results from either dysfunctional IKK/NF-κB or MEK3/6/p38/ATF-2 activation by IL-1. In summary, we propose a novel mechanism of TIMP-1 regulation, which ensures an increased supply of the inhibitor after brain injury, and limits ECM degradation.
This mechanism does not function in gliomas, and may in part explain the increased invasiveness of glioma cells. 32
2.2. INTRODUCTION
The remodeling of the extracellular matrix (ECM), including the degradation of the
ECM by matrix metalloproteinases (MMPs) and its subsequent resynthesis, is critical during normal physiological processes, such as angiogenesis, embryonic development, organ morphogenesis, bone remodeling, and ovulation (26, 211). During these processes the proteolytic activity of MMPs is tightly controlled at the transcriptional level by growth factors, hormones, and cytokines, and at the protein level by proteolytic cleavage of inactive zymogens, and the inhibition by specific inhibitors, including tissue inhibitors of metalloproteinases (TIMPs) (26). The delicate balance between the activities of MMPs and TIMPs is critical to limit deleterious outcomes of uncontrolled degradation, which is manifested in pathological conditions such as periodontal disease, arthritis, tumor cell invasion, fibrosis, and neurodegenerative disorders (26, 149, 150). These pathological conditions often represent chronic inflammatory diseases suggesting that inflammatory mediators, including inflammatory cytokines, may disrupt the intricate balance between
MMPs and TIMPs.
In the central nervous system (CNS), infection and injury induce a histopathological response known as reactive astrogliosis, which is the primary cause of regenerative failure in the mature CNS (54, 156, 177). During this response, activated astrocytes and microglia secrete MMPs, TIMPs, and a plethora of cytokines and growth factors that drastically change the proteolytic balance and affect ECM remodeling (67, 102, 33
192). IL-1 is one of the major neuroinflammatory cytokines that is detected in the CNS after brain injury, and affects the expression of several MMPs and TIMPs in astrocytes, microglia, and brain endothelial cells (30, 145, 192). Thus far, four members of the TIMP family (TIMP-1 through TIMP-4) have been identified in mammals (26). Among TIMPs,
TIMP-1 is encoded by a highly inducible gene, and is upregulated in several cell types by
IL-1, IL-6, tumor necrosis factor, epidermal growth factor, transforming growth factor, and oncostatin M (OSM). In the CNS, TIMP-1 expression is upregulated in astrocytes following intracranial injury, with TIMP-2 expression upregulated in microglia and neurons (102). Astrocytic TIMP-1 expression is also upregulated in experimental autoimmune encephalitis, and in transgenic animals expressing cytokines in the brain
(160). However, chronic inflammation associated with HIV-1-associated dementia is actually characterized by the decreased levels of TIMP-1 in both cerebrospinal fluid and brain tissue, suggesting that prolonged activation of astrocytes leads to TIMP-1 downregulation and, in turn, ECM degradation (192). In vitro, IL-1 significantly increases
TIMP-1 expression in astrocytes, which recapitulates the in vivo findings from acute injury models (109, 192).
Since TIMP-1 upregulation in astrocytes prevents excessive ECM degradation, the mechanisms of TIMP-1 regulation may lead to the identification of new therapeutic targets. We initiated this study with the aim of identifying the molecular mechanism that regulates TIMP-1 expression in astrocytes exposed to IL-1. 34
2.3. MATERIALS AND METHODS
2.3.1. Cell culture. Human cortical astrocyte cultures were established using dissociated human cerebral tissue established exactly as previously described (117). Cortical tissue was provided by Advanced Bioscience Resources (Alameda, CA), and the protocol for obtaining postmortem fetal neural tissue complied with the federal guidelines for fetal research and with the Uniformed Anatomical Gift Act. Human glioblastoma U373-MG cells were obtained from American Type Culture Collection (Rockville, MD), whereas human glioma A172, U251, and T98G cells were obtained from Dr. Jaharul Haque
(Cleveland Clinic Foundation, Cleveland, OH). Cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum, antibiotics, sodium pyruvate, and non-essential amino acids.
2.3.2. Cytokines and cell stimulation. Cells were stimulated with 25 ng/ml OSM (R&D,
Systems, Inc., Minneapolis, MN), or 10 ng/ml IL-1 (a gift from Immunex Corp., Seattle,
WA). For inhibitor studies, cells were pretreated with 1 µM SP600125, 10 µM BAY-
117082, 10 µM SB202190, 5 µM parthenolide, 5 µg/ml Actinomycin D (all from Sigma,
St. Louis, MO), 10 µM GF109203X, or 1 µM CAY10470 (EMD Biosciences, Inc. San
Diego, CA), and then treated with IL-1.
35
2.3.3. RNA preparation and Northern blot analysis. Total RNA was prepared by phenol extraction exactly as described previously (74). The filters were prehybridized at 65°C for
3 h in 0.5 M sodium phosphate buffer pH 7.2, 7% SDS, and 1 mM EDTA, and hybridized in the same solution with cDNA fragments of TIMP-1 labeled by random priming (64).
After the hybridization, nonspecifically bound radioactivity was removed by four washes in 40 mM phosphate buffer, 1% SDS, and 1 mM EDTA at 65°C for 20 min each.
2.3.4. Quantitative PCR. TIMP-1 mRNA levels were measured using TaqMan technology (Applied Biosystems, Foster City, CA) according to the supplier’s instructions.
Briefly, one µg of total RNA was reverse-transcribed using the High capacity cDNA archive kit (Applied Biosystems, Foster City, CA). Subsequently, the cDNAs were diluted
100-fold (TIMP-1) or 10,000-fold (18S rRNA). For real-time PCR, pre-mixed primer- probe sets and TaqMan Universal PCR Master Mix were purchased from Applied
Biosystems (Foster City, CA), and cDNAs were amplified using ABI 7900HT cycler.
2.3.5. Synthetic oligonucleotides. The following oligonucleotides were synthesized to amplify the DNA fragments from the 5’ flanking region of the TIMP-1 gene: (-1.0+1.0);
5’-AGGTCCATGGGGAGGGGGCAGGG-3’ and 5’GGGGCCATGGTGGGTTCTGTGG
GG-3’, (-4.2-0.8); 5’-ACCTGGTACCAGGGTTGTAACTCAGG-3’ and 5’-AAAGGGTA
CCCGTCCAATCAAGAGAC-3’, (-5.3-4.1); 5’-CCAAGGTACCTTACAGCTTAGAAG- 36
3’ and 5’-AGTAGGTACCCGGTTCTGTGGAGTG-3’, (-7.7-7.0); 5’CGGAGCATGCG
GCAGAGGAATGGAG-3’ and 5’-TCTGGGTCATACAGAACCAG-3’, (-9.4-8.9); 5’ AC
CTCGGTACCCCCAGCTCAAGTAAG-3’ and 5’-TGGGGCATGCTAGAGAGAGACA
AGG-3’, (-2.9-2.1); 5’-TGGCTGGTACCTGTAATCCCAGCACTTTGG-3’ and 5’-AGCT
CTCGAGATGGTCACACACCCC-3’, (-2.9-2.7); 5’-ACCTGGTACCTCCGAGGGAGA
AGTGAGG-3’ and 5’-GCATCTCGAGGCAGCGGGCCAGGGAAAC-3’, (-3.5-2.7) 5’-
ACCTGGTACCTCCGAGGGAGAAGTGAGG-3’ and 5’-GCATCTCGAGGCAG CGGG
CCAGGGAAAC-3’, (-3.9-2.7); 5’-ACCTGGTACCTCCGAGGGAGAAGTGAGG-3’ and
5’-ACAACTCGAGACACCCACAACTCAGTTTG-3’. The following oligonucleotides were synthesized to generate the plasmid phT(-0.7m)CAT: 5’-CAGATCTCT CGAGGCA
TGCGTA-3’ and 5’-TACGCATGCCTCGAGAGATCTGGTAC-3’. The activating transcription factor-2 (ATF), activating protein-1 (AP-1), and nuclear factor κB (NF-κB) double stranded oligonucleotides used to generate ATF, AP-1, and NF-κB reporter constructs, and also in EMSA, had the following sequence: AP-1; 5’-GATCTGTGCTGAC
TCAGGTTA-3’ and 5’-GATCTAACCTGAGTCAGCACA-3’, NF-κB; 5’-GATCTGGCA
GGACTTCCCCTGCCA-3’ and 5’-GATCTGGCAGGGGAAGTCCTGCCA-3’, ATF; 5’-
GATCTCGCTTGAGCTCAGGAGA-3’ and 5’-GATCTCTCCTGAGCTCAAGCGA-3’, upperNF-κB; 5’-GATCTCCTGGGCACTCCCACCCA-3’ and 5’-GATCTGGGTGGGA
GTGCCCAGGA-3’, upperATF; 5’-GATCTTGACTGGCGTCATTATA-3’ and 5’-GA TC
TATAATGACGCCAGTCAA-3’. The mutations within the ATF, AP-1 and NF-κB 37
elements were generated using the following primers: AP-1 mutant; 5’-TGAAATCCGGA
CACAGAGTGTTGCCGAC-3’ and 5’-TGCTGTCCGGAGTTTCAAAGAGTTGGCG
TCAG-3’, NF-κB mutant; 5’-GGCAGCTCGAGTCCTGCCTTGGCCCCTC-3’ and 5’-CA
GGACTCGAGCTGCCCTCACTTCTCCCTC-3’, ATF mutant; 5’-CTTGCATATGGGA
GTTCAAGACCAGTCTGG-3’ and 5’-TCCCATATGCAAGCGATCTGCCTGCCTCA
GC-3’, upperNF-κB mutant; 5’-CCTGGGCCTGCAGACCCCAACACACATACAGTC-
3’ and 5’-GGGTCTGCAGGCCCAGGAATGTTTTCTGCAAAC-3’, UpperATF mutant;
5’-TGACTGGTCGACTTATGAGGTGGGCTGAGAGG-3’ and 5’-ATAAGTCGACCA
GTCATTTGGGAAATGAGG-3’.
2.3.6. Plasmid construction. Plasmid phT(-1.0)inCAT (containing promoter, first exon, first intron, and part of the second exon of the TIMP-1 gene) was generated by inserting the 2 kb NcoI-digested PCR product (-1.0+1.0) into the NcoI-digested pCAT3promoter vector (Promega, Madison, WI). Plasmid phT(-0.7)inCAT derives from the plasmid phT(-
1.0)inCAT from which 300 bp KpnI fragment was deleted. Subsequently, this plasmid was digested with NcoI and PstI, ends were blunted, and religated to yield plasmid phT(-
0.7)CAT. The plasmid phT(-4.2-0.8) was generated by cloning a KpnI-digested PCR product into the KpnI sites of phT(-0.7)CAT. In order to generate all the other reporter plasmids containing different fragments of the 5’ flanking region of the TIMP-1 gene, we first constructed a plasmid phT(-0.7m)CAT by inserting a double-stranded oligonucleotide 38
into the KpnI/BstZ17I sites of phT(-0.7)CAT (this introduced BglII, SphI, and XhoI sites).
This plasmid was digested with KpnI, SphI, or StuI to accommodate KpnI-, SphI-, or StuI- digested PCR products, and yielded the plasmids shown in Fig. 3. Plasmid phT(∆Sac)CAT was generated by a deletion of SacI-SacI fragment from the plasmid phT(-4.2-0.8)CAT.
Plasmid phT(-4.2-0.8) served as the template to construct plasmids with mutated AP-1,
NF-κB, and ATF sites using the QuikChange XL Site-directed Mutagenesis kit
(Strategene, La Jolla, CA) according to the manufacturer’s instructions. Plasmids p5xATFCAT, p7xAP-1CAT, and p3xNFκBCAT were generated by cloning corresponding double stranded oligonucleotides into the BamHI site of ptkCAT∆EH (117). The expression plasmid pRSVIκB was a gift from Dr. K. Brand (Munich, Germany).
2.3.7. Transient transfections. Cells were transfected in 12 well clusters using FuGENE6 transfection reagent (Roche, Indianapolis, IN), according to the supplier’s instructions.
Plasmids (400 ng of the reporter CAT plasmid and 100 ng of expression plasmid encoding
β-galactosidase) and 0.6 µl of FuGENE6 diluted into 50 µl of serum free medium were used for each well containing cells growing in 500 µl of culture medium. One day after transfection, the cells were stimulated with cytokines, cultured another 24 h, and harvested.
Protein extracts were prepared by freeze thawing, and the protein concentration was determined by the BCA method (Sigma Chemical Co., St. Louis, MO). Chloramphenicol acetyltransferase (CAT) and β -galactosidase assays were performed as described (51). 39
CAT activities were normalized to β-galactosidase activity and are means + S.E.M. (3-7 determinations).
2.3.8. Downregulation with siRNA. The expression of p65 and ATF-2 was downregulated using SMARTpool siRNA purchased from (Dharmacon, Inc. Lafayette,
CO). SiRNAs were transfected into cells using Dharmafect 1 (Dharmacon, Inc. Lafayette,
CO) according to the manufacturer’s instructions.
2.3.9. Nuclear extract preparation and electromobility shift assays (EMSA). Nuclear extracts were prepared as described (7). All oligonucleotides used for EMSA were designed to contain four bases single-stranded 5’ overhangs at each end after annealing.
Double stranded DNA fragments were labeled by filling in 5’ protruding ends with
Klenow enzyme using [α32P]dCTP (3000 Ci/mmol). EMSA was carried out according to the published procedures (65, 180). Briefly, five µg of nuclear extracts and approx. 10 fmol (10,000 cpm) of probe were used. Polyclonal anti-ATF-1, anti-ATF-2, anti-CREB, anti-c-fos, anti-c-jun, anti-p65, and anti-p50 antisera were purchased from Santa Cruz
Biotechnology, Inc. (Santa Cruz, CA).
2.3.10. Western blotting. Cells were lysed in 10 mM Tris pH 7.4, 150 mM sodium chloride, 1 mM EDTA, 0.5% NP-40, 1% Triton X-100, 1 mM sodium orthovanadate, 0.2 40
mM PMSF and protease inhibitor cocktail (Roche, Mannheim, Germany). Samples were resolved using SDS-PAGE and electroblotted onto nitrocellulose membranes (Schleicher
& Schuell, Keene, NH). Polyclonal anti-ATF-2, anti-p65, and anti-phospho-c-jun antisera were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA) while anti- phospho-p38, anti-phospho-p65(Ser536), anti-phospho-ATF-2, and anti-phospho-MEK3/6 were purchased from Cell Signaling Technology, Inc. (Beverly, MA). Antigen-antibody complexes were visualized by enhanced chemiluminescence according to manufacturer’s instructions (Pierce, Rockford, IL). 41
2.4. RESULTS
2.4.1. Activation of TIMP-1 expression by IL-1 requires ongoing transcription and is mediated by multiple signaling cascades.
IL-1 has previously been shown to upregulate the expression of TIMP-1 in primary human astrocytes, (109, 192). In order to verify these findings, we analyzed TIMP-1 mRNA expression in response to IL-1 using three independent preparations of primary human astrocytes. For comparison, we also treated these cells with OSM, which has previously been shown to upregulate TIMP-1 expression in a number of cell types (22,
196). In agreement with previous observations, we found that IL-1 upregulates expression of TIMP-1 mRNA (2.5-5 fold depending on the batch of astrocytes), whereas OSM was less effective (Fig. 2.1). Activation of TIMP-1 expression by IL-1 was blocked by actinomycin D (Fig. 2.2A), which indicates that ongoing transcription is needed to increase
TIMP-1 mRNA levels. Interestingly, the half life of TIMP-1 mRNA was greater than 18h in both the control and IL-1-treated cells (Fig. 2.1B), indicating that mRNA stability was not enhanced by IL-1. Therefore, the mechanism regulating enhanced transcription of
TIMP-1 in astrocytes could potentially be targeted using pharmacological approaches to ensure sustained upregulation of the inhibitor, which is critical to restrain activity of
MMPs. We examined this mechanism using pharmacological inhibitors that specifically target signaling pathways known to be activated by IL-1 in other cell types. Surprisingly, multiple 42
Fig. 2.1. IL-1 upregulates the expression of TIMP-1 mRNA in human astrocytes.
Human astrocytes were treated with IL-1 or OSM for 18 hours. Subsequently, RNA was isolated and subjected to Northern blot analysis using TIMP-1 cDNA as a probe. The lower panels show 28S RNA stained with ethidium bromide on the membrane. Results of three independent experiments are shown using three different batches of primary human astrocytes.
44
Fig. 2.2. Effect of inhibitors on IL-1-activated expression of TIMP-1 mRNA.
Human astrocytes were pretreated with 5 µg/ml Actinomycin D (A) or 1 µM SP600125, 5
µM BAY11-7082, 10 µM SB202190, 10 µM GF109203X (C) for 1 hour, and subsequently stimulated with IL-1 for 18 hours. (B) Astrocytes were treated with IL-1 for 18 h, and then 5 µg/ml Actinomycin D was added for the indicated time periods. RNA was isolated, and TIMP-1 expression was quantified by real time PCR (using TaqMan technology), normalized to 18S rRNA, and expressed as a ratio to untreated cells. Duplicate experiments were repeated three times.
46
inhibitors blocked the IL-1-mediated activation of the TIMP-1 gene, suggesting that multiple pathways are involved in its regulation (Fig. 2.2C). The effective inhibitors included BAY11-7082 (an inhibitor of IκB kinase (IKK)), GF109203X (an inhibitor of protein kinase C (PKC)), and SB202190 (an inhibitor of p38 kinase), whereas SP600125
(an inhibitor of c-jun N-terminal kinase) was ineffective.
2.4.2. Identification of the IL-1 regulatory elements of the TIMP-1 gene.
Multiple regulatory elements have been described within both the 5’ flanking region and the first intron of the TIMP-1 gene (15, 22, 29, 40, 49, 84). In order to examine if IL-1 responsiveness is mediated by these elements, we generated reporter constructs containing either the 1 kb or 0.7 kb long 5’ flanking region of the TIMP-1 gene fused to a CAT reporter gene. In addition, we also generated a construct containing a 0.7 kb long 5’ flanking region, the first exon (containing the 5’ untranslated region UTR), the entire first intron, and part of the second exon that contains the sequence coding for the first codon of the TIMP-1 protein followed by a CAT reporter gene. Transcription from this construct, followed by splicing, should result in the production of a chimeric mRNA containing the
TIMP-1 5’UTR and the protein coding sequence that encodes the entire CAT protein.
These reporters were not responsive to IL-1 when tested in transfection experiments of astrocytes (Fig. 2.3A); however, all constructs possessed low levels of CAT activity, including the “splicing” construct. This indicates that the chimeric mRNA was properly 47
Fig. 2.3. Identification of the IL-1-responsive elements of the TIMP-1 gene.
(A) The fragment located -4.2 to -0.8 kb upstream of the transcription start site of the
TIMP-1 gene mediates responsiveness to IL-1. Human astrocytes were transfected with reporter plasmids and a β-galactosidase expression vector. One day after transfection, cells were stimulated with IL-1, cultured for another 24 hours, and harvested. CAT activities were normalized to β-galactosidase activities to account for transfection efficiency.
Results are expressed as fold induction relative to the plasmid phT(-0.7)CAT that contains
700 bp long promoter of the TIMP-1 gene indicated by TP. The model of the TIMP-1 gene, including its 5’ flanking region, is also shown (upper part of the panel); black boxes represent exons, restriction sites for SphI (S) and KpnI (K), and transcription start site
(arrow) are indicated. (B) Detailed analysis of the -4.2 to -0.8 kb fragment of the TIMP-1 gene. Human astrocytes were transfected with the indicated reporters and a β-galactosidase expression vector, and processed as described above. A model of the -4.2 to -0.8 kb fragment of the TIMP-1 gene is shown (upper part of the panel); putative binding sites are indicated, restriction sites for SphI (Sp) and SacI (S) are marked. A representative example of 3-6 experiments is shown.
49
transcribed and spliced, while the CAT protein synthesized was expressed in an active form. Since neither the 1 kb long promoter nor the first exon and intron can mediate IL-1 responsiveness, we cloned DNA fragments from the 5’ flanking region of the TIMP-1 gene in front of the 0.7 kb TIMP-1 promoter. This approach enabled the analysis of the cloned
DNA fragments, together with the elements specific for the TIMP-1 promoter, allowing any specific interactions between the IL-1-induced transcription factor(s), and the factors binding to the TIMP-1 promoter. Analysis of these constructs in transient transfections
(Fig. 2.3A) yielded one reporter containing the -4.2 to -0.8 fragment of the TIMP-1 gene that was responsive to IL-1. Therefore, we analyzed the shorter DNA fragments derived from this fragment and found that a 0.8 kb long fragment located at -2.9 to -2.1 still conferred responsiveness to IL-1; however, further truncations led to a decrease or loss of responsiveness (Fig. 2.3B).
2.4.3. Identification of regulatory elements binding IL-1-induced factors.
The entire -4.2 to -0.8 fragment of the TIMP-1 gene, which conferred IL-1 responsiveness, was searched for the presence of putative binding sites for transcription factors using the Mat Inspector program (http://www.genomatix.de). We identified six putative binding sites, including one for AP-1, two for NF-κB, and three for ATF within this fragment (Fig. 2.3B and 2.4A). Three of these elements (-2711 to -2702 NF-κB element, -2174 to -2167 ATF element, and -2767 to -2761 AP-1 element) were located 50
within the 0.8 kb long fragment that conferred minimal IL-1-responsiveness (Fig. 2.3B).
To evaluate the contribution of the six putative binding sites to the overall responsiveness to IL-1, we generated reporter constructs with mutations introduced into each of the putative regulatory sites (Fig. 2.4A). As expected, mutations introduced into the elements located outside of the minimal 0.8 kb long IL-1-responsive element had no effect on the activity of reporters. In contrast, mutations introduced into putative -2711 to -2702 NF-κB and -2174 to -2167 ATF diminished the responsiveness to IL-1, whereas mutation of the
AP-1 element had no effect (Fig. 2.4A). We also fused putative ATF, NF-κB, and AP-1 elements of the TIMP-1 gene to the minimal tk promoter, which is not responsive to IL-1, and examined the activity of these reporters. The NF-κB element conferred IL-1 responsiveness when linked to the tk promoter, while the AP-1 and ATF elements were ineffective (Fig. 2.4B). We also noted that the intrinsic activity of the AP-1 reporter was greatly enhanced (Fig. 2.4B), as observed previously for other AP-1 elements (75, 109).
We conclude that both the NF-κB and ATF elements are needed for the full response of the
TIMP-1 gene to IL-1; however in contrast to the NF-κB element, the ATF element is ineffective by itself.
These findings elucidate that both elements are binding sites for their corresponding transcription factors, which likely bind cooperatively to regulate TIMP-1 gene expression. We tested this prediction by EMSA, and observed that the ATF element was constitutively bound by the ATF-2 homodimer (Fig. 2.5A and 2.5B). In contrast, 51
Fig. 2.4. Identification of functional AP-1, ATF-2, and NF-κB elements within the -4.2 to -0.8 fragment of the TIMP-1 gene.
