DOCSLIB.ORG

Gene Flow at the Crossroads of Humanity: Mtdna Sequence Diversity and Alu Insertion Polymorphism Frequencies in Uzbekistan

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Gene Flow at the Crossroads of Humanity: Mtdna Sequence Diversity and Alu Insertion Polymorphism Frequencies in Uzbekistan The Open Genomics Journal, 2009, 2, 1-11 1 Open Access Gene Flow at the Crossroads of Humanity: mtDNA Sequence Diversity and Alu Insertion Polymorphism Frequencies in Uzbekistan Eric J. Devor*,1, Ibrokhim Abdurakhmonov2, Mark Zlojutro3, Meredith P. Millis1, Jessica J. Galbraith1, Michael H. Crawford4, Shukhrat Shermatov2, Zabardast Buriev2 and Abdusattor Abdukarimov2 1Molecular Genetics and Bioinformatics, Integrated DNA Technologies, Coralville, Iowa 52241 USA 2Laboratory of Genetic Engineering and Biotechnology, Institute of Genetics and Plant Experimental Biology, Academy of Sciences of Uzbekistan, Yuqori Yuz, Tashkent-702151, Uzbekistan 3Department of Genetics, Southwest Foundation for Biomedical Research, San Antonio, Texas 78227, USA 4Department of Anthropology, University of Kansas, Lawrence, Kansas 66045 USA Abstract: Mitochondrial DNA (mtDNA) HVS-I region sequences were obtained from 47 unrelated individuals represent- ing 10 of 12 viloyats of Uzbekistan. In addition, frequencies for five Alu insertion polymorphisms were determined for the same 47 individuals. These data were used to assess the genetic position of Uzbekistan relative to other Central Asians and, more generally, to Eurasian groups. Results show that the Uzbek sample has an approximate balance of west Eura- sian (53.2%) and Asian (46.8%) mtDNA lineages, which is reflected by their intermediate position relative to other Eura- sian groups in MDS plots based on genetic distance matrices. The Uzbeks also exhibit high sequence diversity, a frag- mented median-joining network, and a low regional ST score, all of which suggests a high degree of gene flow from neighboring gene pools. This is consistent with Central Asia’s history of repeated incursions by various nomadic peoples from the Asian steppe and the location of the well-traveled Silk Road within the present-day borders of Uzbekistan. In ad- dition, a star-like cluster within haplogroup H was identified in the Uzbek network, potentially representing a west Eura- sian genetic substratum of an earlier occupation by Caucasoid peoples. Keywords: Mitochondrial DNA, Alu polymorphism, genetic history, Uzbekistan. INTRODUCTION distance matrices that position the Uzbeks intermediate to western and eastern Eurasian populations, strengthening the Central Asia, which encompasses the territories between view of Uzbekistan as a crossroad of humanity. the Caspian Sea and the western boundaries of present-day China, has been a conduit for cultural, economic, and bio- SUBJECTS AND METHODS logical exchanges between Europe and Asia for thousands of years [1]. While much of Central Asia is composed of deso- Population Sample late high altitude regions and broad cold deserts devoid of A panel of 50 DNA samples was prepared from whole significant human habitation, its river basins and steppes blood draws at the Institute of Genetics and Plant Experi- have been occupied since the Lower Paleolithic [2]. How- mental Biology of the Academy of Sciences in Tashkent. ever, in spite of its historical importance during the rise of The origin of each sample was assigned by the birthplace of several far-flung empires and its long record of human habi- the donor’s mother. Three samples were eliminated because tation, the area is poorly characterized genetically. Several maternal birthplace was not located within Uzbekistan. The reports have begun to address this deficiency [3-6], revealing remaining 47 individuals are from ten of the twelve viloyats that the region has been at the center of widespread demo- or