Supplementary Data

Supplementary data

Stromal LRP1 in lung adenocarcinoma predicts clinical outcome

He Meng1+, Guoan Chen2+, Xiaojie Zhang1, Zhuwen Wang2, Dafydd Thomas3, Thomas Giordano3, David G. Beer2, and Michael M. Wang1,4,5 *

From the 1Departments of Neurology, 2Surgery, 3Pathology, 4Molecular & Integrative Physiology, University of Michigan, Ann Arbor, MI 48109-5622 and the 5Neurology Service of the VA Ann Arbor Healthcare System, Ann Arbor, MI 48105

Running Title: LRP1 suppresses lung cancer cell growth

+These authors made equal contributions

*Address Correspondence to: Michael M. Wang, 7629 Medical Science Building II Box 5622, 1137 Catherine St., Ann Arbor, MI 48109-5622, Tel. 734-763-5453; Fax 734-936-8813 E-Mail: [email protected]

Supplementary Table 1. Clinical Characteristics of Samples Used in this Study

Data set Training set Validation set Platform U133A (Shedden) qRT-PCR Sample number 439 101 Type of cancer Adenocarcinomas Adenocarcinomas Age average (SD) 64.4 (10.1) 67.0 (9.6) Gender Female 218 (49.7%) 53 (52.5%) Male 221 48 Stage Stage I 276 (62.9%) 59 (58.4%) Stage II 104 16 Stage III 59 26 Differentiation Well 60 28 Moderate 208 38 Poor 166 (38.3%) 34 (33.7%) Dead (5 years) 186 (42.4%) 44 (43.6%) Alive 253 57 Adjuvant therapy Yes 108 38 No 211 63 Adjuvant therapy included chemo and/or radiotherapy

Supplementary Table 2. Real-time PCR Primers for LRP1 mRNA expression and DNA copy number assessment

Target Primer Sequence (5'-->3') PCR product size mRNA Forward GGCGTGAAGGGCGTGCTCTT 131 bp Reverse GGGCGTTTCACACCTGGGCA

DNA Forward ATGGCCCTTTGGCAGCCACC 90 bp Reverse GGCACAGTGAGAGACACAGCCG

Supplementary Fig. 1. Meta-analysis of LRP1 mRNA expression in multiple cancers from Oncomine (https://www.oncomine.org). LRP1 mRNA expression in tumors was reduced in 8 lung data sets and increased in 8 brain data sets as compared to normal control (arrow). Red indicates increased expression; blue indicates decreased expression.

Supplementary Fig. 2. Detailed meta-analysis of LRP1 mRNA expression in 8 lung and 8 brain cancer data sets shown in Supplementary Fig. 1 from Oncomine (https://www.oncomine.org). LRP1 mRNA expression in tumors was reduced in 8 lung cancer data sets (left panel) and increased in 8 brain cancer data sets (right panel) compared to normal controls.

Supplementary Table 3. LRP1 protein expression in lung adenocarcinomas and squamous cell carcinomas. Protein staining score is based on the staining intensity of

LRP1 protein in each tumor sample. 0 = negative, 1 = trace, 2 = moderate, 3 = high level. Adenocarcinomas

Stroma Macrophage Tumor score 0 10 13 53 score 1 36 3 9 score 2 22 22 2 score 3 0 0 0

Squamous cell carcinomas

Stroma Macrophage Tumor score 0 7 4 33 score 1 17 2 6 score 2 18 10 3 score 3 1 0 0

All carcinomas

Stroma Macrophage Tumor score 0 17 17 86 score 1 53 5 15 score 2 40 32 5 score 3 1 0 0

Supplementary Fig. 3. Cluster and heat map of cancer fibroblast marker genes including LRP1 (rows) in 439 lung adenocarcinomas (columns). Red indicates up- regulation; green indicates down-regulation.

Supplementary Table 4. Correlation between LRP1 and stromal marker genes and P values for patient survival in 439 lung adenocarcinomas

Probe Set Gene Symbol r to LRP1 * P ** beta**

200785_s_at LRP1 1.000 0.025 -0.258

202273_at PDGFRB 0.660 0.380 -0.098

201426_s_at VIM 0.571 0.630 -0.061

205168_at DDR2 0.513 0.078 -0.208

209955_s_at FAP 0.503 0.650 -0.037

203186_s_at S100A4 0.380 0.500 -0.048

217404_s_at COL2A1 0.329 0.970 0.002

202222_s_at DES 0.153 0.690 -0.089

214297_at CSPG4 0.061 0.920 0.016

203872_at ACTA1 0.033 0.870 -0.018

207543_s_at P4HA1 0.025 0.560 0.072

215879_at ITGB1 -0.002 0.640 0.070

*r value from Pearson correlation; ** P and beta values derived from multivariable Cox model (age, gender and stage adjusted) with likelihood test.