Point mutations were introduced into the putative NF-κB, AP-1, and ATF elements of the
TIMP-1 gene (A) or multiple binding elements for ATF, AP-1, and NF-κB were cloned in the front of tk promoter (B) as described in the Materials and Methods. Human astrocytes were transfected with the indicated reporter plasmids and a β-galactosidase expression vector, induced with IL-1 for 24 hours, harvested, and processed as described in the legend to Figure 3. Results are expressed as fold induction (A) or are shown in arbitrary units
(untreated cells transfected with vector were set equal to 1) (B).
53
treatment of astrocytes with IL-1 induced the binding of the p65/p50 heterodimers to the
NF-κB element (Fig. 2.5A and 2.5B). The AP-1 element was also constitutively bound (by c-jun) (Fig. 2.5A and 2.5B), but this element did not mediate the IL-1 response, as shown by mutational analysis (Fig. 2.4A).
2.4.4. Critical role of p65 in regulating TIMP-1 gene expression.
The IL-1 induced binding of the p65/p50 heterodimer to the -2711 to -2702 NF-κB element (Fig. 2.5A), and the reduced activity of the reporter lacking this element (Fig.
2.4B) suggest that NF-κB might be the prominent factor regulating TIMP-1 expression. To verify this hypothesis, we used two additional NF-κB activation inhibitors CAY10470 and parthenolide. Both of these inhibitors abrogated the activation of TIMP-1 by IL-1 (Fig.
2.6A). In addition, we blocked the activation of NF-κB by overexpressing the dominant- negative inhibitor of NF-κB (IκBαSR), which is a mutated form of IκBα. IκBαSR is not phosphorylated, ubiqitinated, nor degraded, and thereby effectively sequesters NF-κB (27).
Activation of the reporter by IL-1 was substantially diminished in the presence of IκBαSR
(Fig. 2.6B), leading us to conclude that NF-κB is critical for the IL-1-mediated expression of the TIMP-1 gene. The in vitro binding (Fig. 2.5A and 2.5B) suggests that the p65 subunit of NF-κB may be critical for TIMP-1 regulation by IL-1. Therefore, we downregulated the expression of p65 using siRNA technology, and analyzed the response of the TIMP-1 gene to IL-1. In fact, the basal expression was not affected but the 54
Fig. 2.5. AP-1, ATF-2, and NF-κB bind to the regulatory elements of TIMP-1 gene in human astrocytes.
Nuclear extracts were prepared from control and IL-1 treated astrocytes as indicated. The binding was then analyzed by EMSA using the 32P-labeled oligonucleotide probes derived from the 5’ flanking region of the TIMP-1 gene (A). Specific antibodies or normal rabbit serum (NRS) were added to the reaction (B) and binding was analyzed as in panel A.
56
Fig. 2.6. Activation of p65 is indispensable for the IL-1 response of the TIMP-1 gene.
Human astrocytes were pretreated with 1 µΜ CAY10470 or 5 µM parthenolide for 1 hour, and subsequently stimulated with IL-1 for 18 hours. Expression of TIMP-1 was analyzed as described in the legend to Figure 2 (A). (B) Astrocytes were cotransfected with the reporter plasmid phT(-4.2-08)CAT, a β-galactosidase expression vector, and either a plasmid encoding the dominant-negative IκBα (pSRIκBα) or an empty vector. CAT activities were assessed as described earlier (3 replicates). (C) Astrocytes were transfected with control siRNA or the SMARTpool siRNA to p65 or ATF-2, and cultured for 48 h.
Subsequently, cells were stimulated with IL-1 for 18 h, and TIMP-1 expression was analyzed as described in the legend to Figure 2.2.
58
activation by IL-1 was abrogated by the p65 siRNA (Fig. 2.6C). These results indicate that p65 is an indispensable component of NF-κB, which mediates the response to IL-1. In contrast, the knock-down of ATF-2 expression had a dramatic effect on the TIMP-1 expression in control and IL-1-treated cells, but the fold activation by IL-1 was not affected (Fig. 2.6C). This implies that ATF-2 may regulate the intrinsic expression of
TIMP-1.
2.4.5. TIMP-1 expression is not activated by IL-1 in many gliomas due to the aberrant activation of either NF-κB or ATF-2.
Grade IV malignant gliomas (glioblastoma multiforme) are the most common primary brain tumors, and are characterized by extreme invasiveness, which makes standard treatments (including radiation and chemotherapy) ineffective. Their invasion into healthy brain tissue presumably requires extensive ECM remodeling involving the activation of MMPs. In primary astrocytes, the activity of the MMPs is tightly controlled by TIMPs, including TIMP-1, which is regulated by growth factors and cytokines, such as
IL-1. The invasive phenotype of gliomas prompted us to hypothesize that TIMP-1 may be expressed at lower levels in gliomas, and IL-1 may not be able to enhance its expression.
This would result in the increased activity of glioma-derived MMPs, and in turn would likely enhance the invasiveness of gliomas. In fact, we found that IL-1 did not enhance the expression of TIMP-1 in the established glioma cell lines we examined, including U373, 59
Fig. 2.7. Analysis of IL-1-activated signaling and TIMP-1 expression in human gliomas. (A) U373, U251, T98G, and A172 cells were treated with IL-1 for 18 hours.
Subsequently, RNA was isolated and subjected to Northern blot analysis using TIMP-1 cDNA as a probe. Lower panels show 28S RNA stained with ethidium bromide on the membrane. (B) RNA was isolated from confluent cultures of human astrocytes, U373,
A172, T98G, and U251 cells, and expression of TIMP-1 mRNA was analyzed by real-time
PCR. (C-E) Human astrocytes, U373, A172, T98G, and U251 cells were treated with IL-
1 as indicated. Non-denaturing lysates were prepared, and analyzed by Western blotting with phospho-ATF-2, ATF-2, phospho-c-jun, phospho-p38, and phospho-MEK3/6 antibodies (C), phospho-ATF-2, ATF-2, and phospho-p38 antibodies (D), and phospho- p65 and p65 antibodies (E), and detected by enhanced chemiluminescence.
61
U251, T98G, and A172 cells (Fig. 2.7A). We also found that the intrinsic expression of
TIMP-1 in glioma cell lines was significantly lower than in primary astrocytes (Fig. 2.7B).
Since both ATF-2 and NF-κB regulate TIMP-1 expression in response to IL-1 in astrocytes, we tested whether these transcription factors are also activated in gliomas. We focused on ATF-2, for two reasons. First, NF-κB activation has been well documented in gliomas (66, 83, 111, 176, 198), and second, our prior inhibitor studies indicated that the inhibition of p38 (Fig. 2.2) significantly diminished the IL-1 induction of TIMP-1 in astrocytes. We assayed the activation of both p38 and its putative upstream kinase, mitogen activated protein kinase kinase (MEK)-3/6, in response to IL-1 by western blotting. ATF-2, MEK3/6, and p38 were rapidly phosphorylated following the IL-1 stimulation of astrocytes (Fig. 2.7C), while neither of these proteins was phosphorylated in
U373 glioma cells. This suggests that the IL-1/MEK3/6/p38/ATF-2 pathway is not functional in these cells. Surprisingly, U373 cells contain much higher levels of total ATF-
2 than astrocytes (Fig. 2.7C). The lack of ATF-2 phosphorylation seen in U373 cells in response to IL-1 was specific since c-jun was phosphorylated in both astrocytes and U373 cells (Fig. 2.7C).
Subsequently, we analyzed three additional glioma cell lines, and found that the
MEK3/6/p38/ATF-2 pathway was not functional in A172 cells; however, ATF-2 and p38 were efficiently activated in U251 and T98G cells (Fig. 2.7D). Although ATF-2 was activated in U251 by IL-1, the expression of TIMP-1 was not activated in these cells (Fig. 62
2.7D and 2.7A), suggesting that the other arm of the cooperative IL-1 response was ineffective. Therefore, we examined NF-κB activation by evaluating the phosphorylation of p65 on serine 536, which was shown to regulate the recruitment of p300/CBP to the nuclear pool of p65 (217). In non-stimulated astrocytes, low levels of phosphorylated p65 were found; however, robust phosphorylation was rapidly induced by IL-1 (Fig. 2.7E). In contrast, glioma cells contain substantial amounts of phosphorylated p65, suggesting that
NF-κB may be constitutively activated in these cells (Fig. 2.7E). This is supported because
IL-1 induces only a slight increase in p65 phosphorylation, and hence p65 activity, in gliomas. In agreement with our predictions, U251 cells contained substantially lower levels of p65, much of which was already phosphorylated in control cells and barely activated in response to IL-1. We conclude that: i) TIMP-1 is expressed at lower levels in gliomas than in astrocytes, ii) TIMP-1 expression is not activated by IL-1 in most gliomas studied, iii) both MEK3/6/p38/ATF-2 and IKK/NF-κB are efficiently activated in response to IL-1 in astrocytes, iv) the gliomas studied are characterized by constitutively phosphorylated p65, and v) in gliomas inefficient activation of either ATF-2 or NF-κB correlates with the loss of IL-1 induced TIMP-1 expression. 63
2.5. DISCUSSION
The precise control of the enzymatic activities of MMPs, in part ensured by the equilibrium between MMPs and TIMPs, is necessary to prevent extensive tissue damage; however, a temporary imbalance that favors MMPs over TIMPs is indispensable for the
ECM remodeling that is required during many physiological processes (26, 150). In the
CNS, injury induces extreme acute changes in the expression pattern of both MMPs and
TIMPs, which are necessary to initiate repair processes. These expression profiles are regulated by neuroinflammatory cytokines, including IL-1. In certain pathological states such as cancer, a sustained imbalance between MMPs and TIMPs may lead to the increased migration of cells, which may possibly aid in tumor metastasis. In agreement with this, the migration of glioblastoma cells into healthy brain tissue depends upon increased proteolytic activity, as a prelude to ECM degradation, and subsequent invasion of the tumor cells. Secreted factors control this process, with IL-1 being a likely regulator since it is produced by both resident brain cells and tumor cells. Expression of TIMP-1, which is a highly regulated soluble inhibitor, is critical in both tissue remodeling/repair and invasion (78, 203).
The expression of TIMP-1 has been shown to be transcriptionally regulated by the binding of multiple transcription factors including AP-1, ETS, EGR, STAT, and RUNX to regulatory elements present in the 5’ flanking region of the gene (15, 22, 29, 40, 49, 84).
The binding of these transcription factors is regulated by several stimuli, including 64
cytokines and growth factors such as IL-6, OSM, epidermal growth factor, and transforming growth factor β. Although, IL-1 has been previously reported to activate
TIMP-1 expression in both astrocytes (109, 192) and orbital fibroblasts (85), the mechanism of TIMP-1 gene regulation remained elusive. It has been proposed that the extracellular signal-regulated kinase (ERK) pathway activates TIMP-1 expression in response to IL-1 in orbital fibroblasts, since its activation could be blocked by a MEK inhibitor PD98059 (85). However, both the overexpression of dominant-negative ERK1 and treatment with PD98059 decreased the intrinsic expression of TIMP-1, and they had a limited if any, effect on IL-1 induced TIMP-1 expression (85). To expand upon these observations, we propose that IL-1 activates TIMP-1 expression by at least two pathways that lead to the activation of NF-κB and ATF-2, which bind to newly identified regulatory elements of the TIMP-1 gene. The activation of NF-κB by IL-1 is critical for the induction of TIMP-1 expression, since the presence of the IKK inhibitors (BAY11-7082,
CAY10470, and parthenolide) (Fig. 2.2C and 2,6A) or the dominant-negative IκBαSR
(superrepressor) (Fig. 2.6B) dramatically diminished TIMP-1 induction. Specifically, p65 is the component of the NF-κB that is indispensable for the induction of TIMP-1 expression, since its downregulation abolished upregulation by IL-1 (Fig. 2.6C).
Conversely, the activation of ATF-2 by the MEK3/6-p38 pathway is needed for the intrinsic expression of TIMP-1, and the response to IL-1. These conclusions are supported by the following findings: i) inhibition of p38 by SB202190 significantly reduced both 65
basal expression of TIMP-1, and its activation by IL-1 (Fig. 2.2C), and ii) the knock-down of ATF-2 expression drastically diminished the basal and IL-1-induced levels of TIMP-1.
It is tempting to speculate that the binding of ATF-2, which possesses histone acetyltransferase activity, may induce the acetylation of nearby histones, relaxation of chromatin, and thereby enabling the efficient binding of NF-κB. Surprisingly, a general inhibitor of protein kinase C effectively blocked TIMP-1 activation by IL-1 (Fig. 2.2C).
The experiments we report do not explain this observation, and we can only speculate that
PKC may either be needed to phosphorylate p65 (59) or to activate proteins necessary for the effective NF-κB activation such as sphingosine kinase-1 (209).
The cooperative activation of the TIMP-1 gene by IL-1 in astrocytes via activation of both the IKK/NF-κB and MEK3/6/p38/ATF-2 pathways partially resembles the NF-κB- and p38-dependent mechanism that regulates MMP-1 and MMP-3 expression in synovial fibroblasts (91), and the NF-κB-, C/EBP-, and ATF-2-dependent mechanism of nitric- oxide synthase activation in rat glial cells (17). The mechanism we propose (Fig. 2.8) for the regulation of TIMP-1 in astrocytes likely controls other genes in these cells, and may also function in other cell types.
The newly identified ATF and NF-κB binding elements of the TIMP-1 gene likely bind cooperatively ATF-2 homodimers and p65/p50 heterodimers, which may be needed to form a functional enhanceosome and activate transcription. This is supported by the 66
Fig. 2.8. Model of the activation of the TIMP-1 gene in human astrocytes.
In astrocytes, IL-1 activates the signaling pathways that lead to the phosphorylation of
IKK (which can be blocked by BAY11-7082, CAY10470, and parthenolide) and MEK3/6
(both likely phosphorylated by TAK1). Activated IKK phosphorylates IkBα, which leads to its subsequent ubiqutination and degradation (this can be blocked by expressing dominant-negative IkBα). Liberated p65/p50 complexes translocate to the nucleus, and bind to the TIMP-1 regulatory element at -2.7 kb (knock down of p65 expression abrogates this signaling). Concurrently, activated MEK3/6 phosphorytlates p38 kinase (this can be blocked by SB202190), which in turn phosphorates ATF-2 bound to its TIMP-1 regulatory region at -2.2 kb. Both ATF-2 and p65/p50 complexes are needed for the full activation of the TIMP-1 gene expression in astrocytes.
68
findings that both of these elements are required for the full IL-1-induced transcriptional activity of the TIMP-1 reporter constructs harboring mutated binding elements (Fig. 2.4A).
Furthermore, an array of ATF binding elements was not able to confer IL-1 responsiveness onto the minimal tk promoter, while three copies of the NF-κB element were effective
(Fig. 2.4B). All of these results suggest that single ATF and NF-κB elements represent binding sites which likely cooperate to activate transcription of the TIMP-1 gene. In contrast, mutation of an AP-1 element at -2.7 kb had no effect on IL-1 responsiveness (Fig.
2.4A), but an array of the AP-1 elements dramatically increased the intrinsic activity of the
AP-1-tk reporter (Fig. 2.4B) while having a negligible effect on the IL-1 induced activity.
Both of these results suggest that this element may therefore be important for the intrinsic expression of the endogenous gene by recruiting coactivators necessary for chromatin modification and remodeling, which cannot be properly recapitulated using reporter constructs.
Although IL-1 increases the phosphorylation of c-jun in astrocytes (Fig. 2.7), the
ATF binding element does not bind ATF-2/c-jun heterodimers in vitro (Fig. 2.5B), but selectively binds homodimers of ATF-2. In contrast, c-jun effectively binds the AP-1 element of the TIMP-1 gene (Fig. 2.5). As suggested for other genes (63), the selective binding of the ATF-2 homodimers may represent another level of specificity in the TIMP-
1 gene regulation. 69
IL-1 is continuously produced and regulates normal physiological processes in the brain. Also, the expression of IL-1 is greatly increased after brain injury and during the progression of neurodegenerative diseases, such as Alzheimer’s and Parkinson’s disease
(20, 146). Furthermore, IL-1 is also expressed by glioma cells and in cells surrounding necrotic tumors, such as glioblastoma multiforme (200). Since IL-1 enhances the expression of several MMPs it is tempting to propose that the net proteolytic activity secreted by gliomas is increased, and may be a cause of the extreme invasiveness of these cells. The IL-1-induced expression of TIMP-1 in astrocytes likely provides a delayed mechanism that limits the proteolytic activities of MMPs, which are needed in the initial phase following brain injury. In contrast to astrocytes, expression of TIMP-1 is not enhanced by IL-1 in glioma cells (Fig. 2.7A), suggesting that this “safety mechanism” to limit the proteolytic activities of MMPs, is not functional in gliomas. Moreover, the intrinsic expression of TIMP-1 in gliomas is significantly lower than in astrocytes (Fig.
2.7B). Our data suggest that either the IKK/NF-κB or the MEK3/6/p38/ATF-2 pathway is dysfunctional or deregulated in gliomas (Fig. 2.7 C-E). We also noted that the intrinsic levels of ATF-2 were higher in gliomas than in astrocytes (Fig. 2.7C and 2.7D), but the importance of this observation is unclear since levels of ATF-2 did not correlate with its activation.
It is important to stress that the intrinsic levels of p65 phosphorylated on serine 536 were higher in gliomas than in astrocytes; however, the IL-induced increase in this 70
phosphorylation was much lower in gliomas. These results suggest that NF-κB may be continuously activated in gliomas, which is of fundamental importance. Recently, the link between carcinogenesis and inflammation has become evident (reviewed in (108)), and
NF-κB is proposed to be critical for tumor promotion and progression. Activated NF-κB may therefore provide signals that allow gliomas to evade apoptosis, and increase; angiogenesis, self-sufficiency in growth, insensitivity to growth inhibition, and to gain limitless replicative and invasive potential (55, 108). It remains to be established if the decreased IL-1-induced phosphorylation of p65 on serine 536 correlates with these tumor promoting processes. Furthermore, the precise role of this modification needs to be addressed, since it was recently shown that it defines an IκBα-independent pathway of NF-
κB activation (178), and results in accelerated NF-κB turnover (126).
In summary, we propose a novel mechanism of TIMP-1 activation by IL-1 in human astrocytes, which involves the activation of two signaling pathways; IKK/NF-κB and MEK3/6/p38/ATF-2. Activated NF-κB and ATF-2 bind to novel regulatory elements at -2.7 kb and -2.2 kb, and activate the transcription of TIMP-1. In contrast to astrocytes, this mechanism does not properly function in glioma cell lines due to the defective activation of at least one of these pathways. Lack of enhanced TIMP-1 expression in gliomas may, in part, explain their increased invasiveness.
71
CHAPTER 3
CONSTITUTIVELY ACTIVE STAT3 PROMOTES THE GROWTH OF
OLIGODENDROGLIOMA TUMORS
3.1. ABSTRACT
Recently, inflammatory processes have been implicated in the development and progression of various tumors. Here, we investigated whether inflammation is associated with the growth of oligodendroglioma tumors. We analyzed the expression of major pro- inflammatory cytokines and chemokines, including IL-1, TNFα, IL-6, OSM, IL-8, MCP1,
MIP1α, and MIP1β in the clinical samples of patients suffering from oligodendroglioma
(OD). We found that OSM, IL-6, MCP1, MIP1α, and MIP1β expression levels were significantly higher in the OD samples, when compared to normal cortical brain tissue, thus contributing to the generation of an inflammatory milieu within the tumors. In addition, we investigated if oligodendroglioma and schwannoma cells produced these inflammatory mediators in vitro. Indeed, these cells express the same set of cytokines in vitro upon IL-1 induction. Consistent with the cytokine expression pattern, we found that both STAT3 and NF-κB, are efficiently activated in oligodendroglioma and schwannoma
72
cells upon OSM and IL-1 stimulation, respectively. However, STAT3, but not NF-κB, is highly activated in the OD samples. Moreover, OSM, but not IL-1 promoted cell proliferation in vitro and this effect was mediated through STAT3. Indeed, pharmacological inhibition of STAT3 phosphorylation, a knock-down of STAT3 with shRNA, or dominant negative STAT3 abolished the proliferative effect of OSM. In addition, we analyzed the expression of inflammation-induced alpha-1-anti-chymotrypsin
(ACT), which is STAT3-dependent. Our data indicate that ACT is present at elevated levels in patient samples and is also upregulated by OSM and IL-1 in oligodendroglioma and schwannoma cells. In summary, oligodendroglioma tumors secrete and respond to inflammatory mediators, with OSM being the major cytokine that activates STAT3 to promote the growth of tumor cells, and ACT as a hallmark of on-going neuro- inflammation. 73
3.2. INTRODUCTION
Recently, it was established that inflammation promotes cancer (44). Normal inflammation is a self-limiting process, as it is followed by an anti-inflammatory response leading to the resolution phase and a return to normal homeostasis. However, persistent and excessive action of pro-inflammatory stimuli, and failure to resolve the inflammatory response, can lead to a chronic inflammatory state, which is the main driving force of anaplastic progression (129). In fact, there are many examples of chronic inflammatory diseases that lead to cancer. The strongest evidence comes from colon cancer, which is associated with inflammatory bowel diseases. Furthermore, infection with the virus hepatitis C predisposes patients to liver carcinoma, schistosomiasis increases the risk of bladder and colon cancers, and Helicobacter pylori is a well established carcinogen in gastric cancer (129).
Inflammation is also a primary response of the brain to injury or infection. It has been implicated in multiple neurodegenerative disorders, such as AD, PD, stroke, depression, schizophrenia, epilepsy, MS, and traumatic brain injury (134). A chronic inflammatory state also develops within the necrotic center of glioblastoma, the most malignant glial tumor of the brain (200). Interleukin-1 (IL-1), Interleukin-6 (IL-6), and
Tumor Necrosis Factor α (TNFα) are the most prominent cytokines involved in these brain inflammatory processes. IL-1 and TNFα exert their effects through the activation of NF-
κB, which regulates the expression of genes involved in suppression of tumor cell death, 74
tumor cell cycle progression, and promotion of tumor invasiveness, angiogenesis, and metastasis (76, 204). On the other hand, the IL-6 family of cytokines, including IL-6 and
OSM, activates the JAK-STAT signaling pathway, which predominantly regulates malignant cell proliferation and survival by targeting genes promoting cell cycle progression and suppression of apoptosis (24, 25). IL-6 is a key growth-promoting and anti-apoptotic cytokine, whereas OSM has both pro- and anti- inflammatory actions (194).
OSM is not detected in the normal brain; however, it is expressed in activated microglia, hypertrophic astrocytes and infiltrating leukocytes in the brains of patients with MS and
HAD (37). Increased levels of OSM have also been detected in brain tumors, including astroglioma, glioblastoma multiforme, and pituitary adenoma. Nevertheless, the role of
OSM in the development and progression of other brain tumors has not been described.
Oligodendroglioma (OD) is the third most common glial neoplasm, accounting for
2-5% of all primary brain tumors. According to the current WHO guidelines, it can be classified as a well-differentiated grade II oligodendroglioma, or a grade III anaplastic oligodendroglioma (112). Most oligodendrogliomas manifest in adults in their 40-50s with the vast majority of tumors occurring in the frontal, temporal, parietal, and occipital lobes.