political districts of Uzbekistan, with the majority (33 of graphic processes responsible for molding the present-day 47 samples, 70.2%) representing the viloyats of Bukhara, genetic variation of local populations, as well as neighboring Kashkadarya, and Tashkent (Fig. 1). Thus, the panel pro- Eurasian groups. In this study, we contribute to the genetic vides a broader geographic coverage of Uzbekistan than understanding of Central Asia by reporting mitochondrial other samples that are in the literature. DNA sequence diversity and Alu element insertion frequen- mtDNA Sequencing and RFLP Analyses cies in Uzbekistan. Our results show comparable frequencies of European and East Asian mtDNA lineages which is re- A 447 bp mtDNA amplicon containing HVS-I segment flected by ordination analyses of the pairwise genetic of the mitochondrial control region was obtained for each member of the Uzbek panel using the primer set mtFOR: 5’- TCCACCATTAGCACCCAAAGCTA-3’ (pos. 15,976 to *Address correspondence to this author at the Molecular Genetics and Bio- o 15,998; TM= 58.4 C) and mtREV: 5’- ATTGATTTCACG- informatics, Integrated DNA Technologies, 1710 Commercial Park, GAGGATGG-3’ (pos. 16,422 to 16,402; T = 52.6oC). Am- Coralville, Iowa 52241, USA; Tel: 319-626-8450; M E-mail: [email protected] plicons were then sequenced in both directions on an Ap- 1875-693X/09 2009 Bentham Open 2 The Open Genomics Journal, 2009, Volume 2 Devor et al. Fig. (1). Map of Uzbekistan. Historic silk routes are shown as dashed lines along with principal regional sites. mtDNA samples were as- signed by mother’s birthplace to Kashkadarya (13), Tashkent (12), Bukhara (8), Surkhandarya (4), Namagan (3), Samarkand (2), Khorezm (2), Djizakh (1), Andijan (1), and Sirdarya (1). plied Biosystems Model 310 automated fluorescence se- Alu Insertion Polymorphisms quencer. Alu elements are a class of retroposons unique to primate Additional characterization of mtDNA haplogroup as- genomes [7]. There are more than one million Alu elements signments was obtained, as needed, by RFLP typing. The in the human genome [8] and a few are young enough that 10,397 Alu I and 10,394 Dde I cut sites were typed by re- they have yet to become fixed. Polymorphic Alu insertions striction enzyme digestion of a 269 bp amplicon produced by are two allele loci easily typed by PCR amplification. We the primers 10,290 FOR: 5’-GCCCTACAAACAACTAAC chose five loci for typing the Uzbek panel; FXIIIB, TPA25, o CTGCCA-3’ (TM= 59.2 C) and 10,558 REV: 5’- AGGGAG APO, PV92, and ACE. Summary information on each locus, o GATATGAGGTGTGAGCGAATA-3’ (TM= 60.1 C). The including PCR primer sequences and PCR reaction condi- 12,406 Hinc II/Hpa I cut site was typed by restriction en- tions, are presented in Table 1. zyme digestion of a 215 bp amplicon produced by primers Comparison Population Data 12,361 FOR: 5’-ACCGAGAAAGCTCACAAGAACTGC-3’ o (TM= 59.2 C) and 12,575 REV: 5’-AGCTTAAGGGAGAGC Comparative information for mtDNA sequences and Alu o TGGGTTGTTT-3’ (TM= 60.0 C). These primer sets were insertion polymorphism frequencies was assembled for a designed and analyzed for melting temperature and secon- number of populations both within and outside Central Asia. dary structure using the on-line SciTools software at Inte- MtDNA sequences were obtained for the Central Asian grated DNA Technologies (www.idtdna.com). PCR condi- populations Kazakhs, Kirghiz, and Uighurs [3]. Southern o 5:00 o 0:30 o 0:30 o 0:30 o 7:00 tions were 94 C [94 C ; 53 C ; 72 C ]3572 C for Siberian groups are represented by the Altai [9], Tuva and the HVR I amplifications and 94oC5:00[94oC0:30; 58oC0:30; Buryats [10], while Eastern Asia is represented by the Mon- o 0:30 o 7:00 72 C ]3572 C for the RFLP amplifications. Restriction gols [11] and Han Chinese [12]. European groups consist of enzyme digests of the RFLP amplicons were carried