UNrVERSrTY OF HAWAr'r LIBRARY

EFFECT OF SIRT! AND TELOMERASE ON STEM CELLS

A DISSERTATION SUBMITTED TO THE GRADUATE DIVISION OF THE UNIVERSITY OF HAW AI'I IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF

DOCTOR OF PHILOSOPHY

IN

BIOMEDICAL SCIENCES (CELL AND MOLECULAR BIOLOGy)

AUGUST 2008

By Matthew 1. Cousseus

Dissertation Committee:

Richard Allsopp, Chairperson Marla Berry Scott Lozanoff Pratibha Nerurkar David Duffy We Certify that we have read this dissertation and that, in our opinion, it is satisfactory is scope and quality as a dissertation for the degree of Doctor of Philosophy in Biomedical Sciences (Cell

and Molecular Biology).

Dissertation Committee: Copyright Information

SIRT! AND TELOMERASE AFFECT STEM CELL SURVIVAL AND FUNCTION by Coussens et aI. Copyright 2006 by Society for the Study of Reproduction. Reproduced with permission of Society for Study of Reproduction in the format of Dissertation via Copyright Clearance Center.

SIRT! DEFICIENCY A'ITENUATES SPERMATOGENESIS AND GERM CELL FUNCTION by Coussens et aI. Copyright: © 2008 Coussens et aI. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which pennits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

SIRT! ACTS AS A NUfRIENT-SENSITIVE GROWTH SUPPRESSOR AND ITS LOSS IS ASSOCIATED WITH INCREASED AMPK AND TELOMERASE ACTIVITY by NaraJa et aI. Copyright 2008 by Molecular Biology of the Cell. Reproduced with permission of Molecular Biology of the Cell in the format of Dissertation via Copyright Clearance Center. ABSTRACT

Two genes that have established roles in the regulation of cell survival are telomerase reverse transcriptase (Tert) and the nicotinamide adenine dinucleotide­ dependent protein deactylase Sirtl. However, the relative importance of these genes to the survival of stem cells, and the regulation of expression of these genes in stem cells, has yet to be thoroughly established.

We now show that telomerase suppression in quiescent male primordial germ cells (PGCs) from murine embryos is accompanied by a decrease in expression of TERT.

Telomerase activity was detected in quiescent PGCs from transgenic embryos, that constitutively express TERT, demonstrating that re-activation of TERT expression is sufficient to restore telomerase activity in these cells and implying that TERT expression is an important mechanism of telomerase regulation in PGCs. These results also demonstrate that TERT per se does not affect proliferation or development of PGCs in mammals, Sirtl, a member of the sirtuin family of proteins, orthologous to the yeast SirZ, has important physiological roles in regulating glucose metabolism. We have now performed a detailed analysis of the molecular and functional effects of Sirtl deficiency in the germ line of Sirtl knock-out (-1-) mice. We fmd that Sirtl deficiency markedly attenuates spermatogenesis, but not oogenesis. Microarray analysis in Sirtl deficient testis revealed dysregulated expression of 85 genes, which were enriched (p

Sirtl deficient germ cells, we compared the efficiency of generating embryos and offspring in in vitro fertilization (IVF) experiments using gametes from Sirtl deficient mice. While viable animals were derived in all experiments, the efficiency of producing both 2-cell zygotes and viable offspring was diminished when IVF was performed with

Sirtl-/- gametes. Using short hairpin RNAs, we found that inhibition of Sirtl in immortalized human cells enhanced cell growth under normal and nutrient limiting conditions. Hematopoietic stem cells, which were shown to express Sirtl, showed increased growth capacity and decreased dependency on growth factors when the Sin1 gene was deleted. These data support an important role for Sirtl in spermatogenesis, including spermatogenic stem cells, as well as germ cell function, but also demonstrate that in certain cell lineages, Sirtl can act as a growth suppressor.

ii Table of Contents

Abstract...... i List of Tables...... v List of Figures ...... vi Chapter 1. Introduction...... 1 Chapter 2. Regulation and Effects of Modulation of Telomerase Reverse Transcriptase Expression in Primordial Germ Cells During Development...... 19 Abstract...... 20 Introduction...... 21 Materials and Methods...... 24 Mice ...... 24 CAG-TERT Transgenic Construct Assembly...... 24 Transgenesis ...... 25 Fluorescence-Activated Cell-Sorting (FACS) Analysis and Purification of PGCs...... 25 Analysis of Telomerase Activity ...... 26 Reverse Transcription-PCR...... 26 Quantitative RT-PCR ...... 27 Cell-Cycle Analysis ...... 28 Results ...... 29 Analysis of Telomerase Activity and TERT Expression in Purified PGCs...... 29 Expression of TERT is Sufficient to Restore Telomerase Activity in Quiescent PGCs...... 30 Analysis of the Effect of Modulation of TERT Expression on PGC Numbers and Cell-Cycle Status...... 31 Discussion...... 33 Acknowledgements ...... 37 Chapter 3. Sirtl Deficiency Attenuates Spermatogenesis and Germ Cell Function...... 43 Abstract...... 44 Introduction...... 46 Materials and Methods ...... 49 Mice...... 49 Sperm Count...... 49 Analysis of Primitive Spermatogenic Stem Cells ...... 50 Histology...... 50 In Vitro Fertilization...... 50 Embryo Transfer...... 51 Comet Assay...... 51 Apoptosis Analysis ...... 52 TRAP Assay...... 52 RNA Isolation and Labeling for Array Analysis...... 52 cDNA Hybridization and Data Analysis...... 53

III Quantitave RT-PCR ...... 54 Results ...... 55 Sirtl Deficiency Abrogates Spermatogenesis...... 55 Sirtl Deficiency Affects Male Gametogenesis Owing Development...... 56 Sirtl Deficiency Induces Elevated DNA Damage in Male Germ Cells... 57 Sirtl Deficiency Affects Expression of Genes Involved in Spermatogenesis...... 57 Discussion...... 59 Acknowledgments...... 63 Author Contributions...... 63 Chapter 4. Sirtl Acts as a Nutrient-sensitive Growth Suppressor and its Loss is Associated with Increased AMPK and Telomerase Activity...... 75 Abstract...... 76 Introduction...... 77 Materials and Methods ...... 80 Cell Culture and Cell Unes...... 80 Cell Culture in Absence of Nutrients ...... 80 Telomerase Assays ...... 81 Design of Sirtl shRNA Expression Vectors, sbRNA-resistant Silent Mutant...... 81 Immonoblotting ...... 82 Chromatin Immunoprecipitation...... 83 Population Doubling Assays ...... 85 RT-PCR Analysis ...... 86 Hematopoietic Stem Cell Analysis and Culture...... 86 Results ...... 88 Inhibition of Sirtl and Telomerase Activity...... 88 Sirtl Suppression and hTERT...... 89 Sirtl Inhibition Cooperates with hTERT to Promote Cell Growth Under Normal and Low Nutrient Conditions ...... 90 Effect of Glucose Withdrawal on Sirtl-depleted BIT Cells...... 91 Increased Prolifemtive Capacity of Hematopoietic Stem Cells in Animals Lacking Sirt1 ...... 91 Discnssion...... 94 Acknowledgements ...... 99 Chapter 5. Discussion...... 111 References...... 117

Iv List of Tables

Table 1. Analysis of Germ Cell Function Using In Vitro Fertilization...... 64

Table 2. Top 10 Up and Down Regulated Differentially Expressed Genes in Testis ...... 65

v List of Figures

Figure 1. Analysis of Telomerase Activity and TERT Expression in PGCs During Development...... 38 Figure 2. Overexpression ofTERT in Quiescent PGCs is Sufficient to Restore Telomerase Activity...... 40 Figure 3. Effect of Alteration of TERT Expression on PGC Frequency...... 41 Figure 4. Effect of Alteration of TERT Expression on Cell Cycle Status of PGCs...... 42 Figure 5. SirU Deficiency Affects Spermatogenesis, but not Oogenesis...... 67 Figure 6. Spermatogenic Stem Cell Numbers are Reduced in Sirtl Deficient Embryos...... 68 Figure 7. DNA Damage is Elevated in Sperm from Sirtl Deficient Mice...... 69 Figure 8. Heat Map Representation of Differentially Expressed Genes in the Testis of Sirt 1 Deficient Mice...... 71 Figure 9. Quantitative RT-PCR Analysis of the Expression of the top 10 up and Down Regulated Genes in the Testis of Sirtl Deficient Mice...... 72 Figure 10. Numbers of Apoptotic Cells is Increased in Sirtl Testis...... 73 Figure 11. Telomerase Activity is not Affected by Sirtl Deficiency in the Testis...... 74 Figure 12. Effect of Sirtl Suppression on Telomerase Activity in Human Cells...... 101 Figure 13. Regulation of hTERT...... 103 Figure 14. Cooperative Effects of Sirtl Knockdown and hTERT Expression on Cell Growth and Survival...... 105 Figure 15. Analysis of the Effect of Sirtl Deficiency on HSCs and Progenitor Frequency and Proliferation...... 107 Figure 16. Confirmation of shRNA Knockdown in Cultured Cell Lines...... 109 Figure 17. Colony Growth of HSCs in Complete Media and Schematic of HSC Surface Phenotype...... 110

vi ~1.ThITRODUCTION

1 Stem cells are cells that have the ability to self renew via mitotic cell division as well as differentiate into a wide variety of tissue and cell types. Broadly, mammalian stem cells are divided into two categories, embryonic stem cells (ESCs) and adult stem cells, which are further categorized according to tissue type. In the developing embryo,

ESCs multiply and differentiate to form every tissue and cell type from each germ layer that makes up a complete organism, and possess a multipotent phenotype. Conversely, adult stem cells are limited in their differentiation. Hematopoietic stem cells for example are considered to be multipotent stem cells as they are limited in their capacity to differentiate and contribute forming all blood cell types including myeloid and lymphoid lineages.

As a result of their abilities to self renew and differentiate into varions cell and tissue types stem cells, both embryonic and adult, are of great clinical interest as developing stem cell therapies could dramatically impact the treatment of human diseases. Indeed, bone marrow transplantation is a current stem cell therapy used widely to treat leukemia. It is anticipated that stem cells could be used to treat many more diseases including Parkinson's disease, spinal cord injury, muscle damage, diabetes, and various cancers.

To accomplish self-renewal, stem cells undergo two different types of cell division, symmetric and asymmetric. In symmetric cell division, the stem cell divides into two identical daughter cells with the same phenotype and properties of the original stem cell. Asymmetric cell division results in the production of one stem cell and a 2 second cell commonly referred to as a progenitor cell. This progenitor cell has limited self-renewal potential and goes on to divide and further differentiate tenninally into a mature cell. The process by which stem cells renew and differentiate is of great interest as understanding these mechanisms and how to control them will provide us with the means to utilize these cells in future therapies.

Germ cells are a population of stem cells whose surviving descendants will become sperm or eggs. These cells playa large role in all sexually reproducing plants and animals, which is the transmission of genetic information from one generation to the next. The production of the mature gametes via spermatogenesis and oogenesis has been intensely investigated for some time and the respective processes are fairly well understood in many species both vertebrate and invertebrate. The origins, emergence and fate of the germ cell populatious have received less scrutiny due in large part to technical difficulty.

Studies in germ cell lineage mapping have been ongoing for the better part of a century since early experiments in the nematode Ascaris showed that germ line committed cells retained their chromatin complement intact, while somatic lineages demonstrated chromatin dimunition, or the discarding of large terminal chromosomal regions (I). In Xenopus and Drosophila, it was shown that aggregates of mitochondria, protein, and RNA in the cytoplasm of the vegetal pole in unfertilized eggs corresponding to the germ celllineage. These pole cells, rich in germ line determinants give rise to the germ line and are the first cells to be formed at the posterior end of the fertilized egg (2).

Detection of early germ cells in the developing mouse embryo has been aided by the

3 fInding that they express a high level of alkaline phosphatase and via staining for this can be detected as early as day 7.5dpc (3). Fate mapping experiments determined that emerging PGCs are derived from epiblast cells located near the extraembryonic ectoderm

(4-6). During development, these cells move to the posterior primitive streak and enter the extraembryonic region and onto the genital ridge where they form the gonads. In addition to alkaline phosphatase expression it has also been shown that PGCs express high levels of the pluripotentcy marker Oct-4. It is interesting to note that Oct-4 expression in the developing mouse is restricted entirely to the PGCs at 8dpc, making

Oct-4 a powerful tool for isolating pure populatious of PGCs. Upon reaching the genital ridge around 1O.5dpc these cells begin expressing germ cell specifIc genes including the mouse vasa homolog, germ cell nuclear antigen, and germ cell-less. These gene expression changes are a part of the reprogramming and fate commitment process the

PGCs undergo. By l2.5dpc, PGCs in both male and female embryos have begun to enter a premeiotic stage and express meiotic genes accordingly such as Scp3 (7). At this point meosis stops and the cells enter mitotic arrest at GO/G 1 until shortly after birth. In the developing female embryo, meiosis proceeds until reaching the diplotene stage at near birth.

Isolated PGCs (8-12.5dpc) can be cultured in a manner similar to embryonic stem cells on feeder layers with Leukemia inhibitory factor (LIF), basic fIbroblast growth factor (bFGF), and stem cell factor (SCF). Termed embryonic germ cells (EGCs), these cells can proliferate for many generations in culture and possess a pluripotent phenotype,

4 being able to self-renew and differentiate into many cell types and contribute to the germ line in chimeric animals (7).

The ability to culture germ cells long-tenn as well as cryopreserve these cells has wide reaching therapeutic advantages. Cryopreservation can be used to protect the germ line and as a result the genetic material necessary to preserve the male genn line of all mammalian species. Of particular interest is the cryopreservation of the germ line of valuable livestock, companion, and endangered species. In humans, the applications are just as great, especially in the instance of prepubertal boys undergoing chemotherapy or irradiation for cancer treatment. Oftentimes, stem cells are depleted by these treatments, but by taking and cryopreservation of a testicular biopsy beforehand, fertility may be restored at any point in time after successful cancer treatment (8, 9).

As a result of the complex structure of the testes, insight into the differentiation of the PGCs and spermatogenic stem cells into the functional components of the male genn line have been very difficult. However, recent evidence points to a role into the niche that these stem cells occupy. Cell adhesions, intercellular communications, ligand binding, and recently siRNAs have all been documented to play roles in directing the renewal and differentiation of the germ line.

The field of stem cell research owes a large debt of gratitude to Canadian researchers Ernest McCulloch and James Till. These early pioneers demonstrated the existence of stem cells by transplanting bone marrow into irradiated mice and observing the development of lumps on the spleens of the recipient mice (10). These colonies

5 termed "spleen colonies" were formed in proportion to the numbers of bone marrow cells injected (11). Later work demonstrated that these bone marrow cells were capable of self-renewal, a crucial part of fitting the definition of a stem cell the pair formulated (12).

Despite this early work it was not until much later that the Wiessman laboratory elucidated the markers to isolate murine HSCs and later, the markers necessary to differentiate between long-term HSCs and their progenitors.

HSCs are multipotent stem cells capable of differentiating into all blood cell types including myeloid cells such as macrophages, neutrophils, dendritic cells, and erythrocytes; as well as the lymphoid cells, such as T -Cells, and B-Cells. In mammals,

HSCs are located in the bone marrow and constitute roughly 1: 10,000 cells in myeloid tissue (13). It is well documented that a small population ofHSCs can give rise to a large number of progeny HSCs as well as a large number of progenitor cells. Indeed, this property is used to facilitate the repopulation of the hematopoietic system during bone marrow transplants (14). This also indicates that symmetric division must occur, at least in the case of bone marrow transplantation, as expansions in HSCs populations could not be seen in instances of asymmetric cell division. The division, differentiation, and renewal of HSCs is thought to be controlled largely by the stem cell niche. That is the cells surrounding the HSC give molecular and environmental cues to the HSC to promote self renewal and differentiation as needed. These cues that regulate the niche and control the fate of the HSCs may come in a wide variety of ways. Evidence exists that these include cell adhesions, asymmetric distribution of signaling molecules, contact with the outside environment, and even calcium levels (15). Even more recently osteoblast celIs

6 were conclusively shown to be part of the niche and to playa large role in initiating and modulating HSC proliferation in the context of mobilization (16).

Studies involving stem cells are impeded by two main obstacles: isolation of stem cell populations and properly defining their functional characteristics. In human systems, the cell surface glycoprotein CD34 is routinely used as broad marker for HSCs, but the majority of CD34+ cells consist of more committed progenitor cells. Utilizing fluorescence-activated cell sorting, it is possible to further enrich for HSCs in the

CD34+ICD3S- fraction. Further markers and combinations have been utilized in murine systems to define and isolate populations of HSCs. Recently it has been shown that fluorescent antibodies to C-kit, lineage, Sea-I, flk2, 0034, IL7Ra, FOyR can be used to sort out highly enriched populations of specific HSCs and progenitor cells. Long-term hematopoietic stem cells can be isolated from fractions that are lineage-, c-kit+, Sca-I +, fJk2., and CD34-. So called multipotent progenitor cells (MPPCs) display the same cell surface markers with the addition of being positive for CD34. Additionally, lymphoid and myeloid progenitors can be isolated from MPPCs based on the positive expression of

IL7Ra and FCyR respectively (17). However, it is still not possible to define a pure population of primitive HSC with repopulation abilities. Therefore demonstration of cellular senescence, numeric, or intrinsic changes in HSC is limited by and may be a reason for the large amount of contradictory studies.

Studies involving stem cell function and survival are also limited by the available methods for functional characterization in both in vitro and in vivo systems. Several in vitro assays such as colony forming unit (CPU) assay, cobblestone area forming cell

7 (CAFC) assay, long-term culture-initiating cell (LTC-IC) assay, or multilineage initiating cell (ML-IC assay) can be used to some degree to gain insights into number and maintenance of HSCs, but do not provide very much information on the roles that the niche and microenvironment play. CFU assays are useful in measuring the numbers of stem cells introduced to culture as each colony represents the progeny of a single stem cell. CAFC assay, an in vitro limiting dilution-type cell culture assay, can be used to visualize long-term undifferentiated HSCs in culture. In this procedure, putative HSCs are placed into culture in dishes coDtBining a feeder layer of irradiated stromal cells. The long-term undifferentiated HSCs will home to and grow under and between the stromal cells forming areas of flattened, dull, dark colored cells similar to cobblestones when visualized with phase contrast microscopy. This is in contrast to other cells on top of the stromal layer which will remain spherical and refractile (14). In Vivo transplantation experiments in the Murine system can be used to examine engraftment and differentiation potential in HSC populations. Commonly used transplantation procedures involve the transplant of varions cell types into recipients that have had the hematopoietic system removed via irradiation. Transplantation experiments are useful in determining which cell population is capable of repopulating the hematopoietic system of the recipient.

Additionally, transplantation assays can be done in a competitive manner. Multiple, distinct populations of cells are introduced and allowed to proliferate with the most competitive population being the largest upon subsequent enmination. However, these assays are very complex, the immune systems of recipient mice are usually severely altered, and there are severe differences between differing mouse strains. Lastly, it remains to be seen if the murine system is an adequate model for the human stem cell

8 niche, and translational studies would be difficult to undertake at best. It should be noted, however, that despite these complications bone marrow transplantations represent the

only conunonly used stem cell therapy in use today.

Recently much thought has been given to the effects of aging on stem cell

populations, including HSCs and the germ line. Aging is characterized by a diminished

capacity to maintain tissue homeostasis, as stem cells regulate this homeostasis, it is

logical to assume that depletion of stem cell reserves and a reduction in their function

may contribute greatly to the aging process. Currently it is postulated that stem cells

accrue a large amount of DNA damage over time and as a result decline in number and

function. In the hematopoietic system, long-term HSCs are a very quiescent cell

population with a very low metabolic rate (18). Additionally, it is thought that they ouly

divide when absolutely necessary to repopulate the pool of more committed progenitor

cells. By limiting cell division and metabolism, HSCs are able to limit the amount of

DNA replication and production of reactive oxygen species (ROS), both of which are

dangerous in such a vital cell. The accumulation of DNA damage may also facilitate the

development of a cancer stem cell by allowing for the mis-regulation of genes allowing

uncontrolled growth and proliferation that is a hallmark of cancer. Recently, however, it

was shown in the hematopoietic system at least, that long-term HSCs reserves were not

depleted with age, their functional capacity was severely reduced in response to stressors.

This reduction in functional capacity manifested itself in a loss of reconstitution and

proliferative potential, diminished self-renewal, increased DNA damage, and apoptosis

(17). It is widely known that fertility in both male and female organisms decreases

9 markedly with advancing age and the culprits are likely to be the same as in HSCs, with accrued DNA damage playing a large role.

Understanding the mechanisms involved in the process of aging and longevity is of great interest with many important applications to improve our quality of life.

Although these mechanisms are likely to be very complex with many equally important aspects, two areas have been shown to be of particular importance in recent years.

Firstly, telomerase and the telomeric ends of chromosomal DNA have been associated with cellular senescence and an aging phenotype. Secondly, Sirt1 expression has been shown to aid in regulating lifespan in several eukaryotic organisms.

Studies originated by Hayflick and Moorehead in the early 1960s demonstrated that diploid human fibroblasts have a finite replicative capacity and undergo senescence in culture (19). This phenomenon, known as the Hayflick limit, was later shown to hold true for other somatic cell types in humans and other organisms. Further investigations also demonstrated a shortening of telomeres in correlation with cellular senescence, thns establishing a potential role of the telomeres regulating replicative lifespan. Telorneres are genetic elements that cap the ends of chromosomes and guard against DNA damage and end to end fusions. In vertebrate animals, telomeres consist of repeats of the DNA sequence TTAGGG, however there is a great deal of variability in the length among species and even between individuals of the same species. In humans, for example, telomeres typically range from 3-12 kb. In mice, the range is on the scale of20-100kb, depending on the strain.

10 The telomeres are maintained by the ribonucleoprotein complex Telomerase, which consists of a catalytic reverse transcriptase protein (TERn subunit surrounding an

RNA template (TERC). Replication of the telomere by Telomerase occms during S phase by single-strand DNA synthesis onto the 3' overhang located at the end of the telomere. Telomerase was originally discovered by Grieder and Blackburn in the ciliate protozoan Tetrahymena in 1984 (20). Telomerase activity is detectable in human germ line and tumor cells, but absent in other tissues. Interestingly, only the TERT component is absent, the RNA component is ubiquitously expressed. As a result, most human cell types experience telomeric shortening as they age. In the mouse, telomerase is detectable in most tissue types and no telomeric shortening occms with age. It is hypothesized that telomeric shortening during replicative aging in human cells may result in cellular senescence. This is supported by in vitro evidence showing that overexpression of TERT in somatic cells allowed the elongation of telomere length and immorta1ization of these cells. Additionally, telomere length maintenance and telomerase activity is important in tumorigenesis. Surveys of many cancer types have established that in over 85% of all cancers telomerase is reactivated in some way, suggesting that the immortality conferred by telomerase plays a key role in cancer development, establishing telomerase as a powerful oncogene. In cancers lacking telomerase expression telomere length is maintained via a separate pathway termed alternative lengthening oftelomeres (ALT).

This pathway is poorly understood, but most likely involves multiple recombination events at the telomere. As a result, much attention is currently devoted to drug development in the hopes of being able to control telomerase activity. Such drugs promise to be potent cancer fighting compounds. Telomere length maintenance is also an

11 important aspect to the survival of stem cell populations including embryonic stem cells and HSCs. In human HSCs, telomeres shorten with age and accelerated shortening has been observed in HSCs isolated from bone marrow transplants. This is to be expected considering these cells are forced to artificially proliferate and repopulate an entire immune system for an individual. Recently, mice deficient for the lERT gene have been created. Frrst and second generation lERT knock-out mice display a wildtype phenotype, but analysis of telomere length shows a significant reduction in telomere length in all tissue types. Third generation lERT -1- mice display a great deal of heterogeneity in phenotype with some mice resembling those of earlier generations, while others are small in size, display an early onset of aging, patches of fur lacking pigment, and have severe defects in the germ lines in both males and females resulting in almost complete infertility. These mice have clearly demonstrated a necessary role of telomerase and telomeres in maintaining the genetic integrity between generations as well as establishing a f11lIl relationship with cellular aging.

