DOCSLIB.ORG

Investigations of the Ufm1 Pathway and Its Association with a Familial Form of Hip Dysplasia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Investigations of the Ufm1 Pathway and Its Association with a Familial Form of Hip Dysplasia Investigations of the Ufm1 pathway and its association with a familial form of hip dysplasia A thesis submitted to the University of Manchester for the degree of Doctor of Philosophy in the Faculty of Medical and Human Sciences 2013 Michal Dudek School of Medicine Table of Contents Table of Contents .............................................................................................................. 2 List of Figures ................................................................................................................... 6 List of Tables..................................................................................................................... 9 List of Supplementary Figures ........................................................................................ 10 Abstract ........................................................................................................................... 11 Declaration ...................................................................................................................... 12 Copyright ........................................................................................................................ 13 Acknowledgements ......................................................................................................... 14 Abbreviations .................................................................................................................. 15 Chapter 1. Introduction ................................................................................................... 18 1.1 Chondrogenesis ..................................................................................................... 19 1.2 Joint development .................................................................................................. 20 1.3 Endochondral ossification ..................................................................................... 22 1.4 Articular cartilage .................................................................................................. 25 1.5. Bone formation ..................................................................................................... 29 1.5.1. Bone structure ................................................................................................ 29 1.5.2 Osteoblast differentiation ................................................................................ 30 1.5.3 Bone formation and remodelling .................................................................... 31 1.6 Skeletal disorders .................................................................................................. 32 1.6.1 Chondrodysplasias .......................................................................................... 32 1.6.2 Osteoarthritis ................................................................................................... 34 1.6.3 Hip dysplasia................................................................................................... 35 1.7 ER stress ................................................................................................................ 36 1.7.1 ER stress responses ......................................................................................... 36 1.7.2 Protein folding and quality control ................................................................. 37 1.7.3 ER stress and skeletal development ................................................................ 41 1.8 Ubiquitin-like pathways ........................................................................................ 44 1.8.1 The ubiquitin system ....................................................................................... 44 1.8.2 Ubiquitin-like proteins .................................................................................... 48 2 1.8.3 Ubiquitin and ubiquitin-like related disorders ................................................ 49 1.8.4 The Ufm1 system: a novel ubiquitin-like protein-conjugating system ........... 52 1.9 Background to the current study ........................................................................... 56 1.10 Hypothesis and aims of the study ........................................................................ 59 Chapter 2. Materials and Methods .................................................................................. 60 2.1 Materials ................................................................................................................ 60 2.2 Methods ................................................................................................................. 60 2.2.1 SDS-PAGE ..................................................................................................... 60 2.2.2 Western blotting .............................................................................................. 60 2.2.3 Cell culture ...................................................................................................... 60 2.2.4 Passaging ........................................................................................................ 61 2.2.5 Cell freezing/recover....................................................................................... 61 2.2.6 Calcium phosphate transfection ...................................................................... 61 2.2.7 Transfection using lipid based reagent ........................................................... 62 2.2.8 Lentiviral transduction .................................................................................... 