out as Russian [13], Greek [14], and Anatolian Turk [15] samples. per supplier recommendations. Uzbekistan Population Genetics The Open Genomics Journal, 2009, Volume 2 3 Table 1. Primer Sequences and PCR Conditions for the Alu Insertion Polymorphisms Alu ID Chr. 5’ Primer Sequence 3’ Tm(oC)a Ta(oC)b Allelesc TCAACTCCATGAGATTTTCAGAAGT 56.2 FXIIIB 1 54.0 500;200 CTGGAAAAAATGTATTCAGGTGAGT 55.3 GTAAGAGTTCCGTAACAGGACAGCT 59.8 TPA25 8 58.0 424;104 CCCCACCCTAGGAGAACTTCTCTTT 61.3 AAGTGCTGTAGGCCATTTAGATTAG 56.5 APO 11 55.0 409;83 AGTCTTCGATGACAGCGTATACAGA 58.9 AACTGGGAAAATTTGAAGAGAAAGT 55.3 PV92 16 55.0 442;119 TGAGTTCTCAACTCCTGTGTGTTAG 58.0 CTGGAGACCACTCCCATCCTTTCT 61.6 ACE 17 58.0 470;173 GATGTGGCCATCACATTCGTCAGAT 61.0 aSequence melting temperature estimated by OligoAnalyzer 3.0 (see SciTools at www.idtdna.com). b o 5:00 o 0:30 o 0:30 o 0:30 o 7:00 Temperature set for primer annealing step of the PCR assay. Constant conditions are: 94 C [94 C ; Ta( C) ; 72 C ]3572 C . cAmplicon length with and without the Alu insertion. FXIIIB, TPA25, APO, PV92, and ACE Alu insertion sional scaling (MDS) using the NTSYS statistical package frequencies used for population comparison were obtained [23]. from the ALFRED database at Yale University (http://alfred. For the Alu polymorphism frequencies, the coefficient of med.yale.edu/alfred/index.asp), including Uighur, Tajik, gene differentiation, G = (H – H )/H , was computed for Buryat, Turk and Greek populations. In addition, several ST T S T each locus using the executable DISPAN [24], where HT is Asian population samples were typed in the present study. the gene diversity for the total population (i.e., average allele These include the Yakuts (n = 50) and Mongols (n = 50), as frequencies for the entire data set) and H is the average of well as the Chuvash (n = 50) and Koryaks (n = 19) that have S the gene diversities computed for the individual not been previously typed for these particular markers. (sub)populations [25]. Nei’s modified Cavalli-Sforza genetic Polymorphism frequencies from these additional samples distance [26] was calculated between the populations and have been deposited in ALFRED. visualized using the MDS methodology. Data Analysis Results Using the software package Arlequin ver. 2.0 [16], three mtDNA Sequence Diversity different sequence diversity measures were employed: (i) 2 mtDNA sequences obtained from the Uzbek panel are haplotypic diversity [(n/n-1)(1-p )], where p is the fre- i i presented in Fig.
Load more

Recommended publications
  • Mitochondrial Haplogroup Background May Influence
    Genetics Mitochondrial Haplogroup Background May Influence Southeast Asian G11778A Leber Hereditary Optic Neuropathy Supannee Kaewsutthi,1,2 Nopasak Phasukkijwatana,2,3 Yutthana Joyjinda,1 Wanicha Chuenkongkaew,3,4 Bussaraporn Kunhapan,1 Aung Win Tun,1 Bhoom Suktitipat,1 and Patcharee Lertrit1,4 PURPOSE. To investigate the role of mitochondrial DNA markedly incomplete penetrance. The three most common (mt DNA) background on the expression of Leber hereditary primary LHON mutations, G3460A in ND1, G11778A in ND4, optic neuropathy (LHON) in Southeast Asian carriers of the and T14484C in ND6, account for more than 90% of LHON G11778A mutation. cases worldwide2 with G11778A being the most common. In 3 4–6 METHODS. Complete mtDNA sequences were analyzed from 53 Thailand and other Asian countries, G11778A is responsi- unrelated Southeast Asian G11778A LHON pedigrees in Thai- ble for approximately 90% of LHON families. land and 105 normal Thai controls, and mtDNA haplogroups The sex bias and the marked incomplete penetrance of were determined. Clinical phenotypes were tested for associ- LHON indicate that there must be other factors that modify disease expression. Mitochondrial background,7–8 nuclear ation with mtDNA haplogroup, with adjustment for potential 9–11 12 confounders such as sex and age at onset. background, and environmental factors have been impli- cated in disease expression, although the precise mechanisms RESULTS. mtDNA subhaplogroup B was significantly associated of pathogenesis are largely undefined. with LHON. Follow-up analysis