Originally discovered in the yeast Saccharomyces cerevissiae, the silent information regulator 2 (Sir2) functions as a nicotinamide adenine dinucleotide dependent protein deacetylase (21). Sir2's discovery was brought about by the isolation of mutants that had lost the ability to silence DNA transcription at the telomeres and previously silenced copies of the mating loci HML and HMR. Loss of silencing produced a haploid ala non-mating phenotype. Further work found that this genetic silencing is a function of a family of related proteins, specifically it was found that mutations in the genes SIR2I3/4 eliminate silencing, while mutation of SIRI only reduces silencing (22).

12 Mutations resulting in overexpression of Sir2 resulted in yeast populations with an increased lifespan (21, 23-26). Further work revealed localization of the Sir2 protein to specific sites on the yeast chromatin. In particular, Sir2 is found at the mating type loci, telomeres, and ribosomal ONA (rONA) (27). The increased lifespan of Sir2 overexpression in yeast appears to be a result of the increased silencing of the rONA loci thereby inhibiting recombinational excision of extrachromosomal rONA which regulates longevity (28). In mammals, Sirtl, a member of the sirtuin family of proteins, functions as a nicotinamide adenine dinucleotide-dependent protein deactylase, and has been shown to have important physiological roles in the regulation of glucose metabolism, and survival of neurons.

Utilizing several techniques including database searches, low stringency blot hybridization, as well as degenerate PCR, Sir2 homologs were discovered in other eukaryotes (29). Since it's discovery in yeast, Sir2 and other Sir protein family members have been found in all eukaryotes studied thus far including nematode, fruitfly, mouse, and humans as well as some prokaryotes (29, 30).

Sir2 has also been of interest in the study of aging and longevity in various eukaryotes. In yeast and nematode worms, Sir2 can be activated by a variety of methods including mutation, sirtuin activating compounds (STACs), and caloric restriction (CR)

(24,31,32). As a result of Sir2 activation, silencing at ribosomal ONA sites is increased.

It has been well established that the accumulation of extrachromosomal rONA and its instability lead to a shortened lifespan (28). Studies have also demonstrated that increased Sir2 levels increase the NAD cycling through the NAD salvage pathway and

13 this increased level of NAD cycling also contributes to an increase in lifespan in CR organisms (26). Recent CR experiments involving mammalian systems have found that cell survival is also increased via induction of a functional Sir2 ortholog (33).

In mammalian systems, the functional Sir2 ortholog, Sirtl, has been shown to have pleiotropic effects. The biochemical function of Sirtl, like yeast Sir2, is as an

NAD+ -dependent protein lysine deacetylase (36). The physiological functions of Sirtl are complex and have yet to be completely resolved, but include roles in the regulation of p53, chromatin structure, insulin-insulin-like growth factor signa1ing, hepatic insulin signaling and glucose and fat metabolism (22, 27, 34,35). In addition to direct interactions with p53, Sirtl has also been shown to interact with the proteins PPAR­ gamma and FOXO transcription factors (22, 36, 37).

The role of p53 as a tumor suppressor is well established. Tumor suppression via p53 activation is achieved by its ability to act as transcription factor to regulate downstream target gene expression (38). Although the mechanism by which p53 is activated due to cellular stress is not entirely understood. it is currently thought to involve posttranslational modification; namely phosphorylation and acetylation. Several independent investigations have now confirmed that the deacetylase activity of both mouse and human Sirtl downregulates p53 activation and promotes cell survival (34, 35,

39). Conversely, it has also been shown that the absence of Sirtl in mice results in the hyperacetylation of p53 and, at least in thymocytes, results in increased apoptotic activity

(40).

The forkhead box 0 (FOXO) proteins are a group of structurally related transcriptional activators possessing a common amino acid motif that binds the consensus

14 DNA sequence GTAAA(ctr)A to control target gene expression (40). The mammalian

FOXO family members FOX01, FOX03a, FOX04, and FOX06 are largely phorsphorylated by protein kinase B and serum and glucocorticoid-induced protein kinase which relay phosphoinositide 3-kinase signals to target genes (41). Upon activation via cellular stress, the various members of the FOXO family migrate to the nucleus, where they can activate or repress many genes involved in apoptosis, cell cycle arrest, differentiation, and DNA repair (41). Recently, it has been shown that mammalian

Sirtl deacetylates FOX03 in both primary cells and cell lines and in so doing, reduces

FOX03 induced apoptosis (36). Additionally it has been established that Sirtl interacts with FOX04 both in vitro and in vivo (43). Based on these recent studies it seems that the interactions of Sirtl with FOXOs tend to push the cell away from apoptosis towards cell-cycle arrest and survival in a manner reminiscent of Sirtl's interaction with p53. It has also been shown that FOX03 activated and sequestered in the nucleus in response to cellular stress can interact and activate p53 to induce apoptosis (44, 45).

A key metabolic response to caloric restriction in mammals is an increased sensitivity to insulin and a corresponding reduction in both blood glucose and insulin levels (46, 47). This decreased insulin signaling causes a decrease in fat synthesis and increases the mobilization of fat deposits for release into the circulatory system. In mammalian systems, white adipose tissue (WAT) functions as the primary fat deposit. In response to caloric restriction, Sirtl is upregulated in WAT and in the case ofPPARy,

Sirtl works with the transcriptional corepressor NCoR to negatively regulate PPARy, and promote fat mobilization (46). In most cases, Sirtl has been shown to negatively regnlate gene expression via protein deacetylation (35, 39, 42). However, it has recently been

15 shown that Sirtl can act as both a positive and negative regulator for gene expression as a cofactor with PGCl-a to control gluconeogenesis and glycolysis in response to pyruvate

(48). Evidence for a conserved role of Sirtl in insulin signaling stems from work showing Sirtl interacts with insulin-insulinlike growth factor I (IGF-n in the nematode worm and in mice (48-50). In the mouse, two separate studies have concluded that Sirtl positively regulates insulin secretion in pancreatic p-cells when stimulated with glucose

(51,52). In regards to p-cell physiology and glucose homeostasis, Sirtl was found to downregulate several genes including uncoupling protein 2 (Ucp2), prolactin receptor

(Prlr), and urocortin 3 (Ucn3) (51). Ucp2 is a mitochondrial inner membrane proton transporter that functions to uncouple respiration from A TP synthesis by leaking protons from the intermembrane space to the matrix side of the inner membrane (53). Ucp2 is a known negative regulator of glucose stimulated insulin secretion and functions in p..cell glucose sensing (54, 55). Prlr functions in pancreatic islet cells in regulating glucose sensitivity, and cells deficient for Prlr demonstrate defects in insulin production and secretion (56, 57). Ucn3 functions as a ligand for type 2 corticotropin-releasing factor receptor. Upon secretion by pancreatic islet cells Ucn3 stimulates glucagons and insulin secretion (58).

Insulin and IGF-l have been shown to play large roles in the protection and survival of neurons (59). Specifically, correct levels of IGF-l in circulation are important for proper adult brain function (60). Evideuce has also been gathered indicating that dec1ining IGF-llevels contribute to age-related brain impairments and some neurodegenerative diseases (60-62). Paradoxically, it was shown that decreased levels of

IGF-l activity increase lifespan in C. elegans, Drosophila, and mouse models; and in the

16 case of C. elegans, restoring IGF-ll daf-2 pathway signaling to neurons resulted in a return to wildtype lifespan (63-66). This evidence suggests that the nervous system may be a strong role player in longevity determination. While elucidating why IGF-l signaling positively impacts neuronal survival to the detriment of organismallifespan is likely to be a complicated process, several studies show a link between IGF-l signaling and SirU (48, 50). Additionally, it has been established that Sirtl is expressed in high levels in the embryonic brain (62). Evidence is mounting that Sirtl and the converse effects of IGF-l signaling on neuronal survival and organismallifespan may be a result of circulating NAD levels. High levels of NAD promote attenuation of Sirtl when combined with high expression of IGF-l, this effect results in conference of a level of resistance to neuronal apoptosis or degeneration; conversely, low NAD levels combined with high IGF-l levels may have a negative effect on Sirtl with a corresponding effect on long-term neuronal survival (67).

Recently, two Sirtl deficient strains have been developed (29, 33). Both strains are small in size, fail to thrive, and one of these strains has been reported to be sterile

(29). Mice that are heterozygous for the Sirtl KO allele appear to be unaffected. Sirtl

KO mice, in addition to being small in size, possess a large number of deformities including exencephaly, cardiac defects, and atrophy of the pancreas. McBurney, et al report that their SirU KO mice are sterile (natural mating) (29, 35). In addition, their male Sirtl KO mice were observed to have a lower sperm count and a higher frequency of deformed sperm. They also observed an increase in the number of apoptotic bodies in the seminiferous tubules of the testis (29).

17 The hypotheses we address in the three studies reported here are as follows: FU'St, we hypothesize that restoring expression of the catalytic component of telomerase is sufficient to restore telomerase activity in quiescent PGCs. Second, we hypothesize that

Sirtl is necessary for the survival of PGCs and is also necessary to promote normal spermatogenesis. Lastly, we hypothesize that Sirtl interacts with telomerase under normal and nutrient-limiting conditions, and that a lack of Sirtl promotes survival of

HSCs.

18 CHAPI'ER 2. REGULATION AND EFFECTS OF MODULATION OF TELOMERASE REVERSE TRANSCRIPTASE EXPRESSION IN PRIMORDIAL GERM CELLS DURING DEVELOPMENT

Matthew Coussens, Yukiko Yamazaki, Stefan Moisyadi, Ryota Suganuma, Ryuzo Yanagimachi, and Richard Allsopp

Institute for Biogenesis Research, University of Hawaii, Honolulu, Hawaii 96822

Originally published iu Biology of Reproduction 75,785-791 (2006)

19 ABSTRACT

Telomere length maintenance in the germ line from generation to generation is essential for the perpetuation of eukaryotic organisms. This task is perfonned by a specialized reverse transcriptase called telomerase. While this critical function of telomerase has been well established, the mechanisms that regulate telomerase in the germ line are still poorly understood. We now show. using a PouSfl-GFP transgenic mouse model, that telomerase suppression in quiescent male primordial germ cells

(PGCs) is accompanied by a decrease in expression of murine telomerase reverse transcriptase (TERT). To further assess the role of TERT in quiescent PGCs. we developed a chicken Actb gene promoter/cytomegalovirus enhancer (CAG)-Tert transgeuic mouse strain that constitutively expresses murine TERT. Telomerase activity was detected in quiescent PGCsfrom CAG-Terttransgeuic embryos. demonstrating that re-activation of TERT expression is sufficient to restore telomerase activity in these cells and implying that TERT expression is an important mechanism of telomerase regulation in PGCs. Fluorescence-activated cell-sorting (FACS) analysis of PGC frequency and cell cycle status revealed no effect of either overexpression or deficiency of TERT in CAG­

Tert transgeuic mice or Tert knock-out mice respectively. These results demonstrate that

TERT per se does not affect proliferation or development of PGCs. in contrast with recent studies that suggest that TERT has a telomere-independent effect in certain stem cells. It is possible that the direct effect of TERT on cell behavior may be dependent on cell type.

20 IN1RODUCTION

Telomerase is an essential ribonucleoprotein complex that functions to complete the replication of telomeres. essential genetic elements that cap the ends of all eukaryotic chromosomes. There are two essential components of telomerase: the telomerase RNA component (68). which contains a short motif that serves as a template for the addition of new telomeric DNA onto the end of the telomere. and telomerase reverse transcriptase

(TERT)(69). which is the catalytic component oftelomerase. In sexually reproducing eukaryotes. the primary function of telomerase is to maintain telomere length in the germ line from generation to generation (70).

In the absence of telomerase. the normal DNA replication machinery cannot completely replicate the ends of telomeres (71). Thns gradual telomere attrition occurs in cells that proliferate in the absence of telomerase (72. 73). Soon after blastocyst implantation in humans, telomerase gradually becomes suppressed in most tissues of the developing embryo. By adulthood, most human tissues. with the exception of the germ line and certain highly proliferative tissues such as the hematopoietic system, lack detectable telomerase altogether. As a result, telomeres gradually shorten during aging in homans. eventually triggering cell senescence once one or more telomeres become critically short (74. 75). Activation of telomerase through ectopic expression of human

TERT in a number of different types of human somatic cells in vitro has been shown to both prevent telomere shortening and immortalize the cells (76. 77). While the role of telomeres and telomerase as ultimate effectors of replicative life span of human cells is now well established, the mechanisms that regulate suppression of telomerase in somatic

21 cells and tissues and maintenance of active telomerase in the germ line are still poorly understood.

Both male and female germ cell lineages are derived from specialized stem cells in the embryo called primordial germ cells (PGCs). The development ofPGCs and gonads has been well established in mice (78). where PGCs are first detectable in the hindgut of Day 7 (d7.0) embryos as a very small population (n.:60) of alkaline phosphatase-positive cells (11). At d9.5. PGCs begin to migrate from the hindgut to the genital ridge. This migration is complete by dll.5. and PGCs continue to proliferate in the inunature gonad until d13.5 when they number approximately 25.000 per gonad. At this point. females enter meiosis and arrest in prophase I until sexual maturity. In male embryos. PGCs enter a state of qniescence until shortly after birth when they differentiate

into spermatogonia of the developing testis.

In both humans and mice. telomerase activity. as assessed by a highly sensitive

PCR-based assay (TRAP assay) (79). is detectable in oocytes (80.81) and the testis (79.

82). but not in mature spermatozoa (81.83). In mice. telomerase activity has also been reported in highly enriched samples of mitotically active PGCs. but not quiescent male

PGCs (81). suggesting that there may be a physiologically relevant switch in telomerase

activity as PGCs enter a state of growth arrest. Telomerase activity would, therefore. be

switched back on again at some point during testicular development. In the present study.

we have rigorously established that telomerase is downregulated in male PGCs as they

become quiescent, and we have begun to assess the mechanism of telomerase suppression

by examining the role that TERT expression may have in this process. We found that

22 inhibition of TERT expression partially, if not entirely, accounts for the suppression of telomerase in male PGCs during development. Furthermore, recent studies (84-86), including our own unpublished work, have demonstrated that alteration in TERT expression can affect the behavior of cells, including stem cells, through a mechanism that is independent oftelomerase. Fmaily, we have also examinedthe consequences of

TERT overexpression and deletion in PGCs from Ten transgenic and Ten knock-out mice, respectively.

23 MATERIALS AND METHODS

Mice

The PouSfl (more commonly known as Oct4) gene promoter-GFP transgenic mouse strain (87) and Ten knockout strain (88) were kindly provided by Drs. leffMann

(University of Melbourne) and Lea Harrington (University of Toronto). respectively. All

B6D2Fl and C57BL6/1 mice were plll'Chased from the National Cancer Institute (NCl). and CD-I mice were purchased from Charles River Laboratories. The chicken Actb gene promoter/cytomegalovirus enhancer (CAG)-Tentransgenic strain was developed as described below. Mice were fed with a standard diet and maintained in a temperature- and light-controlled room (22°C. l4L:lOD; light starting at 0700 h). in accordance with the guidelines of the Laboratory Animal Services at the University of Hawaii and the

Committee on Care and Use of Laboratory Animals of the Institute of Laboratory

Resources National Research Council (DHEW publication 80-23. revised in 1985). The protocol for animal handling and treatment procedures was reviewed and approved by the

Animal Care and Use Committee at the University of Hawaii.

CAG-Ten Transgenic Construct Assembly

A version of murine Ten cDNA (89) containing a short, unique 3' untranslated region (to allow subsequent analysis of transgene expression) was sub-cloned into the

EcoRI site of a chickenActb gene promoter/cytomegalovirus enhancer (CAG) expression construct. A Sall-HindIII fragment containing the CAG-Ten cassette was then sub-cloned into the pMOD-3 vector (Epicentre) to generate the pMOD3-CAG-Ten construct. The

24 transposon flanked by its mosnic end (ME) sequences was linearized by digesting the pMOD3-CAG-Tenconstruct with Pvul, resulting in a 7638-bp fragment containing the active transposon (EZ:TN transposon). The transgenic construct was resolved on a 1% agarose gel, purified with the QIAqnick Gel Extraction Kit (Qiagen) and nsed for transposome assembly as previonsly described (90).

Transgenesis

Transgenesis with the transposable transgenic construct (ME-CAG-Ten-ME) was perfOtmed as previonsly described (90). Pups were screened for the presence of the transgene by PCR using primers specific for the transgene construct. Two of 16 viable pups were positive for transgene integration. One of these founder mouse strains was subsequently shown to express the Ten transgene (as described in Results).

Fluorescence-Activated Cell-Sorting (FACS) Analysis and Purification ofPGCs

PouSfl-GFP males (homozygous for the PouSfl-GFP transgene) were bred with either B6D2Fl females or CAG-Ten transgenic females to allow generation of PouSfl­

GFP transgenic embryos or PouSfl-GFPICAG-Ten double transgenic embryos, respectively. Primordial germ cells were isolated from either the lower half of the embryo

(d9.5 and dlO.5 embryos) or from male gonads (dI2.5, dI5.5, or d16.5 embryos). To prepare single-cell suspensions containing PGCs, the embryonic sections or gonads were treated for 3 min with trypsinlEDTA at 37°C and then further dissociated by pipetting before fIltering through a lOO-l1m nylon fIlter. Trypsin was inactivated with 10% fetal bovine serum (FBS)lPBS solution and cells were centrifuged, washed twice in 2%

25 FBSIPBS solution, and finally resuspended in 2% FBSlPBS for FACS analysis and sorting. All FACS analysis was performed on a Beckman/Coulter Elite FACS machine.

To exclude nonviable cells from the analysis,7-actinomycinD (7-AAD; 5 Ill) was added to all samples 10 min before FACS analysis. For purification ofPGCs, all samples were double sorted.

Analysis of Telomerase Activity

Telomerase activity was assessed using the mAP assay (Chemicon), with slight modiflcatious to the manufacturer's protocol as previously described (91). Briefly, for analysis of single-cell suspensions prepared from whole embryos, cells (n =1000 per embryo) were sorted into 96-well plates containing 50 III [(3- cholamidopropyl)dimethylannnonio]-propanesulfonic acid (CHAPS) lysis buffer and 20 units of RNaseout (Invitrogen) per well. Cells were lysed on ice for 30 min. Thirty cycles of PCR were performed using 1 III of each embryo sample (fmal reaction volume, 25 Ill).

The TRAP analysis of telomerase activity in PGCs was performed the same way, except

32 cycles of PCR were performed, and 1.5 III cell extract was used per mAP reaction.

Reverse Transcription-peR

In all analyses, PGCs or embryonic cells were sorted directly into 50 III RT-PCR lysis buffer (Ambion) containing 20 units of RNaseout (Invitrogen). Reverse transcription

(RT) was performed with Superscript m (Invitrogen) for 45 min at 42°C using an oligo­ dT primer. All RT reactions were performed using 1 III of sample. Forty cycles of PCR

(94°C, 30 sec; 60°C, 30 sec; 72°C, 1 min) were then performed with Taq DNA

26 polymerase, followed by 20 more cycles of nested PCR. Analysis of cyclin D1 expression was performed using previously described primers (92). All RT and PCR reactions were performed on a PTC-100 PCR machine (MJ Research).

Quantitative RT-PCR

In ail FACS analyses, 1500 PGCs were sorted directly into 50 Jll Trizol

(Invitrogen) containing 20 units of RNaseout (Invitrogen). RNA was extracted and precipitated using linear acrylamide (Ambion) as a carrier. Reverse transcription was performed using an oligo-dT primer and Superscript ill (Invitrogen). All RT reactions were performed at 42°C for 45 min using 300 cell equivalents of RNA as template. Real­ time PCR was performed using the Superscript ill Cell Direct qPCR (quantitative PCR) kit (Invitrogen) and the LightCycler system (Roche). To normalize amounts of RT product, Hprtl mRNA was used as an internal control. Real-time PCR reactions were performed using the following primers:

Hprtl-Forward: TCCTCCTCAGACCGCIIII

Hprtl-Reverse: CCTGGTICATCGCTAATC

Tert-Forward: GTGAACAGCCTCCAGACAG

Tert-Reverse: TICCTAACACGCTGGTCAAAGGGA

All primers were designed to span intron/exon boundaries, yield single ampJicons (:!f120 bp) as measured by dissociation curves, and were shown to not amplify genomic sequences.

27 Each real-time PCR reaction mix contained 1 11M of each primer, 200 11M dNTPs,

2.5 mM magnesium chloride (MgCh), and 2 III of first-strand cDNA sample. Reaction products were detected using SybrGreen (Invitrogen). All PCR reactions were performed for 45 cycles (94°C, 5 sec; 55°C, 10 sec; 72°C, 10 sec), followed by continuous melt curve analysis to ensure product accuracy. Standard curves (Cp plotted against the log of relative cDNA concentration) for Hprtl and Tert amplification generated by serial dilutions of fIrSt-strand cDNA were linearthrough a range spanning at least one log greater and less than the amount of cDNA used in the test reactions. All calculations of the relative amount of Tert mRNA, performed using the 2-AAcp method, were carried out in triplicate.

Cell-Cycle Analysis

Primordial germ cells were purified by FACS and fixed overnight in ethanol at

4°C. The next day, fixed cells were washed twice with PBS and then stained for 3 h at

4°C in 3.8 mM sodium citrate buffer containing 50 Ilg/ml propidium iodide and 0.25

Ilg/ml RNaseA before FACS analysis.

28 RESULTS

Analysis ofTelomerase Activity and TERT Expression in Purified PGCs

Preliminary data by Dolci et al. (81) suggest that telomerase activity is suppressed as PGCs stop dividing and become quiescent by dI4.S in male murine embryos.

However, the proliferating PGC samples in this study were enriched but not pure, and, therefore, it remains possible that the observed telomerase activity was due to contaminating cells. To confirm that telomerase is suppressed as male PGCs cease proliferating, we assessed telomerase activity by the TRAP assay in PGCs purified by

FACS from PouSfl-GFP transgeuic (87),] mouse embryos at various stages of development (Figure 1, A). Previous work has shown that POUSF1 is essentially exclusively expressed in PGCs in mouse embryos by d8.S (87). In agreement with Dolci et al. (81), we found that telomerase activity is present in FACS-purified male PGCs at dl2.S but not detectable in quiescent male PGCs at dIS.S or dI6.S (Figure 1). Telomerase activity was also present in PGCs at earlier stages of development (d9.S and dlO.S) at levels similar to that observed in dI2.S male PGCs (Figure 1, B). Importantly, this analysis was done on small numbers of proliferating PGCs (d9.5-dI2.S) thatcousistently showed 100% purity on the basis of alkaline phosphatase activity (data not shown).

To assess whether suppression of telomerase in quiescent male PGCs involves downreguiation ofTERT expression, we performed quantitative RT-PCR (qRT-PCR) analysis of relative Tert mRNA levels. Similar levels of Tert mRNA were observed in dlO.5 anddI2.S PGCs, but was not detected in quiescent malePGCs (dIS.S or dI6.S)

29 (Figure 1. C). These results demonstrate that suppression of telomerase in quiescent male

PGCs is accompanied by downregulation of TERT expression.

Expression ofTERT Is Sufficient to Restore Telomerase Activity in Quiescent PGCs

A nmnber of potential mechanisms for the regulation of telomerase activity have been identified, including regulation of the RNA component of telomerase (93). translocation of TERT between the cytoplasm and nucleus (94). and post-translational modification of TERT (95). in addition to regulation of TERT expression (69). Therefore. to assess whether modification of TERT expression is the primary mechanism for regulation of telomerase activity during PGC development, we created a transgeuic mouse strain in which TERT expression is driven by the chicken Actb gene promoter/cytomegalovirus enhancer (CAG) promoter. This CAG-Tert strain expresses the

Tert transgene and has approximately 2.5-foldhigher telomerase activity levels in whole embryos compared with non-transgenic embryos (P =0.01) (Figure 2. A and B). To assess the effect of TERT overexpression in PGCs. we crossed CAG-Tert transgenic mice with Pou5fl-GFP transgenic mice (each strain was homozygous for their respective transgenes) and used FACS to isolate PGCs from embryos at various stages of development. As a control. PGCs were also isolated from PouSfl-GFP embryos. In mitotically active PGCs (d9.5-d12.5). we observed an approximately 2.3-fold elevation in telomerase activity of Terttransgenic embryos compared with controls (P ~>'ol)

(Figure 2. C and D). We also detected telomerase activity in quiescentmaie PGCs (dI5.5 and dI6.5) from Tert transgenic PGCs. but not in control quiescent PGCs. Real-time RT­

PCR analysis of TertmRNA levels demonstrated increased expression in dlO.5-d16.5

30 PGCs from Ten transgenic animals (Figure 2, E), consistent with the observed elevated levels of telomerase activity. These datademonstrate that reexpression of TERT is sufficient to restore telomerase activity in quiescent male PGCs.