Supplementary Fig. 4. Cluster and heat map of top 100 genes (rows) whose expression correlates with LRP1 in 439 lung adenocarcinomas (columns). Red indicates up-regulation; green indicates down-regulation.

Supplementary Table 5. Top 100 genes whose expression correlates

with LRP1 (P < 0.01) and their relationship to patient survival.

Probe Set Gene Symbol r to LRP1 * P value** beta** 201792_at AEBP1 0.73 0.0290 -0.168 201058_s_at MYL9 0.72 0.0170 -0.188 202995_s_at FBLN1 0.71 0.0096 -0.209 201069_at MMP2 0.71 0.0830 -0.165 204163_at EMILIN1 0.71 0.6200 -0.031 205547_s_at TAGLN 0.70 0.3700 -0.078 204570_at COX7A1 0.69 0.2000 -0.113 200986_at SERPING1 0.68 0.2800 -0.114 209335_at DCN 0.68 0.0140 -0.197 206101_at ECM2 0.67 0.0029 -0.289 203131_at PDGFRA 0.67 0.2500 -0.123 202555_s_at MYLK 0.67 0.0230 -0.174 212419_at ZCCHC24 0.67 0.0081 -0.371 201621_at NBL1 0.66 0.0620 -0.172 213891_s_at TCF4 0.65 0.0340 -0.244 203570_at LOXL1 0.65 0.0990 -0.109 201262_s_at BGN 0.65 0.1000 -0.117 212667_at SPARC 0.65 0.1500 -0.152 204682_at LTBP2 0.65 0.0260 -0.235 213290_at COL6A2 0.65 0.2200 -0.191 213543_at SGCD 0.64 0.0007 -0.210 200974_at ACTA2 0.64 0.3900 -0.092 209356_x_at EFEMP2 0.64 0.9400 0.010 201719_s_at EPB41L2 0.64 0.3600 -0.127 221814_at GPR124 0.64 0.6000 -0.060 208782_at FSTL1 0.63 0.4800 -0.085 201438_at COL6A3 0.63 0.6000 -0.054 207173_x_at CDH11 0.63 0.0450 -0.162 212713_at MFAP4 0.63 0.0025 -0.202 205422_s_at ITGBL1 0.63 0.0008 -0.212 202766_s_at FBN1 0.63 0.0510 -0.177 212488_at COL5A1 0.63 0.8300 0.017 212764_at ZEB1 0.62 0.2200 -0.134 207191_s_at ISLR 0.62 0.1800 -0.097 203886_s_at FBLN2 0.62 0.1400 -0.118 219778_at ZFPM2 0.62 0.1900 -0.128 203547_at CD4 0.62 0.1600 -0.171 202191_s_at GAS7 0.62 0.0450 -0.341 214247_s_at DKK3 0.62 0.0043 -0.242 209651_at TGFB1I1 0.61 0.4000 -0.094

