Mol Biol Rep DOI 10.1007/s11033-009-9882-y Investigation of LDHA and COPB1 as candidate genes for muscle development in the MYOD1 region of pig chromosome 2 Haifang Qiu • Xuewen Xu • Bing Fan • Max F. Rothschild • Yerle Martin • Bang Liu Received: 14 August 2009 / Accepted: 1 October 2009 Ó Springer Science+Business Media B.V. 2009 Abstract Porcine MYOD1 gene has been mapped to Association analyses revealed that the substitution of swine chromosome (SSC) 2p14-p17, which is involved in c.423A[G had a significant effect on average daily gain on the regulation of the proliferation and differentiation of test, average backfat thickness (BFT), loin muscle area, skeletal muscle cells. The LDHA (lactate dehydrogenase A) lumbar BFT, marbling score, tenth rib BFT, average drip and COPB1 (coatomer protein complex, subunit beta 1) loss and fiber type II ratio. The substitution of c.3096C[T genes, which map close to MYOD1, are involved in energy had a significant effect on average BFT, lumbar BFT, tenth metabolism and protein transport processes. Both genes rib BFT, carcass weight and last rib BFT. Interestingly, might play important roles in muscle development. How- both SNPs were all associated with average BFT, lumbar ever, little is known about the porcine LDHA and COPB1 BFT and tenth rib BFT. genes. In the present study, the full-length cDNA of these two genes were cloned. The mapping results demonstrated Keywords Association Á Growth and meat quality traits Á that porcine LDHA and COPB1 were all mapped to SSC Muscle development Á Porcine Á LDHA1 Á COPB1 2p14-p17. In this region, there are several QTL for growth and carcass traits, including average backfat thickness, lean and fat percentage. The RT-PCR results revealed that Introduction both LDHA and COPB1 were highly expressed in porcine skeletal muscle tissues, implying their potential regulatory Myogenic factor 3 (MYF3, MYOD1) is encoded by the function of muscle development. LDHA and COPB1 were MYOD1 gene, one member of the MYOD gene family then mapped to the region and multipoint analyses coding for the transcription factors which control the pro- generated a best sex-averaged map order of each gene cesses of myogenesis and induce the expression of muscle- between linked markers: MYOD1_75.2 cM _LDHA_79 specific genes [1]. Porcine MYOD1 gene has been mapped cM _CSRP3_83.8 cM _TEF-1_86.5 cM _COPB1_90 cM. to SSC 2p14-p17 [2], where several quantitative trait loci (QTL) related to BFT and average daily gain (ADG) were detected [3–5]. So far, no major genes associated with & H. Qiu Á X. Xu Á B. Fan Á B. Liu ( ) these important traits have been identified. Identification of Lab of Molecular Biology and Animal Breeding, Key Laboratory of Agricultural Animal Genetics, predictive markers within QTL regions is dependent in part Breeding and Reproduction of Ministry of Education, by construction of comparative maps with human and Huazhong Agricultural University, Wuhan 430070, China mouse genomes. Therefore, in the present study, we chose e-mail: [email protected] the LDHA (lactate dehydrogenase A) and COPB1 (coa- M. F. Rothschild tomer protein complex, subunit beta 1) genes which are Center for Integrated Animal Genomics, Department of Animal close to MYOD1 on SSC2 to construct a comparative map Science, Iowa State University, Ames, IA 50011, USA and to investigate their effects on economic traits. LDHA is the predominant LDH isoform in skeletal Y. Martin INRA, Laboratoire de Ge´ne´tique Cellulaire, muscle [6] and is more highly expressed in mouse fast- 31326 Castanet-Tolosan, France twitch fibers [7]. LDHA has now been studied as a 123 Mol Biol Rep regulator of hypoxia for a long time. When skeletal muscle laboratory in the same region of MYOD1. CSRP3, TEF-1 is in the state of hypoxia, the process of glycolysis begins. and MYOD1 all play important roles in skeletal muscle LDHA catalyzes the conversion of pyruvate to lactate, and development. Pig chromosome 2 has homology with energy is released. LDHA also controls the formation of human chromosome 11 and there are 78 genes in the lactate and regulates the turnover of lactate in the muscle human region of TEF-1-MYOD1-CSRP3. We selected cell, maintaining a balance condition. COPB1 is a subunit genes related with cell cycle, cell proliferation, differenti- found in the COP1 vesicle coatomer complexes and the ation and skeletal muscle development in that region. clathrin-binding complexes [8, 9]. It is highly conserved in mouse, rat, and human, and is ubiquitously expressed in mouse. COPB plays an essential role in retrograde Golgi- cDNA isolation, sequencing and analysis to-ER transport and retrieval of dilysine-tagged proteins back to the ER [10]. Full-length cDNA sequences of porcine LDHA and COPB1 To test the hypothesis that the LDHA and COPB1 genes were obtained using the rapid amplification of cDNA ends might be the important