Analysis of the Effect ofModulation ofTERT Expression on PGC Numbers and Cell­

Cycle Status

Recent studies have found that TERT overexpression can stimulate proliferation and increase in frequency of cells, including stem cells (84-86). Furthermore, lack of telomerase in the murine genn line results in sterility through a telomere-dependent mechanism, though not until after several generations of successive breeding (70). To detennine whether TERT overexpression or deficiency affects PGC number, we assessed, using FACS, the frequency ofPGCs within the embryonic gonad at d12.5 and d15.5 for

CAG-Ten, early generation Ten knockout, and wild-type embryos (Figure 3). Neither deficiency nor overexpression of TERT had a noticeable effect on PGC frequency as compared to controls. To assess the effect of altered TERT expression on cell-cycle status, we measured the frequency of S/G2IM (cycling) and GO/G 1 (non-cycling) PGCs at d12.5 and d15.5 from CAG-Ten, early generation Ten knockout, and wild-type mice

(Figure 4, A). In agreement with the lack ofeffect of altered TERT levels on PGC frequency (Figure 3), we observed no appreciable difference in the frequency of cycling

PGCs in CAG-Ten transgenic embryos or Ten knockout embryos. To further assess the effect of altered TERT expression on cell cycle status of quiescent male PGCs, we analyzed the expression of the proliferation marker cyclin D 1 by RT -PCR in PGCs from

Ten transgenic and knockout embryos, as well as wild-type embryos. For all strains,

31 cyclin D I expression was detectable in proliferating d12.5 PGCs. but not in quiescent male PGCs (Figure 4. B). Together. these data show that altered expression of TERT. either overexpression or deletion, does not affect frequency or cell-cycle status of PGCs.

32 DISCUSSION

Telomerase is essential for the regulation of telomere length in the germ line, as has been demonstrated in telomerase-deficient mice (70), where the lack of telomerase in successive generations of mice causes unabated telomere shortening and, ultimately, sterility. Although regulation of telomerase in the germ line is poorly understood, a number of studies have now examined telomerase expression in the mammalian germ line. In the female germ line, as demonstrated in humans, telomerase appears to be constitutively expressed in both immature and mature oocytes, although perhaps at a higher level in the former (80). Telomerase activity is also detectable in mature murine oocytes (81). In the male germ line, as demonstrated in humans and mice, telomerase is expressed in the testis (79, 82), but is then repressed in the final stages of spermatogenesis

(82, 83). Following fertilization, telomerase is presumably reactivated in the male genome at some point during early development of the preimplantation embryo. In addition, preliminary analysis of telomerase activity in murine PGCs suggests that telomerase is active in proliferating PGCs and is then suppressed later in development when these cells enter a state of growth arrest in the male gonad (81). We have now established that telomerase is suppressed during development of male PGCs by a mechanism that involves inhibition of TERT expression. Furthermore, we showed that altered expression of TERT in PGes from telomerase deficient or transgenic embryos does not affect the behavior of these cells, implying that neither telomerase activity nor

TERT per se are required for normal development or proliferation of PGCs.

33 The lack of detectable telomerase activity in most types of human somatic cell correlates with the absence of TERT expression (69). In addition, telomerase activity can be restored and telomere length maintained in a number of human cell types by the ectopic expression of human TERT (76, 77). These findings suggest that the primary mechanism of telomerase regulation is through suppression or activation of TERT expression. However, other mechanisms of telomerase regulation may also be important, including regulation of expression of the RNA component of telomerase (93), translocation of TERT between cytoplasm and nucleus (94), and TERT post-translational modification (95). In the present study, we found that TERTexpression is suppressed in quiescent male PGCs and that overexpressionofTERT is sufficient to restore telomerase activity in these cells (Figure 1 and 2). Although a possible effect of elevated TERT expression in non-PGC cells in CAG-Tert transgenic embryos cannot be ruled out, these data strongly suggest that the primary mechanism for regulation of telomerase activity in

PGCs during development is at the level of TERT expression. This conclusion is consistent with other studies that show that telomerase activity and TERT expression are suppressed in quiescent cells (96, 97).

Recent studies have shown that altered TERT expression in various cell types, including stem cells, can not only affect telomerase activity, but can also have additional effects. In some human cancer cells, TERT has been shown to have pro-tumorigenic properties independent of telomere length maintenance (98), and suppression of TERT expression in human fibroblasts leads to attenuation of the DNA damage response (99).

In rodents, overexpression of TERT in cultured neuronal cells promotes resistance to

34 apoptosis(l00). In addition, we found that overexpression oflERT in murine hematopoietic cells causes mild splenomegaly (unpublished results). Furthermore, elevated lERT expression has been shown to promote proliferation of epidennal stem cells (85, 86) and skin cells (84). At least in studies involving rodents, it is improbable that this effect of altered lERT expression on cell behavior is due to prevention of

telomere-mediated cell senescence orcell death, since rodents have relatively long

telomeres (101). In the present study, we found that deficient or elevated expression of lERT in PGCs does not affect PGC number or proliferation (Figure 3 and 4). The Tert

knockout mice used in this study were derived from a C57BU6 Tert+!- strain with

uncharacteristically short telomeres due to Tert haplo-insufficiency (102). The lack of

effect of lERT deficiency in PGCs from first generation knockout embryos (Figure 3 and

4) is consistent with a lack of any overt phenotype or telomere dysfunction, as well as the

nonnallitter size observed for first generation Tert knockout mice derived from this strain

(102). It has also been reported that lERT elevation does not affect hematopoietic stem

cell frequency in transgenic mice that overexpress lERT in the hematopoietic system

(103). It is possible that the effect of lERT on cell behavior is dependent on cell type or,

in the case of lERT overexpression, on the level of lERT expression.

Interestingly, in the CAG-Tert transgenic mice developed in this study, where

lERT is also expected to be overexpressed in epidennal stem cells, we did not observe

the markedly enhanced hair growth that was found upon induction of lERT expression in

a Tet-inducible CAG-Tert strain (86). While the reason for this is unclear, it could be that

the Tet-inducible strain has significantly higher levels of lERT expression, or perhaps

35 there is a mechanism, active during embryonic development, that dampens the effect of

TERT overexpression in epidermal stem cells. Abnormal hair growth in another constitutively-expressing CAG-Tert transgenic strain was not reported (104), in agreement with our observations.

In conclusion, we have shown that telomerase is primarily regulated at the level of

TERT expression during development of male PGCs, and that altered expression of

TERT in PGCs does not affect their behavior in any overt manner, including entry into quiescence later in development. However, more subtle effects of altered TERT expression, for example on chromosome stability or DNA damage response (99), cannot be ruled out and will be of interest to assess in future studies. These observations also imply that transcriptional regulators of the Tert gene are important in the regulation of telomerase during development of male PGCs. While a number of transcription factors have been identified that affect TERT expression in cultured cells (105, 106), to our knowledge, none have been found to have a physiological role in the regulation of TERT expression in normal cells in vivo. It is also possible that expression of transcription factors that regulate telomerase in the germ line is dysregulated during progression of certain cancers, leading to reactivation of telomerase. Thus, it will be important to determine the factors involved in regulation of TERT expression in PGCs, not only from the standpoint of their role in fertility of the male germ line, but also as possible potential targets in cancer.

36 ACKNOWLEDGMENTS

We thank Lea Harrington and Scott Lozanoff for critical review of the manuscript,

Gregg Maeda for excellent technical assistance, and Karen Selph and Jamie Newell for assistance with FACS sorting of PGCs.

37 B

A

GFPLog c in.a~------l a i I I ! diU di2.5 di~.5 dn"

Figure. I. Analysis of telomerase activity and TERT expression in PGCs during development.

A) Purification of PGCs from P01l5fl-GFP transgenic embryos using FACS. Single-cell suspensions were prepared from P01l5fl-GFP embryo sections (d9.5 and d 10.5) or male gonads (dI2.5, dI5.5, and dI6.5) to facilitate FACS purification of PGCs. The gates for analysis and sorting of GFP + PGCs are shown. Also shown is an example of FACS analysis of d 15.5 gonads from C57BU6 embryos (non-transgenic). B) Analysis of telomerase activity in FACS-purified PGCs. Primordial germ cells (n = 50 for each sample) from Pou5fl-GFP embryos at various stages of development were purified by FACS for analysis of telomerase activity by the TRAP assay. Stage of development is indicated above each lane. NTH3T3 cells were used as a positive control (n = 500). The internal control (IC) for the TRAP assay is indicated by the arrow. C) Analysis of TERT expression using real-time RT-PCR. Primordial germ cells (n = 1500) from P01l5fl-GFP transgenic embryos at the indicated stages of development were purified using FACS for extraction of RNA. First strand cDNA was generated using an oligo-dT primer, and 300 cell equivalents of RNA were used in all real-time PCR reactions. Real-time PCR was performed using the LightCycler system (Roche). Hprt I mRNA was used as an internal contTol. Values are an average of three experiments. Bars = SEM. No difference was detected between Ten mRNA levels of d lO.5 and d12.S PGCs (P > 0.1; ANOVA). 38 Figure. 2. Overexpression of TERT in quiescent PGCs is sufficient to restore telomerase activity.

A) Telomerase activity and transgene expression in CAG-Terl transgenic embryos. The CAG-Terl transgenic strain (transgenesis method described in Malerials and Methods) was crossed with C57BU6 mice, and single cell suspensions were prepared from individual d12.5 embryos for analysis of telomerase activity (upper panel) and transgene expression (lower panel). Genotype was subsequently assessed by PCR on a small tissue section from each embryo. A typical result is shown for a transgenic and non-transgenic embryo. Transgene expression was assessed by RT-PCR with transgene-specific primers on oligo-dT purified mRNA. Also shown are expression levels of Gapdh mRNA as a control for PCR efficiency and gel loading. B) Quantitative analysis of telomerase activity in CAG-Terr transgenic and non-transgenic embryos. Telomerase activity was measured using the TRAP assay. All d12.5 embryos (non-transgenic [non-TgJ, n = 5; transgenic [Tg] , n = 6) from a CAG-Tert x C57BU6 cross were used in this analysis. The TRAP assay was also performed on 3-fold serial dilutions of some Tg and non-Tg embryo extracts to ensure that measured telomerase activity for all samples was within the linear range (data not shown). Telomerase activity was significantly greater for extracts prepared from transgenic animals (P = 0.01; Student I-test). C) Analysis of telomerase activity in PGCs from CAG-Terl transgenic embryos. CAG-Terlmice were bred to homozygosity and then crossed with Pou5fl-GFP mice to generate CAG­ Terr1Pou5fl-GFP double transgenic (DT) embryos. Primordial germ cells (n = 200 per embryo) were isolated using FACS from individual embryos at the various stages of development indicated above each lane. A sample blot is shown, with extracts from both DT and POIl5fl -GFP (ST) embryos. D) Quantitative analysis of telomerase activity in CAG-Terr transgenic and non-transgenic PGCs. Analysis oftelomerase activity was performed on PGCs isolated from DT and ST embryos (n ~5 at each stage of development). At each stage of development assessed, telomerase activity levels were significantly greater for DT PGCs compared with ST PGCs (indicated by the asterisk; P ~O.O I at each stage of development; Student I-test). E) Analysis of TERT expression using real-time RT-PCR. Primordial germ cells (n = 1500) from ST and DT transgenic embryos at the indicated stages of development were purified using FACS and RNA was extracted. The RT and real-time PCR were performed as described in the caption to Figure I. Values are an average of three experiments. Bars = SEM. At each stage of development assessed, Terl mRNA levels were significantly greater for DT PGCs than for ST PGCs (P ~0.002 at each stage of development; Student I-test).

39 A 8 c ..!!ll..2....!l.1L§. d15.5 d 16.5 WTTIl 5T DTST DT ST DT ST DT

_"ToIiTg- wt Tg o - " ~pdPr E i 2.cT"'""--n------::"= S t.6+_ 11.:l't-- ! 3l I SlOT STOT STOT STOT ! dl).5 Ci12.5 ~ di6.5

40 >to 1.25 u c: P>O.1 G) :::l 1 0 0- G) ... 0.75 -0 (!) D- 0.5 G) > i 0.25 -G) u: WT KO Tg WT KO Tg d12.5 d15.5

Figure. 3. Effect of alteration of TERT expression on PGC frequency. Gonads were isolated from POll5Jl -GFP embryos (wt), Tert-l-/PoIl5JI-GFP embryos (KO), and CAG-TertIPoll5fl -GFP embryos (Tg), at d12.S and dIS.S for FACS analysis ofPGCs. The CAG-TertIPoIl5JI -GFP embryos were generated as described l in the caption to Figure 2. To generate Tert-l-/ POIl5f l-GFP embryos, Tert - mice were first bred with POll5fl-GFP mice to generate mice heterozygous for both the l I Tert null allele and POll5fl-GFP transgene. These Tert -/PoIl5fl-GFP+- mice were then crossed to generate Tert-l-/P Oll5f] -GFP embryos (gonad samples not exhibiting GFP fluorescence were discarded). Tert-l- embryos were identified retrospectively by genotyping. To assess PGC frequency, the percentage of GFP-positive cells per embryo (gonads from the same embryo were pooled) was measured using FACS. The average frequency of PGCs per Tert-l- and CAG-Tert embryo is shown relati ve to the average frequency of PGCs in wt (Pou5fl-GFP) embryos (n ~4 for each strain).

41 A ! di2.S! wt GOIG1 73% GOIG1 75% GOIG1 77% .!! (J.. S/G21M 27% S/G2JM 25% S/G2JM 23%

Propidlum Iodide ! diS.SI wt -- TenKO CAG.TenTg GOIG1 >99% GOIG1 >99% GOIG1 >99% .!! ..(J S/G2IM <1% S/G2/M <1% S/G2/M <1%

'-' '-l Propidlum Iodide

B

Figure. 4. Effect of alteration of TERT expression on cell cycle status of PGCs. A) Analysis by FACS of cycling PGCs from Tert knockout and transgenic embryos. PGCs were analyzed by FACS from either pooled embryos (CAG-TertIPou5fl-GFP and Pou5fl-GFP embryos) or individual embryos (Tert-l-/Pou5fl-GFP) at d12.5 and d 15.5. Samples were fixed overnight and then stained with propidium iodide for I FACS analysis of cell-cycle status the next day. Tert- - embryos were identified retrospectively by genotyping. Sample cell-cycle histograms for PGCs from each strain at d 12.5 and d 15.5 are shown. The percentages of PGCs in the G lIGO (non­ cycling) and S/G2fM (cycling) stages of the cell cycle are indicated (average result from three experiments). B) Analysis of expression of the cell-cycle marker cyclin D I in Tert knockout and transgenic embryos by RT-PCR. Primordial germ cells (n = 500) were analyzed by FACS from d12.5 and d15.5 embryos, as described in A, directly into RT-PCR lysis buffer. The lower panel shows the level of Gapdh mRNA as a control for PCR efficiency and gel loading.

42 CHAPfER 3. SIRT! DEFICIENCY ATIENUATES SPERMATOGENESIS AND GERM CELL FUNCTION

1 1 Matthew Coussens .2, John G. Maresh\ Ryuzo Yanagimacbi , Gregg Maeda\ Richard AIIsoppl.2

I John A. Bums School of Medicine, University of Hawaii, Honolulu, Hawaii 2 Institute for Biogenesis Research, University of Hawaii, Honolulu, Hawaii

Originally published in PLoS ONE, 2008 Feb 13;3(2):eI571.

43 ABSTRACf

In mammals, Sirtl, a member of the sirtuin family of proteins, functions as a nicotinamide adenine dinucleotide-dependent protein deactylase, and has important physiological roles, including the regulation of glucose metabolism, cell survival, and mitochondrial respiration. The initial investigations of Sirtl deficient mice have revealed a phenotype that includes a reduced lifespan, small size, and an increased frequency of abnonnal spenn. We have now perfonned a detailed analysis of the molecular and functional effects of Sirtl deficiency in the genn line of Sirtl knock-out (-/-) mice. We fmd that Sirtl deficiency markedly attenuates spermatogenesis, but not oogenesis.

Numbers of mature spenn and spennatogenic precursors, as early as dl5.5 of development, are significantly reduced (-2-1O-fold less; PSO.OO4) in numbers in Sirtl-/­ mice, whereas Sirt 1 deficiency did not effect the efficiency oocyte production following superovulation of female mice. Furthennore, the proportion of mature spenn with elevated DNA damage (-7.5% of total epididymal sperm; P = 0.02) was significantly increased in adult Sirtl-/- males. Analysis of global gene expression by microlllT8Y analysis in Sirtl deficient testis revealed dysregulated expression of 85 genes, which were enriched (p

To assess the function of Sirtl deficient genn cells, we compared the efficiency of generating embryos and viable offspring in in vitro fertilization (IVF) experiments using gametes from Sirtl-/- and sibling Sirtl +/- mice. While viable animals were derived in both Sirtl-/- X wild type and Sirtl-/- X Sirtl-/- crosses, the efficiency of producing both 2-cell zygotes and viable offspring was diminished when IVF was perfonned with

44 Sirtl-/- sperm and/or oocytes. Together. these data support an important role for Sirtl in spermatogenesis. including spermatogenic stem cells. as well as germ cell function.

45 INTRODUCTION The Sir (Silent Information Regulator) genes were originally discovered in yeast

(Saccharomyces cerevisiae) where they were shown to affect expression of genes, due to their ability to promote heterochromatin, at the HML and HMR mating type loci (107). In lower eukaryotes, Sir2 functions as an NAD-dependent histone de-acetylase (108) and has been shown to have pro-longevity effects (109). Sirt!, a member of the mammalian

Sirtuin geue family, is the best candidate for an ortholog to the yeast Sir2 gene (28, 116) and is capable of de-acetylating a number of protein substrates including, but not limited to, p53 (34) and FOXO transcription factors (37).

Recent studies have demonstrated that Sirtl has a number of important physiological roles in mammals. Most notably, it plays an important role in the regulation of glucose metabolism. Sirtl has been shown to promote gluconeogenesis in the liver

(47) and increase respiration and insulin secretion in pancreatic (H:ells (50). The former process involves deacetylation of FOXOl and PGCl-a by Sirtl (47) whereas the latter process involves Sirtl-dependent suppression of expression of uncoupling protein 2

(DCP2) which uncouples respiration from A TP production in the mitochondria (50). In addition, Sirtl has been shown to protect against oxidative stress in p-cells, thru a process involving deacetylation ofFOXO proteins (111). Furthermore, Sirtl promotes fat mobilization and inhibits fat cell differentiation in white adipose tissue via a mechanism involving interaction of Sirtl with peroxisome-proliferator-activated receptor-y (PPARy) and suppression of the transcriptional activity of PPARy (48). It has been suggested that these and other affects of Sirtl in mammalian cells may act to counter metabolic syndrome, the dysregulation of glucose homeostasis, which becomes more pronounced

46 with age in some mammals including humans (112). SirU has also been shown to have pro-survival effects on neurons. For example, the neuroprotective affect of the mutation in Wallerian degeneration slow (Wid') mice has been shown to be dependent on SirTI

(113). Moreover, Sirtl over-expression has been shown to protect against IJ-amyloid induced death of microglia by a mechanism involving inhibition of NF-KB signa1ing

(114). While the exact nature of the neuro-protective effects of Sirtl on neurons is presently unknown. it likely involve inhibition of apoptosis by the interaction of Sirtl with a number of different proteins involved in the survival response to stress, including p53 (34) FOXO transcription factors (35) NF-KB (115), E2Fl (116), and Ku70 (32).

Sirtl deficient (knock-out) mouse strains have now been developed in a number of independent studies (29, 33, 117). In all strains, SirU deficient mice have a small, feeble phenotype, with significantly increased post-natal mortaIity rates. Sirtl deficient mice also display a number of developmental defects, most noticeably, irregular shaped eyes, evident in embryos as early as dl6.5 (33) with adult mice often failing to open one or both eyelids (29, 33), and defective cardiac septation (33). Initial analysis of the germ line in Sirtl deficient mice has shown marked attenuation in development of the testis, and elevated numbers of abnormal sperm in adult male mice (29). However, in mouse embryonic fibroblasts derived from Sirtl knock-out mice, Sirtl deficiencyactuaIly promotes extension of replicative lifespan, and survival following exposure to genotoxic stress (118). Together these data suggest that the effect of Sirtl deficiency is pleiotropic and dependent on cell type and/or stage of development.

47 In the present study, we have performed a detailed analysis of the effect of Sirtl deficiency on the function of male and female germ cells at the cellular and molecular level. We show that the low number of spermatozoa and atrophied testis in male Sirtl deficient mice is due to effects that manifest at least as early as d155 of development, and correspond with elevated frequency of DNA damage in mature sperm in adult mice.

Microarray analysis of global gene expression in testis from Sirtl deficiem mice reveals aberrant expression of a number of genes that have important roles in spermatogenesis, as well as genes involved in sumoylation. Furthermore, using in vitro fertilization (lVF), we show that both male and female gametes from Sirtl deficient mice have a reduced efficiency at generating viable zygotes, although these zygotes are fully capable of developing to term following embryo transfer to pseudo-pregnant females.

48 MATERIALS AND MEmODS

Mice

The Sirtl knock-out (-1-) strain (33) aud Oct4-GFP transgenic mouse strain (88) were kindly provided by Fred Alt (Harvard University) aud Dr. Jeff Mann (University of

Melbourne) respectively. To generate Sirtl-/- embryos for primitive spermatogenic stem cell analysis. Sirtl +/- mice were bred with Oct4-GFP mice aud then backcrossed to generate SirU +/- mice that were homozygous for the Oct4-GFP transgene. which were then bred together. The mice were fed with a staudard diet aud maintained in a temperature aud light-controlled room (22°C. l4L:lOD; light starting at 0700 h), in accordauce with the guidelines of the Laboratory Animal Services at the University of

Hawaii aud the Committee on Care aud Use of Laboratory Animals of the Institute of

Laboratory Resources National Research Council (DHEW publication 80-23, revised in

1985).

Sperm Count

For aual ysis of epididymal sperm, male mice were sacrificed using cervical dislocation aud the caudal epididymis was dissected out aud cut Epididymal sperm was extracted using forceps aud placed in a droplet of HTF media overlayed with mineral oil.

After capacitation, au aliquot near the top of the droplet was removed, aud sperm were counted using a hemocytometer.

49 Analysis ofPrimitive Spermatogenic Stem Cells

To assess the effect of Sirtl deficiency on early spermatogenic stem cells, we bred

Sirtl +/- mice homozygous for the Oct4-GFP transgene to generate Sirt-/-,Oct4-GFP embryos (see above), which are easily distinguished from Sirtl+/-,Oct4-GFP or

Sirtl +/+,Oct4-GFP embryos on the basis of size (the Sirtl deficient embryos are much

smaller; genotype of all embryos was also confirmed retrospectively by PCR). Gonads

were then isolated from dIS.S male embryos, and single cell suspensions for FACS

analysis of stem cell numbers were generated as previously described (119).

Histology

Tissues were removed from mice and fixed in Bouin's solution overnight. The

following morning, samples were washed in 70% ethanol, dehydrated, and embedded in

paraffm. Six-micrometer sections were prepared on glass slides, cleared in xylenes, and

stained with fresh hematoxylin for 10 minutes, washed, and then immediately stained

with eosin. Following staining, slides were dehydrated in ethanol, air-dried, then mounted

in balsam for microscopic analysis.

In Vitro Fertilization

In vitro fertilization (IVF) experiments were performed using established

protocols (120, 121). Superovulation was induced in female mice by administration of

SID of PMSG followed by SID of hCG 48-S2 hours later. Oocytes were harvested 14

hours post hCG injection, placed in 200ul of HTF media overlayed with mineral oil, and

SO incubated at 37C (120). Sperm was harvested from the cauda epididymis of male donor mice using forceps, placed in 300ul of HTF media, and incubated for 30 minutes to induce capacitation. Capacitated sperm was then co-incubated with the mature oocytes for 2-3 hours. The oocytes were subsequently transferred and washed through several drops of CZB media and incubated overnight at 37C. The next morning, 2-cell embryos were counted and transferred to fresh CZB. Embryos were either transferred into oviducts of pseudopregnant CD-l females later in the evening, or incubated for an additional 3 days in CZB media to assess efficiency of blastocyst development.

