DOCSLIB.ORG

Supplementary Data

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Data Supplementary data Stromal LRP1 in lung adenocarcinoma predicts clinical outcome He Meng1+, Guoan Chen2+, Xiaojie Zhang1, Zhuwen Wang2, Dafydd Thomas3, Thomas Giordano3, David G. Beer2, and Michael M. Wang1,4,5 * From the 1Departments of Neurology, 2Surgery, 3Pathology, 4Molecular & Integrative Physiology, University of Michigan, Ann Arbor, MI 48109-5622 and the 5Neurology Service of the VA Ann Arbor Healthcare System, Ann Arbor, MI 48105 Running Title: LRP1 suppresses lung cancer cell growth +These authors made equal contributions *Address Correspondence to: Michael M. Wang, 7629 Medical Science Building II Box 5622, 1137 Catherine St., Ann Arbor, MI 48109-5622, Tel. 734-763-5453; Fax 734-936-8813 E-Mail: [email protected] 1 Supplementary Table 1. Clinical Characteristics of Samples Used in this Study Data set Training set Validation set Platform U133A (Shedden) qRT-PCR Sample number 439 101 Type of cancer Adenocarcinomas Adenocarcinomas Age average (SD) 64.4 (10.1) 67.0 (9.6) Gender Female 218 (49.7%) 53 (52.5%) Male 221 48 Stage Stage I 276 (62.9%) 59 (58.4%) Stage II 104 16 Stage III 59 26 Differentiation Well 60 28 Moderate 208 38 Poor 166 (38.3%) 34 (33.7%) Dead (5 years) 186 (42.4%) 44 (43.6%) Alive 253 57 Adjuvant therapy Yes 108 38 No 211 63 Adjuvant therapy included chemo and/or radiotherapy 2 Supplementary Table 2. Real-time PCR Primers for LRP1 mRNA expression and DNA copy number assessment Target Primer Sequence (5'-->3') PCR product size mRNA Forward GGCGTGAAGGGCGTGCTCTT 131 bp Reverse GGGCGTTTCACACCTGGGCA DNA Forward ATGGCCCTTTGGCAGCCACC 90 bp Reverse GGCACAGTGAGAGACACAGCCG 3 Supplementary Fig. 1. Meta-analysis of LRP1 mRNA expression in multiple cancers from Oncomine (https://www.oncomine.org). LRP1 mRNA expression in tumors was reduced in 8 lung data sets and increased in 8 brain data sets as compared to normal control (arrow). Red indicates increased expression; blue indicates decreased expression. 4 Supplementary Fig. 2. Detailed meta-analysis of LRP1 mRNA expression in 8 lung and 8 brain cancer data sets shown in Supplementary Fig. 1 from Oncomine (https://www.oncomine.org). LRP1 mRNA expression in tumors was reduced in 8 lung cancer data sets (left panel) and increased in 8 brain cancer data sets (right panel) compared to normal controls. 5 Supplementary Table 3. LRP1 protein expression in lung adenocarcinomas and squamous cell carcinomas. Protein staining score is based on the staining intensity of LRP1 protein in each tumor sample. 