D I S S E R T a T I O N
The role of pou2/spiel-ohne-grenzen (spg) in brain and endoderm development of the zebrafish, Danio rerio
D I S S E R T A T I O N
zur Erlangung des akademischen Grades
Doctor rerum naturalium (Dr. rer. nat.)
vorgelegt der Fakultät Mathematik und Naturwissenschaften der Technischen Universität Dresden
von
Dipl. Biol. Gerlinde Reim
geboren am 11.Oktober 1970 in Mistelbach, Österreich
Gutachter: Prof. Dr. Michael Brand Prof. Dr. Francis Stewart Priv. Doz. Dr. Jochen Wittbrodt
Eingereicht am: 6. Juni 2003
Tag der Verteidigung: -
“ Der Mensch
ist nur da ganz Mensch,
wo er spielt ”
Friedrich Schiller Acknowledgements
At the end of the year 1998, inquiring the possibility to do my PhD in developmental biology, I had a revealing visit in Heidelberg to Michael Brand, pioneering the field of neural development of the zebrafish. His vivid interest in developmental biological questions encouraged me to embark on an adventurous journey into zebrafish development, which was completely new to me at that time: this started to change in spring 1999, after Michael Brand had accepted me to join his laboratory...
...Reaching the finale of this adventurous journey, I am very grateful to Michael Brand for introducing me to developmental aspects of the zebrafish. In particular, I would like to thank Michael Brand for his supervision and continuous support during my thesis. His stimulating and decidedly open-minded discussions deepened my interests for developmental biology and permitted explorations into other than neuro-developmental fields.
Starting in Heidelberg and continuing, from 2001 onwards, in Dresden, I had the opportunity to meet and to work with people in Michael Brand’s laboratory who contributed to an excellent working atmosphere. I would like to say “thank you” to all past and present members of the Brand laboratory for helpful experimental advices and sharing interests in biological problems – but also, equally important, for their friendship and interest at the personal level. With the same intention, I would like to thank the members of Carl-Philipp Heisenberg’s laboratory.
I thank Florian Raible for various discussions and his unremitting help, but also for musical performances like Brahm’s Hungarian Dances and “unconventional interpretations” of Schubert’s piano pieces. I would like to thank Chris Klisa for identifying and providing me with “spiel-ohne-grenzen” mutant carriers, more than that, for being an appreciated companion, especially in playing the piano. I am also grateful to Chris and Florian for proofreading of this thesis. Moreover, I thank Evelyn Lehman and Günter Junghanns for their excellent maintenance of the fish facility, and Shawn Burgess as well as Yutaka Kikuchi for their collaborations and kind support with materials. I am grateful to Dr. Jochen Wittbrodt and Prof. Dr. Francis Stewart for reviewing my thesis.
Finally, I would like to thank my mother Ernestine and my sister Eva Maria, and last, but not least – Johannes for supporting me in the course of the last years in manifold instances. Summary
The central theme of development, how cells are organized into functional structures and assembled into whole organisms, is addressed by developmental biology. One important feature of embryonic development is pattern formation, which is the generation of a particular arrangement of cells in three-dimensional space at a given point of time. Central to this work is the model system of the zebrafish, Danio rerio. The aim of the first part of this study was to try to understand how a distinct part of the embryonic brain called midbrain-hindbrain boundary (MHB), a region that acts as an organizer for the adjacent brain regions, is established in vertebrates. spiel-ohne-grenzen (spg) is one mutant which interferes with MHB development. Here, I addressed the role of pou2 in brain development by molecular, phenotypical and functional analysis. By genetic complementation and mapping I could elucidate the molecular nature of this mutant and found that the pou2 gene encoding the POU domain transcription factor is affected in spg mutant embryos. By chromosomal syntenic conservation, phylogenetic sequence comparison, and expression and functional data I imply that pou2 is the orthologue of the mammalian Oct4 (Pou5F1) gene. I find by detailed expression and transplantation analysis that pou2 is cell autonomously required within the neuroectoderm to activate genes of the MHB and hindbrain primordium, like pax2.1, wnt1, gbx2 or krox20. By gain-of-function experiments I demonstrate that pou2 synergizes with Fgf8 signaling in order to activate particularly the hindbrain primordium. Since pou2 is already provided to the embryo by the mother, I generated embryos which lack maternal and zygotic pou2 function (MZspg) to reveal a possible earlier than neuroectodermal role of pou2. In the second part of this work I demonstrate that pou2 is a key factor controlling endoderm differentiation. By expression and gain-of-function analysis I suggest a cell autonomous function for Pou2 in the first step of endodermal differentiation. By gain-of-function experiments involving the gene encoding the HMG transcription factor Casanova (Cas) I show that both Cas and Pou2 are necessary to activate expression of the endodermal differentiation marker sox17 in a mutually dependent way, and that the ability of Cas to ectopically induce sox17 strictly requires Pou2. I conclude that both maternal and zygotic pou2 function is necessary for commitment of endodermal progenitor cells to differentiate into endodermal precursor cells. 4 Table of Contents
ACKNOWLEDGEMENTS...... 2 SUMMARY...... 3 TABLE OF CONTENTS ...... 4 INDEX OF FIGURES ...... 7 ABBREVIATIONS...... 8 1 INTRODUCTION ...... 9
1.1 DEVELOPMENTAL BIOLOGY AND ITS ELEMENTARY CONCEPTS ...... 9 1.2 THE ZEBRAFISH: A VERTEBRATE SYSTEM TO STUDY ONTOGENETIC DEVELOPMENT ...... 10 1.3 ONTOGENETIC DEVELOPMENT OF THE ZEBRAFISH...... 12 1.4 THE IDENTIFICATION OF GENES WITH ESSENTIAL FUNCTIONS IN ZEBRAFISH DEVELOPMENT...... 16 1.5 POU DOMAIN TRANSCRIPTION FACTORS REGULATE GENE EXPRESSION DURING DEVELOPMENT ...... 18 1.6 EMBRYONIC DEVELOPMENT OF THE VERTEBRATE BRAIN...... 21 1.7 THE ROLE OF THE MIDBRAIN-HINDBRAIN (MHB) ORGANIZER ...... 23 1.8 THE ROLE OF POU2 (SPG) IN MHB ORGANIZER DEVELOPMENT ...... 24 1.9 EARLY DEVELOPMENT OF ENDODERM FORMATION ...... 25 1.10 THE ROLE OF POU2 IN ENDODERM DEVELOPMENT...... 28 1.11 QUESTIONS AND AIMS OF THIS THESIS...... 29 2 RESULTS ...... 30
2.1 MOLECULAR CHARACTERIZATION OF SPIEL-OHNE-GRENZEN (SPG)...... 30 2.1.1 Mutagenesis screens yield new alleles of spiel-ohne-grenzen (spg)...... 30 2.1.2 The zebrafish pou2 gene is mutated in spg...... 30 2.1.3 Autoregulation of pou2 suggests spghi349 as the strongest spg allele...... 33 2.1.4 The zebrafish pou2 is the orthologue of the mouse Oct4...... 33 2.2 THE ROLE OF SPG/POU2 IN NEUROECTODERMAL DEVELOPMENT...... 34 2.2.1 spiel-ohne-grenzen (spg) is required for midbrain-hindbrain boundary and hindbrain development ...... 34 2.2.2 How can the spg MHB phenotype be related to pou2’s function ? ...... 36 2.2.3 Establishment and maintenance of the MHB is affected in spg mutants...... 38 2.2.4 Positioning of the MHB is normal in spg embryos...... 40 2.2.5 Early failure of hindbrain gene expression in spg mutants ...... 42 2.2.6 Prosencephalic gene expression is caudally expanded in spg...... 44 2.2.7 Mesendoderm development in spg embryos ...... 47 2.2.8 Functional analysis of pou2 ...... 48 2.3 POU2 IS ESSENTIAL FOR THE COMMITMENT TO THE ENDODERM LINEAGE...... 60 2.3.1 pou2 exerts both maternal and zygotic function during zebrafish development...... 60 2.3.2 The differentiation of endodermal precursors is abolished in MZspg embryos...... 62 2.3.3 pou2 is required cell autonomously within the endoderm to elicit endodermal differentiation...... 65 2.3.4 Temporal requirement for pou2 in endoderm development...... 66 2.3.5 Pou2 and Cas are synergistically required for endodermal differentiation ...... 69 2.3.6 MZspg mutant cells develop into mesoderm...... 72 Table of contents 5 - 3 DISCUSSION...... 76
3.1 THE FUNCTION OF ZYGOTIC POU2 IN MHB ORGANIZER AND HB PRIMORDIUM DEVELOPMENT.76 3.1.1 Nature of the spg alleles...... 76 3.1.2 pou2 serves different functions in early embryonic development...... 77 3.1.3 spg functions during establishment of the MHB- and hindbrain primordium ...... 77 3.1.4 Competence to respond to Fgf8 in the early hindbrain requires pou2...... 79 3.1.5 spg/pou2 functions during maintenance of the MHB- and hindbrain primordium...... 81 3.1.6 The role of pou2 in ear development ...... 84 3.1.7 Control of totipotency versus differentiation switch ...... 84 3.1.8 Early developmental pou2 function – a correlation to mouse Oct3/4 ?...... 85 3.2 THE ROLE OF MATERNAL AND ZYGOTIC POU2 IN ENDODERM DEVELOPMENT...... 86 3.2.1 MZspg mutant embryos reflect lack of Pou2 function...... 86 3.2.2 pou2 is required for the first step of endoderm differentiation and acts in a cell autonomous manner ...... 87 3.2.3 pou2 acts cell autonomously, and the contribution of both maternal and zygotic pou2 is necessary in endoderm differentiation...... 88 3.2.4 Pou2 acts together with Cas to elicit endoderm differentiation ...... 89 3.2.5 pou2 biases the fate decision of bipotential endo-mesodermal progenitor cells and is required for commitment to the endodermal lineage ...... 90 3.2.6 A conserved role for pou2 in endoderm formation? ...... 91 4 MATERIALS AND METHODS ...... 93
4.1 MATERIAL ...... 93 4.1.1 Animals...... 93 4.1.2 Technical equipment...... 94 4.1.3 Chemicals...... 94 4.2 METHODS ...... 97 4.2.1 Fish maintenance...... 97 4.2.2 Test for the phenotypical complementation of mutations ...... 97 4.2.3 Radiation Hybrid (RH) mapping for the fgfr3 coding region...... 97 4.2.4 DNA and RNA preparation ...... 97 4.2.5 Identification of homozygous spghi349 mutant carriers by genotype-specific PCR ...... 98 4.2.6 Genetic mapping of the spg locus to the pou2 locus ...... 98 4.2.7 Sequencing of mutant cDNA...... 99 4.2.8 Cloning of murine Oct3/4 (Pou5F1) and Osteopontin (Opn) cDNA...... 99 4.2.9 Dissection of mouse embryos and whole mount in situ hybridization (ISH)...... 99 4.2.10 Analysis of gene expression by whole mount ISH of zebrafish embryos...... 99 4.2.11 Generation of antisense RNA ISH probes...... 100 4.2.12 Generation of poly(A) mRNA for injection...... 101 4.2.13 Generation of morpholinos for injection ...... 101 4.2.14 Generation of DNA for injection...... 101 4.2.15 Injection of messenger RNA (mRNA), morpholinos, DNA and vital dyes...... 101 4.2.16 Analysis of protein expression by antibody staining...... 102 4.2.17 Staining with vital dyes and microscopy of living embryo...... 103 4.2.18 Histochemistry ...... 103 4.2.19 Implantation of beads coated with Fgf8 protein ...... 103 4.2.20 Transplantation and detection of single cells...... 103 4.2.21 RGC axon front filling...... 104 4.2.22 Inhibiton of Fgf signaling...... 104 4.2.23 Dual-Luciferase Reporter Assay (DLRA)...... 104 Table of contents 6 -
5 APPENDIX...... 106
5.1 MZSPG EMBRYOS REVEAL NEW FUNCTIONS OF POU2 IN DORSO-VENTRAL (DV) PATTERNING ...... 106 5.1.1 Establishment of axes in the early embryo ...... 106 5.1.2 pou2 is necessary for early dorso-ventral (DV) patterning...... 107 5.1.3 Behaviour of cell movements of MZspg mutant cells...... 111 5.2 EPIBOLY MOVEMENT IS DIFFERENTIALLY AFFECTED IN MZSPG MUTANTS...... 113 5.3 THE MZSPG MUTANT PHENOTYPES AFFECTING ENDODERM, DV PATTERNING AND EPIBOLY CAN BE DISENTANGLED FROM EACH OTHER ...... 116 6 REFERENCES ...... 117 7 PUBLICATIONS...... 127 7 Index of Figures
