Natural Competence in Strains of Actinobacillus Pleuropneumoniae Janine T
Total Page：16
File Type：pdf, Size：1020Kb
RESEARCH LETTER Natural competence in strains of Actinobacillus pleuropneumoniae Janine T. Bosse´ 1, Sunita Sinha1,2, Timo Schippers1, J. Simon Kroll1, Rosemary J. Redfield2 & Paul R. Langford1 1Molecular Infectious Disease Group, Department of Paediatrics, Imperial College London, London, UK; and 2Department of Zoology, University of British Columbia, Vancouver, BC, Canada Correspondence: Janine T. Bosse,´ Molecular Abstract Infectious Disease Group, Department of Paediatrics, Imperial College London, Norfolk We have identified a highly transformable strain of Actinobacillus pleuropneumoniae Place, London W2 1PG, UK. Tel.: 144 020 whose competence is regulated by the competence-activator Sxy as in other 7594 3717; fax: 144 020 7594 3984; Pasteurellaceae. Other strains were poorly transformable or nontransformable. The e-mail: [email protected] genomes of two poorly transformable strains contain intact sets of competence genes. Moreover, we show that the low competence of one of these strains is not due Received 27 February 2009; accepted 19 June to an inability to induce sxy expression or to a defect in Sxy function, suggesting 2009. that some other component of the competence system is defective. Although the Final version published online 16 July 2009. A. pleuropneumoniae sxy gene has only 24% identity to its Haemophilus influenzae homologue, both genes fully complemented an H. influenzae sxy knockout, DOI:10.1111/j.1574-6968.2009.01706.x demonstrating that Sxy function is conserved throughout the Pasteurellaceae. Editor: Arnoud van Vliet Keywords Actinobacillus pleuropneumoniae; Sxy; natural competence; transformation. strongly when cells are transferred to the starvation medium Introduction MIV, and to a lesser extent at the onset of the stationary phase Natural competence, the ability of many bacteria to take up in a rich medium (Herriott et al., 1970; Redfield et al., 2005). DNA from their environment, is usually tightly regulated These genes share a common promoter motif (CRP-S site) (Solomon & Grossman, 1996). Once inside the cell, the that requires both cyclic AMP receptor protein (CRP), the DNA can serve as a source of nutrients or can recombine global regulator of carbon and energy metabolism, and Sxy, a with the host chromosome to transform the recipient cell. specific positive regulator of competence (Zulty & Barcak, Transformation is a valuable genetic tool, but its use in the 1995; Redfield et al., 2005; Cameron & Redfield, 2006). swine pathogen Actinobacillus pleuropneumoniae has been The failure of A. pleuropneumoniae cultures to respond to limited both by the poor transformability of clinically the standard competence induction protocol is surprising in relevant strains and by our lack of understanding of compe- the light of recent evidence that a common mechanism of tence regulation in this organism. Two strains have been competence induction and regulation is shared not only by reported to be naturally competent, but transformation and other Pasteurellaceae (Aggregatibacter actinomycetemcomitans DNA uptake occurred at very low frequencies and compe- and Haemophilus parainfluenzae) but also by species in other tence was not detectably induced by the standard protocol genera (Vibrio cholerae and Escherichia coli) (Gromkova et al., used for other Pasteurellaceae (Rowji et al., 1989; Gromkova 1998; Wang et al., 2002; Meibom et al., 2005; Cameron & et al., 1998; Bosse´ et al., 2004; Fujise et al., 2004; Redfield Redfield, 2006; Bhattacharjee et al., 2007; Sinha et al., 2009). et al., 2006; Maughan & Redfield, 2009). As has been observed in H. influenzae, expression of plasmid- Competence regulation in Gram-negative bacteria has borne sxy in these species is known to induce the CRP-S been best studied in the pasteurellacean Haemophilus influ- regulon and/or to cause near-constitutive natural compe- MICROBIOLOGY LETTERS MICROBIOLOGY enzae, which takes up DNA under conditions of nutrient tence. Phylogenetic analysis has shown that A. pleuropneumo- limitation (MacFadyen et al., 1996, 2001; Maughan et al., niae and H. influenzae belong to two divergent 2008). Genes required for DNA uptake, transport and pasteurellacean subclades (Redfield et al., 2006), raising the processing form a competence regulon that is upregulated possibility that the two clades regulate competence c 2009 Federation of European Microbiological Societies FEMS Microbiol Lett 298 (2009) 124–130 Published by Blackwell Publishing Ltd. All rights reserved Sxy and natural competence in A. pleuropneumoniae 125 differently. Sequenced pasteurellacean genomes in both sub- (Fodor et al., 1989; MacDonald & Rycroft, 1992; Nielsen clades have predicted CRP-S sites preceding their competence et al., 1997; Sheehan et al., 2000; Blackall et al., 2002). All gene homologues (Cameron & Redfield, 2006), but the strains were grown on brain–heart infusion (BHI) agar regulation of Sxy and its role in their induction has not been supplemented with 10% Levinthal’s base (prepared as investigated in the