Supplementary data Stromal LRP1 in lung adenocarcinoma predicts clinical outcome He Meng1+, Guoan Chen2+, Xiaojie Zhang1, Zhuwen Wang2, Dafydd Thomas3, Thomas Giordano3, David G. Beer2, and Michael M. Wang1,4,5 * From the 1Departments of Neurology, 2Surgery, 3Pathology, 4Molecular & Integrative Physiology, University of Michigan, Ann Arbor, MI 48109-5622 and the 5Neurology Service of the VA Ann Arbor Healthcare System, Ann Arbor, MI 48105 Running Title: LRP1 suppresses lung cancer cell growth +These authors made equal contributions *Address Correspondence to: Michael M. Wang, 7629 Medical Science Building II Box 5622, 1137 Catherine St., Ann Arbor, MI 48109-5622, Tel. 734-763-5453; Fax 734-936-8813 E-Mail: [email protected] 1 Supplementary Table 1. Clinical Characteristics of Samples Used in this Study Data set Training set Validation set Platform U133A (Shedden) qRT-PCR Sample number 439 101 Type of cancer Adenocarcinomas Adenocarcinomas Age average (SD) 64.4 (10.1) 67.0 (9.6) Gender Female 218 (49.7%) 53 (52.5%) Male 221 48 Stage Stage I 276 (62.9%) 59 (58.4%) Stage II 104 16 Stage III 59 26 Differentiation Well 60 28 Moderate 208 38 Poor 166 (38.3%) 34 (33.7%) Dead (5 years) 186 (42.4%) 44 (43.6%) Alive 253 57 Adjuvant therapy Yes 108 38 No 211 63 Adjuvant therapy included chemo and/or radiotherapy 2 Supplementary Table 2. Real-time PCR Primers for LRP1 mRNA expression and DNA copy number assessment Target Primer Sequence (5'-->3') PCR product size mRNA Forward GGCGTGAAGGGCGTGCTCTT 131 bp Reverse GGGCGTTTCACACCTGGGCA DNA Forward ATGGCCCTTTGGCAGCCACC 90 bp Reverse GGCACAGTGAGAGACACAGCCG 3 Supplementary Fig. 1. Meta-analysis of LRP1 mRNA expression in multiple cancers from Oncomine (https://www.oncomine.org). LRP1 mRNA expression in tumors was reduced in 8 lung data sets and increased in 8 brain data sets as compared to normal control (arrow). Red indicates increased expression; blue indicates decreased expression. 4 Supplementary Fig. 2. Detailed meta-analysis of LRP1 mRNA expression in 8 lung and 8 brain cancer data sets shown in Supplementary Fig. 1 from Oncomine (https://www.oncomine.org). LRP1 mRNA expression in tumors was reduced in 8 lung cancer data sets (left panel) and increased in 8 brain cancer data sets (right panel) compared to normal controls. 5 Supplementary Table 3. LRP1 protein expression in lung adenocarcinomas and squamous cell carcinomas. Protein staining score is based on the staining intensity of LRP1 protein in each tumor sample. 