62 2.2.9 Preparation of competent E. coli cells ............................................................ 62 2.2.10 Transformation of competent E. coli cells .................................................... 63 2.2.11 Polymerase chain reaction (PCR) ................................................................. 63 2.2.12 Agarose gel electrophoresis .......................................................................... 64 2.2.13 DNA extraction from an agarose gel ............................................................ 64 2.2.14 Plasmid DNA purification ............................................................................ 64 2.2.15 Mouse genomic DNA extraction .................................................................. 64 2.2.16 mRNA extraction .......................................................................................... 65 2.2.17 Generation of cDNA by reverse transcription PCR...................................... 65 2.2.18 Tandem affinity purification (TAP) .............................................................. 65 2.2.19 Radioactive in situ hybridisation .................................................................. 66 2.2.20 Osteogenic differentiation............................................................................. 68 2.2.21 Chondrogenic differentiation in micromass cultures .................................... 69 2.2.22 Qantitative real-time PCR ............................................................................. 69 2.2.23 Luciferase assay ............................................................................................ 69 2.2.24 Colloidal Blue staining ................................................................................. 70 2.2.25 Preparation of tissue sections for histology .................................................. 70 Chapter 3. Expression of the Ufm1 system ..................................................................... 72 3 3.1 Introduction ........................................................................................................... 72 3.2 Results ................................................................................................................... 73 3.2.1 Investigation of Ufsp2 gene expression in the hip joint during mouse development ............................................................................................................. 73 3.2.2 Expression of the Ufm1 system during osteogenic differentiation................. 78 3.2.3 Expression of the Ufm1 system during chondrogenic differentiation. ........... 82 3.2.4 Expression of the Ufm1 system in response to ER stress. .............................. 84 3.2.5 Analysis of the promoter regions of the Ufm1 system genes. ........................ 89 3.3 Discussion ............................................................................................................. 93 Chapter 4. Ufm1 biochemistry ........................................................................................ 99 4.1 Introduction ........................................................................................................... 99 4.2 Results ................................................................................................................. 100 4.2 Development of a purification method for isolation of Ufm1 conjugation targets. .................................................................................................................... 100 4.2.3 Large scale purification and mass spectrometry analysis of Ufm1 conjugated proteins................................................................................................................... 105 4.2.4 Testing of chemical agents potentially inducing conjugation of Ufm1 in the HEK293T cell line ................................................................................................. 109 4.2.5 Expression of the Ufm1 system in response to ER stress
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • The HECT Domain Ubiquitin Ligase HUWE1 Targets Unassembled Soluble Proteins for Degradation
    OPEN Citation: Cell Discovery (2016) 2, 16040; doi:10.1038/celldisc.2016.40 ARTICLE www.nature.com/celldisc The HECT domain ubiquitin ligase HUWE1 targets unassembled soluble proteins for degradation Yue Xu1, D Eric Anderson2, Yihong Ye1 1Laboratory of Molecular Biology, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD, USA; 2Advanced Mass Spectrometry Core Facility, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD, USA In eukaryotes, many proteins function in multi-subunit complexes that require proper assembly. To maintain complex stoichiometry, cells use the endoplasmic reticulum-associated degradation system to degrade unassembled membrane subunits, but how unassembled soluble proteins are eliminated is undefined. Here we show that degradation of unassembled soluble proteins (referred to as unassembled soluble protein degradation, USPD) requires the ubiquitin selective chaperone p97, its co-factor nuclear protein localization protein 4 (Npl4), and the proteasome. At the ubiquitin ligase level, the previously identified protein quality control ligase UBR1 (ubiquitin protein ligase E3 component n-recognin 1) and the related enzymes only process a subset of unassembled soluble proteins. We identify the homologous to the E6-AP carboxyl terminus (homologous to the E6-AP carboxyl terminus) domain-containing protein HUWE1 as a ubiquitin ligase for substrates bearing unshielded, hydrophobic segments. We used a stable isotope labeling with amino acids-based proteomic approach to identify endogenous HUWE1 substrates. Interestingly, many HUWE1 substrates form multi-protein com- plexes that function in the nucleus although HUWE1 itself is cytoplasmically localized. Inhibition of nuclear entry enhances HUWE1-mediated ubiquitination and degradation, suggesting that USPD occurs primarily in the cytoplasm.