Figure 1 Development of the zebrafish...... 14 Figure 2 Morphogenetic movements ...... 15 Figure 3 Initial steps of endoderm formation ...... 27 Figure 4 The pou2 gene is mutated in spg mutant embryos...... 32 Figure 5 The brain phenotype of spg mutant embryos at pharyngula stages...... 35 Figure 6 Expression of pou2 during embryogenesis...... 37 Figure 7 The primordium of the MHB organizer is affected in spg embryos...... 39 Figure 8 Normal MHB positioning, but affected hindbrain primordium in spg ...... 41 Figure 9 Prosencephalic markers expand posteriorly in spg embryos...... 46 Figure 10 pou2/Oct4 mRNA injection rescues spg mutants...... 49 Figure 11 pou2 morpholinos phenocopy the spg mutant phenotype...... 51 Figure 12 pou2 is cell autonomously required within the neuroectoderm...... 54 Figure 13 pou2 and fgf8 act synergistically to activate HB primordial genes...... 56 Figure 14 The double mutant spg-ace embryo shows severe brain phenotype...... 58 Figure 15 The role of pou2 in neuroectodermal development...... 59 Figure 16 Generation of MZspg and Mspg mutant embryos...... 62 Figure 17 Marker gene expression for endodermal progenitor and precursor cells...... 64 Figure 18 pou2 is cell autonomously required in the endoderm...... 66 Figure 19 Maternal and zygotic pou2 is required for endoderm development...... 68 Figure 20 Epistatic relationship between pou2 and endoderm promoting Nodal signaling...... 70 Figure 21 Epistatic relationship beween pou2 and cas...... 71 Figure 22 Luciferase Assay...... 72 Figure 23 MZspg mutant endomesodermal progenitors develop into mesoderm...... 73 Figure 24 cas can repress ntl independently of pou2...... 74 Figure 25 The role of pou2 in endoderm differentiation...... 75 Figure 26 MZspg embryos appear strongly dorsalized...... 108 Figure 27 Gene expression in MZspg embryos at blastula stages...... 110 Figure 28 Cell movement behaviour of MZspg embryos...... 112 Figure 29 Epiboly movement is affected in MZspg embryos...... 115 Table of contents 8 - Abbreviations
AP anterior-posterior ace acerebellar (fgf8) BMP Bone morphogenetic protein bp basepair(s) BSA Bovine serum albumine C degree Celsius CE convergence-extension DAB 3’-3’-Diaminobenzidine DMSO Dimethylsulfoxide DNA Deoxyribonucleic acid dpf day(s) post fertilization dNTP deoxy-A/C/G/T-Triphosphate DV dorso-ventral EVL enveloping layer Fgf(r) Fibroblast growth factor (receptor) HB Hindbrain hr(s) hour(s) hpf hour(s) post fertilization ISH in-situ-hybridization MESAB 3-aminobenzoic acid ethyl ester MHB Midbrain-hindbrain-boundary M maternal min minute(s) morpholino(s) morpholino-modified oligonucleotide(s) mRNA messenger ribonucleic acid MZ maternal-zygotic n number(s) OD optical density o/n over night PCR Polymerase chain reaction r rhombomere(s) rpm rotations per minute RT room temperature s second(s) spg spiel-ohne-grenzen (pou2) som somite(s) UTR untranslated region UV Ultraviolet YSL yolk syncytial layer Z zygotic 9 1 Introduction 1.1 Developmental biology and its elementary concepts
One elementary problem of the development of organisms is how cells are organized into functional structures and assembled into whole organisms, involving the spatio- temporal patterning and the differentiation of many different cells from one single cell. This central theme of development is addressed by developmental biology which is a synthetic discipline, unified by the understanding derived from other different main disciplines like experimental embryology, morphological embryology, developmental genetics and molecular biology. An important feature of embryonic development is pattern formation, which is the formation of a particular arrangement of cells in three- dimensional space at a given point of time. This is achieved by regional specification of the embryo, which involves the activation of the right genes in the right places. Regional specification can be achieved by cellular differentiation: Multipotent progenitor cells change their state in terms of gene expression which is associated with a loss of multipotency and a gain of a certain level of fate determination. Assignment of a particular cell fate can be achieved by a combination of inheritance of specific factors that create a combinatorial code of transcriptional activity and regulatory networks that ensure the activity of particular combinations. Mechanisms acting during ontogenetic development, giving rise to pattern formation, are predominantly gene product interactions and changes in cellular behaviour and can be assigned to three main categories (Salazar-Ciudad et al. 2003): (1) Cell autonomous mechanisms: Cells can enter a specific arrangement or state without employing cell-cell interactions but involving equal cell division (mitosis) of heterogenous eggs or asymmetric cell division of polarized cells. Thereby, gene products like mRNAs or proteins can be distributed into different parts of a cell and are segregated into different daughter cells. (2) Inductive mechanisms: Embryonic induction is a phenomenon described by classical experimental embryologists and is based on “outside” influences, where a cell or a population of cells evoke a specific developmental response i.e. instructing a program of gene expression or protein activity in other cells. Therefore, inductive interactions involve two primary components: a signal that is generated by the inducing cell and the interpretation of this signal by a receptive system that directly or indirectly controls gene expression in the responding cell. Responsive cells may be predisposed to adopt different fates in response to a uniform concentration of the inducing signal which is typical for threshold signaling. The inducing signal can be membrane-bound or a Introduction 10 - secreted diffusible factor, which can exert its signaling property in a short range or in a long range whereby the range of action can be regulated e.g. by differences in the presentation of inducing ligands, which can be membrane anchored, attached to the extracellular matrix, or freely diffusible. Signal transduction is finally coupled to the regulation of transcription factors and signaling can be controlled at various levels of the signal transduction cascade (reviewed by Freeman and Gurdon 2002). An operational variation of this concept is the concept of positional information, linking the process of cell fate assignment to pattern formation: cells develop according to where they lie in an inductive field. Thereby, a single inducer could elicit a concentration gradient, thereby specifying many embryonic regions, with different concentrations eliciting different responses, e.g. switching on different genes. This is the classical concept of how morphogens act as previously suggested (Wolpert 1981, Meinhardt 1983). It is noteworthy to mention that the concept of a morphogen can also be applied not only to multicellular tissues, but also to intracellular differentiation of single, polarized cells where the morphogen can also be a transcription factor. One important prerequisite of induction is competence, which endows cells with the ability to receive or to interpret an incoming and instructive signal and describes the state of responsiveness. Competence may be controlled at various levels, e.g. by modifying the expression or activity of the appropriate receptors, components of the intracellular signal transduction pathway or the transcription of target genes. (3) Morphogenetic mechanisms: Some patterning mechanisms use cellular behaviour other than signaling (but signaling may have been active at prior stages), leading to a change in the spatial arrangement of cells without changing the fate of the cells. In particular, these mechanisms can involve differential growth, apoptosis, directed mitosis, movements like migration and differential cell adhesion. Developmental mechanisms of these three categories can also be combined, and development is normally a concert of spatio-temporally ordered inductive and morphogenetic processes, where strict cell-autonomous mechanisms are frequently exerted in very early stages of development (i.e. maternal phase).
1.2 The zebrafish: a vertebrate system to study ontogenetic development
The adult zebrafish species Danio rerio (former name: Brachydanio rerio), belongs to the Superclass of the Gnathostomata, Class Actinopterygii, Division Teleostei, Introduction 11 - Subdivision Euteleostei, Superorder Ostariophysi, Order Cypriniformes, Familiy Cyprinidae (carps), Subfamily Rasborinae, Genus Danio. Zebrafish have originated in the southeast of Asia and their nowaday natural habitats are the tropical freshwaters of Asia, predominantly of Pakistan and India, as well as Africa. The zebrafish was first subject of scientific interests in the 1930s, when Jane Oppenheimer recognized its suitability for experimental biology (Oppenheimer 1936). For several years, the adult zebrafish has been employed for toxicological investigations. Recently, the zebrafish embryo has come into focus to answer developmental biological questions, starting in the 1980s by George Streisinger and colleages, who first began the genetic study of the zebrafish and established mutagenesis and mapping techniques (Streisinger et al. 1981). The embryo of the zebrafish offers many advantages to study a plethora of developmental aspects which are indicated in the following. Zebrafish eggs (zygotes) are easy to handle because they develop extracorporally and are relatively large (0.7 mm). The embryo is optically transparent from earliest development onwards, and semitransparent in later developmental stages, allowing the live morphological inspection even at organogenesis stages (e.g. heart development). Importantly, the embryo is accessible at all stages of development to experimental manipulations such as the microinjection of nucleic acids and lineage tracer molecules, cell transplantations or cell ablations. Embryonic development is already finished after 2 days post fertilization (dpf) at 28.5°C, and the generation time amounts to 3 months. The zebrafish (which has a diploid karyotype consisting of 25 chromosomes) has also been highly amenable to, and therefore, has a strong background of genetic analyses. In particular, it has been subject of several types of mutagenesis where it is one of the few vertebrates in which large scale screens are feasible. Moreover, sequencing of the zebrafish genome is nearly completed. The adult zebrafish, which is 4-6 cm in body length, can be readily bred in tanks in the laboratory, and the maintainance of a zebrafish facility is thereby less space consuming as compared to a mouse facility, which bears financial advantage but also an important prerequisite for the application of large-scale mutagenesis screens. Following a particular light-dark cycle, adult female fish spawn synchronized egg clutches, resulting in up to 900 eggs per day. The interval of successful spawnings by a female is 5-7 days. Beside the zebrafish, the Japanese Medaka fish (Oryzias latipes) contributes to developmental biology as well. However, in contrast to zebrafish, it has been subject of genetic studies to a lesser extent. In addition, the Japanese puffer fish (Fugu rubripes) has been used mainly as a model for in silico comparative genomic studies, aiding gene Introduction 12 - prediction and identification of non-coding regulatory motifs of other vertebrates. All together, the zebrafish system uniquely allows for the combination of embryological, cytological as well as genetic approaches.