0 = negative, 1 = trace, 2 = moderate, 3 = high level. Adenocarcinomas Stroma Macrophage Tumor score 0 10 13 53 score 1 36 3 9 score 2 22 22 2 score 3 0 0 0 Squamous cell carcinomas Stroma Macrophage Tumor score 0 7 4 33 score 1 17 2 6 score 2 18 10 3 score 3 1 0 0 All carcinomas Stroma Macrophage Tumor score 0 17 17 86 score 1 53 5 15 score 2 40 32 5 score 3 1 0 0 6 Supplementary Fig. 3. Cluster and heat map of cancer fibroblast marker genes including LRP1 (rows) in 439 lung adenocarcinomas (columns). Red indicates up- regulation; green indicates down-regulation. 7 Supplementary Table 4. Correlation between LRP1 and stromal marker genes and P values for patient survival in 439 lung adenocarcinomas Probe Set Gene Symbol r to LRP1 * P ** beta** 200785_s_at LRP1 1.000 0.025 -0.258 202273_at PDGFRB 0.660 0.380 -0.098 201426_s_at VIM 0.571 0.630 -0.061 205168_at DDR2 0.513 0.078 -0.208 209955_s_at FAP 0.503 0.650 -0.037 203186_s_at S100A4 0.380 0.500 -0.048 217404_s_at COL2A1 0.329 0.970 0.002 202222_s_at DES 0.153 0.690 -0.089 214297_at CSPG4 0.061 0.920 0.016 203872_at ACTA1 0.033 0.870 -0.018 207543_s_at P4HA1 0.025 0.560 0.072 215879_at ITGB1 -0.002 0.640 0.070 *r value from Pearson correlation; ** P and beta values derived from multivariable Cox model (age, gender and stage adjusted) with likelihood test. 8 Supplementary Fig. 4. Cluster and heat map of top 100 genes (rows) whose expression correlates with LRP1 in 439 lung adenocarcinomas (columns). Red indicates up-regulation; green indicates down-regulation. 9 10 Supplementary Table 5. Top 100 genes whose expression correlates with LRP1 (P < 0.01) and their relationship to patient survival. Probe Set Gene Symbol r to LRP1 * P value** beta** 201792_at AEBP1 0.73 0.0290 -0.168 201058_s_at MYL9 0.72 0.0170 -0.188 202995_s_at FBLN1 0.71 0.0096 -0.209 201069_at MMP2 0.71 0.0830 -0.165 204163_at EMILIN1 0.71 0.6200 -0.031 205547_s_at TAGLN 0.70 0.3700 -0.078 204570_at COX7A1 0.69 0.2000 -0.113 200986_at SERPING1 0.68 0.2800 -0.114 209335_at DCN 0.68 0.0140 -0.197 206101_at ECM2 0.67 0.0029 -0.289 203131_at PDGFRA 0.67 0.2500 -0.123 202555_s_at MYLK 0.67 0.0230 -0.174 212419_at ZCCHC24 0.67 0.0081 -0.371 201621_at NBL1 0.66 0.0620 -0.172 213891_s_at TCF4 0.65 0.0340 -0.244 203570_at LOXL1 0.65 0.0990 -0.109 201262_s_at BGN 0.65 0.1000 -0.117 212667_at SPARC 0.65 0.1500 -0.152 204682_at LTBP2 0.65 0.0260 -0.235 213290_at COL6A2 0.65 0.2200 -0.191 213543_at SGCD 0.64 0.0007 -0.210 200974_at ACTA2 0.64 0.3900 -0.092 209356_x_at EFEMP2 0.64 0.9400 0.010 201719_s_at EPB41L2 0.64 0.3600 -0.127 221814_at GPR124 0.64 0.6000 -0.060 208782_at FSTL1 0.63 0.4800 -0.085 201438_at COL6A3 0.63 0.6000 -0.054 207173_x_at CDH11 0.63 0.0450 -0.162 212713_at MFAP4 0.63 0.0025 -0.202 205422_s_at ITGBL1 0.63 0.0008 -0.212 202766_s_at FBN1 0.63 0.0510 -0.177 212488_at COL5A1 0.63 0.8300 0.017 212764_at ZEB1 0.62 0.2200 -0.134 207191_s_at ISLR 0.62 0.1800 -0.097 203886_s_at FBLN2 0.62 0.1400 -0.118 219778_at ZFPM2 0.62 0.1900 -0.128 203547_at CD4 0.62 0.1600 -0.171 202191_s_at GAS7 0.62 0.0450 -0.341 214247_s_at DKK3 0.62 0.0043 -0.242 209651_at TGFB1I1 0.61 0.4000 -0.094 11 204894_s_at AOC3 0.61 0.0200 -0.190 209687_at CXCL12 0.61 0.0840 -0.131 212067_s_at C1R 0.61 0.8700 -0.016 209496_at RARRES2 0.61 0.6400 -0.034 213993_at SPON1 0.61 0.0830 -0.143 209708_at MOXD1 0.61 0.0057 -0.247 212915_at PDZRN3 0.61 0.0700 -0.135 219179_at DACT1 0.61 0.9500 -0.006 204223_at PRELP 0.61 0.0026 -0.254 212077_at CALD1 0.60 0.3200 -0.109 212822_at HEG1 0.60 0.0024 -0.547 206201_s_at MEOX2 0.60 0.0460 -0.144 212464_s_at FN1 0.60 0.5900 -0.075 203603_s_at ZEB2 0.60 0.0760 -0.156 215706_x_at ZYX 0.60 0.9700 -0.006 201162_at IGFBP7 0.60 0.6500 -0.057 214438_at HLX 0.59 0.2800 -0.204 200897_s_at PALLD 0.59 0.2700 -0.123 203766_s_at LMOD1 0.59 0.0240 -0.271 209101_at CTGF 0.59 0.0760 -0.160 204436_at PLEKHO2 0.59 0.5100 -0.095 219315_s_at TMEM204 0.59 0.0360 -0.243 201278_at DAB2 0.59 0.1900 -0.139 202664_at WIPF1 0.59 0.2300 -0.124 203688_at PKD2 0.59 0.0021 -0.360 221447_s_at GLT8D2 0.59 0.1000 -0.203 201744_s_at LUM 0.59 0.0470 -0.203 221011_s_at LBH 0.59 0.0130 -0.260 208789_at PTRF 0.59 0.8800 -0.017 202202_s_at LAMA4 0.59 0.6500 -0.044 217897_at FXYD6 0.59 0.1700 -0.137 220327_at VGLL3 0.58 0.0320 -0.177 209280_at MRC2 0.58 0.6900 0.057 220244_at LOH3CR2A 0.58 0.5300 -0.105 209348_s_at MAF 0.58 0.5000 -0.071 210139_s_at PMP22 0.58 0.6100 -0.097 202686_s_at AXL 0.58 0.5900 -0.080 202947_s_at GYPC 0.58 0.0710 -0.226 205116_at LAMA2 0.58 0.0071 -0.305 219165_at PDLIM2 0.58 0.0460 -0.212 202450_s_at CTSK 0.58 0.1400 -0.117 44790_s_at PPP1R2P4 0.58 0.0670 -0.178 208851_s_at THY1 0.58 0.2400 -0.155 217853_at TNS3 0.58 0.6500 -0.063 209473_at ENTPD1 0.58 0.0130 -0.412 12 205312_at SPI1 0.57 0.0450 -0.163 213241_at PLXNC1 0.57 0.0093 -0.243 217757_at A2M 0.57 0.0034 -0.297 201508_at IGFBP4 0.57 0.0800 -0.153 203473_at SLCO2B1 0.57 0.2000 -0.118 213001_at ANGPTL2 0.57 0.8800 -0.016 203370_s_at PDLIM7 0.57 0.8900 0.014 221900_at COL8A2 0.57 0.0013 -0.214 205407_at RECK 0.57 0.0340 -0.349 221541_at CRISPLD2 0.56 0.4800 -0.063 202465_at PCOLCE 0.56 0.7300 -0.038 210605_s_at MFGE8 0.56 0.0200 -0.302 203940_s_at VASH1 0.56 0.4600 -0.112 204150_at STAB1 0.56 0.9500 0.006 201150_s_at TIMP3 0.56 0.0057 -0.237 203083_at THBS2 0.54*** 0.8500 -0.014 *Pearson correlation; ** P and beta value are from multivariable Cox model (age, gender and stage adjusted) in 439 lung adenocarcinomas; ***THBS2 is not in the top 100 gene list, but significantly correlated to LRP1 (r = 0.54, P < 0.01). 13 Supplementary Fig. 5. LRP1 mRNA content in the validation set of 101 lung adenocarcinomas was decreased compared to the levels of LRP1 mRNA in normal lung tissue.
