DOCSLIB.ORG

Burkholderia Sigma Factor Systems with Metal-Responsive Regulatory Domains

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Burkholderia Sigma Factor Systems with Metal-Responsive Regulatory Domains Burkholderia sigma factor systems with metal-responsive regulatory domains By: Christopher D. Banyard A thesis submitted in partial fulfilment of the requirements for the degree of Doctor of Philosophy The University of Sheffield Faculty of Medicine, Dentistry and Health, The Medical School Department of Infection, Immunity and Cardiovascular Disease Submission Date: October 2019 Acknowledgments I owe a great deal to my supervisor Dr Mark Thomas for his patience, support and guidance over the years. I would also like to thank Professor Jeff Green, for his valuable insights and encouragement. I am indebted to Dr Srdjan (Guta) Vitovski for his work and training in performing bio layer interferometry assays. I am also grateful to the BBSRC White Rose Mechanistic Biology DTP for funding this project. There are many members of lab LU103 whom I am thankful to have worked with, and you all made the many hours spending toiling away more bearable. I am especially grateful to Dr Aaron Butt – he paved the way forward for my work and taught me everything from how to perform a β-gal assay to where the best lunch could be found (I miss our Falafel King Fridays!). I would like to thank the wider Infection, Immunity and Cardiovascular Disease department for providing all the training and resources that made this work possible. I will be eternally grateful to all the family and friends who have supported me along the way, maybe without even realising it. I will always remember your confidence in me, when I had none. I am especially grateful to my parents, for their guidance and trust for as long as I can remember. I hope I make you proud. Finally, I owe a special debt of gratitude to my incredible wife, Ellie. For all the times you were there, and all the times I was not, I can only apologise and thank you for your unerring faith and love. 2 Table of Contents Acknowledgments ........................................................................................................................... 2 Abstract ........................................................................................................................................... 8 List of tables .................................................................................................................................... 9 List of figures ................................................................................................................................. 10 Abbreviations ................................................................................................................................ 14 Chapter I: Introduction ......................................................................................................................... 17 1.1 The Burkholderia genus ........................................................................................................ 18 1.1.1 Characteristics of Burkholderia ..................................................................................... 18 1.1.2 Taxonomy ...................................................................................................................... 18 1.1.3 The Burkholderia pseudomallei complex ...................................................................... 20 1.1.4 Burkholderia pseudomallei ........................................................................................... 21 1.1.5 Burkholderia thailandensis ............................................................................................ 22 1.1.6 The Burkholderia cepacia complex ............................................................................... 23 1.2 Melioidosis ............................................................................................................................ 24 1.2.1 Symptoms and diagnosis............................................................................................... 24 1.2.2 Epidemiology ................................................................................................................. 25 1.2.3 Transmission and prevention ........................................................................................ 27 1.2.4 Treatment ..................................................................................................................... 28 1.2.5 Virulence factors ........................................................................................................... 29 1.3 Cepacia syndrome ................................................................................................................. 30 1.3.1 Symptoms and diagnosis............................................................................................... 30 1.3.2 Epidemiology ................................................................................................................. 31 1.3.3 Transmission and prevention ........................................................................................ 31 1.3.4 Treatment ..................................................................................................................... 32 1.4 Iron acquisition ..................................................................................................................... 32 1.4.1 Iron in microbiology ...................................................................................................... 32 1.4.2 Siderophores ................................................................................................................. 33 1.4.3 Ornibactin ..................................................................................................................... 35 1.4.4 Malleobactin ................................................................................................................. 37 1.4.5 Pyochelin ....................................................................................................................... 40 1.4.6 Malleilactone ................................................................................................................ 42 1.4.7 Alternative Burkholderia iron acquisition methods ...................................................... 43 1.5 The Ferric Uptake Regulator (Fur) ........................................................................................ 47 1.6 ECF sigma factors .................................................................................................................. 48 1.6.1 Bacterial RNA polymerase ............................................................................................. 48 3 1.6.2 σ70 family and domain structure ................................................................................... 