0 = negative, 1 = trace, 2 = moderate, 3 = high level. Adenocarcinomas Stroma Macrophage Tumor score 0 10 13 53 score 1 36 3 9 score 2 22 22 2 score 3 0 0 0 Squamous cell carcinomas Stroma Macrophage Tumor score 0 7 4 33 score 1 17 2 6 score 2 18 10 3 score 3 1 0 0 All carcinomas Stroma Macrophage Tumor score 0 17 17 86 score 1 53 5 15 score 2 40 32 5 score 3 1 0 0 6 Supplementary Fig. 3. Cluster and heat map of cancer fibroblast marker genes including LRP1 (rows) in 439 lung adenocarcinomas (columns). Red indicates up- regulation; green indicates down-regulation. 7 Supplementary Table 4. Correlation between LRP1 and stromal marker genes and P values for patient survival in 439 lung adenocarcinomas Probe Set Gene Symbol r to LRP1 * P ** beta** 200785_s_at LRP1 1.000 0.025 -0.258 202273_at PDGFRB 0.660 0.380 -0.098 201426_s_at VIM 0.571 0.630 -0.061 205168_at DDR2 0.513 0.078 -0.208 209955_s_at FAP 0.503 0.650 -0.037 203186_s_at S100A4 0.380 0.500 -0.048 217404_s_at COL2A1 0.329 0.970 0.002 202222_s_at DES 0.153 0.690 -0.089 214297_at CSPG4 0.061 0.920 0.016 203872_at ACTA1 0.033 0.870 -0.018 207543_s_at P4HA1 0.025 0.560 0.072 215879_at ITGB1 -0.002 0.640 0.070 *r value from Pearson correlation; ** P and beta values derived from multivariable Cox model (age, gender and stage adjusted) with likelihood test. 8 Supplementary Fig. 4. Cluster and heat map of top 100 genes (rows) whose expression correlates with LRP1 in 439 lung adenocarcinomas (columns). Red indicates up-regulation; green indicates down-regulation. 9 10 Supplementary Table 5. Top 100 genes whose expression correlates with LRP1 (P < 0.01) and their relationship to patient survival. Probe Set Gene Symbol r to LRP1 * P value** beta** 201792_at AEBP1 0.73 0.0290 -0.168 201058_s_at MYL9 0.72 0.0170 -0.188 202995_s_at FBLN1 0.71 0.0096 -0.209 201069_at MMP2 0.71 0.0830 -0.165 204163_at EMILIN1 0.71 0.6200 -0.031 205547_s_at TAGLN 0.70 0.3700 -0.078 204570_at COX7A1 0.69 0.2000 -0.113 200986_at SERPING1 0.68 0.2800 -0.114 209335_at DCN 0.68 0.0140 -0.197 206101_at ECM2 0.67 0.0029 -0.289 203131_at PDGFRA 0.67 0.2500 -0.123 202555_s_at MYLK 0.67 0.0230 -0.174 212419_at ZCCHC24 0.67 0.0081 -0.371 201621_at NBL1 0.66 0.0620 -0.172 213891_s_at TCF4 0.65 0.0340 -0.244 203570_at LOXL1 0.65 0.0990 -0.109 201262_s_at BGN 0.65 0.1000 -0.117 212667_at SPARC 0.65 0.1500 -0.152 204682_at LTBP2 0.65 0.0260 -0.235 213290_at COL6A2 0.65 0.2200 -0.191 213543_at SGCD 0.64 0.0007 -0.210 200974_at ACTA2 0.64 0.3900 -0.092 209356_x_at EFEMP2 0.64 0.9400 0.010 201719_s_at EPB41L2 0.64 0.3600 -0.127 221814_at GPR124 0.64 0.6000 -0.060 208782_at FSTL1 0.63 0.4800 -0.085 201438_at COL6A3 0.63 0.6000 -0.054 207173_x_at CDH11 0.63 0.0450 -0.162 212713_at MFAP4 0.63 0.0025 -0.202 205422_s_at ITGBL1 0.63 0.0008 -0.212 202766_s_at FBN1 0.63 0.0510 -0.177 212488_at COL5A1 0.63 0.8300 0.017 212764_at ZEB1 0.62 0.2200 -0.134 207191_s_at ISLR 0.62 0.1800 -0.097 203886_s_at FBLN2 0.62 0.1400 -0.118 219778_at ZFPM2 0.62 