1.3 Ontogenetic development of the zebrafish
In the following, I will briefly introduce important stages of embryonic development of the zebrafish which were previously described (Figure 1; Kimmel et al. 1995). Morphological staging information is based on embryonic development at 28.5°C. Ontogenesis of the zebrafish starts with the external fertilization of the egg, where a spermatozoon enters the oocyte at the future animal pole. The freshly laid egg is surrounded by a transparent chorion. At the one-cell-stage contractile forces cause yolk- free cytoplasm to accumulate at the animal pole of the telolecithal zygote, thereby segretating from the vegetal part of the egg, which is enriched with yolk granules. Segregation of the blastodisc (which gives rise to the embryo proper) from the vegetal pole perpetuates during early cleavage stages. During early cleavage stages the zygote starts to divide in a discoidal-meroblastic manner, leaving newly formed blastomeres interconnected by cytoplasmic bridges. Blastomeres are cleaved radial-symmetrically without cell growth, thereby diminishing in size in the course of early development. Although early cleavages produce highly stereotyped arrays of cells, no aspect of the final body plan appeas to be specified by these arrays, what is called undetermined development. With the fourth cleavage (16-cell-stage), central cells become completely cleaved from the others. In contrast, marginal blastomeres remain cytoplasmatically connected to the yolk cell. Already during early cleavage stages the embryo undergoes its first divison into two cell lineages: (a) germ line cells, which inherit unique maternal transcripts demarcating them as primordial germ cells (PGCs), and (b) somatic cells forming the large bulk of the embryo. During early blastula stages, when the embryo consists of 1000, cells it undergoes various cellular changes, collectively termed as midblastula transition (MBT), which is triggered by reaching a distinct nucleo- cytoplasmic ratio. This period is hallmarked by the lengthening of the cell cycles, which progresses now in metasynchronous waves through the embryo. Until MBT, the embryo lives exclusivley on maternal products including mRNAs, proteins or mitochondria which have been deposited into the oocyte. At MBT, zygotic transcription commences and cells become motile during the interphases of their cell cycles. Marginal most cells collapse and release their cellular content, including nuclei, into the underlying Introduction 13 - cytoplasm of the yolk cell, thereby constituting an teleost-specific extraembryonic structure, the yolk syncytial layer (YSL). At late blastula stages, distinct morphogenetic movements commence: epiboly starts with the doming of the yolk cell and causes a specific distribution of cells whereby cells migrate and spread over the yolk cell in an animal-to-vegetal direction, thereby thinning the blastoderm. At the same time the first topological distinction is made between an unicellular sheet of an outermost layer, the enveloping layer (EVL) and a deep cell multilayer, the deep enveloping layer (DEL). Until completion of gastrulation at the tailbud stage, developmental stages are in the following indicated by ‘percentage of epiboly’. This nomenclature refers to the extent to which the blastoderm has spread over the yolk cell along the animal-vegetal axis, or, in other words, the blastoderm margin is at a certain percentage of the entire distance between the animal and vegetal pole. At 50% epiboly additional, interdependent morphogenetic cell movements commence, hallmarking the start of the gastrulation period which gives rise to the re-organization of the embryo into three germ layers and involves a concert of morphogenetic movements (Figure 2). Outer, prospective ectodermal cells that interact directly with the environment are separated from inner cells affiliated with e.g. nutritive functions. The marginal most DEL cells start to involute around the germ ring in an vegetal-to-animal direction, leading to a thickening of the blastodermal margin, the germ ring. Involution is more pronounced at the dorsal as compared to the ventral side. At the same time, cells start convergence and move to the prospective dorsal side of the embryo which leads to the formation of a knob-like thickening at the dorsal margin, which is called the shield (this structure is functionally orthologous to the node in the mouse and the chick, and to the dorsal blastopore lip in the frog). Introduction 14 -
FIGURE 1 Development of the zebrafish Stages are named after anatomical features and developmental age at 28°C. Stages are depicted in lateral views if not noted otherwise. Until the 16 somite stage the prospective dorsal embryonic side is to the right. Modified after camera lucida drawings of Kimmel et al. (1995).
Involuting cells give rise to the hypoblast, comprising the mesoderm and the endoderm, which is continuously fed by cells from the overlying epiblast or ectoderm. In additon to convergence movements along the VD axis, medio-lateral intercalation - extension movements of cells near the dorsal side occur along the animal-vegetal, or future anterior-posterior axis, which act in concert with epiboly to extend the embryo Introduction 15 - along the AP axis. When epiboly is completed at the end of gastrulation, the yolk is completely covered by the blastoderm, and the concerted movements have established the DV and AP body axes. After gastrulation the embryo is further patterned and elongated in the course of the segmentation period along its DV and AP axes. In particular, the tailbud extends away from the yolk cell to produce the embryonic tail region. The gut tube forms in close apposition to the yolk surface and the notochord primordium separates from the adjacent somitic mesoderm which is progressively subdivided into the segmentally arranged somites. Anteriorly, the forebrain, midbrain, hindbrain and, posteriorly, the spinal cord primordia become morphologically distinct, reflecting the AP regionalization along the central nervous system. After 1 dpf the pharyngula period starts and the basic body plan structures become visible and the embryo subsequently developes a beating heart, circulating blood cells and a partly functional neural circuitry. The embryonic axis has straighten and organogenesis ensues for the next days. After 2 dpf the embryo hatches from the chorion and has completed most of its morphogenesis. At 5 dpf larvae develop a swim bladder and commence to swim and to feed. Sexual maturity is reached within 3-4 months, and adults can live for 2.5 – 4 years.
FIGURE 2 Morphogenetic movements The cartoon illustrates various concurrent cell movements in the gastrulating teleost embryo occurring at the same time. Epiboly spreads the blastoderm over the yolk, involution generates the hypoblast, and convergence brings cells of the hypo- and epiblast towards the dorsal side of the embryo, where cells intercalate and extend towards the animal (future anterior) pole to generate the embryonic axis. After Gilbert 1997.
Development of the zebrafish embryo - as of other vertebrates or Drosophila – is called indeterminate: the fate of cells becomes determined comparably late in development, during gastrulation. Experiments involving the generation of mosaic embryos revealed that indeterminate embryos can compensate for the loss of cells and thus are called “regulative”. In particular, there are no defined numbers of cells or a stereotyped pattern Introduction 16 - of division like in C. elegans, where the fate of the cells is determined from early development onwards wherey cell lineages can be discerned by simple observation and at the single cell level of resolution. Moreover, multicellular arrangements matter more than individual cells and the progeny of indeterminate cells is allocated to particular fates according to their position. Studies of cell lineages, which refer to the pattern of descendent through which a cell of an organism can be traced back to the zygote, help to develop ‘fate maps’, which are graphic representations of the early embryo’s contribution of undifferentiated cells of various ‘founder’ regions to the final structures, thereby revealing early spatial relationships between cell populations that might be dispersed later. Cells are not specified and committed to a particular fate at blastula stages but become specified to a specific germ layer at mid-gastrula stages, where a cell embarks on a distinct developmental pathway, leading from an undifferentiated state to a distinct developmental fate (Davidson 1993; Ho and Kimmel 1993). After specification, the fate of a cell undergoes commitment, starting earliest at the end of gastrulation: the developmental potential of the cell becomes restricted such that it will autonomously give rise to one particular type.
1.4 The identification of genes with essential functions in zebrafish development
Genetic mutagenesis screens have been the most powerful approach to elucidate the molecular nature of a large number of genes and to study their encoded gene products to delineate its affiliated developmental processes. Mutations have been successful tools to identify biologically relevant genes in the mouse, C. elegans or Drosophila. The establishment of genetic methods in zebrafish has allowed a systematic mutational analysis of vertebrate development (Streisinger et al. 1981; Kimmel 1989; Rossant and Hopkins 1992; Mullins and Nusslein 1993, 1993; Solnica-Krezel et al. 1994). Forward genetic approaches were carried out before in the zebrafish, predominantly using electromagnetic waves like X-rays or gamma-rays as the mutagen which results in deletions or chromosomal rearrangements of one or more genetic loci (Kimmel 1989). Recently, genome-wide large scale Mendelian genetic mutagenesis screens for embryonic phenotypes have been applied. In particular, two main strategies have been employed to recover recessive mutations which affect zygotically expressed genes: parthenogenetic (F1) screens and 2-generation (F2) screens. (Haffter et al. 1996; Driever et al. 1996). For the facilitation of forward genetics by reverse genetics, a new Introduction 17 - PCR-based basepair mismatch detection technique, called TILLING, is currently adopted for the zebrafish and facilitates the selection and elucidation of chemically induced point mutations of known genes already of the F1 generation (McCallum et al. 2000). Chemicals like the alkylating agent ENU (N-ethyl N-nitrosourea) have been employed as mutagens which usually introduce single base-changes. Although the mutation frequency can vary widely for different loci, chemical mutagens can induce single point mutations to most genes of the germline, and so far, mutations in more than 1000 genes could be recovered by chemical mutagenesis. However, cloning of mutated loci remains difficult and involves arduous and time-consuming genetic linkage mapping techniques and positional cloning (for review: Kelly et al. 2000). Otherwise, genes can be identified by the testing of likely candidates based on existing knowledge of the other model organisms. However, positional cloning methods will be speed up when the genome has been physically mapped to high resolution or, moreover, when the sequencing of the zebrafish genome is completed. An alternative approach to chemical-mediated mutagenesis is insertional mutagenesis which has been established for a long time in Drosophila and, recently, also in the zebrafish, where retroviral elements are mutagenic by integration into the zebrafish germline genome after injection of the virus into the embryo, leading to the generation of hundreds of insertions (Gaiano et al. 1996). The advantage of insertional mutagenesis is that it greatly speeds the cloning of mutant genes: the integrated viral DNA serves as a tag to clone mutated genes. Limitations are that insertional mutagens provoke a less efficient mutagenic rate than chemical mutagens and do not integrate entirely randomly into the host DNA. Another limitation results from the organization of the vertebrate, predominantly of teleostean genomes where genes are frequently represented in large families and multiple gene copies, often with partially or completely functional redundancy (Force et al. 1999). This genetic redundancy may preclude the identification of key regulatory genes even when “saturation” is achieved. Moreover, mutational saturation of the zebrafish genome (which is estimated to be 1.7 gigabase in size, harbouring approximately 3000 genes essential for development; Streisinger et al., 1981) has not been achieved so far for its technical difficulty, even using chemical mutagens. However, a gene whose null mutant is an early lethal in mouse may appear as two genes each of whose null phenotype is milder, allowing development to a more advanced stage or even long term viability. In contrast to mouse, reverse genetic approaches like gene replacement strategies based on homologous Introduction 18 - recombination are so far not amenable in the zebrafish, although ES cells are now available (Sun et al. 1995). However, modified antisense RNA-analoga termed “morpholinos” can be targeted against mRNAs to prevent gene expression at the level of protein translation or splicing, respectively.