Load more

Recommended publications
  • Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Screening and identification of key biomarkers in clear cell renal cell carcinoma based on bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Clear cell renal cell carcinoma (ccRCC) is one of the most common types of malignancy of the urinary system. The pathogenesis and effective diagnosis of ccRCC have become popular topics for research in the previous decade. In the current study, an integrated bioinformatics analysis was performed to identify core genes associated in ccRCC. An expression dataset (GSE105261) was downloaded from the Gene Expression Omnibus database, and included 26 ccRCC and 9 normal kideny samples. Assessment of the microarray dataset led to the recognition of differentially expressed genes (DEGs), which was subsequently used for pathway and gene ontology (GO) enrichment analysis.
    [Show full text]
  • Immuno-Oncology Panel 1
    Immuno-Oncology panel 1 Gene Symbol Target protein name UniProt ID (& link) Modification* (56 analytes) ADA17 ADAM17 metalloprotease domain 17 P78536 *blanks mean the assay detects the ANXA1 Annexin A1 P04083 non-modified peptide sequence ANXA1 Annexin A1 P04083 ARG2 arginase, type II P78540 ATM Serine-protein kinase ATM, Ataxia telangiectasia mutated Q13315 pS2996 ATM Serine-protein kinase ATM, Ataxia telangiectasia mutated Q13315 ATM Serine-protein kinase ATM, Ataxia telangiectasia mutated Q13315 pS367 ATM Serine-protein kinase ATM, Ataxia telangiectasia mutated Q13315 C10orf54 / VISTA chromosome 10 open reading frame 54 Q9H7M9 CCL5 C-C motif chemokine ligand 5 P13501 CD14 CD14 molecule P08571 CD163 CD163 molecule Q86VB7 CD274 / PDL1 Programmed cell death 1 ligand 1 CD274 Q9NZQ7 CD33 CD33 molecule P20138 CD40/TNR5 tumor necrosis factor receptor superfamily member 5 P25942 CD40/TNR5 tumor necrosis factor receptor superfamily member 5 P25942 CD47 CD47 molecule Q08722 CD70 CD70 antigen P32970 CD74/HG2A CD74 molecule, major histocompatibility complex, class II invariant chain Q8SNA0 CEACAM8 carcinoembryonic antigen-related cell adhesion molecule 8 P31997 CX3CL1 C-X3-C motif chemokine ligand 1 P78423 CXCL10 C-X-C motif chemokine ligand 10 P02778 CXCL13 chemokine (C-X-C motif) ligand 13 O43927 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 Q86VV3 FAS/TNR6 Fas (TNF receptor superfamily, member 6) P25445 pY291 FAS/TNR6 Fas (TNF receptor superfamily, member 6) P25445 GAPDH Glyceraldehyde-3-phosphate dehydrogenase P04406 HAVCR2 hepatitis
    [Show full text]
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
    [Show full text]
  • Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
    Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo
    [Show full text]
  • CD226 T Cells Expressing the Receptors TIGIT and Divergent Phenotypes of Human Regulatory
    The Journal of Immunology Divergent Phenotypes of Human Regulatory T Cells Expressing the Receptors TIGIT and CD226 Christopher A. Fuhrman,*,1 Wen-I Yeh,*,1 Howard R. Seay,* Priya Saikumar Lakshmi,* Gaurav Chopra,† Lin Zhang,* Daniel J. Perry,* Stephanie A. McClymont,† Mahesh Yadav,† Maria-Cecilia Lopez,‡ Henry V. Baker,‡ Ying Zhang,x Yizheng Li,{ Maryann Whitley,{ David von Schack,x Mark A. Atkinson,* Jeffrey A. Bluestone,‡ and Todd M. Brusko* Regulatory T cells (Tregs) play a central role in counteracting inflammation and autoimmunity. A more complete understanding of cellular heterogeneity and the potential for