Embryo Transfer

Following IVF, surrogate mothers were prepared by mating female CD-I mice in estrus with vasectomized CD-l male mice. Twenty-four hours later, the pseudopregnant

CD-I females were anesthetized aud 2-cell embryos were injected into each oviduct and allowed to develop to term.

Comet Assay

Epididymal sperm was isolated and re-suspended in HTF media. Each sperm sample was then promptly pelleted, re-suspended in low melt agarose at 37C. and applied as a uniform layer on glass slides. Alkaline comet assays were performed according to the manufacturers' protocol (Trevigen, Gathersburg, MD) with minor revisions.

Specifically, 40 mM DTT was added to the lysis solution during initial incubation, without Proteinase K, for one hour. Slides were then further incubated in lysis solution containing 10uglmL of Proteinase K for an additional 2.5 hours at 37°C. Following

51 electrophoresis. slides were air dried over night and then stained in Sybr- Green before microscopic analysis. Only sperm with clearly extended Comet tails (at least 2-fold greater than the average comet tail size) were scored as positive.

Apoptosis Analysis

Whole testis were isolated, fixed in 4% paraformaldehydelPBS solution at 4C over-night solution. Six micrometer thick sections were mounted on silanized glass slides and processed using the Apoptag Plus Peroxidase Apoptosis Detection Kit (Chemicon,

Temecula, CAl according to manufacturers' protocol.

TRAP assay

Testis were snap frozen in liqnid nitrogen and then homogenized using mortar and pestle. Telomerase extracts were prepared using CHAPS lysis buffer. and protein concentration was determined using the Bradford assay. The TRAP assay was perfonned as previously described (79) using 5ug from each sample testis extract.

RNA Isolation and Labeling for Array Analysis

Whole testis were snap frozen in liquid nitrogen, ground with mortar and pestle. followed by extraction of total RNA with Trizol reagent. Quality of RNA for all samples was assessed on 1% agarose gels. Labeled cDNA was generated using the MicroMax

Direct Labeling kit (Perkin Elmer). Briefly. 20ug of each RNA sample was used as template in reverse transcription (RT) reactions using an oligo dT primer. Each RT reaction included either Cy3 or Cy5 conjugated nucleotides to label the cDNA product.

52 Input RNA was hydrolyzed after each RT reaction using NaOH, and eDNA was purified by isopropanol precipitation. The eDNA samples from sibling Sirt1-/- and Sirt1+/- mice

(each labeled with a different fluorophor) were then washed briefly, re-suspended in hybridization buffer (see below), combined together, and immediately used in the hybridization step. eDNA Hybridization and Data Analysis

After a brief rinse in Ix SSC buffer, each array slide was immersed in pre­ hybridization buffer (3x SSC, 25% formamide, 0.2% BSA and 0.1 % SDS) for 30 minutes at 42C. Slides were then rinsed in water, then 95% ethanol, and finally spun dry prior to hybridization. The labeled cDNA probe mixture, re-suspended in hybridization buffer (3x

SSC. 25% formamide. 0.1 % SDS. 0.3ug/ul yeast tRNA), was heated to 95C for 2 minutes just prior to applying to the slide. All hybridizations were performed at 42C over night in sealed hybridization chambers immersed in a water bath. After hybridization, slides were washed in the following solutions. in order, for 15 minutes each at room temperature­

O.sx SSC, 0.01 %SDS, O.06x SSC, 0.01 % SDS, O.06x SSC.

After the final wash step, slides were immediately scanned using a GenePix 4000b array scanner and GenePix Pro 6.0 software, at settings which produced eqnivalent signal in both Cy3 and Cy5 channels and low background. Array data was then transferred to

Acuity 4.0 software for normalization and analysis.

53 Quantitative RT-PCR

Real time RT PCR was performed using a Roche Ught-Cycler, as previously described (119) with the except that lug of total RNA from pooled Sirtl-/- or Sirtl +/­ testis RNA samples (equal amounts of total RNA used from each testis RNA sample to derive the Sirtl-/- and Sirtl +/- RNA pools) was used in the RT reactions. All primer sets used in the PCR step were designed to span a terminal intron and produce an amplicon in the size range of 100-150 bp. The production of a single PCR product was also verified by gel electrophoresis for each primer set.

54 RESULTS

Sirt] deficiency abrogates spermatogenesis

To assess the affect of Sirtl deficiency on germ cell development, we initially examined genn cell number in sibling Sirtl-/- and Sirtl +/- male and female mice. As

shown in Figure 5, histological analysis of ovaries from female mice 9 hours after hCG

injection revealed no substantial deficit in oocyte maturation in Sirtl-/- females. In

addition, no difference in the average number of mature oocytes produced following

superovulation was observed between Sirtl-/- and Sirtl+/- female mice (Figure 5, A

and B), confirming the lack of effect of Sirtl deficiency on oocyte production. In

contrast, histological analysis of testis and cauda epididymis from Sirtl-/- and Sirtl+/­

males showed reduced number of sperm, as well as small and abnonnal seminiferous

tubules (Figure 5, C). Furthermore, the average epididymal sperm count was reduced -10

fold in Sirt-/- mice (Figure 5, D). The frequency of abnonnai sperm, for example spenn

with misshapen heads or spenn lacking a tail, was also elevated in Sirtl-/- mice (Figure

5, E and F), in agreement with previous observations 18. In addition, analysis of the

frequency of apoptotic cells in the testis of Sirtl-/- and Sirtl +/- mice was elevated

(Figure 10). Together, these results show that Sirtl deficiency abrogates spermatogenesis,

but not oogenesis.

We and others (29) have found that male and female Sirtl-/- mice fail to

reproduce when paired with wild type mice (6 out of 6 mating pairs for both male and

female Sirtl-/- mice failed to produce litters when paired with B6D2FI mice). To assess

the effect of Sirt I deficiency on germ cell function in more detail, we utilized male and

55 female gametes from Sirtl-/- and Sirtl +/- mice in in vitro fertilization (NF) experiments to examine the relative efficiency of developing zygotes as well as development to term following embryo transfer to surrogate mothers. We fmd that both sperm and oocytes from Sirt 1-/- mice are capable of fertilization. although the efficiency of developing to the 2-cell stage is substantially compromised for both sperm and oocytes from Sirti-/- mice as compared to gametes from Sirtl +/- mice (Table 1). Nevertheless, we were able to reproducibly obtain live pups when performing NF with Sirtl-/- sperm or oocytes together with gametes from B6D2FI mice. Furthermore, the FI Sirtl +/- mice from these crosses were fertile, and had a general phenotype indistinguishable from that of Sirtl+/- or Sirtl +/+ mice. When performing NF with both Sirtl-/- sperm and oocytes, we are also able to obtain viable FI Sirtl-/- pups. These FI Sirti-/- pups are also capable of surviving to adulthood, and appear to have a similar phenotype to

Sirtl-/- mice generated by breeding Sirtl +/- mice.

Sirtl deficiency effects male gametogenesis during development

We and others have previously shown that the Oct4-GFP transgene is a useful marker for the identification and purification of primitive germ stem cells from mouse embryos (88, 119). Thus, to examine the effect of Sirtl deficiency on early spermatogenic precursors during development, we crossed the Sirtl koock-out strain with the Oct4-GFP transgenic strain to allow identification and purification of spermatogenic stem cells from embryonic gonads. In d15.5 male embryos, we find that spermatogenic stem cells (ie. d15.5 pro-spermatogonia cells) are reduced in numbers by -50% in Sirtl deficient embryos as compared to sibling Sirtl+/- embryos (Figure 6). These data show

56 that the effect of Sirtl on male germ cells is evident at least as early as d15.5 of development.

Sin] deficiency induces elevated DNA damage in male germ cells

Since Sirtl has been implicated in the regulation of expression of telomerase reverse transcriptase (Tert) (106) we examined telomerase activity levels in Sirtl-/- and

Sirtl+/- testis. We did not observe any appreciable effect of Sirtl deficiency on telomerase activity levels in the testis (Figure 11), indicating that accelerated telomere attrition is unlikely to have a major role in the effect of Sirtl deficiency in male germ cells.

Recent studies have implicated that Sirtl may playa role in maintaining genomic integrity (116, 122) in mammalian cells. Therefore, we sought to compare the status of genomic integrity in sperm from Sirtl-/- and Sirtl+1- mice using the Comet assay

(single cell alkaline electrophoresis). As shown in Figure 7, we observed very few sperm

«1 %) with extended comet tails in Sirtl +/- mice, whereas approximately -8% of sperm from Sirtl -/- mice had extended comet tails. These results show that the number of sperm with DNA damage, specifically, the number of sperm with single or double strand

DNA breaks, is significantly elevated in Sirtl deficient mice.

Sin] deficiency effects expression ofgenes involved in spermatogenesis

To assess the effect of Sirtl deficiency on spermatogenesis in more detail, we compared global gene expression for Sirtl-/- and Sirtl+/- testis using spotted

57 oligonucleotide micro array technology (all analyses were performed using the MEEBO oligonucleotide library- microarrays were purchased from Stanford University microarray facility). In this analysis, we performed intriplicate analysis of global gene expression, including dye swap analysis. for 2 pairs of sibling Sirtl-/- and Sirtl +/- mice. We identified a total of 85 differentially expressed genes, with a >1.7 fold change in gene expression, either up or down, in at least 5 of the 6 arrays analyzed (Figure 8; the microarray data from this study may be accessed at the GEO database with accession number (GSE8492)). Analysis of the relative mRNA levels for the top 10 up and down regulated genes (Table 2) by qRT -PCR confinned the differential expression of all these genes (Figure 9), and showed an overall concordance in relative expression levels with that obtained from microarray analysis.

To objectively assess which genes were differentially regulated, we used the gene classification tool Gene Ontology (GO) (123). Gene ontology analysis using GOstat revealed an over-representation of differentially expressed genes in the GO category spermatogenesis ((Hookl, RNFI7, Nasp, Spespl, and Dnajal). Interestingly, genes involved in sumoylation of proteins (SUMOI and SUM02) were also over-represented.

For both the genes involved in spermatogenesis and sumoylation, over-expression was observed in the testis of Sirtl-/- mice (see Discussion section).

58 DISCUSSION

Sirt1 has been shown to have a significant role in the regulation of glucose metabolism and the promotion neural cell survival. In this study, we have examined in detail the role of Sirt1 in germ cell function and gametogenesis using a Sirt1 knock-out mouse strain. We find that both mature sperm and spermatogenic stem cell numbers are

significantly reduced in Sirt1 deficient mice and embryos respectively, whereas oocyte

numbers are not affected. While the fertility of Sirt1 deficient gametes is markedly attenuated, we were able to generate F1 Sirt1-/- mice which survived to adulthood by performing IVF with gametes from Sirt1-/- mice. The deleterious effect of Sirtl

deficiency on sperm numbers is at least in part accounted for by elevated levels of DNA damage, as assessed using the Comet assay. Microarray analysis of global gene expression in the testis from Sirtl deficient mice revealed aberrant expression of a

number of genes involved in spermatogenesis. Together, these data demonstrate that Sirt1 has important roles in spermatogenesis and germ cell function.

While we did not observe an affect of Sirtl deficiency on the ability to produce

mature oocytes, we did notice a marked decrease in efficiency in generating both 2-cell

embryos and live-offspring when performing IVF with oocytes from Sirtl-/- females

(Table 2). We have confirmed that Sirt1 is expressed in oocytes (data not shown), and

therefore, these results suggest Sirt1 may playa role in fertilization andlor early stages of

embryogenesis. Nevertheless, the ability to generate live offspring utilizing gametes from

both Sirtl-/- males and females (Table 1 and reference 117) clearly shows that Sirt1 is

59 not essential for embryogenesis. Whether the survival of these FI Sirtl deficient embryos is due to compensation by other Sirtuins or other proteins remains to be assessed.

The observation that Sirtl deficiency causes a reduction not only in the numbers

of mature sperm in adnlt mice (Figure 5) but also in numbers of spermatogenic stem cells

(Figure 6) from d15.5 male embryos indicates that Sirtl may have important roles in

certain types stem cells. Based on recent observations by us and others, we predict that

the exact nature of the effect of Sirtl deficiency will likely be lineage dependent For

example, while Sirtl deficiency attenuates spermatogenesis, mouse embryonic fibroblasts

deficient in Sirtl exhibit enhanced survival in response to genotoxic stress and the ability

to bypass cell senescence (118). Furthermore, we have observed enhanced survival and

growth potential of HSC from Sirtl deficient mice during culture in cytokine deprived

media, and negligible differences in numbers of HSC between young Sirtl-/- and

Sirtl +/- mice (unpublished observations). Thus Sirt! likely has different functions in

different cell types, including stem cells.

Global analysis of gene expression revealed an over-representation of genes in the

GO categories of spermatogenesis and protein sumoylation. The former observation is in

agreement with the reduced sperm count and increased frequency of abnormal sperm and

DNA damage in sperm from Sirtl deficient mice. Most of the differentially expressed

genes involved in spermatogenesis were over-expressed in the testis of Sirtl deficient

mice. Sirtl has the potential to promote transcriptional silencing, for example by

deacetylating and inactivating the transcription factors p300 and FOXO proteins (124,

41). Therefore, the effect of Sirtl deficiency on expression of genes involved in

60 spermatogenesis in the testis could be a direct affect at the level of transcription.

However, the expression of a number of these genes occurs predominantly at specific stages of spermatogenesis. For example. Hookl is expressed predominantly in spermatocytes and round spennatids (125) and Nasp is predominantly expressed in spermatocytes (126). Thus a possible affect due to altered cellularity, the relative numbers of different types of spermatogenic precursors, in the testis of Sirtl deficient mice on differential expression of these genes cannot be presently ruled out. It will be of interest to assess whether Sirtl regulates transcription of genes involved in spermatogenesis and/or alters the proportions of spermatogenic cells in the testis, perhaps by causing a block at a specific stage of spermatogenesis, in future studies.

Interestingly, genes involved in the sumoylation of proteins, the addition or removal of small ubiquitin-like modifiers (SUMO) to proteins, are also over-represented in the genes differentially expressed in Sirtl deficient testis. Recent studies have suggest that Sirtl can affect the sumoylation of certain proteins via a mechauism where the deacetylation of specific Lys residues by Sirtl allows the subsequent addition of SUMO by other proteins (124, 127). It is possible that, the over-expression of SUMO-l and

SUMO-2, both of which are capable of adding SUMO to other proteins, in the testis of

Sirtl deficient mice may be a compensatory response to promote the sumoy1ation of specific proteins in the testis in the absence of the deacetylase activity of Sirtl. The exact role of Sirtl in the regulation of sumoylation of proteins in spermatogenic cells, and the relevance of this to spermatogenesis, remains to be addressed.

61 Results from recent studies on the ability of Sirtl-/- mice to successfully mate and produce offspring with other mice are incongruent. A study by McBurney et al (29) and the results presented here suggest that Sirtl-/- mice are infertile. in that they cannot successfully mate with other mice. are at least that fertility is severely compromised by

Sirtl deficiency. However. Gu et al have recently reported that Sirtl-/- mice. both males and females. can generate offspring by mating with wild-type mice (117). While the reason for this discrepancy is not presently understood, it is unlikely to be accounted for by the expression of different dysfunctional versions of Sirtl in the different Sirtl knock­ out strains. since both the strain used by Gu et al (117) and that used in our study were derived from the same Sirtt knock-out ES cell strain (Exon 4 of the Sirtl gene is deleted in both strains) (33). One possible explanation is hybrid vigor. since the Sirtl-/- strain used by Gu et al was on a 129SvJ/C57BL6 background (117) whereas the strain used by

McBurney et al was on a l29/J background, and the Sirtl-/- mice used here had been back-crossed onto a C57BL6 background. Nevertheless. our ability to generate viable offspring using IVF with Sirtl-/- gametes. in both Sirtl-/- X wild type crosses and

Sirtl-/- X Sirtl-/- crosses (Table 2). shows that Sirtl-/- mice (at least those derived from Sirtl +/- X Sirtt +/- crosses) are not sterile, in agreement with the results of Gu et al. Furthermore. the observation that viable F2 Sirtl-/- mice may be readily generated using IVF (Table 2) shows that assisted reproductive technologies may be a practical method to study the long term effect of Sirtt deficiency. across multiple generations of

Sirtt-/- mice. on development and aging.

62 ACKNOWLEDGMENTS

We thank Dr. Fred Alt for providing the Sirtl knock out mouse strain, Ryuzo

Yanagimachi for help with histology, Yuki Yamazaki with help in spermatogenic stem cell analysis, and Ralph Shohet for help with oligonucleotide microarray analysis of gene expression, Alex Gurary for assistance with FACS, and Melissa Nagata for excellent technical support.

AUTHORCO~UTIONS

Conceived and designed the experiments: MC 1M. Performed the experiments:

RY RA MC GM. Analyzed the data: RY MC. Contributed reagents/materials/analysis tools: 1M. Wrote the paper: MC.

63 Table 1. Analysis of Germ Cell Function using In Vitro Fertilization

64 Table 2. T op 10 up and down regulated di fferentially ex pressed genes in testis UPREGUL AT ED

Gene Function Fold change 1. Kif3a kinesin family member 3A 3.S<2>t 2. EirSh eukaryoti c translation initiation ntctor 511 3.1 3. Vwc2 von Willebrand factor C domain co nt a inin~ 2 3.0 4. Hookl hook I homolog (Drosophila); ahnorm,,1 spermatozoon head shape 2.9<2> S. Nasp IUUS musculus nuclear autoHnti gcnic sperm protein (histone-binding) 2.9 6. Sucla2 succi nate-Coenzyme A li gase. ADJ'-forming, J3 ·subunil 2.7 7. I'relp proline/ar ginine-rich e nd leucine-rich repeat protein 2., 7- H. Khdrbs l KH domain containing, RNA binding. signal transducti on associated I -. ~ 9. Dnaja 1 mus musculus DnaJ (Hsp40) homolog. subfamily A, member I 2.5<2> 10. Ns bpl nu clcosome hinding protein I 2.4

DOWN-REGULATED Gene Function Fold change 1. Spesp 1 sperm equatorial segment protein I 4.0 2. SLC9al solute carrier ramil) 22 (anion transporter) I 3.9 3. SPIN-2 spindlin-like protein 2 3.6 ~. Strn~ calmodulin binding protein ~ 3.0 S. Mgst2 microsomal glutathinne S-transferase 2 3.0 6. Tmod4 mus musculus tropomodulin ~ 2.9 <2> 7. I nterleukin3 Cltokine 2.6 8. Gfer growth factor, en 1 (S. cerc\isiae)-like (augmenter of Iher regeneratiun) 2.5 9. Slc22a7 solute carrier family 22 (anion transporter) 7 2.~ 10. Klhl8 kelch-like 8 (Drosophila) 2.3 10. FX)d5 FXYO domain-containing ion transport regulator 5 2.3 <2> t- Number in parentheses is included for genes represented o n the array by more than I feature, and represent s the number of fea tures for that gene yielding a consistent pattern of differential expression across 5 or more arrays.

65 Figure 5. Sirtl deficiency effects spermatogenesis, but not oogenesis.

A. Cross section of ovaries from sibling female Sirtl +/- and Sirtl-/- mice following superovulation. Mature oocytes are indicated by arrowheads. B. Average number of oocytes for female Sirtl +/- and Sirtl-/- mice (n =10; P>O.I). C. Cross section of testis and epididymis from sibling male Sirtl +/- and Sirtl-/- mice. D. Average number of sperm from the cauda epididymis for male Sirtl+/- and Sirtl-/- mice (n =3 sibling pairs). P values for comparison of average counts (student's t Test) are shown. E. Analysis of spenn morphology. Total epididymal sperm were fixed to slides and stained with Diff-Quik staining media. Sperm with misshapen heads are indicated by arrowheads. F. Frequency of abnormal sperm from epididymis of Sirtl-/- mice. The number of abnormal sperm for Sirtl +/- mice was «1 %. In all analyses, mice were 8 weeks of age.

66 A B

E 25t-..-'-+--i :::Jo "

D

:f' 0 ~ ~ c: -:::J 0 E" ~ Q. (/)'" 2 0

E _/_ ,..:...... ---..,.-- • .- [}-. •

+/- F

, • , , • Abnormal ' . , , .' . .. Normal " , , ,

, ~ < " , ' " " • " '.' " • , . , , . , . KO 67 A d15.5 B Sirt1 +1- >- u 1. 0{) c 0 Q) P=O.OO4 .....:l ~ 1.25 CI.:l 0- ~ .....Q) 1.0 -0 <..9 0.75 GFP a.. Q) 0.5 Sirt1 -1- > 1UO.25 0{) 0 Q) .....l 0::: ~ +/- -/- ~

GFP

Figure 6. Spermatogenic stem cell numbers are reduced in Sirt I deficient embryos.

A. Sirtl+/- mice were back-crossed with Oct4-GFP transgenic mice to generate Sirt1 +/­ mice that were homozygous for the Oct4-GFP trans gene. These mice were then bred. and gonads were isolated from d 15 .5 male embryos. Single cell suspensions were prepared for each gonad sample. and the frequency of GFP+ cells was assessed using FACS (see Materials and Methods and reference 11 9 for further details). The genotype of each sample was confirmed retrospectively using PCR. Sample FACS plots for a Sirtl-/- and sibling Sirt I +/- male embryo are shown. B. Average frequency ofGFP+ cells per embryo fo r Sirt l+/- or Sirtl+/- or Sirtl+/+ embryos (Sirtl-/-. n = 4; Sirtl+/- and Sirt 1+ /+. n = 8). Note. no significant difference in GFP+ frequency was observed for Sirtl+/- and Sirtl+/+ mice (data not shown).

68 A B Sirt1-/- 10 ....------,

J: - 9 -1------1 _ '#. P=O.02 .- - ~ VI 8 -I-----=F-- --1

...E= ~ 7+--­ Q)- Co Q) 61---- CI) -E '08 5 +--- :>. g -g 4+--- Q)"C ::::J !: 3 +--­ C"Q) ...Q)­ >< 2+--­ LLW 1t---- o +/- -/-

Figure 7. DNA damage is elevated in sperm from Sirt I deficient mi ce.

A. Im age of sperm nuclei from Sin I +/- and Sirt 1-/- mice stained with Syhr-Green fo ll owin g sin gle cell alkaline electrophoresis (Comet assay). The Comet assay was performed usin g the Trev igen comet assay kit. Sperm with extended comet tail s are indicated with arrowheads. B. Frequency of sperm with ex tended Comet tails for pairs of sibling Sirtl+/- and Sirt l-/- mi ce (n = 2).

69 Figure 8. Heat map representation of differentially expressed genes in the testis of Sirtl deficient mice.

Rows represent genes and columns represent array comparisons of Sirtl-J- and Sirtl+J­ RNA samples as indicated. Green indicates genes that are up-regulated in the Sirtl-J­ testis samples. Columns labeled in blue are analyses done using dye reversal. Only differentially expressed genes showing an average of 1.7 or greater fold change in expression across at least 5 of the 6 arrays analyzed are included in this analysis

70 Sib Pair 1 Sib Pair 2 12 3 4 6

> -6.99

71 14~------~ :r 12~---r------r------r-~ + • -Array ~ 10+-;--.----;------; ~ ~~ (j) 8

I 6 -"l' 4 2

I: o o III 2+------III III ...<» 4+------Q. 6+------~~----- x W <» 8+------__ ------> 10+------~----~~------~ ~ <» 12+------~------~ a:: 14+------~ 16~===;==~~;=~~==;=====;=~~ Up-regulated Down-regulated

Figure 9. Quantitati ve RT-PCR analysis or the expression o rthe top 10 up and down regul ated genes in the testi s o f Sirt I deficient mi ce.

T he relati ve expression level of the to p 10 di fferentiall y ex pressed genes, both up and down regul ated (see Table 2), was assessed lI sin g real-time RT-PC R fo r the Sin 1-/- and Sin I +/- RNA samples. All PCR primers were designed to fl ank the most 3' intron, and were shown to yield a single PCR product in the size range or 100- 150 bp. Each analys is was performed intriplicate, and error bars representing standard deviati on are shown. Ex pression level for qRT-PCR analysis is shown relative to the level of ex pression of HpI1 .