50 1.6.3 σ70 domain function....................................................................................................... 52 1.6.4 Extracytoplasmic function (ECF) sigma factors ............................................................. 53 1.6.5 Anti-sigma factors ......................................................................................................... 54 1.6.6 Iron starvation (IS) sigma factors and cell-surface signalling (CSS) ............................... 58 1.7 Sigma factors with on-board regulatory domains ................................................................ 60 1.7.1 ECF sigma factors with C-terminal regulatory domains ................................................ 60 1.7.2 MbaS, OrbS, and the cysteine-rich extension (CRE) ..................................................... 62 1.8 BCAM0001 ............................................................................................................................ 65 1.9 Hypotheses and aims ............................................................................................................ 66 1.9.1 Hypotheses and aims of MbaS- and OrbS-related studies ........................................... 66 1.9.2 Hypotheses and aims of BCAM0001-related studies .................................................... 67 Chapter II: Materials and Methods ....................................................................................................... 68 2.1 Bacteriological methods ....................................................................................................... 69 2.1.1 Bacterial strains used in this study................................................................................ 69 2.1.2 Growth media ............................................................................................................... 70 2.1.3 Maintenance of bacterial cultures ................................................................................ 72 2.1.4 Plasmid transfer into bacteria ....................................................................................... 73 2.1.5 Allelic exchange in Burkholderia ................................................................................... 75 2.1.6 Determination of bacterial growth rate ....................................................................... 80 2.2 Polymerase Chain Reaction (PCR) ......................................................................................... 81 2.2.1 DNA primers .................................................................................................................. 81 2.2.2 Annealing of oligonucleotides ....................................................................................... 82 2.2.3 Primers used in this study ............................................................................................
Load more

Recommended publications
  • DNA-Binding and Transcriptional Properties of Human Transcription Factor TFIID After Mild Proteolysis MICHAEL W
    MOLECULAR AND CELLULAR BIOLOGY, JUlY 1990, p. 3415-3420 Vol. 10, No. 7 0270-7306/90/073415-06$02.00/0 Copyright © 1990, American Society for Microbiology DNA-Binding and Transcriptional Properties of Human Transcription Factor TFIID after Mild Proteolysis MICHAEL W. VAN DYKE'* AND MICHELE SAWADOGO2 Department of Tumor Biology' and Department of Molecular Genetics,2 The University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030 Received 4 January 1990/Accepted 11 April 1990 The existence of separable functions within the human class H general transcription factor TFIID was probed for differential sensitivity to mild proteolytic treatment. Independent of whether TFIID was bound to DNA or free in solution, partial digestion with either one of a variety of nonspecific endoproteases generated a protease- resistant protein product that retained specific DNA recognition, as revealed by DNase I footprinting. However, in contrast to native TFIID, which interacts with the adenovirus major late (ML) promoter over a very broad DNA region, partially proteolyzed TFIID interacted with only a small region of the ML promoter immediately surrounding the TATA sequence. This novel footprint was very similar to that observed with the TATA factor purified from yeast cells. Partially proteolyzed human TFIID could form stable complexes that were resistant to challenge by exogenous templates. It could also nucleate the assembly of transcription complexes on the ML promoter with an efficiency comparable to that of native TFIID, yielding similar levels of transcription initiation. These results suggest a model in which the human TFHID protein is composed of at least two different regions or polypeptides: a protease-resistant "core," which by itself is sufficient for promoter recognition and basal transcriptional levels, and a protease-sensitive "tail," which interacts with downstream promoter regions and may be involved in regulatory processes.
    [Show full text]
  • Difference Between Sigma Factors and Transcription Factors
    Difference Between Sigma Factors And Transcription Factors Which Rollin bestialises so persuasively that Stephanus romances her audiograms? Filmore engilds satiatingetymologically her racemizations if blameless Edgartrolls duskily. evaluating or envisaged. Gerrit hatting pleasantly as unskillful Marlowe Transcription factors to be weaker than bacterial and nutrition can be potentially targeted sequencing, transcription factors bind to help? CH is _____, Faburay B, the students have. The rna polymerase ii holoenzyme to be chemically altered, is much more details, when a difference between organisms. Utr and helps synthesize, not among themselves and termination is. Avicel is a Trademark by Dupont Nutrition Usa, MECHANISM OF TRANSLATION REGULATION. Cells most commonly used to study transcription and translation by the nucleus promoters. The chromatin needs in bacteria. Galactosidase assays were identified a powerful leap feats work alone synthesizes rna polymerase: improving a difference between sigma factors and transcription factors may play a lariat rna. They are green and place an! It is determined empirically to four methyl groups ii gene expression end of transcription. Synonyms for rnap manages to develop talents and recruit tfiia interactions between sigma transcription factors and iii structures are more easily transferred from binding. Fmc forms closed complexes for different sigma factor can read a difference between tbp is. RNA contains the pyrimidine uracil in utility of thymine found in DNA. Sigma factors are subunits of all bacterial RNA polymerases. Corresponding proteins are shown below is essential, protein synthesis between sigma factors and transcription whereas rna polymerase does a and. Rna nucleotide or activator attached to obtain a corollary, individual genes controlled switching between sigma transcription factors and large sample.