    [Show full text]
  • Female Genetic Distribution Bias in Mitochondrial Genome Observed In
    www.nature.com/scientificreports OPEN Female genetic distribution bias in mitochondrial genome observed in Parkinson’s Disease patients in Received: 07 April 2015 Accepted: 26 October 2015 northern China Published: 25 November 2015 Qiaohong Chu1, Xiaoguang Luo2, Xiaoni Zhan1, Yan Ren2 & Hao Pang1 Genetic polymorphisms associated with susceptibility to Parkinson’s disease (PD) have been described in mitochondrial DNA (mtDNA). To explore the potential contribution of mtDNA mutations to the risk of PD in a Chinese population, we examined the linkage relationship between several single nucleotide polymorphisms (SNPs) and haplotypes in mtDNA and PD. We genotyped 5 SNPs located on coding genes using PCR-RFLP analysis. A specific allele 10398G demonstrated an increased risk of PD (OR 1.30; 95% CI 0.95–1.76; P = 0.013). After stratification by gender, the increased risk appeared to be more significant in females (OR 1.91; 95% CI 1.16–3.16; P = 0.001). But the significance only appeared in females under Bonferroni correction. No significant differences were detected for other SNPs (T4336C, G5460A, G9055A, and G13708A). Individual haplotype composed of 4336T-5460G-9055G-10398A-13708G was found to be associated with protective effect regarding PD (P = 0.0025). The haplotypes 4336T-5460G-9055G-10398G-13708G and 4336T-5460G-9055G- 10398A-13708G were more significantly associated in females (P = 0.0036 for risk and P = 0.0006 for protective effects). These data suggest that the A10398G and two haplotypes coupled with 10398A or 10398G are closely associated with susceptibility to PD in a northern Chinese population. This association demonstrated a female genetic distribution bias.
    [Show full text]
  • Different Matrilineal Contributions to Genetic Structure of Ethnic Groups in the Silk Road Region in China
    Different Matrilineal Contributions to Genetic Structure of Ethnic Groups in the Silk Road Region in China Yong-Gang Yao,*1 Qing-Peng Kong,* à1 Cheng-Ye Wang,*à Chun-Ling Zhu,* and Ya-Ping Zhang* *Laboratory of Cellular and Molecular Evolution, and Molecular Biology of Domestic Animals, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, China; Laboratory for Conservation and Utilization of Bio-resource, Yunnan University, Kunming, China; and àGraduate School of the Chinese Academy of Sciences, Beijing, China Previous studies have shown that there were extensive genetic admixtures in the Silk Road region. In the present study, we analyzed 252 mtDNAs of five ethnic groups (Uygur, Uzbek, Kazak, Mongolian, and Hui) from Xinjiang Province, China (through which the Silk Road once ran) together with some reported data from the adjacent regions in Central Asia. In a simple way, we classified the mtDNAs into different haplogroups (monophyletic clades in the rooted mtDNA tree) according to the available phylogenetic information and compared their frequencies to show the differences among Downloaded from https://academic.oup.com/mbe/article/21/12/2265/1071048 by guest on 27 September 2021 the matrilineal genetic structures of these populations with different demographic histories. With the exception of eight unassigned M*, N*, and R* mtDNAs, all the mtDNA types identified here belonged to defined subhaplogroups of haplogroups M and N (including R) and consisted of subsets of both the eastern and western Eurasian pools, thus providing direct evidence supporting the suggestion that Central Asia is the location of genetic admixture of the East and the West.
