A Novel Functional T Cell Hybridoma Recognizes Macrophage Cell Death Induced by Bacteria: A Possible Role for Innate Lymphocytes in Bacterial Infection This information is current as of October 1, 2021. Koichi Kubota J Immunol 2006; 176:7576-7588; ; doi: 10.4049/jimmunol.176.12.7576 http://www.jimmunol.org/content/176/12/7576 Downloaded from

References This article cites 50 articles, 19 of which you can access for free at: http://www.jimmunol.org/content/176/12/7576.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

by guest on October 1, 2021 *average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2006 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

A Novel Functional T Cell Hybridoma Recognizes Macrophage Cell Death Induced by Bacteria: A Possible Role for Innate Lymphocytes in Bacterial Infection

Koichi Kubota1

We have established a novel TCR␣␤ (TCRV␤6)؉CD4؊CD8؊ T cell hybridoma designated B6HO3. When the B6HO3 cells were cocultured with bacterial-infected J774 macrophage-like cells, IFN-␥ production by B6HO3 cells was triggered through direct cell-cell contact with dying J774 cells infected with Listeria monocytogenes (LM), Shigella flexneri,orSalmonella typhimurium that expressed the type III secretion system, but not with intact J774 cells infected with heat-killed LM, nonhemolytic lysteriolysin ␥-O-deficient (Hly؊) LM, plasmid-cured Shigella, or stationary-phase Salmonella. However, the triggering of B6HO3 cells for IFN production involved neither dying hepatoma cells infected with LM nor dying J774 cells caused by gliotoxin treatment or freeze d d d thawing. Cycloheximide and Abs to H-2K , H-2D ,Ia , CD1d, TCRV␤6, and IL-12 did not inhibit the contact-dependent IFN-␥ Downloaded from response, indicating that this IFN-␥ response did not require de novo protein synthesis in bacterial-infected J774 cells and was TCR and IL-12 independent. Thus, in an as yet undefined way, B6HO3 hybridoma recognizes a specialized form of macrophage cell death resulting from bacterial infection and consequently produces IFN-␥. Moreover, contact-dependent interaction of minor subsets of splenic ␣␤ T cells, including NKT cells with dying LM-infected J774 and bone marrow-derived macrophage (BMM) cells, proved to provide an IFN-␥-productive stimulus for these minor T cell populations, to which the parental T cell of the B6HO3 hybridoma appeared to belong. Unexpectedly, subsets of ␥␦ T and NK cells similarly responded to dying LM-infected macrophage http://www.jimmunol.org/ cells. These results propose that innate lymphocytes may possess a recognition system sensing macrophage cell “danger” resulting from bacterial infection. The Journal of Immunology, 2006, 176: 7576–7588.

acrophages are well known for their scavenger func- survive and replicate inside macrophages (12–15). In addition, a tion. They are able to ingest and digest a variety of variety of bacterial pathogens are known to induce cell death in M particulate bodies, such as macromolecular com- macrophages (15–26). However, the biological significance of the plexes, aged erythrocytes, apoptotic cells, and microbial pathogens pathogen-induced cell death in macrophages is not fully defined (1). Upon infection, in addition to ingesting microbial pathogens, with respect to the host-parasite relationship and it may differ with by guest on October 1, 2021 macrophages recognize pathogen-associated molecular patterns of individual pathogens; viz, the macrophage cell death may be one bacteria, such as LPS or bacterial CpG DNA, via pattern recogni- evasion mechanisms of bacteria from killing by macrophages, or it tion receptors that include several members of the TLR family (2), may constitute a host defense response to the incoming pathogen and consequently produce a variety of soluble mediators, such as to halt its survival within macrophages and/or to present Ags to the cytokines and chemokines that recruit immune cells and induce adaptive immune system through bystander dendritic cells (27, inflammation (1). Among other things, IL-12 produced by macro- 28), or it may be the result of a bacterial strategy to promote dis- phages (3), in conjunction with other cytokines like IL-18 (4), ease through activation of caspase-1 which can cleave the pro- induces NK cells (5, 6) and some TCR␣␤-bearing memory-type forms of the inflammatory cytokines IL-1␤ and IL-18 (18–20). ϩ CD8 T cells (7–9) to produce IFN-␥, which in turn activates In previous studies, we developed a novel T cell hybridization macrophages to ultimately kill internalized bacteria via generation system, referred to as a functional T cell hybridoma, which com- of reactive nitrogen and oxygen intermediates (10). The macro- prised production of growth-arrested hybrids between the YACUT phages, therefore, constitute both sentinels and the first line of T cell lymphoma (29) and normal T cells and subsequent sponta- defense against bacterial pathogens, and IFN-␥ is the most impor- neous cell transformation of the hybrids (30, 31). Compared with tant key factor of early host resistance against bacterial infection. the ordinary T cell hybridomas using the BW5147 T cell lym- Microbes, on the other hand, have evolved a variety of coun- phoma (32), our hybridoma system is unique in that the hybrid- termeasures to macrophage defense mechanisms (1, 11). Intracel- omas dictate most of the terminally differentiated phenotypes of lular bacterial pathogens evade the macrophage killing mecha- normal parental T cells, thus preserving the effector functions of T nisms that eliminate intracellular pathogens, and thus they can lymphocytes, such as T cell contact helper activity (30) and cyto- toxic activity (31). Thus, we were interested in the feasibility of constructing functional T cell hybridomas with hitherto unknown Department of Microbiology, Kitasato University School of Medicine, Sagamihara, Kanagawa, Japan phenotypes by using this hybridization system (32), as T lympho- Received for publication November 16, 2005. Accepted for publication March cytes were becoming recognized as consisting of functionally 29, 2006. more heterogeneous populations than previously anticipated (33– The costs of publication of this article were defrayed in part by the payment of page 36). In a series of attempts to produce functional T cell hybridomas charges. This article must therefore be hereby marked advertisement in accordance derived from minor T cell populations, we obtained a novel T cell with 18 U.S.C. Section 1734 solely to indicate this fact. hybridoma designated B6HO3. We focused in this study on the 1 Address correspondence and reprint requests to Dr. Koichi Kubota, Department of Microbiology, Kitasato University School of Medicine, 1-15-1 Kitazato, Sagamihara, characterization of this hybridoma and found that the B6HO3 T Kanagawa 228, Japan. E-mail address: [email protected] cell hybridoma recognizes and responds to a specialized form of

Copyright © 2006 by The American Association of Immunologists, Inc. 0022-1767/06/$02.00 The Journal of Immunology 7577 cell death in bacterial-infected J774 macrophage cells with the Iad mAbs were purchased from Meiji Institute of Health Science. Fab of production of IFN-␥, a crucial cytokine for microbicidal functions anti-V␤6 mAb was produced by Takara Bio. PE-conjugated streptavidin of macrophages. This finding predicted that a minor subset of T was purchased form DakoCytomation. Gliotoxin and cycloheximide (CHX) were purchase from Sigma-Aldrich. cells should have the ability to recognize cell death in macro- phages resulting from bacterial infection. In fact, we have shown Cell fusion and hybrid selection ␣␤ in this study that not only minor subsets of spleen T cells but ϫ 6 ϫ 6 ␥␦ ␥ YC11 cells (10 10 ) were hybridized with 10 10 secondary C3H/He also subsets of T and NK cells produce IFN- in response to anti-DBA/2 MLC cells as described previously with slight modifications direct cell-cell contact with dying Listeria monocytogenes (LM)2- (31). Briefly, after fusion, cells were suspended in culture medium (DMEM Ϫ infected macrophage cells. Thus, this study suggests that the innate supplemented with 10% FCS, 10 mM HEPES, 5 ϫ 10 5 M 2-ME, and 1 immunity may involve a lymphocyte recognition system sensing mM nonessential amino acids) containing hypoxanthine/aminopterin/thy- midine, distributed into the wells of a 24-well microculture plate and cul- macrophage cell “danger” resulting from bacterial infection. tured for 18 days to eliminate unhybridized YC11 cells. Eighteen days after fusion, unhybridized MLC cells were eliminated by the panning method as Materials and Methods described previously (30). The adherent cells on the panning plate were ϫ 6 Mice and cell lines recovered by vigorous pipetting with culture medium, mixed with 6 10 irradiated DBA/2 mouse spleen cells and then pelleted by centrifugation. We derived TCR␣␤-deficient T cell line YC11 from the hypoxanthine- The pelleted cells were suspended in culture medium and distributed into guanine phosphoribosyltransferase-negative YACUT T cell line (29). the wells of a 24-well microculture plate and then incubated at 37°C in a YC11 cells and J774 macrophage-like cells were maintained in DMEM CO2 incubator. On the next day, human rIL-2 (25 U/ml) was added to the medium containing 10% FCS. Mouse hepatoma cell line Hepa 1-6 (37) and culture. After 5 days, growing cells were collected and distributed at one mouse fibroblast cell line L929 were obtained from Riken Cell Bank and cell per well into 96-well microculture plates containing irradiated DBA/2 maintained in DMEM supplemented with 10% FCS and 4.5 g/ml glucose. spleen cells, and IL-2 was added at day 2. After 5 days, growing cells in Downloaded from Bone marrow-derived macrophages (BMM) were grown from marrow each well were passaged into a 24-well microculture plate containing ir- cells from C57BL/6 mice according to the method described elsewhere radiated DBA/2 spleen cells followed by addition of IL-2 at day 2. Cells in (38). C3H/He, DBA/2, and C57BL/6 mice were purchased from Japan SLC most wells proliferated vigorously for 4–6 days and then died over time. and Oriental Yeast. Mice were used in accordance with the institutional However, cells in some wells ceased to proliferate without dying out and guideline. were observed to be gathering round macrophages which had been used as feeder cells. These survived cells were passaged into a 24-well microcul- Bacteria ture plate containing irradiated C3H/He spleen cells and IL-2. They pro- http://www.jimmunol.org/ ϩ liferated for several days and then ceased to proliferate. After this passag- Virulent LM (EGD strain; Hly ) and its nonhemolytic strain Ϫ ing of the hybrid cells was repeated five times with intervals of 2 wk, (ATCC15316; Hly ) were obtained from Dr. T. Fujimura (Department of autonomously proliferating cells appeared in one of the wells. This hybrid- Dermatology, Kitasato University School of Medicine, Sagamihara, Ja- oma cell line was designated B6HO3 and used in the present study. pan). A mutant strain of LM, DP-L4048 (39), which produces a mutant listeriolysin O (LLO) protein that is not subjected to phosphorylation, was Flow cytometric analysis of surface Ags obtained from Dr. D. A. Portnoy (Department of Molecular and Cell Bi- ology, University of California, Berkeley, CA). LM strains were grown in This method was described previously (30). tryptic soy broth overnight. Escherichia coli (ATCC25922), Salmonella typhimurium (ST; a stock strain of our laboratory), and Staphylococcus Ab-mediated cross-linking of the TCR-CD3 complex aureus (SA; a stock strain of our laboratory) were grown in brain-heart