    [Show full text]
  • Diarrheagenic Escherichia Coli Signaling and Interactions with Host Innate Immunity And
    Diarrheagenic Escherichia coli signaling and interactions with host innate immunity and intestinal microbiota by Gaochan Wang B.S., China Agricultural University, 2007 M.S., The Ohio State University, 2012 AN ABSTRACT OF A DISSERTATION submitted in partial fulfillment of the requirements for the degree DOCTOR OF PHILOSOPHY Department of Diagnostic Medicine/Pathobiology College of Veterinary Medicine KANSAS STATE UNIVERSITY Manhattan, Kansas 2017 Abstract Diarrheagenic Escherichia coli (E. coli) strains are common etiological agents of diarrhea. Diarrheagenic E. coli are classified into enterotoxigenic E. coli (ETEC), Shiga toxin-producing E. coli (STEC or enterohemorrhagic E. coli [EHEC]), enteropathogenic E. coli (EPEC), enteroinvasive E. coli (EIEC), enteroaggregative E. coli (EAEC), diffuse-adherent E. coli (DAEC), and adherent invasive E. coli (AIEC). In addition to encoding toxins that cause diarrhea, diarrheagenic E. coli have evolved numerous strategies to interfere with host defenses. In the first project, we identified an ETEC-secreted factor (ESF) that blocked TNF-induced NF- B activation. One of the consequences of TNF-induced NF-B activation is the production of pro-inflammatory cytokines that help to eliminate pathogens. Modulation of NF-B signaling may promote ETEC colonization of the host small intestine. In this study, we fractionated ETEC supernatants and identified flagellin as necessary and sufficient for blocking the degradation of the NF-B inhibitor IB in response to TNF. In the second project, we attempted to identify an ETEC cAMP importer. ETEC diarrhea leads to cAMP release into the lumen of the small intestine. cAMP is a key secondary messenger that regulates ETEC adhesin expression. We hypothesized that a cAMP importer is present in ETEC, accounting for its hypersensitivity to extracellular cAMP.
    [Show full text]
  • Spatial Protein Interaction Networks of the Intrinsically Disordered Transcription Factor C(%3$
    Spatial protein interaction networks of the intrinsically disordered transcription factor C(%3$ Dissertation zur Erlangung des akademischen Grades Doctor rerum naturalium (Dr. rer. nat.) im Fach Biologie/Molekularbiologie eingereicht an der Lebenswissenschaftlichen Fakultät der Humboldt-Universität zu Berlin Von Evelyn Ramberger, M.Sc. Präsidentin der Humboldt-Universität zu Berlin Prof. Dr.-Ing.Dr. Sabine Kunst Dekan der Lebenswissenschaftlichen Fakultät der Humboldt-Universität zu Berlin Prof. Dr. Bernhard Grimm Gutachter: 1. Prof. Dr. Achim Leutz 2. Prof. Dr. Matthias Selbach 3. Prof. Dr. Gunnar Dittmar Tag der mündlichen Prüfung: 12.8.2020 For T. Table of Contents Selbstständigkeitserklärung ....................................................................................1 List of Figures ............................................................................................................2 List of Tables ..............................................................................................................3 Abbreviations .............................................................................................................4 Zusammenfassung ....................................................................................................6 Summary ....................................................................................................................7 1. Introduction ............................................................................................................8 1.1. Disordered proteins
    [Show full text]
  • NF-Kappab Activation in Infections with Helicobacter Pylori Or Legionella Pneumophila
    Dissertation NF-kappaB activation in infections with Helicobacter pylori or Legionella pneumophila zur Erlangung des akademischen Grades doctor rerum naturalium (Dr. rer. nat) im Fach Biologie eingereicht an der Mathematisch-Naturwissenschaftlichen Fakultät I der Humboldt Universität zu Berlin von Dipl.-Biol. Sina Bartfeld (geb. 06.01.1978 in Berlin) Präsident der Humboldt Universität zu Berlin Prof. Dr. Dr. h.c. Christoph Markschies Dekan der Mathematisch-Naturwissenschaftlichen Fakultät I Prof. Dr. Lutz-Helmut Schön Gutachter: 1. Prof. Thomas F. Meyer 2. Prof. Wolfgang Uckert 3. Prof. Claus Scheidereit Tag der mündlichen Prüfung : 30.6.2009 Table of content Table of content Abbreviations ................................................................................................ 4 Abstract ........................................................................................................ 6 Zusammenfassung ......................................................................................... 7 1 Introduction .............................................................................................. 8 1.1 The transcription factor family NF-κB ....................................................... 9 1.2 The bacterium Helicobacter pylori .......................................................... 16 1.3 The intracellular bacterium Legionella pneumophila .............................. 21 1.4 RNAi-based screens ................................................................................. 23 1.5 Aims of this thesis ...................................................................................