    [Show full text]
  • Y-Chromosome & Mitochondrial DNA Variation
    The Genetic Structure of the Kuwaiti and Failaka Island Populations: Y-chromosome & Mitochondrial DNA Variation By Jasem Bader Theyab M.A., University of Kansas, 2010 Copyright 2013 Submitted to the graduate degree program in Anthropology and the Graduate Faculty of the University of Kansas in partial fulfillment of the requirements for the degree of Doctor of Philosophy. ________________________________ Chairperson, Dr. Michael H. Crawford ________________________________ Dr. Majid Hannoum ________________________________ Dr. Deborah Smith ________________________________ Dr. Bartholomew C. Dean ________________________________ Dr. John Kelly Date Defended: May 28, 2013 The Dissertation Committee for Jasem Bader Theyab certifies that this is the approved version of the following dissertation: The Genetic Structure of the Kuwaiti and Failaka Island Populations: Y-chromosome & Mitochondrial DNA Variation ________________________________ Chairperson, Dr. Michael H. Crawford Date approved: May 31, 2013 ii Abstract Recent studies applying multidisciplinary approaches suggest that the Anatomically Modern Homo sapiens (AMHS) passed through the Arabian Peninsula in their major diaspora out of Africa. The Arabian Peninsula is connected to three continents: Africa, Asia, and Europe. In addition to the major diaspora, the Arabian Peninsula has witnessed numerous migrations among the three continents. The populations of the Arabian Peninsula have been investigated to better understand their evolutionary history. This dissertation investigated the paternal genetic structure of the Kuwaiti and Failaka Island populations using 15 loci Y-STR data. In addition, the maternal genetic structure of Failaka Island has been investigated using mtDNA HVS-I sequence data. This is the first genetic study to characterize Failaka Island population. The result showed that the Kuwaiti population has a high frequency of Y- haplogroup J1 (37%) similar to other Arabian populations.
    [Show full text]
  • Mitochondrial
    Proc. Natl. Acad. Sci. USA Vol. 91, pp. 1158-1162, February 1994 Genetics Mitochondrial DNA "clock" for the Amerinds and its implications for timing their entry into North America (Amerind mlgrations/Chibeba time depth/Amerind mtDNA evolution) ANTONIO TORRONI*t, JAMES V. NEELt, RAMIRO BARRANTES§, THEODORE G. SCHURR*, AND DOUGLAS C. WALLACE* Departments of *Genetics and Molecular Medicine and lAnthropology, Emory University, Atlanta, GA 30322; tDepartment of Human Genetics, University of Michigan Medical School, Ann Arbor, MI 48109-0618; and fEscuela de Biologia, Universidad de Costa Rica, San Jose, Costa Rica Contributed by James V. Neel, October 11, 1993 ABSTRACT Students of the time of entry of the ancestors erinds are defined primarily by four sets of specific muta- of the Amerinds into the New World are divided into two tions that cluster in four haplotype groups (haplogroups), camps, one favoring an "early" entry [more than approxi- termed A, B, C, and D. Moreover, the observation that each mnately 30,000 years before the present (YBP)], the other of these haplogroups was apparently founded by a single favoring a "late" entry (less than approximately 13,000 YBP). haplotype present in Asia permitted a quantification of the An "intermediate" date is unlikely for geological reasons. The mtDNA variation that had accumulated within each ofthose correlation of the appropriate data on mtDNA variation in haplogroups from the time of the first human arrival in the Amerinds with lin s, archaeological, and genetic data Americas (13). offers the possibility of establishing a time frame for tDNA We have also recently developed, from archeological, evolution in Amerinds.
    [Show full text]
  • Haplogroup Relationships Between Domestic and Wild Sheep Resolved Using a Mitogenome Panel
    Heredity (2011) 106, 700–706 & 2011 Macmillan Publishers Limited All rights reserved 0018-067X/11 www.nature.com/hdy ORIGINAL ARTICLE Haplogroup relationships between domestic and wild sheep resolved using a mitogenome panel JRS Meadows1,3, S Hiendleder2 and JW Kijas1 1CSIRO Livestock Industries, St Lucia, Queensland, Australia and 2School of Agriculture, Food and Wine & Research Centre for Reproductive Health, School of Animal and Veterinary Science, University of Adelaide, Roseworthy, South Australia, Australia Five haplogroups have been identified in domestic sheep 920 000±190 000 years ago based on protein coding through global surveys of mitochondrial (mt) sequence sequence. The utility of various mtDNA components to inform variation, however these group classifications are often the true relationship between sheep was also examined with based on small fragments of the complete mtDNA sequence; Bayesian, maximum likelihood and partitioned Bremmer sup- partial control region or the cytochrome B gene. This study port analyses. The control region was found to be the mtDNA presents the complete mitogenome from representatives of component, which contributed the highest amount of support to each haplogroup identified in domestic sheep, plus a sample the tree generated using the complete data set. This study of their wild relatives. Comparison of the sequence success- provides the nucleus of a mtDNA mitogenome panel, which can fully resolved the relationships between each haplogroup be used to assess additional mitogenomes and serve as a and provided insight into the relationship with wild sheep. reference set to evaluate small fragments of the mtDNA. The five haplogroups were characterised as branching Heredity (2011) 106, 700–706; doi:10.1038/hdy.2010.122; independently, a radiation that shared a common ancestor published online 13 October 2010 Keywords: Ovis aries; domestication; mitochondria; genome; diversity Introduction Pedrosa et al., 2005; Pereira et al., 2006; Tapio et al., 2006; Meadows et al., 2007).