␮ by guest on October 1, 2021 infusion broth overnight. The bacteria were washed twice with PBS by Anti-CD3 mAb (25 g/ml) diluted in Tris buffer (0.05 M Tris-HCl, pH 9.5) centrifugation and stored at –80°C until use. Heat-killed LM (HKLM) was was incubated in a 96-well microculture plate at 4°C overnight. After un- ϫ 3 prepared by incubating suspension of bacteria at 70°C for 1 h. S. typhi- bound mAb was removed, 50 10 of B6HO3 cells or YACUT cells were murium expressing type III secretion system (TTSS) was prepared accord- added to each well and cultured for 16 h. ing to the method described elsewhere (21). Briefly, overnight cultures of S. typhimurium were diluted to an OD measured at 600 nm of 0.1 in L- RNA extraction and RT-PCR broth containing 0.3 M sodium chloride, incubated at 37°C for 3 h with Total RNA was extracted from B6HO3 hybridoma and YACUT lymphoma shaking, and used immediately after washing twice with PBS by centrif- by using the High Pure RNA isolation kit (Boehringer Mannheim). RT- ugation. Shigella flexneri 2a strain YSH6000 and its 230-kbp plasmid- PCR was performed by using the Access RT-PCR system (Promega) with cured mutant YSH6200, obtained from Dr. C. Sasakawa (Institute of Med- ␤ two primer sets, 2-microglobulin-specific primers as an endogenous stan- ical Science, University of Tokyo, Tokyo, Japan) (22, 40), were grown in dard (42) and cytokine-specific primers, in the same tube. Primers used for tryptic soy broth at 30°C overnight, then diluted 1/50 with brain-heart PCR are shown in Table I1. They were synthesized by SIGM Genosys and infusion broth, incubated at 37°C for 2.5 h on a horizontal shaker, and used designed with Primer3 software (Broad Institute, Cambridge, MA). immediately after washing twice with PBS. Cytokine assay mAbs and reagents Mouse IFN-␥, TNF-␣, and GM-CSF levels in culture supernatants were The following mAbs were used: FITC-conjugated, PE-conjugated, or bi- determined by ELISA using commercial ELISA kits (BioSource Interna- ␣␤ otinylated mAbs specific for TCR (H-57-59), CD4 (GK1.5), CD8 (53- tional). For early T lymphocyte activation protein 1 (Eta-1), a mouse os- 6.7), CD11c (HL-3), CD69 (H1.2F3), CD45R/B220 (RA3-6B2), DX5, teopontin determination kit (ImmunoBiologicals) was used. For intracel- ␤ TCRV 6 (44-22-1), CD25 (3C7), CD3 (145-2C11), NK1.1 (PK136), Fc- lular cytokine staining, cells pretreated with the blocking anti-Fc␥R mAb ␥ RII/III (2.4G2), and mouse IFN- (XMG1.2) (all purchased from BD (2.4G2) were stained with mAbs against surface markers, and then the cells Pharmingen). Anti-CD1d (1B1) mAb and PE-Cy5-conjugated streptavidin were permeabilized using the Cytofix/Cytoperm Plus kit (BD Pharmingen) ␥␦ were purchased from eBioscience. PE-conjugated anti-TCR (GL3), PE- and stained using either FITC-conjugated anti-IFN-␥ or PE-conjugated anti- conjugated hamster IgG and PE-conjugated anti-mouse IL-4 (BVD6- IL-4 mAb. The data were acquired using FACScan and analyzed using 24G2) were purchased from Caltag Laboratories. Anti-CD244 mAb (C9.1) CellQuest software (BD Biosciences). For measuring intracellular IFN-␥ was produced and fluorescein conjugated in our laboratory (41). Biotinyl- production by B6HO3 cells, B6HO3 cells were separated from J774 cells ␤ ated anti-CD122 mAb (TM- 1) was obtained from Dr. T. Tanaka (Osaka using magnetic cell sorting. Briefly, cells in cocultures of B6HO3 with University, Suita, Japan). Anti-mouse IL-12 polyclonal Abs and its control LM-infected or noninfected J774 cells were collected in microcentrifuge goat Igs were purchased from PeproTech. Biotinylated anti-mouse TCR␥␦ ␥␦ d d tubes and incubated with biotinylated anti-TCR followed by addition of (GL3) was purchased from Immunotech. Anti-H-2K , anti-H-2D , and anti- streptavidin-conjugated microbeads (Miltenyi Biotec), since this mAb non- specifically bound to J774 cells, but not to B6HO3 cells. Magnetically labeled J774 cells were removed by placing the tube in the magnetic field 2 Abbreviations used in this paper: LM, Listeria monocytogenes; BMM, bone mar- of a MACS separator and then the rest of the cells were assessed for row-derived macrophage; CHX, cycloheximide; Eta-1, early T lymphocyte activation ␥ ␥ protein 1; LDH, lactate dehydrogenase; LLO, listeriolysin O; MOI, multiplicity of intracellular IFN- . For measuring intracellular IFN- production by infection; NWNA, nylon wool nonadherent; TTSS, type III secretion system; SA, NWNA spleen cells, dying LM-infected J774 cells were excluded on the Staphylococcus aureus; ST, Salmonella typhimurium. basis of forward and side light scatter. 7578 LYMPHOCYTE RECOGNITION OF MACROPHAGE DEATH

Table I. Primer sequences used for RT-PCR and expected sizes of the PCR products

Product Sizes Cytokine Primer Sequences (5Ј–3Ј)a (bp)b ␤ 2-microglobulin GGCTCGCTCGGTGACCCTAGTCTTT 301 TCTGCAGGCGTATGTATCAGTCTCA IL-2 TGATGGACCTACAGGAGCTCCTGAG 168 GAGTCAAATCCAGAACATGCCGCAG IL-4 CGAAGAACACCACAGAGAGTGAGCT 181 GACTCATTCATGGTGCAGCTTATCG IL-10 TACCTGGTAGAAGTGATGCC 251 CATCATGTATGCTTCTATGC IFN-␥⅐ GCGGCTGACTGAACTCAGATTGTAG 247 GTCACAGTTTTCAGCTGTATAGGG GM-CSF CCCATCACTGTCACCCGGCCTTGG 261 GTCCGTTTCCGGAGTTGGGGGGC TNF-␣ ATGAGCACAGAAAGCATGATC 276 TACAGGCTTGTCACTCGAATT Eta-1 GGATGAACCAAGTCTGGAAACAC 154 GACTAGCTTGTCCTTGTGGCTGT MCP-1 CACCAAGCTCAAGAGAGAGG 243 TTCACTGTCACACTGGTCAC Downloaded from a The sense sequence is shown above the antisense sequence. b Predicted size of the PCR product.

In vitro stimulation of B6HO3 hybridoma and NWNA spleen spectively, are known to be expressed on activated/memory-type T cells by bacterial-infected J774 cells cells (43, 44). Other activation markers for T cells, such as CD69, high high http://www.jimmunol.org/ J774 cells (1 ϫ 105 cells/well) or BMM cells (5 ϫ 104 cells/well) sus- CD45RB , and CD44 (45), were also detected on the pended in culture medium without antibiotics were seeded into a 96-well B6HO3 cells as well as the parental YC11 cells (data not shown).

microculture plate and cultured at 37°C overnight in a CO2 incubator. After These results demonstrate that the B6HO3 is the each well was washed with DMEM without antibiotics, bacteria were in- CD4ϪCD8ϪTCR␣␤ϩ T cell hybridoma exhibiting the activated/ ␮ oculated into each well (100 l/well) of the microculture plate at various memory phenotype. Since some double-negative T cells have been multiplicity of infection(MOI) and the plate was centrifuged at 800 ϫ g for reported to express surface markers such as B220, CD16/CD32 1 min and then incubated at 37°C in a CO2 incubator. After a 1-h infection period, 50 ϫ 103 B6HO3 cells or 8 ϫ 105 NWNA spleen cells per 0.2 ml (46), or DX5 (35), we also examined the expression of those Ags of culture medium containing gentamicin (200 ␮g/ml) were added to each on B6HO3 cells and found that B6HO3 cells were negative for the well. The microculture plate was incubated at 37°C for 24 h in a CO 2 Ags (data not shown). by guest on October 1, 2021 incubator. For B6HO3 cells, culture supernatants were harvested and as- sessed for IFN-␥ levels by ELISA. For NWNA cells, intracellular IFN-␥ staining was conducted and analyzed on FACScan. Cytokine production by B6HO3 cells upon Ab-mediated cross- Macrophage cytotoxicity assay linking of the TCR-CD3 complex Cytotoxcity was assessed by measuring the release of cytosolic lactate B6HO3 cells were next studied for their ability to produce cyto- dehydrogenase (LDH) into the supernatants. J774 cells were incubated kines following activation of the cells by cross-linking of the TCR- with bacteria for a 1-h infection period and then cultured in medium con- CD3 complex with solid-phase anti-CD3 mAb. Fig. 2, A and B, taining 200 ␮g/ml gentamicin. At various time points, the culture super- show the analysis of RT-PCR products from GM-CSF, IFN-␥, natants were harvested and their LDH levels were measured using the IL-2, IL-4, and TNF-␣ mRNAs extracted from the B6HO3 hy- colorimetric Cytotox 96 kit (Promega). The relative LDH release was cal- culated as 100 ϫ (experimental release Ϫ spontaneous release)/(total re- bridoma and the YACUT lymphoma before and after cross-linking lease Ϫ spontaneous release), where spontaneous release is the amount of of the CD3-TCR complex. The CD3-TCR ligation induced LDH activity in the supernatant of uninfected J774 cells and total release B6HO3 cells to express GM-CSF and IFN-␥ mRNA, but not IL-2 is the activity in cell lysates. and IL-4 mRNA, while parental YACUT lymphoma cells tran- scribed only IL-4 mRNA in response to CD3-TCR ligation, whose Results responsiveness was thus suppressed in the B6HO3 hybridoma. Surface membrane phenotype of B6HO3 hybridoma TNF-␣ mRNA was constitutively expressed in both YACUT and The B6HO3 hybridoma and its parental YC11 lymphoma were B6HO3 cells, and CD3-TCR ligation did not enhance the levels of characterized by immunofluorescence for surface staining of Abs its expression in both of the cells. Since some double-negative T specific for a variety of T cell surface Ags. Fig. 1 mainly illustrates cells have been reported to produce MCP-1(CCL2), Eta-1 (47), or FACS profiles of the Ags that were specifically expressed by the IL-10 (34), investigation of their mRNAs expression was included B6HO3 cells. The B6HO3 cells expressed the H-2Dk of the in this experiment. As shown in Fig. 2C, although YACUT cells C3H/He parental lymphocytes and H-2Dd of the YC11 lymphoma did not express Eta-1 mRNA before and after CD3-TCR ligation, (Fig. 1, A–D), which, along with the fact that the mean chromo- B6HO3 cells constitutively expressed Eta-1 mRNA, and the ex- some numbers of B6HO3 were 80 (data not shown), indicates that pression level was enhanced by CD3-TCR ligation. MCP-1 and the B6HO3 cells were hybrids. B6HO3 cells expressed 2B4 IL-10 mRNAs were not detectable in both B6HO3 and YACUT (CD244), CD11c, IL-2R␣ (CD25), IL-2R␤ (CD122) and TCR␣␤ cells before and after CD3-TCR ligation (data not shown). utilizing the V␤6 gene segment (Fig. 1, I–T), but did not express To see production of cytokines at a translational level, secretion CD4 and CD8 (Fig. 1, E–H), whereas none of these Ags were of GM-CSF, IFN-␥, TNF-␣, and Eta-1 into culture supernatants expressed on the parental YC11 cells. CD244 and CD11c, which following activation of B6HO3 and YACUT cells by Ab-mediated are primarily expressed by NK cells (41) and dendritic cells, re- cross-linking of the TCR-CD3 complex was assessed by ELISA The Journal of Immunology 7579