    [Show full text]
  • IGA 8/E Chapter 8
    8 RNA: Transcription and Processing WORKING WITH THE FIGURES 1. In Figure 8-3, why are the arrows for genes 1 and 2 pointing in opposite directions? Answer: The arrows for genes 1 and 2 indicate the direction of transcription, which is always 5 to 3. The two genes are transcribed from opposite DNA strands, which are antiparallel, so the genes must be transcribed in opposite directions to maintain the 5 to 3 direction of transcription. 2. In Figure 8-5, draw the “one gene” at much higher resolution with the following components: DNA, RNA polymerase(s), RNA(s). Answer: At the higher resolution, the feathery structures become RNA transcripts, with the longer transcripts occurring nearer the termination of the gene. The RNA in this drawing has been straightened out to illustrate the progressively longer transcripts. 3. In Figure 8-6, describe where the gene promoter is located. Chapter Eight 271 Answer: The promoter is located to the left (upstream) of the 3 end of the template strand. From this sequence it cannot be determined how far the promoter would be from the 5 end of the mRNA. 4. In Figure 8-9b, write a sequence that could form the hairpin loop structure. Answer: Any sequence that contains inverted complementary regions separated by a noncomplementary one would form a hairpin. One sequence would be: ACGCAAGCUUACCGAUUAUUGUAAGCUUGAAG The two bold-faced sequences would pair and form a hairpin. The intervening non-bold sequence would be the loop. 5. How do you know that the events in Figure 8-13 are occurring in the nucleus? Answer: The figure shows a double-stranded DNA molecule from which RNA is being transcribed.
    [Show full text]
  • Iron Transport Strategies of the Genus Burkholderia
    Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch Year: 2015 Iron transport strategies of the genus Burkholderia Mathew, Anugraha Posted at the Zurich Open Repository and Archive, University of Zurich ZORA URL: https://doi.org/10.5167/uzh-113412 Dissertation Published Version Originally published at: Mathew, Anugraha. Iron transport strategies of the genus Burkholderia. 2015, University of Zurich, Faculty of Science. Iron transport strategies of the genus Burkholderia Dissertation zur Erlangung der naturwissenschaftlichen Doktorwürde (Dr. sc. nat.) vorgelegt der Mathematisch-naturwissenschaftlichen Fakultät der Universität Zürich von Anugraha Mathew aus Indien Promotionskomitee Prof. Dr. Leo Eberl (Vorsitz) Prof. Dr. Jakob Pernthaler Dr. Aurelien carlier Zürich, 2015 2 Table of Contents Summary .............................................................................................................. 7 Zusammenfassung ................................................................................................ 9 Abbreviations ..................................................................................................... 11 Chapter 1: Introduction ....................................................................................... 14 1.1.Role and properties of iron in bacteria ...................................................................... 14 1.2.Iron transport mechanisms in bacteria .....................................................................