Surgical resection is the mainstay of initial treatment, which is followed by chemotherapy
(113). Significantly, 70% of oligodendrogliomas with a loss of chromosome regions 1p and 19q respond favorably to this treatment, thus increasing the survival rates. The median postoperative survival period for patients with grade II oligodendroglioma ranges from 3- 75
17 years. However, the median survival time ranges from 10 months to 3.9 years for patients with anaplastic oligodendroglioma, receiving surgical and radiotherapy treatments
(201). Nevertheless, every patient diagnosed with oligodendroglioma will eventually die of this disease. Despite progress in the treatment of oligodendrogliomas, molecular markers of these tumors are still not well characterized in contrast to the markers of glioblastomas.
Therefore, defining the molecular differences and similarities between these two, most common glial tumors of the brain is critical.
It is unclear whether inflammation is associated with, and contributes to the development and progression of brain tumors. Thus far, inflammatory cytokines such as
IL-1 and IL-6 were detected in malignant gliomas (166, 200), specifically glioblastoma multiforme. Moreover, signaling pathways activating STAT3 and NF-κB are constitutively active within these tumors (187). Nevertheless, neither inflammatory cytokines nor signaling pathways were shown to play a role in the development and progression of oligodendroglioma tumors. Therefore, we analyzed the expression of several pro- inflammatory cytokines, including IL-1, IL-6, OSM, and TNFα, the activation of STAT3 and NF-κB, and expression of inflammatory markers in both the clinical samples and established cell lines. 76
3.3. MATERIALS AND METHODS
3.3.1. Cell culture. Human oligodendroglioma HOG cells were kindly provided by Dr.
Carmen Sato-Bigbee (Virginia Commonwealth University, Richmond, VA), while human schwannoma T265 cells were obtained from Dr. George H. de Vries (Loyola University
Medical Center, Maywood, IL). Cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum, containing penicillin/streptomycin, sodium pyruvate, and non-essential amino acids in a humidified 5% CO2 incubator at 37
˚C.
3.3.2. Clinical samples. Biopsy samples of human brain tissue from patients with oligodendroglioma tumors were obtained from VCU’s brain tumor bank (Department of
Neurosurgery, Virginia Commonwealth University, Richmond, VA). Normal cortical tissue samples were obtained from a healthy brain region of a patient with OD or epileptic patients. Brain tissue biopsies were snap-frozen and subsequently homogenized in liquid nitrogen for total RNA and protein preparation. The biopsy samples we analyzed represent primary oligodendroglioma tumors, grade II and III, as well as the recurrent tumors. All tested samples expressed significant amounts of the myelin basic protein MBP (data not shown), which is the oligodendrocyte marker, thus confirming the oligodendroglial origin of these tumors.
77
3.3.3. Cytokines and cell stimulation. Cells were stimulated with 10 ng/ml IL-1 (a gift from Immunex Corp., Seattle, WA, USA), 25 ng/ml OSM, or 5 ng/ml TNFα (both from
R&D, Systems, Inc., Minneapolis, MN, USA). One µM dexamethasone (Sigma Chemical
Co., St. Louis, MO, USA) was also added to enhance cytokine action for the analysis of
ACT expression, 100 µM AG490 (Calbiochem, Darmstadt, Germany) was added 1 hour prior to cytokine stimulation.
3.3.4. RNA preparation and quantitative PCR. Homogenized brain tissue, or cultured cells were lysed by Trizol (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions to prepare total RNA. Target gene mRNA levels were measured using
TaqMan technology (Applied Biosystems, Foster City, CA) according to the supplier’s instructions. Briefly, 1 µg of total RNA was reverse-transcribed using the High capacity cDNA archive kit. Subsequently, the cDNAs were diluted 10-fold (for target genes) or
100-fold for GAPDH, and amplified using TaqMan pre-mixed primer-probe sets,
Universal PCR Master Mix, and ABI 7900HT cycler.
3.3.5. Plasmids and transient or stable transfections. Plasmids containing the ACT promoter (pACT-361CAT, pdmACTCAT), and ACT enhancer (p∆5ACTCAT, p(muttriple)ACTCAT) were described previously (115). Cells were transiently transfected in 12 well clusters by FuGENE6 transfection reagent (Roche, Indianapolis, IN) according 78
to the supplier’s instructions. Four hundred ng of the reporter CAT plasmid, and 100 ng of the expression plasmid encoding β-galactosidase were used per well. One day after transfection, cells were stimulated with cytokines, cultured another 24 hours, and harvested. Protein extracts were prepared by freeze thawing, and chloramphenicol acetyltransferase (CAT) and β-galactosidase activities were assayed as described (117). An expression plasmid containing the dominant negative STAT3 (STAT3-DN) (109) was co- transfected with a pcDNA3 plasmid carrying the neomycin resistance gene into HOG cells.
Briefly, 4.5 µg STAT3-DN and 0.5 µg pcDNA3 were incubated with 15 µl FuGENE6, and transfected into a 10 cm dish of 30% confluent HOG cells. The next day, 10% FBS
DMEM containing 1 mg/ml G418 (Hyclone, Logan, UT) was added, and it was replaced every day for 2 consecutive weeks to generate stable HOG/STAT3-DN clones that were later pooled.
3.3.6. Western blotting. Homogenized brain tissue was lysed in 2% SDS, 50 mM Tris pH
7.5, and 1 mM sodium orthovanadate at 90°C. Cultured cells were lysed in 10 mM Tris pH
7.4, 150 mM sodium chloride, 1 mM EDTA, 0.5% NP-40, 1% Triton X-100, 1 mM sodium orthovanadate, and 0.4 mM PMSF. Subsequently, the protein concentration was determined by the BCA method (Sigma Chemical Co., St. Louis, MO), equal amounts were resolved using SDS-PAGE, and electroblotted onto nitrocellulose membrane
(Schleicher & Schuell, Keene, NH). Polyclonal, anti-p65, anti-PARP-1, and anti-β-tubulin 79
antisera were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA), while anti-phospho-p65, and anti-phospho-IkBα were purchased from Cell Signaling
Technology, Inc. (Beverly, MA). Monoclonal anti-phospho-STAT3, anti-STAT3, anti- phospho-STAT1, anti-STAT1, anti-phospho-STAT5, and anti-STAT5 antibodies were a gift from Dr. Andrew Larner (Massey Cancer Center, Virginia Commonwealth University,
Richmond, VA). Polyclonal anti-COX-2 antibody was a gift from Dr. Frank Fang
(Department of Biochemistry, Virginia Commonwealth University, Richmond, VA).
Antigen-antibody complexes were visualized by enhanced chemiluminescence according to the manufacturer’s instructions (Pierce, Rockford, IL). Densitometry analysis was performed as indicated using the NIH Image J software.
3.3.7. Gene knockdown by siRNA. RelA (p65) expression was down-regulated using
SmartPool siRNAs and Dharmafect 1 transfection reagent (both from Dharmacon, Inc.
Lafayette, CO) according to the suggested manufacturer’s protocols. The efficiency of the gene knockdown was assayed by Western blotting 48 hours post-transfection.
3.3.8. Cell proliferation assay. Cells were grown in 24-well plates in 10% FBS DMEM, and then stimulated with cytokines in the presence of 1 µCi/ml [methyl-3H]-thymidine
(Amersham, UK). Twenty four hours later, cells were washed 3 times with PBS, and DNA was precipitated with ice-cold 20% trichloroacetic acid (TCA) solution for 30 min on ice. 80
This was followed by 3 washes with 5% TCA, and solubilization by 70% formic acid for 1 hour at 37 °C. Cell lysates were then analyzed for radioactivity content in a scintillation counter. Independent experiments were repeated at least twice, and data were presented as a percentage of proliferation versus non-treated cells. Alternatively, the WST-1 reagent
(Roche, Indianapolis, IN) was used to measure cell proliferation. Briefly, cells grown in
10% FBS DMEM were treated with cytokines for 24 h. Next, the cells were incubated with
WST-1 for 30 minutes at 37 °C in a humidified 5% CO2 atmosphere. Absorbance of the reaction product was measured at 450 nm with background subtraction at 630 nm. All experimental points were performed in triplicates and independent experiments were repeated at least twice. Statistical analysis was performed by one-way analysis of variance.
Differences were considered statistically significant when p-values were <0.05.
3.3.9. Lentiviral transductions of HOG cells. Lentiviral stock containing the packaged
GFP-labeled non-targeting shRNA expression construct (Invitrogen, Carlsbad, CA) was a gift from Dr. Frank Fang (Department of Biochemistry, VCU). Lentiviral vector containing GFP-labeled STAT3-targeting shRNA was a gift from Dr. Andrew Larner
(VCU Massey Cancer Center, Richmond, VA) and was described previously (92). These shRNA-expressing lentiviral constructs were packaged in 293FT cells according to the supplier’s instructions (Invitrogen, Carlsbad, CA). Subsequently, HOG cells were 81
incubated with the produced lentiviruses for 48 hours, which resulted in 30-50% transduction efficiency, estimated by a visual analysis of cells with GFP fluorescence.
These cells were then expanded, and GFP+ cells were selected by cell sorting (Flow
Cytometry and Imaging Shared Resource Facility, VCU) and used for further experiments. 82
3.4. RESULTS
3.4.1. Pro-inflammatory cytokine genes are highly expressed in the oligodendroglioma tumors.
Inflammatory processes have been implicated in the development and progression of various tumors. These tumors secrete a plethora of cytokines, and are characterized by the activation of cytokine-induced pathways (129). Thus far, neither the expression of inflammatory cytokines nor the activation of corresponding signaling pathways has been investigated in oligodendrogliomas. Therefore, we have analyzed cytokine expression in the samples of patients suffering from these tumors. Since IL-1, TNFα, IL-6, and OSM have been shown to regulate inflammation in the CNS (37, 204), we investigated the expression levels of these cytokine genes in the OD samples, and compared them to normal cortical tissue (Fig. 3.1A). We found that OSM and IL-6 mRNA was expressed at higher levels in most of the OD patients, while IL-1 mRNA was elevated in half of the samples. Our data suggest that OSM and IL-6, which both belong to the same cytokine family, may trigger a local inflammatory response in OD patients. In contrast, the expression of TNFα was not significantly changed in most of the patient samples.
Moreover, chemokines are crucial for the local inflammatory response, as they recruit and activate immune cells. Specifically, IL-8 acts as a chemoattractant and activator of neutrophils (8), MCP1 acts primarily on macrophages (215), and MIP1α and MIP1β have more divergent effects on most immune cells (139). Our results (Fig. 3.1B) 83
Fig. 3.1. Pro-inflammatory cytokine genes are highly expressed in oligodendroglioma tumors. Biopsy samples of oligodendroglioma tumors (OD; ) from 12 different, patients and 3 control samples of healthy brain tissue (normal; •) were homogenized and processed for RNA isolation. Subsequently, expression of cytokines (A) and chemokines (B) was assayed by qPCR, and normalized to GAPDH levels. Data were analyzed in triplicates, and are represented as a fold change in reference to normal cortical tissue. A mean value was calculated for each group, and is represented by the black bars.
85
demonstrate that MCP1 mRNA expression levels were strikingly elevated in most of the
OD patients, whereas MIP1α and MIP1β mRNA were increased in half of the OD samples when compared to the normal cortical tissue. However, IL-8 mRNA amounts were not significantly increased in most OD samples. According to our data, chemokines attracting macrophages, but not neutrophils, are elevated in OD samples, suggesting that macrophages may play a pivotal role over neutrophils in the local inflammation within the oligodendroglioma tumors.
In this study, eight samples were from primary oligodendroglioma grade II and III tumors, whereas four samples represented recurrent oligodendrogliomas. There was no correlation between expression of the pro-inflammatory cytokines/chemokines and the oligodendroglioma grade. We conclude that oligodendroglioma tumors show increased expression of select pro-inflammatory cytokines, mainly OSM, IL-6, MCP1, MIP1α, and
MIP1β, that likely drive a local inflammatory reaction within the tumor, which is independent of the tumor grade.
3.4.2. Oligodendroglioma HOG and schwannoma T265 cells express pro- inflammatory cytokines and chemokines.
The biopsy samples consist of blood and other brain cells, apart from oligodendroglioma cells, thus analyzing the cytokine expression pattern does not specify their actual cells of origin. Therefore, we used an established human oligodendroglioma 86
Fig. 3.2. IL-1 induces the expression of pro-inflammatory cytokines and chemokines in oligodendroglioma and schwannoma cells. Both HOG and T265 cells were stimulated with IL-1 for the indicated times, and RNA was prepared. Subsequently, IL-1,
IL-6, OSM (A, B), MCP1 (C, D), MIP1α and MIP1β (Ε) mRNA levels were assayed by qPCR and normalized to GAPDH. Data were analyzed in triplicates, and are represented as a fold induction in reference to the untreated sample.
88
HOG cell line, and we tested its capability to produce cytokines in response to IL-1, which is a major neuro-inflammatory cytokine. In fact, IL-1 activated the expression of IL-6, and itself (Fig. 3.2A). Interestingly, these cytokine mRNAs peaked at 2-4 hours, which indicates a rapid and time-sensitive induction of response to inflammatory stimuli. For comparison, we analyzed the cytokine expression pattern in T265 cells, which derive from schwannoma tumor localized to peripheral nerve myelin sheaths. Since Schwann cells serve as a functional equivalent of oligodendrocytes in the peripheral nervous system, we anticipated that these cells will also produce similar cytokines as HOG cells. Indeed, T265 cells produced IL-1 and IL-6 upon IL-1 stimulation (Fig. 3.2B). Interestingly, neither HOG nor T265 cells expressed OSM upon IL-1, OSM, or PGE2 stimulation (data not shown).
Subsequently, we analyzed the expression of chemokines in both HOG and T265 cells.
MCP1 was robustly induced in both cell types (Fig. 3.2C-D). However, MIP1α and MIP1β were drastically induced in T265 cells, but not in HOG cells (Fig. 3.2E). Altogether, these data suggest that cytokines detected in the OD samples, such as IL-6, MCP1, and IL-1, but not OSM, may derive from oligodendroglioma cells as they are capable of producing these cytokines in vitro.
3.4.3. ACT and COX-2 as inflammatory markers in OD tumors.
Inflammation induces the expression of a plethora of effector genes, which are known as the inflammatory marker genes. For example, alpha-1-anti-chymotrypsin (ACT) 89
Fig. 3.3. Oligodendroglioma tumors and cells express ACT and COX-2. Expression of
ACT mRNA was analyzed by qPCR, and normalized to GAPDH following RNA isolation.
(A) Biopsy samples of oligodendroglioma tumors (OD; ) from 12 different patients, and
3 control samples of the healthy brain tissue (normal; •) were processed as in Fig. 1. A mean value was calculated for each group, and is represented by the black bars. (B) RNA was prepared from untreated primary human astrocytes (Astr), U373, HOG, and T265 cells. qPCR assays were performed from three independent cultures, and data were analyzed in duplicates. ACT expression level in primary human astrocytes was set to 1.
(C) HOG and T265 cells were stimulated with IL-1 or OSM for 18 h. One µM
Dexamethasone was added to enhance cytokine action. Data are presented as a fold induction in reference to the untreated sample. Experiments were performed three times.
(D) Biopsy samples of OD tumors were homogenized and protein lysates were prepared.
Protein levels of COX-2 and β-tubulin were detected by Western blotting. Patient clinical number is indicated by # (#1226 is the normal cortical tissue).
91
is produced by activated hepatocytes in the liver (31), and by reactive astrocytes in the brain (2), in response to ongoing inflammation. Therefore, we analyzed its expression in the OD samples, and we found high expression levels of ACT mRNA (Fig. 3.3A). In order to specify the cell type expressing ACT in the OD samples, we analyzed the expression of
ACT in the established oligodendroglioma and schwannoma cell lines. These cells were compared to astrocytes and glioblastoma cells, which are known sources of ACT in the normal and pathological brain. Surprisingly, intrinsic ACT expression levels are 100-fold lower in HOG and T265 cells than in astrocytes or glioblastoma U373 cells (Fig. 3.3B).
However, ACT expression was strongly activated by both IL-1 and OSM, resulting in a
200-500 fold increase in HOG and T265 cells (Fig. 3.3C).
Since enhanced COX-2 immunoreactivity has been reported in the OD tumor microenvironment (28), we analyzed the expression of COX-2 in OD samples (#1323,
#1330, #1129, #1173, #1260), which contained high levels of IL-1, IL-6, and OSM (Fig.
3.3D). Indeed, these samples were also characterized by the increased COX-2 levels when compared to normal cortical tissue (#1226); however, COX-2 was not induced in HOG cells by IL-1, OSM, or PGE2 (data not shown). Thus, COX-2 is likely produced by immune cells, (i.e. the macrophages) that are recruited to the site of inflammation.
Collectively, these data suggest that inflammation induces the expression of inflammatory markers, such as ACT and COX-2, within the oligodendroglioma tumors. In 92
Fig. 3.4. NF-κB and STAT3 regulate ACT expression in oligodendroglioma and schwannoma cells. HOG (A) or T265 (B) cells were transfected with either control or p65 siRNA. 48 h post-transfection, cells were stimulated with IL-1 for 18 h in the presence of 1
µM Dexamethasone. RNA was extracted and reverse-transcribed. ACT mRNA was quantified by qPCR and normalized to endogenous GAPDH mRNA. Experiments were repeated three times in duplicates. (C) The efficiency of p65 down-regulation was assessed by Western blotting 48 h post-transfection, and β-tubulin was used as a loading control.
(D) T265 cells were transfected with ACT promoter, ACT enhancer reporters, and a β- galactosidase expression vector. 24h after transfection, cells were stimulated with IL-1 or
OSM, cultured for another 24 h, and harvested. CAT activities were normalized to β- galactosidase activities to account for transfection efficiency. Results are expressed as fold induction relative to the untreated sample for each plasmid. The experiments were repeated three times. The model of the ACT gene, including its 5’ flanking region, is also shown in the upper part of the panel; black boxes represent exons, transcription factors binding sites are indicated; the –13 kb enhancer (ENH) and promoter (PROM) are depicted by grey boxes.
94
addition, these data also demonstrate that brain cells, other than of astrocytic origin, can express ACT, which is further increased by cytokine stimulation.
3.4.4. NF-κB and STAT3 regulate ACT expression in oligodendroglioma HOG and schwannoma T265 cells.
In the brain, ACT expression is increased by inflammatory cytokines in astrocytes and glioblastoma cells (116, 117). This induction of ACT expression is mediated by the activation of NF-κB and STAT3; however, the mechanisms regulating the ACT expression in oligodendroglioma and schwannoma cells are not known. Therefore, we down-regulated the p65 subunit of NF-κB in these cells, and examined the ACT gene activation by IL-1 stimulation (Fig. 3.4A-B). In fact, IL-1 could no longer stimulate ACT gene expression in cells depleted of p65 (Fig. 3.4B-C). The ACT gene contains two STAT3 binding sites within its promoter, and two NF-κB binding sites within the -13 kb enhancer, which in primary human astrocytes mediate ACT activation in response to OSM and IL-1, respectively (116, 117). In order to verify that these regulatory elements function in oligodendroglioma/schwannoma cells, we used several ACT reporters in transient transfection experiments of T265 cells, as HOG cells are very difficult to transfect. Thus, we transiently transfected reporters containing either the ACT promoter, or the ACT enhancer and promoter, and analyzed the reporter activity after OSM and IL-1 stimulation
(Fig. 3.4D). Indeed, OSM strongly activated these reporters, and this activation was 95
abolished when the two STAT3 binding sites were mutated. In contrast, IL-1 only activated the reporter containing the ACT enhancer, and this activation depended on the two NF-κB binding sites. Altogether, these results provide strong evidence that ACT expression is regulated by NF-κB and STAT3 in oligodendroglioma and schwannoma cells upon IL-1 and OSM stimulation, which parallels its regulation in primary human astrocytes and glioblastoma cells.
3.4.5. Constitutive activation of STAT3 in oligodendroglioma.
The presence of inflammatory cytokines in OD samples suggests that corresponding inflammatory signaling pathways may be activated. Cytokines of the IL-6 family, including IL-6 and OSM, activate the JAK-STAT pathway, which is constitutively active in multiple cancers, with STAT3 being a well-known oncogene (93). Therefore, we assessed the phosphorylation of STAT3 (Fig. 3.5A) in the OD samples expressing high levels of OSM, IL-6, and IL-1. In all of these samples we detected significantly higher levels of phosphorylation of STAT3 on Tyr705, a modification, which is necessary for
STAT3 dimerization and nuclear translocation. However, control samples (n=3, only
#1226 shown in Fig. 3.5A) had only a background phosphorylation level of STAT3. The densitometric analysis indicated that the levels of phosphorylated STAT3 (Tyr 705) were
64-1000 fold higher in the OD samples than in normal brain. In addition, OSM induced robust phosphorylation of STAT3 on Tyr705 of HOG and T265 cells (Fig. 3.5B). 96
Fig. 3.5. STAT3 is activated in oligodendroglioma. Biopsy samples of OD tumors were homogenized and denaturing protein lysates were prepared (A, C, E). Patient clinical number is indicated by # (#1226 is the normal brain cortical tissue). Densitometry analysis indicated an increase (64-1000 fold) in phospho-STAT3 in OD samples relatively to normal brain. (B, D, F) HOG and T265 cells were stimulated with OSM for 30 min or with
IL-1 for the indicated times, cell lysates prepared, and protein levels of phospho-STAT3,
STAT3, phospho-STAT1, STAT1, STAT5, phospho-p65, p65, phospho-IκBα, and β- tubulin were detected by Western blotting. Experiments were repeated in duplicates.
98
On the contrary, phosphorylation of STAT3 on Ser727 was not increased in OD samples, nor induced by OSM in HOG cells (data not shown). Interestingly enough, neither the phosphorylation of STAT1 on Tyr701 nor STAT5 on Tyr694 (Fig. 3.5C and data not shown) were substantially different between normal and OD samples. In vitro, STAT1 was phosphorylated on Tyr701 by OSM in HOG cells (Fig. 3.5D); however, STAT5 was not affected.
The activation of NF-κB was assessed in the OD samples characterized by high expression levels of IL-1 (Fig. 3.5E). We analyzed phosphorylation of p65 in these samples, but no correlation was found. In contrast, in vitro stimulation of HOG and T265 cells by IL-1 (Fig. 3.5F) resulted in robust phosphorylation of IκBα and p65 on Ser536.
These findings indicate that both STAT3 and NF-κB are efficiently activated in oligodendroglioma and schwannoma cell lines, upon OSM and IL-1 stimulation, respectively. Moreover, STAT3 is activated in oligodendroglioma tumors, which strongly supports the importance of the JAK-STAT pathway in these tumors.
3.4.6. Effect of pro-inflammatory cytokines on proliferation and apoptosis of oligodendroglioma HOG cells.
Inflammatory milieu within a tumor may be generated by both the tumor cells themselves, surrounding activated normal cells, and extravasating immune cells (129).