1.5 POU domain transcription factors regulate gene expression during development
Since all genes are transmitted to all cells, expression of the genes must be regulated differently: different genes have to be activated in different cells which is central to elicit cell differentiation. Gene expression is spatio-temporally controlled at the transcriptional level, involving chromatin accessibility, but also at the translational aswell as the post-translational level. The principle of transcriptional gene regulation was discovered by Jacob and Monod in Prokaryotes whereby regulatory genes are required to control gene expression of other regulatory or structural genes (Lewin 2000). Positive regulators are necessary to switch on gene expression whereas negative regulators render genes inactive unless their repressory function can be overcome by additional activators of transcription. In general, eukaryotic genes, which are important in developmental processes and transcribed by RNA polymerase II, harbour the promotor region normally upstream in the near vicinity of the transcriptional start within the 5’ untranslated region of the gene. The cis-regulatory promotor region determines where the RNA polymerase binds to the gene, where it assembles with various additional factors of the basal transcrition factor complex. In addition to basal transcription factors, specific transcriptional factors, which ensue time- and/or tissue- dependent transcriptional activation, bind to additional cis-regulatory enhancer elements which can be separated from the promotor region up to 400 kbp. These specific factors can directly determine gene expression by positively (transcriptional activators) or negatively (transcriptional repressors) influencing the kinetics of the formation of the transcriptional initiation complex at the promotor. Transcription factors are hallmarked by their abilities of DNA-binding and interacting with the basal transcription initiation complex, exerted by distinct protein domains. To achieve proper transactivation, specific transcription factors have to ensue direct protein-protein interactions with the basal transcription complex at the promotor region, and transactivation is mediated by an activation domain of the specific transcription factor. Alternatively, interaction between transcription factors bound to enhancer and promotor regions can be mediated Introduction 19 - indirectly via the interaction with additional, so-called ‘architectural’ or ‘bridging’ factors. Immediate proximity between enhancer and promotor regions is thought to be achieved by looping or bending of the intermittent DNA portion. Since my thesis focuses on the ontogenetic role of a particular transcription factor in the zebrafish, I would like to introduce the family of POU domain transcription factors it is assigned to. POU domain proteins represent a structurally related subfamily of homeodomain-containing transcription factors that are involved in many animal orders in a broad range of biological processes ranging from housekeeping gene functions to programming of embryonic stem cells, fate commitment events in the developing as well as in the adult organism (reviewd in Ryan and Rosenfeld 1997). ‘POU’ is initially derived from four independently investigated founder members of this protein superfamily, Pit-1, Oct-1/2 and Unc-86, which shared significant similarities within their DNA binding domain. Transactivation domains (seronine/threonine-rich regions) are found N- and C-terminally, outside of the POU domain, and activate the basal transcription machinery, which consists of DNA-dependent RNA polymerase and its associated core transcription factors, from a distant promotor or enhancer element. POU domain factors can be currently grouped into six distinct subclasses according to gene structure, sequence homology and structural conservations in the POU domain and the flexible linker region. DNA binding domains modulate the properties of nuclear factors to which they are attached and ensue their attachment to regulatory DNA elements. Crystallization and in vitro binding studies contributed to the delineation of POU factor’s mode of action: POU domain proteins bind to a DNA recognition element, the octamer motif (ATGCAAAT), by means of two conserved, tandemly arranged (bipartite) domains separated by a variable and flexible linker which is supposed to enhance the overall affinity for the full binding site. The bipartite POU domain comprises the POU-specific domain (POUS, 75-82 aa) and the POU α homeodomain (POUH, 60 aa), each of them containing –helical segments (Klemm et al. 1994). The homeodomain of POU domain proteins shows the least similarity to other homeodomain-containing proteins. The POU-specific domain is structurally, but not in regard to its amino acid sequence, highly similar to the transcriptional repressor of the λ phage, and confers high affinity, site-specific DNA binding. The α−helices 2 and 3 of both the POUS and the POUH domain form a ‘helix-turn-helix’ motif that are similar, while the remaining parts of these domains are highly different. The DNA- recognition-helix 3 of the POUS domain contacts the 5’ subsite of the Octamer sequence with four highly conserved amino acid residues, whereas helix 3 of the POUH domain Introduction 20 - recognizes the DNA bases of the 3’ subsite of the Octamer sequence. Thereby, both POU domains bind to opposite sites of the DNA double helix with their recognition helices in the major groove, whereby homo- or hetero-dimeric protein-protein interactions involving other transcriptional co-regulators occur in a highly cooperative manner, since POU domain proteins elicit their transcriptional function generally in partnership with transcriptional co-factors, which in turn can influence the activity of POU domain proteins in a positive or negative way (Rhee et al. 1998). Co-factors of POU domain proteins are frequently DNA-bending HMG proteins like Sox transcription factors (Wilson et al. 2002). The sequence of a regulatory DNA element can significantly influence whether a bifunctional nuclear factor exerts transcriptional activity or transcriptional repression. Therefore, regulatory DNA elements can function as allosteric effectors by positioning the transcriptional regulator in the proximity of a gene promotor and, furthermore, providing information about the mode of regulation. In particular, the DNA motif not only serves as a binding site for transcription factors but also regulates their function by mediating distinct assemblies of transcription factors, which determine binding to conformation-dependent co-regulators. Based on the precedents of some POU domain proteins it is suggested that enhancer elements are able to mediate different quaternary conformational arrangements of the same POU transcription factor whereby different arrangements result in differential interaction with transcriptional co-regulators, eliciting different transcriptional responses: either activation or repression of transcription. Moreover, distinct dimeric arrangements, e.g. by different spacing arrangements of the half-sites of the DNA motif or the context of additional regulatory DNA elements, allow selective recruitment of cofactors, which exert diverse effects on transcription. Therefore, differences in specificity between POU protein subtypes may result from distinct spacing or orientation of the two tethered POU subdomains rather than from distinct amino-acid-DNA contacts (Klemm et al. 1994; van Leeuwen et al. 1997; van Leeuwen et al. 1997). POU domain proteins likely exploit multiple regulatory strategies to execute programs of gene activation, including also phosphorylation and nuclear translocation in addition to the recruitment of co-regulators (Veenstra et al. 1999). Introduction 21 - 1.6 Embryonic development of the vertebrate brain
The organization of the vertebrate brain and its differentiation into functionally and anatomically distinct areas is based on early patterning and regional specification of the neural plate during embryonic development. The genetic control of vertebrate brain development is now beginning to be understood through a combination of investigative gain- and loss-of-function approaches involving various biological systems. Mechanisms involved in the formation of the various subdivisions of the brain share many common elements among vertebrates, making it possible to generalize information learned in one organism to all vertebrates. In vertebrates, initiation of neuroectodermal identity is established during gastrulation on the dorsal side within the ectoderm of the embryo. Originally, Niewkoop 1952 (review: Nieuwkoop 1999) proposed a two-step model responsible for inducing different regions of the nervous system: In a first activation step, neural fate is induced and forebrain is specified. During a second transformation step, neuroectoderm becomes differentially posteriorized (reviewed by Sasai and De Robertis 1997). This model invokes the dorsal gastrula organizer (Spemann 1938; Nieuwkoop 1973; Kodjabachian et al. 1998; Solnica-Krezel 1999), which establishes dorsal-ventral (DV) patterning through BMP, Noggin and Chordin signaling (Fekany-Lee et al. 2000; Hammerschmidt et al. 1996; Bauer et al. 1998), as an inducer of the anterior-posterior (AP) determination of the neurectoderm. In particular, both vertical signals emanating from the mesendoderm and planar signals travelling within the plain of the neuroectoderm itself are thought to be involved in neural plate patterning (Ruiz i Altaba 1994; Kelly and Melton 1995; Lumsden and Krumlauf 1996; Wilson et al. 2002). However, this model re-inforces some modifications, since several zebrafish mutations affecting mesoderm development do not disrupt the initiation of neuroectoderm along the AP axis in the absence of many of these signals (Barth et al. 1999; Fekany-Lee et al. 2000). It thus remains a major question as to how the AP axis of the neurectoderm is established in the early embryo. In the zebrafish, fate mapping experiments revealed that cells contributing to the nervous system occupy distinct regions of the embryo already at the onset of gastrulation, similar to that of other chordate embryos (Kimmel et al. 1990; Woo and Fraser 1995). Cell fates of the neurectoderm are in large part demarcated by a sequence of gene expression patterns that are established early in the early gastrulating embryo. In particular, otx1, otx2 and gbx1 are the first genes transcribed neuroectodermally, Introduction 22 - commencing expression at about 65% epiboly in what will ultimately become the fore/midbrain and the hindbrain, respectively (Li et al. 1994; Mori et al. 1994, Rhinn et al., 2003). Genes encoding transcription factors like her5, bts1, pax2.1, gbx2, or secreted factors like fgf8 and wnt1 appear next, between 70% and 90% epiboly, defining the midbrain-hindbrain region (Krauss et al. 1991; Kelly and Moon 1995; Lun and Brand 1998; Reifers et al. 1998; Rhinn and Brand 2001). Slightly later, pax6 expression is evident in both the forebrain and hindbrain regions (Krauss et al. 1991; Amirthalingam et al. 1995). Thus, the earliest rostro-caudal organization of the zebrafish CNS is basically divided into three domains based on unique regulatory gene expression within the neuroepithelium at the end of gastrulation, where a neural plate is morphologically evident as a dorso-medial thickening of cells, before any distinct brain structures are visible under the microscope. In particular, patterning of the forebrain depends on a neuroectodermal 'organizer' comprising the rostral-most cells of the neuroectoderm (Houart et al. 1998). Furthermore, development of the midbrain and the anterior hindbrain depend on an 'midbrain-hindbrain (MHB) organizer', which will be introduced in more detail in the following chapter. Knock-out studies in the mouse and expression analysis in the zebrafish suggest mutual repression of otx2 and gbx2 (gbx1 in zebrafish) to be crucial for the initial spatial determination of MHB-specific gene activation (Wassarman et al. 1997; Simeone 1998, Broccoli et al. 1999; Millet et al. 1999; Rhinn et al., 2003). A tripartite organization, including a structure homologous to the vertebrate MHB, is already developed in invertebrate protochordates like ascidians (Wada et al. 1998; Kozmik et al. 1999). In the course of gastrulation the neural territory, as other parts of the embryo, becomes rearranged, involving convergence to the dorsal side, as well as an extension along the AP axis (Kimmel et al. 1994; review: Solnica-Krezel et al. 2002). Neurulation coincides in time with the segmentation of the zebrafish trunk and tail, which is characterized by the formation of somites at regular spatio-temporal intervals. Like other teleosts, neurulation of the zebrafish proceeds primarily by secondary neurulation, or neuroepithelial infolding at the midline, driven by convergent extension movements, thereby composing the neural keel, rather than closure of the neural fold (Papan et al. 1999). Only secondarily the neural rod, which has formed from the keel, cavitates, and gives rise to the central canal (neurocoel). Signals emanating from the precordal plate and the notochord, axial mesodermal structure underlying the neural tube (the latter gives rise to the adult corda dorsalis), pattern the neural tube along its DV axis. The prospective brain becomes morphologically subdivided into Introduction 23 - neuromeres by constrictions along the AP axis after a half day of development, giving rise to the telencephalon and diencephalon of the forebrain, to the midbrain, and to the hindbrain, which is subdivided the cerebellum and seven rhombomeres. Neuronal differentiation commences in ventro-bilateral regions of the neural tube, and primary neurons become interconnected by axons after 1 day of development (Kimmel 1993). 1.7 The role of the midbrain-hindbrain (MHB) organizer