FIGURE 2. Cytokine expression in B6HO3 hybridoma and its parental YACUT lymphoma upon Ab-mediated cross-linking of the TCR-CD3 Downloaded from complex. B6HO3 cells (A) and YACUT cells (B) were cultured in the presence (ϩ) or absence (Ϫ) of solid-phase anti-CD3 mAb for 16 h, and ␤ FIGURE 1. Fluorescence flow cytometric analysis of surface membrane total RNA was extracted, subjected to RT-PCR with two primer sets, 2- phenotypes. YC11 lymphoma cells and B6HO3 hybridoma cells were microglobulin-specific primers as an endogenous standard and cytokine stained with (shaded curve) or without (open curve) each of mAbs indi- specific primers, in the same tube, and then electrophoresed on 3.5% aga- rose gel. Cytokines examined were GM-CSF, IFN-␥, IL-2, IL-4, and cated on the bottom of the panel and analyzed using FACScan. a.u., Ar- http://www.jimmunol.org/ ␣ bitrary units. TNF- , whose PCR primer pairs and product sizes are shown in Table I. The product sizes are also shown in parentheses. The band corresponding ␤ to 301 bp in each lane is a PCR product specific for 2-microglobulin. Lane M, Molecular size marker. C, Eta-1 mRNA expression by B6HO3 and (Fig. 2D). As expected from the results obtained in the RT-PCR YACUT cells was examined as in A and B. D, B6HO3 and YACUT cells experiment (Fig. 2, A and B), B6HO3 cells secreted both GM-CSF were cultured in the presence (ϩ) or absence (Ϫ) of solid-phase CD3 mAb and IFN-␥ into culture supernatants upon CD3-TCR ligation. Un- for 24 h, and culture supernatants were assessed for the production of expectedly, TNF-␣ secretion was observed only in B6HO3 cells cytokines by ELISA. upon CD3-TCR ligation although TNF-␣ mRNA was constitu- by guest on October 1, 2021 tively expressed in both B6HO3 and YACUT cells without its expression levels being enhanced by CD3-TCR ligation (Fig. 2, A the B6HO3 cells cocultured with LM-infected J774 cells were pos- and B). Similarly, although Eta-1 mRNA was constitutively ex- itive for intracytoplasmic IFN-␥ (Fig. 3B, upper panel), whereas pressed in B6HO3 cells (Fig. 2C), Eta-1 secretion by B6HO3 cells no IFN-␥ was detectable in B6HO3 cells cocultured with nonin- was strongly induced upon activation of the cells by CD3-TCR fected J774 cells (Fig. 3B, lower panel). These results indicate that ligation (Fig. 2D). the B6HO3 hybridoma produces IFN-␥ in response to dying LM- infected J774 cells. B6HO3 hybridoma produces IFN-␥ when cocultured with dying LM-infected J774 macrophage cells Cell-cell contact is necessary for activation of B6HO3 cells by In the course of the cell fusion experiments, we noticed that the dying LM-infected J774 cells, but the TCR is not involved in its IL-2-dependent hybrid cells, precursor cells of the B6HO3 hybrid- recognition mechanism oma before its transformation, were gathering around the macro- We next addressed a question of whether soluble mediators se- phages that had been used for feeder cells. Thus, we hypothesized creted by LM-infected J774 cells were responsible for the IFN-␥ that the hybridoma cells might functionally interact with macro- production by B6HO3 cells. To this end, we compared the ability phages. To test this possibility, we cocultured B6HO3 cells with of LM-infected J774 cells to induce IFN-␥ production by B6HO3 the J774 macrophage-like cell line alone or J774 cells infected cells with that of LM-infected J774 supernatants collected at 24 h with each one of the following bacteria: LM, HKLM, LLO-defi- postinfection (Fig. 4A). Since IL-12 plays a pivotal role in the cient (HlyϪ) LM, E. coli, ST, and SA, and then supernatants har- production of IFN-␥ by T and NK cells (3), we also examined vested at 24 h of coculture were assessed for IFN-␥ levels by whether IL-12 played a role in this response by coculturing ELISA as illustrated in Fig. 3A. High amounts of IFN-␥ were B6HO3 cells with LM-infected J774 cells in the presence of neu- detectable only in cocultures of B6HO3 cells with LM-infected tralizing Ab specific for IL-12. Fig. 4A shows IFN-␥ levels in J774 cells. J774 cells cultured with HKLM and J774 cells infected supernatants collected from those 24-h cocultures. A culture su- with HlyϪ LM, Escherichia, Salmonella,orStaphylococcus dis- pernatant from LM-infected J774 cells was incapable of inducing played no significant ability of stimulating B6HO3 cells to produce IFN-␥ by B6HO3 and addition of anti-IL-12 Ab to the coculture IFN-␥. Interestingly, among the bacterial-infected J774 cells ex- did not inhibit the production of IFN-␥. These results indicate that amined, wild type LM-infected J774 cells were the only cells that the IFN-␥ response is IL-12 independent and not triggered by sol- were microscopically observed to undergo cell death. uble mediators. To verify that B6HO3 cells themselves produce IFN-␥, flow To determine whether cell-cell contact between B6HO3 cells cytometric analysis of IFN-␥ production was performed by using and dying LM-infected J774 cells is required for the production of intracellular cytokine staining (Fig. 3B). Approximately 56% of IFN-␥, B6HO3 cells were cocultured with LM-infected J774 cells 7580 LYMPHOCYTE RECOGNITION OF MACROPHAGE DEATH

FIGURE 3. IFN-␥ production by B6HO3 hybridoma cocultured with LM-infected J774 cells. A, Supernatants were collected from 24-h cultures of the following combinations: J774 cells alone, B6HO3 cells alone, B6HO3 and J774 cells, B6HO3 and LM, LM-infected J774 cells, B6HO3 and LM-infected J774 cells, Hly-deficient(HlyϪ) LM-infected J774 cells, B6HO3 and HlyϪ LM-infected J774 cells, HKLM and J774 cells, B6HO3 and HKLM-inoculated J774 cells, E. coli-infected J774 cells, B6HO3 and E. coli-infected J774 cells, ST-infected J774 cells, B6HO3 and ST-infected J774 cells, SA-infected J774 cells, or B6HO3 and SA-infected J774 cells. Infection was performed at MOI of 50:1. IFN-␥ levels of supernatants were measured by ELISA. B, IFN-␥ production by B6HO3 cells was assessed by intracellular cytokine staining. B6HO3 cells were cultured alone (open curve) or cocultured with J774 cells (lower panel, shaded curve) or LM-infected J774 cells (upper panel, shaded curve) for 24 h. Monensin was added for the last 10 h of culture. B6HO3 cells Downloaded from were separated from J774 cells by magnetic cell sorting, stained for intracellular IFN-␥, and analyzed using FACScan. Depletion of J774 cells was confirmed by the fact that no cells were detected in the forward and light scatter area gated for B6HO3 after magnetic cell sorting of control LM-infected J774 cells. Representative data from one of two experiments are shown.