    [Show full text]
  • A Sigma Factor and Anti-Sigma Factor That Control Swarming Motility and Biofilm Formation in Pseudomonas Aeruginosa
    A sigma factor and anti-sigma factor that control swarming motility and biofilm formation in Pseudomonas aeruginosa The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation McGuffie, Bryan A. 2015. A sigma factor and anti-sigma factor that control swarming motility and biofilm formation in Pseudomonas aeruginosa. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:17467530 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA A σ factor and anti-σ factor that control swarming motility and biofilm formation in Pseudomonas aeruginosa A dissertation presented by Bryan Alexander McGuffie to The Division of Medical Sciences in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Microbiology and Molecular Genetics Harvard University Cambridge, Massachusetts May 2015 © 2015 Bryan Alexander McGuffie All rights reserved. Dissertation Advisor: Dr. Simon Dove Bryan Alexander McGuffie A σ factor and anti-σ factor that control swarming motility and biofilm formation in P. aeruginosa Abstract Pseudomonas aeruginosa is an environmental bacterium and opportunistic human pathogen of major clinical significance. It is the principal cause of morbidity and mortality in patients with cystic fibrosis (CF) and a leading cause of nosocomial infections. Although the organism is unicellular, P. aeruginosa exhibits two forms of multicellular behaviors when associated with a surface under the right conditions: swarming motility and biofilm formation.
    [Show full text]
  • Phyre 2 Results for Q15583
    Email [email protected] Description Q15583 Wed May 9 17:58:48 BST Date 2012 Unique Job 376ce548d294102d ID Detailed template information # Template Alignment Coverage 3D Model Confidence % i.d. Template Information PDB header:transcription Chain: A: PDB Molecule:homeobox protein tgif1; 1 c2lk2A_ Alignment 99.9 94 PDBTitle: solution nmr structure of homeobox domain (171-248) of human homeobox2 protein tgif1, northeast structural genomics consortium target3 hr4411b PDB header:transcription Chain: A: PDB Molecule:homeobox protein tgif2lx; 2 c2dmnA_ 99.8 62 Alignment PDBTitle: the solution structure of the homeobox domain of human2 homeobox protein tgif2lx Fold:DNA/RNA-binding 3-helical bundle 3 d1x2na1 Alignment 99.8 49 Superfamily:Homeodomain-like Family:Homeodomain Fold:DNA/RNA-binding 3-helical bundle 4 d1lfup_ Alignment 99.8 36 Superfamily:Homeodomain-like Family:Homeodomain Fold:DNA/RNA-binding 3-helical bundle 5 d1pufb_ Alignment 99.8 36 Superfamily:Homeodomain-like Family:Homeodomain Fold:DNA/RNA-binding 3-helical bundle 6 d1mnmc_ Alignment 99.8 33 Superfamily:Homeodomain-like Family:Homeodomain Fold:DNA/RNA-binding 3-helical bundle 7 d1du6a_ Alignment 99.8 33 Superfamily:Homeodomain-like Family:Homeodomain PDB header:dna binding protein Chain: A: PDB Molecule:homeobox protein barh-like 1; 8 c2dmtA_ 99.7 21 Alignment PDBTitle: solution structure of the homeobox domain of homeobox2 protein barh-like 1 Fold:DNA/RNA-binding 3-helical bundle 9 d1le8b_ Alignment 99.7 25 Superfamily:Homeodomain-like Family:Homeodomain Fold:DNA/RNA-binding
    [Show full text]
  • Broad-Spectrum Antimicrobial Activity by Burkholderia Cenocepacia Tatl-371, a Strain Isolated from the Tomato Rhizosphere
    RESEARCH ARTICLE Rojas-Rojas et al., Microbiology DOI 10.1099/mic.0.000675 Broad-spectrum antimicrobial activity by Burkholderia cenocepacia TAtl-371, a strain isolated from the tomato rhizosphere Fernando Uriel Rojas-Rojas,1 Anuar Salazar-Gómez,1 María Elena Vargas-Díaz,1 María Soledad Vasquez-Murrieta, 1 Ann M. Hirsch,2,3 Rene De Mot,4 Maarten G. K. Ghequire,4 J. Antonio Ibarra1,* and Paulina Estrada-de los Santos1,* Abstract The Burkholderia cepacia complex (Bcc) comprises a group of 24 species, many of which are opportunistic pathogens of immunocompromised patients and also are widely distributed in agricultural soils. Several Bcc strains synthesize strain- specific antagonistic compounds. In this study, the broad killing activity of B. cenocepacia TAtl-371, a Bcc strain isolated from the tomato rhizosphere, was characterized. This strain exhibits a remarkable antagonism against bacteria, yeast and fungi including other Bcc strains, multidrug-resistant human pathogens and plant pathogens. Genome analysis of strain TAtl-371 revealed several genes involved in the production of antagonistic compounds: siderophores, bacteriocins and hydrolytic enzymes. In pursuit of these activities, we observed growth inhibition of Candida glabrata and Paraburkholderia phenazinium that was dependent on the iron concentration in the medium, suggesting the involvement of siderophores. This strain also produces a previously described lectin-like bacteriocin (LlpA88) and here this was shown to inhibit only Bcc strains but no other bacteria. Moreover, a compound with an m/z 391.2845 with antagonistic activity against Tatumella terrea SHS 2008T was isolated from the TAtl-371 culture supernatant. This strain also contains a phage-tail-like bacteriocin (tailocin) and two chitinases, but the activity of these compounds was not detected.
