Investigation of LDHA and COPB1 As Candidate Genes for Muscle Development in the MYOD1 Region of Pig Chromosome 2

Mol Biol Rep DOI 10.1007/s11033-009-9882-y

Investigation of LDHA and COPB1 as candidate genes for muscle development in the MYOD1 region of pig chromosome 2

Haifang Qiu • Xuewen Xu • Bing Fan • Max F. Rothschild • Yerle Martin • Bang Liu

Received: 14 August 2009 / Accepted: 1 October 2009 Ó Springer Science+Business Media B.V. 2009

Abstract Porcine MYOD1 gene has been mapped to Association analyses revealed that the substitution of swine chromosome (SSC) 2p14-p17, which is involved in c.423A[G had a significant effect on average daily gain on the regulation of the proliferation and differentiation of test, average backfat thickness (BFT), loin muscle area, skeletal muscle cells. The LDHA (lactate dehydrogenase A) lumbar BFT, marbling score, tenth rib BFT, average drip and COPB1 (coatomer protein complex, subunit beta 1) loss and fiber type II ratio. The substitution of c.3096C[T genes, which map close to MYOD1, are involved in energy had a significant effect on average BFT, lumbar BFT, tenth metabolism and protein transport processes. Both genes rib BFT, carcass weight and last rib BFT. Interestingly, might play important roles in muscle development. How- both SNPs were all associated with average BFT, lumbar ever, little is known about the porcine LDHA and COPB1 BFT and tenth rib BFT. genes. In the present study, the full-length cDNA of these two genes were cloned. The mapping results demonstrated Keywords Association Growth and meat quality traits that porcine LDHA and COPB1 were all mapped to SSC Muscle development Porcine LDHA1 COPB1 2p14-p17. In this region, there are several QTL for growth and carcass traits, including average backfat thickness, lean and fat percentage. The RT-PCR results revealed that Introduction both LDHA and COPB1 were highly expressed in porcine skeletal muscle tissues, implying their potential regulatory Myogenic factor 3 (MYF3, MYOD1) is encoded by the function of muscle development. LDHA and COPB1 were MYOD1 gene, one member of the MYOD gene family then mapped to the region and multipoint analyses coding for the transcription factors which control the pro- generated a best sex-averaged map order of each gene cesses of myogenesis and induce the expression of muscle- between linked markers: MYOD1_75.2 cM _LDHA_79 specific genes [1]. Porcine MYOD1 gene has been mapped cM _CSRP3_83.8 cM _TEF-1_86.5 cM _COPB1_90 cM. to SSC 2p14-p17 [2], where several quantitative trait loci (QTL) related to BFT and average daily gain (ADG) were detected [3–5]. So far, no major genes associated with & H. Qiu X. Xu B. Fan B. Liu ( ) these important traits have been identified. Identification of Lab of Molecular Biology and Animal Breeding, Key Laboratory of Agricultural Animal Genetics, predictive markers within QTL regions is dependent in part Breeding and Reproduction of Ministry of Education, by construction of comparative maps with human and Huazhong Agricultural University, Wuhan 430070, China mouse genomes. Therefore, in the present study, we chose e-mail: [email protected] the LDHA (lactate dehydrogenase A) and COPB1 (coa- M. F. Rothschild tomer protein complex, subunit beta 1) genes which are Center for Integrated Animal Genomics, Department of Animal close to MYOD1 on SSC2 to construct a comparative map Science, Iowa State University, Ames, IA 50011, USA and to investigate their effects on economic traits. LDHA is the predominant LDH isoform in skeletal Y. Martin INRA, Laboratoire de Geńe´tique Cellulaire, muscle [6] and is more highly expressed in mouse fast- 31326 Castanet-Tolosan, France twitch fibers [7]. LDHA has now been studied as a 123 Mol Biol Rep regulator of hypoxia for a long time. When skeletal muscle laboratory in the same region of MYOD1. CSRP3, TEF-1 is in the state of hypoxia, the process of glycolysis begins. and MYOD1 all play important roles in skeletal muscle LDHA catalyzes the conversion of pyruvate to lactate, and development. Pig chromosome 2 has homology with energy is released. LDHA also controls the formation of human chromosome 11 and there are 78 genes in the lactate and regulates the turnover of lactate in the muscle human region of TEF-1-MYOD1-CSRP3. We selected cell, maintaining a balance condition. COPB1 is a subunit genes related with cell cycle, cell proliferation, differenti- found in the COP1 vesicle coatomer complexes and the ation and skeletal muscle development in that region. clathrin-binding complexes [8, 9]. It is highly conserved in mouse, rat, and human, and is ubiquitously expressed in mouse. COPB plays an essential role in retrograde Golgi- cDNA isolation, sequencing and analysis to-ER transport and retrieval of dilysine-tagged proteins back to the ER [10]. Full-length cDNA sequences of porcine LDHA and COPB1 To test the hypothesis that the LDHA and COPB1 genes were obtained using the rapid amplification of cDNA ends might be the important candidate genes for meat quality, (RACE). Gene specific primers were designed using pig carcass and growth traits, we cloned the cDNA sequence of EST data from GenBank of NCBI (Table 1). RACE was these two porcine genes, analyzed their mRNA expression, performed according to the manufacturer’s protocol of the and confirmed their chromosome assignments. We also SMARTTM RACE cDNA kit (Clontech Inc, Pab Alto, CA, found SNPs and detected their association with meat USA). The PCR products were purified with Gel Extraction quality, carcass and growth traits. Mini Kit (Takara, Dalian, China) and cloned into pMD18- T (Takara, Japan), then sequenced commercially. Open reading frames (ORFs) were predicted and the amino acid Materials and methods sequences were deduced with DNAstar software package. The functional domains of the deduced proteins were Selection of candidate genes analyzed with SMART program (http://smart.embl-heidel berg.de/), and the subcellular localization prediction was The CSRP3 (cysteine and glycine-rich protein 3) and TEF- performed using PSORT II (http://psort.nibb.ac.jp/form2. 1 (TEA domain family member 1) genes had been previ- html). Alignments of deduced proteins were conducted by ously mapped to 2p14-p17 region [11, 12] by our DNAMAN software (Lynnon Biosoft, Quebec, Canada).