    [Show full text]
  • A Family of Mammalian E3 Ubiquitin Ligases That Contain the UBR Box Motif and Recognize N-Degrons Takafumi Tasaki,1 Lubbertus C
    MOLECULAR AND CELLULAR BIOLOGY, Aug. 2005, p. 7120–7136 Vol. 25, No. 16 0270-7306/05/$08.00ϩ0 doi:10.1128/MCB.25.16.7120–7136.2005 Copyright © 2005, American Society for Microbiology. All Rights Reserved. A Family of Mammalian E3 Ubiquitin Ligases That Contain the UBR Box Motif and Recognize N-Degrons Takafumi Tasaki,1 Lubbertus C. F. Mulder,2 Akihiro Iwamatsu,3 Min Jae Lee,1 Ilia V. Davydov,4† Alexander Varshavsky,4 Mark Muesing,2 and Yong Tae Kwon1* Center for Pharmacogenetics and Department of Pharmaceutical Sciences, School of Pharmacy, University of Pittsburgh, Pittsburgh, Pennsylvania 152611; Aaron Diamond AIDS Research Center, The Rockefeller University, New York, New York 100162; Protein Research Network, Inc., Yokohama, Kanagawa 236-0004, Japan3; and Division of Biology, California Institute of Technology, Pasadena, California 911254 Received 15 March 2005/Returned for modification 27 April 2005/Accepted 13 May 2005 A subset of proteins targeted by the N-end rule pathway bear degradation signals called N-degrons, whose determinants include destabilizing N-terminal residues. Our previous work identified mouse UBR1 and UBR2 as E3 ubiquitin ligases that recognize N-degrons. Such E3s are called N-recognins. We report here that while double-mutant UBR1؊/؊ UBR2؊/؊ mice die as early embryos, the rescued UBR1؊/؊ UBR2؊/؊ fibroblasts still retain the N-end rule pathway, albeit of lower activity than that of wild-type fibroblasts. An affinity assay for proteins that bind to destabilizing N-terminal residues has identified, in addition to UBR1 and UBR2, a huge (570 kDa) mouse protein, termed UBR4, and also the 300-kDa UBR5, a previously characterized mammalian E3 known as EDD/hHYD.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • The Ubiquitin Proteasome System and Its Involvement in Cell Death Pathways
    Cell Death and Differentiation (2010) 17, 1–3 & 2010 Macmillan Publishers Limited All rights reserved 1350-9047/10 $32.00 www.nature.com/cdd Editorial The ubiquitin proteasome system and its involvement in cell death pathways F Bernassola1, A Ciechanover2 and G Melino1,3 Cell Death and Differentiation (2010) 17, 1–3; doi:10.1038/cdd.2009.189 Following the awarding of the 2004 Nobel Prize in Chemistry Inactivation of the proteasome following caspase-mediated to Aaron Ciechanover, Avram Hershko, and Irwin A Rose cleavage may disable the proteasome, interfering with its for the discovery of ubiquitin (Ub)-mediated degradation, role in the regulation of key cellular processes and thereby Cell Death and Differentiation has drawn the attention of facilitating induction of apoptosis. The noted recent develop- its readers to the Ub Proteasome System (UPS) and its ments show how understanding of these functions is just involvement in regulating cell death pathways.1–4 The current starting to emerge. For example, why does dIAP1 associate set of reviews is an update on this theme.5–16 with multiple E2s via its RING finger? Does dIAP1 also interact From previous review articles published in Cell Death and with the E3 – the F-box protein Morgue, which is a part of an Differentiation, it was apparent that the UPS has a major SCF E3 complex? Why does dIAP1, which is an E3, have to mechanistic role in regulating cell death via modification and interact with other ligases such as the N-end rule UBR1 and degradation of key regulatory proteins involved in
    [Show full text]
  • Uncovering Ubiquitin and Ubiquitin-Like Signaling Networks Alfred C
    REVIEW pubs.acs.org/CR Uncovering Ubiquitin and Ubiquitin-like Signaling Networks Alfred C. O. Vertegaal* Department of Molecular Cell Biology, Leiden University Medical Center, Albinusdreef 2, 2333 ZA Leiden, The Netherlands CONTENTS 8. Crosstalk between Post-Translational Modifications 7934 1. Introduction 7923 8.1. Crosstalk between Phosphorylation and 1.1. Ubiquitin and Ubiquitin-like Proteins 7924 Ubiquitylation 7934 1.2. Quantitative Proteomics 7924 8.2. Phosphorylation-Dependent SUMOylation 7935 8.3. Competition between Different Lysine 1.3. Setting the Scenery: Mass Spectrometry Modifications 7935 Based Investigation of Phosphorylation 8.4. Crosstalk between SUMOylation and the and Acetylation 7925 UbiquitinÀProteasome System 7935 2. Ubiquitin and Ubiquitin-like Protein Purification 9. Conclusions and Future Perspectives 7935 Approaches 7925 Author Information 7935 2.1. Epitope-Tagged Ubiquitin and Ubiquitin-like Biography 7935 Proteins 7925 Acknowledgment 7936 2.2. Traps Based on Ubiquitin- and Ubiquitin-like References 7936 Binding Domains 7926 2.3. Antibody-Based Purification of Ubiquitin and Ubiquitin-like Proteins 7926 1. INTRODUCTION 2.4. Challenges and Pitfalls 7926 Proteomes are significantly more complex than genomes 2.5. Summary 7926 and transcriptomes due to protein processing and extensive 3. Ubiquitin Proteomics 7927 post-translational modification (PTM) of proteins. Hundreds ff fi 3.1. Proteomic Studies Employing Tagged of di erent modi cations exist. Release 66 of the RESID database1 (http://www.ebi.ac.uk/RESID/) contains 559 dif- Ubiquitin 7927 ferent modifications, including small chemical modifications 3.2. Ubiquitin Binding Domains 7927 such as phosphorylation, acetylation, and methylation and mod- 3.3. Anti-Ubiquitin Antibodies 7927 ification by small proteins, including ubiquitin and ubiquitin- 3.4.