The boundary region comprising the future morphological border between the midbrain and the hindbrain of vertebrates, also called midbrain-hindbrain-boundary (MHB) or isthmic constriction, serves as an organizer for posterior midbrain and cerebellum development. The concept of an organizer was defined by Spemann and Mangold 1924 (Spemann et al. 2001) as a piece of embryonic tissue that “creates an organization field of a certain orientation and extent, in the indifferent material in which it is normally located or to which it is transplanted”. The organizer potential was initially demonstrated by transplantation experiments in chicken embryos, where isthmic tissue grafts induced and patterned ectopic midbrain and/or cerebellar tissue, depending on the location of the graft (Martinez et al. 1991; review: Puelles et al. 1996; Rhinn and Brand 2001; Wurst and Bally-Cuif 2001). In its normal location, the MHB organizer was then proposed to regulate polarized morphological differentiation of the adjacent tectum and elaboration of the cerebellar anlage (Martinez and Alvarado-Mallart 1990; reviews: Garda et al. 2001; Liu et al. 2001). Evidence for this concept has come from functional studies of the molecules involved. Mutational analysis as well as morpholino interference studies in zebrafish have revealed a number of genes involving pax2.1/(noi), fgf8/(ace), bts1 and eng2/3 as playing essential roles at distinct stages during MHB development (Lun and Brand 1998; Pfeffer et al. 1998; Reifers et al. 1998; Tallafuss et al. 2001; Scholpp and Brand 2001). In particular, null mutations for the pax2.1 gene (no isthmus or noi) or inactivation of its downstream targets, the eng2/3 genes, causes absence of the midbrain, MHB and cerebellum, similar to the cognate mouse phenotypes (Millen et al. 1994; Wurst et al. 1994; Favor et al. 1996; Urbanek et al. 1997; Schwarz et al. 1997). Fgf8, a secreted molecule like Wnt1, is expressed in the MHB organizer and when added ectopically mimicks the organizing activity (Crossley et al. 1996). Both factors are thought to mediate the organizing activity of the MHB on surrounding tissue. Studies of the acerebellar/fgf8 (ace) mutant in zebrafish and targeted disruption in mice highlight a crucial function of Fgf8 in maintaining MHB development (Brand et al. 1996; Reifers et al. 1998; Meyers et al. 1998; Picker et al. Introduction 24 - 1999; Araki and Brand 2001). Like other Fgfs, Fgf8 is thought to signal through the MAP kinase pathway (Basilico and Moscatelli 1992; Fürthauer et al. 2001), resulting in activation of the specific target genes gbx2, spry2, spry4, erm and pea3 after exposure to Fgf8 (Chambers et al. 2000;Fürthauer et al. 2001); Raible and Brand 2001; Araki and Brand 2001; Roehl and Nusslein-Volhard 2001; Rhinn et al., 2003). In addition, Fgf8 is required during formation of the heart field, for limb development, neural induction, telencephalon patterning, left-right asymmetry, gastrulation and ear development, among others (Brand et al. 1996; Shimamura and Rubenstein 1997; Meyers et al. 1998; Reifers et al. 2000; Shanmugalingam et al. 2000; Moon and Capecchi 2000; Streit et al. 2000). Thus, Fgf8 elicits very different responses in different embryonic target cells, raising the important question of how the differential competence of the responding cells arises. A phenotype resembling that of acerebellar (ace) mutants is displayed in spiel-ohne-grenzen (spg) mutants, which show a lack of the cerebellum and the isthmus, with a variably enlarged tectum and ear defects (Schier et al. 1996; Driever et al. 1997). 1.8 The role of pou2 (spg) in MHB organizer development
Because zebrafish can be used effectively in large-scale classical genetics, there lies great potential to use zebrafish to discover new factors involved in the early brain development of all vertebrates. In two ongoing genetic screens, one using pseudotyped retroviruses as an insertional mutagen (Lin et al. 1994; Gaiano et al. 1996; Amsterdam et al. 1999), and a second, chemical mutagenesis screen in haploid embryos (C. Klisa, N. Morita, G. Reim, M. Rhinn, S. Léger, W. Huttner and M. Brand, unpublished), mutations were isolated which mimicked the spg phenotype. In the first part of my thesis I demonstrate by genetic complementation and genetic mapping that the newly isolated mutations fail to complement each other and are highly likely new alleles of spg. In a collaboration we found that spg mutants affect the gene encoding the transcription factor Pou2, where the proviral integration in the insertional mutation disrupts the previously cloned pou2 gene (Takeda et al. 1994; Hauptmann and Gerster 1995; Burgess et al. 2002), encoding a class V POU domain transcription factor (Ryan and Rosenfeld 1997). Mapping of the chemically induced spg alleles verified the genetic linkage of the spg phenotype to the pou2 locus on linkage group 21. As a confirmation of the mapping data, injection of antisense pou2 morpholinos phenocopy the spg phenotype, and injection of pou2 mRNA can rescue the spg phenotype to the wild-type. Based on the syntenic chromosomal position, Introduction 25 - phylogenetic sequence comparisons as well as functional replacability, I suggest that pou2 is orthologous to the mammalian Oct4(Pou5f1) gene. Moreover, I performed detailed analysis of the function of the zebrafish pou2 gene during neural development and show that pou2 serves a key function during development of the MHB and the hindbrain; such a function has not been described for the mammalian homologue, therefore a novel component of the MHB genetic hierarchy could be identified by this work. pou2 functions specifically in AP patterning of the neuroectoderm where it is necessary to establish and maintain the MHB organizer and the hindbrain primordium, in agreement with its specific expression in these territories. Molecularly, pou2 is necessary to activate expression of MHB and primordial hindbrain genes like pax2.1, wnt1, gbx2 or spry4. In contrast, pou2 appears dispensable for the earliest stage of subdividing the neuroectoderm. Importantly, functional epistasis experiments and Fgf8-bead implantations demonstrate that the early neural primordium of spg mutants is insensitive to the effects of Fgf8 signaling. In particular, both Pou2 and Fgf8 are necessary to initiate gbx2 expression at the MHB primordium. Thus I suggest that pou2 is required to allow early neuroectodermal cells around the MHB to respond to Fgf8 whereby pou2 confers regionally specific competence to respond to Fgf8 signaling during brain development. 1.9 Early development of endoderm formation
One of the earliest events in bilaterian development is the segregation of the blastoderm cells into the three germlayers, the ectoderm, mesoderm and endoderm in the course of gastrulation. The term ‘germ layer’ refers to the observation that each of these tissue layers, each with a characteristic position relative to the others, acts as a rudiment, or ‘germ’, for a specific set of elements of the different tissues in the embryo. In vertebrates, endoderm gives rise to the respiratory tract, and posteriorly to the inner, epithelial lining of the gastrointestinal tract, e.g. the fish-specific swim bladder, the liver, the biliary system, the spleen and the pancreas develop from the gastro-intestinal primordium. In particular, the fish respiratory tract, i.e. segmented gill clefts, develops from pharyngeal pouch endoderm, like the glands of the thyroid and parathyroid, the thymus and parts of the inner ear (Nelsen 1953). Fate mapping experiments showed that endoderm and mesoderm derive from a common primordium, located at the margin of the blastoderm in zebrafish embryos (Figure 3A). In particular, cells of the blastoderm region give rise to mesoderm only, endoderm only, or both mesoderm and endoderm (Kimmel et al. 1990; Warga and Kimmel 1990). Because of their common origin, and Introduction 26 - because mesodermal and endodermal precursor cells are indistinguishable by morphology or marker gene expression, they are referred to as endomesodermal precursors (Figure 3A,B; Warga and Nusslein-Volhard 1999; Maduro et al. 2001). This relationship between both germ layers may be evolutionarily conserved between vertebrate and invertebrate development (Kimelman et al. 2000; Rodaway et al. 2001). Endoderm derives mainly from the dorso-lateral margin of the blastoderm margin, while mesoderm derives predominantly from the ventro-lateral margin. Besides, in none of the animal models described so far does all the mesoderm exclusively derive from mesendoderm (reviewed by Rodaway, 2002), and a fraction of mesoderm also derives from a non-mesendodermal compartment located in a distance of some tiers of cells from the blastula margin. Endodermal development at the pole of the egg at which the yolk protein reserves accumulate, the vegetal pole, seems evolutionarily conserved. Germlayer formation starts with the appearance of the germring, a thickening that forms due to involuting cells at the margin (Figure 3C), and that persists during gastrulation. As they involute, cells at the blastoderm margin undergo an ephithelium- to-mesenchyme transition within the germring, and subsequently form the internal hypoblast layer of cells from which mesodermal and endodermal organs derive at later stages (Kimmel et al. 1995). During somitogenesis and pharyngula stages, patterning along the anterior-posterior, dorso-ventral and radial axis is established. At pharyngula stages, organogenesis and morphogenesis is taking place, including mesenchymal-epithelial induction by signals emitted by mesodermal structures close to endodermal derivatives (reviewed in Roberts 2000). Introduction 27 -
FIGURE 3 Initial steps of endoderm formation (A,C) Lateral views. (A) At blastula stages the embryonic margin contains bi-potential endo-mesodermal progenitor cells. The highest proportion of endoderm (51-80%) derives from dorso-lateral positions; modified after Warga and Nüsslein-Volhard (1999). Marginal cells of blastula-stage embryos co-express both mesodermal and endodermal markers. (B) Animal pole views depict the marginal location of endo- mesodermal progenitor (light blue) and endodermal precursor cells (dark blue) before and after the beginning of gastrulation, respectively. (C) Endodermal precursor cells (dark blue) involute and move animalwards to the future anterior pole of the embryo; modified after Kimmel (1994).
Molecularly, early endoderm development can be subdivided into two major steps: mesendodermal progenitors (Figure 3A,B) are formed at blastula stages in response to maternal and zygotic signals from the extraembryonic YSL and the embryonic blastoderm, respectively, and development of the earliest endoderm and mesoderm is linked by commonly shared molecular pathways at blastula stages. (Rodaway et al. 1999; Chen and Kimelman 2000). A key function in this step is ascribed to the Nodal- Introduction 28 - family of secreted signaling proteins of the TGF-β superfamily (Watanabe and Whitman 1999; Chen and Schier 2001). In response to Nodal signaling, several zygotic genes are expressed at the blastoderm margin, including prospective endodermal transcription factors like cas, bon, gata5 and mez (reviewed by Ober et al. 2003). These genes are initially co-expressed by marginal progenitor cells, and expression is subsequently restricted to the mesoderm or the endoderm, respectively, suggesting that the fate of the marginal-most cells is initially bipotential. The second phase of early endoderm development starts with gastrulation, when bipotential progenitors segregate into endodermal and mesodermal precursor cells. The HMG-box transcription factor Casanova (Cas) is a key player in this step and activates expression of endodermal differentiation markers sox17 and foxA2 while repressing mesodermal fate (Kikuchi et al. 2001, Aoki et al. 2002, Dickmeis et al. 2001). 1.10 The role of pou2 in endoderm development
The transcription factor Pou2 is expressed both in the oocyte and the early zygotic embryo, and is mutated in spiel-ohne-grenzen (spg) mutant zebrafish embryos. Zygotic expression is required for early neural development, in particular establishment of the midbrain-hindbrain organizer (Schier et al. 1996; Belting et al. 2001; Burgess et al. 2002; Reim and Brand 2002). Moreover, Zspg mutant embryos display impaired gene expression in the mesoderm as well as the endoderm during gastrulation. Together, the overtly strong maternal and zygotic expression of pou2 as well as its autoregulatory zygotic role at the late blastula stage raised the possibility that pou2 might also play an earlier role and in other than the ectodermal germlayer. Therefore, I removed both the maternal and the zygotic gene function of pou2, thus generating MZspg mutant embryos. I find that pou2 is essential for formation of the endoderm and the entire digestive tract. At the molecular level, the earliest endoderm-specific expression of sox17, foxA2 and of other endoderm specific markers is not activated in MZspg mutants, although endodermal progenitors are present. In the absence of Pou2, endodermal progenitors develop into mesoderm. Functional epistasis experiments show that Pou2 is absolutely required to enable Casanova (Cas), which has been known so far as the key activator of endoderm differentiation, to exert its effect. These data suggest that Pou2 is a competence factor for Cas in eliciting the initial step of endoderm differentiation. Introduction 29 - 1.11 Questions and aims of this thesis
I Elucidation of the zygotic function of pou2
1. Which gene is mutated in spg mutant embryos - what is the molecular nature of spg alleles ?
2. Can pou2 be assigned to the cognate molecular pathway(s) acting in MHB organizer development?
3. What is the function of pou2 in the neuroectoderm, and how does it contribute to the formation to the MHB?
4. Is pou2 involved in a genetic relationship with fgf8, as suggested by ace (fgf8) mutant embryos which display a MHB phenotype similar to spg mutant embryos?
II Elucidation of the maternal-zygotic function of pou2
1. By generation of maternal-zygotic (MZ) spg mutant embryos, which are completely devoid of pou2 function, it can be adressed whether maternal pou2 expression masks developmental functions of zygotic pou2 already before its role in MHB development.
2. What do the phenotypes of MZspg and Mspg mutant embryos reveal about the function of pou2 in earliest embryonic development?
3. What is the funciton of pou2 in endoderm development in relation to other endoderm regulators?
4. By which molecular mechanism do pou2 and cas act? 30 2 Results 2.1 Molecular characterization of spiel-ohne-grenzen (spg)
2.1.1 Mutagenesis screens yield new alleles of spiel- ohne-grenzen (spg) Three new mutant alleles were isolated in our group employing a haploid ENU mutagenesis screen for mutants affecting development of the MHB organizer, as initially judged by loss of fgf8 expression at the MHB (N.Morita, C.Klisa, G.Reim, W.Huttner and M.Brand, unpublished data). Homozygotes for the mutation e713 and e728, which cause lack of fgf8 expression, lack the MHB during pharyngula stages. A similar, albeit weaker disruption was found in the mutant e68, which retains a partially formed MHB (not shown). The phenotype caused by these alleles segregates as a Mendelian trait. The similarity of the mutant phenotypes to the mutants acerebellar (ace), no isthmus (noi) and spiel-ohne-grenzen (spg) isolated in an earlier large scale, diploid ENU mutagenesis screen (Brand et al. 1996; Schier et al. 1996) suggested that we might have isolated new alleles of these mutations. Concomitantly, in the course of a large-scale, insertional mutagenesis screen for mutations affecting embryonic development (Amsterdam et al. 1999), a mutant carrier family Hi349 was isolated. The mutation has several different phenotypes that display significant variation in their expression. The earliest visible phenotype is a loss of the fold at the midbrain hindbrain boundary (MHB) clearly visible after the first 24 hours of development (Figure 5B). Phenotypes range from a reduction of the cerebellum to a complete deletion of the MHB area without visible change in the anterior tectum or the posterior hindbrain regions. Other phenotypes include misshapen and smaller otic vesicles commonly containing only a single otolith, a variable defect in the length of the tail, and a significant reduction in the escape reflex response to touch (not shown). In complementation testcrosses with the previously isolated MHB mutants noi, ace and spg the alleles of e713, e728, e68 as well as hi349 failed to complement spgm216, and are therefore considered as new alleles of spg. From this point onwards, the mutations will be known as spghi349, spge713, spge728 and spge68.