in a Transwell to separate both cells with a permeable membrane, ment showing that TNF-␣ production by LM-infected-J774 cells http://www.jimmunol.org/ which inhibited cell-cell contact (Fig. 4B). Separation of B6HO3 was strongly inhibited in the presence of CHX (Fig. 4E). These cells from dying LM-infected J774 cells failed to induce IFN-␥, results indicate that the B6HO3 cell recognition of dying LM- indicating that cell-cell contact between B6HO3 cells and LM- infected J774 cells does not require de novo protein synthesis in infected J774 cells was required for the activation of B6HO3 cells. LM-infected J774 cells. To evaluate the contribution of the TCR expressed on B6HO3 ␥ cells in the cognitive interaction between B6HO3 cells and dying IFN- production by B6HO3 hybridoma is also induced through LM-infected J774 cells, we examined the effect of Fab of anti- direct cell-cell contact with dying J774 cells infected with S. TCRV␤6 mAb and mAbs to H-2Kd, H-2Dd,Iad, and CD1d, po- flexneri or ST that expressed TTSS by guest on October 1, 2021 tential ligands for the TCR, on the IFN-␥ response by adding each Since S. flexneri and ST had been reported to induce cell death in one of these mAbs to cocultures of B6HO3 cells with LM-infected macrophages (16, 19–26), we next determined whether cell death J774 cells (Fig. 4C). Fab of anti-TCRV␤6 mAb as well as anti- in J774 cells caused by Shigella or Salmonella infection could also H-2Dd, anti-Iad, and anti-CD1d mAbs did not inhibit IFN-␥ pro- induce B6HO3 cells to produce IFN-␥. Fig. 5A shows the time duction by B6HO3 cells. Anti-H-2Kd mAb and a mixture of anti- course of cell destruction following infection of J774 cells with H-2Kd and anti-H-2Dd mAbs slightly enhanced the IFN-␥ LM or Shigella as assessed by LDH release into culture superna- production for an unknown reason. These results indicate that the tants. Infection of J774 cells with LM resulted in cell destruction TCR expressed on B6HO3 cells is not involved in the mechanism beginning at 8 h postinfection, reaching a maximum of 60% death underlying the cognitive interaction between B6HO3 cells and dy- within 20 h. Infection of J774 cells with wild-type Shigella ing LM-infected J774 cells, and thus the IFN-␥ response is TCR YSH6000 resulted in almost complete destruction of the cells independent. within 16 h, while plasmid-cured Shigella-infected J774 cells did not undergo cell death. Fig. 5B shows IFN-␥ levels in supernatants De novo protein synthesis is not required for B6HO3 hybridoma from 24-h cocultures of B6HO3 cells with wild-type Shigella-or cell recognition of dying LM-infected J774 cells plasmid-cured Shigella-infected J774 cells. Like dying LM-in- Since a variety of proteins, such as cytokines and heat shock pro- fected J774 cells, dying wild-type Shigella-infected J774 cells in- teins, are induced to synthesize in bacterial-infected macrophages, duced IFN-␥ production by B6HO3 cells, whereas intact J774 cells we next asked whether de novo protein synthesis in LM-infected infected with plasmid-cured Shigella YSH6200 did not signifi- J774 cells was required for the B6HO3 cell recognition of dying cantly induce B6HO3 cells to produce IFN-␥. Fig. 5C shows the LM-infected J774 cells. To this end, J774 cells that had been result of an experiment using a Transwell to separate B6HO3 cells treated with CHX, an inhibitor of protein synthesis, were infected from dying wild-type Shigella-infected J774 cells, and the result of with LM, and at 6 h postinfection the infected cells were cocul- an experiment in which the ability of a supernatant collected from tured with B6HO3 cells without removing CHX. After4hofco- a 24-h culture of wild-type Shigella-infected J774 cells to induce culture, total RNA was extracted from the cultures and assessed for IFN-␥ production by B6HO3 cells was examined. Separation of the expression of IFN-␥ mRNA by RT-PCR (Fig. 4D). Although wild-type Shigella-infected J774 cells and B6HO3 cells by a per- no IFN-␥ mRNA was detectable in cultures of J774 cells, LM- meable membrane completely abrogated the IFN-␥ production by infected J774 cells, and B6HO3 cells alone, IFN-␥ mRNA expres- B6HO3 cells, and a culture supernatant from wild-type Shigella- sion was detected in cocultures of B6HO3 cells with LM-infected infected J774 cells had no ability to stimulate B6HO3 cells to J774 cells, and this IFN-␥ mRNA expression was not inhibited by produce IFN-␥. These results indicate that direct cell-cell contact the treatment of J774 cells with CHX. The inhibitory effect of between B6HO3 cells and dying Shigella-infected J774 cells is CHX on protein synthesis was confirmed by the parallel experi- necessary for the IFN-␥ production by B6HO3 cells. The Journal of Immunology 7581 Downloaded from http://www.jimmunol.org/ FIGURE 4. Requirement of direct cell-cell contact between B6HO3 cells and LM-infected J774 cells for IFN-␥ production by B6HO3 hybridoma, but no requirement of the TCR and de novo protein synthesis for B6HO3 hybridoma recognition of LM-infected J774 cells. A, B6HO3 cells were cultured for 24 h with a 24-h culture supernatant (*1) from LM-infected J774 cells or cocultured with LM-infected J774 cells in the presence or absence of neutralizing Ab to IL-12 (2 ␮g/ml), and then culture supernatants were assessed for IFN-␥ levels by ELISA. B, B6HO3 cells were cocultured for 24 h with LM-infected J774 cells in either a 24-well microculture plate or a Transwell (*2). C, Effect of Abs on production of IFN-␥ by B6HO3 hybridoma. B6HO3 cells were cocultured for 24 h with LM-infected J774 cells in the presence or absence of the mAb indicated. Data are expressed as the percentage of IFN-␥ production in the presence vs absence of the mAb indicated. D, J774 cells were treated or untreated with 10 ␮g/ml CHX for 10 min, infected with LM, and B6HO3 cells were added to the cultures at 6 h postinfection without removing CHX. After4hofcoculture, total RNA was extracted from each culture indicated and IFN-␥ mRNA expression was assessed by RT-PCR as in Fig. 2. E, Culture supernatants from LM-infected J774 cells treated or untreated with 10 ␮g/ml CHX for 10 h were assessed for TFN-␣ levels by ELISA. Representative data from one of two experiments are shown. by guest on October 1, 2021