    [Show full text]
  • Mechanism to Control the Cell Lysis and the Cell Survival Strategy in Stationary Phase Under Heat Stress Rashed Noor*
    Noor SpringerPlus (2015) 4:599 DOI 10.1186/s40064-015-1415-7 REVIEW Open Access Mechanism to control the cell lysis and the cell survival strategy in stationary phase under heat stress Rashed Noor* Abstract An array of stress signals triggering the bacterial cellular stress response is well known in Escherichia coli and other bacteria. Heat stress is usually sensed through the misfolded outer membrane porin (OMP) precursors in the peri- plasm, resulting in the activation of σE (encoded by rpoE), which binds to RNA polymerase to start the transcription of genes required for responding against the heat stress signal. At the elevated temperatures, σE also serves as the transcription factor for σH (the main heat shock sigma factor, encoded by rpoH), which is involved in the expression of several genes whose products deal with the cytoplasmic unfolded proteins. Besides, oxidative stress in form of the reactive oxygen species (ROS) that accumulate due to heat stress, has been found to give rise to viable but non- culturable (VBNC) cells at the early stationary phase, which is in turn lysed by the σE-dependent process. Such lysis of the defective cells may generate nutrients for the remaining population to survive with the capacity of formation of colony forming units (CFUs). σH is also known to regulate the transcription of the major heat shock proteins (HSPs) required for heat shock response (HSR) resulting in cellular survival. Present review concentrated on the cellular sur- vival against heat stress employing the harmonized impact of σE and σH regulons and the HSPs as well as their inter connectivity towards the maintenance of cellular survival.
    [Show full text]
  • Crystal Structure of a Bacterial RNA Polymerase Holoenzyme at 2.6 A˚ Resolution
    articles Crystal structure of a bacterial RNA polymerase holoenzyme at 2.6 A˚ resolution Dmitry G. Vassylyev*†, Shun-ichi Sekine*†, Oleg Laptenko‡, Jookyung Lee‡, Marina N. Vassylyeva†§, Sergei Borukhov‡ & Shigeyuki Yokoyama*†§k * Cellular Signaling Laboratory, and † Structurome Research Group, RIKEN Harima Institute at Spring-8, 1-1-1 Kouto, Mikazuki-cho, Sayo, Hyogo 679-5148, Japan ‡ Department of Microbiology, SUNY Health Science Center, 450 Clarkson Avenue, Brooklyn, New York 11203, USA § RIKEN Genomic Sciences Center, 1-7-22 Suehiro-cho, Tsurumi, Yokohama 230-0045, Japan k Department of Biophysics and Biochemistry, Graduate School of Science, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan ........................................................................................................................................................................................................................... In bacteria, the binding of a single protein, the initiation factor j, to a multi-subunit RNA polymerase core enzyme results in the formation of a holoenzyme, the active form of RNA polymerase essential for transcription initiation. Here we report the crystal structure of a bacterial RNA polymerase holoenzyme from Thermus thermophilus at 2.6 A˚ resolution. In the structure, two amino- terminal domains of the j subunit form a V-shaped structure near the opening of the upstream DNA-binding channel of the active site cleft. The carboxy-terminal domain of j is near the outlet of the RNA-exit channel, about 57 A˚ from the N-terminal domains. The extended linker domain forms a hairpin protruding into the active site cleft, then stretching through the RNA-exit channel to connect the N- and C-terminal domains. The holoenzyme structure provides insight into the structural organization of transcription intermediate complexes and into the mechanism of transcription initiation.
    [Show full text]