2.1.2 The zebrafish pou2 gene is mutated in spg The elucidation of the molecular nature of the insertional spg mutation involved a collaboration with S. Burgess, W. Chen and N. Hopkins (Burgess et al., 2002). Tail biopsies from each spghi349 heterozygous carrier fish were taken and the genomic DNA was isolated. Using linker mediated PCR and a primer specific to proviral sequences, Results 31 - we identified a single proviral insert which was present in both parents of each pair whose offspring showed the mutant phenotype, but was never present in both parents in pairs which did not display the phenotype. The fragment containing the adjacent genomic DNA 3’ of the identified insertion site was excised from a polyacrylamide gel and sequenced. The genomic DNA showed that the provirus had integrated into an exon of the zebrafish pou2 gene, a transcription factor identified previously (Takeda et al. 1994; Hauptmann and Gerster 1995). Using southern analysis and inverse PCR, the genomic DNA adjacent to the 5’ side of the virus was also isolated and it showed that the DNA on the other side of the provirus continued in the same pou2 exon. The proviral integration was 875 nucleotides from the starting methionine in the cDNA sequence, 37 amino acids into the POU specific domain (Figure 4A). Since this integration disrupts the POU specific domain, and truncates the protein ahead of the entire POU homeodomain, it is likely that this integration generates a null allele. Non-complementation of hi349 and spg alleles suggested that one same gene is affected in the insertional hi349 and the point mutational spg alleles. I verified the chromosomal location of spg by mapping one of the chemically induced alleles, spge713. pou2 has been previously mapped to the linkage group 21 (Takeda et al., 1994). Molecular elucidation of genes carrying a point mutation has been facilitated by the characterization of the genome which is displayed by high-resolution genetic maps and electronically available (http://www.zfin.org; Geisler et al. 1999), with genomic mapping markers spaced at distances of nearly 1 cM (1 cM is equivalent to 500-800 kb in zebrafish). spge713 was found to be linked to linkage group (=chromosome) 21 wihtin the vicinity of the chromosomal location of pou2 (Figure 4B,C). z13467 is a marker of PCR-mediated mapping and is located on chromosome 21 at 32.4 cM, relatively close to pou2 (Figure 4C). This marker gives different size bands depending on the genetic background, and we found no recombinants between this marker and the spg mutant phenotype among 39 haploid embryos obtained from a heterozygous carrier female (21 spg and 18 wild-type, Figure 4B), showing that spg is linked genetically to pou2. To determine the molecular defect in the ENU alleles, I used pou2 specific primers to amplify the coding region of the ENU alleles. Sequencing revealed a single amino acid exchange in spgm216 and spge713 from Lys to Pro in helix one of the POU homeodomain, which most likely disrupts the function of the protein. Both mutations were induced on a similar genetic background (AB), but were found in independent mutagenesis experiments with strains that carried different genetic markers, suggesting that this mutation may have been present in the AB background at a low frequency (Burgess et Results 32 - al. 2002). No amino acid exchange was found in the coding region of the weak allele spge68, which I hypothesize might therefore affect the regulatory sequences of pou2.
FIGURE 4 The pou2 gene is mutated in spg mutant embryos. (A) Schematic of the part of the Pou2 protein containing the POU-Specific and the POU-Homeo Domain. The insertional mutation spghi349 and the point mutation spge713 are indicated. The point mutation is based on a transition from T to C, leading to an amino acid exchange from leucine to proline. (B) spg is genetically linked to the SSR marker z13467 mapping on chromosome 21 (indicated by an purple arrow in (C). z13467 was used as a diagnostic marker in PCR based mapping of wild-type and spge713, resulting in an amplification product of 280bp for the mutant (purple arrow) and, 190bp for the wild-type (black arrow). (C) detail from chromosome 21. The red and the purple arrow indicate the position of the mapping marker z13467 and pou2/spg, respectively. (D) Syntenic relationship between the zebrafish linkage group 21, human chromosome 6 and mouse chromosome 17. Zebrafish pou2, clic1, efna5a and bf and their mammalian orthologues show conserved synteny (source: OMIM and ZFIN). The different Results 33 - order of efna5a and bf may be due to smaller inversions that frequently occur in an overall syntenic area (Woods et al., 2000). (E) Zebrafish Pou2 (DrPou2, red arrowhead) and its mouse (MmOct4) and human (HsPou5F1) orthologue cluster within the ClassV POU domain protein subfamily in an unrooted phylogenetic tree, the closest mammalian members being in the Oct4/Pou5F1 subgroup.
2.1.3 Autoregulation of pou2 suggests spghi349 as the strongest spg allele In situ hybridization on embryos from spghi349 carrier parents using pou2 sequences as the probe showed a severe reduction in pou2 expression starting at 40-50% epiboly (not shown), and expression is totally abolished at the end of gastrulation (Figure 8E). A reduction of pou2 mRNA is also observed in homozygous spgm216 and spg e713 embryos, but slightly later from the beginning of somitogenesis onwards (not shown). These observations argue that Pou2 is involved in feedback regulation of its own expression, that it functions already prior to the onset of gastrulation in all embryonic cells, and that spghi349 is the strongest allele. The chemical alleles m216, e713 and e728 carry a point mutation leading to an amino acid exchange within the first alpha-helix in the POU homeodomain (Figure 4A). Whereas an intact homeodomain is required for DNA binding of POU proteins, the contribution of the POU-specific domain varies, depending both on the DNA-binding site and on the POU protein (review: Schöler 1991).
2.1.4 The zebrafish pou2 is the orthologue of the mouse Oct4 Previous studies of pou2 had not resolved the relation between zebrafish pou2 and mammalian Pou genes. Phylogenetic sequence comparison with the full length sequence furthermore shows that these genes fall into the same class V subfamily of POU transcription factors (Figure 4E). In the conserved POU domain, Pou2 is 74% identical and 89% similar to murine Oct4, in the homeodomain 71% and 84%, respectively. Outside of these functional domains there is little conservation, giving lower values over the entire aminoacid sequence (30% identity, 40% similarity). Importantly, the chromosomal position of pou2 shows that it is located in an area that is syntenic with mammalian chromosomes, and which contains the Oct4/Pou5f1 genes in mice and humans (Figure 4D; Woods et al. 2000). These results are further substantiated by expression and functional analysis of the mouse Oct4 (see Section 2.1.3.1), suggesting that pou2 is the orthologue of the mammalian Oct4/Pou5f1 genes. Results 34 - 2.2 The role of spg/pou2 in neuroectodermal development
2.2.1 spiel-ohne-grenzen (spg) is required for midbrain- hindbrain boundary and hindbrain development At 24 hours post fertilization (hpf), the midbrain-hindbrain boundary (MHB) of wild- type embryos is anatomically reflected by a prominent inward fold of the neuroepithelium which develops into the isthmic constriction of the brain (Figure 5A). The formation of this fold is disturbed in living homozygous spg embryos (Figure 5B; Schier et al. 1996). Results are based on analysis of the spge713 allele and the likely null allele spghi349; they give an identical phenotype of slightly variable expressivity, with the exception of the pou2 staining. Optical sections of live embryos stained with Bodipy- Ceramide and histological sections show that in spg mutants both the prominent inward fold at the MHB and the cerebellar primordium which abuts the MHB are missing, and that the tectum opticum is variably reduced in size (Figure 5C-F, I,J). After 26 hours of development a small aggregate of cells is visible at the MHB of spg mutants (Figure 5D,F) that is absent in acerebellar (ace) mutants (Reifers et al. 1998). In addition, spg mutants have smaller otic vesicles with often only one otolith, and a curved, slightly shortened tail with misshaped somites (not shown). From day 4 on, 30-50% of mutant larvae show a slightly reduced frequency of heart beat and develop an oedema, although both the atrium and ventricle are initially present, also unlike acerebellar embryos (Reifers et al. 2000). spg mutants feed far less efficiently than wild type embryos and die after 14 to 19 days for unknown reasons. Acridine Orange specifically interacts with DNA of non-condensed, fragmented chromatin and can be used in zebrafish to detect cells undergoing cell death. We detected dying cells in the prospective MHB and tectum of spg mutants from the 14 somite stage onwards until the pharyngula period, most prominently during late somitogenesis (Figure 5G,H). Cell death is particularly apparent within the hindbrain around the 22 somite stage, in two transverse stripes (Figure 5H’, inset) that probably correspond to r3 and r5 (see also Figure 8G,G’). Weaker incorporation of acridine orange occurs in the optic stalk, tail-tip and the dorsal midline of the tail- and trunk region (Figure 5H, and not shown). Because dying cells are detectable from mid- somitogenesis stages onwards, cell death probably results from earlier defects. In addition, the cell death likely contributes to the development of the MHB phenotype of spg mutants at 24 hpf. Antibodies against acetylated tubulin were used at 30 hours postfertilization (hpf) on whole mutant embryos homozygous for spghi349or spge713 to examine the architecture of the axonal scaffold in the brain (Figure 5K). Anti- Results 35 - acetylated-tubulin staining demonstrates that the segmented appearance of the wild-type scaffold is severely disrupted not only in midbrain, but also hindbrain development: longitudinal and transverse axon bundles, normally located at rhombomeric boundaries, are not tightly fasciculated and show imprecise scaffolding, and the distance between forebrain and hindbrain commissures is reduced in spg embryos, probably due to tissue elimination by cell death (Figure 5L). Indeed, spg embryos lack a recognizable trochlear nerve within the MHB (not shown). In wild-type embryos monoclonal antibody 3A10 clearly stains the Mauthner neurons in wholemount staining at 30hpf. In the mutant embryos, the Mauthner neurons, which normally form in rhombomere 4 of the hindbrain, are completely absent (Figure 5M,N). Therefore, in addition to the MHB, very specific disruption of cell types also occurs in the hindbrain of spg mutants.