The same results were obtained with ST as shown in Fig. 5, toxin as assessed by LDH release into culture supernatants. The D–F. J774 cells infected with Salmonella grown under conditions gliotoxin treatment of J774 cells resulted in cell destruction with for TTSS expression underwent rapid cell death (Fig. 5D) and similar kinetics to cell death in LM-infected J774 cells. However, simultaneously stimulated B6HO3 cells to produce IFN-␥ (Fig. the dying gliotoxin-treated J774 cells, when cocultured with 5E). However, J774 cells infected with Salmonella in stationary B6HO3 cells, did not induce IFN-␥ production by B6HO3 cells as phase neither underwent cell death (Fig. 5D) nor induced IFN-␥ assessed by IFN-␥ levels in culture supernatants (Fig. 6B). Fig. 6B production by B6HO3 cells (Fig. 5E). In the same way as Shigella, also shows that dead J774 cells subjected to freeze and thaw did the necessity of cell-cell contact between B6HO3 cells and dying not stimulate B6HO3 cells to produce IFN-␥. These results indi- Salmonella-infected J774 cells for the induction of IFN-␥ was ver- cate that the B6HO3 hybridoma discriminates between typical ap- ified by both the cell separation experiment and the experiment optotic and necrotic cell death in macrophages and macrophage using a supernatant collected from 24-h cultures of J774 cells in- cell death caused by bacterial infection. fected with Salmonella grown under conditions for TTSS expres- We next addressed a question of whether B6HO3 cells could sion (Fig. 5F). produce IFN-␥ in response to cell death in LM-infected cells other These results indicate that cell death in bacterial-infected J774 than macrophages. To this end, we infected Hepa 1-6 hepatoma cells is closely associated with the ability of the infected cells to cells with mutant LM strain DP-L4048, because infection of Hepa stimulate B6HO3 cells to produce IFN-␥ in a direct cell-cell con- 1-6 cells with wild-type LM did not result in cell death in Hepa 1-6 tact-dependent manner. cells (data not shown). The mutant strain DP-L4048 expresses mu- tant LLO protein, whose potential phosphate acceptor residues in Cell death in J774 cells induced by gliotoxin or freeze thawing the PEST-like sequence were all changed to a residue that cannot and cell death in hepatoma cells caused by LM infection do not accept phosphate, and thus the LLO proteins are not subjected to ␥ trigger B6HO3 hybridoma to produce IFN- degradation in the cytosol, being capable of inducing rapid mem- To determine whether B6HO3 cells recognize macrophage cell brane damage (39). Fig. 6, C–F, show phase-contrasted micro- death per se, we examined whether cell death in J774 cells induced scopic observations of normal Hepa 1-6 cells and J774 cells (Fig. by the treatment of gliotoxin (48) or freeze thawing, which induce 6, C and E) and those infected with the mutant LM stain DP-L4048 apoptosis and necrosis, respectively, in macrophages, could also Fig. 6, D and F) in the absence of gentamicin at 6 h postinfection. induce B6HO3 to produce IFN-␥. Fig. 6A shows the time course of As has been reported (39), J774 cells infected with the mutant cell destruction following a 3-h treatment of J774 cells with glio- strain underwent rapid cell death within 6 h (Fig. 6F). Similarly, 7582 LYMPHOCYTE RECOGNITION OF MACROPHAGE DEATH Downloaded from FIGURE 5. IFN-␥ production by B6HO3 cells cocultured with and time course of LDH release from LM-, Shigella- and Salmonella-infected J774 cells. A and D, J774 cells were infected with LM (f) (MOI, 50:1), wild-type Shigella (YSH6000) (F) (MOI, 4:1), plasmid-cured Shigella (YSH6200) (Œ) (MOI, 20:1), ST culture grown under conditions for TTSS expression (ૺ) (MOI, 10:1), or ST in stationary phase () (MOI, 50:1). At the indicated time points, LDH contents in culture supernatants were determined and relative LDH release was calculated. B and E, Supernatants from 24-h cocultures of B6HO3 cells with LM (MOI, 50:1)-, wild-type Shigella (YSH-6000)(MOI, 4:1)-, plasmid-cured Shigella (YSH6200)(MOI, 20:1)-, TTSS-expressing ST (MOI, 10:1)-, or stationary-phase ST (MOI, 50:1)-infected J774 cells were assessed for IFN-␥ levels by ELISA. C and F, B6HO3 cells were cocultured for 24 h with wild-type Shigella (YSH-6000)(MOI, 4:1)-infected J774 cells or with J774 cells infected with ST grown under conditions for TTSS expression in a http://www.jimmunol.org/ 24-well microculture plate or in a Transwell, and culture supernatants were assessed for IFN-␥ production by ELISA. *1 and *5, B6HO3 cells were added to an upper chamber of a Transwell. *2, A 24-h culture supernatant from wild-type Shigella-infected J774 cells. *3, ST grown under conditions for TTSS expression. *4, Stationary-phase culture of ST. *6, A 24-h culture supernatant from J774 cells infected with ST grown under conditions for TTSS expression. Data are representative from one of two experiments. the mutant strain induced rapid cell death in Hepa 1-6 cells (Fig. ducing ␣␤ T cells expressed intermediate levels of the TCR␣␤. 6D). To see whether both of the dying cells have the ability to Unexpectedly, dying LM-infected J774 cells also induced a by guest on October 1, 2021 induce B6HO3 cells to produce IFN-␥, the DP-L4048-infected small percentage of non-␣␤ T cells (6.1 Ϯ 0.6% of total NWNA J774 and Hepa 1-6 cells were cocultured with B6HO3 cells for spleen cells) to produce IFN-␥ (Fig. 7D, lower right quadrant), 24 h, and IFN-␥ levels in the supernatants were assessed by and those cells were decreased to 3.0 Ϯ 0.4% in the presence of ELISA. Fig. 6G shows that dying DP-L4048-infected J774 cells anti-IL-12 Ab (Fig. 7G, lower right quadrant). When the dot induced B6HO3 to produce IFN-␥, but dying DP-L4048-infected plots were gated on IFN-␥-producing non-␣␤ T cells and as- Hepa 1-6 cells did not. These results indicate that the IFN-␥ re- sessed for DX5 expression, 89.2 Ϯ 4.2% and 92.1 Ϯ 2.7% of sponse of B6HO3 is a bacterial-infected macrophage death-spe- the IFN-␥-producing non-␣␤ T cells were DX5ϩ in the absence cific phenomenon. and presence of anti-IL-12 Ab, respectively (Fig. 7, E and H), indicating that most of the IFN-␥-producing non-␣␤ T cells ␣␤ ␥␦ Ϫ ϩ A minor subset of T cells and subsets of T and NK cells were NK cells. Of total NK cells (␣␤TCR DX5 cells), 41.4 Ϯ respond to dying LM-infected J774 cells with the production of 5.0% were IFN-␥ϩ cells, which were reduced to 26.3 Ϯ 2.6% ␥ IFN- in a cell-cell contact-dependent manner in the presence of anti-IL-12 Ab (data not shown). Since ϳ10% The above-mentioned functional phenotype of the T cell hybrid- of IFN-␥-producing non-␣␤T cells were not NK cells, we next oma B6HO3 predicted that a minor subset of T cells should determined whether ␥␦T cells also produced IFN-␥. As shown recognize dying LM-infected J774 cells. To address this ques- in Fig. 7, I–K, when NWNA spleen cells cocultured with dying tion, wild-type LM- or HlyϪ LM-infected J774 cells were LM-infected J774 cells in the presence of anti-IL-12 Ab (Fig. cocultured with C3H/He mouse nylon wool nonadherent 7J) or control Ab (Fig. 7I) were stained with PE-conjugated (NWNA) spleen cells in ordinary wells or Transwells in the mAb specific for TCR␥␦ (Fig. 7, I and J) or control PE-conju- presence of either neutralizing Ab specific for IL-12 or control gated hamster IgG (Fig. 7K) followed by intracellular IFN-␥ Ab, and 24 h after coculture the NWNA spleen cells were as- staining, 21 Ϯ 0.2% of ␥␦ T cells, which comprised 2.4 Ϯ 0.3% sessed for IFN-␥ production by intracellular cytokine staining of the NWNA spleen cell population, produced IFN-␥ in the in combination with surface staining of TCR␣␤ and NK cell absence of anti-IL-12 Ab and 6.4 Ϯ 1.6% of ␥␦ T cells pro- marker DX5. A representative result is shown in Fig. 7, A–K. duced IFN-␥ in the presence of anti-IL-12 Ab. Fig. 7, C and F, Although coculture of NWNA spleen cells with HlyϪ LM-in- show that separation of NWNA spleen cells from dying LM- fected J774 cells, which had not undergone cell death, did not infected J774 through permeable membrane failed to induce result in the production of IFN-␥ by NWNA spleen cells (Fig. NWNA spleen cells to produce IFN-␥, indicating that IFN-␥ 7B), dying wild-type LM-infected J774 cells indeed induced production by a minor subset of ␣␤ T cells and subsets of ␥␦ T 2.3 Ϯ 0.5% of ␣␤ T cells to produce IFN-␥ (Fig. 7D), of which and NK cells is completely dependent on direct cell-cell contact the proportion was decreased to 0.7 Ϯ 0.1% by addition of with dying LM-infected J774 cells. To ensure that LM-infected anti-IL-12 Ab (Fig. 7G). It is noteworthy that the IFN-␥-pro- J774 culture supernatants do not include soluble mediators that The Journal of Immunology 7583 Downloaded from http://www.jimmunol.org/ FIGURE 6. Time course of LDH release from gliotoxin-treated J774 cells, and B6HO3 hybridoma cell recognition of dying J774 cells caused by gliotoxin treatment or freeze thawing and of dying Hepa 1-6 cells infected with mutant LM strain DP-L4048. A, J774 cells were treated with gliotoxin (10 ␮M) for 3 h, washed extensively, and at the indicated time point, culture supernatants were collected and LDH contents were determined. B, J774 cells infected with LM, or treated with gliotoxin as in A, or subjected to freeze thawing, were cocultured with B6HO3 cells for 24 h and supernatants were assessed for IFN-␥ production. C–F, phase-contrasted microscopic observations of control Hepa 1-6 cells (C) and J774 cells (E), and those of dying Hepa 1-6 hepatoma cells (D) and J774 cells (F) infected at MOI of 4:1 with mutant LM strain DP-L4048 at 6 h postinfection. G, B6HO3 cells were cocultured with dying DP-L4048-infected Hepa 1-6 cells or dying DP-L4048-infected J774 cells for 24 h, and IFN-␥ levels in supernatants were assessed by ELISA. Gentamicin was added to cultures at 6 h postinfection. Data are representative from one of two experiments. by guest on October 1, 2021 can induce T and NK cells to produce IFN-␥, NWNA spleen by using three-color flow cytometric analysis. C3H/He mouse cells were cultured for 24 h with (Fig. 7M) or without (Fig. 7L) NWNA spleen cells that had been cocultured with LM-infected a supernatant collected from 24-h cultures of LM-infected J774 J774 cells in the presence of anti-IL-12 Ab or control Ab were cells, and the production of IFN-␥ by NWNA spleen cells was stained for TCR␣␤, intracellular IFN-␥, and CD4 or CD8, sub- assessed by intracellular cytokine staining. As shown in Fig. jected to flow cytometry, and then dot plots were gated on IFN- 7M, a culture supernatant from LM-infected J774 cells was in- ␥-producing ␣␤ T cells and analyzed for the expression of CD4 capable of inducing IFN-␥ by NWNA spleen cells. and CD8. A representative result is shown in Fig. 8A. Of the IFN- To evaluate the role of IL-12, various amounts of anti-IL-12 Ab ␥-producing ␣␤ T cells, 5.2 Ϯ 2.3% were CD8ϩ and 55.8 Ϯ 9.2% were added to the cocultures and their effects on the IFN-␥ pro- were CD4ϩ in the absence of anti-IL-12 Ab, and 7.3 Ϯ 2.4% were duction by NWNA spleen cells were examined (Fig. 7, N and O). CD8ϩ and 43.9 Ϯ 9.4% were CD4ϩ in the presence of anti-IL-12 Addition of a range of concentrations between 0.01 and 0.3 ␮g/ml Ab. These results indicate that the IFN-␥-producing ␣␤ T cell anti-IL-12 Ab resulted in a decrease in the numbers of IFN-␥- population mainly consists of CD4ϩ (ϳ50%) and CD4ϪCD8Ϫ producing ␣␤ T and non-␣␤ T cells by ϳ25 and ϳ50%, respec- (ϳ44%) ␣␤ T cells. It was noteworthy that the level of CD4 ex- tively, but higher concentrations than 1 ␮g/ml anti-IL-12 Ab no pression on the surface of the IFN-␥-producing ␣␤ T cells (Fig. 8, longer reduced the number of IFN-␥-producing cells. These results middle and bottom panels) was lower that that of ordinary T cells indicate that 1 ␮g/ml anti-IL-12 Ab was sufficient to neutralize (Fig. 8, top panel). IL-12 and that ϳ25% of the IFN-␥-producing ␣␤ T cells and ␥ ␣␤ ϳ50% of IFN-␥-producing non-␣␤ T cells did not require IL-12 IFN- -producing T cells involve NKT cells for the production of IFN-␥. Because the surface membrane phenotype of the IFN-␥-producing Overall, these results indicate that a small percentage of ␣␤ T ␣␤ T cells responding to dying LM-infected J774 cells was similar cells recognize and respond to dying LM-infected J774 cells by to that of NKT cells (35), we next determined whether the IFN- producing IFN-␥ in a similar way as the B6HO3 T cell hybridoma. ␥-producing ␣␤ T cells were NKT cells or not. To this end, Furthermore, subsets of ␥␦ T and NK cells proved to have the NWNA spleen cells from a C57BL/6 mouse instead of a C3H/He same ability of responding to dying LM-infected J774 cells as this mouse were cocultured with dying LM-infected J774 cells in the minor subset of ␣␤ T cells. presence of anti-IL-12 Ab or control Ab, stained with mAbs spe- cific for TCR␣␤ and NK1.1 followed by intracellular IFN-␥ and ␥ ␣␤ Surface membrane phenotype of IFN- -producing T cells IL-4 staining, and then three-color flow cytometric analysis was We further examined CD4 and CD8 expression on the IFN-␥- performed (Fig. 8B). Dying LM-infected J774 cells did not induce producing ␣␤ T cells responding to dying LM-infected J774 cells NWNA spleen cells to produce IL-4, but induced 2.9 Ϯ 0.8% of 7584 LYMPHOCYTE RECOGNITION OF MACROPHAGE DEATH

(ϳ75%). When the opposite analysis was done by gating on NK1.1ϩ T cells and evaluating the percentage of IFN-␥-producing cells in this NKT cell population, we found that 60 Ϯ 5.5% and 10 Ϯ 2.7% of the NK1.1ϩ NKT cells were IFN-␥ ϩ in the absence and presence of anti-IL-12 Ab, respectively (Fig. 8C). Because most of NK1.1ϩ NKT cells carry an invariant TCR restricted to interactions with the class I-like molecule CD1d, we determined whether CD1d was involved in the NKT cell recogni- tion of dying LM-infected J774 cells. To this end, blocking anti- CD1d mAb was added to cocultures of C57BL/6 mouse NWNA spleen cells with LM-infected J774 cells in the presence of anti- IL-12 Ab or control Ab, and the numbers of IFN-␥ ϩNK1.1ϩ NKT cells per 105 NWNA spleen cells were determined by three-color flow cytometric analysis (Fig. 8D). Addition of anti-CD1d mAb did not reduce the numbers of both the IL-12-dependent and -in- dependent IFN-␥ϩNK1.1ϩ NKT cells that responded to dying LM-infected J774 cells. This result indicates that the V␣14 invari- ant TCR expressed on NKT cells is not involved in the mechanism by which NKT cells recognize dying LM-infected J774 cells. Also this result is consistent with the conclusion that the contact-depen- Downloaded from dent interaction between B6HO3 T cell hybridoma and dying LM- infected J774 cells is not mediated by the TCR of B6HO3 cells (Fig. 4C).