    [Show full text]
  • (Ubl-Ptms): Small Peptides with Huge Impact in Liver Fibrosis
    cells Review Ubiquitin-Like Post-Translational Modifications (Ubl-PTMs): Small Peptides with Huge Impact in Liver Fibrosis 1 1, 1, Sofia Lachiondo-Ortega , Maria Mercado-Gómez y, Marina Serrano-Maciá y , Fernando Lopitz-Otsoa 2, Tanya B Salas-Villalobos 3, Marta Varela-Rey 1, Teresa C. Delgado 1,* and María Luz Martínez-Chantar 1 1 Liver Disease Lab, CIC bioGUNE, Centro de Investigación Biomédica en Red de Enfermedades Hepáticas y Digestivas (CIBERehd), 48160 Derio, Spain; [email protected] (S.L.-O.); [email protected] (M.M.-G.); [email protected] (M.S.-M.); [email protected] (M.V.-R.); [email protected] (M.L.M.-C.) 2 Liver Metabolism Lab, CIC bioGUNE, 48160 Derio, Spain; fl[email protected] 3 Department of Biochemistry and Molecular Medicine, School of Medicine, Autonomous University of Nuevo León, Monterrey, Nuevo León 66450, Mexico; [email protected] * Correspondence: [email protected]; Tel.: +34-944-061318; Fax: +34-944-061301 These authors contributed equally to this work. y Received: 6 November 2019; Accepted: 1 December 2019; Published: 4 December 2019 Abstract: Liver fibrosis is characterized by the excessive deposition of extracellular matrix proteins including collagen that occurs in most types of chronic liver disease. Even though our knowledge of the cellular and molecular mechanisms of liver fibrosis has deeply improved in the last years, therapeutic approaches for liver fibrosis remain limited. Profiling and characterization of the post-translational modifications (PTMs) of proteins, and more specifically NEDDylation and SUMOylation ubiquitin-like (Ubls) modifications, can provide a better understanding of the liver fibrosis pathology as well as novel and more effective therapeutic approaches.
    [Show full text]
  • TRAIP Modulates the IGFBP3/AKT Pathway to Enhance the Invasion
    www.nature.com/cddis ARTICLE OPEN TRAIP modulates the IGFBP3/AKT pathway to enhance the invasion and proliferation of osteosarcoma by promoting KANK1 degradation ✉ ✉ Mi Li1,6, Wei Wu2,6, Sisi Deng3, Zengwu Shao2 and Xin Jin 4,5 © The Author(s) 2021 Osteosarcoma is one of the most common primary malignancies in bones and is characterized by high metastatic rates. Circulating tumor cells (CTCs) derived from solid tumors can give rise to metastatic lesions, increasing the risk of death in patients with cancer. Here, we used bioinformatics tools to compare the gene expression between CTCs and metastatic lesions in osteosarcoma to identify novel molecular mechanisms underlying osteosarcoma metastasis. We identified TRAIP as a key differentially expressed gene with prognostic significance in osteosarcoma. We demonstrated that TRAIP regulated the proliferation and invasion of osteosarcoma cells. In addition, we found that TRAIP promoted KANK1 polyubiquitination and subsequent degradation, downregulating IGFBP3 and activating the AKT pathway in osteosarcoma cells. These results support the critical role of the TRAIP/ KANK1/IGFBP3/AKT signaling axis in osteosarcoma progression and suggest that TRAIP may represent a promising therapeutic target for osteosarcoma. Cell Death and Disease (2021) 12:767 ; https://doi.org/10.1038/s41419-021-04057-0 INTRODUCTION mechanisms underlying osteosarcoma metastasis. We identified Mesenchymal stem cell-derived osteosarcoma is one of the most TRAIP as a differentially expressed gene (DEG) with prognostic and common primary malignancies in bones [1], and it is particularly diagnostic significance. We also found that TRAIP regulated the common in children and adolescents. With the recent progress in proliferation and invasion of osteosarcoma cells.