Since oligodendroglioma tumor cells secrete or respond to cytokines, including IL-1, 99
Fig. 3.6. Pro-inflammatory cytokines affect proliferation and apoptosis of oligodendroglioma cells. (A) HOG cells were stimulated with IL-1, OSM, IL-6, or TNFα as indicated. After 24 h [methyl-3H]-Thymidine incorporation proliferation assay was performed as described in the M&M section. Experiments were performed twice, with experimental points repeated 3-4 times. Data are represented as a percentage of proliferation in reference to the untreated cells. Error bars are standard deviations and p<0.01 (B) HOG cells were stimulated with IL-1 or TNFα for 8 or 24 h as indicated. Cell lysates were prepared, and PARP-1 and β-tubulin were detected by Western blotting.
101
OSM, IL-6, and TNFα, we assessed whether these cytokines affect oligodendroglioma tumor growth. We found that OSM increased the proliferation of HOG cells by 50-60 % within 24 hours (Fig. 3.6A). IL-6 also had a moderate proliferative effect of 20%, whereas neither IL-1 nor TNFα were effective. Moreover, we measured PARP-1 cleavage after IL-
1 and TNFα stimulation, which is an indicator of ongoing apoptosis (Fig. 3.6B). TNFα induced partial PARP-1 cleavage, while IL-1 had no effect. We conclude that OSM and
IL-6 promote oligodendroglioma cell proliferation, whereas TNFα may be deleterious, as it induces the apoptosis of oligodendroglioma cells.
3.4.7. Activated STAT3 enhances the proliferation of HOG cells.
Constitutively activated STAT3 is present in multiple cancers, and contributes to their progression through stimulating the proliferation of tumor cells, and suppressing the anti-tumor immune response (212). Since OSM and IL-6 stimulate the proliferation of oligodendroglioma cells, we tested whether this effect is mediated through STAT3. We used AG490, a Jak2 inhibitor previously shown to inhibit STAT3 phosphorylation (166).
Indeed, OSM could no longer increase proliferation of HOG cells in the presence of the inhibitor (Fig. 3.7A). To verify these data, we knocked-down the STAT3 expression with an shRNA-expressing lentiviral vector (Fig. 3.7D). Significantly, expression of shRNA to
STAT3, but not control shRNA, abolished the proliferative effect of OSM in HOG cells
(Fig. 3.7C). To further confirm these data, we generated HOG cells expressing a dominant- 102
Fig. 3.7. OSM-activated STAT3 regulates the proliferation of HOG cells. (A) HOG cells were pretreated with AG490 for 1 h as indicated, and then stimulated with OSM for
24 h. (B) HOG cells were infected with lentiviral vectors encoding either a non-targeting control (shCON), or targeting STAT3 (shStat3) shRNA and GFP. The homogenous populations of GFP+ cells were then isolated by cell sorting. HOG cells expressing dominant negative STAT3 (STAT3-DN) were a population of pooled clones. Cells were stimulated with OSM for 24 h, and their proliferation was measured using [methyl-3H]-
Thymidine as described in the M&M section. Experiments were performed twice, with experimental points repeated 3-4 times. Data are represented as a percentage of proliferation in reference to the untreated cells. Error bars represent the standard deviation and p<0.01. (C) HOG cells were stimulated with OSM for 18 h, RNA was isolated, and
Myc expression was analyzed by qPCR in triplicates. Results were normalized to GAPDH, and are represented as a fold induction to the untreated cells; error bars indicate standard deviation. (D) Cell lysates were prepared from stable HOG clones described in (B), and analyzed for protein levels of STAT3 and β-tubulin by Western blotting.
104
negative STAT3 (STAT3-DN). These cells also do not increase their proliferation in response to OSM. Since STAT3 is known to affect proliferation via activation of several growth promoting genes, including Myc, we analyzed Myc expression after OSM stimulation. Significantly, Myc mRNA levels increased 2-fold after OSM stimulation, whereas IL-1 had no effect (Fig. 3.7B). These data demonstrate that STAT3 mediates the stimulatory effect of OSM on the proliferation of oligodendroglioma cells. These data are also consistent with the increased STAT3 phosphorylation in OD samples (Fig. 3.5A). 105
3.5. DISCUSSION
Development and progression of cancer depends on cellular transformation, deregulation of apoptosis, and uncontrollable cell proliferation, accompanied by angiogenesis, invasion, and metastasis. Recent studies have suggested that chronic inflammation contributes to tumor initiation, promotion, and progression (44, 129). Indeed, chronic inflammation leads to the generation of a tumor-supporting microenvironment, which is rich in inflammatory cells, cytokines, growth and survival factors, and facilitates genomic instability, as well as promotes angiogenesis. Furthermore, mediators produced by inflammatory cells regulate the growth of both neoplastic and normal cells, including fibroblasts, and endothelial cells. Later during tumor progression, neoplastic cells divert inflammatory mechanisms to favor their growth and development, and subvert anti-tumor immune cell functions. However, only recently, inflammation has been associated with pathological processes of the brain (94, 134, 204). Thus far, inflammatory cytokines, such as IL-1 and IL-6, have been detected in malignant glioma tissue and activated microglia.
Moreover, tumor-associated macrophages (TAMs) were found in the brain tumor microenvironment.
Here we report that inflammatory mediators, including IL-1, IL-6, OSM, MCP-1, and MIP1α/β, but not TNFα or IL-8, are present within human oligodendroglioma tumors.
High expression levels of these mediators indicate a local inflammatory response, with a prevalence of cytokines of the IL-6 family, as well as macrophage/microglia activating 106
chemokines. MCP-1 is known to recruit and activate macrophages (215), and in fact, the presence of both macrophages and microglia have been reported previously within oligodedroglioma tumors (50). In addition, various immune cells may be recruited and activated by MIP-1α/β (142), which is upregulated in over half of the OD samples.
However, expression of IL-8, which recruits and activates neutrophils (8), was not elevated in OD samples. Thus, we conclude that macrophages and microglia play a major role in ongoing inflammation within the OD tumors. Interestingly, these immune cells are not the only source of pro-inflammatory cytokines within the OD tumors. Human oligodendroglioma cells also produce IL-1, IL-6, and MCP-1 upon the action of IL-1 (Fig.
3.2A-C). In contrast, cells of monocyte origin, including macrophages and microglia, are likely the source of OSM within OD tumors, as HOG cells do not express OSM upon activation by its known stimuli. According to the published data, microglia and macrophages in the OD tumors may secrete OSM in response to PGE2 (168), which is the product of COX-2. In fact, COX-2 expression is induced by IL-1 and TNFα (45), and is also abundant in the OD tumors (Fig.3.3).
Our data suggest that cytokines of the IL-6 family, in particular OSM and IL-6, play a critical role in the etiology of OD tumors. Increased levels of OSM have also been found in other brain tumors, but its role is ambiguous since it can exert both growth promoting and inhibitory effects (37). For example, OSM inhibits the growth of human glioma cells in vitro, and tumor formation in vivo. On the other hand, it stimulates the 107
expression of VEGF, and hence it is pro-angiogenic and promotes glioma progression. We demonstrate that OSM is expressed at high levels in OD samples (Fig. 3.1A), and increases the proliferation of human oligodendroglioma cells (Fig. 3.6A). In addition to OSM, IL-6 mRNA was also present in OD samples (Fig. 3.1A), suggesting an important role for this cytokine. As reported previously, IL-6 is pivotal in several cancers (93), including Kaposi sarcoma, multiple myeloma, and Hodgkin lymphoma. It is correlated with a poor prognosis as it directly enhances proliferation of tumor cells, which is consistent with moderate stimulatory effect of IL-6 on the proliferation of human oligodendroglioma cells (Fig.
3.6A). Therefore, we postulate that OSM and IL-6 stimulate the proliferation of oligodendroglioma cells, and promote growth of tumors in vivo.
IL-6 and OSM signal via receptor complexes that cause the recruitment and subsequent phosphorylation of STAT3, which leads to its dimerization, nuclear translocation, and ultimately the activation of target genes (128). Furthermore, STAT3 is constitutively activated in a variety of cancers, including glioblastoma, leukemia, lymphoma, breast, lung, and prostate (93). Activated STAT3 is present in both tumor cells and immune cells, and it enhances tumor cell proliferation, inhibits the expression of mediators necessary for anti-tumor immunity, and thus leads to tumor-induced immuno- suppression (212). Similarly, we found that STAT3 is constitutively phosphorylated in OD samples (Fig. 3.3A). As previously reported in other cancers (93), STAT3 regulates genes promoting proliferation and survival, such as Myc, cyclin D, BCL-XL, survivin, and MCL- 108
1. It also promotes angiogenesis and invasiveness by increasing the expression of VEGF,
HIF-1, and MMPs. In addition, immunosuppressive effects of STAT3, which lead to diminished cytotoxicity of neutrophils and NK cells, reduced antigen presentation by
APCs, decreased T-cell activation, and tumor infiltration, is critical for tumor progression.
Thus, similar to other cancers, STAT3 likely promotes oligodendroglioma growth, inhibits apoptosis, and suppresses the anti-tumor immune response.
In GBMs, persistent activation of STAT3 is mediated by autocrine IL-6 signaling, or by activated EGFR (166), which is often mutated or amplified. In contrast, EGFR is not commonly affected in oligodendrogliomas. Therefore, activation of STAT3 in oligodendroglioma may result from enhanced OSM, and/or IL-6 signaling in these tumors.
Hence, STAT3 activated by OSM and IL-6 is likely crucial for the progression of OD tumors.
Moreover, OD samples contain moderate amounts of IL-1. As a matter of fact, IL-1 is the major neuro-inflammatory cytokine during inflammation and is abundantly produced, thus stimulating both the growth and invasiveness of malignant cells. In addition, polymorphisms in the promoters of genes encoding IL-1β and IL-1RA have been associated with an increased risk of cancer (174). Despite its well established role in other tumors (6), IL-1 is elevated only in half of the OD samples (Fig. 3.1A). Although it does not affect the proliferation of oligodendroglioma cells (Fig. 3.6A), it stimulates its own production as well as other inflammatory cytokines (Fig. 3.2), and activates NF-κB in 109
these cells. Both, IL-1 and TNFα activate the classical IKK/NF-κB pathway in many cell types, which promotes cell proliferation and survival (76). However, the phosphorylation status of RelA was not affected in OD samples (Fig. 3.5E) despite an efficient IL-induced phosphorylation of RelA (Fig. 3.5F), and activation of NF-κB-responsive genes (Fig.
3.2A-B) in oligodendroglioma and shwannoma cells in vitro. This apparent discrepancy may be explained by limitations of the in vitro model, which mimics an acute inflammatory response of the tumor cells, while a chronic inflammatory state develops in vivo. Furthermore, neither IL-1 nor TNFα affected the proliferation of HOG cells, and
TNFα caused their apoptosis as indicated by the PARP-1 cleavage (Fig. 3.6). We conclude that the oligodendroglioma tumors depend on OSM/IL-6-activated STAT3 pathway, while they are independent of IL-1/TNFα-induced NF-κB signaling.
During a resolution phase of inflammation (191), homeostasis is restored via the secretion of acute phase proteins, such as ACT (114). Therefore, ACT is a good marker of inflammation (1), which is activated by many cytokines, including IL-1 and OSM in astrocytes (116, 117). Interestingly, ACT expression was noticeably higher in most of the
OD samples (Fig. 3.3A), which is most likely caused by the activated STAT3, as the ACT gene is STAT3-dependent (Fig. 3.4D). Although, the IKK/NF-κB pathway was not activated in OD samples, ACT was upregulated by IL-1-induced NF-κB in oligodendroglioma and shwannoma cells (Fig. 3.4). Thus ACT regulation in oligodendroglioma and shwannoma cells parallels that in human astrocytes and 110
glioblastoma cells. It is noteworthy that the basal ACT level is extremely low in oligodendroglioma and shwannoma cells (Fig. 3.3B); however, it is drastically increased by either IL-1 or OSM (Fig. 3.3C). Therefore, astrocytes and glioma cells are not the sole source of ACT in the nervous system, as ACT is also produced by oligodendroglioma and schwannoma cells. In support of our findings, ACT has been detected in oligodendrogliomas and schwannomas by immunocytochemistry (120, 154). Collectively,
ACT is an important component of the inflammatory network associated with the tumor microenvironment, and its role may be to protect from apoptosis and enable spreading of the tumor cells, all of which should be addressed in brain tumors.
In summary, we propose a model of interdependent cytokine communication between the cells within the oligodendroglioma tumor milieu (Fig. 3.8). The pro-inflammatory cytokines, such as IL-1, IL-6, OSM, MCP-1 as well as markers of ongoing inflammation, such as ACT and COX-2, are expressed in these tumors. MCP1, secreted by the tumor cells, recruits and activates macrophages and microglia to the tumor site. Subsequently, IL-
1 induces the expression of COX-2 in endothelial and microglial cells, which leads to the production of PGE2 in these cells. PGE2 induces the expression of OSM in microglia and macrophages, which in turn activates STAT3 in the oligodendroglioma cells, and thus stimulates their proliferation. Simultaneously, STAT3 is activated in other immune cells, and leads to the suppression of the anti-tumor response. These data strengthen the position of STAT3 as a common target for future glioblastoma and oligodendroglioma therapies. 111
Fig. 3.8. Proposed model of inflammation within an oligodendroglioma tumor. Pro- inflammatory cytokines, such as IL-1, IL-6, and MCP-1 as well as markers of inflammation, including ACT and COX-2, are present within the oligodendroglioma tumor milieu. Chemokines secreted by the tumor cells recruit immune cells, including macrophages, lymphocytes, and microglia, which are subsequently activated by tumor- derived cytokines. IL-1 induces the expression of COX-2 in endothelial and microglial cells, leading to the production of PGE2 in these cells. PGE2 acts on microglia and macrophages to induce the expression of OSM, which in turn activates STAT3 in the oligodendroglioma cells, and thus stimulates their proliferation. 112
113
CHAPTER 4
NUCLEAR FACTOR I REGULATES GENE EXPRESSION DURING
ASTROCYTE DIFFERENTIATION
4.1. ABSTRACT
The mechanisms controlling gene expression during the differentiation of astrocytes are poorly understood, even though astrocytes are critical for the development and progression of many pathological states of the brain, including neuroinflammation associated with neurodegenerative diseases. The published data suggest that several signaling pathways are critical for astrocyte differentiation, including the JAK-STAT,
BMP-2/Smads, and Notch signaling. More recently, emerging evidence suggested that a family of Nuclear Factor-1 (NFI-A, NFI-B, NFI-C, NFI-X) regulates the development of vertebral neocortex, with NFI-A and NFI-B specifically controlling the onset of gliogenesis. Here, we developed and characterized an in vitro model of differentiation of stem cells towards neural progenitors and subsequently astrocytes. The transition from stem cells to progenitors was accompanied by a proper change in the expression profile of differentiation markers, including Sox-2, Musashi-1, and Oct4. Furthermore, the generated
114
astrocytes were characterized by proper morphology, increased glutamate uptake, and expression of marker genes. We used this in vitro differentiation model to study NFI role in stem cell maturation. Interestingly, embryonic stem cells expressed only background levels of NFIs, while differentiation to neural progenitors was accompanied by upregulation of NFI-A expression. More importantly, NFI-X expression was induced during the final stages of differentiation towards astrocytes. In addition, NFI-C and NFI-X, but not NFI-A or NFI-B were required for the expression of GFAP and SPARCL1, which are the markers of terminally differentiated astrocytes. We conclude that an expression program of NFIs is executed during the differentiation of astrocytes, with NFI-C and NFI-
X controlling expression of terminal astrocytic markers. 115
2. INTRODUCTION
Astrocytes are critical for the development of many pathological states in the brain (19,
123, 147, 208), including neuroinflammation associated with neurodegenerative diseases and progression of brain tumors. Furthermore, a loss of astrocyte-specific markers is the hallmark of gliomas (71), suggesting that they represent cells that have escaped differentiation at different stages. Despite the crucial role of astrocytes in the brain, the mechanisms controlling astrocyte-specific gene expression and differentiation are only partially understood.
The data accumulated over the years suggest that several signaling pathways are indispensable for astrocyte differentiation and expression of astrocyte-specific markers.
These include the JAK-STAT and the BMP-2-Smads pathways, the activation of Notch signaling, and the expression of Nuclear Factor-1 (NFI) family of transcription factors (82,
143, 179). During vertebrate embryonic development, gliogenesis follows neurogenesis, and is likely triggered by the activation of the JAK-STAT signaling pathway in neural precursors by neuron-derived cardiotrophin-1 (12). Specifically, STAT3 is believed to be critical for the generation of astrocytes (87), and its effect is synergistic with bone morphogenic protein-2 (BMP-2), which activates Smad1 (158). Smad1 then forms a complex with STAT3, which is bridged by the coactivator p300, and this results in synergistic induction of astrogliogenesis (152). In addition to JAK-STAT and BMP-
Smad1 pathways, Notch signaling also affects gliogenesis by activating the transcriptional 116
activity of RBP-Jκ (77). RBP-Jκ can promote gliogenesis only when the JAK-STAT pathway is active (68). When the JAK-STAT pathway is not activated, RBP-Jκ binds to a repressive cofactor protein, NCoR, which represses gliogenic genes (90). Recently, it became apparent that the NFI family of transcription factors also regulates gliogenesis; however, their role in this process, and the subsequent expression of astrocyte-specific genes, is not known.
The phylogenetically conserved NFI family of proteins regulates the expression of various cellular and viral proteins, as well as viral DNA replication (79). These transcription factors are encoded by four, highly conserved genes: Nfia, Nfib, Nfic, and
Nfix (165). In vertebrates, products of these genes (NFI-A, NFI-B, NFI-C, and NFI-X) share a conserved N-terminal sequence, containing both DNA binding and dimerization domains (157). However, significant variations occur within the C-terminal transactivation domains of the NFI proteins (79). In addition, transcripts of all four genes can be alternatively spliced, yielding as many as nine different proteins from a single gene
(80).
In mammals, the NFI genes are expressed in complex, overlapping patterns during embryogenesis (34), with particularly high levels of expression of NFI-A, NFI-B, and NFI-
X in the developing neocortex (163). Binding sites for NFI proteins are present in genes expressed in multiple tissues, but also in genes expressed solely in the brain, muscle, liver, or specific cell types (79). More recently, Nfia, Nfib, Nfic, and Nfix genes have been 117
successfully disrupted in mice. Disruption of either the Nfia (47, 184) or Nfib (189) gene causes late gestation neuroanatomical defects, including agenesis of the corpus callosum, size reduction in other forebrain commissures, loss of specific midline glial populations, and a 5-10 fold decrease in the levels of glial fibrillary acidic protein (GFAP), a specific marker of astrocytes. In addition, Nfib-deficient mice show aberrant hippocampus and pons formation, and defects in lung development. In contrast, disruption of the Nfic gene results in early postnatal defects in tooth formation, including the loss of molar roots and aberrant incisor development (188). Loss of the Nfix gene is postnatally lethal, and leads to hydrocephalus and agenesis of the corpus callosum. Furthermore, NFI-X-deficient mice develop a deformation of the spine with kyphosis, due to a delay in ossification of vertebral bodies and a progressive degeneration of intervertebral disks (58). Collectively, these data suggest that NFI-A, NFI-B, and NFI-X isoforms play an important role in brain development. In fact, it has been recently demonstrated that both NFI-A and NFI-B affect gliogenesis in the chick embryo (53). Moreover, NFI-A is also necessary for the maintenance of neural precursors. Interestingly, NFI-A expression precedes NFI-B expression in the developing chick embryo, suggesting a sequential expression of NFI isoforms, with NFI-A expressed in early stages, followed by NFI-B, and then NFI-C and
NFI-X. Altogether, these data indicate that NFI-A and NFI-B may be critical in the initial stages of gliogenesis, while the functions of NFI-C and NFI-X are not known. Therefore, 118
we initiated this study to clarify the role of the NFI isoforms in astrogliogenesis using an in vitro differentiation model.
Here, we find that NFI-C and NFI-X are expressed later during the astrocyte differentiation process, and are required for the expression of astrocyte markers, including
GFAP and SPARCL1. We also demonstrate that human embryonic stem cells and derived neural progenitors are an excellent in vitro model to study the mechanisms of astrocyte differentiation. 119
4.3. MATERIALS AMD METHODS
4.3.1. Human embryonic stem cell culture. Human BG01VV embryonic stem cell line was cultured on mitomycin C-inactivated mouse embryonic fibroblasts (MEF) layer. Cells were cultured in DMEM/F12 medium, supplemented with 20% knockout serum replacement (KSR) (Gibco, Grand Island, NY), 1 mM L-glutamine, 0.1 mM nonessential amino acids, 50 U/ml penicilin, 50 µg/ml streptomycin, 4 ng/ml basic fibroblast growth factor (bFGF) (PeproTech, Rocky Hill, NJ), and 0.1 mM β-mercaptoethanol. Cells were propagated in 4 day cycles, and enzymatically passaged with collagenase and trypsin.
4.3.2. Human primary astrocytes culture. Human cortical astrocyte cultures were established using dissociated human cerebral tissue as previously described (117). Cortical tissue was provided by Advanced Bioscience Resources (Alameda, CA), and the protocol for obtaining postmortem fetal neural tissue complied with the federal guidelines for fetal research and with the Uniformed Anatomical Gift Act. Cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum, penicillin and streptomycin, sodium pyruvate, and non-essential amino acids.
4.3.3. Generation of neural progenitors. In order to generate neural progenitors,
BG01VV cells were allowed to proliferate for 7 days as described previously (183).
Briefly, cells were grown in DMEM/F12, supplemented with 15% defined FBS (Hyclone, 120
Logan, UT) and 5% KSR, 2 mM L-glutamine, 0.1 mM nonessential amino acids, 50 U/ml penicilin, 50 µg/ml streptomycin, 4 ng/ml bFGF, and 10 ng/ml leukemia inhibitory factor
(LIF) (Chemicon, Temecula, CA). Subsequently, cells were grown for an additional 7 days in differentiation medium composed of DMEM/F12, N2 supplement (Gibco, Grand Island,
NY), 2 mM L-glutamine, 50 U/ml penicilin, 50 µg/ml streptomycin, and 4 ng/ml bFGF.
Following this stage, the MEF layer was removed and cells were dissociated by DPBS without calcium and magnesium, followed by collagenase and trypsin incubation. Cells were then plated on laminin and poly-L-ornithin coated dishes, propagated in NB27 medium consisting of neurobasal medium, B27 supplement (both from Gibco, Grand
Island, NY), 2 mM L-glutamine, 50 U/ml penicilin, 50 µg/ml streptomycin, 20 ng/ml bFGF, and 10 ng/ml LIF. Cells were maintained by passaging using trypsin.