lineage plasticity in human Treg subsets may identify markers of disease pathogenesis and facilitate the development of optimized cellular therapeutics. To better elucidate human Treg subsets, we conducted direct transcriptional profiling of CD4+FOXP3+Helios+ thymic-derived Tregs and CD4+FOXP3+Helios2 T cells, followed by comparison with CD4+FOXP32Helios2 T conventional cells. These analyses revealed that the coinhibitory receptor T cell Ig and ITIM domain (TIGIT) was highly expressed on thymic-derived Tregs. TIGIT and the costimulatory factor CD226 bind the common ligand CD155. Thus, we analyzed the cellular distribution and suppressive activity of isolated subsets of CD4+CD25+CD127lo/2 T cells expressing CD226 and/or TIGIT. We observed TIGIT is highly expressed and upregulated on Tregs after activation and in vitro expansion, and is associated with lineage stability and suppressive capacity. Conversely, the CD226+TIGIT2 population was associated with reduced Treg purity and suppressive capacity after expansion, along with a marked increase in IL-10 and effector cytokine production. These studies provide additional markers to delineate functionally distinct Treg subsets that may help direct cellular therapies and provide important phenotypic markers for assessing the role of Tregs in health and disease.
    [Show full text]
  • Anti-CD38 Antibody Therapy: Windows of Opportunity Yielded by the Functional Characteristics of the Target Molecule
    Anti-CD38 Antibody Therapy: Windows of Opportunity Yielded by the Functional Characteristics of the Target Molecule Antonella Chillemi,1 Gianluca Zaccarello,1 Valeria Quarona,1 Manuela Ferracin,3 Chiara Ghimenti,4 Massimo Massaia,2,5 Alberto L Horenstein,1,2 and Fabio Malavasi1,2,6 1Laboratory of Immunogenetics, Department of Medical Sciences and 2Research Center on Experimental Medicine (CeRMS), University of Torino Medical School, Torino, Italy; 3Laboratory for Technologies of Advanced Therapies (LTTA) and Department of Morphology, Surgery and Experimental Medicine, University of Ferrara, Ferrara, Italy; 4Cancer Genomics Laboratory, Edo ed Elvo Tempia Foundation, Biella, Italy; 5Laboratory of Hematological Oncology, Department of Molecular Biotechnology and Health Sciences, University of Torino, Torino, Italy; and 6Transplantation Immunology Service, Città della Salute e della Scienza Hospital, Torino, Italy In vivo use of monoclonal antibodies (mAbs) has become a mainstay of routine clinical practice in the treatment of various human diseases. A number of molecules can serve as targets, according to the condition being treated. Now entering human clinical trials, CD38 molecule is a particularly attractive target because of its peculiar pattern of expression and its twin role as re- ceptor and ectoenzyme. This review provides a range of analytical perspectives on the current progress in and challenges to anti- CD38 mAb therapy. We present a synopsis of the evidence available on CD38, particularly in myeloma and chronic lymphocytic leukemia (CLL). Our aim is to make the data from basic science helpful and accessible to a diverse clinical audience and, at the same time, to improve its potential for in vivo use. The topics covered include tissue distribution and signal implementation by mAb ligation and the possibility of increasing cell density on target cells by exploiting information about the molecule’s regulation in combination with drugs approved for in vivo use.