    [Show full text]
  • Genetic Affinity Between the Kamsui Speaking Chadong and Mulam
    Journal of Systematics and Evolution 51 (3): 263–270 (2013) doi: 10.1111/jse.12009 Research Article Genetic affinity between the Kam‐Sui speaking Chadong and Mulam people 1Qiong‐Ying DENG*y 2Chuan‐Chao WANGy 1Xiao‐Qing WANGy 2Ling‐Xiang WANG 2Zhong‐Yan WANG 2Wen‐Jun WU 2Hui LI* the Genographic Consortium‡ 1(Department of Anatomy, Guangxi Medical University, Nanning 530021, China) 2(State Key Laboratory of Genetic Engineering and MOE Key Laboratory of Contemporary Anthropology, School of Life Sciences, Fudan University, Shanghai 200433, China) Abstract The origins of Kam‐Sui speaking Chadong and Mulam people have been controversial subjects in ethnic history studies and other related fields. Here, we studied Y chromosome (40 informative single nucleotide polymorphisms and 17 short tandem repeats in a non‐recombining region) and mtDNA (hypervariable segment I and coding region single nucleotide polymorphisms) diversities in 50 Chadong and 93 Mulam individuals. The Y chromosome and mtDNA haplogroup components and network analyses indicated that both Chadong and Mulam originated from the admixture between surrounding populations and the indigenous Kam‐Sui populations. The newly found Chadong is more closely related to Mulam than to Maonan, especially in the maternal lineages. Key words East Asian population, genetic structure, mitochondrial DNA, Tai‐Kadai, Y chromosome. Chadong dialect is a newly discovered Kam‐Sui and Mulam languages are both Kam‐Sui languages language spoken by some 20 000 people, mainly in spoken mainly in northern Guangxi by Maonan and Chadong Township, Lingui County, northeastern Mulao people, respectively (Li, 2001; Anthony et al., Guangxi Zhuang Autonomous Region, China. Accord- 2008).
    [Show full text]
  • Genetics, Linguistics, and Prehistoric Migrations: an Analysis of California Indian Mitochondrial DNA Lineages
    Journal of California and Great Basin Anttiropology | Vol, 26, No, 1 (2006) | pp 33-64 Genetics, Linguistics, and Prehistoric Migrations: An Analysis of California Indian Mitochondrial DNA Lineages JOHN R. JOHNSON Department of Anthropology, Santa Barbara Museum of Natural History 2559 Puesta del Sol, Santa Barbara, CA 93105 JOSEPH G. LORENZ Laboratory of Molecular Biology, Coriell Institute for Medical Research 403 Haddon Avenue, Camden, NJ 08103 The advent of mitochondrial DNA analysis makes possible the study of past migrations among California Indians through the study of genetic similarities and differences. Four scenarios of language change correlate with observable genetic patterns: (1) initial colonization followed by gradual changes due to isolation; (2) population replacement; (3) elite dominance; and (4) intermarriage between adjacent groups. A total of 126 mtDNA samples were provided by contemporary California Indian descendants whose maternal lineages were traced back to original eighteenth and nineteenth century sociolinguistic groups using mission records and other ethnohistoric sources. In particular, those groups belonging to three language families (Chumashan, Uto-Aztecan, and Yokutsan) encompassed enough samples to make meaningful comparisons. The four predominant mtDNA haplogroups found among American Indians (A, B, C, and D) were distributed differently among populations belonging to these language families in California. Examination of the distribution of particular haplotypes within each haplogroup further elucidated the separate population histories of these three language families. The expansions of Yokutsan and Uto-Aztecan groups into their respective homelands are evident in the structure of genetic relationships within haplogroup diagrams. The ancient presence of Chumashan peoples in the Santa Barbara Channel region can be inferred from the presence of a number of haplotypes arrayed along a chain-like branch derived from the founding haplotype within Haplogroup A.