Cell death in LM-infected BMM cells is also associated with the http://www.jimmunol.org/ IFN-␥ production by subsets of ␣␤ T cells, ␥␦ T cells, and NK cells Since LM had been reported to induce nonapoptotic cell death in BMM (17), we reiterated the same experiments using BMM in- stead of the J774 macrophage cell line to corroborate that dying ␣␤ ␥␦ FIGURE 7. Subsets of T cells, T cells, and NK cells produce LM-infected macrophages have the ability to stimulate subsets of ␥ IFN- in response to dying LM-infected J774 cells. C3H/He mouse lymphocytes to produce IFN-␥ in a cell-cell contact-dependent NWNA spleen cells were cocultured for 24 h with J774 cells alone (A), Ϫ manner. C57BL/6 mouse BMM cells were infected with LM and Hly LM-infected J774 cells (B), or LM-infected J774 cells in an ordinary by guest on October 1, 2021 24-well plate (D and G) or a Transwell (C and F) in the presence (2 ␮g/ml) cocultured with syngeneic C57BL/6 mouse NWNA spleen cells in of anti-IL-12 Ab (F and G) or control Ab (C and D). Monensin was added ordinary wells or Transwells in the presence of either neutralizing forthelast6hofculture. NWNA spleen cells were assessed for TCR␣␤ anti-IL-12 Ab or control Ab, and 20 h after coculture the NWNA and DX5 expression by double-labeled surface staining and for IFN-␥ pro- spleen cells were assessed for intracellular IFN-␥ production by duction by intracellular cytokine staining. The histograms represent three-color flow cytometric analysis (Fig. 9). LM induced cell TCR␣␤ϪIFN-␥ϩ gated cells stained for DX5. I–K, C3H/He NWNA spleen death in BMM (Fig. 9B), as has been reported, and coculture of cells cocultured with dying LM-infected J774 cells in the presence of anti- dying LM-infected BMM cells with NWNA spleen cells induced ␥␦ IL-12 Ab (J) or control Igs (I) were assessed for TCR expression and 1.6 Ϯ 0.6% of ␣␤ T cells, part of non-␣␤ T cells (2.0 Ϯ 0.3% of ␥ intracellular IFN- production. Control staining was conducted by using total NWNA spleen cells; Fig. 9D), and 15 Ϯ 2% of ␥␦ T cells PE-conjugated hamster IgG (K). L and M, C3H/He mouse spleen cells were (Fig. 9I) to produce IFN-␥. When anti-IL-12 Ab was added to the cultured for 24 h with (M) or without (L) a 24-h culture supernatant col- ␥ ␣␤ ␣␤ lected from dying LM-infected J774 cells and were assessed for TCR␣␤ coculture, the proportion of IFN- -producing T cells, non- ␥␦ Ϯ Ϯ expression and intracellular IFN-␥ production. N and O, Effect of various T cells, and T cells decreased to 0.4 0.2%, 1.1 0.2%, and concentrations of anti-IL-12 Ab on the IFN-␥ production by ␣␤ T and 3.9 Ϯ 0.6%, respectively. Addition of higher concentrations than 2 non-␣␤T cells was examined. IFN-␥ϩ cells were expressed as the percent- ␮g/ml anti-IL-12 no longer reduced the number of IFN-␥-produc- age of IFN-␥ϩ cells in the presence of anti-IL-12 Ab vs control Ab. The ing cells (data not shown). When the dot plots were gated on numbers shown in the upper right quadrants represent mean percentages of TCR␣␤ϩNK1.1ϩ cells (NKT cells), we found that 50.9 Ϯ 7.0% ϩ IFN-␥ cells in ␣␤ T cells or ␥␦ T cells, and those in the lower right and 16 Ϯ 5.2% were IFN-␥ϩ in the absence or presence of anti- ␥ϩ ␣␤ Ϫ ϩ quadrants represent mean percentages of IFN- non- T cells in total IL-12 Ab, respectively (Fig. 9, G and H). Of TCR␣␤ NK1.1 spleen NWNA cells from four experiments. cells (NK cells), 46 Ϯ 9% were IFN-␥ϩ, of which the proportion was decreased to 27 Ϯ 5% in the presence of anti-IL-12 Ab (data not shown). Separation of NWNA spleen cells from dying LM- ␣␤ T cells to produce IFN-␥, of which the proportion was de- infected BMM cells in a Transwell failed to induce IFN-␥ produc- creased by 0.6 Ϯ 0.2% in the presence of anti-12 Ab. Of the IFN- tion (Fig. 9F). These results indicate that in addition to a minor ␥-producing ␣␤ T cells, 27.2 Ϯ 2.3% were NK1.1ϩ in the absence subpopulation of ␣␤ T cells, subsets of ␥␦ T cells, NK cells, and of anti-IL-12 Ab, and 24.8 Ϯ 1.8% were NK1.1ϩ in the presence NKT cells produced IFN-␥ in response to direct cell-cell contact of anti-IL-12 Ab. The NK1.1ϩ T cells comprised 1.5 Ϯ 0.2% of with dying LM-infected BMM. the NWNA spleen cell population and this proportion remained Mutant LM strain DP-L4048 infection has been reported to in- unchanged before and after coculture with LM-infected J774 cells duce cell death in macrophages in a manner that is inversely cor- (data not shown). These results indicate that IFN-␥-producing ␣␤ related to the presence of gentamicin in culture medium (39); ac- T cells consist of NK1.1ϩ NKT cells (ϳ25%) and non-NKT cells cordingly, we examined whether the IFN-␥ production by NWNA The Journal of Immunology 7585

FIGURE 8. Phenotypic characterization of IFN- ␥-producing ␣␤ T cells by means of three-color flow cytometric analysis. A, C3H/He NWNA spleen cells that had been cocultured with dying LM-infected J774 cells for 24 h in the presence (2 mg/ml) of anti-IL-12 Ab or control Ab were assessed for the expression of TCR␣␤, intracellular IFN-␥, and CD4 or CD8. A representative result from four experi- ments is shown, and the numbers within the histo- ϩ grams represent the mean percentages of CD8 or Downloaded from CD4ϩ cells in gated IFN-␥ϩ ␣␤ T cells. B, C57BL/6 NWNA spleen cells were assessed for the expres- sion of TCR␣␤, NK1.1, and intracellular IFN-␥ or IL-4. The numbers within the histograms represent the mean percentages of NK1.1ϩ cells in gated IFN-␥ϩ ␣␤ T and non-␣␤T cells from three exper- ϩ iments. C, The percentages of IFN-␥ cells in NKT http://www.jimmunol.org/ cells were determined from three experiments and shown in the histograms. D, C57BL/6 NWNA spleen cells cultured as in B in the presence or ab- sence of blocking mAb specific for CD1d were sub- jected to three-color flow cytometric analysis, and the numbers of IFN-␥ϩ NKT cells per 105 NWNA spleen cells were determined. by guest on October 1, 2021

spleen cells was also inversely correlated to the presence of gen- Discussion tamicin. As shown in Fig. 10, A and B, when gentamicin was We have established in the present study a novel double-negative added 45 min after infection, DP-L4048-infected BMM did not T cell hybridoma line designated B6HO3, which expresses acti- undergo cell death, probably because bacteria that escaped from vated/memory markers such as CD25, CD69, CD44high, and host phagosomes were killed by the antibiotic that was allowed to CD45RBhigh and produces IFN-␥, TNF-␣, GM-CSF, and Eta-1, flow into the cytoplasm through the plasma membrane permeabilized but not IL-2 and IL-4 upon CD3-TCR ligation. We have also by the mutant LLO (39), whereas in the absence of gentamicin DP- shown that the B6HO3 hybridoma recognizes a specialized form L4048-infected BMM underwent cell death within 10 h. When of macrophage cell death caused by bacterial infection in a TCR- NWNA spleen cells were cocultured with these BMM cells, dying independent manner and consequently produces IFN-␥ in an IL- DP-4048-infected BMM cells, but not intact DP-L4048-infected BMM cells, induced IFN-␥ production by NWNA spleen cells (Fig. 12-independent manner. 10, C and D). The same results were obtained with B6HO3 hybrid- A variety of bacterial pathogens induce cell death in macro- oma. When B6HO3 cells were cocultured with the dying or intact phages (16), but the mechanisms by which cell death is induced DP-L4048-infected BMM cells, only the dying DP-L4048-infected seem to be manifold and there exists considerable controversy; i.e., BMM cells induced B6HO3 cells to produce IFN-␥ (Fig. 10E). combinations of different types of macrophage cells and bacteria These results indicate that cell death in BMM caused by LM have been reported to induce different modes of cell death in bac- infection is closely associated with its capability of stimulating terial-infected macrophages, with some exhibiting apoptotic or au- subsets of lymphocytes and the B6HO3 hybridoma to produce tophagic cell death and others exhibiting necrosis or oncosis (15– IFN-␥, and thus this phenomenon is not limited to the J774 mac- 26). The mode of cell death in LM-infected J774 cells has been rophage cell line. shown to be nonapoptotic (Ref. 17 and my unpublished data), but 7586 LYMPHOCYTE RECOGNITION OF MACROPHAGE DEATH Downloaded from