Table 1 Primers used in this study Gene Primer name Primer sequences (50-30)Tm(°C) Size(bp)

LDHA 50nesta 50AGCTGATCCTTGAGAGTTGCCAT30 60 150 30nesta 50AACGTGACTGCAAACTCTAGGCT30 60 1360 LE-Fb 50ATCTTGACCTATGTGGCTTGGA30 62 214 LE-R 50TCTTCAGGGAGACACCAGCAA30 LM-Fc 50GGGTATTGGTAGTCTTGACCA30 60 251 LM-R 50CACCACCTGTTTGTGAACTGCT30 COPB1 C-CFd 50AGCTGCTGATGTCTTGGAGTTC30 58 1452 C-CR 50ATGGAACGAGCATAGAGGTTG30 50nesta 50GCAGCTTCATTACTGTCACTGAGA30 60 1408 30nesta 50AAGATGCACTTGCTAATGTCAGC30 60 486 CE-Fb 50ACAGAGGAAAGAGGCAGCAGA 30 60 161 CE-R 50GCAAGGTATCACTGGTTTGGTTC30 CM-Fc 50GTGTTTTGTGCATTGGAAGCA30 62 285 CM-R 50ACCACATCAACCATGAAACC30 18S 18E-Fb 50TTTCGCTCTGGTCCGTCTTG30 60 101 18E-R 50TTCGGAACTGAGGCCATGAT30 a Primers for RACE b Primers for expression pattern c Primers for RH mapping d Primers for cDNA cloning