    [Show full text]
  • Single-Cell RNA Sequencing Demonstrates the Molecular and Cellular Reprogramming of Metastatic Lung Adenocarcinoma
    ARTICLE https://doi.org/10.1038/s41467-020-16164-1 OPEN Single-cell RNA sequencing demonstrates the molecular and cellular reprogramming of metastatic lung adenocarcinoma Nayoung Kim 1,2,3,13, Hong Kwan Kim4,13, Kyungjong Lee 5,13, Yourae Hong 1,6, Jong Ho Cho4, Jung Won Choi7, Jung-Il Lee7, Yeon-Lim Suh8,BoMiKu9, Hye Hyeon Eum 1,2,3, Soyean Choi 1, Yoon-La Choi6,10,11, Je-Gun Joung1, Woong-Yang Park 1,2,6, Hyun Ae Jung12, Jong-Mu Sun12, Se-Hoon Lee12, ✉ ✉ Jin Seok Ahn12, Keunchil Park12, Myung-Ju Ahn 12 & Hae-Ock Lee 1,2,3,6 1234567890():,; Advanced metastatic cancer poses utmost clinical challenges and may present molecular and cellular features distinct from an early-stage cancer. Herein, we present single-cell tran- scriptome profiling of metastatic lung adenocarcinoma, the most prevalent histological lung cancer type diagnosed at stage IV in over 40% of all cases. From 208,506 cells populating the normal tissues or early to metastatic stage cancer in 44 patients, we identify a cancer cell subtype deviating from the normal differentiation trajectory and dominating the metastatic stage. In all stages, the stromal and immune cell dynamics reveal ontological and functional changes that create a pro-tumoral and immunosuppressive microenvironment. Normal resident myeloid cell populations are gradually replaced with monocyte-derived macrophages and dendritic cells, along with T-cell exhaustion. This extensive single-cell analysis enhances our understanding of molecular and cellular dynamics in metastatic lung cancer and reveals potential diagnostic and therapeutic targets in cancer-microenvironment interactions. 1 Samsung Genome Institute, Samsung Medical Center, Seoul 06351, Korea.
    [Show full text]
  • Supplementary Table S2
    1-high in cerebrotropic Gene P-value patients Definition BCHE 2.00E-04 1 Butyrylcholinesterase PLCB2 2.00E-04 -1 Phospholipase C, beta 2 SF3B1 2.00E-04 -1 Splicing factor 3b, subunit 1 BCHE 0.00022 1 Butyrylcholinesterase ZNF721 0.00028 -1 Zinc finger protein 721 GNAI1 0.00044 1 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 GNAI1 0.00049 1 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 PDE1B 0.00069 -1 Phosphodiesterase 1B, calmodulin-dependent MCOLN2 0.00085 -1 Mucolipin 2 PGCP 0.00116 1 Plasma glutamate carboxypeptidase TMX4 0.00116 1 Thioredoxin-related transmembrane protein 4 C10orf11 0.00142 1 Chromosome 10 open reading frame 11 TRIM14 0.00156 -1 Tripartite motif-containing 14 APOBEC3D 0.00173 -1 Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D ANXA6 0.00185 -1 Annexin A6 NOS3 0.00209 -1 Nitric oxide synthase 3 SELI 0.00209 -1 Selenoprotein I NYNRIN 0.0023 -1 NYN domain and retroviral integrase containing ANKFY1 0.00253 -1 Ankyrin repeat and FYVE domain containing 1 APOBEC3F 0.00278 -1 Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3F EBI2 0.00278 -1 Epstein-Barr virus induced gene 2 ETHE1 0.00278 1 Ethylmalonic encephalopathy 1 PDE7A 0.00278 -1 Phosphodiesterase 7A HLA-DOA 0.00305 -1 Major histocompatibility complex, class II, DO alpha SOX13 0.00305 1 SRY (sex determining region Y)-box 13 ABHD2 3.34E-03 1 Abhydrolase domain containing 2 MOCS2 0.00334 1 Molybdenum cofactor synthesis 2 TTLL6 0.00365 -1 Tubulin tyrosine ligase-like family, member 6 SHANK3 0.00394 -1 SH3 and multiple ankyrin repeat domains 3 ADCY4 0.004 -1 Adenylate cyclase 4 CD3D 0.004 -1 CD3d molecule, delta (CD3-TCR complex) (CD3D), transcript variant 1, mRNA.