204894_s_at AOC3 0.61 0.0200 -0.190 209687_at CXCL12 0.61 0.0840 -0.131 212067_s_at C1R 0.61 0.8700 -0.016 209496_at RARRES2 0.61 0.6400 -0.034 213993_at SPON1 0.61 0.0830 -0.143 209708_at MOXD1 0.61 0.0057 -0.247 212915_at PDZRN3 0.61 0.0700 -0.135 219179_at DACT1 0.61 0.9500 -0.006 204223_at PRELP 0.61 0.0026 -0.254 212077_at CALD1 0.60 0.3200 -0.109 212822_at HEG1 0.60 0.0024 -0.547 206201_s_at MEOX2 0.60 0.0460 -0.144 212464_s_at FN1 0.60 0.5900 -0.075 203603_s_at ZEB2 0.60 0.0760 -0.156 215706_x_at ZYX 0.60 0.9700 -0.006 201162_at IGFBP7 0.60 0.6500 -0.057 214438_at HLX 0.59 0.2800 -0.204 200897_s_at PALLD 0.59 0.2700 -0.123 203766_s_at LMOD1 0.59 0.0240 -0.271 209101_at CTGF 0.59 0.0760 -0.160 204436_at PLEKHO2 0.59 0.5100 -0.095 219315_s_at TMEM204 0.59 0.0360 -0.243 201278_at DAB2 0.59 0.1900 -0.139 202664_at WIPF1 0.59 0.2300 -0.124 203688_at PKD2 0.59 0.0021 -0.360 221447_s_at GLT8D2 0.59 0.1000 -0.203 201744_s_at LUM 0.59 0.0470 -0.203 221011_s_at LBH 0.59 0.0130 -0.260 208789_at PTRF 0.59 0.8800 -0.017 202202_s_at LAMA4 0.59 0.6500 -0.044 217897_at FXYD6 0.59 0.1700 -0.137 220327_at VGLL3 0.58 0.0320 -0.177 209280_at MRC2 0.58 0.6900 0.057 220244_at LOH3CR2A 0.58 0.5300 -0.105 209348_s_at MAF 0.58 0.5000 -0.071 210139_s_at PMP22 0.58 0.6100 -0.097 202686_s_at AXL 0.58 0.5900 -0.080 202947_s_at GYPC 0.58 0.0710 -0.226 205116_at LAMA2 0.58 0.0071 -0.305 219165_at PDLIM2 0.58 0.0460 -0.212 202450_s_at CTSK 0.58 0.1400 -0.117 44790_s_at PPP1R2P4 0.58 0.0670 -0.178 208851_s_at THY1 0.58 0.2400 -0.155 217853_at TNS3 0.58 0.6500 -0.063 209473_at ENTPD1 0.58 0.0130 -0.412

205312_at SPI1 0.57 0.0450 -0.163 213241_at PLXNC1 0.57 0.0093 -0.243 217757_at A2M 0.57 0.0034 -0.297 201508_at IGFBP4 0.57 0.0800 -0.153 203473_at SLCO2B1 0.57 0.2000 -0.118 213001_at ANGPTL2 0.57 0.8800 -0.016 203370_s_at PDLIM7 0.57 0.8900 0.014 221900_at COL8A2 0.57 0.0013 -0.214 205407_at RECK 0.57 0.0340 -0.349 221541_at CRISPLD2 0.56 0.4800 -0.063 202465_at PCOLCE 0.56 0.7300 -0.038 210605_s_at MFGE8 0.56 0.0200 -0.302 203940_s_at VASH1 0.56 0.4600 -0.112 204150_at STAB1 0.56 0.9500 0.006 201150_s_at TIMP3 0.56 0.0057 -0.237 203083_at THBS2 0.54*** 0.8500 -0.014

*Pearson correlation; ** P and beta value are from multivariable Cox model (age, gender and stage adjusted) in 439 lung adenocarcinomas; ***THBS2 is not in the top 100 gene list, but significantly correlated to LRP1 (r = 0.54, P < 0.01).

Supplementary Fig. 5. LRP1 mRNA content in the validation set of 101 lung adenocarcinomas was decreased compared to the levels of LRP1 mRNA in normal lung tissue. RNA samples were quantified by RT-PCR, as described in Methods.

Supplementary Fig. 6A. DNA copy number analysis in tumors from the validation set (n = 97) and other 7 tumors demonstrated only occasional gene amplification (copy number > 2, 3/104 samples) or deletion (copy number < 0.5, 2/104 samples) of the LRP1 gene.

Supplementary Fig. 6B. There was no correlation between mRNA expression levels and DNA copy number changes within tumor samples (n = 97)

Supplementary Table 6. LRP1 protein expression in the validation set of 101 lung adenocarcinomas. Several samples that were analyzed by RT-PCR were not analyzed by protein staining.

TMA Score Stroma Macrophage Tumor score 0 1 0 44 score 1 1 3 36 score 2 84 34 12 score 3 10 22 0

Protein staining score is based on the staining intensity of LRP1 protein. 0 is negative

staining, 1 indicates trace staining, 2 represents moderate staining, and 3 is the highest

staining intensity. Values indicate the number of tumor samples with each given score.

Supplementary Fig. 7. Kaplan-Meier survival curve showing that high levels of A2M mRNA favored patient survival in 439 lung adenocarcinomas (high 2/3 vs low 1/3 samples, log-rank test, P = 0.006). We applied a multivariable Cox model adjusted by age, gender and stage using continuous A2M mRNA values with likelihood test, P =

0.004, beta = -0.29.