123 Mol Biol Rep

Expression patterns of LDHA and COPB1 of 30 s at 94°C, 30 s at 68°C, 20 s at 72°C, and a final extension of 5 min at 72°C. Ten different tissues (heart, liver, spleen, lung, kidney, Linkage map was conducted in the F2 animals of the skeletal muscle, small intestine, lymph node, testis and Berkshire 9 Yorkshire resource family [4]. Linkage anal- brain) were collected from a mature Tongcheng pig. RNA ysis was conducted using two-point and multipoint analy- and cDNA were prepared as described in our previous ses of CRIMAP version 2.4 [16] with all options to get the work [13]. best order of the markers and the fixed option to obtain the The mRNA expressions of porcine LDHA and COPB1 map distance. Then a linkage map of LDHA and COPB1 in different tissues were detected by RT-PCR with 18s as was made by MapDraw. internal control. Primers (Table 1) were designed in sepa- rate exons to distinguish the cDNA products from the Association analysis of the porcine LDHA and COPB1 contaminating genomic DNA. The PCR reactions were genes and meat quality, carcass and growth traits performed in a volume of 10 lLof19 PCR buffer (Ta- kara), containing 1 lL cDNA, 0.2 lM of each primer, The animals for association analysis were from the F2 150 lM of each dNTPs, 1.5 mM MgCl2 and 2.0 Units Taq animals of the Berkshire 9 Yorkshire resource family [4]. DNA polymerase (Takara, Dalian, China). PCR reactions Briefly, 2 F0 Berkshire sires were crossed with 9 F0 were conducted under the following condition: initial Yorkshire dams to produce nine F1 litters, and then 8 sires denaturation at 95°C for 5 min, 30 cycles with 94°C for and 26 dams from these F1 litters were selected and crossed 30 s, 60°C for 30 s, 72°C for 20 s, followed by a final to produce 515 F2 animals. The analyzed traits in the study extension at 72°C for 5 min. The PCR products were were composed of 28 meat quality traits and 13 growth and separated on a 2% agarose gel and visualized on a SYN- body composition traits. The details of these trait mea- GENE BioImaging Systems (Synoptics, Cambridge, UK) surements have been described by Malek et al. [4], and the after ethidium bromide staining. model for association analysis between SNPs and traits was reported in our recent work [17, 18]. Radiation hybrid mapping The association analyses between single SNPs and traits were performed with a statistical model using the MIXED RH mapping of LDHA and COPB1 was performed using model procedures (SAS 9.0; SAS Institute, Cary, NC, USA). the INRA–University of Minnesota 7000-rad radiation In this model, sex, slaughter date and marker genotypes were hybrid panel (IMpRH) consisting of 118 hamster–porcine considered as fixed effects, dam (litter) as a random effect hybrid cell lines [14]. The PCR for RH mapping was in a and carcass body weight as a covariate. Combined associa- total volume of 10 lL, which included 19 PCR buffer tion analyses were carried out to explore the possible inter- (Promega, USA), 25 ng hybrid DNA, 0.2 lmol/L of each action between the SNPs. The model was similar to that of primer, 75 lmol/L of each dNTP, 1.5 mmol/L MgCl2, and single marker association analysis, except the interaction 1.0 U Taq DNA polymerase (Promega). The PCR profile between the two SNPs was included as a fixed effect. included 5 min at 94°C, 35 cycles of 20 s at 94°C, 20 s at 60°C, 20 s at 72°C, and a final 5 min extension at 72°C. Data analyses were performed through the IMpRH map- Results and discussion ping server [15] available on the Internet (http://www. toulouse.inra.fr/lgc/pig/RH/IMpRH.htm). Candidate genes