    [Show full text]
  • Functional ENTPD1 Polymorphisms in African Americans with Diabetes and End-Stage Renal Disease
    Functional ENTPD1 Polymorphisms in African Americans With Diabetes and End-Stage Renal Disease The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Friedman, David J., Matthew E. Talbert, Donald W. Bowden, Barry I. Freedman, Yves Mukanya, Keiichi Enjyoji, and Simon C. Robson. 2009. Functional ENTPD1 polymorphisms in African Americans With diabetes and end-stage renal disease. Diabetes 58(4): 999-1006. Published Version doi://10.2337/db08-1214 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:5346717 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA ORIGINAL ARTICLE Functional ENTPD1 Polymorphisms in African Americans With Diabetes and End-Stage Renal Disease David J. Friedman,1,2 Matthew E. Talbert,3,4 Donald W. Bowden,3,5,6 Barry I. Freedman,5 Yves Mukanya,7,8 Keiichi Enjyoji,7,8 and Simon C. Robson7,8 OBJECTIVE—The vascular ectonucleotidase ENTPD1 protects against renal injury and modulates glucose homeostasis in mouse models. We sought to determine whether human variation in iabetes and its complications are enormous ENTPD1 influences predisposition to diabetes or diabetic sources of mortality, morbidity, and cost in the nephropathy. U.S. African Americans are especially prone to diabetes and diabetic kidney disease (1). Ge- RESEARCH DESIGN AND METHODS—We analyzed ENTPD1 D single nucleotide polymorphisms (SNPs) in 363 African American netic variation plays a major role in susceptibility to both control subjects, 380 subjects with type 2 diabetes and end-stage development of diabetes and onset of diabetic renal injury renal disease (DM-ESRD), and 326 subjects with ESRD unrelated to (2,3).
    [Show full text]
  • Bioinformatics Analysis for the Identification of Differentially Expressed Genes and Related Signaling Pathways in H
    Bioinformatics analysis for the identification of differentially expressed genes and related signaling pathways in H. pylori-CagA transfected gastric cancer cells Dingyu Chen*, Chao Li, Yan Zhao, Jianjiang Zhou, Qinrong Wang and Yuan Xie* Key Laboratory of Endemic and Ethnic Diseases , Ministry of Education, Guizhou Medical University, Guiyang, China * These authors contributed equally to this work. ABSTRACT Aim. Helicobacter pylori cytotoxin-associated protein A (CagA) is an important vir- ulence factor known to induce gastric cancer development. However, the cause and the underlying molecular events of CagA induction remain unclear. Here, we applied integrated bioinformatics to identify the key genes involved in the process of CagA- induced gastric epithelial cell inflammation and can ceration to comprehend the potential molecular mechanisms involved. Materials and Methods. AGS cells were transected with pcDNA3.1 and pcDNA3.1::CagA for 24 h. The transfected cells were subjected to transcriptome sequencing to obtain the expressed genes. Differentially expressed genes (DEG) with adjusted P value < 0.05, | logFC |> 2 were screened, and the R package was applied for gene ontology (GO) enrichment and the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. The differential gene protein–protein interaction (PPI) network was constructed using the STRING Cytoscape application, which conducted visual analysis to create the key function networks and identify the key genes. Next, the Submitted 20 August 2020 Kaplan–Meier plotter survival analysis tool was employed to analyze the survival of the Accepted 11 March 2021 key genes derived from the PPI network. Further analysis of the key gene expressions Published 15 April 2021 in gastric cancer and normal tissues were performed based on The Cancer Genome Corresponding author Atlas (TCGA) database and RT-qPCR verification.