FIGURE 5 The brain phenotype of spg mutant embryos at pharyngula stages. (A,C,E,G,I,K,M) Wild-type and (B,D,F,H,J,L,N) homozygous spg mutant embryos. (C,D,G,H,I,J) lateral views, other pictures dorsal views. In wildtype embryos, the MHB is marked by an arrow; The asterisk in B and the arrow in J indicate lack of the MHB in mutant embryos. (D,F) An arrowhead indicates a likely rudimentary tissue of the posterior cell row and the cerebellum after 28 hpf. (A,B) phenotype of living wild-type embryos. (C-F) Confocal sections of living embryos stained with fluorescent Bodipy-Ceramide. (G,H) Fluorescent staining with Acridine Orange indicates cell death at the prospective MHB and the optic stalk in spg embryos at the 17 somite stage, indicated by arrows. Cell death is also detected in 2 transverse bands within the rhombencephalon at the 22-somite-stage (arrowheads, insert in H; the arrow points to the MHB). (I,J) Sagittal histological sections. (K,L) α- acetylated tubulin staining recognizing the axonal scaffold in the developing brain at 28hpf. (K) in the wild-type, six bilateral transverse axon bundles mark the borders between single rhombomeres. (L) spg mutant embryo shows strong disorganization of the axonal scaffold within the hindbrain. (M,N) Staining with the monoclonal antibody 3A10 at 30hpf. (M) The Mauthner neurons in the wild type embryo are marked with a black arrow. (N) Mauthner neurons are completely absent in the spg mutant embryo. Structures labeled: tc- tectum, cb- cerebellum, hb- hindbrain, and otic p.- otic placode. Results 36 -
2.2.2 How can the spg MHB phenotype be related to pou2’s function ? To understand the mechanism by which Pou2 activates transcription of MHB markers, i.e. pax2.1, I examined the relative distribution of these genes during formation of the midbrain and hindbrain primordia by wholemount double-ISH. Both Takeda et al. (1994) and Hauptmann and Gerster (1995) reported that at tailbud- to 2-somite stages these genes occupy non-overlapping expression domains in the midbrain and anterior Results 37 - hindbrain primordium, respectively, but earlier stages of neural development were not examined. I find that at 80%-90% epiboly, the Pou2 domain is initially broader and encompasses the pax2.1 domain at its anterior end (Figure 6B,F,G). pou2 is therefore available to regulate pax2.1 in the same cells at this stage, which may explain why the midbrain is affected in spg mutants. As development of the embryo progresses, the overlap of expression reduces in size, and until at the tailbud stage, the majority of the pou2 expression lies in the anterior hindbrain primordium (Figure 6G), posterior to the pax2.1 domain. At early somitogenesis stages, pou2 expression is further confined to distinct bi-lateral patches of expression which lie in the rhombomeres 2 and 4 (Figure 6C). Beside the expression in the neuroectoderm, pou2 is also expressed within the tailbud-region (Figure 6D). Around the 6 somite-stage, pou2 expression is lost (not shown).
FIGURE 6 Expression of pou2 during embryogenesis. Shown are (A-D) and (F-G) wild-type and (E) spg mutant embryos. (A,D,E) Lateral views, anterior to the left. (B,C,F,G) Dorsal views, anterior to the top. (A) pou2 is ubiquitously expressed before gastrulation. (B) pou2 expression refines within the neuroectoderm at the end of gastrulation. (C) During early somitogenesis, pou2 expression becomes restricted to the hindbrain within r2 and r4 and to a ventromedial patch at the MHB. (D) Wild-type embryo at the tailbud stage. Expression in rhombomere 2 and 4 is indicated by asterisks. Beside the expression within the brain, pou2 is also expressed within the posterior spinal cord. (E) pou2 is completely lost at tailbud stage in the spg mutant. (F,G) Double in situ hybridizations with pou2 (blue staining, long brackets) and pax2.1 (red staining, short brackets). At 90% epiboly, MHB expression of pax2.1 is completely contained within the anterior pou2 expression domain (F) but slightly later, at tb stage, expression domains of pax2.1 and pou2 start to separate from each other (G). Results 38 - 2.2.3 Establishment and maintenance of the MHB is affected in spg mutants The above observations, previous data (Schier et al. 1996) and the expression pattern of pou2, all suggest that early neural development is abnormal in spg mutants. Using in situ-hybridization (ISH) with antisense RNA, I therefore followed in detail the expression of MHB and hindbrain marker genes. Four representative stages are shown to illustrate the results (Figure 7; and summarized in Table 1). Expression of pax2.1 is downregulated already at the onset of expression at 80% of epiboly (Figure 7A´; as reported previously, Schier et al. 1996), as is spry4 (Fig. 2M´). pax2.1 remains strongly reduced during early somitogenesis stages (Figure 7B´), is completely eliminated during midsomitogenesis stages (Figure 7C´) and is re-expressed in a dorsal patch at the prospective MHB after 24 hpf (Figure 7D´). Similarly, expression of eng2, eng3 and her5 is affected both during initiation and maintenance (Figure 7Q´-U´). The kinetics of fgf8 expression at the MHB in spg mutants is overall similar to that of pax2.1 and the other markers (Figure 7I´-P´; red arrowheads). In contrast, however, fgf8 and wnt1 are initiated normally at 70-80% of epiboly, and only become decreased at 80-90% of epiboly (Figure 7E´, I´,M´). During early somitogenesis stages, fgf8 and spry4 are expressed in rhombomeres 1, 2 and 4 (Reifers et al. 1998; Fürthauer et al. 2001). In these rhombomeric domains fgf8 and spry4 expression is likewise strongly reduced in spg mutants (Figure 7J´, N´). Conversely, initiation of pou2 expression is not affected during gastrulation stages in noi/pax2.1 and ace/fgf8 mutants, or in wild-type embryos in which all Fgf signaling was blocked pharmacologically (data not shown). Beginning at the 1-2-somite stage, pou2 expression is gradually lost in ace mutants or in Fgf signaling-inhibited embryos, as described previously for many other markers, but pou2 expression remains normal in noi mutants at least until the 6-somite stage (data not shown and Reifers et al. 1998). Thus, spg/pou2 is required to initiate expression of pax2.1, eng2, eng3 and her5, and is required to maintain, but not initiate, expression of wnt1 and fgf8. Although the tectum expresses otx2 (Figure 8Q), tectum development is abnormal in spg mutants. Expression of the engrailed-genes eng2 and eng3 is reduced in spg mutants throughout embryonic development (Figure 7R´,S´), consistent with their role as target genes of pax2.1 (Lun and Brand 1998; Scholpp and Brand 2001). Moreover, the tectum-specific ephrins ephrinA5a and ephrinA5b, likely target genes of engrailed proteins, are strongly restricted to a dorsal patch but never completely abolished in spg mutants (not shown). her5 encodes a bHLH transcription factor Results 39 - expressed at 70% of epiboly in the MHB primordium and the underlying mesendoderm (Figure 7T; Müller et al. 1996; Lun and Brand 1998). In spg mutants, her5 expression is initially normal in the mesendodermal layer (Figure 7T´), but is not initiated within the overlying neuroectoderm (arrow in Figure 7T´,U´). At 90%, her5 expression is downregulated in the mesendoderm of wild-type and mutant embryos. The expression of additional MHB markers in spg mutants is similar to those above and is summarized in Table 1. MHB markers are typically more strongly affected in the ventral MHB of spg mutants during early somitogenesis, before the expression is eventually lost completely (Figure 14O, and not shown). This is not due to defective midline tissue, since shh and twhh, encoding two secreted hedgehog-family members expressed throughout the ventral CNS midline, are expressed normally in spg mutants. Tailbud expression of these genes was slightly reduced (not shown), possibly explaining the slightly twisted tail of the mutants.
FIGURE 7 The primordium of the MHB organizer is affected in spg embryos. (A-B´,E-F´,I–J´,M,N´,Q,Q´) dorsal views, anterior to the top; embryos in the remaining pictures are shown from the lateral view, anterior to the left. Gene expression, stages and genotypes are noted. Throughout the figure, red arrowheads indicate expression of genes at the MHB, black arrows indicate expression within the otic placode. (A-D´) pax2.1 shows reduced expression at the MHB from its onset onwards (A´,B´), is lost during midsomitogenesis (C´) and re-expressed as a dorsal patch after 24hpf. Expression of pax2.1 within the otic placode (B-D´) is not affeced in mutant embryos. (E-H´) wnt1 is normally expressed at its onset at 80% of epiboly (not shown), but becomes subsequently downregulated (E´) at the time when pax2.1 is initiated. During somitogenesis (F-G´), the expression of wnt1 at the MHB (arrowhead) and within rhombomeres is kept downregulated. At pharyngula stages, wnt1 expression is continued within a dorsal patch at the MHB. (H,H´) The midsagittal expression in the diencephalon seems not affected but MHB expression is reduced to a dorsal patch in mutant embryos. (I- I´) fgf8 expression, likewise wnt1, is not affected at its onset of expression at the MHB (not shown) but soon becomes downregulated around 90% of epiboly. (J) fgf8 expression caudally continues in r1, 2 and 4 in wild type embryos. (J’) In mutant embryos, fgf8 expression is strongly reduced within r1 and abolished within r2 and r4. (K,K’) During somitogenesis fgf8 expression is completely lost in the mutant from the MHB, but, like pax2.1 and wnt1, recovers at a dorsal patch at the MHB at pharyngula stages (L,L’). Expression domains within the otic placode (J´) and telencephalic domains as the optic stalk and facial ectoderm (L´) are also slightly reduced in mutant embryos. (M-P´) spry4 is not properly initiated in spg embryos. At the 4 somite stage spry4 is strongly reduced at the MHB and in r1, 2 and 4 (N). MHB expression of spry4 during somitogenesis and pharyngula stages follows the same mode as fgf8 and pax2.1. (Q,Q´) en2 is normally initiated at the MHB at the end of gastrulation. In spg mutant embryos, en2 is downregulated from its initiation of expression. (R) en2 is expressed in the prospective tectum in a graded fashion during somitogenesis but is strongy reduced in spg embryos (R’). (S) en3 is encompassed within the en2 domain at the tectum in wild-type embryos. (S´) In spg embryos, en3 is downregulated in a similar fashion as en2. (T,T’) lateral half sides of transversal sections through the her5 positive domain at the spatial level of the future MHB; arrows point to the neuroectoderm. (T) her5 is normally initiated within the neuroectoderm around 70% of epiboly, overlying mesendodermal expression. (T’) her5 is not properly initiated at the MHB of spg embryos, whereas expression within the hypoblast is not affected. Results 40 -
2.2.4 Positioning of the MHB is normal in spg embryos Studies in several vertebrates suggest that Otx2 and Gbx2, which are expressed in mutually exclusive territories of the hindbrain and fore/midbrain, respectively, are involved in positioning the organizer at the MHB (Wassarman et al. 1997; Broccoli et al. 1999; Millet et al. 1999; review: Rhinn and Brand 2001). In zebrafish, gbx1 is the functional equivalent of the murine Gbx2 gene (Rhinn 2003). In wild-type embryos, gbx1 is expressed in the hindbrain primordium, in a domain complementary to the Results 41 - expression of otx2 which partially includes the pax2.1 activation domain (Lun and Brand 1998; Figure 8A,B). In spg mutants, recognizable by their reduced expression of pax2.1, the spatial relationship between gbx1, otx2 and pax2.1 expression appears normal (Figure 8A´,B´), indicating that the initial subdivision of the neurectoderm into an otx2 and a gbx1 positive domain occurs normally in spg mutants.