SNP identification and linkage analysis of the porcine From the 78 genes listed in Table 2, a total of 18 genes LDHA and COPB1 genes (LDHA, PIK3C2A, E2F8, COPB1 etc) related to cell cycle, cell proliferation, differentiation and skeletal muscle Complement DNA from Landrace and Tongcheng pigs was development were selected. Finally, based on the EST amplified and sequenced respectively to identify cSNPs. information and the potential SNPs, LDHA and COPB1 PCR-restriction fragment length polymorphism (PCR- related with energy metabolism and protein transport were RFLP) analyses and sequencing of PCR products were selected as the final candidate genes. used to confirm the SNP. The PCR reactions for genotyp- ing were performed in a volume of 25 lLof19 PCR Molecular characterization of the porcine LDHA buffer, consisting of 30 ng of genomic DNA, 0.2 lMof and COPB1 genes each primer, 100 lM of each dNTP, 1.5 mM MgCl2 and 2.0 Units Taq DNA polymerase (Takara, Dalian, China). Analysis of the cDNA sequence of porcine LDHA revealed The PCR profiles are 3 min at 94°C followed by 35 cycles the following results, (1) the full-length cDNA of porcine 123 Mol Biol Rep

Table 2 The 78 genes in the TEF-1-MYOD1-CSRP3 linkage map No Gene No Gene No Gene No Gene

1 TEF-1 21 LOC440031 41 MYOD1 61 LDHAL6A 2 LOC644943 22 INSC 42 KCNC1 62 TSG101 3 ARNTL 23 SOX6 43 SERGEF 63 UEVLD 4 BTBD10 24 LOC729347 44 TPH1 64 SPTY2D1 5 PTH 25 LOC645210 45 SAAL1 65 TMEM86A 6 LOC644992 26 C11orf58 46 SAA3P 66 IGSF22 7 MLSTD2 27 PLEKHA7 47 MRGPRX3 67 PTPN5 8 LOC729147 28 LOC729362 48 LOC645297 68 LOC441592 9 SPON1 29 OR7E14P 49 MRGPRX4 69 LOC645397 10 RRAS2 30 RPS13 50 LOC645312 70 LOC390098 11 LOC401676 31 SNORD14A 51 LOC645319 71 LOC390099 12 COPB1 32 SNORD14B 52 LOC494141 72 MRGPRX1 13 PSMA1 33 PIK3C2A 53 SAA4 73 LOC729352 14 PDE3B 34 LOC91561 54 SAA2 74 LOC645415 15 MORF4LP3 35 NUCB2 55 FAM10A5 75 LOC390101 16 CYP2R1 36 DKFZp686 56 SAA1 76 MRGPRX2 17 CALCP 37 KCNJ11 57 HPS5 77 ZDHHC13 18 CALCA 38 ABCC8 58 GTF2H1 78 CSRP3 19 OR7E41P 39 USH1C 59 LDHA 20 CALCB 40 OTOG 60 LDHC The bold shows the TEF-1, MYOD1 and CSRP3 genes

LDHA is 1713 bp and contains an ORF of 999 bp encoding before the poly (A) stretch. The sequence of porcine a protein of 332 residues with a calculated molecular COPB1 had been deposited in GenBank (GenBank acces- mass of 36.6 kDa and an isoelectric point (pI) of 8.18. It sion no. FJ865397). (2) There are several sites of phos- contains a 50-untranslated region (50-UTR) of 108 bp and a phorylation, N-myristoylation and Galaptin signature, but 30-untranslated (30-UTR) region of 606 bp with a consen- no protein-binding motifs, signal peptide, or transmem- sus AATAAA polyadenylation signal 12 bp before the brane regions that are common to any other known protein poly (A) stretch. The sequence of porcine LDHA had been family predicted by ExPASy. The BLAST search result deposited in GenBank (GenBank accession no. FJ865398). from the GenBank database (http://www.ncbi.nlm.nih. (2) There are several phosphorylation, N-myristoylation gov/blast) indicated that the predicted protein shared high and Galaptin signature sites, but no protein-binding motifs, similarity with other mammals, including 85% identity to signal peptide, or transmembrane regions are common to human and rat, and 83% identity to mouse, respectively. any other known protein family predicted by ExPASy. The BLAST search result from the GenBank database (http:// Expression patterns of porcine LDHA and COPB1 www.ncbi.nlm.nih.gov/blast) indicated that the predicted genes protein shared high similarity with other mammals including 85% identity to human and rat, and 83% identity Porcine LDHA was highly expressed in lung, kidney, to mouse. skeletal muscle and fat, and lower levels was detected in The cDNA sequence of porcine COPB1 revealed the heart, liver, spleen, stomach and small intestine (Fig. 1). following results, (1) the full-length cDNA of porcine High expression of COPB1 was in the lung, kidney, skel- COPB1 is 3,310 bp and contains an ORF of 2,862 bp etal muscle and small intestine, and lower level was in encoding a protein of 953 residues with a calculated heart, liver, spleen, stomach and fat (Fig. 1). They were all molecular mass of 107.1 kDa and an isoelectric point (pI) expressed highly in skeletal muscle. The RT-PCR results of 5.83. It contains a 50-untranslated region (50-UTR) of revealed that porcine LDHA and COPB1 were all expres- 161 bp and a 30-untranslated (30-UTR) region of 331 bp sed highly in skeletal muscle. This suggests that they with a consensus AATAAA polyadenylation signal 13 bp probably play a crucial role in muscle development.