    [Show full text]
  • CD73 Promotes Anthracycline Resistance and Poor Prognosis in Triple Negative Breast Cancer
    CD73 promotes anthracycline resistance and poor prognosis in triple negative breast cancer Sherene Loia,1, Sandra Pommeyb,1, Benjamin Haibe-Kainsc, Paul A. Beavisd, Phillip K. Darcyd,e, Mark J. Smythd,e,f,g,2, and John Staggb,2,3 aDivision of Cancer Medicine and Research, Peter MacCallum Cancer Centre, East Melbourne, VIC 3002, Australia; bFaculté de Pharmacie et Institut du Cancer de Montréal, Centre de Recherche du Centre Hospitalier de l’Université de Montréal, Montreal, QC, Canada H2L 4M1; cBioinformatics and Computational Genomics Laboratory, Institut de Recherches Cliniques de Montréal, Montreal, Canada H2W 1R7; dCancer Immunology Program, Trescowthick Laboratories, Peter MacCallum Cancer Centre, East Melbourne, VIC 3002, Australia; eSir Peter MacCallum Department of Oncology, University of Melbourne, Parkville, VIC 3010, Australia; fImmmunology in Cancer and Infection Laboratory, Queensland Institute of Medical Research, Herston, QLD 4006, Australia; and gSchool of Medicine, University of Queensland, Herston, QLD 4006, Australia Edited by Thierry Boon, Ludwig Institute for Cancer Research, Brussels, Belgium, and approved May 23, 2013 (received for review December 30, 2012) Using gene-expression data from over 6,000 breast cancer patients, autophagy (8). Extracellular ATP activates P2X7 receptors on we report herein that high CD73 expression is associated with a poor dendritic cells, which initiates a cascade of events that ultimately + prognosis in triple-negative breast cancers (TNBC). Because anthra- culminates in the generation of IFN-γ–producing CD8 T cells. cycline-based chemotherapy regimens are standard treatment for Because of its proinflammatory effects, extracellular levels of ATP TNBC, we investigated the relationship between CD73 and anthra- are tightly regulated.
    [Show full text]
  • Single-Cell RNA Sequencing Reveals Distinct Cellular Factors for Response
    Open access Original research Single- cell RNA sequencing reveals J Immunother Cancer: first published as 10.1136/jitc-2021-002503 on 12 July 2021. Downloaded from distinct cellular factors for response to immunotherapy targeting CD73 and PD-1 in colorectal cancer Miok Kim,1 Yong Ki Min,1 Jinho Jang,2,3 Hyejin Park,1 Semin Lee,2,3 1 Chang Hoon Lee To cite: Kim M, Min YK, ABSTRACTS BACKGROUND Jang J, et al. Single- cell RNA Background Although cancer immunotherapy is one of Cancer immunotherapy has generated sequencing reveals distinct the most effective advanced- stage cancer therapies, no cellular factors for response to unparalleled and durable responses in clinically approved cancer immunotherapies currently exist immunotherapy targeting CD73 regard to several cancers and is a pillar of for colorectal cancer (CRC). Recently, programmed cell death 1 and PD-1 in colorectal cancer. advanced-stage cancer therapy. Colorectal protein 1 (PD-1) blockade has exhibited clinical benefits Journal for ImmunoTherapy cancer (CRC) is one of the most prominent of Cancer 2021;9:e002503. according to ongoing clinical trials. However, ongoing clinical causes of cancer- related deaths and exhibits doi:10.1136/jitc-2021-002503 trials for cancer immunotherapies are focused on PD-1 2 signaling inhibitors such as pembrolizumab, nivolumab, and high rates of morbidity and mortality. Recent clinical trials examining the use of immune ► Additional supplemental atezolizumab. In this study, we focused on revealing the material is published online only. distinct response mechanism for the potent CD73 ectoenzyme checkpoint inhibitors (ICIs) are anticipated 3 4 To view, please visit the journal selective inhibitor AB680 as a promising drug candidate that to improve survival rates in CRC.
    [Show full text]