FIGURE 9. IFN-␥ production by subsets of ␣␤ T cells, ␥␦ T cells, and FIGURE 10. NK cells in response to dying LM-infected BMM. C57BL/6 mouse BMM Correlation of cell death in BMM caused by mutant LM ␥ cells were infected with wild-type LM (MOI, 50:1) and cocultured for 24 h strain DP-L4048 with the production of IFN- by NWNA spleen cells and A B, http://www.jimmunol.org/ with C57BL/6 mouse NWNA spleen cells in an ordinary 24-well plate by B6HO3 hybridoma cells. and Phase-contrasted microscopic ob- (C–E and G–K) or a Transwell (F) in the presence (2 mg/ml) of anti-IL-12 servations of DP-L4048-infected C57BL/6 mouse BMM cells at 20 h ␮ A B Ab (E and H) or control Ab (D). The expression of TCR␣␤, NK1.1, and postinfection. Gentamicin (100 g/ml) was added 45 min ( )or10h( ) C D, IFN-␥ was analyzed using FACScan. The histograms in D and E represent after bacterial internalization. and DP-L4048-infected C57BL/6 TCR␣␤Ϫ IFN-␥ϩ gated cells stained for NK1.1, and the histograms in G BMM cells were cocultured with C57BL/6 mouse NWNA spleen cells for ␣␤ and H represent TCR␣␤ϩNK1.1ϩ gated cells (NKT cells) stained for 24 h and NWNA spleen cells were assessed for TCR expression and ␥ IFN-␥. I–K, The same NWNA spleen cells in the presence of anti-IL-12 Ab intracellular IFN- production by flow cytometric analysis. Gentamicin C D E, (J) or control Ab (I) were assessed for TCR␥␦ expression and intracellular was added at 45 min ( )orat10h( ) postinfection. DP-L4048-infected IFN-␥ production. Control staining was conducted by using PE-conjugated C57BL/6 mouse BMM cells were cocultured with B6HO3 hybridoma cells ␥ hamster IgG (K). Data are representative from one of three experiments. for 24 h and culture supernatants were assessed for IFN- levels by ELISA. by guest on October 1, 2021 The numbers shown in the upper right quadrants represent mean percent- Gentamicin was added 45 min (*1) or 10 h (*2) after bacterial ages of IFN-␥ ϩ cells in ␣␤ T cells or ␥␦ T cells. internalization. the exact mechanism is yet undefined. Mutant LM DP-4048, which The precise mode of the pathogen-induced macrophage cell death produces mutant LLO protein that is not subjected to intracellular that B6HO3 cells can recognize and the recognition mechanism degradation, has been reported to induce cell death in J774 cells by thereof remain to be further explored. rapid pore formation in the plasma membrane (39). Shigella was Since our hybridoma system dictates most of the terminally dif- first shown to induce apoptosis in J774 cells in a caspase-1-depen- ferentiation programs of parental T cells and thus preserves the dent manner (16, 18), but recent reports have shown that Shigella effector functions of T cells (30, 31), the unique functional phe- induces necrotic cell death (22, 23); i.e., the Shigella YSH 6000 notype of the B6HO3 hybridoma predicted existence of a hitherto strain induces necrosis in J774 cells by forming pores in the unknown minor T cell population that should respond to pathogen- plasma membrane (22). Salmonella-induced macrophage death in- induced macrophage cell death by producing IFN-␥. In fact, the volves several mechanisms depending on the particular stage of present study has revealed that in response to direct cell-cell con- infection (15, 19–21, 25). Salmonella grown under conditions for tact with dying LM-infected J774 cells ϳ1.6 and ϳ0.7% of splenic TTSS expression has been reported to induce rapid cell death that ␣␤ T cells produce IFN-␥ in an IL-12-dependent and -independent is caspase-1 dependent and characterized by necrosis-like features manner, respectively. These two IFN-␥-producing ␣␤ T popula- that include an increase in the cell membrane permeability (21). tions consisted of CD4ϩ (ϳ50%), CD4ϪCD8Ϫ (ϳ44%), and Thus, since the modes of cell death in the bacterial-infected J774 CD8ϩ (ϳ6%) T cells expressing intermediate levels of TCR␣␤. cells examined in the present study are all reportedly nonapoptotic, Among these T cells, the CD4Ϫ CD8Ϫ ␣␤ T cells that produce the IFN-␥ response of B6HO3 appears to be particularly associated IFN-␥ independently from IL-12 signaling appears to be the pa- with necrosis-like cell death in macrophages resulting from bac- rental T cell of the B6HO3 hybridoma. As B6HO3 cells expressed terial infection. The results presented here have shown that the CD244 and CD11c, we examined whether IFN-␥-producing ␣␤ T IFN-␥ response of B6HO3 is macrophage cell death specific (Fig. cells also expressed these Ags and we found that very few IFN- 6) and does not require de novo protein synthesis in bacterial- ␥-producing ␣␤ T cells expressed CD244 and CD11c (data not infected macrophages (Fig. 4D). Therefore, some intracellular en- shown). Thus, the parental T cell of this hybridoma might have tity that exists intrinsically inside macrophages could be exposed happened to be the cell expressing these Ags. Like the B6HO3 or released outside the surface membrane due to the specialized hybridoma, all of the IFN-␥-producing ␣␤ T cells responding to form of macrophage cell death caused by bacterial infection, and dying LM-infected J774 cells had a CD44highCD69ϩ phenotype this exposed novel entity could be recognized by B6HO3 cells. (data not shown). Since this phenotype is expressed upon T cell The Journal of Immunology 7587 activation, it was not determined whether it was induced to express subpopulations among the ␣␤ T cells, ␥␦ T cells, and NK cells that on the IFN-␥-producing cells as a result of activation through the produce IFN-␥ in response to direct cell-cell contact with dying interaction with dying J774 cells or this particular subset of ␣␤ T LM-infected J774 cells (Fig. 7). The direct cell contact with dying cells naturally expressed this activation phenotype in vivo like in- LM-infected macrophages, therefore, provides a novel costimula- nate T lymphocytes (36). However, the latter possibility is more tion signal for the production of IFN-␥ by the IL-12-dependent likely, because the functional T cell hybridoma B6HO3 expressed populations, while this signal is necessary and sufficient for the this phenotype and the IFN-␥-producing ␣␤ T cells were shown to IL-12-independent subsets of the ␣␤ T cells, ␥␦ T cells, and NK involve NKT cells (Fig. 8B), which are known to bear this acti- cells to produce IFN-␥. These two IL-12-dependent and -indepen- vation phenotype (35). dent populations may differ in maturation stages, exhibiting dif- The experiments using C57BL/6 mice have shown that ϳ26% ferent responsiveness to this costimulation signal, and thus it may of the IFN-␥-producing ␣␤ T cells responding to dying LM-in- be a potentiating role that IL-12 plays in this response. fected J774 cells are NK1.1ϩ NKT cells (Fig. 8B) and the rest are The experiments with BMM in the present study have corrob- NK1.1 negative. It was possible that the NK1.1Ϫ ␣␤ T cells were orated the results obtained using the J774 macrophage cell line. derived from NK1.1ϩ NKT cells as a result of down-regulation of Thus, we may conclude that IFN-␥ production by subsets of innate NK1.1 Ag expression upon activation of the cells (49). However, lymphocytes in response to direct cell-cell contact with dying bac- this possibility is unlikely, because the proportion of NK1.1ϩ NKT terial-infected macrophages is a general phenomenon not limited cells in the NWNA spleen cell population remained unchanged to the J774 macrophage cell line. The macrophages constitute the before and after coculture with dying LM-infected J774 cells (data first line of defense against bacterial pathogen, and activation of not shown). Since NKT cells consist of phenotypically and func- macrophages by IFN-␥ is cardinally important in the early defense tionally diver cell populations (35, 50), the definition of NKT cells against bacterial infection. Therefore, macrophage cell death in- Downloaded from is expanding and it is now known that there exist NK1.1Ϫ NKT duced by bacteria is thought to be detrimental to the host defense cells (50). Because the IFN-␥-producing ␣␤ T cells expressed in- against bacterial infection, although the biological significance of termediate levels of the TCR (Fig. 7), which is one of the charac- the pathogen-induced cell death in macrophages is not fully de- teristics of NKT cells (35, 50), it is possible that the NK1.1Ϫ ␣␤ fined. The demonstration of IFN-␥ production by NKT cells, NK T cells may represent NK1.1Ϫ NKT cells. Further investigation is cells, and ␥␦ T cells as well as B6HO3 T cell hybridoma following necessary to define this IFN-␥ϩNK1.1Ϫ ␣␤ T cell in view of NKT direct cell-cell contact with dying LM-infected macrophage cells http://www.jimmunol.org/ cell biology. raises the possibility that there is a novel innate IFN-␥ production The present study has also shown that in response to contact- pathway that is mediated by the innate lymphocyte recognition of dependent interaction with dying LM-infected J774 cells ϳ50 and macrophage cell death caused by bacterial infection. Provided that ϳ10% of splenic NK1.1ϩ NKT cells produce IFN-␥ in an IL-12- this innate IFN-␥ production does not require de novo protein syn- dependent and -independent manner, respectively (Fig. 8C) and thesis in bacterial-infected macrophages as has been shown with that this response is not mediated by the V␣14 invariant TCR the B6HO3 hybridoma (Fig. 4D), the proposed IFN-␥ production expressed on the NKT cells (Fig. 8D). Upon TCR ligation, NKT pathway may particularly contribute to the host defense at the ini- cells rapidly produce many cytokines including Th1 and Th2 cy- tial phase of bacterial infection where resting macrophages are by guest on October 1, 2021 tokines such as IFN-␥ and IL-4 and thus NKT cells have been killed and exposed to danger by an attack of microbial pathogens implicated in a variety of immune responses, playing a regulatory before de novo protein synthesis that is required for cytokine pro- role (51, 52). However, the question remains as to how a variety of duction can take place. cytokines produced by NKT cells leads to a regulated immune The establishment of the functional T cell hybridoma line response (52). The production of IFN-␥, but not IL-4, by NKT B6HO3, which has led to the identification of the innate lympho- cells upon interaction with dying LM-infected J774 cells (Fig. 8B) cytes that respond to dying LM-infected macrophage cells, will may explain one of the regulation mechanisms by which NKT make it feasible to dissect the mechanisms underlying the lym- cells direct the Th1-type response that is beneficial for eradication phocyte recognition of macrophage cell death and the precise of invaded bacteria. mode of the specialized cell death in macrophages caused by bac- Unexpectedly, this study has revealed that in addition to the terial infection. It will also open new insights into the innate im- minor subset of ␣␤ T cells, which obviously involve NKT cells, mune responses of lymphocytes upon bacterial infection. ϳ15% of splenic ␥␦ T cells and ϳ15% of splenic NK cells in an IL-12-dependent manner and ϳ6% of the ␥␦ T cells and ϳ26% of Acknowledgments the NK cells in an IL-12-independent manner produce IFN-␥ in We thank Drs. Sasakawa, Portony, and Fujimura for providing bacteria, Dr. response to direct cell-cell contact with dying LM-infected J774 Tamauchi for help with three-color flow cytometric analysis, and Dr. cells. NK cells, NKT cells, and ␥␦ T cells are grouped as innate Tanaka for mAb. lymphocytes, which are characterized as having germline-encoded Disclosures autoreactive receptors, being poised to unleash their effector func- The authors have no financial conflict of interest. tion and participating in innate immune responses (36, 53). The present results suggest that subsets of these innate lymphocytes References posses a common recognition system sensing macrophage cell 1. Ross, J. A., and M. J. Auger. 2002. Macrophages in bacterial infection. In The death caused by bacterial infection and consequently produce Macrophage, 2nd Ed. B. Burke and C. E. Lewis, eds. Oxford Univ. Press, Ox- IFN-␥. These IFN-␥-producing NK and ␥␦ T cell subpopulations ford, pp. 3–72. 2. Janeway, C. A., and R. Medzhitov. 2002. Innate immune recognition. Annu. Rev. remain to be further characterized to shed light on the understand- Immunol. 20: 197–216. ing of NK cell and ␥␦ cell biology. 3. Trinchieri, G. 2003. Interleukin-12 and the regulation of innate resistance and IL-12 is a pivotal cytokine for IFN-␥ production by NK cells adaptive immunity. Nat. Rev. Immunol. 3: 133–146. 4. Dinarello, C. A., and G. 2003. Fantuzzi. Interleukin-18 and host defense against and T cells, but IL-12-induced efficient IFN-␥ production by these infection. J. Infect. Dis. 187: S370–S384. cells requires costimulation mediated by other cytokines such as 5. Tripp, C. S., S. F. Wolf, and E. R. Unanue. 1993. Interleukin 12 and tumor necrosis factor ␣ are costimulators of interferon ␥ production by natural killer IL-18 or by interaction with other cognate cells (3). The present cells in severe combined immunodeficiency mice with listeriosis, and interleukin study revealed that there are IL-12-dependent and -independent 10 is a physiologic antagonist. Proc. Natl. Acad. Sci. USA 90: 3725–3729. 7588 LYMPHOCYTE RECOGNITION OF MACROPHAGE DEATH