72 A B Sirt1+/- ~100 ~, 9. ~, ~ 8. . ~ i ~ ,. ~ u.. 6. .!1 '0 50 "0 4. ~ 3C '0 ~ ,. ,•~ ,. ~ ~ ~

Sirt1-/- ~ .,

Fi gure 10. Numbers 01' Apoptoti c Cell s is Increased in Sirt l De fi cient Testi s.

Testi s fro m Si n I +/- and Sin 1-/- mi ce were dissected, fi xed, embedded in paraffin , and sectioned. The sections were then stained for apoptoti c cell s using the ApoTag kit (Chemicon- C HECK). A. Sample images of stained sections from Sirt 1-/- and Sirt 1+/­ micc arc shown. Apoptotic cell s arc indicated by arrowheads. B. Quantitati ve analysis o f rhe number of apoptoti c cells per scminiferous tubule. The number of tubules in Sin 1-/­ testi s with no detectable apoptOli c cells was < I %.

73 A ,c...... B Pair 1 Pair 2 § 100"",---~ -/- +/--/- +/- (j . +/- 1----1 -.-1/1 -/- -c: . :::s ->- 70 i---ll--+---t -: ~ 60 :I.- 50 I II d) 1/1 40 I I ~ Q) ,I II E o ,I II ....'ii ,I II ,I II

Figure II. Telomerase Activity is not Affected by Sirtl Deficiency in the Testi s. Telomerase activity is not affected by Sirt I deficiency in the testis. Extracts were prepared from testis from Sirtl-/- and Sirtl+/- mice and telomerase activity was measured using the TRAP assay according to manufacturers' protocol (TRAPeze Kit; Chemicon). A. Sample blot showing TRAP assay results for testis samples from sibling Sinl-/- and Sirtl+/- mice. The internal control peR product is indicated by the arrowhead. B. Quantitative analysis of telomerase activity. The level of telomerase activity was assessed for Sittl-/- and Sinl+/-testis samples according to manufacturers' protocol. The bars represent average results from intriplicate analyses of testis samples from 3 pairs of sibling Sirtl-/- and Sirtl +/- mice (all 8 weeks of age). Error bars representing standard deviation are shown .

74 CHAPTER 4. SIRTI ACTS AS A NUTRIENT-SENSITIVE GROWTH SUPPRESSOR

AND ITS LOSS IS ASSOCIATED WITH INCREASED AMPK AND TELOMERASE

ACTIVITY

Sw~ R. Narala*, Richard 5. Allsoppt, Trys~ B. Wells", Guangle\Zhang*, Prema Prasad, Matthew J. Coussens ,Derrick J. Rossi, Irving L. Weissman, and Homayoun Vaziri"

*Ontario Cancer Institute, Departmen! of Medical Biophysics, University of Toronto, Toronto, ON, M5G-2M9, Canada; Stanford Institute for Stem Cell B{ology and Regenerative Medicine, Stanford University, Stanford, CA 94305; and Institute for Biogenesis Research, University of Hawaii, Honolulu, HI 96813

Originally Published in Molecular Biology of the Cell, 2008 Mar; 19(3): 1210-9.

75 ABSTRACT Sirtl, the mammalian homolog of SIR2 in Saccharomyces cerevisiae, is an NAD- dependent deacetylase implicated in regulation oflifespan. By designing effective short hairpin RNAs and a silent shRNA-resistant mutant Sirtl in a genetically defined system, we show that efficient inhibition of Sirtl in telomerase-immortalized human cells enhanced cell growth under normal and nutrient limiting conditions. Hematopoietic stem cells obtained from Sirtl-deficient mice also showed increased growth capacity and decreased dependency on growth factors. Consistent with this, Sirtl inhibition was associated with increased telomerase activity in human cells. We also observed a significant increase in AMPK levels up on Sirtl inhibition under glucose limiting conditions. Although Sirtl suppression cooperated with hTERT to promote cell growth, either overexpression or suppression of Sirtl alone had no effect on life span of human diploid fibroblasts. Our findings challenge certain models and connect nutrient sensing enzymes to the immortalization process. Furthermore, they show that in certain cell lineages, Sirt I can act as a growth suppressor gene.

76 INTRODUCTION

Loss of silencing of mating type loci in Saccharomyces cerevisiae (128, 40) led to discovery of a gene named MARl (mating-type regulator 1; 129) also known as SIR2

(silent information regulator 2 (130). Increased dosage of SIR2 extends replicative lifespan in certain strains of S. cerevisiae (131) and increases longevity of

Caenorhabditis eZegans (132). Studies also have shown that CR (calorie restriction) may mediate lifespan extension through SIR2 (133) or HST2 (134). However, newer studies have challenged these notions and shown that CR-dependentreplicative lifespan extension occurs in a SIR2IHST2-independentmanner (135, 136).

In the case of chronological lifespan in yeast, SIR2 mediates the opposite effect

(limiting lifespan). In one study, deletion of SIR2 promoted chronological lifespan extension under CR (137). Early studies on SIR2 of S. cerevisiae suggested that SIR2 has an ADP-ribosylating activity in vitro (138). This subsequently led to uncovering an activity capable of deacetylating synthetic acetylated histone substrates in vitro (109), generating O-acetyl ADP-ribose (139, 140). The in vivo deacetylation targets of mammalian SIR2 homolog (Sirt!) are nuclear factors such as p53 (141-144), FOXO (35,

145), Ku (146), acetylatedhistones (147), and nuclear factor (NF)-dJ (116).

More recently novel activators of Sirtl such as mCl and AROS have also been identified that activate Sirtl and promote deacetylation of its targets such as p53 (148,

149). Sirtl is also suggested to act as a nutrient sensor in response to caloric restriction

(32, 145). In S. cerevisiae, Sir proteins have been shown to have critical roles in response

77 to DNA damage and are mobilized from telomeres to sites of DNA strand breaks (150.

151) and are involved in maintenance of telomeric silencing (152). Synthesis of de novo telomere repeats is achieved by telomerase an enzyme originally detected as an RNP

(ribosenucleotide protein) complex in Tetrahymena (153) and subsequently in human cells (154). The mammalian telomerase is composed of a reverse transcrlptase cataIytic subunit (hTERT) (155. 156. 69) and an RNA template (hTR) (157). Inactivation of telomerase in Mus musculus has revealed roles in cell survival and maintenance of genomic integrity via telomere maintenance (70. 158). Telomere maintenance and regulation in mammals is achieved by collaborative effects of telomerase and telomere­ binding proteins (159). Protective effects of telomeres on chromosome ends may be achieved via function of specialized protein complexes including TRF11IRF21I'IN2 (160) and other single-strand G-rich telomere-binding proteins such as Poll that regulate accessibilityoftelomeres to telomerase (161.162). Human diploid fibroblasts have a finite lifespan and undergo senescence upon completion of a fixed number of cell doublings (19). At least a part of this molecular clock is thought to operate through telomere erosion or dysfunction with each division in normal cells that ultimately triggers initiation of cellular senescence (163). Consistent with this model telomerase is reactivated in immortal human cells (80. 164).

Further direct findings indicate that reconstitution of telomerase activity in vivo in primary mortal human fibroblasts causes bypass of senescence and leads to cell immortaIity (34. 76). Consistent with this model. human germ cells maintain their telomeres (165). and human embryonic and adult hematopoietic stem cells express

78 telomerase (166). This telomerase activity in hematopoietic stem cells is not sufficient to prevent telomere shortening and may confer a finite self-renewing capacity (167).

Telomerase has since been widely used as a marker for identification of human pluripotent stem cells (168).

Here we investigate the role of Sirt! in regulation of replicative life span and cell growth in primary. telomerase-immortalizedhuman cells and murine hematopoietic stem cells under normal and nutrient-limiting conditions. We designed effective short hairpin

RNA (shRNA) constructs that are able to reduce Sirt! protein expression significantly.

By suppressing endogenous Sirt! in human cells we show that Sirt! can negatively regulate cell growth. and this is associated with an increase in telomerase activity levels.

Extension of these findings to an animal model indicates that hematopoietic stem cells from mice lacking Sirtl show a greater proliferative capacity under conditions of stress.

We propose that Sirtl is a nutrient-sensitive growth suppressor in certain cell types.

Therefore our fmdings have implications for growth of normal and immortal cells.

79 MATERIALS AND MElHODS

Cell Culture and Cell Lines

All cell strains were grown either in DMEM + 10% fetal bovine serum (FBS) in

6Q-.l00-mm Petri dishes (Greiner. Frickenhausen, Germany). A rapid plasmid-based system (142) was used to generate all retroviruses (lmgenex. San Diego. CA). In brief. pSRP (pSUPER-Retro-Puro). pSRP-shSlRTl(HS6). pSRP-shSlRTl (HS 11) and pSRP­ shControl. pBabe-Ires-Neo. pBabe-Ires-Neo-SlRTl-R. and pBabe-puro-wtSlRTl vectors and packaging plasmid (Imgenex) were transfected into 293T cells using Fugene 6. and supernatants were used to infect the target cells carrying mCAT!. Cells were typically infected with pSRP-based viruses at multiplicity of infection (MOl) of ~O. two times sequentially and subsequently selected in 1 f.lglml puromycin or 200-400 f.lg of G418.

Wild-type or SlRTI-R viruses were put in at A:2-5 MOl.

Cell Culture in Absence ofNutrients

Initially. cells were grown in growth medium (H21 medium, Invitrogen, Carlsbad,

CA; cat no 12800) with 10% FBS (Invitrogen) under low density in 60-mm dishes.

Twenty-four hours later. the exponentially dividing cells were washed once with phosphate-buffered saline (pBS; -Ca and -Mg). Media on the cells was subsequently changed with 4 ml of .,...MEM without glucose and serum (89-5118EF. Invitrogen, with base media to which aspargine, arginine. methionine. isoleucine. L-valine. and ascorbic acid with antibiotics were added; ocr. Toronto. Ontario. Canada, Media Department).

Duplicate dishes were used to estimate the total number of cells in the plates. For each

80 cell line the cells were trypsinized, neutralized by addition of a-MEM without glucose with 2% PBS, and counted on a hemocytometer using trypan blue exclusion. The average live cell count was then calculated. Cell counts were performed every 24 h after the addition of the <>:-MEM without glucose. Cells were collected at different time points (0,

4, 8, 12, and 15 h) after addition of a-MEM without glucose and subjected to lysis as described below under immunoblotting.

Telomerase Assays

TRAP (telomere repeat amplification protocol) assays were performed as previously described (169). Typically, within 2-10 population doublings (PDs) after selection, CHAPS lysates were prepared from cells, and aliquots were frozen. For rescue experiments cells from IOId'D 93 were used to prepare lysates. On thawing, the lysates were subjected to protein quantification using the quick-start Bradford assay system (Bio­

Rad, Hercules, CA). Twenty-six--cycle PCR-TRAPs were performed in Jinearrange of the assay using 50-300 ng of total protein lysate per reaction. TRAP products were resolved on 15% polyacrylamide large gels and exposed to phosphorimager screens.

Design ofSirt] shRNA Expression Vectors, shRNA-resistant Silent Mutant

More than 12 shRNAs were designed to find the most effective set. The most effective we developed was HS6 (Qiagen, Chatsworth, CA). The second sequence

(HS 11) was based on a published sequence (170).

81 The Sirtl sbRNA sequences (bold) used as insert in pSRP (pSuper-Retro-Puro.

OligoEngine. Seattle. WA) vector were as follows: HS6:

GATCCCCAGCGATGTTTGATATTGAATTCAAGAGATTCAATATCAAACATCGC

I"I'I'I"I IA. HSll:

GATCCCCGATGAAGTTGACCTCCTCATTCAAGAGATGAGGAGGTCAACTTCA

Tell IlIA.

The control sbRNA sequence was as follows:

GATCCCCTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAG

AAI I I I IA.

A PCR-based strategy was used to introduce six silent mutations in the Sirtl

region targeted by the HS6 shRNA (for sequence. see Supplementary Figure lA). The

resulting mutant named SIRTl-R was subcloned in the PBabe-INeo vector. This vector

PBIN-SIRTl-Rand the backbone (pBIN) were subsequently used to infect puromycin­

resistant target cells expressing pSRPshControl and pSRPshSIRTl(HS6) for a genetic

rescue experiment.

lmmwwblotting

Cells were harvested by trypsinization (0.05%) and neutralized with either

DMEM + 10% FBS (for nutrient experiments. MEM without glucose + 2% FBS). Cells

were spun and washed in PBS+twice. and the pellets were lysed in 0.5% NP40. 150 mM

NaCl. and 50 mM Tris in presence of Ix complete miniprotease inhibitor mix (Roche.

Indianapolis. IN; lOx stock, I tablet in 10 ml water). for 30 min with occasional

82 vortexing. Celllysates were centrifuged at 12,000 rpm for 20 min at 4°C. Protein content of lysates was measured by Bio-Rad Quick Start protein assay (500-0201). Protein, 10-

50 Jlg, was resolved on NuPAGE (Novex, Encinitas, CAl 4-12% Bis-Tris gradient gels, transferred to PVDF membranes (Bic-Rad) and blocked in 5% skim milk. The membrane was incubated in: 1:5000 dilution for anti-Sirtl (142), 1:500 for 2 h for hTERT (Santa

Cruz Biotechnology, Santa Cruz, CA; H-231: SC-7212), 1:20,000 for f3-actin (Abeam,

Cambridge, MA) 10-20 min, 1:2000 dilution of Phospho-AMPK-a(ThrI72)(40H9) and total AMPK-Q (23A3) (Cell Signalling, Beverly, MA; kit 9957) for 2 h. For AMPK experiments membranes were first immunoblotted with total anti-AMPK.... antibody, and the levels were measured. To prevent residual carry over, the membrane was subsequently stripped and after testing for clearance was subjected to the phospho-AMPK-Q antibody for detection of active form.

The membrane was washed twice in 0.05% TBST buffer for 20 min. Peroxidase conjugated AffinPure goat anti-rabbit horseradish peroxidase IgG (H+L) secondary antibody or anti-mouse (Jackson ImmunoResearch, West Grove, PAl were used at a concentration of 1:30,000 for 45 min in 1% milk was used. After washing, the membrane was then incubated with Super signal west, dura, orfemto maximum substrate (Pierce,

Rockford, IL) for 2 min and exposed to film for up to 30 min.

Chromatin Immunoprecipitation

7 Cells (10 ) were cross-linked in plates by addition of 1% formaldehyde for 10

min, followed by the addition of glycine to a final concentration of 0.125 M to stop the

83 7 cross-linking reaction. Hela-pSRP-controlshRNA and Hela-pSRPshSIRTI cells (n = 10 ) were used per immunoprecipitationreaction mixture. Cells were washed twice in PBS and lysed in 1 ml of cell lysis buffer (S mM PIPES. pH 8.0. 8S mM KC1. 0.5% NP-40. Ix protease inhibitors) on ice for 10 min. The nuclei were pelleted at SOOO rpm and lysed in nuclei lysis buffer (SOmM Tris. pH 8.1.10 mMEDTA. and 1% SDS. including protease

inhibitors on ice for 10 min. The chromatin was sonicated eight times. IS s each on ice.

The samples were precleared by incubating with 20 III of blocked protein G agarose beads (Roche) containing 1.S I1g of sea urchin sonicated sperm DNA for IS min. The protein-chromatin complexes were incubated with no antibody. 3 III of antiacety1ated histone H4 antibody (06-866; Upstate Biotechnology. Lake Placid, NY). anti-SIR2 antibody (2111). or rabbit serum (2111) at 4°C overnight. Each reaction mixture was then incubated with 20 III of protein G beads for 30 min at room temperature. The protein G agarose beads were pelleted, and the supernatant from the no-antibody sample was used as total input chromatin (input). The protein G agarose pellets were washed twice in

dialysis buffer (2 mM EDTA. SO mM Tris. pH 8.0) and four times in

immunoprecipitation (IP) wash buffer (100 mM Tris. pH 9.0. SOO mM LiCI. 1% NP-40.

1% deoxycholic acid). The protein-cbromatincomplexes were eluted from the protein G

agarose beads twice in IP elution buffer (SO mM NaHCClJ. 1% SDS). followed by reverse cross-linking in 0.3 M NaCl along with Il1g of RNase-A at 67°C for S h. The reactions

were precipitated with 2.S volumes of ethanol at -20°C overnight. The reaction mixtures were then centrifuged at 13.200 rpm for 20 min, and the pellets were air-dried and resuspended in 100 III ofTris-EDTA-proteinase K buffer (final reaction concentrations.

10 mM Tris. pH 7.5. S mM EDTA, 0.2S% SDS. and proteinase K (1 U) and incubated at

84 45°C for 2 h. Subsequently, the samples were purified by phenol-chloroform extraction.

NaCl (final concentration of 0.14 M), and 2.5 volumes of ethanol were then added, and the samples were allowed to precipitate overnight at -20°C. The samples were centrifuged at 13,200 rpm for 20 min, and the pellets were air dried and resuspended in

50 1-11 of water. Two microliters of the purified DNA was used for each PCR. In addition the input DNA was diluted 1:20, and the same volume was used in the PCR reaction. The

PCR was performed with the following primers: Forward: 5'-acgtggcggagggactg, and

Reverse: 5' -gccagggcttcccacgt.

PCR conditions were as follows: 94°C for 3 min, followed by 32 cycles at; 94°C for 0.45 min; 65°C for 0.30 min; and 72°C for 0.30 min. The ChIP (chromatin immunoprecipitation) PCR products were analyzed on a 2% agarose gel and analyzed using the Bio-Rad imaging system.

Population Doubling Assays

Primary BJ cells infected with pSRPshControl and pSRPshSlRT1(HS6) were grown in DMEM + 10% PBS and were subjected to a standard replicative lifespan assay.

Late passage BJ fibroblasts strain -7 PDs away from senescence was infected with pM­ hTERT-lRES-EGFPvector(MSCV-based vector, Weinberg lab). Inunediately aftergreen fluorescent protein (GFP) was expressed these BIT cells were either infected with pSRP, pSRP-shControl, or pSRP-shSIRT1(HS6) viruses. After selection in Il-1g of puromycin for 4 d, the resistant cells were split and grown for a standard population-doubling analysis.

85 RT-PCR Analysis

For RT-PCR analysis, Trizol reagent was used to purify total RNA from cells.

Frrst-strand eDNA synthesis was perfonned as described by manufacturer (Amersham

Biosciences, Piscataway, NJ). The sequence of primers used is described elsewhere (69).

The resulting eDNA were quantified on a Tumerfluorometer, and equal DNA amounts were used for the PCR amplification. PCR amplification was performed using 25 eycles

in presence of a 32p_Iabeled forward hTERT primer. Products were resolved on 15% polyacrylamide gels and exposed to phosphoimager screens, and bands were quantified

using Image Quant (Molecular Dynamics, Sunnyvale, CAlAmersham). hTERT siguals

were normalized to the GAPDH sigual. Quantitative-PCR on an ABI 7900HT sequence

detection system (Applied Biosystems, Foster City, CA) with SYBR Green chemistry

(Qiagen). The cDNA preparation was similar to that of RT-PCR use; however, the

template was used at a final concentration of 500 ng/reaction in a 20 "I total reaction

volume. Each sample had been run through the Q-PCR (quantitative PCR) analysis in

triplicate on freshly synthesized cDNA, using a no-template negative control for each

sample set of cDNA and primers. Each 20-,,1 reaction contained 10 "I of SYBR Green

master mix, 2 "I of template cDNA or water, 1 "I of forward and reverse primer mix at

0.6 "M each/reaction, and 7 "I of nuclease-free water.

Hematopoietic Stem Cell Analysis and Culture

The SirU knockout strain (from Dr. Fred Alt, Harvard Medical School) was back­

crossed five times onto a C57BL6 background before performing this study. In all

86 experiments. young mice (3-9 wk old) were used. Mice were fed with a standard diet and

maintained in a temperature- and light-controlled room (228C. 14L:IOD; light starting at

0700 h). in accordance with the guidelines of the Laboratory Animal Services at the

University of Hawaii and the Committee on Care and Use of Laboratory Animals of the

Institute of Laboratory Resources National Research Council (DHEW publication 80-23.

revised in 1985). The protocol for animal handling and treatment procedures was

reviewed and approved by the Animal Care and Use Committee at the University of

Hawaii. Hematopoietic stem cells (HSCs) were analyzed using flow cytometry as

previously described (171-173). Briefly. whole bone marrow (WBM)was flushed from

the tibia and femur bones. and cells were stained with antibodies to c-Kit, Sea-I. plus a

lineage cocktail. as well as either antibodies to FIk2 and CD34. or CD150 (SLAM). All

analysis and cell sorting was performed on a FACS Aria (Becton-Dickinson). For HSC

culture. complete media cousisted of X-Vivo 15 media (BioWhittaker. Walkersville. MD)

plus 5 x 10-5 M 2-mereaptoethanol. Steel factor (10 ng/ml). IL-3 (30 ng/ml). IL-6 (10

ng/ml). IL-ll (10 ng/ml). Tpo (10 ng/ml). and Flt3 ligand (10 ng/ml). Cells were cultured

in standard tissue culture incubators at 5% CCh.

87 RESULTS

Inhibition ofSirt1 and Telomerase Activity

Low hTERT-expressing primary human BIT diploid fibroblasts. Hela cells. and

Lovo cells were infected with pSRP-shSIRTl(HS6).pSRP-ShSIRT1(HSll). and pSRP­ shControl (a control shRNA). Cells were selected in puromycin and kept under selection for the remainder of experiments. Sirtl expression was effectively reduced to varying degrees in all cell types by shSirtl (Figure 12. A-D). The HS6 shRNA was more effective thanHSll (Figure 12. D). In all cell lines in which Sirt1 shRNA was stably expressed, we observed an increase in telomerase activity as measured by TRAP (Figure

12. E-G). As an additional control we ran the TRAP reaction in the presence of an internal control for which similar results was observed (Figure 12. H). Furthermore. in order to rule out the possibility of off-target effects. we took two strategies. FIrSt, we used a second shRNA (HSll) for Sirt1 suppression (Figure 12. D and I). and most importantly we designed a shRNA-resistantSirtl gene. (SIRTl-R) in which we introduced six silent mutations in the region targeted by HS6. Expression of this shRNA-resistant mutant

(Supplementary Figure 1B) of Sirt1 in BIT cells blocked the ability of shSIRTl(HS6) to induce telomerase activity (Figure 12. J). It is noteworthy to mention that we found that higher than physiological quantities of wild-type Sirt1 or a SIRTlH363Y mutant can lead to enhancement or suppression of telomerase activity. respectively (Supplementary

Figure 16. C). Hence by using two independent shRNAs and a genetic rescue experiment we show that Sirt1 suppression is associated with an increase in telomerase activity and is not due to off-target effects.

88 Sirt] Suppression and hTEKI'

To determine the mechanism through which Sirtl suppresses hTERT activity. we performed RT-PCR and immunoblotting in shSirtl-expressingcells. When Sirt1 was

suppressed in Hela cells. an l'o3-fold increase in the level of hTERT protein was observed

(Figure 13. A). and this was accompanied by a O.3-fold increase in the levels ofhTERT

mRNA both by in-gel RT-PCR (Figure 13. B) and an insignificant but reproducible

increase of O.3-O.5-fold by real-time quantitative PCR (Figure 13. C and E). We conclude

that Sirt1 controls endogenous and exogenous hTERT expression possibly at the level of

RNA stability and/or through changes in chromatin structure at the hTERT promoter. To

test this model. we performed ChIP experiments 240 nuc1eotides upstream of ATG in the

hTERT promoter (Figure 13. F). We used a pan-acetyl antibody against acetylated histone

H4 and found that Hela cells in which Sirtl was suppressed contained more total

acetylated H4 on hTERT promoter than control cells expressing endogenous Sirtl.

Forthennore. a small amount of Sirt1 was associated with hTERT promoter (Figure 13. F)

in control cells but not in Sirt1 knockdown cells. These results indicate that there is a

transcriptional component (albeit small) to the observed effect When we performed

effective knockdown of Sirt1 in BJ-hTERT cells. we found that compared with controls.

the BJ-hTERT-pSRP-SIRTl cells showed a slower migrating band (Figure 13. D).