4.3.4. Differentiation into astrocytes and oligodendrocytes. To generate astrocytes, neural progenitors were cultured on laminin and poly-L-ornithin coated dishes in DMEM, supplemented with 10% FBS, 2 mM L-glutamine, 50 U/ml penicilin, 50 µg/ml streptomycin, and nonessential amino acids for 21 days. To generate oligodendrocytes, neural progenitors were grown on laminin and poly-L-ornithin coated dishes in NB27 medium for 14 days, which was followed by culture in the same medium with the addition of 5 ng/ml PDGF (Peprotech, Rocky Hill, NJ) and 50 µM 3,3’,5-Triiodo-L-thyronine
(Sigma, Saint Louis, MO) for 6 days. 121
4.3.5. Down-regulation of target genes. Expression of NFI-A, -B, -C, -X genes was down-regulated using SmartPool siRNAs from Dharmacon (Dharmacon, Int., Lafayette,
CO). siRNAs were transfected into neural progenitor cells on day 15 of differentiation, by using Dharmafect 1 reagent (Dharmacon, Inc., Lafayette, CO), according to the manufacturer’s instructions. Subsequently, efficiency of target gene downregulation was assayed by quantitative PCR 6 days post-transfection.
4.3.6. RNA isolation and Quantitative PCR. Total cellular RNA was prepared by Trizol
(Invitrogen, Carlsbad, CA), following the manufacturer’s protocol. Subsequently, one µg of total RNA was reverse-transcribed using the High Capacity cDNA Archive kit (Applied
Biosystems, Foster City, CA). GFAP, CD44, GLAST, SPARCL, S100B, BFABP, nestin, vimentin, NFI-A, -B, -C, -X, and GAPDH mRNA levels were measured using pre-mixed primer-probe sets, and TaqMan Universal PCR Master Mix according to the supplier’s instructions (Applied Biosystems, Foster City, CA). The cDNAs were diluted 10-fold (for the target genes) or 100-fold (for GAPDH), and amplified using the ABI 7900HT cycler.
Gene expression levels were normalized to GAPDH mRNA levels and presented as fold induction with mean values +/- standard deviation. Statistical analysis was performed by one-way analysis of variance. Differences were considered statistically significant when p- values were <0.05.
122
4.3.7. Immunocytochemistry. For immunocytochemical staining, neural progenitor cells were differentiated in 4-well chamber slides (Nunc, Rochester, NY). After 21 days in culture, cells were washed with PBS, fixed with 3% formaldehyde for 15 min at room temperature, and washed once more with PBS. Cells were then permeabilized in 0.3%
TritonX-100 in PBS for 10 min at 20°C, except when later stained for O1 surface marker.
Slides were washed twice in PBS and blocked in 10% milk/0.1% goat serum in PBS for 3 hours. Subsequently, cells were incubated with primary antibodies against O1 (1:500),
GFAP (1:600), βIII-tubulin (1:1000) or isotype control nonspecific sera (Chemicon,
Temecula, CA) overnight at 4°C in the blocking solution. This was followed by 5 times washing with PBS and a 3 hour incubation with the corresponding fluorescent secondary antibodies in the blocking solution. After washing 5 times with PBS, cells were refixed with 3% parafolmadehyde for 15 minutes at 20°C, washed with PBS and dried. Coverslips were mounted over the chamber slides using 1.5µg/ml Vectashield Mounting Media with
DAPI. Images were captured on a confocal LSM 510 Meta Zeiss microscope with a 100x objective using the appropriate laser excitation.
4.3.8. Western Blotting. Cells were lysed in 10 mM Tris pH 7.4, 150 mM sodium chloride, 1 mM EDTA, 0.5% NP-40, 1% Triton X-100, 1 mM sodium orthovanadate, 0.2 mM PMSF, and protease inhibitor cocktail (Roche, Mannheim, Germany). Samples were resolved using SDS-PAGE, and electroblotted onto nitrocellulose membranes (Schleicher
& Schuell, Keene, NH). Polyclonal anti-Oct-4 (1:1000), anti-Sox2 (1:1000), and anti- 123
Musashi-1 (1:500) antibodies were purchased from Chemicon (Chemicon, Temecula, CA).
Anti-β-tubulin polyclonal antibodies were from Santa Cruz Biotechnology, Inc. (Santa
Cruz, CA). Antigen-antibody complexes were visualized by enhanced chemiluminescence using Immobilon Western according to the manufacturer’s instructions (Millipore, MA).
4.3.9. Glutamate Uptake Assay. The uptake of [3H]-glutamate (Amersham, UK) was determined as previously described (*). Briefly, cells were grown in a 12-well plate, and the medium was replaced by fresh DMEM, supplemented with 10% FBS, non-essential aminoacids, and penicillin/streptomycin, 50 µM glutamate (Sigma, St. Louis, MO), and
18.5 kBq (9.25 pmol) [3H]-glutamate. Cells were incubated for 15 minutes at 37°C, and then washed three times with ice-cold PBS containing 5 mM glutamate. After cell lysis in
0.5 ml of 10 mM NaOH with 0.1% Triton X-100, 300 µl of the lysate aliquotes were assayed for 3H radioactivity by liquid scintillation counting, and 100 µl were used for measuring protein concentration by the BCA method (Sigma, St. Louis, MO). Statistical analysis was performed by one-way analysis of variance. Differences were considered statistically significant when p-values were <0.05. 124
4.4. RESULTS
4.4.1. Generation of neural progenitors
Thus far, human fetal brain neural progenitor cells have been differentiated in vitro into cells expressing markers for either neurons or astrocytes, with 70% and 100% efficiency, respectively (164, 183). However, the supply of human fetal tissue is limited due to ethical issues. Therefore, the use of commercially available human embryonic stem cells (153), including the BG01V cell line used in these studies offer a potential alternative. These and other embryonic stem cell lines have been successfully differentiated into neural progenitors, and further into cells expressing markers of astrocytes, neurons, and oligodendrocytes. We used these cells as an in vitro model to study the mechanisms of astrocyte differentiation. First, we successfully differentiated BG01V cells into neural progenitors as described earlier (*). These progenitors are characterized by rosette-forming structures, and are capable of growing in culture without the mouse feeder layer (Fig.
4.1A). To further characterize the cultures, we have analyzed the expression of pluripotent stem cell (Oct-4) (155) and neural progenitor (Musashi-1) (107) markers by Western blotting (Fig. 4.1B.). The expression of Musashi-1 was much higher in neural progenitor cells than in the stem cells. In addition, the transcription factor Oct-4 was no longer expressed in the NP cells. Furthermore, the expression of Sox2 was abundant in both cell types (10). Collectively, these data indicate that BG01V cells were successfully differentiated into cells expressing the neural progenitor markers. 125
Fig. 4.1. BG01V embryonic stem cells differentiate into neural progenitors. (A)
Contrast phase microscopic images of embryonic stem cells grown on a MEF feeder layer
(left), and generated neural progenitors grown on laminin (right). Arrows point to stem cell colonies. (B) Cells were trypsinized, washed, lysed, and the expression of cell-specific markers was analyzed by western blotting as described in the M&M section. β-tubulin was used as a loading control.
127
4.4.2. Neural progenitors as a model for astrocyte differentiation.
Due to the limitations of in vivo methods to study specific mechanisms of cellular differentiation, we aimed at developing an in vitro differentiation model consisting of stem cells and neural progenitors. First, we assessed if the BG01V-derived neural progenitors can further differentiate into astrocytes by evaluating the expression of multiple markers in stem and progenitor cells, and then compared them to primary human astrocytes (Fig.
4.2A). This analysis included genes expressed in astrocytes, such as glial fibrillary acidic protein (GFAP) (62), glutamate transporter (GLAST) (182), CD44 antigen (131), calcium- binding protein S100β (219), and secreted protein acidic and rich in cystein-like protein 1
(SPARCL1/hevin) (141). The expression of these markers was extremely low in BG01V and neural progenitor cells, however it was drastically high in primary human astrocytes.
In addition, neural progenitor cells expressed significant levels of S100β, GLAST, and
SPARCL1 mRNA (Fig. 4.2A), which is in accordance with previously published data that showed the presence of these markers in other cells in the brain. Subsequently, we analyzed the expression of the brain fatty acid binding protein (B-FABP) (121), which is abundantly expressed in radial glia and immature astrocytes in vivo. Indeed, BFABP was expressed at relatively low levels in stem and progenitor cells, whereas its expression was very high in primary human astrocytes. 128
Fig. 4.2. Characterization of gene expression patterns in generated neural progenitors. RNA was prepared from BG01V cells (ESC), neural progenitors (NP), and human primary astrocytes (Astr), which serve as a positive control. Subsequently, expression of glial marker mRNAs (A), and mRNAs for the different NFI isoforms (B) was measured by qPCR (Taqman). Data were normalized to GAPDH mRNA levels, and are represented as a relative fold induction in reference to embryonic stem cells. Assays were performed in triplicates and the data represent the mean +/- standard deviation (error bars) with p<0.01.
130
Vimentin and nestin are the early intermediate filament proteins present in progenitor and early precursor cells, and are later replaced by GFAP in mature astrocytes
(61, 161). Thus, we analyzed the expression of these markers in BG01V and neural progenitor cells. We found that neural progenitors express higher levels of nestin and vimentin than stem cells (Fig. 4.2A); however, these markers are also expressed at high levels in primary human astrocytes, suggesting that these cells are immature. In fact, primary astrocytes in culture express all of the intermediate filament proteins (181), including nestin, vimentin, and GFAP, a situation, which is similar to that observed in reactive astrocytes in vivo. In addition, human primary astrocytes were isolated from fetuses at the 18th week of gestation, which corresponds to the onset stage of gliogenesis; thus, they are likely heterogenous and comprise cells at different stages of differentiation, which cannot be separated by commonly used isolation methods.
Since the BG01V-derived neural progenitor cells express very low levels of GFAP,
BFABP, and CD44, while they express higher levels of S100β, GLAST, vimentin, and nestin, they represent the undifferentiated progenitor cells in the brain which have the potential to differentiate into astrocytes, neurons, or oligodendrocytes. Therefore, we conclude that these BG01V-derived neural progenitors are a good starting point for studying astrocyte differentiation. 131
Fig. 4.3. Differentiation of neural progenitors into astrocytes. Neural progenitors (NP) were subjected to the astrocyte differentiation protocol as described in the M&M section.
(A) Contrast phase microscopic images of neural progenitors (left), generated astrocytes
(center), and human primary astrocytes (right). (B) Immunocytochemical staining of differentiated astrocytes with anti-GFAP, secondary antibodies (NS), anti-O1, anti-
βIIItubulin, and DAPI (blue) was performed as described in the M&M section. (C)
Glutamate uptake was assayed in cultured neural progenitors (NP), generated astrocytes
(Diff. Astr), and primary human astrocytes (Astr) as described in the M&M section.
Protein concentration was measured by the BCA assay. Data are expressed in picomoles of glutamate per mg of cellular protein. Experiment was performed in triplicates, and error bars indicate the standard deviation values with p<0.05. 132
133
4.4.3. Expression of NFI isoforms in stem cells and neural progenitors.
Expression of NFI isoforms is developmentally regulated in the CNS, with NFI-A,
-B and -X knockout mice presenting severe neuroanatomical defects (47, 58, 189).
However, the specific functions of each NFI isoform in the brain remain unknown.
Furthermore, it is not clear which isoforms are crucial for proper differentiation of particular brain cell types, including astrocytes. In order to determine if BG01V stem cells and progenitors can be used to study the role of NFI isoforms in the process of differentiation, we analyzed the pattern of NFI expression in stem cells and neural progenitors, and compared it to primary human astrocytes (Fig. 4.2B). Indeed, the embryonic stem cells express only minute amounts of mRNAs for all NFI isoforms when compared to primary astrocytes, in which the NFI expression is tens- or hundreds- fold higher. More importantly, NFI-A expression was dramatically increased in neural progenitor cells, indicating that these cells underwent the expected differentiation process.
In addition, there was a several fold increase in the expression of NFI-C and NFI-B in the neural progenitor cells, suggesting that these isoforms may be the next NFIs activated during differentiation. We conclude that the in vitro differentiation model may be used to study the terminal differentiation of neural progenitor cells into astrocytes, neurons, and oligodendrocytes. Furthermore, this is a great model to investigate the role of NFI in astrocyte differentiation.
134
4.4.4. Generation of astrocytes.
Recently, both rat and human neural progenitors were differentiated towards astrocytes in vitro (153, 164). We have followed the protocols with some modifications
(183), and generated cells that were subsequently analyzed for the expression of specific markers. Morphologically these cells resembled primary astrocytes, as they showed a spread-out flat body and uniform distribution with characteristic projections, in contrast to the more compact and round neural progenitor cells forming the rosettes (Fig. 4.3A). In addition, all of the cells were GFAP-positive, but O1- and βΙII-tubulin-negative, which are the astrocyte, oligodendrocyte and neuronal markers, respectively (Fig. 4.3B). In order to further confirm the identity of the generated cells, we performed a functional glutamate uptake assay. Indeed, primary human astrocytes demonstrated a 2-fold increase in glutamate uptake when compared to the original neural progenitor cells. Furthermore, astrocytes generated from the neural progenitor cells had a significant increase of 40%
(Fig. 4.3C), a good indication of their differentiation. It is noteworthy that many cells underwent apoptosis or became senescent as part of the differentiation process, hence the overall survival was low (10-20%), and the differentiated astrocytes lost their proliferative potential. Furthermore, BFABP, GFAP, SPARCL1, and CD44 mRNA levels were significantly increased in the differentiated astrocytes in comparison to neural progenitor cells (Fig. 4.4A). As expected, nestin expression was decreased (4-fold), while vimentin levels remained unchanged, suggesting that these cells resemble an early stage of astrocyte 135
Fig. 4.4. Characterization of gene expression patterns in differentiated astrocytes.
Neural progenitors were subjected to the astrocyte differentiation protocol as described in the M&M section. On day 21, the expression of glial markers (A) and NFI isoforms (B) was measured by qPCR (Taqman) in the differentiated astrocytes (Diff. Astr), and compared to BG01V embryonic stem cells (ESC) and neural progenitors (NP). Data were normalized to GAPDH mRNA, and are represented as a relative fold induction in reference to the ESC. Assays were performed in triplicates, and the results represent the mean +/- standard deviation (error bars) with p<0.05.
137
differentiation. Interestingly, the generated cells expressed S100β and GLAST at similar to neural progenitors levels. Although S100β is produced by astrocytes, it is present at low levels in many neural cell types in the brain. It is also an indicator of astrocytic damage and disfunction, since it is abundantly expressed by activated astrocytes (219). Similarly,
GLAST is co-expressed with NFI-A already in the progenitors destined to become glia in vivo (53). As a negative control, we analyzed the expression of myelin basic protein
(MBP), a marker of differentiated oligodendrocytes (214), during astrocyte differentiation, and we did not detect any MBP expression in this process (data not shown). In addition, we have quantified the expression of Olig2, the oligodendrocyte-lineage transcription factor (173), and we found that Olig2 was already present in the NP cells, and it decreased
20-fold in the differentiated astrocytes (data not shown). Collectively, these results indicate that neural progenitors underwent proper differentiation towards astrocytes, but not neurons or oligodendrocytes, as indicated by the expression of appropriate glial markers.
4.4.5. NFI expression is sequential during astrocyte differentiation.
Since the neural progenitors express significant amounts of NFI-A, very low levels of
NFI-B and NFI-C but not NFI-X, we investigated whether the expression of NFI isoforms is further induced during the process of differentiation (Fig. 4.4B). Indeed NFI-X expression was dramatically increased during differentiation towards astrocytes. 138
Fig. 4.5. NFI-C and NFI-X regulate the expression of GFAP and SPARCL1 during astrocyte differentiation. Neural progenitors were subjected to the astrocyte differentiation protocol for 21 days. On day 15 of the differentiation process, cells were transfected with non-targeting control siRNA, siRNA targeting NFI-C and NFI-X ((C+X) siRNA), or siRNA targeting all NFI isoforms (panNFI siRNA). RNA was then isolated on day 21, and the expression of (A) glial markers and (B) NFI isoforms were analyzed in triplicates. Data were normalized to GAPDH mRNA, and are presented as a fold induction in reference to untreated, differentiated astrocytes. Satistical significance was estimated by values of p<0.0001 for GFAP, SPARCL1, NFI-C, and NFI-X genes and p<0.05 for
BFABP, S100B, NFI-A, and NFI-B genes.
140
In contrast, the expression of NFI-A and NFI-B increased 2-fold, while the expression of
NFI-C was unchanged. These data suggest that NFI-A and NFI-B may be crucial at the initial stages of astrocyte differentiation and maintenance of progenitor cells. Later, NFI-X, and possibly NFI-C, may regulate gene expression during the final stages of astrocyte differentiation.
4.4.6. NFI-C and NFI-X control astrocyte-specific gene expression.
To further study the role of NFI in the expression of astrocyte-specific markers, we knocked-down the expression of specific NFI isoforms during the differentiation process.
Since simultaneous down-regulation of NFI-C and NFI-X isoforms is required to diminish
GFAP expression in primary human astrocytes (data not shown), we applied siRNAs targeting both NFI-C and NFI-X on day 15 of astrocyte differentiation. For comparison, we used combined Smart Pool siRNAs for all NFI isoforms (PanNFI siRNA), and a non- targeting control siRNA. Subsequent marker gene expression analysis on day 21 revealed that the knockdown of NFI-C and NFI-X drastically decreased the expression of the GFAP and SPARCL1 genes by 80% and 50%, respectively (Fig. 4.5A). In contrast, there was no effect on GLAST, CD44, or nestin and a moderate effect (25%) was observed on S100β and BFABP mRNA levels. Since simultaneous knockdown of all NFI isoforms did not have any additional effect on the expression of analyzed markers, we conclude that NFI-C and NFI-X are the major NFIs required for the expression of GFAP and SPARCL1. The 141
efficiency of the target NFI down-regulation was 60-90%. We did not observe any non- specific effects of either the specific siRNAs or the control siRNA (Fig. 4.5B). In summary, both NFI-C and NFI-X are required for the expression of the GFAP and
SPARCL1 genes during the process of astrocyte differentiation.
142
4.5. DISCUSSION
Currently, there is ongoing research on human stem and progenitor cells aimed at using the modified cells as replacements for cells lost during disease (PD, MS, Cerebral
Palsy) (72) or as tools to deliver drugs to the target sites of disease by ‘homing in’ (GBM)
(148). Particularly, understanding the processes controlling glial differentiation may have critical consequences in future therapies of gliomas and neurodegenerative disorders. Thus far, differentiation and functional studies have been done using rodent neural progenitors
(164). Although research on animal cellular differentiation provides the basic knowledge of the processes, it cannot be directly extrapolated to the human system and used to analyze the mechanisms regulating genes, which may be different between humans and rodents. In this regard, most of the neurodegenerative disorders are typically human, as rodents do not develop AD, MS, nor PD diseases. Recently, human neural progenitors have been isolated from epileptic patients or human fetal tissue, and directed to develop into different brain cell types (125, 171). However, these types of studies are always controversial and thus, there is a need for functional in vitro models recapitulating molecular mechanisms of cellular differentiation in the brain. Moreover, stem cell pluripotency must be handled properly so that it leads to the generation of a desired and functional cell type of the CNS. Therefore, extensive studies in this area, including the mechanisms regulating the differentiation of neurons, astrocytes, and oligodendrocytes, are absolutely necessary. 143
Here, we have employed human BG01V stem cells to generate neural progenitors, which were further differentiated towards astrocytes. This in vitro astrocyte differentiation model allowed us to study the involvement of transcription factors and mechanisms of gene regulation. Moreover, it allowed us to monitor the gene expression in the course of the differentiation process, and analyze the effects of specific gene knock-down. Therefore, this is a very good in vitro model to study glial cell differentiation, which may contribute to the future stem cell-based therapies.
The analysis of the marker gene expression patterns proved that stem cell-derived neural progenitors are excellent candidates for further differentiation into astrocytes (Fig.
4.2A). These neural progenitor cells were successfully differentiated towards astrocytes, as characterized by astrocyte-like morphology and increased glutamate uptake (Fig. 4.3).
Moreover, we also demonstrated dramatically increased expression of GFAP, SPARCL1,
BFABP, and CD44 genes in the cells differentiated towards astrocytes (Fig. 4.4).
GFAP is an intermediate filament that replaces vimentin and nestin during the differentiation of astrocytes in vivo. It is detected in the later stages of brain development, and its expression increases with time (62). Although GFAP can also be present in embryonic stem cells, it is expressed by mature astrocytes at levels that are hundreds fold higher. Importantly, BG01V stem cells and neural progenitor cells express only minute amounts of GFAP. However, their in vitro differentiation resulted in approximately 100 fold higher expression of GFAP. 144
Furthermore, SPARCL1 (or hevin), a matricellular protein widely expressed in the embryonic and neonatal brain and vasculature, is gradually expressed at higher levels during development (141). Therefore, its increased expression levels indicate the progression of differentiation. Accordingly, very low SPARCL1 levels were found in the embryonic stem cells (Fig. 4.2A), increased in the neural progenitor cells, and peak in astrocytes.
On the other hand, CD44 is a receptor for hyaluronic acid expressed by astrocyte- restricted precursors in the developing rodent spinal cord before the acquisition of GFAP immunoreactivity. Moreover, CD44 does not co-localize with neuronal or oligodendroglial markers (131). The increased expression of CD44 in the differentiated astrocytes versus the progenitor and stem cells indicates that these cells followed the astrocyte differentiation pathway in our in vitro differentiation model.
In the developing brain, BFABP is abundantly expressed by radial glia, the early precursors of astrocytes (121). High levels of its expression in differentiated astrocytes
(Fig. 4.4A) may indicate an immature differentiation state, which also coincides well with
CD44 expression.
Conversely, S100β belongs to a family of Ca2+-binding proteins, and is localized to many cell types, including astrocytes, oligodendrocytes, microglia, and some neuronal subpopulations (219). Its expression defines cells which lose neural stem cell potential; 145
therefore, its presence in the generated neural progenitors and astrocytes concurring with its absence in the stem cells is a good indicator of the correct gliogenic differentiation.
One of the main functions of astrocytes in the brain is to maintain low levels of glutamate within the perisynaptic regions by means of glutamate transporters in order to protect the neurons against glutamate-mediated cytotoxicity (46). However, during the neurogenesis period in brain development, before astrocytes are generated during gliogenesis, this function is performed by the neural progenitors (137). Therefore, significant glutamate uptake in the neural progenitor cells, which is further increased in the differentiated astrocytes, supports proper differentiation of the neural progenitor cells in this in vitro system. These observations coincide with the fact that GLAST is widely expressed in cortical progenitors during early developmental stages, and also by mature astrocytes.
Nuclear Factor I is a family of ubiquitous transcription factors that are expressed during the development of the CNS (79). The role of NFI in astrocyte development is suggested by the presence of functional NFI-binding sites within the GFAP promoter (75).
Furthermore, NFI-A and NFI-B direct the onset of gliogenesis in the developing mouse and chick spinal cord, with NFI-A also required for the maintenance of neural progenitors, specification of oligodendrocyte fate, and the inhibition of neurogenesis (53). However, there are no reports on the role of NFI on the mechanisms involved in the human CNS development. Therefore, the in vitro model that we propose is an attractive alternative to 146
study the differentiation of astrocytes, which overcomes the limitations of the knock-out studies.