123 Mol Biol Rep

distance between loci in Kosambi cM): SW1686-9.9- MYOD1-3.8-LDHA-4.8-CSRP3-2.7-TEF-1-3.5-COPB1-7.5- CMYA5-3.5-SW766. The linkage map is shown in Fig. 2. The results showed that the order of genes is the same in the RH map and linkage map, MYOD1-LDHA-CSRP3- TEF-1-COPB1. The distance between SW2167 and gene PTH3 was 130 cR on the RH map. These two markers are around 14.8 cM distant from each other on the linkage map. Thus, on average, 1 cM equals approximately

8.78 cR7000 in this region. The relationship between centirays and centimorgans is not equal throughout the gen- Fig. 1 Porcine LDH and COPB1 expression patterns in heart, liver, ome [20]. With the same porcine RH panel, 1 cM equals spleen, lung, kidney, stomach, small intestine, skeletal muscle and fat approximately 17 cR7000 on SSC8 [14]. We conclude, therefore, that there is a high recombination rate in the MYOD1-LDHA-CSRP3-TEF-1-COPB1 region. RH mapping of the porcine LDHA and COPB1 genes The results made it possible to integrate the five genes into a framework map of microsatellites. The established The RH mapping analysis revealed that LDHA is closely orders of these five genes in pig can be compared with the linked to microsatellite marker SW2167 at a distance of 4 orders determined in other mammals (Fig. 3). All five cR (two-point LOD score = 25.65). COPB1 is closely genes have been mapped in the mouse (MYOD1-LDHA- linked to gene peptidyl-tRNA hydrolase 3 (PTH3)ata CSRP3-TEF-1-COPB1), the same order in the two species. distance of 20 cR (two-point LOD score = 17.51). A comparison of the human and porcine maps are con- According to the position of SW2167 and PTH3,we structed, the only difference is a shift translocation of the deduced the LDHA and COPB1 were mapped to SSC2p14- order of MYOD1-LDHA-CSRP3 and TEF-1-COPB1 in the p17. LDHA and COPB1 were assigned to SSC 2p14-p17, two species. In human, the linkage group is TEF-1- which are consistent with the assignment of human LDHA COPB1-MYOD1-LDHA-CSRP3. So on the one hand, the and COPB1 to chromosome HSA 11p15.4 and 11p15.2 linkage regions of MYOD1-LDHA-CSRP3 and TEF-1- (http://www.ncbi.nlm.nih.gov/sites/entrez) because of the COPB1 are conserved in mammals, and on the other hand, homology of human 11p-q13 and pig 2p [19]. Adding the the whole region is more conserved in the pig and mouse mapping results of MYOD1, CSRPS and TEF-1 in the same than that of pig and human. region [2, 11, 12], the order of these five genes is MYOD1- LDHA-CSRP3-TEF-1-COPB1.