    [Show full text]
  • Most of the Extant Mtdna Boundaries in South and Southwest Asia Were
    BMC Genetics BioMed Central Research article Open Access Most of the extant mtDNA boundaries in South and Southwest Asia were likely shaped during the initial settlement of Eurasia by anatomically modern humans Mait Metspalu*1, Toomas Kivisild1, Ene Metspalu1, Jüri Parik1, Georgi Hudjashov1, Katrin Kaldma1, Piia Serk1, Monika Karmin1, DoronMBehar2, M Thomas P Gilbert6, Phillip Endicott7, Sarabjit Mastana4, Surinder S Papiha5, Karl Skorecki2, Antonio Torroni3 and Richard Villems1 Address: 1Institute of Molecular and Cell Biology, Tartu University, Tartu, Estonia, 2Bruce Rappaport Faculty of Medicine and Research Institute, Technion and Rambam Medical Center, Haifa, Israel, 3Dipartimento di Genetica e Microbiologia, Università di Pavia, Pavia, Italy, 4Department of Human Sciences, Loughborough University, Loughborough, United Kingdom, 5Department of Human Genetics, University of Newcastle-upon- Tyne, United Kingdom, 6Ecology and Evolutionary Biology, The University of Arizona, Tucson, Arizona, USA and 7Henry Wellcome Ancient Biomolecules Centre, Department of Zoology, University of Oxford, Oxford OX1 3PS,United Kingdom Email: Mait Metspalu* - [email protected]; Toomas Kivisild - [email protected]; Ene Metspalu - [email protected]; Jüri Parik - [email protected]; Georgi Hudjashov - [email protected]; Katrin Kaldma - [email protected]; Piia Serk - [email protected]; Monika Karmin - [email protected]; Doron M Behar - [email protected]; M Thomas P Gilbert - [email protected]; Phillip Endicott - [email protected]; Sarabjit Mastana - [email protected]; Surinder S Papiha - [email protected]; Karl Skorecki - [email protected]; Antonio Torroni - [email protected]; Richard Villems - [email protected] * Corresponding author Published: 31 August 2004 Received: 07 May 2004 Accepted: 31 August 2004 BMC Genetics 2004, 5:26 doi:10.1186/1471-2156-5-26 This article is available from: http://www.biomedcentral.com/1471-2156/5/26 © 2004 Metspalu et al; licensee BioMed Central Ltd.
    [Show full text]
  • The Genetic History of the Otomi in the Central Mexican Valley
    University of Pennsylvania ScholarlyCommons Anthropology Senior Theses Department of Anthropology Spring 2013 The Genetic History Of The Otomi In The Central Mexican Valley Haleigh Zillges University of Pennsylvania Follow this and additional works at: https://repository.upenn.edu/anthro_seniortheses Part of the Anthropology Commons Recommended Citation Zillges, Haleigh, "The Genetic History Of The Otomi In The Central Mexican Valley" (2013). Anthropology Senior Theses. Paper 133. This paper is posted at ScholarlyCommons. https://repository.upenn.edu/anthro_seniortheses/133 For more information, please contact [email protected]. The Genetic History Of The Otomi In The Central Mexican Valley Abstract The Otomí, or Hñäñhü, is an indigenous ethnic group in the Central Mexican Valley that has been historically marginalized since before Spanish colonization. To investigate the extent by which historical, geographic, linguistic, and cultural influences shaped biological ancestry, I analyzed the genetic variation of 224 Otomí individuals residing in thirteen Otomí villages. Results indicate that the majority of the mitochondrial DNA (mtDNA) haplotypes belong to the four major founding lineages, A2, B2, C1, and D1, reflecting an overwhelming lack of maternal admixture with Spanish colonizers. Results also indicate that at an intra-population level, neither geography nor linguistics played a prominent role in shaping maternal biological ancestry. However, at an inter-population level, geography was found to be a more influential determinant. Comparisons of Otomí genetic variation allow us to reconstruct the ethnic history of this group, and to place it within a broader-based Mesoamerican history. Disciplines Anthropology This thesis or dissertation is available at ScholarlyCommons: https://repository.upenn.edu/anthro_seniortheses/133 THE GENETIC HISTORY OF THE OTOMI IN THE CENTRAL MEXICAN VALLEY By Haleigh Zillges In Anthropology Submitted to the Department of Anthropology University of Pennsylvania Thesis Advisor: Dr.