Our previous study showed that down-regulation of NFI-X decreases the expression of GFAP in U373 glioma cells (75). However, simultaneous down-regulation of
NFI-X and NFI-C is required to affect GFAP expression in primary human astrocytes (data not shown). Moreover, GFAP levels are normal in both NFI-X and NFI-C KO mice (58,
188), suggesting that these two isoforms share a high sequence homology and likely substitute for each other. Since NFI-X KO mice have a high post-natal lethality rate, making a double knock-out is very difficult. Here, we analyzed the effect of specific knock-down of NFI isoforms in the in vitro differentiation model. Significantly, a knock- down of NFI-C and NFI-X is sufficient to down-regulate the expression of GFAP and
SPARCL1, which are marker genes of differentiated astrocytes. It is noteworthy that
GFAP expression was completely lost, whereas the expression of SPARCL1 was downregulated by 50%. This may be due to the fact that SPARCL1 is already expressed in the neural progenitor cells, independently of NFI, and its expression is probably controlled by other mechanisms, which also function in astrocytes. Interestingly, other marker genes were not affected by the NFI knock-down, suggesting that GFAP and SPARCL1 may be specifically regulated by these two NFI isoforms. In accordance with the fact that there are
NFI-responsive elements within the BFABP promoter (18), NFI knock-down (C+X or pan- 147
NFI siRNAs) had a moderate, yet significant effect on the expression of BFABP by differentiated astrocytes.
In addition, knockdown of NFI-A or NFI-B at day 15 of differentiation did not have any effect on any of the astrocyte markers analyzed. In fact, NFI-A is co-expressed with GLAST at the onset of gliogenesis in the mouse and chick spinal cord (53). The same co-expression was observed in our in vitro model (Fig. 4.2A), as there is significant expression of NFI-A in neural progenitors that coincides with the expression of GLAST in these cells. Intriguingly, we observed an interesting expression pattern of NFI isoforms during cellular differentiation. All NFIs are hardly detectable in the ESC, while NFI-A expression is high and NFI-B and NFI-C levels are slightly increased in neural progenitor cells. However, NFI-X is expressed at significant levels only in differentiated astrocytes, and not in the progenitors. These data suggest that the NFI expression cascade exists during the differentiation of astrocytes, with NFI-A followed by NFI-B, NFI-C, and NFI-
X, which is expressed at the end of the differentiation process. This is also observed in vivo where NFI-A is expressed first, followed by NFI-B and NFI-X (34). However, the expression of NFI-C is concurrent with NFI-B, but it is at very low levels.
Collectively, our data suggest that the expression of distinct NFIs is temporally regulated during astrocyte differentiation, and they are responsible for the expression of marker genes during the progression of gliogenesis. NFIs most likely cooperate with the
JAK-STAT, BMP, and Notch pathways to promote astrocyte differentiation, which may be 148
coordinated around the formation of the CBP/p300 complex. Our study adds to the research on mechanisms of gliogenesis, and partly elucidates the mysterious role of NFI in the process of astrogenesis.
149
CHAPTER 5
GENERAL DISCUSSION
Neuroinflammation is a term often used to describe inflammatory reactions within the CNS that are associated with pathological conditions, such as MS, AD, PD, HAD, schizophrenia, depression, epilepsy, trauma, and brain tumors (134). The neuroinflammatory reactions are driven by reactive microglia and astrocytes (147) (156), as well as infiltrating immune cells due to a disrupted brain blood barrier. As a consequence, these cells secrete a plethora of inflammatory mediators, and express genes involved in cell proliferation, migration, and clearance of the pathogen and cellular debris that emerged locally. IL-1 is the major neuroinflammatory cytokine produced by both microglia and astrocytes in response to pathological conditions, and it is responsible for most of the subsequent cellular reactions (145). It induces the expression of other cytokines, chemokines, COX-2, iNOS, a series of adhesive proteins, and MMPs thus allowing extensive cell migration (103). Simultaneously, it induces the production of corresponding protease inhibitors, including TIMP-1 (192), to maintain the proteolytic balance in the ECM. Since the versatility of IL-1 actions in the brain is not fully understood, we investigated the mechanism by which IL-1 induces TIMP-1 expression in
150
primary human astrocytes (Chapter 2). We found that two signaling pathways, namely
the IKK/NF-κB and p38/ATF-2, need to be activated simultaneously by IL-1 in order to
induce the expression of TIMP-1 in primary human astrocytes. This mechanism is very
similar to the one described in rheumatoid arthritis, where the chronic inflammation
results in IL-1-mediated activation of NF-κB and p38, which regulate the expression of
MMP-1 and MMP-3 in synovial fibroblasts (91). The mechanisms regulating MMPs expression often parallel that of their inhibitors in response to pro-inflammatory conditions, which is necessary to maintain the proteolytic balance. In contrast, IL-1 does
not upregulate TIMP-1 in human glioblastoma cells due to the inactivation of either one
of the branches of the IL-1-induced signaling. It is noteworthy that glioblastoma
deregulate gene expression to shift the proteolytic equilibrium towards their favor, and
promote cell invasion. TIMP-1 functions as a proteinase inhibitor, and is not beneficial
for the fast-growing and invading glioblastoma cells; therefore, its basal expression level
is low, and it is not elevated by IL-1. This allows the tumors to spread due to an increased net proteolytic activity, adhesiveness, and cell motility in response to IL-1. Thus far, inflammation has been associated with the centers of glioblastoma tumors, with IL-1 and
IL-6 playing a major role in the progression and invasiveness of these tumors (166, 200).
IL-1 is known to stimulate the migration and invasion of glioma cells through the induction of the plasminogen activator system (PAS) (109, 110), and activation of sphingosine kinase 1 (our unpublished data). Importantly, local levels of IL-1 correlate 151
with tumor invasiveness (6), and a poor prognosis in cancer patients and in experimental
tumor models (60). Most GBMs produce IL-1 (133), while exogenous IL-1 induces the
secretion of growth and invasiveness-promoting factors, such as bFGF, MMPs,
angiogenic factors such as VEGF, and chemotactic factors such as IL-8 and MCP-1 in
stromal cells, leukocytes, and in malignant cells (103). Despite the well-established role
of IL-1 in tumorigenesis, neither OD tumors express significant levels of IL-1, nor do
oligodendroglioma cells increase their proliferation in response to IL-1. In contrast, IL-6
and OSM, which activate the JAK-STAT3 pathway, promote the proliferation of
oligodendroglioma cells (Chapter 3). Although inflammation is associated with
oligodendroglioma tumors, which abundantly express OSM, IL-6, MCP-1, MIP1α, and
MIP1β, the question remains as to whether inflammation is the cause, or the symptom of
tumor progression. IL-6 has been shown to induce autocrine proliferation of
glioblastomas via the JAK-STAT3 pathway (166). Similarly, we show that IL-6 and
OSM activate STAT3 and proliferation of oligodendroglioma cells, suggesting that a similar molecular mechanism exists in both GBMs and OD tumors. Interestingly enough, these two types of brain tumors do not share any molecular characteristics. Activated
STAT3 exerts its effects in both tumor cells, and surrounding stromal cells (212). On one
hand it drives proliferation and prevents apoptosis of tumor cells, and on the other it
suppresses the anti-tumor immune response. This shared significance of STAT3 points to
the fact that oligodendrocytes and astrocytes differentiate from the same glial precursor, 152
restricted to generate these glial cells, but not neurons. In fact, activation of the JAK-
STAT3 pathway is required for astrocyte differentiation (87), and it is triggered by
neuron-derived CT-1 (12). It is also necessary for the maintenance and proliferation of
neural progenitors, and the inhibition of neurogenesis. Since this pathway promotes the
growth of progenitor and glial cells, it is also likely advantageous for the tumor cells,
which sustain its activation. It is noteworthy that in glioblastomas, it is mostly the EGFR,
or autocrine IL-6 signaling that leads to the activation of STAT3, and promotes cell
growth (69, 167). In contrast, OSM activates STAT3 and proliferation in
oligodendroglioma cells. Therefore, it is interesting that different stimuli cause STAT3
activation and enhance proliferation of glioma cells and neural progenitors, and are also
critical for normal gliogenesis. Critical roles of STAT3 in tumorigenesis and tumor
maintenance have qualified it as a valid target for the development of novel anticancer
therapies. Our findings suggest that STAT3 should be considered as a target for treatment
of oligodendroglioma tumors. There are several strategies that may be employed to target
the activated STAT3, including the use of Tyrosine kinase inhibitors or receptor
antagonists, and the disruption of STAT3 dimerization by peptidomimetics or non-
peptide analogs. To date, several studies show that direct inhibition of persistently active
STAT3 induces apoptosis of malignant cells, and induces tumor regression (96, 99, 166).
The role of STAT3 in glial differentiation (87) is very prominent, whereas its
contribution to gliomagenesis is under investigation. Currently, the origin of glioma 153
tumors is still debated. On one hand, the dedifferentiation theory is based on the similarities of astrocytomas to astrocytes and oligodendrogliomas to oligodendrocytes.
Furthermore, these cells express compatible markers such as GFAP, BFABP in
astrocytes/astrocytomas (71), and Olig genes in oligodendrocytes/oligodendrogliomas
(132). On the other hand, there is an emerging evidence for the existence of CD133+
positive cancer stem cells, which may give rise to glioma tumors (14, 185, 186). These
CD133+ cells are multipotent, which is reflected in the common heterogeneity of glioma
tumors, and are characterized by high self-renewal capacity. The brain cancer stem cell
theory is additionally based on the fact that glioma tumors often depend on the activation
of developmental signaling, such as the Wnt, Notch, and Hedgehog pathways, which are
often required for stem cell maintenance (169). Components of the Notch pathway
control stem cell proliferation, and act as oncogenes in tumors, including astrocytomas
and oligodendrogliomas (39). The Sonic Hedgehog (SHH) pathway is commonly
activated in brain, prostate and skin tumors, and it is required to sustain their growth
(175). Indeed, Gli transcription factors that are regulated by SHH are highly expressed in
gliomas (42). Moreover, glioma tumors downregulate the expression of cell specific
markers, such as GFAP, which inversely correlates with the glioma grade (202).
Significantly, we demonstrated that NFI-X regulates GFAP expression in glioma cells
and astrocytes (75), and it is indispensable for GFAP expression during astrocyte
differentiation (Chapter 4). Moreover, NFI-X expression levels are lower in several 154
glioblastoma cell lines when compared to human primary astrocytes (data not shown).
Furthermore, we show that NFI-X is required for the terminal differentiation of
astrocytes, characterized by GFAP and SPARCL1 expression. Indeed, the SPARCL1
expression levels are downregulated in glioma cells (data not shown). Intriguingly,
SPARCL1 is known as the tumor suppressor, which has anti-proliferative and counter- adhesive properties (39). These observations suggest that glioma cells are characterized by a gene expression pattern, which resembles dedifferentiated astrocytic cells, or alternatively that did not complete terminal differentiation. In this context, full comprehension of mechanisms of astrocyte differentiation, and the role of NFI in this process, is critical.
The most fascinating questions revolve around the connection between the gliogenic JAK-STAT3 pathway, and NFI-X. It is unclear whether STAT3 regulates NFI-
X expression, or whether these two transcription factors form a complex by protein- protein interactions. Importantly, the JAK-STAT3 pathway is also required for the survival, proliferation, and differentiation of oligodendrocyte precursors (52). Since MBP expression also depends on NFI (41), it is tempting to speculate that NFI may be important to a larger glial cell population, including oligodendrocytes. Thus, whereas
NFI-X is crucial for astrocyte differentiation, other NFI isoforms may be relevant in oligodendrocyte differentiation. However, all of these exciting questions remain to be investigated and answered in future projects. This dissertation adds to the expanding data 155
on inflammation-induced mechanisms of gene regulation in brain cells, which are fascinating and promising in terms of finding new therapeutic targets for CNS diseases.
Moreover, this thesis also contributes to resolving the mechanisms of cellular differentiation in the brain, which are likely critical for understanding the development and origin of brain tumors.
156
Literature Cited
1. Abraham, C. R. 2001. Reactive astrocytes and alpha1-antichymotrypsin in Alzheimer's disease. Neurobiol Aging 22:931-6. 2. Abraham, C. R., D. J. Selkoe, and H. Potter. 1988. Immunochemical identification of the serine protease inhibitor alpha 1-antichymotrypsin in the brain amyloid deposits of Alzheimer's disease. Cell 52:487-501. 3. Akira, S., and K. Takeda. 2004. Toll-like receptor signalling. Nat Rev Immunol 4:499-511. 4. Allore, R. J., W. C. Friend, D. O'Hanlon, K. M. Neilson, R. Baumal, R. J. Dunn, and A. Marks. 1990. Cloning and expression of the human S100 beta gene. J Biol Chem 265:15537-43. 5. Apt, D., Y. Liu, and H. U. Bernard. 1994. Cloning and functional analysis of spliced isoforms of human nuclear factor I-X: interference with transcriptional activation by NFI/CTF in a cell-type specific manner. Nucleic Acids Res 22:3825-33. 6. Apte, R. N., S. Dotan, M. Elkabets, M. R. White, E. Reich, Y. Carmi, X. Song, T. Dvozkin, Y. Krelin, and E. Voronov. 2006. The involvement of IL-1 in tumorigenesis, tumor invasiveness, metastasis and tumor-host interactions. Cancer Metastasis Rev 25:387-408. 7. Baeuerle, P. A., and D. Baltimore. 1988. I kappa B: a specific inhibitor of the NF-kappa B transcription factor. Science 242:540-6. 8. Baggiolini, M., and I. Clark-Lewis. 1992. Interleukin-8, a chemotactic and inflammatory cytokine. FEBS Lett 307:97-101. 9. Bahr, M. J., K. J. Vincent, M. J. Arthur, A. V. Fowler, D. E. Smart, M. C. Wright, I. M. Clark, R. C. Benyon, J. P. Iredale, and D. A. Mann. 1999. Control of the tissue inhibitor of metalloproteinases-1 promoter in culture- activated rat hepatic stellate cells: regulation by activator protein-1 DNA binding proteins. Hepatology 29:839-48. 10. Bani-Yaghoub, M., R. G. Tremblay, J. X. Lei, D. Zhang, B. Zurakowski, J. K. Sandhu, B. Smith, M. Ribecco-Lutkiewicz, J. Kennedy, P. R. Walker, and M. Sikorska. 2006. Role of Sox2 in the development of the mouse neocortex. Dev Biol 295:52-66. 11. Bao, S., Q. Wu, R. E. McLendon, Y. Hao, Q. Shi, A. B. Hjelmeland, M. W. Dewhirst, D. D. Bigner, and J. N. Rich. 2006. Glioma stem cells promote radioresistance by preferential activation of the DNA damage response. Nature 444:756-60. 157
12. Barnabe-Heider, F., J. A. Wasylnka, K. J. Fernandes, C. Porsche, M. Sendtner, D. R. Kaplan, and F. D. Miller. 2005. Evidence that embryonic neurons regulate the onset of cortical gliogenesis via cardiotrophin-1. Neuron 48:253-65. 13. Baumeister, H., R. M. Gronostajski, G. E. Lyons, and F. L. Margolis. 1999. Identification of NFI-binding sites and cloning of NFI-cDNAs suggest a regulatory role for NFI transcription factors in olfactory neuron gene expression. Brain Res Mol Brain Res 72:65-79. 14. Beier, D., P. Hau, M. Proescholdt, A. Lohmeier, J. Wischhusen, P. J. Oefner, L. Aigner, A. Brawanski, U. Bogdahn, and C. P. Beier. 2007. CD133(+) and CD133(-) glioblastoma-derived cancer stem cells show differential growth characteristics and molecular profiles. Cancer Res 67:4010-5. 15. Bertrand-Philippe, M., R. G. Ruddell, M. J. Arthur, J. Thomas, N. Mungalsingh, and D. A. Mann. 2004. Regulation of tissue inhibitor of metalloproteinase 1 gene transcription by RUNX1 and RUNX2. J Biol Chem 279:24530-9. 16. Besnard, F., M. Brenner, Y. Nakatani, R. Chao, H. J. Purohit, and E. Freese. 1991. Multiple interacting sites regulate astrocyte-specific transcription of the human gene for glial fibrillary acidic protein. J Biol Chem 266:18877-83. 17. Bhat, N. R., D. L. Feinstein, Q. Shen, and A. N. Bhat. 2002. p38 MAPK- mediated transcriptional activation of inducible nitric-oxide synthase in glial cells. Roles of nuclear factors, nuclear factor kappa B, cAMP response element-binding protein, CCAAT/enhancer-binding protein-beta, and activating transcription factor-2. J Biol Chem 277:29584-92. 18. Bisgrove, D. A., E. A. Monckton, M. Packer, and R. Godbout. 2000. Regulation of brain fatty acid-binding protein expression by differential phosphorylation of nuclear factor I in malignant glioma cell lines. J Biol Chem 275:30668-76. 19. Block, M. L., and J. S. Hong. 2005. Microglia and inflammation-mediated neurodegeneration: multiple triggers with a common mechanism. Prog Neurobiol 76:77-98. 20. Blum-Degen, D., T. Muller, W. Kuhn, M. Gerlach, H. Przuntek, and P. Riederer. 1995. Interleukin-1 beta and interleukin-6 are elevated in the cerebrospinal fluid of Alzheimer's and de novo Parkinson's disease patients. Neurosci Lett 202:17-20. 21. Boch, J. A., N. Wara-aswapati, and P. E. Auron. 2001. Interleukin 1 signal transduction--current concepts and relevance to periodontitis. J Dent Res 80:400- 7. 158
22. Botelho, F. M., D. R. Edwards, and C. D. Richards. 1998. Oncostatin M stimulates c-Fos to bind a transcriptionally responsive AP-1 element within the tissue inhibitor of metalloproteinase-1 promoter. J Biol Chem 273:5211-8. 23. Boutin, H., I. Kimber, N. J. Rothwell, and E. Pinteaux. 2003. The expanding interleukin-1 family and its receptors: do alternative IL-1 receptor/signaling pathways exist in the brain? Mol Neurobiol 27:239-48. 24. Bowman, T., R. Garcia, J. Turkson, and R. Jove. 2000. STATs in oncogenesis. Oncogene 19:2474-88. 25. Bowman, T., and R. Jove. 1999. STAT Proteins and Cancer. Cancer Control 6:615-619. 26. Brew, K., D. Dinakarpandian, and H. Nagase. 2000. Tissue inhibitors of metalloproteinases: evolution, structure and function. Biochim Biophys Acta 1477:267-83. 27. Brockman, J. A., D. C. Scherer, T. A. McKinsey, S. M. Hall, X. Qi, W. Y. Lee, and D. W. Ballard. 1995. Coupling of a signal response domain in I kappa B alpha to multiple pathways for NF-kappa B activation. Mol Cell Biol 15:2809- 18. 28. Buccoliero, A. M., A. Caldarella, L. Arganini, P. Mennonna, P. Gallina, A. Taddei, and G. L. Taddei. 2004. Cyclooxygenase-2 in oligodendroglioma: possible prognostic significance. Neuropathology 24:201-7. 29. Bugno, M., L. Graeve, P. Gatsios, A. Koj, P. C. Heinrich, J. Travis, and T. Kordula. 1995. Identification of the interleukin-6/oncostatin M response element in the rat tissue inhibitor of metalloproteinases-1 (TIMP-1) promoter. Nucleic Acids Res 23:5041-7. 30. Bugno, M., B. Witek, J. Bereta, M. Bereta, D. R. Edwards, and T. Kordula. 1999. Reprogramming of TIMP-1 and TIMP-3 expression profiles in brain microvascular endothelial cells and astrocytes in response to proinflammatory cytokines. FEBS Lett 448:9-14. 31. Castell, J. V., M. J. Gomez-Lechon, M. David, T. Andus, T. Geiger, R. Trullenque, R. Fabra, and P. C. Heinrich. 1989. Interleukin-6 is the major regulator of acute phase protein synthesis in adult human hepatocytes. FEBS Lett 242:237-9. 32. Chaillan, F. A., S. Rivera, E. Marchetti, J. Jourquin, Z. Werb, P. D. Soloway, M. Khrestchatisky, and F. S. Roman. 2006. Involvement of tissue inhibition of metalloproteinases-1 in learning and memory in mice. Behav Brain Res 173:191- 8. 33. Chakraborti, S., M. Mandal, S. Das, A. Mandal, and T. Chakraborti. 2003. Regulation of matrix metalloproteinases: an overview. Mol Cell Biochem 253:269-85. 159