    [Show full text]
  • RING-Type E3 Ligases: Master Manipulators of E2 Ubiquitin-Conjugating Enzymes and Ubiquitination☆
    Biochimica et Biophysica Acta 1843 (2014) 47–60 Contents lists available at ScienceDirect Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbamcr Review RING-type E3 ligases: Master manipulators of E2 ubiquitin-conjugating enzymes and ubiquitination☆ Meredith B. Metzger a,1, Jonathan N. Pruneda b,1, Rachel E. Klevit b,⁎, Allan M. Weissman a,⁎⁎ a Laboratory of Protein Dynamics and Signaling, Center for Cancer Research, National Cancer Institute, 1050 Boyles Street, Frederick, MD 21702, USA b Department of Biochemistry, Box 357350, University of Washington, Seattle, WA 98195, USA article info abstract Article history: RING finger domain and RING finger-like ubiquitin ligases (E3s), such as U-box proteins, constitute the vast Received 5 March 2013 majority of known E3s. RING-type E3s function together with ubiquitin-conjugating enzymes (E2s) to medi- Received in revised form 23 May 2013 ate ubiquitination and are implicated in numerous cellular processes. In part because of their importance in Accepted 29 May 2013 human physiology and disease, these proteins and their cellular functions represent an intense area of study. Available online 6 June 2013 Here we review recent advances in RING-type E3 recognition of substrates, their cellular regulation, and their varied architecture. Additionally, recent structural insights into RING-type E3 function, with a focus on im- Keywords: RING finger portant interactions with E2s and ubiquitin, are reviewed. This article is part of a Special Issue entitled: U-box Ubiquitin–Proteasome System. Guest Editors: Thomas Sommer and Dieter H. Wolf. Ubiquitin ligase (E3) Published by Elsevier B.V. Ubiquitin-conjugating enzyme (E2) Protein degradation Catalysis 1.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • CDK5RAP3, a Novel Nucleoplasmic Shuttle, Deeply Regulates HSF1-Mediated Heat Stress Response and Protects Mammary Epithelial Cells from Heat Injury
    International Journal of Molecular Sciences Article CDK5RAP3, a Novel Nucleoplasmic Shuttle, Deeply Regulates HSF1-Mediated Heat Stress Response and Protects Mammary Epithelial Cells from Heat Injury 1, 1, 2, 1 3 1, Yangyang Shen y , Yan Zou y , Jun Li y, Fanghui Chen , Honglin Li and Yafei Cai * 1 College of Animal Science and Technology, Nanjing Agricultural University, Nanjing 210095, China; [email protected] (Y.S.); [email protected] (Y.Z.); [email protected] (F.C.) 2 College of Life Sciences, Anhui Normal University, Wuhu 241000, China; [email protected] 3 Department of Biochemistry and Molecular Biology, Medical College of Georgia, Augusta University, Augusta, GA 30912, USA; [email protected] * Correspondence: [email protected]; Tel.: +86-131-5156-8780 These authors contributed equally to this work. y Received: 12 October 2020; Accepted: 7 November 2020; Published: 9 November 2020 Abstract: CDK5RAP3 was regarded as the most significant regulator of cellular responses against heat stress, which is associated with dysfunctions of the immune system and animal susceptibility to disease. Despite this, little known about how CDK5RAP3 regulates heat stress response. In this study, CDK5RAP3 conditional Knockout (CKO) mice, CDK5RAP3-/- mouse embryo fibroblasts (MEFs) and bovine mammary epithelial cells (BMECs) were used as an in vitro and in vivo model, respectively to reveal the role of CDK5RAP3 in regulating the heat stress response. The deletion of CDK5RAP3 unexpectedly caused animal lethality after 1.5-h heat stimulations. Furthermore, BMECs were re-cultured for eight hours after heat stress and was found that the expression of CDK5RAP3 and HSPs showed a similar fluctuating pattern of increase (0–2, 4–6 h) and decrease (2–4, 6–8 h).
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]