A. pleuropneumoniae subclade. Alterna- described in Bosse´ et al., 2004) (BHI-L), or in BHI broth tively, the failure to detect competence induction may simply supplemented with 100 mgmLÀ1 b-NAD (BHI-N). Haemo- be an artefact of a lack of sensitivity, as the maximum philus influenzae strains Rd KW20, sxy<kan and MAP7 transformation frequencies in the two tested strains were (Zulty & Barcak, 1995; Poje & Redfield, 2003) were grown in close to the limit of detection (Bosse´ et al., 2004). BHI broth or agar supplemented with 10 mgmLÀ1 hemin Competence is not typically a species-specific property: in and 2 mgmLÀ1 NAD (BHI-HN). All strains were grown many species, different strains are known to differ dramati- at 37 1C. Where necessary, the media were supplemented cally in transformability (Rowji et al., 1989; Gromkova et al., with 50 mgmLÀ1 kanamycin, 1 mgmLÀ1 chloramphenicol or 1998; Fujise et al., 2004; Bhattacharjee et al., 2007; Maughan 2.5 mgmLÀ1 novobiocin. & Redfield, 2009). We therefore surveyed A. pleuropneumo- niae reference strains for their ability to transform naturally. Inactivation of A. pleuropneumoniae sxy This work identified one strain whose transformation fre- In order to inactivate A. pleuropneumoniae sxy, two regions of quency was substantially higher than the previously tested DNA flanking and including A. pleuropneumoniae sxy were strains, and whose competence is regulated similarly to PCR amplified from the chromosome of strain HS143 using that of H. influenzae and other Pasteurellaceae. To begin primers sxyUp_F (CGGATACGGATTCTTTGGTTCTGC) and addressing the cause of the poor transformability of other sxyUp_RBamHI (CATAGAGGGCGAACATAGGATCCTC; A. pleuropneumoniae strains, we investigated the role of BamHI site underlined), and primers sxyDown_FBamHI differences in Sxy expression and function. (CTCATTGGATCCTCTCTGCTATCGAAG; BamHI site un- derlined) and sxyDown_R (CTACCGCAGGGATAGTTTGTT Materials and methods CAACC). Both PCR products were digested with BamHI, ligated using the Rapid DNA ligation kit (Roche) and ream- Bacterial strains and growth conditions plified using primers sxyUp_F/sxyDown_R. The resulting 1.5-kb fragment [containing a truncated sxy gene (194 bp Actinobacillus pleuropneumoniae reference strains (listed deleted) with a unique BamHI site] was cloned into pGEMT < in Table 1) and 4074 sodC kan are described elsewhere (Promega) to yield plasmid psxy. In parallel, the cat gene from Staphylococcus aureus (Jansen et al., 1995) was PCR Table 1. Transformability of Actinobacillus pleuropneumoniae strains amplified with primers Cm_F (CGCGGATCCGAGCTCTAAC AAGCGGTAAGCAGACAAGTAAGCCTCC) and Cm_R (CG Transformation Strain name Serotype Transformability frequency Æ SDÃ CGGATCCCATGCATGCATAACAAGCGGTTTCAACTAACG GGGCAGG) to incorporate the uptake signal sequence (bold) Shope 4074 1 Low 4.3À08 Æ 2.0À08 À10w from A. pleuropneumoniae and BamHI restriction sites (under- 1536 2 None detected o 2 1421 3 Low 3.6À08 Æ 2.7À08 lined). Plasmid psxy was linearized with BamHI and the cat M62 4 Low 1.0À08 Æ 4.4À09 gene was inserted. The resulting plasmid, pTDsxyCm, was w K17 5a None detected o 2À09 linearized with NotI and used to transform MIV-competent L20 5b Low 1.6À08 Æ 1.1À09 w cells of HS143 as described below. Chloramphenicol-resistant Femø 6 None detected o 9À10 w colonies were selected and the sxy mutation was confirmed by WF83 7 None detected 2À10 o PCR. 405 8 Low 5.8À08 Æ 2.1À08 w CVJ13261 9 None detected o 2À10 w D13039 10 None detected o 8À10 Transformation assays w 56153 11 None detected o 3À10 w Transformation with marked chromosomal DNA [from 8329 12 None detected o 9À10 À10w A. pleuropneumoniae 4074 sodC<kan or from H. influenzae N-273 13 None detected o 9 w 3906 14 None detected o 3À10 MAP7 (NovR)] was assessed on plates, in broth or in MIV HS143 15 High 4.6À04 Æ 3.8À04 medium. Plate transformations were performed as described w HS143sxy- 15 None detected o 3À10 elsewhere (Bosse´ et al., 2004). Briefly, 20 mLofbacteriagrown to OD 0.5 were spotted onto BHI-L plates, with 1 mg ÃValues shown represent the mean of four assays. Transformation 600 nm frequencies are the ratio of CFU mLÀ1 on BHI Kan agar to CFU mLÀ1 on DNA added to the cells after 100 min of incubation at 37 1C. BHI agar. Bacteria were scraped from the plates after 4 h at 37 1C, and wLimit of detection. resuspended and diluted in phosphate-buffered saline before FEMS Microbiol Lett 298 (2009) 124–130 c 2009 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved 126 J.T. Bosse´ et al. plating. MIV transformation assays were performed as de- chromosomal DNA from the serotype 1 strain 4074 (Bosse´ scribed elsewhere (Poje & Redfield, 2003): cells growing et al., 2004). As shown in Table 1, most strains produced no exponentially in BHI-N or BHI-HN were transferred to MIV transformants at all. This is not likely to be due to the low medium for 100 min at 37 1C and incubated with 1 mgDNA homology between donor and recipient DNAs, as the 4-kb for 15 min at 37 1C before diluting and plating. Competence region flanking sodC was 97–100% identical in all development of A. pleuropneumoniae HS143 was monitored A.