Linkage analysis of the porcine LDHA and COPB1 genes

Two mutations, c.423A[G in exon 6 of porcine LDHA and c.3096C[Tin30UTR of COPB1 were identiﬁed by comparative sequencing. The c.423A[G substitution is a syn- onymous mutation in exon 6. The polymorphisms of c.423A[G in the BY resource family was analyzed using an AciI PCR-RFLP, which yielded two different restriction fragments, i.e., the 95 bp band represents for allele A and the 72 bp band for allele G. The polymorphism of c.3096C[T in the BY resource family was analyzed using a RsaI PCR-RFLP method, which yielded two different restriction fragments, i.e., the 205 bp band represented for allele C and the 177 bp band for allele T. The polymorphic sites were then used for the linkage analysis, and two-point analysis assigned the LDHA and COPB1 genes to SSC 2 linkage map. The multipoint analysis yielded to a best sex-averaged map order of the porcine LDHA and COPB1 genes and linked markers (with Fig. 2 The linkage map of porcine LDHA and COPB1 genes 123 Mol Biol Rep

Fig. 3 Comparative maps of porcine chromosome 2p, mouse 7 and human 11. Maps shown are (left to right) partial pig RH map of 2p, linkage map of partial pig 2p, partial mouse 7 and partial human 11. Distances are in centirays (cR), centimorgans (cM) and megabases (Mb), respectively. The linkage map of partial pig 2p is constructed with previous microsatellite markers

Table 3 The association analyses between SNP genotypes of LDHA, COPB1 and meat quality and growth traits Gene Traits Genotypic least squares means (SE) P value AA(96)/CC(53) AG(261)/CT(330) GG(165)/TT(141)

LDHA A95G Average back fat thickness 3.436 (0.079) 3.263 (0.058) 3.203 (0.063) 0.0124 Loin eye area 34.596 (0.763) 36.145 (0.613) 36.195 (0.647) 0.0235 Lumbar BF 3.740 (0.095) 3.561 (0.070) 3.452 (0.076) 0.0120 Marbling 3.852 (0.094) 3.690 (0.066) 3.590 (0.073) 0.0308 Tenth rib BF 3.304 (0.093) 3.081 (0.069) 3.041 (0.075) 0.0123 Average daily gain on test 0.680 (0.006) 0.699 (0.008) 0.695 (0.007) 0.0011 Average drip loss 5.646 (0.150) 6.241 (0.236) 5.788 (0.173) 0.0399 Fiber type II ratio 0.886 (0.072) 1.078 (0.059) 1.212 (0.097) 0.0102 COPB1 C73T Average back fat 3.137 (0.008) 3.357 (0.056) 3.163 (0.065) 0.0001 Carcass weight 86.431 (0.348) 87.355 (0.181) 87.142 (0.230) 0.0340 Last rib BF 3.061 (0.087) 3.209 (0.051) 3.068 (0.061) 0.0151 Lumbar BF 3.393 (0.106) 3.646 (0.067) 3.419 (0.077) 0.0072 Tenth rib BF 2.947 (0.103) 3.210 (0.066) 3.000 (0.076) 0.0002 The A and G alleles go with LDHA; C and T alleles go with COPB1. Values with different letters within the same row differ signiﬁcantly; the lowercase letters show the level of P \ 0.05; the capital letters show the level of P \ 0.01

Significant effects of LDHA and COPB1 on meat and tenth rib BFT, and was significantly associated (P \ 0.05) quality and growth traits with carcass weight and last rib BFT. Interestingly, both SNPs were all associated with average BFT, lumbar BFT and tenth The results of the association analyses between single markers rib BFT. The combined association results for c.423A[Gand and the meat quality and growth traits are shown in Table 3. c.3096C[T was also conducted. No significant interactions The SNP c.423A[G was highly significantly associated were observed between these two SNPs with average BFT, (P \ 0.01) with average daily gain on test, and was signifi- lumbar BFT and tenth rib BFT, but a significant interaction cantly associated (P \ 0.05) with average BFT, loin eye area, (P \ 0.05) was found for chew score. For animals with lumbar BFT, marbling, tenth rib BFT, average drip loss and genotype GG at c.423A[G, the chew score phenotype fiber type II ratio. The SNP c.3096C[T was highly signifi- depended on the c.3096C[T allele present with a GG/TT cantly associated (P \ 0.01) with average BFT, lumbar BFT genotype showing the highest score.