34. Chaudhry, A. Z., G. E. Lyons, and R. M. Gronostajski. 1997. Expression patterns of the four nuclear factor I genes during mouse embryogenesis indicate a potential role in development. Dev Dyn 208:313-25. 35. Chaudhry, A. Z., A. D. Vitullo, and R. M. Gronostajski. 1998. Nuclear factor I (NFI) isoforms differentially activate simple versus complex NFI-responsive promoters. J Biol Chem 273:18538-46. 36. Chaudhry, A. Z., A. D. Vitullo, and R. M. Gronostajski. 1999. Nuclear factor I-mediated repression of the mouse mammary tumor virus promoter is abrogated by the coactivators p300/CBP and SRC-1. J Biol Chem 274:7072-81. 37. Chen, S. H., and E. N. Benveniste. 2004. Oncostatin M: a pleiotropic cytokine in the central nervous system. Cytokine Growth Factor Rev 15:379-91. 38. Chen, S. H., G. Y. Gillespie, and E. N. Benveniste. 2006. Divergent effects of oncostatin M on astroglioma cells: influence on cell proliferation, invasion, and expression of matrix metalloproteinases. Glia 53:191-200. 39. Claeskens, A., N. Ongenae, J. M. Neefs, P. Cheyns, P. Kaijen, M. Cools, and E. Kutoh. 2000. Hevin is down-regulated in many cancers and is a negative regulator of cell growth and proliferation. Br J Cancer 82:1123-30. 40. Clark, I. M., A. D. Rowan, D. R. Edwards, T. Bech-Hansen, D. A. Mann, M. J. Bahr, and T. E. Cawston. 1997. Transcriptional activity of the human tissue inhibitor of metalloproteinases 1 (TIMP-1) gene in fibroblasts involves elements in the promoter, exon 1 and intron 1. Biochem J 324 ( Pt 2):611-7. 41. Clark, R. E., Jr., W. K. Miskimins, and R. Miskimins. 2002. Cyclic AMP inducibility of the myelin basic protein gene promoter requires the NF1 site. Int J Dev Neurosci 20:103-11. 42. Clement, V., P. Sanchez, N. de Tribolet, I. Radovanovic, and A. Ruiz i Altaba. 2007. HEDGEHOG-GLI1 signaling regulates human glioma growth, cancer stem cell self-renewal, and tumorigenicity. Curr Biol 17:165-72. 43. Cooke, D. W., and M. D. Lane. 1999. The transcription factor nuclear factor I mediates repression of the GLUT4 promoter by insulin. J Biol Chem 274:12917- 24. 44. Coussens, L. M., and Z. Werb. 2002. Inflammation and cancer. Nature 420:860- 7. 45. Crofford, L. J. 1997. COX-1 and COX-2 tissue expression: implications and predictions. J Rheumatol Suppl 49:15-9. 46. Danbolt, N. C. 2001. Glutamate uptake. Prog Neurobiol 65:1-105. 47. das Neves, L., C. S. Duchala, F. Tolentino-Silva, M. A. Haxhiu, C. Colmenares, W. B. Macklin, C. E. Campbell, K. G. Butz, and R. M. Gronostajski. 1999. Disruption of the murine nuclear factor I-A gene (Nfia) results in perinatal lethality, hydrocephalus, and agenesis of the corpus callosum. Proc Natl Acad Sci U S A 96:11946-51. 160
48. Dasse, E., L. Bridoux, T. Baranek, E. Lambert, S. Salesse, M. L. Sowa, L. Martiny, C. Trentesaux, and E. Petitfrere. 2007. Tissue inhibitor of metalloproteinase-1 promotes hematopoietic differentiation via caspase-3 upstream the MEKK1/MEK6/p38alpha pathway. Leukemia 21:595-603. 49. Dean, G., D. A. Young, D. R. Edwards, and I. M. Clark. 2000. The human tissue inhibitor of metalloproteinases (TIMP)-1 gene contains repressive elements within the promoter and intron 1. J Biol Chem 275:32664-71. 50. Deininger, M. H., R. Meyermann, K. Trautmann, M. Morgalla, F. Duffner, E. H. Grote, J. Wickboldt, and H. J. Schluesener. 2000. Cyclooxygenase (COX)-1 expressing macrophages/microglial cells and COX-2 expressing astrocytes accumulate during oligodendroglioma progression. Brain Res 885:111- 6. 51. Delegeane, A. M., L. H. Ferland, and P. L. Mellon. 1987. Tissue-specific enhancer of the human glycoprotein hormone alpha-subunit gene: dependence on cyclic AMP-inducible elements. Mol Cell Biol 7:3994-4002. 52. Dell'Albani, P., M. A. Kahn, R. Cole, D. F. Condorelli, A. M. Giuffrida- Stella, and J. de Vellis. 1998. Oligodendroglial survival factors, PDGF-AA and CNTF, activate similar JAK/STAT signaling pathways. J Neurosci Res 54:191- 205. 53. Deneen, B., R. Ho, A. Lukaszewicz, C. J. Hochstim, R. M. Gronostajski, and D. J. Anderson. 2006. The transcription factor NFIA controls the onset of gliogenesis in the developing spinal cord. Neuron 52:953-68. 54. DiProspero, N. A., S. Meiners, and H. M. Geller. 1997. Inflammatory cytokines interact to modulate extracellular matrix and astrocytic support of neurite outgrowth. Exp Neurol 148:628-39. 55. Ditsworth, D., and W. X. Zong. 2004. NF-kappaB: key mediator of inflammation-associated cancer. Cancer Biol Ther 3:1214-6. 56. Dixit, V., and T. W. Mak. 2002. NF-kappaB signaling. Many roads lead to madrid. Cell 111:615-9. 57. Docherty, A. J., A. Lyons, B. J. Smith, E. M. Wright, P. E. Stephens, T. J. Harris, G. Murphy, and J. J. Reynolds. 1985. Sequence of human tissue inhibitor of metalloproteinases and its identity to erythroid-potentiating activity. Nature 318:66-9. 58. Driller, K., A. Pagenstecher, M. Uhl, H. Omran, A. Berlis, A. Grunder, and A. E. Sippel. 2007. Nuclear factor I X deficiency causes brain malformation and severe skeletal defects. Mol Cell Biol 27:3855-3867. 59. Duran, A., M. T. Diaz-Meco, and J. Moscat. 2003. Essential role of RelA Ser311 phosphorylation by zetaPKC in NF-kappaB transcriptional activation. Embo J 22:3910-8. 161
60. Elaraj, D. M., D. M. Weinreich, S. Varghese, M. Puhlmann, S. M. Hewitt, N. M. Carroll, E. D. Feldman, E. M. Turner, and H. R. Alexander. 2006. The role of interleukin 1 in growth and metastasis of human cancer xenografts. Clin Cancer Res 12:1088-96. 61. Eliasson, C., C. Sahlgren, C. H. Berthold, J. Stakeberg, J. E. Celis, C. Betsholtz, J. E. Eriksson, and M. Pekny. 1999. Intermediate filament protein partnership in astrocytes. J Biol Chem 274:23996-4006. 62. Eng, L. F., R. S. Ghirnikar, and Y. L. Lee. 2000. Glial fibrillary acidic protein: GFAP-thirty-one years (1969-2000). Neurochem Res 25:1439-51. 63. Falvo, J. V., B. S. Parekh, C. H. Lin, E. Fraenkel, and T. Maniatis. 2000. Assembly of a functional beta interferon enhanceosome is dependent on ATF-2-c- jun heterodimer orientation. Mol Cell Biol 20:4814-25. 64. Feinberg, A. P., and B. Vogelstein. 1983. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal Biochem 132:6- 13. 65. Fried, M., and D. M. Crothers. 1981. Equilibria and kinetics of lac repressor- operator interactions by polyacrylamide gel electrophoresis. Nucleic Acids Res 9:6505-25. 66. Funakoshi, M., K. Tago, Y. Sonoda, S. Tominaga, and T. Kasahara. 2001. A MEK inhibitor, PD98059 enhances IL-1-induced NF-kappaB activation by the enhanced and sustained degradation of IkappaBalpha. Biochem Biophys Res Commun 283:248-54. 67. Gardner, J., and A. Ghorpade. 2003. Tissue inhibitor of metalloproteinase (TIMP)-1: the TIMPed balance of matrix metalloproteinases in the central nervous system. J Neurosci Res 74:801-6. 68. Ge, W., K. Martinowich, X. Wu, F. He, A. Miyamoto, G. Fan, G. Weinmaster, and Y. E. Sun. 2002. Notch signaling promotes astrogliogenesis via direct CSL-mediated glial gene activation. J Neurosci Res 69:848-60. 69. Ghosh, M. K., P. Sharma, P. C. Harbor, S. O. Rahaman, and S. J. Haque. 2005. PI3K-AKT pathway negatively controls EGFR-dependent DNA-binding activity of Stat3 in glioblastoma multiforme cells. Oncogene 24:7290-300. 70. Ghosh, S., and M. Karin. 2002. Missing pieces in the NF-kappaB puzzle. Cell 109 Suppl:S81-96. 71. Godbout, R., D. A. Bisgrove, D. Shkolny, and R. S. Day, 3rd. 1998. Correlation of B-FABP and GFAP expression in malignant glioma. Oncogene 16:1955-62. 72. Goldman, S. 2005. Stem and progenitor cell-based therapy of the human central nervous system. Nat Biotechnol 23:862-71. 73. Gomis-Ruth, F. X., K. Maskos, M. Betz, A. Bergner, R. Huber, K. Suzuki, N. Yoshida, H. Nagase, K. Brew, G. P. Bourenkov, H. Bartunik, and W. Bode. 162
1997. Mechanism of inhibition of the human matrix metalloproteinase stromelysin-1 by TIMP-1. Nature 389:77-81. 74. Gopalan, S., A. Kasza, W. Xu, D. L. Kiss, K. M. Wilczynska, R. E. Rydel, and T. Kordula. 2005. Astrocyte- and hepatocyte-specific expression of genes from the distal serpin subcluster at 14q32.1 associates with tissue-specific chromatin structures. J Neurochem 94:763-73. 75. Gopalan, S. M., K. M. Wilczynska, B. S. Konik, L. Bryan, and T. Kordula. 2006. Nuclear factor-1-X regulates astrocyte-specific expression of the alpha1- antichymotrypsin and glial fibrillary acidic protein genes. J Biol Chem 281:13126-33. 76. Gosselin, D., and S. Rivest. 2007. Role of IL-1 and TNF in the brain: twenty years of progress on a Dr. Jekyll/Mr. Hyde duality of the innate immune system. Brain Behav Immun 21:281-9. 77. Grandbarbe, L., J. Bouissac, M. Rand, M. Hrabe de Angelis, S. Artavanis- Tsakonas, and E. Mohier. 2003. Delta-Notch signaling controls the generation of neurons/glia from neural stem cells in a stepwise process. Development 130:1391-402. 78. Groft, L. L., H. Muzik, N. B. Rewcastle, R. N. Johnston, V. Knauper, M. A. Lafleur, P. A. Forsyth, and D. R. Edwards. 2001. Differential expression and localization of TIMP-1 and TIMP-4 in human gliomas. Br J Cancer 85:55-63. 79. Gronostajski, R. M. 2000. Roles of the NFI/CTF gene family in transcription and development. Gene 249:31-45. 80. Grunder, A., F. Qian, T. T. Ebel, A. Mincheva, P. Lichter, U. Kruse, and A. E. Sippel. 2003. Genomic organization, splice products and mouse chromosomal localization of genes for transcription factor Nuclear Factor One. Gene 304:171- 81. 81. Guedez, L., L. Courtemanch, and M. Stetler-Stevenson. 1998. Tissue inhibitor of metalloproteinase (TIMP)-1 induces differentiation and an antiapoptotic phenotype in germinal center B cells. Blood 92:1342-9. 82. Guillemot, F. 2007. Cell fate specification in the mammalian telencephalon. Prog Neurobiol 83:37-52. 83. Guo, C. J., S. D. Douglas, Z. Gao, B. A. Wolf, J. Grinspan, J. P. Lai, E. Riedel, and W. Z. Ho. 2004. Interleukin-1beta upregulates functional expression of neurokinin-1 receptor (NK-1R) via NF-kappaB in astrocytes. Glia 48:259-66. 84. Hall, M. C., D. A. Young, J. G. Waters, A. D. Rowan, A. Chantry, D. R. Edwards, and I. M. Clark. 2003. The comparative role of activator protein 1 and Smad factors in the regulation of Timp-1 and MMP-1 gene expression by transforming growth factor-beta 1. J Biol Chem 278:10304-13. 163
85. Han, R., and T. J. Smith. 2005. Induction by IL-1 beta of tissue inhibitor of metalloproteinase-1 in human orbital fibroblasts: modulation of gene promoter activity by IL-4 and IFN-gamma. J Immunol 174:3072-9. 86. Hayakawa, T., K. Yamashita, K. Tanzawa, E. Uchijima, and K. Iwata. 1992. Growth-promoting activity of tissue inhibitor of metalloproteinases-1 (TIMP-1) for a wide range of cells. A possible new growth factor in serum. FEBS Lett 298:29-32. 87. He, F., W. Ge, K. Martinowich, S. Becker-Catania, V. Coskun, W. Zhu, H. Wu, D. Castro, F. Guillemot, G. Fan, J. de Vellis, and Y. E. Sun. 2005. A positive autoregulatory loop of Jak-STAT signaling controls the onset of astrogliogenesis. Nat Neurosci 8:616-25. 88. Heidtmann, H. H., and J. Travis. 1993. A novel chymotrypsin-like serine proteinase from human lung. Biol Chem Hoppe Seyler 374:871-5. 89. Heinrich, P. C., I. Behrmann, S. Haan, H. M. Hermanns, G. Muller-Newen, and F. Schaper. 2003. Principles of interleukin (IL)-6-type cytokine signalling and its regulation. Biochem J 374:1-20. 90. Hermanson, O., K. Jepsen, and M. G. Rosenfeld. 2002. N-CoR controls differentiation of neural stem cells into astrocytes. Nature 419:934-9. 91. Hiramitsu, T., T. Yasuda, H. Ito, M. Shimizu, S. M. Julovi, T. Kakinuma, M. Akiyoshi, M. Yoshida, and T. Nakamura. 2006. Intercellular adhesion molecule-1 mediates the inhibitory effects of hyaluronan on interleukin-1beta- induced matrix metalloproteinase production in rheumatoid synovial fibroblasts via down-regulation of NF-kappaB and p38. Rheumatology (Oxford) 45:824-32. 92. Ho, H. H., and L. B. Ivashkiv. 2006. Role of STAT3 in type I interferon responses. Negative regulation of STAT1-dependent inflammatory gene activation. J Biol Chem 281:14111-8. 93. Hodge, D. R., E. M. Hurt, and W. L. Farrar. 2005. The role of IL-6 and STAT3 in inflammation and cancer. Eur J Cancer 41:2502-12. 94. Hohlfeld, R., M. Kerschensteiner, and E. Meinl. 2007. Dual role of inflammation in CNS disease. Neurology 68:S58-63; discussion S91-6. 95. Hornebeck, W., E. Lambert, E. Petitfrere, and P. Bernard. 2005. Beneficial and detrimental influences of tissue inhibitor of metalloproteinase-1 (TIMP-1) in tumor progression. Biochimie 87:377-83. 96. Hussain, S. F., L. Y. Kong, J. Jordan, C. Conrad, T. Madden, I. Fokt, W. Priebe, and A. B. Heimberger. 2007. A novel small molecule inhibitor of signal transducers and activators of transcription 3 reverses immune tolerance in malignant glioma patients. Cancer Res 67:9630-6. 97. Hwang, S. R., B. Steineckert, A. Kohn, M. Palkovits, and V. Y. Hook. 1999. Molecular studies define the primary structure of alpha1-antichymotrypsin (ACT) 164
protease inhibitor in Alzheimer's disease brains. Comparison of act in hippocampus and liver. J Biol Chem 274:1821-7. 98. Inoue, T., T. Tamura, T. Furuichi, and K. Mikoshiba. 1990. Isolation of complementary DNAs encoding a cerebellum-enriched nuclear factor I family that activates transcription from the mouse myelin basic protein promoter. J Biol Chem 265:19065-70. 99. Iwamaru, A., S. Szymanski, E. Iwado, H. Aoki, T. Yokoyama, I. Fokt, K. Hess, C. Conrad, T. Madden, R. Sawaya, S. Kondo, W. Priebe, and Y. Kondo. 2007. A novel inhibitor of the STAT3 pathway induces apoptosis in malignant glioma cells both in vitro and in vivo. Oncogene 26:2435-44. 100. Iyer, S., S. Wei, K. Brew, and K. R. Acharya. 2007. Crystal structure of the catalytic domain of matrix metalloproteinase-1 in complex with the inhibitory domain of tissue inhibitor of metalloproteinase-1. J Biol Chem 282:364-71. 101. Jaeckle, K. A., K. V. Ballman, R. D. Rao, R. B. Jenkins, and J. C. Buckner. 2006. Current strategies in treatment of oligodendroglioma: evolution of molecular signatures of response. J Clin Oncol 24:1246-52. 102. Jaworski, D. M. 2000. Differential regulation of tissue inhibitor of metalloproteinase mRNA expression in response to intracranial injury. Glia 30:199-208. 103. John, G. R., S. C. Lee, X. Song, M. Rivieccio, and C. F. Brosnan. 2005. IL-1- regulated responses in astrocytes: relevance to injury and recovery. Glia 49:161- 76. 104. Jourquin, J., E. Tremblay, A. Bernard, G. Charton, F. A. Chaillan, E. Marchetti, F. S. Roman, P. D. Soloway, V. Dive, A. Yiotakis, M. Khrestchatisky, and S. Rivera. 2005. Tissue inhibitor of metalloproteinases-1 (TIMP-1) modulates neuronal death, axonal plasticity, and learning and memory. Eur J Neurosci 22:2569-78. 105. Kaczmarek, L., J. Lapinska-Dzwonek, and S. Szymczak. 2002. Matrix metalloproteinases in the adult brain physiology: a link between c-Fos, AP-1 and remodeling of neuronal connections? Embo J 21:6643-8. 106. Kaminska, B. 2005. MAPK signalling pathways as molecular targets for anti- inflammatory therapy--from molecular mechanisms to therapeutic benefits. Biochim Biophys Acta 1754:253-62. 107. Kaneko, Y., S. Sakakibara, T. Imai, A. Suzuki, Y. Nakamura, K. Sawamoto, Y. Ogawa, Y. Toyama, T. Miyata, and H. Okano. 2000. Musashi1: an evolutionally conserved marker for CNS progenitor cells including neural stem cells. Dev Neurosci 22:139-53. 108. Karin, M., and F. R. Greten. 2005. NF-kappaB: linking inflammation and immunity to cancer development and progression. Nat Rev Immunol 5:749-59. 165
109. Kasza, A., D. L. Kiss, S. Gopalan, W. Xu, R. E. Rydel, A. Koj, and T. Kordula. 2002. Mechanism of plasminogen activator inhibitor-1 regulation by oncostatin M and interleukin-1 in human astrocytes. J Neurochem 83:696-703. 110. Kasza, A., M. Kowanetz, K. Poslednik, B. Witek, T. Kordula, and A. Koj. 2001. Epidermal growth factor and pro-inflammatory cytokines regulate the expression of components of plasminogen activation system in U373-MG astrocytoma cells. Cytokine 16:187-90. 111. Kiss, D. L., W. Xu, S. Gopalan, K. Buzanowska, K. M. Wilczynska, R. E. Rydel, and T. Kordula. 2005. Duration of alpha 1-antichymotrypsin gene activation by interleukin-1 is determined by efficiency of inhibitor of nuclear factor kappa B alpha resynthesis in primary human astrocytes. J Neurochem 92:730-8. 112. Kleihues, P., D. N. Louis, B. W. Scheithauer, L. B. Rorke, G. Reifenberger, P. C. Burger, and W. K. Cavenee. 2002. The WHO classification of tumors of the nervous system. J Neuropathol Exp Neurol 61:215-25; discussion 226-9. 113. Koeller, K. K., and E. J. Rushing. 2005. From the archives of the AFIP: Oligodendroglioma and its variants: radiologic-pathologic correlation. Radiographics 25:1669-88. 114. Koj, A. 1985. Cytokines regulating acute inflammation and synthesis of acute phase proteins. Blut 51:267-74. 115. Kordula, T., M. Bugno, R. E. Rydel, and J. Travis. 2000. Mechanism of interleukin-1- and tumor necrosis factor alpha-dependent regulation of the alpha 1-antichymotrypsin gene in human astrocytes. J Neurosci 20:7510-6. 116. Kordula, T., M. Bugno, R. E. Rydel, and J. Travis. 2000. Mechanism of interleukin-1- and tumor necrosis factor alpha-dependent regulation of the alpha 1-antichymotrypsin gene in human astrocytes. J Neurosci 20:7510-6. 117. Kordula, T., R. E. Rydel, E. F. Brigham, F. Horn, P. C. Heinrich, and J. Travis. 1998. Oncostatin M and the interleukin-6 and soluble interleukin-6 receptor complex regulate alpha1-antichymotrypsin expression in human cortical astrocytes. J Biol Chem 273:4112-8. 118. Krona, A., S. Jarnum, L. G. Salford, B. Widegren, and P. Aman. 2005. Oncostatin M signaling in human glioma cell lines. Oncol Rep 13:807-11. 119. Kumar, K. U., A. Pater, and M. M. Pater. 1993. Human JC virus perfect palindromic nuclear factor 1-binding sequences important for glial cell-specific expression in differentiating embryonal carcinoma cells. J Virol 67:572-6. 120. Kunze, E., F. Theuring, and G. Kruger. 1994. Primary mesenchymal tumors of the urinary bladder. A histological and immunohistochemical study of 30 cases. Pathol Res Pract 190:311-32. 121. Kurtz, A., A. Zimmer, F. Schnutgen, G. Bruning, F. Spener, and T. Muller. 1994. The expression pattern of a novel gene encoding brain-fatty acid binding 166
protein correlates with neuronal and glial cell development. Development 120:2637-49. 122. Lai, R., G. Z. Rassidakis, L. J. Medeiros, L. Ramdas, A. H. Goy, C. Cutler, Y. Fujio, K. Kunisada, H. M. Amin, and F. Gilles. 2004. Signal transducer and activator of transcription-3 activation contributes to high tissue inhibitor of metalloproteinase-1 expression in anaplastic lymphoma kinase-positive anaplastic large cell lymphoma. Am J Pathol 164:2251-8. 123. Laird, M. D., J. R. Vender, and K. M. Dhandapani. 2008. Opposing roles for reactive astrocytes following traumatic brain injury. Neurosignals 16:154-64. 124. Lambert, E., C. Boudot, Z. Kadri, M. Soula-Rothhut, M. L. Sowa, P. Mayeux, W. Hornebeck, B. Haye, and E. Petitfrere. 2003. Tissue inhibitor of metalloproteinases-1 signalling pathway leading to erythroid cell survival. Biochem J 372:767-74. 125. Lawrence, D. M., P. Seth, L. Durham, F. Diaz, R. Boursiquot, R. M. Ransohoff, and E. O. Major. 2006. Astrocyte differentiation selectively upregulates CCL2/monocyte chemoattractant protein-1 in cultured human brain- derived progenitor cells. Glia 53:81-91. 126. Lawrence, T., M. Bebien, G. Y. Liu, V. Nizet, and M. Karin. 2005. IKKalpha limits macrophage NF-kappaB activation and contributes to the resolution of inflammation. Nature 434:1138-43. 127. Lemke, D. M. 2004. Epidemiology, diagnosis, and treatment of patients with metastatic cancer and high-grade gliomas of the central nervous system. J Infus Nurs 27:263-9. 128. Levy, D. E., and J. E. Darnell, Jr. 2002. Stats: transcriptional control and biological impact. Nat Rev Mol Cell Biol 3:651-62. 129. Lin, W. W., and M. Karin. 2007. A cytokine-mediated link between innate immunity, inflammation, and cancer. J Clin Invest 117:1175-83. 130. Liu, X. W., M. M. Bernardo, R. Fridman, and H. R. Kim. 2003. Tissue inhibitor of metalloproteinase-1 protects human breast epithelial cells against intrinsic apoptotic cell death via the focal adhesion kinase/phosphatidylinositol 3- kinase and MAPK signaling pathway. J Biol Chem 278:40364-72. 131. Liu, Y., S. S. Han, Y. Wu, T. M. Tuohy, H. Xue, J. Cai, S. A. Back, L. S. Sherman, I. Fischer, and M. S. Rao. 2004. CD44 expression identifies astrocyte-restricted precursor cells. Dev Biol 276:31-46. 132. Lu, Q. R., J. K. Park, E. Noll, J. A. Chan, J. Alberta, D. Yuk, M. G. Alzamora, D. N. Louis, C. D. Stiles, D. H. Rowitch, and P. M. Black. 2001. Oligodendrocyte lineage genes (OLIG) as molecular markers for human glial brain tumors. Proc Natl Acad Sci U S A 98:10851-6. 167