Although this suggests a posttranslational component by acetylation in stabilization of

hTERT. further experimentation is required to show that the effect is directly through

posttranslational modification of hTERT.

89 Sirt] ]nhibition Cooperates with hTERT to Promote Cell Growth under Normal and Low

Nutrient Conditions

Having shown that Sirtl suppression is associated with increased telomerase activity, we wanted to determine if Sirtl and telomerasefunctionally cooperate in a replicative lifespan assay in human cells. The shRNA-mediated repression of Sirtl in primary BJ fibroblasts did not affect replicative lifespan in a long-term assay (Figure 14,

A). Furthermore, no sigoificant effect on replicative lifespan was observed when Sirtl was overexpressed (Figure 14, B). Next, we asked if Sirtl repression affected the growth of ectopichTERT-expressing BJ cells. We flTSt introduced hTERT in the same primary

BJ cells, and then subjected these telomerase-positive cells to infection with the shSIRTl(HS6), control shRNA virus, or the backbone virus (pSRP). We observed that the population doubling time of cells expressing shSirtl was sigoificantlyreduced compared with cells infected with pSRP or pSRP-shControl(Figure 14, C and D) and that the endogenous Sirtl was effectively repressed in the shSirtl-expressing cells (Figure 16,

D.). Hence the ability of Sirtl to control the growth of BJ cells is observed only in the presence of hTERT expression. Ectopic expression of SIRTl-R reversed the enhanced growth phenotype of BJ cells expressing hTERT and shSIRTl(HS6) (Figure 14, D).

Hence the results of this genetic rescue experiment indicate that the effect of the Sirtl shRNA in enhancement of cell growth is specific to Sirtl and is independent of any off­ target effects of the shRNA used.

90 Effect of Glucose Withdrawal on Sinl-depleted BJT Cells

When cells are exposed to glucose withdrawal they are known to undergo cell cycle arrest followed by death. When we exposed BIT-pSRP-shControl and BIT-pSRP­ shSIRTl(HS6) cells expressingtelomerase to nutrient withdrawal by exposing them to media containing no glucose, we found that BIT cells expressing ectopic telomerase with no Sirtl expression could survive and divide much longer in the initial phases of glucose withdrawal (Figure 14, E). Although both control and knockdown cells died at approximately the same time (5th day; Figure 14, E). In the control BJT cells, the levels of Sirtl were gradually increased after glucose depletion and activated AMPK levels graduaJly increased with time. However. in Sirtl suppressed BIT cells subjected to glucose withdrawal there was a significant increase early on in total AMPK levels and phosphorylated AMPK protein levels at 4--8 h (AMPK..... Thr 172 phosphorylation).

Increased Proliferative Capacity ofHematopoietic Stem Cells in Animals Lacking Sin]

To extend our fmdings to a more physiological system, we assayed the effect of

Sirtl deficiency on the establishment of the primitiveHSC compartment, by quantitating the total number of HSCs and multipotent progenitors in BM from young (3-9 wk) Sirtl knockout (Sinl r/l and control mice by flow cytometryusing rigorous cell surface criteria for isolating HSCs and progenitor cells (172) (Supplementary Figore 1). These analyses showed that establishment of neither the HSCs nor multiprogenitor subsets were significantly impacted in the absence of Sirtl (Figore 15, A). Similar results were

91 observed when alternative markers for isolating HSCs were used (174, not shown). These results suggest that Sirtl does not play an important role in establishing HSC homeostasis in young adult mice housed in a stress-free enviroumenL

To assess the capacity of young Sirtl-deficient HSCs to proliferate in response to mitogenic stimuli, we purified HSCs from Sin1-!- and control mice by fluorescence­ activated cell sorting, cultured the cells in cytokine-rich media. and then quantitated the total number of progeny cells generated after 7 d (Figure 15, B). Strikingly, these experiments revealed that the Sinl-l- HSCs exhibited a three- to fivefold (1'::120,000 cells) increased proliferative capacity compared with Sirtl +/- HSC controls (Figure 15, B). To address the capacity of Sirtl-deficient HSCs to proliferate under conditions of nutrient deprivation, we clone sorted HSCs from Sinl-l- or Sinrl- mice into individual wells of

Terasaki plates containing cytokine-deprived media and monitored the number of wells in which cell proliferation could be detected (i.e., wells containing two or more cells). As shown in Figure 15, a significantly greater number of Sin1-!- HSCs were capable of proliferating in media in the presence of single cytokines with either IL-3 (Figure 15, C) or SCF (Figure 15, D) compared with control HSCs, indicating that Sirtl-deficient HSCs have a greater capacity than controls to proliferate under these restrictive conditions.

To determine whether Sirtl expression per se is affected by cell proliferation, we purified HSCs, as described above, and either immediately isolated RNA from resting

HSCs (HSC-R), or cultured HSCs in complete media for 4 d before RNA isolation from actively cytokine stimulated HSCs (HSC-S). As shown in Figure 15, E; real-time RT­

PCR analysis of Sirtl mRNA levels relative to Hprt reveals a small (about twofold) but

92 significant increase in Sirt! levels in cytokine stimulated HSCs. Although this result suggests that Sirtl expression may be cell cycle dependent in HSCs, it is important to note that cytokine-stimulated HSCs undergo extensive differentiation in vitro. Thus it remains to be determined to what extent the regulation of Sirtl levels has physiologically relevant affects on the proliferation ofHSCs in vivo.

93 DISCUSSION

Here we present results showing that Sirtl. the NAD-utilizing deacetylase enzyme is a negative regulator of growth under normal and restrictive conditions in certain cell lineages. Consistent with this notion, efficient inhibition of Sirtl deacetylase was associated with an increase in telomerase activity that is required for survival and long­ term cell growth. Our data indicate that the effect of SirU on telomerase activity is mediated through the catalytic subunit of telomerase. hTERT. On SirU inhibition there is a small increase inhTERT mRNAlevel and a significant increase in levels ofhTERT protein. This increase in mRNA correlated with lack of SirU at proximal regions of hTERT promoter and an increase in total H4 acetylation at the hTERT promoter. Cell lines expressing either endogenous hTERT under its native promoter or primary human diploid fibroblasts expressing ectopic hTERT showed increased levels of hTERT protein and activity upon SirU suppression. We find that the suppression of Sirtl and its effects on telomerase are independent of how hTERT is expressed (i.e .• under native or ectopic viral promoters). Interestingly, we also observed an hTERT doublet in BJT cells in which

Sirtl was expressed suggesting a posttranslational role for SirU in regulation of hTERT protein stability. However. further experimentation is required to investigate if this is cansed by increased hTERT acetylation.

The increased telomerase activity and cell growth phenotype observed could be rescued by a silent mutant SIRTl-R protein that is resistant to repressive effect of shRNA directed to Sirtl. showing that the effect observed was specific. Our results point toward a functional interaction between SirU and hTERT; however. the basis for this genetic

94 interaction is unknown, and it is possible that the effect of Sirtl on hTERT is not direct and is mediated via other proteins. Furthermore, given the diverse range of Sirtl targets the effects observed on hTERT maybe one factor that contributes to the observed cellular phenotype.

Overexpression of SIR2 extends replicative lifespan of single-cell eukaryotes such as S. cerevisae and chronological lifespan of multicellular protostomes such as C. elegans. We reasoned that if the lifespan-inducing functions of the mammalian SIR2 homolog Sirtl is conserved, this should reflect itself in either survival or replicative lifespan of vertebrate cells with long life spans. such as somatic cells of Homo sapiens.

When we overexpressed wild-type Sirtl in mortal normal hmnan diploid BJ fibroblasts. we observed no significant effect on replicative lifespan, consistent with published data (144). We also performed the reverse experiments by suppressing Sirtl to near detection limits in primary BJ fibroblasts. and we still did not observe any effects on replicative life span. Becanse it has been shown before by us and others that ectopic expression of hTERT and reconstitution of its activity causes life span extension in hmnan cells. we reasoned that inhibition of Sirtl may have an effect on telomerase­ induced extension of lifespan. If primary BJ cells were first infected with an hTERT­ expressing virus and sequentially were subjected to Sirtl inhibition, there was an increased efficiency in cell growth reflected by a decrease in the population doubling time. This effect could be mediated through telomeres or other indirect effects on cell

survival. It is however clear from our data that Sirtl suppression promotes cell growth in the presence of ectopic telomerase activity. Our findings in hmnan cells are consistent 95 with that of others who have shown that murine fibroblasts deficient for Sirtl(Sir2a) have a higher frequency of immortalization (175). In contrast, others have shown that in different cell types such as endothelial cells Sirtl suppression has the opposite effect: its loss induces cell cycle arrest (176). Given the range of substrates currently identified for

Sirtl and their increasing number, it is possible that the contradicting growth-promoting and growth-suppressing properties observed are cell type or species specific.

Extension of our in vitro results to hematopoiesis under adverse conditions caused by lack of growth factors is consistent with the notion that Sirtl is a growth suppressor.

Although we observed no appreciable difference in HSCs or progenitor frequencies in young Sinl-l- mice, the in vitro proliferative capacity of Sirtl-deficient HSCs were significantly elevated in both complete media and under cytokine-deprived conditions containing a single growth factor. These results were consistent with that of immortalized human BIT cells lacking Sirtl expression that showed higher proliferation under normal or glucose-deprived conditions. We found that consistent with the role of activated

AMPK in response to low glucose (177), cells lacking Sirtl showed an earlier peak in both totailevels and activated phospho-AMPK-a protein upon glucose deprivation.

Activation of AMPK hence may allow survival in response to an energy shortage.

Although this fmding suggests that Sirtl may regulate AMPK, others have found that induction of AMPK by the Sirtl activator resveratrol is Sirtl independent (178). Although

a useful marker of energy statns and survival, AMPK induction observed here maybe due

to a complex and indirect effect of Sirtl on cell survival under A TP-limiting conditions.

96 It is possible that under nutrient-restrictive conditions, Sirtl acts as a growth suppressor to limit division in high-capacity progenitor cells. 1bis limitation may be a physiological response to save on nsage of macromolecules required for survival of pre­ existing stem cells. Hence, Sirtl can modulate the division and survival capacity of stem cells in response to nutrient availability. Our results have significant implications for survival of adult stem cells under stress and would be of interestto examine whether Sirtl has similar effects in other types of stem cells. They also indicate that specific chemical inhibitors of Sirtl may enhance survival or pluripotency in adult or embryonic humao or murine stem cells.

Evidence suggests that calorie restriction is associated with decreased age­ associated tumor incidence (128). Furthermore, the beneficial biological effects of calorie restriction in increasing lifespan have been well documented. Therefore. it is possible that in human cells, calorie restriction can increase Sirtl activity, which in torn can suppress immortalizing genes such as telomerase. Therefore increased Sirtl activity would then suppress tumor incidence and therefore only indirectly leads to extension of lifespan.

Hence the effects of induction of molecules such as Sirtl on longevity of complex multicellular vertebrates may be mediated indirectly via stimulating its tumor suppressor functions and hence reduce death due to cancer. We predict that overexpression of Sirtl in mice would primarily result in suppression of certain types of tumors. Based on our results and models, Sirtl overexpression may have no functional effect on the network of human genes promoting somatic cell chronological/replicative survival, leading directly to increased longevity. Current lack of a unifying evolutionary conservation in longevity

97 functions of SIR2 however should not detract from its fundamental roles in cellular survival and growth from yeast to mammals.

Our fmdings underscore the importance of nutrient-dependent pathways and propose that Sirtl is a nutrient-sensitive growth suppressor that may act as an important barrier to retard the growth of certain nutrient-sensitive immortal tumor cells.

98 ACKNO~GE~

We thank Dr. Samuel Benchimol and Dr. Norman Iscove for comments on the manuscript. The Sirtl knockout mice used in this study were a kind gift from Dr. Fred

Alt. S.N .• G.Z. and T.W. performed all experiments in Figures 12. 13. 14. and 16. Figure

16. R.A .• M.C .• P.P.• andD.R. performed experiments in Figure 15 and Figure 17. This work was supported by an operating grant from the Canadian Institutes of Health

Research and Canada Research Chair program (H. V.) and National Institutes of Health

Grant PZO RRI6467 -05 (R.A.). Infrastructure support was provided by Canadian

Foundation for Innovation to H.V.

99 Figure 12. Effect of Sirtl suppression on telomerase activity in human cells.

(A) Suppression of Sirtl in BJ-hTERT cells (BIT). BIT cells were infected with a control shRNA expressing retrovirus pSRP-shControl or Sirtl knockdown virus pSRP­ shSIRTl(HS6). Celllysates were subjected to immunoblotting using an anti-Sirtl antibody or a jJ-actin antibody. (B) Suppression of Sirtl in Lavo cells. The same retroviral vectors as in A and in analysis were used. (C) Suppression of Sirtl in Hela cells. The same retroviral constructs as in A were used. (D) Suppression of Sirtl in Hela cells using control shRNA retrovirus and two shSIRTl (HS6) and shSlRTl (HS1I) constructs.(E) Parental BJ cells expressing ectopic pM (MSCV)-hTERT-lEGFP were infected with pSRP-shControl RNA or pSRP-shSIRTl (HS6) virus. Within 6 PDs after selection in puromycin, cells were lysed in CHAPS lysis buffer, and equal protein quantities (50 and 300 ng) were subjected to 1RAP analysis to determine telomerase activity. Control RNase and heat treatments all contained 300 ng of protein lysate. (F) Lavo cells were infected twice with the viruses and were subjected to 1RAP analysis. Protein amounts of 50, 200, and 600 ng were used in the 1RAP reaction. (G) Same as F except Hela cells were used. (II) Same as in G except internal controls were included using HeLacell extracts (10, 50, and 200 ng). (I) A second shRNA (HSll) was used to suppress Sirtl in Hela cells and 1RAP analysis was performed as in H. (1) Same cells as in A (BJ-hTERT-lEGFP with and without shRNA against Sirtl) were infected with pBabe-neo (pBN) control vector or with an shRNA-resistant silent SIRTl-R expressing construct (PBN-SIRTl-R) generating four additional lines. Two protein concentrations (50 and 200 ng) from four cell line were subjected (total of 16) to the 1RAP analysis. The first six lanes are experimental controls. Lanes 7 and 8 are results of rescue experiments. The last three lanes are negative controls for the 1RAP reaction.

100 A

SJRTI --+ __ ~ SIRTI -+ SlRTl _ SIRTI -+

I\-Aclin --+ ~-A 1: tlu --. _ - " -At tin --+ E ---:-;-- • •

.. j

I J

•

IC _

I 2 J 4 S 6 7 8 9 10 11

101 Figure 13. Regulation of hTERT. (A) Effect of Sirtl suppression on hTERT protein in Hela cells.

Western blot analysis was performed on celllysates, and they were subjected to immunoblotting with anti-Sirtl, anti-hTERT, and anti-p-actin antibodies. (B) Effect of Sirtl suppression on hTERT mRNA in Hela cells. Total RNA was isolated from Hela­ pSRP-shControl and Hela-pSRPshSlRTI cells and hTERT mRNA was quantified by quantitative radioactive in-gel PCR as described (69). The ratio ofhTERT/GAPDH is shown. (C) Quantification ofhTERT mRNA in Hela and Hela-pSRPshSlRTl cells by real-time Q-PCR. The values shown are normalized to an internal GAPDH control. (D) Regulation of hTERT protein in BIT cells. BIT-pSRP-shControl and BIT-pSRPshSlRTI celllysates were resolved on 4-12% gradient gels, and immunoblotting was performed using an anti-hTERT rabbit antibody. Primary BJ cells in the first lane were used as negative control. (E) Effect of Sirtl suppression on hTERT mRNA in BIT cells. Same as in C except that BIT and BIT-pSRPshSlRTl cells were used. (F) ChIP of hTERT promoter using the antibodies shown. Hela control and Sirtl(HS6) knockdown cells were used in each ChIP reaction as shown. Antibodies used were against total acetylated H4 and Sirtl. Controls were rabbit semm (RS) and no antibody reactions. For details consult Materials and Methods.

102 A B

SlRTl -+ hTERT -+

hTERT -+ GAPDH -+ p-A

1.& < ~ I.' } 0.3 5'-' SIRTI -+ ~ Cl ,9 > -- '.c~ 0.' hTERT :::; ~ OJ jl-A

103 Figure 14. Cooperative effects of Sirtl knockdown and hTERT expression on cell growth and survival.

(A) Sirtl suppression effects on lifespan of primary BI fibroblasts. Late-passage BI cells (fld7 PD before senescence) were infected with either pSRP-shControl or pSRPshSlRTl (HS6) and pSRP control shRNA vector viruses and cells were subjected to selection in puromycin. (B) Overexpression of wild-type Sirtl in primary BJ fibroblasts. Same as in A. except for the overexpression constructs (pBabe-Puro-wtSIRT1) and pBabe-Puro control vector were used. (C) Effects of Sirtl knockdown on growth of BIT (hTERT­ IRES-EGFP) fibroblasts. Late-passage BJ fibroblasts were infected with an hTERT containing virus. and the resulting BIT cells were subsequently infected by pSRP­ shControl or BI-pSRPshSIRTl (HS6) viruses and subjected to a standard replicative lifespan assay. (D) Rescue of the biological effect of shRNA by an shRNA-resistant mutant. BIT cells were infected with pSRP-shControl or BJ-pSRPshSIRTl(HS6) viruses and subsequently infected with the rescue construct PBN-SIRTl-R or PBN control alone. Cells were kept under puromycin and neomycin selection throughout the experiments. BIT cells and their rescue counterparts generated were subjected to a long-term replicative assay as before to asses the ability of SIRT-R to rescue the phenotype of BIT cells expressing the Sirtl shRNA. (E) BIT cells expressing control of Sirtl shRNA were subjected to glucose withdrawal on day 0 and cell viability was measured for a week. Experiments were performed in duplicate dishes. Error bars. SEM. (F) Same strains as in E were subjected to glucose withdrawal and at the shown time point (hours after withdrawal). and celllysates were prepared and subjected to immunoblotting with an anti-Sirtl. anti-phosphor-AMPK.... (Tbr-172). total AMPK.... and l3-actin antibodies.

104 A B '00

' 10 ...... p..'ii RI'sbSIKTltllS6) ...... pSRP ro.l lhRNA .., .. ~ ., 1\ ---.0.... .-.. ..~ i' l If li ... g -~' •..- ~ 7! = .i /" .= '" .i ~• 10 1 " •~ ;:. ., ~• .. ..

~ ~--~--~----r---~--~---'-­ " o so , no .. ,,. " ...... • .. •• .. 'M " "'Y' c D

--pM _bTERT_III:G FP - pSRP ShSIRT I(IIS6} I7J _ ...... 1"110 ·.""" _ _ __ IIJ -+- pM.hTF.RT.IEG FP "'pSRPl"untdoR.VA '63 IO' l e, ~ ----- pM-hTERT.I £C Fl·-pSRP ~ 103 t '''' 1 100 J & j 98 • ..:;; '" 8- 'lJ L IIJ " 103 " ~=-~--~--~--r--'r--'---'---' 93 o .. 0 80 'OIl " .. " .. " .. .. '" ~ '"~ E F 10' _ -'IUT""".~p ~S~RI'~.c7. :."...:.. B.lT I,SJU' ... IIoSI R rI(U ~1 ," ' OJ -! l -l iil ..Ji -3 .. An: <4 o .. II I! l!i 0 8 II IS 14' . ~ SI RT I I ! O --+ --::'JlU•• tt l V;-• . .., '10 Thl'l I AM PK - u ~ ,.... - _... _-_ .. Ph u)'poo AMI'K-u .. ---+­ .. ~ - A CIIA "'" 20

DaYI"

lOS Figure 15. Analysis of the effect of Sirt1 deficiency on HSCs and progenitor frequency and proliferation.

(A) Analysis of the affect of Sirt1 deficiency on HSCs and progenitor numbers. Bone marrow was harvested, red blood cells were lysed, and the remaining white cells were stained with fluorophor-conjugated antibodies to markers for HSCs and progenitors (see Materials and Methods for details). Multipotent progenitors and short-term and long-term HSCs are defmed as the c-Kit+Sca- 1"1. ..innegF1k2+CD34+ fraction. the c-Kit+Sca-1 "Linneg F1k2D08(D34+ fraction. and the c-KitSca-1 "LinDel!p(JaDellCD34neg fraction of WBM. respectively. The avemge total cell number for each type of cell. normalized to body weight, is shown (for each bar. n ~3). Error bars. SO. (B) Quantitative analysis of cell numbers after 1 wk of growth in complete media. BM was stained as described in Materials and Methods, and 100 HSCs were sorted directly into individual wells of a 48- well plate containing complete media. Bars represent average counts from five wells. HSCs are defined as the c-Kit+Sca-1 +SLAM(CD150)"LinDe8FJk2neg fraction of WBM. (C) Left, graph represents read out over time of Terasaki plates containing single HSCs per well. The HSCs were sorted into Terasaki plates containing serum free X-Vivo media plus llr3. and plates were monitored daily for the nmnber of wells containing proliferating cells (i.e .• more than one cell). Right, graph represents average value of frequency of proliferating HSCs from four Terasaki plates. HSCs are defined as the c­ Kit+Sca-1 +SLAM(CD150tLin"egF1k2neg fraction of WBM. For all experiments. mice were 3-9 wk old. P values represent results from Student's t test. (0) Same experiments as in C were performed except that cells were sorted into media containing Steel factor. (E) Analysis of Sirt1 mRNA levels in resting and prolifemting HSCs. HSCs (n =1000) were purified from young adult mice (n = 3). and RNA was either extracted immediately for analysis of resting HSCs (HSC-R) or cells were stimulated to proliferate in media (X­ Vivo 15 serum-free media [Stem Cell] plus 20 ngfml Steel factor. 10 ngfmlllr6. 30 ngfJ.lI IL-3. 2 roM L-Glu, and 50 J.lM mercaptoethanol) for 5 d for analysis of proliferating HSCs (HSC-S). Both T-cells (CD-3+B22OnegMaclneg) and B-cells (B220+CD- 3negMaclneg) were purified from the bone marrow as a reference. RNA was extracted using Trizol. cDNA was synthesized using Superscript m (Invitrogen). and real-time PCR was performed using primers specific for Hprt (reference) and Sirtl yielding single amplicons of 100 and 150 bp. respectively. Forty cycles ofPCR was performed in triplicate for all samples using an iCycler real-time PCR machine (Bio-Rad). For each cell type. the average level of Sirt1 is shown. relative to Hprt.

106 A B 25 -r------,

20

S: 15 " "= 10 U• 5

+/+ +/- -/- +/+ +/- -/- +/+ +/- -/- +/- -/- !.'T-II SC LT-HSC SIRTI c 40 ,-~------~--, ;;: 50 -r-----, • Sirt +/- ~ ~ P-o.OO4 . • Sirl -/- .!O 40 ~ 30 .., " ."S 20 .5' 30 ~ ~ 20 ~ ~ ..f 10 ..E 10

o 4 ti 12 Days In cultu re D 40 t • Si r! TJ- e . • Sirt -I- . ","0.03 .., 30 .. 30 ,." ,." .= 20 .!; f ~ o!< ~ ~ 10 "0 10 .t .t 0 0 4 8 12 Oays In cullure E "'-6 ~£ ~~ " ~..s• " ~1

B c:c::11 T I.'dl IISC-R nsc-s

107 Figure 16. Confirmation of shRNA Knockdown in Cultured Cell Lines

(A) The region of Sirtl targeted by the HS6 shRNA. Top sequence shows the wild type sequence in Sirt I and the one below outlines the six silent mutations in bold that were created in the wild type Sirt I (verified by sequencing) to render it insensitive to degradation by HS6 shRNA. (B) Efficiency of Sirtl shRNA knockdown in BJT cells and expression of the SIRTI-R construct. These four cell lines were used in experiments of Figure IJ and Figure 3D. Lysates were subjected to immunoblotting with an anti-Sirt! antibody and a beta actin antibody. (C) Overexpression of control vector (PBP) wild type SIRTl(PBP-SIRTl) and SIRTlH363Y (PBP-SIRTlHY) in Hela cells. Celllysates were subjected to TRAP analysis as in Figure I. (D) Primary BJ fibroblasts generated were infected with pSRP, pSRP-shControl or pSRPshSIRTl, selected and their Iysates were subjected to immunoblotting with an anti-Sirt! antibody and a p-actin antibody.