6. Hunter, C. A., R. Chizzonite, and J. S. Remington. 1995. IL-1␤ is required for 31. Kubota, K., K. Nakazato, H. Tamauchi, T. Sasahara, and H. Katoh. 1996. Gen- IL-12 to induce production of IFN-␥ by NK cells: a role for IL-1␤ in the T eration of novel killer hybridomas derived from proliferation-suppressed somatic cell-independent mechanism of resistance against intracellular pathogens. J. Im- cell hybrids between YACUT T cell lymphoma and normal lymphocytes acti- munol. 155: 4347–4354. vated in secondary mixed lymphocyte cultures. J. Immunol. Methods 192: 7. Bregenholt, S., P. Berche, F. Brombacher, and J. P. Di Santo. 2001. Conventional 137–147. ␣␤ T cells are sufficient for innate and adaptive immunity against enteric Listeria 32. Melchers, F. 1978. T cell hybrids: shortcut or dead end? Nature 271: 9–10. monocytogenes. J. Immunol. 166: 1871–1876. 33. Jonuleit, H., and E. Schimitt. 2003. The regulatory T cell family: distinct subsets 8. Lertmemongkolchai, G., G. Cai, C. A. Hunter, and G. J. Bancroft. 2001. By- and their interrelations. J. Immunol. 171: 6323–6327. stander activation of CD8ϩ T cells contributes to the rapid production of IFN-␥ 34. Zhang, Z. X., K. Young, and L. Zhang. 2001. CD3ϩCD4ϪCD8Ϫ␣␤Ϫ CRϩ T cell in response to bacterial pathogens. J. Immunol. 166: 1097–1105. as immune regulatory cell. J. Mol. Med. 79: 419–427. 9. Berg, R. E., C. J. Cordes, and J. Forman. 2002. Contribution of CD8ϩ T cells to 35. Hammond K. J. L., S. B. Pelikan, N. Y. Crowe, E. Randle-Barrett, T. Nakayama, innate immunity: IFN-␥ secretion induced by IL-12 and IL-18. Eur. J. Immunol. M. Taniguchi, M. J. Smyth, I. R. van Driel, R. Scollay, A. G., Baxter, and 32: 2807–2816. D. I. Godfrey. 1999. NKT cells are phenotypically and functionally diverse. Eur. 10. Schroder, K., P. J. Hertzog, T. Ravasi, and D. A. Hume. 2004. Interferon-␥:an J. Immunol. 29: 3768–3781. overview of signals, mechanisms and functions. J. Leukocyte Biol. 75: 163–189. 36. Bendelac, A. 2001. Autoreactivity by design: innate B and T lymphocytes. Nat. 11. Rosenberger, C. M., and B. B. Finlay. 2003. Phagocyte sabotage: disruption of Rev. Immunol. 1: 177–186. macrophage signalling by bacterial pathogens. Mol. Cell. Boil. 4: 385–396. 37. Darlington, G. J., H. P. Bernhard, R. A. Miller, and F. H. Ruddle. 1980. Expres- 12. Kaufmann, S. H. E. 1993. Immunity to intracellular bacteria. Annu. Rev. Immu- sion of liver phenotypes in cultured mouse hepatoma cells. J. Natl. Can. Inst. 64: nol. 11: 129–163. 809–819. 13. de Chastellier, C., and P. Berche. 1994. Fate of Listeria monocytogenes in murine 38. Fortier, A. H., and L. A. Falk. 1993. Isolation of murine macrophages. In Current macrophages: evidence for simultaneous killing and survival of intracellular bac- Protocols in Immunology, Vol 3. J. E. Colligan, A. M. Kuirbeek, teria. Infect. Immun. 62: 543–553. D. H. Margulies, E. M. Shevach, and W. Scrober, eds. Wiley, New York, pp. 14. Drevets, D. A. 1999. Dissemination of Listeria monocytogenes by infected 16.1.1–16.1.9. phagocytes. Infect. Immun. 67: 3512–3517. 39. Decatur, A. L., and D. A. Portnoy. 2000. A PEST-like sequence in listeriolysin 15. Knodler, L. A., and B. B. Finlay. 2001. Salmonella and apoptosis: to live or let O essential for Listeria monocytogenes pathogenicity. Science 290: 992–995. die? Microbes Infect. 3: 1321–1326. 40. Sasakawa, C., K. Kamata, T. Sakai, S. Y. Murayama, S. Makino, and 16. Weinrauch, Y., and A. Zychlinsky. 1999. The induction of apoptosis by bacterial M. Yoshikawa. 1986. Molecular alteration of the 140-magadalton plasmid asso- Downloaded from pathogens. Annu. Rev. Microbiol. 53: 155–187. ciated with loss of virulence and Congo Red binding activity in Shigella flexneri. 17. Barsig, J., S. H. E. Kaufmann. 1997. The mechanism of cell death in Listeria Infect. Immun. 51: 470–475. monocytogenes-infected murine macrophages is distinct from apoptosis. Infect. 41. Kubota, K., H. Katoh, K. Muguruma, and K. Koyama. 1999. Characterization of Immun. 65: 4075–4081. a surface membrane molecule expressed by natural killer cells in most inbred 18. Navarre, W. W., and A. Zychlinsky. 2000. Pathogen-induced apoptosis of mac- mouse strains: monoclonal antibody C9.1 identifies an allelic form of the 2B4 rophages: a common end for different pathogenic strategies. Cell. Microbiol. 2: antigen. Immunology 96: 491–497. 265–273. 42. Yamamoto, Y., C. Retzlaff, P. He, T. W. Klein, and H. Friedman. 1995. Quan-

19. Monack, D. M., W. W. Navarre, and S. Folkow. 2001. Salmonella-induced mac- titative reverse transcription-PCR analysis of Legionella pneumophila-induced http://www.jimmunol.org/ rophage death: the role of caspase-1 in death and inflammation. Microbes infect. cytokine mRNA in different macrophage populations by high-performance liquid 3: 1201–1212. chromatography. Clin. Diagn. Lab. Immunol. 2: 18–24. 20. Boise, L. H., and C. M. Collins. 2001. Salmonella-induced cell death: apoptosis, 43. Kambayashi, T., E. Assarsson, B. J. Chambers, and H. G. Ljunggren. 2001. necrosis or programmed cell death? Trends Microbiol. 9: 64–67. Regulation of CD8ϩ T cell proliferation by 2B4/CD48 interactions. J. Immunol. 21. Brennan, M. A., and B. T. Cookson. 2000. Salmonella induces macrophage death 167: 6706–6710. by caspase-1-dependent necrosis. Mol. Microbiol. 38: 31–40. 44. Huleatt, J. W., and L. Lefrancois. 1995. Antigen-driven induction of CD11c on 22. Nonaka, T., T. Kuwabara, H. Mimuro, A. Kuwae, and S. Imajoh-Ohmi. 2003. intestinal intraepithelial lymphocytes and CD8ϩ T cells in vivo. J. Immunol. 154: Shigella-induced necrosis and apoptosis of U937 cells and J774 macrophages. 5684–5693. Microbiology 149: 2513–2527. 45. Sprent, J. 2003. Turnover of memory-phenotype CD8ϩ T cells. Microbes Infect. 23. Koterski, J. F., M. Nahvi, M. M. Venkatesan, and B. Haimovich. 2005. Virulent 5: 227–231. Shigella flexneri causes damage to mitochondria and triggers necrosis in infected 46. Koyasu, S. 1994. CD3ϩCD16ϩNK1.1ϩB220ϩ large granular lymphocytes arisen ϩ Ϫ Ϫ ϩ Ϫ Ϫ human monocyte-derived macrophages. Infect. Immun. 73: 504–513. from both ␣-␤TCR CD4 CD8 and ␥-␦TCR CD4 CD8 cells. J. Exp. Med. by guest on October 1, 2021 24. Hernandez, L. D., M. Pypaert, R. A. Flavell, and J. E. Galan. 2003. A Salmonella 179: 1957–1972. protein causes macrophage cell death by inducing autophagy. J. Cell Biol. 163: 47. Kadena, T., G. Matsuzaki, S. Fujise, K. Kishihara, H. Takimoto, M., Sasaki, 1123–1131. M. Beppu, S. Nakamura, and K. Nomoto. 1997. TCR␣␤ϩCD4ϪCD8Ϫ T cells 25. Hueffer, K., and J. E. Galan. 2004. Salmonella-induced macrophage death: mul- differentiate extrathymically in an lck-independent manner and participate in tiple mechanisms, different outcomes. Cell. Microbiol. 6: 1019–1025. early response against Listeria monocytogenes infection through interferon-␥ pro- 26. Fink, S. L., and B. T. Cookson. 2005. Apoptosis, pyroptosis, and necrosis: mech- duction. Immunology 91: 511–519. anistic description of dead and dying eukaryotic cells. Infect. Immun. 73: 48. Waring, P., R. D. Eichner, A. Mullbacher, and A. Sjaarda. 1988. Gliotoxin in- 1907–1916. duces apoptosis in macrophages unrelated to its antiphagocytic properties. J. Biol. 27. Yrlid, U., and M. J. Wick. 2000. Salmonella-induced apoptosis of infected mac- Chem. 263: 18493–18499. rophages results in presentation of a bacterial-encoded antigen after uptake by 49. Wilson, M. T., C. Johansson, D. Olivares-Villagomez, A. K. Singh, A. K. Stanic, bystander dendritic cells. J. Exp. Med. 191: 613–623. C. R. Wang. S. Joyce, M. J. Wick, and L. V. Kaer. 2003. The response of natural 28. Schaible, U. E., F. Winau, P. A. Sieling, K. Fischer, H. L. Collins, K. Hagens, killer T cells to glycolipid antigen is characterized by surface receptor down- R. L. Modlin, V. Brinkman, and S. H. Kaufmann. 2003. Apoptosis facilitates modulation and expansion. Proc. Natl. Acad. Sci. USA 100: 10913–10918. antigen presentation to T lymphocytes through MHC-I and CD1 in tuberculosis. 50. Godfrey, D. I., H. R. MacDonald, M. Kronenberg, M. J. Smyth, and L.V. Kaer. Nat. Med. 9: 1039–1046. 2004. NKT cells: what’s in a name? Nat. Rev. Immunol. 4: 231–237. 29. Klein, E., and G. Klein. 1964. Antigenic properties of lymphomas induced by the 51. Kronenberg, M. 2005. Toward an understanding of NKT cell biology: progress Moloney agent. J. Natl. Cancer Inst. 32: 547–568. and paradoxes. Annu. Rev. Immunol. 26: 877–900. 30. Kubota, K., and K. Nakazato. 1994. The role of duplication of tumour-derived 52. Taniguchi, M., M. Harada, S. Kojo, T. Nakayama, and H. Wakao. 2003. The chromosome 15 carrying the rearranged pvt-1 gene in the transformed phenotype regulatory role of V␣14 NKT cells in innate and acquired immune response. of YACUT T-cell lymphoma ϫ G4 T-cell line somatic cell hybrids in dictating Annu. Rev. Immunol. 21: 483–513. the terminal differentiation program of the parental G4 cell. J. Cell Sci. 107: 53. Carding, S. R., and P. J. Egan. 2002. ␥␦ T cells: functional plasticity and heter- 2761–2768. ogeneity. Nat. Rev. Immunol. 2: 336–345.