0.1900 -0.128 203547_at CD4 0.62 0.1600 -0.171 202191_s_at GAS7 0.62 0.0450 -0.341 214247_s_at DKK3 0.62 0.0043 -0.242 209651_at TGFB1I1 0.61 0.4000 -0.094 11 204894_s_at AOC3 0.61 0.0200 -0.190 209687_at CXCL12 0.61 0.0840 -0.131 212067_s_at C1R 0.61 0.8700 -0.016 209496_at RARRES2 0.61 0.6400 -0.034 213993_at SPON1 0.61 0.0830 -0.143 209708_at MOXD1 0.61 0.0057 -0.247 212915_at PDZRN3 0.61 0.0700 -0.135 219179_at DACT1 0.61 0.9500 -0.006 204223_at PRELP 0.61 0.0026 -0.254 212077_at CALD1 0.60 0.3200 -0.109 212822_at HEG1 0.60 0.0024 -0.547 206201_s_at MEOX2 0.60 0.0460 -0.144 212464_s_at FN1 0.60 0.5900 -0.075 203603_s_at ZEB2 0.60 0.0760 -0.156 215706_x_at ZYX 0.60 0.9700 -0.006 201162_at IGFBP7 0.60 0.6500 -0.057 214438_at HLX 0.59 0.2800 -0.204 200897_s_at PALLD 0.59 0.2700 -0.123 203766_s_at LMOD1 0.59 0.0240 -0.271 209101_at CTGF 0.59 0.0760 -0.160 204436_at PLEKHO2 0.59 0.5100 -0.095 219315_s_at TMEM204 0.59 0.0360 -0.243 201278_at DAB2 0.59 0.1900 -0.139 202664_at WIPF1 0.59 0.2300 -0.124 203688_at PKD2 0.59 0.0021 -0.360 221447_s_at GLT8D2 0.59 0.1000 -0.203 201744_s_at LUM 0.59 0.0470 -0.203 221011_s_at LBH 0.59 0.0130 -0.260 208789_at PTRF 0.59 0.8800 -0.017 202202_s_at LAMA4 0.59 0.6500 -0.044 217897_at FXYD6 0.59 0.1700 -0.137 220327_at VGLL3 0.58 0.0320 -0.177 209280_at MRC2 0.58 0.6900 0.057 220244_at LOH3CR2A 0.58 0.5300 -0.105 209348_s_at MAF 0.58 0.5000 -0.071 210139_s_at PMP22 0.58 0.6100 -0.097 202686_s_at AXL 0.58 0.5900 -0.080 202947_s_at GYPC 0.58 0.0710 -0.226 205116_at LAMA2 0.58 0.0071 -0.305 219165_at PDLIM2 0.58 0.0460 -0.212 202450_s_at CTSK 0.58 0.1400 -0.117 44790_s_at PPP1R2P4 0.58 0.0670 -0.178 208851_s_at THY1 0.58 0.2400 -0.155 217853_at TNS3 0.58 0.6500 -0.063 209473_at ENTPD1 0.58 0.0130 -0.412 12 205312_at SPI1 0.57 0.0450 -0.163 213241_at PLXNC1 0.57 0.0093 -0.243 217757_at A2M 0.57 0.0034 -0.297 201508_at IGFBP4 0.57 0.0800 -0.153 203473_at SLCO2B1 0.57 0.2000 -0.118 213001_at ANGPTL2 0.57 0.8800 -0.016 203370_s_at PDLIM7 0.57 0.8900 0.014 221900_at COL8A2 0.57 0.0013 -0.214 205407_at RECK 0.57 0.0340 -0.349 221541_at CRISPLD2 0.56 0.4800 -0.063 202465_at PCOLCE 0.56 0.7300 -0.038 210605_s_at MFGE8 0.56 0.0200 -0.302 203940_s_at VASH1 0.56 0.4600 -0.112 204150_at STAB1 0.56 0.9500 0.006 201150_s_at TIMP3 0.56 0.0057 -0.237 203083_at THBS2 0.54*** 0.8500 -0.014 *Pearson correlation; ** P and beta value are from multivariable Cox model (age, gender and stage adjusted) in 439 lung adenocarcinomas; ***THBS2 is not in the top 100 gene list, but significantly correlated to LRP1 (r = 0.54, P < 0.01). 13 Supplementary Fig. 5. LRP1 mRNA content in the validation set of 101 lung adenocarcinomas was decreased compared to the levels of LRP1 mRNA in normal lung tissue.