candidate genes for meat quality, (RACE). Gene specific primers were designed using pig carcass and growth traits, we cloned the cDNA sequence of EST data from GenBank of NCBI (Table 1). RACE was these two porcine genes, analyzed their mRNA expression, performed according to the manufacturer’s protocol of the and confirmed their chromosome assignments. We also SMARTTM RACE cDNA kit (Clontech Inc, Pab Alto, CA, found SNPs and detected their association with meat USA). The PCR products were purified with Gel Extraction quality, carcass and growth traits. Mini Kit (Takara, Dalian, China) and cloned into pMD18- T (Takara, Japan), then sequenced commercially. Open reading frames (ORFs) were predicted and the amino acid Materials and methods sequences were deduced with DNAstar software package. The functional domains of the deduced proteins were Selection of candidate genes analyzed with SMART program (http://smart.embl-heidel berg.de/), and the subcellular localization prediction was The CSRP3 (cysteine and glycine-rich protein 3) and TEF- performed using PSORT II (http://psort.nibb.ac.jp/form2. 1 (TEA domain family member 1) genes had been previ- html). Alignments of deduced proteins were conducted by ously mapped to 2p14-p17 region [11, 12] by our DNAMAN software (Lynnon Biosoft, Quebec, Canada). Table 1 Primers used in this study Gene Primer name Primer sequences (50-30)Tm(°C) Size(bp) LDHA 50nesta 50AGCTGATCCTTGAGAGTTGCCAT30 60 150 30nesta 50AACGTGACTGCAAACTCTAGGCT30 60 1360 LE-Fb 50ATCTTGACCTATGTGGCTTGGA30 62 214 LE-R 50TCTTCAGGGAGACACCAGCAA30 LM-Fc 50GGGTATTGGTAGTCTTGACCA30 60 251 LM-R 50CACCACCTGTTTGTGAACTGCT30 COPB1 C-CFd 50AGCTGCTGATGTCTTGGAGTTC30 58 1452 C-CR 50ATGGAACGAGCATAGAGGTTG30 50nesta 50GCAGCTTCATTACTGTCACTGAGA30 60 1408 30nesta 50AAGATGCACTTGCTAATGTCAGC30 60 486 CE-Fb 50ACAGAGGAAAGAGGCAGCAGA 30 60 161 CE-R 50GCAAGGTATCACTGGTTTGGTTC30 CM-Fc 50GTGTTTTGTGCATTGGAAGCA30 62 285 CM-R 50ACCACATCAACCATGAAACC30 18S 18E-Fb 50TTTCGCTCTGGTCCGTCTTG30 60 101 18E-R 50TTCGGAACTGAGGCCATGAT30 a Primers for RACE b Primers for expression pattern c Primers for RH mapping d Primers for cDNA cloning 123 Mol Biol Rep Expression patterns of LDHA and COPB1 of 30 s at 94°C, 30 s at 68°C, 20 s at 72°C, and a final extension of 5 min at 72°C. Ten different tissues (heart, liver, spleen, lung, kidney, Linkage map was conducted in the F2 animals of the skeletal muscle, small intestine, lymph node, testis and Berkshire 9 Yorkshire resource family [4]. Linkage anal- brain) were collected from a mature Tongcheng pig. RNA ysis was conducted using two-point and multipoint analy- and cDNA were prepared as described in our previous ses of CRIMAP version 2.4 [16] with all options to get the work [13]. best order of the markers and the fixed option to obtain the The mRNA expressions of porcine LDHA and COPB1 map distance. Then a linkage map of LDHA and COPB1 in different tissues were detected by RT-PCR with 18s as was made by MapDraw. internal control. Primers (Table 1) were designed in sepa- rate exons to distinguish the cDNA products from the Association analysis of the porcine LDHA and COPB1 contaminating genomic DNA. The PCR reactions were genes and meat quality, carcass and growth traits performed in a volume of 10 lLof19 PCR buffer (Ta- kara), containing 1 lL cDNA, 0.2 lM of each primer, The animals for association analysis were from the F2 150 lM of each dNTPs, 1.5 mM MgCl2 and 2.0 Units Taq animals of the Berkshire 9 Yorkshire resource family [4]. DNA polymerase (Takara, Dalian, China). PCR reactions Briefly, 2 F0 Berkshire sires were crossed with 9 F0 were conducted under the following condition: initial Yorkshire dams to produce nine F1 litters, and then 8 sires denaturation at 95°C for 5 min, 30 cycles with 94°C for and 26 dams from these F1 litters were selected and crossed 30 s, 60°C for 30 s, 72°C for 20 s, followed by a final to produce 515 F2 animals. The analyzed traits in the study extension at 72°C for 5 min. The PCR products were were composed of 28 meat quality traits and 13 growth and separated on a 2% agarose gel and visualized on a SYN- body composition traits. The details of these trait mea- GENE BioImaging Systems (Synoptics, Cambridge, UK) surements have been described by Malek et al. [4], and the after ethidium bromide staining. model for association analysis between SNPs and traits was reported in our recent work [17, 18]. Radiation hybrid mapping The association analyses between single SNPs and traits were performed with a statistical model using the MIXED RH mapping of LDHA and COPB1 was performed using model procedures (SAS 9.0; SAS Institute, Cary, NC, USA). the INRA–University of Minnesota 7000-rad radiation In this model, sex, slaughter date and marker genotypes were hybrid panel (IMpRH) consisting of 118 hamster–porcine considered as fixed effects, dam (litter) as a random effect hybrid cell lines [14].