108 A ~ B ~ ~ ~ ..:;: .. :;! ~ ~ i .. ..'" .. .." • ;t i c i ~ tiS£., SIRTI ShRl\A ~ .. ~ i ~ ! ....,. .. SIRT I-(W!j : ~ '6.'" Go .. '"".. ca r g, atg ga, att gaj <: .. t: .. I ;,. l ,. "- "" SIRTI-R: cali. get atg ttg gac ala gag '" E ~ if (S lIe,,! Res'"•• ! I" ~ ... ;! ;! .. :...; 1\{Uta.D[) "' '" "'" '"

>- :: Ii:-- ...... "i ..'""i ..= ..::.. ..= • :; • c ! ! ,~#. D .-::::::J.-::::l .-::::::l ~ ~::~~

ft-.' I::tin ......

109 A Sirt1+/- complete Sirtl-I- complete

B

Stem Cell Multi-potent Progenitors f ,

> --iIa(t::>-> Matu,.. effector eella

long4:t!rm ~&populatlng !flott-term Repopulating P4J1tJ-potent Progt-nltor He-mltopol.tk: Stem Cell Hema:opol.lc Stem Cell (MPP'''" (LT-HSC) (ST -HSC) c-lll!" e-kle c-klt- U n ••ge- Uneag.­ Un ••g. - Sc.a-,. Sea-'­ SU-" flkT IkZ flkZ C034' CO:W· CO:W'

Figure 17. Colony Growth of HSCs in Complete Media and Schematic of HSC Surface Phenotype.

(A) Colony growth of HSCs in complete media. HSCs from heterozygote and null mice were stained as described in Materials and Methods, and 100 HSC were sorted individual wells of a 48-well plate containing complete media (x' Vivo 15 serum free media plus cytokine cocktail. Pictures were taken after one week of growth. All donor mice were eight weeks old. (B) Generation of the Sirt I shRNA resistant mutant SlRT I-R. Mutatedresidues that result in silent mutations are shown in bold below. Sequence of the wildtype Sirt I is shown above. (B) Schematic of the primitive hematopoietic stem cell compartment showing the developmental relationship and cell surface phenotype of hematopoietic stem cells (LTHSC), and multi-potent progenitor subsets (ST-HSC and MPPflk2+). Self-renewing LTHSC resi de at the top of the hematopoietic hierarchy and give rise to the multi-potent progenitor subsets, which in turn give rise to all mature blood cells by differentiation through a number of intermediate oligo-potent and lineage-restricted progenitors (not shown). 110 CHAPTER 5. DISCUSSION

111 Our investigations have shown that as PGCs enter into a quiescent state telomerase levels decrease in response to a decrease in TERT expression levels. This process can be reversed by overexpression ofTERT in cell cultures and transgenic animals. The mechanisms and reasons behind this downregulation remain to be elucidated. However, it appears that neither the absence nor overexpression of TERT has any effect on the behavior or survival of PGCs. At least in early generation animals, the effects of longterm TERT deficiency in transgenic animals does result in a severe reduction in number and function of PGCs and subsequently the germ line. We found that expression of TERT mRNA levels were downregulated in quiescent roes, as such it is likely that this is cansed by the action of one or more transcription factors. We have begun to look for novel transcriptional regulators of TERT expression in murine ESCs via challenge with a shRNA library consisting of shRNAs specific for murine transcription factors. One potential regulator ofTERT expression isolated so far is the protein hypoxia-inducible factor 1 a (HIFl-a). Recently, two hypoxia response elements

(HREs) have been found in the TERT promoter region. HREs are sites that HlFI-a can bind to and regulate transcription of downstream genes (180). We are currently utilizing site directed mutagenesis to investigate the roles these sites play in regulating TERT in stem cell populations. It will also be of great interest to explore the role of Hifl-a on

TERT expression in other stem cell populations particularly in HSCs as they reside in a hypoxic niche and are relatively quiescent cells. Hifl-a may also prove to be of interest as a regulator of TERT expression in many cancer cells.

112 Although the main method of telomerase regulation is through control of TERT expression, other mechanisms cannot be entirely ruled out such as translocation, post­ translational modification, or regulation of the RNA component. As such it will be interesting to see which if any of these possible mechanisms playa role in telomerase regulation in PGCs and other stem cell populations.

We have now clearly established a role of Sirtl in maintenance of the male murine germ line. Mice lacking Sirtl had reduced populations of PGCs as well as mature sperm cells. Microarray analysis of whole testis from Sirtl deficient mice revealed the dysregulation of a host of genes, of particular interest were several genes involved directly with spermatogenesis, among these are Hookl and Nasp. Recent work has demonstrated that Hook! is required for proper development and shape of the mature sperm head (181). It may be that the dysregu1ation of Hook 1 results in the abnormally shaped sperm seen in Sirtl deficient animals. How Sirtl affects Hookl expression remains to be elucidated, but may involve its deacetylase activity. Nasp (nuclear autoantigenic sperm protein), is a cell cycle dependent histone binding protein. In the nucleus, histones that are not bound to DNA are bound to Nasp and is partially responsible for transporting histone proteins from the cytoplasm to the nucleus (182). It may be that Sirtl deficiency causes an increase in Nasp transcription via lowered histone deacetylation levels. It cannot be ruled out that increase in Nasp expression is a compensatory effect in response to an absence of Sirtl. It will be interesting to investigate the relationship between these genes and Sirt! in transgenic animals. Further elucidating the aforementioned relationships may have important clinical applications to

113 understanding cause of infertility in human males. Another set of genes displaying dysregulation were those involved in protein sumoylation, specifically SUMOI and

SUM02. SUMO proteins are small ubiquitin-related modifiers that are covalently attached and detached from other proteins to modify their function. Once the last four amino-acids are cleaved from the C-terminus Sumo proteins are activated and function in an enzymatic cascade analogous to the process of ubuquitination by binding to lysine residues on the target substrate (183). However, sumoylation does not function to label proteins for degradation. Modification of proteins via sumoylation has many functious including nuclear-cytosolic transport and transcriptional regulation. Unlike, ubiquitination, sumoylation lengthens a proteins lifespan rather than shorten it. Already work has begon by others to explore the link between SUMO family members and Sirtl

(124, 127). Current evidence points to an increase in SUMO protein expression levels being a compensatory response for the lack of Sirtl in affected organisms. With new functions and targets of Sirtl being elucidated constantly, this view is likely to change. It would be quite interesting to examine this relationship in vivo through the use of a double transgenic mouse lacking SUMO! and conditionally lacking Sirtl.

Global gene expression analysis of the whole testis from Sirtl deficient animals has already given us significant insight into other possible roles of Sirtl, but it would be quite exciting to pursue this in much greater detail. For example, it could prove worthwhile to conduct further microarray analysis on specific spermatogenic cell populations in these Sirtl deficient animals, as undoubtedly, much valuable signal from these relatively small cell populations was lost to the "noise" of the somatic cell

114 populations in the testis. Additionally, this investigation should be expanded to include the female germline including expression analysis on mature oocytes and whole ovaries.

Lastly, it is necessary to investigate gene expression differences in the PGC populations of both sexes of Sirtl deficient animals at both mitotically active and quiescent stages.

Indeed, these experiments are currently ongoing. However, as little is known about the normal gene expression of PGCs at these stages and the differences between the sexes, we are starting at ground zero so to speak with the establishment of a baseline of gene expression in wildtype PGC populations.

Although we have shown Sirtt deficient mice are capable of reproduction via

IVF, all nine F2 generation Sirt t deficient mice from four different litters were male.

The probability of this occurring is 0.002; as such it is highly unlikely that this is the result of random chance. Instead there may be a mechanism in place that is favoring survival of males versus females in response to long-term Sirtt deficiency. Determining what this mechauism is will certainly be a challenging venture. It may be that Sirtt has an as yet unknown role in X-inactivation and that improper silencing of the X chromosome leads to severe developmental defects and embryonic death. This is certainly possible given Sirtt's role in histone deacetylation and chromatin silencing.

Clearly, an in-depth study of histone acetylation pattems of the X chromosome in both wildtype and Sirtt deficient mice is necessary to test this hypothesis.

We have now further explored the role of Sirtt on Telomerase activity and have shown that hTERT expression is increased in the absence of Sirtt in human fibroblast cells. The basis for this interaction is currently unknown and it is certainly possible that

115 it is not a direct involvement, but rather is mediated via other proteins. Given the wide range of Sirtl targets elucidating the mechanism will undoubtedly take some time. One avenue is to explore the possibility of Sirtl acting on transcriptional regulators ofhTERT.

Sirtl deficiency may cause an increase in histone acetylation at the transcriptional start site of hTERT. thereby facilitating an increase in hTERT transcription.

Early work in yeast and nematodes demonstrated that Sir2 overexpression extended the lifespan of these organisms. Since then, much work has gone into examining a role of Sirtl in extending lifespan in mammalian systems with complex and often contrasting results as we have demonstrated here. Sirtl has been shown to have a wide and ever increasing number of targets; as such it is likely that its expression will have varying effects based on tissue. cell, and species type. Indeed, when examining the role of Sirtl deficiency in the murine hematopoietic system we found that a lack of Sirtl promoted an increase in proliferative capacity and survival of HSCs cultured under conditions of nutrient deprivation. Conversely. no appreciable differences in HSCS or progenitors were detected in Sirtl deficient animals. This suggests a role of Sirtl as a nutrient dependent growth suppressor. This activity may act to preserve and protect stem cell populations under stress. Clearly more work is needed to evaluate the role of Sirtl as a nutrient sensitive growth suppressor particularly in embryonic and other adult stem cell populations as well as cancers.

116 REFERENCES

1. Nieuwkoop PD, Sutasurya LA. Primordial Germ Cells in the Invertebrates. Cambridge University Press. 1981

2. Illmensee 1(, Mahowald AP. Transplantation of posterior polar plasm in Drosophila. Induction of germ cells at the anterior pole of the egg. Proc Nat! Acad Sci USA. 1974 Apr;71(4):1016-20.

3. Ginsburg M, Snow MH, McLaren A. Primordial germ cells in the mouse embryo doring gastrulation. Development. 1990 Oct; 110(2):521-8.

4. Gardner RL, Rossant J. Investigation of the fate of 4-5 day post-coitum mouse inner cell mass cells by blastocyst injection. J Embryol Exp Morphoi. 1979 Aug;52: 141-52.

5. Snow MH. Autonomous development of parts isolated from primitive-streak­ stage mouse embryos. Is development clonal? J Embryol Exp Morphol. 1981 Oct;65 Suppl:269-87.

6. Lawson KA, Hage WJ. Clonal analysis of the origin of primordial germ cells in the mouse. Ciba Found Symp. 1994;182:68-84; discussion 84-91. Review.

7. Di Carlo AD, Travia G, De Fetici M. The meiotic specific synaptonemal complex protein SCP3 is expressed by female and male primordial germ cells of the mouse embryo. Int J Dev BioI. 2000 Feb;44(2):241-4.

8. Brinster RL. Male germline stem cells: from mice to men. Science. 2007 Apr 20;316(5823):404-5.

9. Brinster RL. Germline Stem Cell Transplantation and Transgenesis. Science. 2002 June 21 June. Vol. 296. no. 5576, pp. 2174- 2176

10. Till, J .E., McCulloch, E.A. (1961) A direct measurement of the radiation sensitivity of normal mouse bone marrow cells. Radiation Research 14:213-22.

11. Becker, AJ., McCulloch, E.A., Till, J.E. (1963) Cytological demonstration of the clonal nature of spleen colonies derived from transplanted mouse marrow cells. Nature 197:452-4.

12. Siminovitch, L., McCulloch, E.A., Till, J.E. (1963) The distribution of colony­ furming cells among spleen colonies. Journal of Cellular and Comparative Physiology 62:327-36. 117 13. Ploemacher RE, van der Sluijs JP, Voerman JS, Brons NH. An in vitro limiting­ dilution assay of long-term repopulating hematopoietic stem cells in the mouse. Blood. 1989 Dec;74(8):2755-63.

14. Martinez-Agosto JA, Mikkola HI<, Hartenstein V, Banerjee U. The hematopoietic stem cell and its niche: a comparative view. Genes Dev. 2007 Dec 1;21(23):3044-60.

15. Zon U. Intrinsic and extrinsic control ofhaematopoietic stem-cell self-renewal. Nature. 2008 May 15;453(7193):306-13.

16. Mayack SR, Wagers AJ. Osteolineage niche cells initiate hematopoietic stem cell mobilization. Blood. 2008 May 2. [Epub ahead of print]

17. Rossi OJ, Bryder D, Seita J, Nnssenzweig A, Hoeijmakers J, Weissman IL. Deficiencies in DNA damage repair limit the function ofhaematopoietic stem cells with age. Nature. 2007 Jun 7;447(7145):725-9.

18. Wagner W, Hom P, Bork S, Ho AD. Aging of hematopoietic stem cells is regulated by the stem cell niche. Exp Gerontol. 2008 Apr 22. [Epub ahead of print]

19. Hayflick L, Moorhead PS. The serial cultivation of human diploid cell strains. Exp Cell Res. 1961 Dec;25:585-621.

20. Greider, C.W. & Blackburn, E.H .. "Identification of a specific telomere terminal transferase activity in Tetrahymena extracts". Cell. 198543: 405-413.

21. Yang T, Fu M, Pestell R, Sauve AA. SIRTI and endocrine signaling. Trends Endocrinol Metab 2006;17(5):186-91.

22. Gmnstein M. Yeast heterochromatin: regulation of its assembly and inheritance by histones. Cell 1998;93(3):325-8.

23. Blander G, Guarente L. The Sir2 family of protein deacetylases. Annu Rev Biochem 2004;73:417-35.

24. Lombard DB, Chua KF, Mostoslavsky R, Franco S, Gostissa M, Alt FW. DNA repair, genome stability, and aging. Cell 2005;120(4):497-512.

25. Sinclair DA. Paradigms and pitfalls of yeast longevity research. Mech Ageing Dev 2002;123(8):857-67.

118 26. Ouarente L. Diverse and dynamic functions of the Sir silencing complex. Nat Genet 1999;23(3):281-5.

27. Bitterman KJ, Medvedik 0, Sinclair DA. Longevity regulation in Saccharomyces cerevisiae: linking metabolism, genome stability, and heterochromatin. Microbiol Mol BioI Rev 2003;67(3):376-99, table of contents.

28. Bra..hmann CB, Sherman 1M, Devine SE, Cameron BE, Pillus 1., Boeke JD. The SIR2 gene family, conserved from bacteria to humans, functions in silencing, cell cycle progression, and chromosome stability. Genes Dev 1995;9(23):2888-902.

29. McBurney MW, Yang X, Jardine K, Hixon M, Boekelheide K, Webb JR, et aI. The mammalian SIR2a1pha protein has a role in embryogenesis and gametogenesis. Mol Cell BioI 2003;23(1 ):38-54.

30. Ouarente 1., Picard F. Calorie restriction--the SIR2 connection. Cell 2005; 120(4):473-82.

31. Sinclair D. Sirtuins for healthy neurons. Nat Genet 2005;37(4):339-40.

32. Cohen HY, Miller C, Bitterman KJ, Wall NR, Hekking B, Kessler B, et aI. Calorie restriction promotes mammalian cell survival by inducing the SIRTl deacetylase. Science 2004;305(5682):390-2.

33. Cheng lll." Mostoslavsky R, Saito S, Manis JP, Ou Y, Patel P, et aI. Developmental defects and p53 hyperacetylation in Sir2 homolog (SIRT1)­ deficient mice. Proc Natl Acad Sci USA 2003;100(19):10794-9.

34. Vaziri H, Dessain SK, Ng Eaton E, lmai SI, Frye RA, Pandita TK, et aI. hSIR2(SIRTl) functions as an NAD-dependent p53 deacetylase. Cell 2001; 107(2): 149-59.

35. Brunet A, Sweeney LB, Sturgill JF, Chua KF, Greer PL, Lin Y, et aI. Stress­ dependent regulation of FOXO transcription factors by the SIRT! deacetylase. Science 2004;303(5666):2011-5.

36. Oiannakou ME, Partridge L. The interaction between FOXO and SIRTl: tipping the balance towards survival. Trends Cell Bioi 2004;14(8):408-12.

37. Nakano K, Vousden KH. PUMA, a novel proapoptotic gene, is induced by p53. Mol Cell 2001;7(3):683-94.

38. Luo J, Nikolaev AY, lmai S, Chen D, Su F, Shiloh A. et aI. Negative control of p53 by Sir2a1pha promotes cell survival under stress. Cell 2001;107(2):137-48.

119 39. Greer EL. Brunet A. FOXO transcription factors at the interface between longevity and tumor suppression. Oncogene 2005;24(50):7410-25.

40. Lam EW. Francis RE. Petkovic M. FOXO transcription factors: key regulators of cell fate. Biochem Soc Trans 2006;34(pt 5):722-6.

41. Motta Me. Divecha N. Lemieux M. Kamel C. Chen D. Gu W. et al. Mammalian SIRTl represses forkhead transcription factors. Ce112004;116(4):551-63.

42. van der Horst A, Tertoolen LG. de Vries-Smits LM, Frye RA. Medema RH. Burgering BM. FOX04 is acetylated upon peroxide stress and deacetylated by the longevity protein hSir2(SIRT1). J BioI Chem 2004;279(28):28873-9.

43. You H. Mak TW. Crosstalk between p53 and FOXO transcription factors. Cell Cycle 2005;4(1):37-8.

44. You H, Yamamoto K. Mak TW. Regulation of transactivation-independent proapoptotic activity of p53 by FOX03a Proc Nat! Acad Sci USA 2006; 103(24):9051-6.

45. Barzilai N. Banerjee S. Hawkins M. Chen W. Rossetti L. Caloric restriction reverses hepatic insulin resistance in aging rats by decreasing visceral fat. J Clin Invest 1998;101(7):1353-61.

46. Dhahbi 1M. Mote PI., Wingo J, Rowley BC, Can Sx. Walford RL. et al. Caloric restriction alters the feeding response of key metabolic enzyme genes. Mech Ageing Dev 2001;122(10):1033-48.

47. Rodgers JT, Lerin C. Haas W. Gygi SP. Spiegelman BM. Puigserver P. Nutrient control of glucose homeostasis through a complex of PGC-lalpha and SIRT!. Nature 2005;434(7029): 113-8.

48. Picard F. Kurtev M, Chung N. Topark-Ngarm A, Senawong T, Machado De Oliveira R, et al. Sirtl promotes fat mobilization in white adipocytes by repressing PPAR-gamma Nature 2004;429(6993):771-6.

49. Tissenbaum HA. Guarente L. Increased dosage of a sir-2 gene extends lifespan in Caenorhabditis elegans. Nature 2001;410(6825):227-30.

50. Bordone I., Motta MC. Picard F. Robinson A, Jhala US. Apfeld J. et al. Sirtl regulates insulin secretion by repressing UCP2 in pancreatic beta cells. PLoS BioI 2006;4(2):e31.

120 51. Moynihan KA, Grimm AA. Plueger MM. Bernal-Mizrachi E, Ford E, Cras­ Meneur C, et al. Increased dosage of mammalian Sir2 in pancreatic beta cells enhances glucose-stimulated insulin secretion in mice. Cell Metab 2005;2(2): 105- 17.

52. Chan CB, Saleh MC, Koshkin V, Wheeler MB. Uncoupling protein 2 and islet function. Diabetes 2004;53 Suppll:SI36-42.

53. Joseph JW, Koshkin V, Zhang CY, Wang J, Lowell BB, Chan CB, et al. Uncoupling protein 2 knockout mice have enhanced insulin secretory capacity after a high-fat diet. Diabetes 2002;51(11):3211-9.

54. Zhang CY, Baffy G, Perret p, Krauss S, Peroni 0, Grujic D, et al. Uncoupling protein-2 negatively regulates insulin secretion and is a major link between obesity, beta cell dysfunction, and type 2 diabetes. Cell 2001;105(6):745-55.

55. Am.araI ME, Cunha DA, Anhe GF, Veno M, Carneiro EM, Velloso LA, et al. Participation of prolactin receptors and phosphatidylinositol 3-kinase and MAP kinase pathways in the increase in pancreatic islet mass and sensitivity to glucose during pregnancy. J EndocrinoI2004;183(3):469-76.

56. Freemark M, Avril I, Fleenor D, Driscoll p, Petro A, Opara E, et al. Targeted deletion of the PRL receptor: effects on islet development, insulin production, and glucose tolerance. Endocrinology 2002;143(4):1378-85.

57. Li C, Chen P, VaughanJ, Blount A, Chen A, JarniesonPM, et al. Vrocortin m is expressed in pancreatic beta-cells and stimulates insulin and glucagon secretion. Endocrinology 2003;144(7):3216-24.

58. Tang BL. SIRT!, neuronal cell survival and the insulinlIGF-l aging paradox. Neurobiol Aging 2006;27(3):501-5.

59. Trejo JL, Carro E, Lopez-Lopez C, Torres-Aleman I. Role of serum insulin-like growth factor I in mammalian brain aging. Growth Horm IOF Res 2004; 14 Suppl A:S39-43.

60. Carro E, Trejo JL, Gomez-Isla T, LeRoith D, Torres-Aleman I. Serum insulin-like growth factor I regulates brain amyloid-beta levels. Nat Med 2002;8( 12): 1390-7.

61. Torres-Aleman I. Sermn growth factors and neuroprotective surveillance: focus on IGF-I. Mol Neurobiol 2000;21(3):153-60.

121 62. Holzenberger M, Dupont J, Ducos B, Leneuve P, Geloen A, Even PC, et al. IGF-l receptor regulates lifespan and resistance to oxidative stress in mice. Nature 2003;421(6919): 182-7.

63. Kimura KD, Tissenbaum HA, tiu Y, Ruvkun G. daf-2, an insulin receptor-like gene that regulates longevity and diapause in Caenorhabditis e1egans. Science 1997;277(5328):942-6.

64. Tatar M, Kopelman A, Epstein D, Tu MP, Yin eM, Garofalo RS. A mutant Drosophila insulin receptor homolog that extends life-span and impairs neuroendocrine function. Science 2001;292(5514):107-10.

65. Wolkow CA, Kimura KD, Lee MS, Ruvkun G. Regulation of C. elegans life-span by insulinlike signaling in the nervous system. Science 2000;290(5489):147-50.

66. Sakamoto J, Miura T, Shimamoto K, Horio Y. Predominant expression of Sir2alpha, an NAD-dependent histone deacetylase, in the embryonic mouse heart and brain. FEBS Lett 2004;556(1-3):281-6.