    [Show full text]
  • Phylogenetic Resolution with Mtdna D-Loop Vs. HVS 1: Methodological Approaches in Anthropological Genetics Utilizing Four Siberian Populations
    Phylogenetic Resolution with mtDNA D-loop vs. HVS 1: Methodological Approaches in Anthropological Genetics Utilizing Four Siberian Populations By Stephen M Johnson Submitted to the graduate degree program in Anthropology and the Graduate Faculty of the University of Kansas in partial fulfillment of the requirements for the degree of Master of Arts. ________________________________ Chairperson: Michael H Crawford, PhD ________________________________ Bartholomew Dean, PhD ________________________________ James H Mielke, PhD Date Defended: 5 July 2013 The Thesis Committee for Stephen M Johnson certifies that this is the approved version of the following thesis: Phylogenetic Resolution with mtDNA D-loop vs. HVS 1: Methodological Approaches in Anthropological Genetics Utilizing Four Siberian Populations ________________________________ Chairperson: Dr. Michael H Crawford, PhD Date approved: 5 July 2013 ii ABSTRACT Mitochondrial DNA is a useful genetic marker for answering evolutionary questions due to its high copy number, maternal mode of inheritance, and its high rate of evolution (Stoneking and Soodyall, 1996). The vast majority of research on mitochondrial DNA in anthropological studies has utilized the hypervariable segment 1 (HVS 1) to reconstruct population history and structure, explore population ancestry, construct phylogenies, and answer questions about the origins of prehistoric populations. A common debate in this field is whether better phylogenetic resolution can be obtained by the use of additional sequence data or genomic
    [Show full text]
  • Mtdna Evidence: Genetic Background Associated with Related Populations at High Risk for Esophageal Cancer Between Chaoshan and T
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Genomics 90 (2007) 474–481 www.elsevier.com/locate/ygeno mtDNA evidence: Genetic background associated with related populations at high risk for esophageal cancer between Chaoshan and Taihang Mountain areas in China ⁎ Xiao-Yun Li a,1, Min Su a, ,1, Hai-Hua Huang a, Hui Li b, Dong-Ping Tian a, Yu-Xia Gao a a Department of Pathology, Key Immunopathology Laboratory of Guangdong Province, Shantou University Medical College, Shantou, Guangdong 515031, China b State Key Laboratory of Genetic Engineering and Center for Anthropological Studies, School of Life Sciences, Fudan University, Shanghai, Jiangsu 200433, China Received 4 April 2007; accepted 20 June 2007 Available online 9 August 2007 Abstract There are three major geographic regions in China known for their high incidences of esophageal cancer (EC): the Taihang Mountain range of north-central China, the Minnan area of Fujian province, and the Chaoshan plain of Guangdong province. Historically, waves of great population migrations from north-central China through coastal Fujian to the Chaoshan plain were recorded. To study the genetic relationship among the related EC high-risk populations, we analyzed mitochondrial DNA (mtDNA) haplogroups based on 30 EC patients from Chaoshan and used control samples from the high-risk populations, including 48, 73, and 89 subjects from the Taihang, Fujian, and Chaoshan areas, respectively. The principal component of all haplogroups, correlation analysis of haplogroup frequency distributions between populations, and haplogroup D network analysis showed that compared with other Chinese populations, populations in the three studied areas are genetically related.
    [Show full text]