123 Mol Biol Rep

These analyses results give further support to the asso- chromosomal regions influencing economic traits in the pig. II. ciation between the polymorphisms of c.423A[G and Meat and muscle composition. Mamm Genome 12:637–645. doi: 10.1007/s003350020019 c.3096C[T and economic traits. Furthermore, the positive 6. Van Hall G (2000) Lactate as a fuel for mitochondrial respiration. effect of A allele on backfat thickness and the negative Acta Physiol Scand 168:643–656. doi:10.1046/j.1365-201x.2000. effect on average daily gain on test, fiber type II ration and 00716.x average drip loss is in agreement with the breeding herd 7. Campbell WG, Gordon SE, Carlson CJ, Pattison JS, Hamilton MT, Booth FW (2001) Differential global gene expression in red selection for high backfat thickness and low growth. The and white skeletal muscle. Am J Physiol Cell Physiol 280:C763– positive effect of the C allele on backfat thickness and C768 carcass weight is in accordance with the breeding herd 8. Sytnyk V, Leshchyns’ka I, Dityatev A, Schachner M (2004) selection for low backfat thickness, low carcass weight and Trans-Golgi network delivery of synaptic proteins in syn- aptogenesis. J Cell Sci 117:381–388. doi:10.1242/10.1242/jcs. high lean meat percentage. The combined association for 00956 c.423A[G and c.3096C[T is the same for chew score, also 9. Nickel W, Brugger B, Wieland FT (2002) Vesicular transport: the a meat quality trait. These results in our study indicated core machinery of COPI recruitment and budding. J Cell Sci that the substitution c.423A[G and c.3096C[T could be 115:3235–3240 10. Letourneur F, Gaynor EC, Hennecke S, Demolliere C, Duden R, used as a genetic marker of assisted selection. Emr SD et al (1994) Coatomer is essential for retrieval of The porcine LDHA and COPB1 genes were assigned to di-lysine-tagged proteins to the endoplasmic reticulum. Cell SSC 2p in the region where a QTL for average daily gain 79:1199–1207. doi:10.1016/0092-8674(94)90011-6 on test was detected in the BY family [4]. Surrounding the 11. Xu XW, Xing S, Du ZQ, Rothschild MF, Yerle M, Liu B (2008) Porcine TEF1 and RTEF1: molecular characterization and asso- region of porcine LDHA and COPB1, a search of the pig ciation analyses with growth traits. Comparative biochemistry QTL database (http://www.animalgenome.org/QTLdb/pig. and physiology Part B. Biochem Mol Biol 150:447–453. doi: html) revealed multiple QTL for growth and carcass traits, 10.1016/j.cbpb.2008.05.003 including average backfat thickness [21, 22], loin muscle 12. Xu XW, Qiu HF, Du ZQ, Fan B, Rothschild MF, Yuan F et al (2009) Porcine CSRP3: polymorphism and association analyses area, lean and fat percentage [23]. These data give a sup- with meat quality traits and comparative analyses with CSRP1 port to the results of association analysis to some extent, and CSRP2. Mol Biol Rep. doi:10.1007/s11033-009-9632-1 but further study is needed to validate the association. 