67. Vincent AM, Feldman EL. Control of cell survival by IGF signaling pathways. Growth Horm IGF Res 2002;12(4):193-7.

68. Greider CW, Blackburn EH, The telomere terminal transferase of Tetrahymena is a ribonucleoprotein enzyme with two kinds of primer specificity. Cell 1987 51:887-898

69. Nakamura TM, Morin GB, Chapman KB, Weinrich SL, Andrews WH, Ungner J, Harley CB, Cech TR, Telomerase catalytic subunit homologs from fission yeast and human. Science 1997 277:955-959

70. Blasco MA, Lee HW, Hande MP, Samper E, Lansdorp PM, DePinho RA, Greider CW, Telomere shortening and tumor formation by mouse cells lacking telomerase RNA. Cell 1997 91:25-34

71. Olovnikov A, A theory ofmarginotomy. The incomplete copying of template margin in enzymic synthesis of polynucleotides and biological significance of the phenomenon. J Theor Bioi 1973 41:181-190

72. de Lange T, Shiue L, Myers RM, Cox DR, Naylor SL, Killery AM, Varmus HE, Structure and variability of human chromosome ends. Mol Cell Bioi 1990 10:518- 527

73. Greider CW, Futcher AB, Harley CB, Telomeres shorten during ageing of human fibroblasts. Nature 1990 345:458-460

122 74. Harley C, Telomere loss: mitotic clock or genetic time bomb? Mutat Res 1991 256:271-282

75. Hemann Mr, Strong MA, Hao LY, Greider CW, The shortest telomere, not average telomere length, is critical for cell viability and chromosome stability. Cell 2001 107:67-77

76. Bodnar AG, Ouellette M, Frolkis M, Holt SE, Chiu CP, Morin GB, Harley CB, Shay JW, Lichtsteiner S, Wright WE, Extension oflife-span by introduction of telomerase into normal human cells. Science 1998 279:349-352

77. Harley C, Telomerase is not an oncogene. Oncogene 2002 21 :494-502

78. McLaren A, Primordial germ cells in the mouse. Dev BioI 2003 262: 1-15

79. Kim NW, Piatyszek MA, Prowse KR, Harley CB, West MO, Ho PI., Coviello GM, Wright WE, Weinrich SL, Shay JW, Specific association of human telomerase activity with immortal cells and cancer. Science 1994 266:2011-2015

80. Wright DL, Jones EL, Mayer JF, Oebninger S, Gibbons WE, Lanzendorf SE, Characterization of telomerase activity in the human oocyte and preimplantation embryo. Mol Hum Reprod 2001 7:947-955

81. Dolci S, Levati I., Pellegrini M, Faraoni I, Graziani G, Di Carlo A, Geremia R, Stem cell factor activates telomerase in mouse mitotic spermatogonia and in primordial germ cells. J Cell Sci 2002 115:1643-1649

82. Yamamoto Y, Sofikitis N, Ono K, Kaki T, Isoyama T, Suzuki N, Miyagawa I, Postmeiotic modificatious of spermatogenic cells are accompanied by inhibition oftelomerase activity. Urol Res 199927:336-345

83. Wright WE, Piatyszek MA, Rainey WE, Byrd W, Shay JW, Telomerase activity in human germline and embryonic tissues and cells. Dev Genet 1996 18: 173-179

84. Gonzalez-Suarez E, Sarnper E, Ramirez A, Flores 1M, Martin-Caballero J, Jorcano JL, Blasco MA, Increased epidermal tumors and increased skin wound healing in trausgenic mice overexpressing the catalytic subunit of telomerase, TERT, in basal keratinocytes. EMBO J 200120:2619-2630

85. Flores I, Cayuela ML, Blasco MA, Effects of telomerase and telomere length on epidermal stem cell behavior. Science 2005 309: 1253-1256

123 86. Sarin KY. Cheung P. Gilison D. Lee E, Tennen RI, Wang E, Artandi MK, Oro AE. Artandi SE. Conditional telomerase induction causes proliferation of hair follicle stem cells. Nature 2005 436: 1048-1052

87. Szabo PE, Hubner K. Scholer H. Mann JR, Allele-specific expression of imprinted genes in mouse migratory primordial germ cells. Mech Dev 2002 115:157-160

88. Liu Y. Snow BE. Hande MP. Yeung D. Erdmann NJ. Wakeham A, ltie A. Siderovski DP. Lansdorp PM. Robinson MO. Harrington L. The telomerase reverse transcriptase is limiting and necessary for telomerase function in vivo. Curr BioI 2000 10:1459-1462

89. Greenberg RA. Allsopp RC. Chin L. Morin GB. DePinho RA, Expression of mouse telomerase reverse transcriptase during development. differentiation and proliferation. Oncogene 1998 16:1723-1730

90. Suganuma R. Pelczar p. Spetz IF. Hohn B. Yanagimachi R. Moisyadi S, TnS transposase-mediated mouse transgenesis. Bioi Reprod 2005 73:1157-1163

91. Allsopp R, Cheshier S. Weissman I, Telomere shortening accompanies increased cell cycle activity during serial transplantation of hematopoietic stem cells. J Exp Med 2001193:917-924

92. Cheshier SH. Morrison SJ. Liao X. Weissman IL, In vivo proliferation and cell cycle kinetics of long-term self-renewing hematopoietic stem cells. Proc Nat! Acad Sci USA 1999 96:3120-3125

93. Blasco MA. Funk W. Villeponteau B. Greider CWo Functional characterization and developmental regulation of mouse telomerase RNA. Science 1995 269: 1267- 1270

94. Liu K. Hodes RI. Weng NP. Cutting edge: telmnerase activation in human T lymphocytes does not require increase in telomerase reverse transcriptase (hTERT) protein but is associated with hTERT phosphorylation and nuclear translocation. J ImmunoI2001166:4826-4830

95. Seimiya H. Sawada H. Muraruatsu Y. Shimizu M. Obko K, Yamane K, Tsuruo T. Involvement of 14-3-3 proteins in nuclear localization oftelomerase. EMBO J 2000 19:2652-2661

96. Allsopp Re. Chang E. Kashefi-Aazarn M. Rogaev EI, Piatyszek MA. Shay JW. Harley CB. Telomere shortening is associated with cell division in vitro and in vivo. Exp Cell Res 1995220:194-200

124 97. Masutomi K, Yu EY, Khurts S, Ben-Porath I, Currier JL, Metz GB, Brooks MW, Kaneko S, Murakami S, DeCaprio JA, Weinberg RA, Stewart SA, Hahn WC, Telomerase maintains telomere structure in normal human cells. Cell 2003 114:241-253

98. Stewart SA, Hahn WC, O'Connor BF, Banner EN, Lundberg AS, Modha P, Mizuno H, Brooks MW, Fleming M, Zimonjic DB, Popescu NC, Weinberg RA, Telomerase contributes to tmnorigenesis by a telomere length-independent mechanism. Proc Nat! Acad Sci USA 2002 99:12606-12611

99. Masutomi K, Possemato R, Wong 1M, Currier JL, Tothova Z. Manola JB, Ganesan S, Lansdorp PM, Collins K, Hahn WC, The telomerase reverse transcriptase regulates chromatin state and DNA damage responses. Proc Natl Acad Sci USA 2005 102:8222-8227

100. Zhu H, Fu W, Mattson MP, The catalytic subunit oftelomerase protects neurons against amyloid beta-peptide-induced apoptosis. J Neurochem 2000 75:117-124

101. Kipling D, Cooke H, Hypervariable ultra-long telomeres in mice. Nature 1990 347:400-402

102. Erdmann N, Liu Y, Harrington L, Distinct dosage requirements for the maintenance of long and short telomeres in Tert heterozygous mice. Proc Nat! Acad Sci USA 2004 10 1:6080-6085

103. Allsopp RC, Morin GB, Horner JW, DePinho R, Harley CB, Weissman IL, Effect of TERT over-expression on the long-term transplantation capacity of hematopoietic stem celIs. Nat Med 2003 9:369-371

104. Artandi SE, A1son S, Tietze MK, Sharpless NE, Ye S, Greenberg RA, Castrillon DH, Homer JW, Weiler SR, Carrasco RD, DePinho RA, Constitutive telomerase expression promotes mammary carcinomas in aging mice. Proc Nat! Acad Sci U SA 2002 99:8191-8196

105. Wang J, Xie LY, Allan S, Beach D, Hannon GJ, Myc activates telomerase. Genes Dev 199812:1769-1774

106. Lin SY, Elledge SJ, Multiple tumor suppressor pathways negatively regulate telomerase. Cell 2003 113:881-889

107. Shore D, Squire M, Nasmyth KA (1984) Characterization of two genes required for the position-effect control of yeast mating-type genes. EMBO J. 3: 2817-23.

125 108. Imai S, Armstrong CM, Kaeberlein M, Ouarente L (2000) Transcriptional silencing and longevity protein Sir2 is an NAD-dependent histone deacetylase. Nature. 403: 795-800.

109. Kennedy BK, Smith ED, Kaeberlein M (2005) The enigmatic role of Sir2 in aging. Cell. 18: 548-50.

110. Smith JS, Bracbmann CB, Celic I, Kenna MA, Muhammad S, et al. (2000) A phylogenetically conserved NAD+-dependent protein deacetylase activity in the Sir2 protein family. Proc Nat! Acad Sci USA, 97: 665~3.

111. Kitamura YI, Kitamura T, Kruse JP, Raum JC, Stein R, et al. (2005) FoxOI protects against pancreatic beta cell failure through NeuroD and MafA induction. Cell Metab. 2: 153--63.

112. Ouarente L (2006) Sirtuins as potential targets for metabolic syndrome. Nature, 444: 868-74.

113. Araki T, Sasaki Y, Milbrandt J (2004) Increased nuclear NAD biosynthesis and SIRT! activation prevent axonal degeneration. Science. 305: 1010-3.

114. Chen J, Zhou Y, Mneller-Steiner S, Chen LF, Kwon H, et al. (2005) SIRT! protects against microglia-dependent amyloid-beta toxicity through inhibiting NF­ kappaB signaling. J BioI Chern. 280: 40364-74.

115. Yeung F, Hoberg JE, Ramsey CS, Keller MD, Jones DR, et al. (2004) Modulation of NF-kappaB-dependent transcription and cell survival by the SIRT! deacetylase. EMBO J. 23: 2369-80.

116. Wang C, Chen L, Hou X, Li Z. Kabra N, et al. (2006) Interactions between E2Fl and SirTl regulate apoptotic response to DNA damage. Nat Cell BioI. 8: 1025- 31.

117. Li H, Rajendran OK, Liu N, Ware C, Rubin BP, et al. (2007) SirT! modulates the estrogen-insulin-like growth factor-l signaling for postnatal development of mammary gland in mice. Breast Cancer Res. 9: R1.

118. Chua KF, Mostoslavsky R, Lombard DB, Pang WW, Saito S, et al. (2006) Mammalian SIRT! limits replicative life span in response to chronic genotoxic stress. Cell Metab. 2: 67-76.

119. Conssens M, Yamazaki Y, Moisyadi S, Suganuma R, Yanagimachi R, et al. (2006) Regulation and effects of modulation of telomerase reverse transcriptase 126 expression in primordial germ cells during development. BioI Reprod. 75: 785- 91.

120. Nagy A, Gertsenstein M, Vintersten K, Behringer R (2002) ManiJulating the mouse embryo: a laboratory manual. Cold Spring Harbor Press. 3 edition.

121. Hoppe p. Pitts S (1973) Fertilization in vitro and development of mouse ova. BioI Reprod. 8: 420-6.

122. Yuan Z, Zhang X. Sengupta N. Lane WS. Seto E (2007) SIRTl regulates the function of the Nijmegen breakage syndrome protein. Mol Cell. 27: 14~2.

123. Ashburner M. Ball CA, Blake JA, Botstein D. Butler II, et al. Gene ontology: Tool for the unification of biology. The Gene Ontology Consortium. Nat Genet 25: 25-29.

124. Bouras T. Fu M. Sauve AA, Wang F. Quong AA. et al. (2005) SIRTI deacetylation and repression of p300 involves lysine residues 1020/1024 within the cell cycle regulatory domain 1. J BioI Chern. 280: 10264--76.

125. Mendoza-Lujambio I. Burfeind p. Dmens C. Meinhardt A. Hoyer-Fender S. et al. (2002) The Hook 1 gene is non-functional in the abnorma1 spermatozoon head shape (azh) mutant mouse. Hum Mol Genet. II: 1647-58.

126. Welch J. O'Rand M (1990) Characterization of a sperm-specific nuclear antoantigenic protein. ll. Expression and localization in the testis. BioI Reprod. 43: 569-78.

127. Stankovic-Valentin N. Deltour S. Seeler J. Pinte S. Vergoten G. et al. (2007) An acetylationldeacetylation-SUMOylation switch through a phylogenetica1ly conserved psiKXEP motif in the tumor suppressor mCI regulates transcriptional repression activity. Mol Cell BioI. 27: 2661-75.

128. Hopper. A. K.. and Hall. B. D. (1975). Mating type and sporulation in yeast I. Mutations which alter mating-type control over sporulation. Genetics 80. 41-59.

129. KIar. AJ.S.• Fogel. S.• and MacLeod, K. (1979). MARl-a regulator ofHMa and HMalpha loci in Saccharomyces cerevisiae. Genetics 93. 37-50.

130. Rine, J. D., N. S. J., Hicks, J. B.• and Herskowitz. I. (1979). A suppressor of mating type locus mutations in Saccharomyces cerevisiae: evidence for and identification of cryptic mating type loci. Genetics 93. 877-901.

127 131. Kaeberlein, M .• McVey, M .• and Guarente. L. (1999). The SIR2I3/4 complex and SIR2 alone promote longevity in Saccharomyces cerevisiae by two different mechanisms. Genes Dev 13. 2570-2580.

132. Tissenbaum, H. A., and Guarente, L. (2001). Increased dosage of a sir-2 gene extends lifespan in Caenorhabditis elegans. Nature 410. 227-230.

133. Lin, S. J .• Defossez. P. A.. and Guarente. L. (2000). Requirement of NAD and S1R2 for life-span extension by calorie restriction in Saccharomyces cerevisiae. Science 289, 2126--2128.

134. Lamming. D. W .• Latorre-Esteves. M., Medvedik. 0 .• Wong, S. N.• Tsang. F. A.• Wang, C., Lin, S. J .• and Sinclair, D. A. (2005). HST2 mediates SIR2- independent life-span extension by calorie restriction. Science 309.1861-1864. Epub 2005 Ju128.

135. Kaeberlein, M., Kirkland, K. T .• Fields, S., and Kennedy, B. K. (2004). Sir2- independent life span extension by calorie restriction in yeast. PLoS BioI 2. E296. Epub 2004 Aug 24.

136. Kaeberlein, M., Steffen, K. K., Hu, D., Dang, N.• Kerr. E. 0 .• Tsuchiya, M.• Fields. S .• and Kennedy, B. K. (2006). Comment on "HST2 mediates SIR2- independent life-span extension by calorie restriction". Science 312. 1312.

137. Fabrizio. P., Gattazzo. C .• Battistella, L., Wei. M.• Cheng. C., McGrew. K .• and Longo, V. D. (2005). Sir2 blocks extreme life-span extension. Cell 123. 655-667. 138. Moazed, D. (2001). Enzymatic activities of Sir2 and chromatin silencing. Curro Opin. Cell Biol!3. 232-238.

139. Tanner. K. G., Landry. J .• Sternglanz. R.. and Denu, J. M. (2000). Silent information regulator 2 family of NAD-dependent histone/protein deacetylases generates a unique product, 1-0-acetyl-ADP-ribose. Proc. Nat!. Acad. Sci. USA 97, 14178-14182.

140. Tanny. J. C.• and Moazed. D. (2001). Coupling of histone deacetylation to NAD breakdown by the yeast silencing protein Sir2. Evidence for acetyl transfer from substrate to an NAD breakdown product. Proc. Nat!. Acad. Sci. USA 98. 415-- 420.

141. Luo, J .• Nikolaev. A. Y., Imai, S., Chen, D .• Su, F .• Shiloh, A.• Guarente, L., and Gu, W. (2001). Negative control ofp53 by Sir2alpha promotes cell survival nnder stress. Cell 107. 137-148.

128 142. Vaziri, H., and Benchimol, S. (1998). Reconstitution oftelomerase activity in normal human cells leads to elongation of telomeres and extended replicative life span. Curr. Bioi 8, 279-282.

143. Langley, E., Pearson, M., Faretta, M., Bauer, U. M., Frye, R. A., Minucci, S., Pelicci, P. G., and Kouzarides, T. (2002). Human SIR2 deacetylates p53 and antagonizes PMUp53-induced cellular senescence. EMBO J 21, 2383-2396.

144. Michishita, E., Park, J. Y., Burneskis, J. M., Barrett, J. C., and Horikawa, I. (2005). Evolutionarily conserved and nonconserved cellular localizations and functions of human SIRT proteins. Mol. BioI. Cell 16, 4623-463S. Epub 200S Aug 3.

145. Nemoto, S., Fergusson, M. M., and FInkel, T. (2004). Nutrient availability regulates SIRT! through a forkhead-dependent pathway. Science 306, 21OS- 2108.

146. Cohen, H. Y., Lavu, S., Bitterman, K. J., Hekking, B.,lmahiyerobo, T. A., Miller, C., Frye, R., Ploegh, H., Kessler, B. M., and Sinclair, D. A. (2004a). Acetylation of the C terminus of Ku70 by CBP and PCAF controls Bax-mediated apoptosis. Mol. Cell 13, 627-638.

147. Vaquero, A., Scher, M., Lee, D., Erdjument-Bromage, H., Tempst, P., and Reinberg, D. (2004). Human SirTl interacts with histone HI and promotes formation of facultative heterochromatin. Mol. Cell 16, 93-10S.

148. Chen, W. Y., Wang, D. H., Yen, R. C., Luo, J., Gn, W., and Baylin, S. B. (2005). Tumor suppressor mCl directly regulates SIRT! to modulate p53- dependent DNA-damage responses. Cell 123, 437-448.

149. Kim, E. J., Kho, J. H., Kang, M. R., and Urn, S. J. (2007). Active regulator of SIRTI cooperates with SIRT! and facilitates suppression of pS3 activity. Mol. Cell 28, 277-290.

ISO. McAinsh, A. D., Scott-Drew, S., Murray, J. A., and Jackson, S. P. (1999). DNA damage triggers disruption oftelomeric silencing and Meclp-dependent relocation of Sir3p. Curro BioI 9, 963-966.

151. Mills, K. D., Sinclair, D. A., and Guarente, L. (1999). MECI-dependent redistribution of the Sir3 silencing protein from telomeres to DNA double-strand breaks. Cell 97, 609-620.

129 152. Moretti, P., Freeman, K., Coodly, L., and Shore, D. (1994). Evidence that a complex of SIR proteins interacts with the silencer and telomere-binding protein RAP!. Genes Dev 8, 2257-2269.

153. Greider, C. W., and Blackburn, E. H. (1985). Identification of a specific telomere terminal transferase activity in Tetrahymena extracts. Cell 43, 405-413.

154. Morin, G. B. (1989). The human telomere terminal transferase enzyme is a ribonucleoprotein that synthesizes TTAGGG repeats. Cell 59, 521-529.

155. Harrington, L., Zhou, W., McPhail, T., Oulton, R., Yeung, D. S., Mar, V., Bass, M. B., and Robinson, M. O. (1997). Human telomerase contains evolutionarily conserved catalytic and structural subunits. Genes Dev 11,3109-3115.

156. Meyerson, M. et al. (1997). hEST2, the putative human telomerase catalytic subunit gene, is up-regulated in tumor cells and during immortalization. Cell 90, 785-795.

157. Feng, J. et al. (1995). The RNA component of human telomerase. Science 269, 1236-1241.

158. Lee, H. W., Blasco, M. A., Gottlieb, G. J., Homer, J. W., 2nd, Greider, C. W., and DePinho, R. A. (1998). Essential role of mouse telomerase in highly proliferative organs. Nature 392, 569-574.

159. van Steensel, B., and de Lange, T. (1997). Control of telomere length by the human telomeric protein TRF1. Nature 385, 740-743.

160. Smogorzewska, A., and de Lange, T. (2004). Regulation of telomerase by telomeric proteins. Annu. Rev. Biochem 73, 177-208.

161. Baumann, P., and Cech, T. R. (2001). PotI, the putative telomere end-binding protein in fission yeast and humans. Science 292, 1171-1175.

162. Colgin, L. M., Baran, K., Baumann, P., Cech, T. R., and Reddel, R. R. (2003). Human POTI facilitates telomere elongation by telomerase. Curr. BioI 13, 942- 946.

163. Harley, C. B., Futcher, A. B., and Greider, C. W. (1990). Telomeres shorten during ageing of human fibroblasts. Nature 345, 458-460.

164. Counter, C. M., Avilion, A. A., LeFeuvre, C. E., Stewart, N. G., Greider, C. W., Harley, C. B., and Bacchetti, S. (1992). Telomere shortening associated with 130 chromosome instability is arrested in immortal cells which express telomerase activity. EMBO J 11, 1921-1929.

165. Allsopp, R. C., Vaziri, H., Patterson, C., Goldstein, S., Younglai, E. V., Futcher, A. B., Greider, C. W., and Harley, C. B. (1992). Telomere length predicts replicative capacity of human fibroblasts. Proc. Natl. Acad. Sci. USA 89, 10114- 10118.

166. Chiu, C. P., Dragowska. W., Kim, N. W., Vaziri, H., Yui, J., Thomas, T. E., Harley, C. B., and Lansdorp, P. M. (1996). Differential expression oftelomerase activity in hematopoietic progenitors from adult human bone marrow. Stem Cells 14,239-248.

167. Vaziri, H., Dragowska, W., Allsopp, R. C., Thomas, T. E., Harley, C. B., and Lansdorp, P. M. (1994). Evidence for a mitotic clock in human hematopoietic stem cells: loss of telomeric DNA with age. Proc. Natl. Acad. Sci. USA 91, 9857- 9860.

168. Shamblott, M. J., Axelman, J., Littlefield, J. W., Blumenthal, P. D., Huggins, G. R., Cui, Y., Cheng, L., and Gearhart, J. D. (2001). Human embryonic germ cell derivatives express a broad range of developmentally distinct markers and proliferate extensively in vitro. Proc. Natl. Acad. Sci. USA 98, 113-118.

169. Kim, N. W., and Wn, F. (1997). Advances in quantification and characterization of telomerase activity by the telomeric repeat amplification protocol (TRAP). Nucleic Acids Res 25, 2595-2597.

170. Ota, H., Tokunaga, E., Chang, K., Hikasa, M., Iijima, K., Eto, M., Kozaki, K., Akishita, M., Ouchi, Y., and Kaneki, M. (2006). Sirtl inhibitor, Sirtinol, induces senescence-like growth arrest with attenuated Ras-MAPK signaling in human cancer cells. Oncogene 25,176-185.

171. Allsopp, R. C., Cheshier, S., and Weissman, I. L. (2002). Telomerase activation and rejuvenation of telomere length in stimulated T cells derived from serially transplanted hematopoietic stem cells. J. Exp. Med 196, 1427-1433.

172. Rossi, D. J., Bryder, D., Zahn, J. M., Ahlenius, H., Sonn, R., Wagers, A. J., and Weissman, I. L. (2005). Cell intrinsic alterations underlie hematopoietic stem cell aging. Proc. Natl. Acad. Sci. USA 102,9194-9199. Epub 2005 Jun 20.

173. Yilmaz, O. H., Kiel, M. J., and Morrison, S. J. (2006). SLAM family markers are conserved among hematopoietic stem cells from old and reconstituted mice and markedly increase their purity. Blood 107, 924-930. Epub 2005 Oct 11.

131 174. Kiel, M. J., Yilmaz, O. H., Iwashita, T., Terhorst, C., and Morrison, S. J. (2005). SLAM family receptors distinguish hematopoietic stem and progenitor cells and reveal endothelial niches for stem cells. Cell 121, 1109-1121.

175. Chua, K. F. et aI. (2005). Mammalian SIRTl limits replicative life span in response to chronic genotoxic stress. Cell Metab 2, 67-76.

176. Ota, H., Akishita, M., Eto, M., lijima, K., Kaneki, M., and Ouchi, Y. (2007). Sirtl modulates premature senescence-like phenotype in human endothelial cells. J. Mol. Cell Cardiol43, 571-579. Epub 2007 Aug 22.

177. Salt, I. P., Jolmson, G., Ashcroft, S. J., and Hardie, D. G. (1998). AMP-activated protein kinase is activated by low glucose in cell lines derived from pancreatic beta cells, and may regulate insulin release. Biochern.. J 335, 533-539. 178. Dasgupta, B., and Milbrandt, J. (2007). Resveratrol stimulates AMP kinase activity in neurons. Proc. Natl. Acad. Sci. USA 104,7217-7222. Epub 2007 Apr 16.

179. Weindruch, R. (1992). Effect of caloric restriction on age-associated cancers. Exp. Geronto127, 575-581.

180. Yatabe N, Kyo S, Maida Y, Nishi H, Nakamura M, Kanaya T, Tanaka M, lsaka K, Ogawa S, Inoue M. HIP-I-mediated activation of telomerase in cervical cancer cells. Oncogene. 2004 Apr 29;23(20):3708-15.

181. Yamauchi Y, Ward MA. Preservation of ejaculated mouse spermatozoa from fertile C57BU6 and infertile Hook1IHookl mice collected from the uteri of mated females. BioI Reprod. 2007 Jun;76(6):1002-8.

182. Alekseev OM, Widgren BE, Richardson RT, O'Rand MG. Association of NASP with HSP90 in monse spermatogenic cells: stimulation of ATPase activity and transport of linker histones into nuclei. J Bioi Chern.. 2005 Jan 28;280(4):2904- 11.

183. Wilson VG, Heaton PRo Ubiquitin proteolytic system: focus on SUMO. Expert Rev Proteomics. 2008 Feb;5(1):121-35.

132