133. Lu, T., L. Tian, Y. Han, M. Vogelbaum, and G. R. Stark. 2007. Dose- dependent cross-talk between the transforming growth factor-beta and interleukin- 1 signaling pathways. Proc Natl Acad Sci U S A 104:4365-70. 134. Lucas, S. M., N. J. Rothwell, and R. M. Gibson. 2006. The role of inflammation in CNS injury and disease. Br J Pharmacol 147 Suppl 1:S232-40. 135. Ma, J., A. Yee, H. B. Brewer, Jr., S. Das, and H. Potter. 1994. Amyloid- associated proteins alpha 1-antichymotrypsin and apolipoprotein E promote assembly of Alzheimer beta-protein into filaments. Nature 372:92-4. 136. Maher, E. A., F. B. Furnari, R. M. Bachoo, D. H. Rowitch, D. N. Louis, W. K. Cavenee, and R. A. DePinho. 2001. Malignant glioma: genetics and biology of a grave matter. Genes Dev 15:1311-33. 137. Maragakis, N. J., M. S. Rao, J. Llado, V. Wong, H. Xue, A. Pardo, J. Herring, D. Kerr, C. Coccia, and J. D. Rothstein. 2005. Glial restricted precursors protect against chronic glutamate neurotoxicity of motor neurons in vitro. Glia 50:145-59. 138. Martin, M. U., and H. Wesche. 2002. Summary and comparison of the signaling mechanisms of the Toll/interleukin-1 receptor family. Biochim Biophys Acta 1592:265-80. 139. Maurer, M., and E. von Stebut. 2004. Macrophage inflammatory protein-1. Int J Biochem Cell Biol 36:1882-6. 140. McKay, M. M., and D. K. Morrison. 2007. Integrating signals from RTKs to ERK/MAPK. Oncogene 26:3113-21. 141. McKinnon, P. J., and R. F. Margolskee. 1996. SC1: a marker for astrocytes in the adult rodent brain is upregulated during reactive astrocytosis. Brain Res 709:27-36. 142. Menten, P., A. Wuyts, and J. Van Damme. 2002. Macrophage inflammatory protein-1. Cytokine Growth Factor Rev 13:455-81. 143. Miller, F. D., and A. S. Gauthier. 2007. Timing is everything: making neurons versus glia in the developing cortex. Neuron 54:357-69. 144. Moses, M. A., J. Sudhalter, and R. Langer. 1990. Identification of an inhibitor of neovascularization from cartilage. Science 248:1408-10. 145. Moynagh, P. N. 2005. The interleukin-1 signalling pathway in astrocytes: a key contributor to inflammation in the brain. J Anat 207:265-9. 146. Mrak, R. E., and W. S. Griffin. 2001. Interleukin-1, neuroinflammation, and Alzheimer's disease. Neurobiol Aging 22:903-8. 147. Mucke, L., and M. Eddleston. 1993. Astrocytes in infectious and immune- mediated diseases of the central nervous system. Faseb J 7:1226-32. 148. Muller, F. J., E. Y. Snyder, and J. F. Loring. 2006. Gene therapy: can neural stem cells deliver? Nat Rev Neurosci 7:75-84. 168
149. Nagase, H., Q. Meng, V. Malinovskii, W. Huang, L. Chung, W. Bode, K. Maskos, and K. Brew. 1999. Engineering of selective TIMPs. Ann N Y Acad Sci 878:1-11. 150. Nagase, H., and J. F. Woessner, Jr. 1999. Matrix metalloproteinases. J Biol Chem 274:21491-4. 151. Nakahira, K., K. Ikenaka, K. Wada, T. Tamura, T. Furuichi, and K. Mikoshiba. 1990. Structure of the 68-kDa neurofilament gene and regulation of its expression. J Biol Chem 265:19786-91. 152. Nakashima, K., M. Yanagisawa, H. Arakawa, N. Kimura, T. Hisatsune, M. Kawabata, K. Miyazono, and T. Taga. 1999. Synergistic signaling in fetal brain by STAT3-Smad1 complex bridged by p300. Science 284:479-82. 153. Nat, R., M. Nilbratt, S. Narkilahti, B. Winblad, O. Hovatta, and A. Nordberg. 2007. Neurogenic neuroepithelial and radial glial cells generated from six human embryonic stem cell lines in serum-free suspension and adherent cultures. Glia 55:385-99. 154. Ng, H. K., and S. T. Lo. 1988. Immunostaining for alpha 1-antichymotrypsin and alpha 1-antitrypsin in gliomas. Histopathology 13:79-87. 155. Nichols, J., B. Zevnik, K. Anastassiadis, H. Niwa, D. Klewe-Nebenius, I. Chambers, H. Scholer, and A. Smith. 1998. Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4. Cell 95:379-91. 156. Norenberg, M. D. 1994. Astrocyte responses to CNS injury. J Neuropathol Exp Neurol 53:213-20. 157. Novak, A., N. Goyal, and R. M. Gronostajski. 1992. Four conserved cysteine residues are required for the DNA binding activity of nuclear factor I. J Biol Chem 267:12986-90. 158. Ochiai, W., M. Yanagisawa, T. Takizawa, K. Nakashima, and T. Taga. 2001. Astrocyte differentiation of fetal neuroepithelial cells involving cardiotrophin-1- induced activation of STAT3. Cytokine 14:264-71. 159. O'Sullivan, L. A., C. Liongue, R. S. Lewis, S. E. Stephenson, and A. C. Ward. 2007. Cytokine receptor signaling through the Jak-Stat-Socs pathway in disease. Mol Immunol 44:2497-506. 160. Pagenstecher, A., A. K. Stalder, C. L. Kincaid, S. D. Shapiro, and I. L. Campbell. 1998. Differential expression of matrix metalloproteinase and tissue inhibitor of matrix metalloproteinase genes in the mouse central nervous system in normal and inflammatory states. Am J Pathol 152:729-41. 161. Pekny, M., and M. Pekna. 2004. Astrocyte intermediate filaments in CNS pathologies and regeneration. J Pathol 204:428-37. 162. Petitfrere, E., Z. Kadri, C. Boudot, M. L. Sowa, P. Mayeux, B. Haye, and C. Billat. 2000. Involvement of the p38 mitogen-activated protein kinase pathway in 169
tissue inhibitor of metalloproteinases-1-induced erythroid differentiation. FEBS Lett 485:117-21. 163. Plachez, C., C. Lindwall, N. Sunn, M. Piper, R. X. Moldrich, C. E. Campbell, J. M. Osinski, R. M. Gronostajski, and L. J. Richards. 2008. Nuclear factor I gene expression in the developing forebrain. J Comp Neurol 508:spc1. 164. Pollard, S. M., L. Conti, Y. Sun, D. Goffredo, and A. Smith. 2006. Adherent neural stem (NS) cells from fetal and adult forebrain. Cereb Cortex 16 Suppl 1:i112-20. 165. Qian, F., U. Kruse, P. Lichter, and A. E. Sippel. 1995. Chromosomal localization of the four genes (NFIA, B, C, and X) for the human transcription factor nuclear factor I by FISH. Genomics 28:66-73. 166. Rahaman, S. O., P. C. Harbor, O. Chernova, G. H. Barnett, M. A. Vogelbaum, and S. J. Haque. 2002. Inhibition of constitutively active Stat3 suppresses proliferation and induces apoptosis in glioblastoma multiforme cells. Oncogene 21:8404-13. 167. Rahaman, S. O., M. A. Vogelbaum, and S. J. Haque. 2005. Aberrant Stat3 signaling by interleukin-4 in malignant glioma cells: involvement of IL- 13Ralpha2. Cancer Res 65:2956-63. 168. Repovic, P., and E. N. Benveniste. 2002. Prostaglandin E2 is a novel inducer of oncostatin-M expression in macrophages and microglia. J Neurosci 22:5334-43. 169. Reya, T., S. J. Morrison, M. F. Clarke, and I. L. Weissman. 2001. Stem cells, cancer, and cancer stem cells. Nature 414:105-11. 170. Rho, S. B., B. M. Chung, and J. H. Lee. 2007. TIMP-1 regulates cell proliferation by interacting with the ninth zinc finger domain of PLZF. J Cell Biochem 101:57-67. 171. Richardson, R. M., K. L. Holloway, M. R. Bullock, W. C. Broaddus, and H. L. Fillmore. 2006. Isolation of neuronal progenitor cells from the adult human neocortex. Acta Neurochir (Wien) 148:773-7. 172. Ritter, L. M., S. H. Garfield, and U. P. Thorgeirsson. 1999. Tissue inhibitor of metalloproteinases-1 (TIMP-1) binds to the cell surface and translocates to the nucleus of human MCF-7 breast carcinoma cells. Biochem Biophys Res Commun 257:494-9. 173. Ross, S. E., M. E. Greenberg, and C. D. Stiles. 2003. Basic helix-loop-helix factors in cortical development. Neuron 39:13-25. 174. Rothwell, N. J., and G. N. Luheshi. 2000. Interleukin 1 in the brain: biology, pathology and therapeutic target. Trends Neurosci 23:618-25. 175. Ruiz i Altaba, A., C. Mas, and B. Stecca. 2007. The Gli code: an information nexus regulating cell fate, stemness and cancer. Trends Cell Biol 17:438-47. 170
176. Russell, J. S., and P. J. Tofilon. 2002. Radiation-induced activation of nuclear factor-kappaB involves selective degradation of plasma membrane-associated I(kappa)B(alpha). Mol Biol Cell 13:3431-40. 177. Saporta, S. 1992. How plastic is the central nervous system? J Fla Med Assoc 79:645-7. 178. Sasaki, C. Y., T. J. Barberi, P. Ghosh, and D. L. Longo. 2005. Phosphorylation of RelA/p65 on serine 536 defines an I{kappa}B{alpha}-independent NF- {kappa}B pathway. J Biol Chem 280:34538-47. 179. Sauvageot, C. M., and C. D. Stiles. 2002. Molecular mechanisms controlling cortical gliogenesis. Curr Opin Neurobiol 12:244-9. 180. Sawadogo, M. 1988. Multiple forms of the human gene-specific transcription factor USF. II. DNA binding properties and transcriptional activity of the purified HeLa USF. J Biol Chem 263:11994-2001. 181. Sergent-Tanguy, S., D. C. Michel, I. Neveu, and P. Naveilhan. 2006. Long- lasting coexpression of nestin and glial fibrillary acidic protein in primary cultures of astroglial cells with a major participation of nestin(+)/GFAP(-) cells in cell proliferation. J Neurosci Res 83:1515-24. 182. Shibata, T., K. Yamada, M. Watanabe, K. Ikenaka, K. Wada, K. Tanaka, and Y. Inoue. 1997. Glutamate transporter GLAST is expressed in the radial glia- astrocyte lineage of developing mouse spinal cord. J Neurosci 17:9212-9. 183. Shin, S., M. Mitalipova, S. Noggle, D. Tibbitts, A. Venable, R. Rao, and S. L. Stice. 2006. Long-term proliferation of human embryonic stem cell-derived neuroepithelial cells using defined adherent culture conditions. Stem Cells 24:125-38. 184. Shu, T., K. G. Butz, C. Plachez, R. M. Gronostajski, and L. J. Richards. 2003. Abnormal development of forebrain midline glia and commissural projections in Nfia knock-out mice. J Neurosci 23:203-12. 185. Singh, S. K., I. D. Clarke, M. Terasaki, V. E. Bonn, C. Hawkins, J. Squire, and P. B. Dirks. 2003. Identification of a cancer stem cell in human brain tumors. Cancer Res 63:5821-8. 186. Singh, S. K., C. Hawkins, I. D. Clarke, J. A. Squire, J. Bayani, T. Hide, R. M. Henkelman, M. D. Cusimano, and P. B. Dirks. 2004. Identification of human brain tumour initiating cells. Nature 432:396-401. 187. Smith, D., T. Shimamura, S. Barbera, and B. E. Bejcek. 2008. NF-kappaB controls growth of glioblastomas/astrocytomas. Mol Cell Biochem 307:141-7. 188. Steele-Perkins, G., K. G. Butz, G. E. Lyons, M. Zeichner-David, H. J. Kim, M. I. Cho, and R. M. Gronostajski. 2003. Essential role for NFI-C/CTF transcription-replication factor in tooth root development. Mol Cell Biol 23:1075- 84. 171
189. Steele-Perkins, G., C. Plachez, K. G. Butz, G. Yang, C. J. Bachurski, S. L. Kinsman, E. D. Litwack, L. J. Richards, and R. M. Gronostajski. 2005. The transcription factor gene Nfib is essential for both lung maturation and brain development. Mol Cell Biol 25:685-98. 190. Stylianou, E., and J. Saklatvala. 1998. Interleukin-1. Int J Biochem Cell Biol 30:1075-9. 191. Suffredini, A. F., G. Fantuzzi, R. Badolato, J. J. Oppenheim, and N. P. O'Grady. 1999. New insights into the biology of the acute phase response. J Clin Immunol 19:203-14. 192. Suryadevara, R., S. Holter, K. Borgmann, R. Persidsky, C. Labenz-Zink, Y. Persidsky, H. E. Gendelman, L. Wu, and A. Ghorpade. 2003. Regulation of tissue inhibitor of metalloproteinase-1 by astrocytes: links to HIV-1 dementia. Glia 44:47-56. 193. Tan, T. T., and L. M. Coussens. 2007. Humoral immunity, inflammation and cancer. Curr Opin Immunol 19:209-16. 194. Tanaka, M., and A. Miyajima. 2003. Oncostatin M, a multifunctional cytokine. Rev Physiol Biochem Pharmacol 149:39-52. 195. Temple, S. 2001. The development of neural stem cells. Nature 414:112-7. 196. Tong, L., D. Smyth, C. Kerr, J. Catterall, and C. D. Richards. 2004. Mitogen- activated protein kinases Erk1/2 and p38 are required for maximal regulation of TIMP-1 by oncostatin M in murine fibroblasts. Cell Signal 16:1123-32. 197. Trim, J. E., S. K. Samra, M. J. Arthur, M. C. Wright, M. McAulay, R. Beri, and D. A. Mann. 2000. Upstream tissue inhibitor of metalloproteinases-1 (TIMP- 1) element-1, a novel and essential regulatory DNA motif in the human TIMP-1 gene promoter, directly interacts with a 30-kDa nuclear protein. J Biol Chem 275:6657-63. 198. Ueda, A., K. Okuda, S. Ohno, A. Shirai, T. Igarashi, K. Matsunaga, J. Fukushima, S. Kawamoto, Y. Ishigatsubo, and T. Okubo. 1994. NF-kappa B and Sp1 regulate transcription of the human monocyte chemoattractant protein-1 gene. J Immunol 153:2052-63. 199. Valente, P., G. Fassina, A. Melchiori, L. Masiello, M. Cilli, A. Vacca, M. Onisto, L. Santi, W. G. Stetler-Stevenson, and A. Albini. 1998. TIMP-2 over- expression reduces invasion and angiogenesis and protects B16F10 melanoma cells from apoptosis. Int J Cancer 75:246-53. 200. Valter, M. M., O. D. Wiestler, and T. Pietsche. 1999. Differential control of VEGF synthesis and secretion in human glioma cells by IL-1 and EGF. Int J Dev Neurosci 17:565-77. 201. van den Bent, M. J. 2004. Advances in the biology and treatment of oligodendrogliomas. Curr Opin Neurol 17:675-80. 172
202. van der Meulen, J. D., H. J. Houthoff, and E. J. Ebels. 1978. Glial fibrillary acidic protein in human gliomas. Neuropathol Appl Neurobiol 4:177-90. 203. VanMeter, T. E., H. K. Rooprai, M. M. Kibble, H. L. Fillmore, W. C. Broaddus, and G. J. Pilkington. 2001. The role of matrix metalloproteinase genes in glioma invasion: co-dependent and interactive proteolysis. J Neurooncol 53:213-35. 204. Wang, C. X., and A. Shuaib. 2002. Involvement of inflammatory cytokines in central nervous system injury. Prog Neurobiol 67:161-72. 205. Wang, T., K. Yamashita, K. Iwata, and T. Hayakawa. 2002. Both tissue inhibitors of metalloproteinases-1 (TIMP-1) and TIMP-2 activate Ras but through different pathways. Biochem Biophys Res Commun 296:201-5. 206. Wang, W., R. E. Stock, R. M. Gronostajski, Y. W. Wong, M. Schachner, and D. L. Kilpatrick. 2004. A role for nuclear factor I in the intrinsic control of cerebellar granule neuron gene expression. J Biol Chem 279:53491-7. 207. Wilcockson, D. C., S. J. Campbell, D. C. Anthony, and V. H. Perry. 2002. The systemic and local acute phase response following acute brain injury. J Cereb Blood Flow Metab 22:318-26. 208. Williams, A., G. Piaton, and C. Lubetzki. 2007. Astrocytes--friends or foes in multiple sclerosis? Glia 55:1300-12. 209. Xia, P., L. Wang, P. A. Moretti, N. Albanese, F. Chai, S. M. Pitson, R. J. D'Andrea, J. R. Gamble, and M. A. Vadas. 2002. Sphingosine kinase interacts with TRAF2 and dissects tumor necrosis factor-alpha signaling. J Biol Chem 277:7996-8003. 210. Yanagisawa, M., K. Nakashima, T. Takizawa, W. Ochiai, H. Arakawa, and T. Taga. 2001. Signaling crosstalk underlying synergistic induction of astrocyte differentiation by BMPs and IL-6 family of cytokines. FEBS Lett 489:139-43. 211. Yang, E. V., C. M. Bane, R. C. MacCallum, J. K. Kiecolt-Glaser, W. B. Malarkey, and R. Glaser. 2002. Stress-related modulation of matrix metalloproteinase expression. J Neuroimmunol 133:144-50. 212. Yu, H., M. Kortylewski, and D. Pardoll. 2007. Crosstalk between cancer and immune cells: role of STAT3 in the tumour microenvironment. Nat Rev Immunol 7:41-51. 213. Yuan, X., J. Curtin, Y. Xiong, G. Liu, S. Waschsmann-Hogiu, D. L. Farkas, K. L. Black, and J. S. Yu. 2004. Isolation of cancer stem cells from adult glioblastoma multiforme. Oncogene 23:9392-400. 214. Zecevic, N., A. Andjelkovic, J. Matthieu, and M. Tosic. 1998. Myelin basic protein immunoreactivity in the human embryonic CNS. Brain Res Dev Brain Res 105:97-108. 215. Zhang, Y. J., B. J. Rutledge, and B. J. Rollins. 1994. Structure/activity analysis of human monocyte chemoattractant protein-1 (MCP-1) by mutagenesis. 173
Identification of a mutated protein that inhibits MCP-1-mediated monocyte chemotaxis. J Biol Chem 269:15918-24. 216. Zhao, W. Q., H. Li, K. Yamashita, X. K. Guo, T. Hoshino, S. Yoshida, T. Shinya, and T. Hayakawa. 1998. Cell cycle-associated accumulation of tissue inhibitor of metalloproteinases-1 (TIMP-1) in the nuclei of human gingival fibroblasts. J Cell Sci 111 ( Pt 9):1147-53. 217. Zhong, H., M. J. May, E. Jimi, and S. Ghosh. 2002. The phosphorylation status of nuclear NF-kappa B determines its association with CBP/p300 or HDAC-1. Mol Cell 9:625-36. 218. Zhu, Y., and L. F. Parada. 2002. The molecular and genetic basis of neurological tumours. Nat Rev Cancer 2:616-26. 219. Zimmer, D. B., E. H. Cornwall, A. Landar, and W. Song. 1995. The S100 protein family: history, function, and expression. Brain Res Bull 37:417-29.
174
VITA
KATARZYNA MARTA WILCZYNSKA Department of Biochemistry and Molecular Biology Virginia Commonwealth University School of Medicine 1101 East Marshall St., Room 2-016n Richmond, VA 23298, USA Phone: 804-828-0166 Email: [email protected]
PERSONAL INFORMATION
Date of Birth August 28th 1978 Place of Birth Krakow, Poland Citizenship Polish Visa Status F1 (Student Visa)
EDUCATION
PhD Biochemistry and Molecular Biology, Virginia Commonwealth University, 2008 M.Sc Biotechnology, Jagiellonian University, 2003
AWARDS
2008 Thesis/Dissertation Assistantship, VCU Graduate School 2007 Phi Kappa Phi Scholarship, VCU School of Medicine 2007 Phi Kappa Phi Society Membership 2006 Clayton Award, VCU School of Medicine 175
2006 Outstanding Poster Presentation, VCU ICAMS Research Symposium 2000-2003 Stipend for Outstanding Students of Biotechnology, Jagiellonian University 2002 Socrates/Erasmus Scholarship, European Union
PUBLICATIONS
1. Wilczynska KM, Gopalan SM, Bugno M, Kasza A, Konik BS, Bryan L, Wright S, Griswold-Prenner I, Kordula T. A Novel Mechanism Of Tissue Inhibitor Of Metalloproteinases-1 Activation By Interleukin-1 In Primary Human Astrocytes. J Biol Chem. 281:34955-64, 2006.
2. Gopalan SM, Wilczynska KM, Konik BS, Bryan L, Kordula T. Nuclear Factor- 1-X Regulates Astrocyte-Specific Expression Of The Alpha1-Antichymotrypsin And Glial Fibrillary Acidic Protein Genes. J Biol Chem. 281:13126-33, 2006.
3. Gopalan SM, Wilczynska KM, Konik BS, Bryan L, Kordula T. Astrocyte- Specific Expression Of The Alpha 1-Antichymotrypsin And Glial Fibrillary Acidic Protein Genes Requires Activator Protein-1. J.Biol Chem. 281: 1956-63, 2006.
4. Gopalan S, Kasza A, Xu W, Kiss DL, Wilczynska KM, Rydel RE, Kordula T. Astrocyte- And Hepatocyte-Specific Expression Of Genes From The Distal Serpin Subcluster At 14q32.1 Associates With Tissue-Specific Chromatin Structures. J Neurochem. 94:763-73, 2005.
5. Kiss DL, Xu W, Gopalan S, Buzanowska K, Wilczynska KM, Rydel RE, Kordula T. Duration Of Alpha 1-Antichymotrypsin Gene Activation By Interleukin-1 Is Determined By Efficiency Of Inhibitor Of Nuclear Factor Kappa B Alpha Resynthesis In Primary Human Astrocytes. J Neurochem. 92:730-8, 2005.
6. Paugh BS, Paugh SW, Bryan L, Kapitonov D, Wilczynska KM, Gopalan S, Rokita H, Milstein S, Spiegel S, Kordula T. EGF Regulates Plasminogen Activator Inhibitor-1 By A Pathway Involving c-Src, PKCδ And Sphingosine Kinase 1 In Glioblastoma Cells. : FASEB J. 2007 Sep 12; [Epub ahead of print]
176
7. Bryan LE, Paugh BS, Kapitonov D, Wilczynska KM, Alvarez SM, Singh SK, Milstein S, Spiegel S, Kordula T. Sphingosine-1-Phosphate And Interleukin-1 Cooperatively Regulate Plasminogen Activator System In Gliomas; Implications For Invasion. (Submitted)
8. Paugh BS, Paugh SW, Bryan LE, Kapitonov D, Wilczynska KM, Alvarez SM, Singh SK, Rokita H, Milstein S, Spiegel S, Kordula T. Interleukin-1 Regulates Expression Of Sphingosine Kinase 1 Via Activation Of JNK/C-JUN Pathway In Glioblastoma Cells. (Submitted)
9. Wilczynska KM, Alvarez SM, Singh SK, Szelag M, Bryan LE, Paugh BS, Fillmore H, Fang X, Kordula T. Constitutively Active STAT3 Promotes The Growth Of Oligodendroglioma Tumors. (In Preparation)
10. Wilczynska KM, Singh SK, Adams, B, Bryan LE, Alvarez SM, Paugh BS, Rao R, Kordula T. A Role of Nuclear Factor I in Astrocyte Differentiation. (In Preparation)