13. Wang H, Zhu Z, Wang H, Yang S, Mo D, Li K (2006) Charac- In conclusion, our study showed that both LDHA and terization of different expression patterns of calsarcin-1 and calsarcin-2 in porcine muscle. Gene 374:104–111. doi:10.1016/ COPB1 genes will be important candidate genes for meat j.gene.2006.01.035 quality and growth traits in animal breeding, and may also 14. Yerle M, Pinton P, Robic A, Alfonso A, Palvadeau Y, Delcros C be useful for the research of muscle development mecha- et al (1998) Construction of a whole-genome radiation hybrid nisms. Our data provide basic molecular information useful panel for high-resolution gene mapping in pigs. Cytogenet Cell Genet 82:182–188. doi:10.1159/000015095 for the further investigation of the function of the LDHA 15. Milan D, Hawken R, Cabau C, Leroux S, Genet C, Lahbib Y et al and COPB1 gene. (2000) IMpRH server: an RH mapping server available on the Web. Bioinformatics 16:558–559. doi:10.1093/bioinformatics/ 16.6.558 16. Green P, Falls K, Crooks S (1990) Documentation for CRIMAP, version 2.4. Washington University School of Medicine, St References Louis, MO 17. Yu M, Geiger B, Deeb N, Rothschild MF (2007) Investigation of 1. Urban´ski P, Kurył J (2004) Two new SNPs within exon 1 of the TXNIP (thioredoxin-interacting protein) and TRX (thioredoxin) porcine MYOD1 (MYF3) gene and their frequencies in chosen genes for growth-related traits in pigs. Mamm Genome 18:197– pig breeds and lines. J Anim Breed Genet 121:204–208. doi: 209. doi:10.1007/s00335-007-9006-8 10.1111/j.1439-0388.2004.00458.x 18. Xu XL, Xu XW, Pan PW, Li K, Jiang ZH, Yu M et al (2009) 2. Cepica S, Yerle M, Stratil A, Schroffel J, Redl B (1999) Regional Porcine skeletal muscle differentially expressed gene CMYA1: localization of porcine MYOD1, MYF5, LEP, UCP3 and LCN1 isolation, characterization, mapping, expression and association genes. Anim Genet 30:476–478. doi:10.1046/j.1365-2052.1999. analysis with carcass traits. Anim Genet 40:255–261. doi: 00498-17.x 10.1111/j.1365-2052.2008.01825.x 3. de Koning DJ, Rattink AP, Harlizius B, van Arendonk JA, 19. Goureau A, Yerle M, Schmitz A, Riquet J, Milan D, Pinton P et al Brascamp EW, Groenen MA (2000) Genome-wide scan for body (1996) Human and porcine correspondence of chromosome seg- composition in pigs reveals important role of imprinting. Proc ments using bidirectional chromosome painting. Genomics Natl Acad Sci USA 97:7947–7950. doi:10.1073/pnas.140216397 36:252–262. doi:10.1006/geno.1996.0460 4. Malek M, Dekkers JC, Lee HK, Baas TJ, Rothschild MF (2001) 20. Gyapay G, Schmitt K, Fizames C, Jones H, Vega-Czarny N, A molecular genome scan analysis to identify chromosomal Spillett D et al (1996) A radiation hybrid map of the human regions influencing economic traits in the pig. I. Growth and body genome. Hum Mol Genet 5:339–346. doi:10.1093/hmg/5.3.339 composition. Mamm Genome 12:630–636. doi:10.1007/s00335 21. Rattink AP, De Koning DJ, Faivre M, Harlizius B, van Arendonk 0020018 JA, Groenen MA (2000) Fine mapping and imprinting analysis 5. Malek M, Dekkers JC, Lee HK, Baas TJ, Prusa K, Huff-Lonergan for fatness trait QTLs in pigs. Mamm Genome 11:656–661. doi: E et al (2001) A molecular genome scan analysis to identify 10.1007/s003350010117

123 Mol Biol Rep

22. Qu YC, Deng CY, Xiong YZ, Zheng R, Yu L, Su YH et al 23. Lee S, Chen Y, Moran C, Cepica S, Reiner G, Bartenschlager H (2002) The construction of the genetic map and QTL locating et al (2003) Linkage and QTL mapping for Sus scrofa chromo- analysis on chromosome 2 in swine. Yi Chuan Xue Bao some 2. J Anim Breed Genet 120:11–19. doi:10.1046/j.0931- 29:972–976 2668.2003.00419.x

123