FIGURE 8 Normal MHB positioning, but affected hindbrain primordium in spg Embryos are photographed from dorsal, with the exception of (D,D´) (transverse section at the level indicated by an arrow in (C,C´) and (E,E´) (lateral view). Dorsal is up in (D,D´). Anterior is to the top in Results 42 - (A-C´,F,F´,S,S´); anterior is to the left in the remaining pictures. Embryos are at the tailbud stage unless indicated differently. (A) gbx1 expression is strictly posteriorly adjacent to the MHB domain of pax2.1 in wild-type embryos during gastrulation. (A´) In spg embryos pax2.1 and gbx1 are expressed in the same mutually exclusive fashion as it is seen in wild-type embryos at the end of gastrulation. However, in mutant embryos pax2.1 expression is reduced at the MHB. (B) In wild-type embryos, otx2 expression partially overlaps with pax2.1 expression at the MHB at the end of gastrulation. (B´) spg embryos show a proper spatial relationship of otx1 and pax2.1 at the prospective MHB at the end of gastrulation. (C,D) In wild-type embryos gbx2 becomes activated around 90% of epiboly within the neural ectoderm, shortly after onset in the underlying mesendoderm. (C´,D´) In mutant embryos, the mesendodermal domain of gbx2 is initiated normally (red arrowhead in D´) but the neurectodermal domain of gbx2 is not initiated. Two longitudinal stripes in the non-neural ectoderm are unaffected (black arrow in (D´)) (E,E´) In contrast to spg mutant embryos, gbx2 is lost in both, the mesendodermal and the neuroectodermal germ layer in ace mutant embryos. (F) The hindbrain domain of fkd3 is lost in mutant embryos (F´). (G) In wild-type embryos, krox20 stains r3 and 5 and six3 is expressed within the prosencephalon, including the prospective eye field. (G´) In mutant embryos, six3 seems not affected but krox20 is strongly reduced. (H) ephA4 is expressed in wild-type embryos within the prosencephalon and the rhombencephalon, in particular within rhombomeres1, 3 and 5. (H´) Rhombomeric expression of ephA4 is strongly affected and the prosencephalic domain shows massive posterior expansion. (I) wnt8b is normally expressed within the diencephalon, at the MHB and within rhombomeres 1, 3 and 5. (I´) In spg embryos, MHB expression of wnt8b is strongly reduced (arrowhead) and rhombomeric expression is strongly downregulated, in particular, expression of r1 cannot be discriminated from and possibly fuses with the MHB domain. (J) Double in situ staining for hoxb1a, expressed in r4, and hoxb4a, expressed within the spinal cord with an anterior limit at the border between r6 and 7 in wild-type embryos. The bracket indicates the gap between r4 and 7. (J´) In mutant embryos, the gap between r4 and 7, indicated by the bracket, is strongly reduced. (K,K´) rhombomeric expression of krox20 in r3 and r5 is nearly abolished in spg, whereas hoxb1a expression in r4 is expanded. (L) pou2 expression becomes refined during early somitogenesis within distinct bilateral clusters according to r2 and 4 and to a patch of expression at the posterior border of the MHB. (L´) In early somitogenesis, embryos of the allele spge713 show strongly reduced rhombomeric expression of pou2 whereas in embryos carrying the insertional allele spghi349, pou2 expression is totally abolished (L´´). (M) val is normally expressed within r5 and 6. (M´) In mutant embryos, val is nearly abolished in r5 but the expression in r6 is not affected. val is also expressed within precursor cells of the neural crest (indicated by an arrow in (M,M´)), which is not affected in mutant embryos. (N) fkd3 is expressed at inter-rhombomeric borders at late somitogenesis stages in wild-type embryos. (N´) In spg embryos, inter-rhombomeric expression is strongly reduced. (O) zath1 is normally expressed at the prospective cerebellum and along the dorsal rim of the fourth ventricle. This expression is also maintained during later pharyngula stages (P). (O´) zath1 expression is lost from the cerebellar anlage in spg embryos (arrow) but expression recovers partially at later stages (arrow in (P´)). (Q) In wild-type embryos, expression of otx2 at pharyngula stages covers the midbrain and the MHB, in particular the concise stripe of the posterior cell row (arrow) marking the transition between the tectum and the cerebellar anlage. (Q´) In spg embryos, expression of otx2 partially recovers within this particular posterior cell row (arrow) at late pharyngula stages. The spatial extent of the midbrain territory of otx1 is apparently smaller than in wild-type embryos. (R) Among the proneural genes, ngn1 is expressed in precursors of primary neurons in wild-type embryos at the begin of somitogenesis. (R´) ngn1 is strongly abrogated in mutant embryos. (S) sox17 is normally expressed within the endodermal precursors in a punctate pattern during gastrulation. Inset: transversal section at 70% epiboly, showing pou2 expression restricted to the neuroectodermal layer. (S´) sox17 expression is strongly affected in mutant embryos. (T) myoD is expressed within the paraxial mesoderm and muscle precursors within somites during somitogenesis. (T´) myoD expression is strongly reduced in the somitic mesoderm of spg embryos but the paraxial domain seems not affected.
2.2.5 Early failure of hindbrain gene expression in spg mutants During the analysis of MHB specific genes like fgf8 and spry4 I found that these genes are also affected in their hindbrain expression (Figure 7J´, N´). pou2 is itself expressed in the hindbrain primordium at the end of gastrulation (Figure 6F,G; Hauptmann and Gerster 1995) prompting me to examine establishment of gene expression in the hindbrain primordium of spg embryos. I find that gene expression in the hindbrain fails Results 43 - from late gastrula stages onwards, as is most clearly evident from the analysis of gbx2 expression. gbx2 expression is initiated first in the mesendoderm around 80% of epiboly and subsequently around 90% within the overlying hindbrain neuroectoderm (Figure 8C-E; Rhinn 2003). Studies of acerebellar (ace) mutants showed that both tissue layers absolutely require fgf8 to express gbx2 (Figure 8E´; Rhinn 2003). In contrast, in spg mutants neuroectodermal expression of gbx2 is not initiated at all (Figure 8D´), whereas the underlying mesendodermal expression of gbx2 occurs normally (Figure 8C´,D´; arrowhead in D´). In addition to gbx2, ectodermal expression of the forkhead domain transcription factor fkd3 (Odenthal and Nusslein-Volhard 1998) is absent from the hindbrain primordium of spg embryos (Figure 8F´). Therefore, although positioning of the MHB in the neuroectoderm appears normal, global gene expression in the hindbrain primordium, a known site of pou2 expression, is already severely disrupted before the end of gastrulation in spg mutants. During the early segmentation period, pou2 expression becomes confined to distinct cell populations in r2 and r4 (Figure 8L; Hauptmann and Gerster 1995). Genes marking the segmental organisation of the hindbrain, like krox20, ephA4, wnt8b, hoxb1a and hoxb4a are all strongly affected in their expression (Figure 8G-K´), probably due to a mixture of a global and a rhombomere specific requirement for pou2 in the hindbrain. Next to the pou2-expressing rhombomeres r2 and r4, krox20, ephA4 and wnt8b are normally expressed within r3 and r5. In spg mutants, the size of r3 and r5 appears reduced, whereas that of the intermittent r4 appears normal or enlarged (Figure 8G-I). Thus, in addition to the early gene expression defects of the hindbrain primoridium, rhombomeres also show specific defects during segmentation stages that differ depending on the rhombomere considered. This may reflect a later, rhombomere- restricted function of pou2. six3 expression in the prospective telencephalon and eye field is not altered in spg, whereas ephA4 expression in the otic placode is reduced, and diencephalic expression is posteriorly expanded into the midbrain and MHB (Figure 8H´), as described above for other diencephalic markers, except for wnt8b, which is not altered (Figure 8I´). Expression of the Hox genes hoxb1a in rhombomere 4 (r4) and hoxb4a from r7 into the spinal cord (Figure 8J) is mildly affected in spg embryos at midsomitogenesis. The hoxb1a domain appears more diffuse compared to the wild-type and is even wider towards the end of somitogenesis (Figure 8K), but more strikingly, the gap between the hoxb1a and hoxb4a domains in the r4-r7 territory is significantly reduced in spg embryos, as indicated by brackets in Figure 8J. At late somitogenesis stages, hoxb1a is more strongly affected in spg mutants. Concommitant with the Results 44 - reduced odd-numbered rhombomeres, r4 apparently enlarges at the expense of r3 and 5, as judged from hoxb1a/krox20 double staining (Figure 8K,K´). The expression of pou2 itself provides one of the clearest example for a function of spg/pou2 in specific hindbrain rhombomeres. In embryos carrying the spge713 point allele, the discrete patches of pou2 expression in r2 and r4 are strongly reduced or absent in spg mutants (Figure 8L´). Embryos carrying the apparent null allele spghi349 show complete absence of expression in all pou2 domains (Figure 8L´´). Expression of the bZIP transcription factor valentino/Kreisler (Manzanares et al. 1999; Cordes and Barsh 1994) in r5 and 6 is abrogated in r5 but unaffected in r6, including the neural crest streaming from r6 (Figure 8M). Consistent with the disorganization of hindbrain commissures, expression of fkd3 (Figure 8N; Odenthal and Nüsslein-Volhard 1998) at rhombomere boundaries is nearly abolished in spg embryos (Figure 8N´). Neurogenesis, as labelled by zath1 expression, is reduced in spg mutants in the ventricular zone of the hindbrain ventricle at 24 and 32 hpf (Figure 8O,P). zath1 expression in the mutants occurs also in a position corresponding to the cerebellar anlage/posterior MHB in the wild-type (arrow). Expression in this tissue might either reflect an expanded rhombic lip, or a partial reformation of the cerebellum at later stages in the mutants. This tissue does not express the fore/midbrain marker otx2 (Figure 8Q), and I therefore tentatively suggest that this is the result of a partial re- formation of cerebellar tissue after 30hpf in the spg mutants, explaining some of the observed variation in morphological strength. Earlier stages of neurogenesis, as labelled by the proneural bHLH transcription factor ngn1 are also affected. ngn1 is expressed in trigeminal precursors and in proneural cell clusters in the brain primordium already at the end of gastrulation, and this expression fails to be initiated in spg mutants (Figure 8R). Expression in three rostro-caudal rows of cells within the presumptive spinal cord containing the precursors of motoneurons, interneurons and sensory neurons is however initiated normally in spg mutants, although the rows are compressed into a narrower space.
2.2.6 Prosencephalic gene expression is caudally expanded in spg Morphological, histological and immunohistochemical inspection at pharyngula stages showed that forebrain architecture is largely normal in spg mutants (Figure 5). ace/fgf8 mutants show abnormal retinotectal projection and a defective optic chiasm (Picker et al. 1999; Shanmugalingam et al. 2000), prompting me to study forebrain marker expression, and to specifically examine the visual system in spg mutants using Results 45 - anterograde fills with DiI. In all of 7 examined spg mutant embryos, I observed normal contralateral retinotectal mapping of retinal ganglion cell axons (Figure 9F) and a properly elaborated decussation of the optic nerve (Figure 9G). In the marker analysis, I find evidence for abnormal development of the forebrain neural plate, especially of the diencephalic primordium. emx1 is expressed in the telencephalic primordium at the end of gastrulation, lining the anteriormost border of the developing brain, and in a bilateral transverse stripe of expression in the posterior diencephalon which does not fuse at the midline (Morita et al. 1995). These bilateral stripes are parallel to, yet separate from, the pax2.1 stripes at the MHB (Figure 9A). In spg mutant embryos, emx1 expression appears generally upregulated, also in the telencephalic primordium, and the bilateral transverse stripes in the diencephalon almost fuse with the strongly reduced MHB domain of pax2.1 (Figure 9A´; pax2.1 expression is shown in red). anf1 is expressed similarly to emx1 but with a triangular domain in the diencephalon (Figure 9B; Shanmugalingam et al. 2000; Kazanskaya et al. 1997) that is not seen in spg embryos (Figure 9B´). Furthermore, expression of pax6 at the di-mesencephalic boundary (Macdonald et al. 1994) is upregulated and strongly expanded caudally from its onset of expression (Figure 9C´). During somitogenesis stages, fgfr3 and pax6 are expressed in wild-type embryos in the diencephalon and in r1, i.e. in territories abutting the midbrain and MHB (Figure 9D,E; Krauss et al. 1991; Sleptsova-Friedrich et al. 2001). In spg embryos, these expression domains nearly fuse (see also Schier et al. 1996). Since strong cell death is not yet detectable at this stage, this fusion may be due to a transformation of the intervening mis-specified midbrain and MHB tissue, rather than a simple elimination. In double ISH analysis with fgfr3 and eng3 (red staining in Figure 9D,D´), eng3 is still expressed in a mesencephalic remnant posteriorly adjacent to the diencephalic territory of fgfr3 but is reduced to a faint dorsal patch as expected for spg embryos (Figure 9D´). This suggests that during early somitogenesis the remnant expression of tectal or MHB markers is still able to specify some rudimentary tissue between the forebrain and the hindbrain, which prevents forebrain gene expression from invading into this distinct dorsal tissue. Later in development, when gene expression is generally absent at the MHB in spg embryos, prosencephalic markers are not only posteriorly expanded on the ventral but also on the dorsal side exemplified by the expanded dorsal thalamic domain of ephA4 (Figure 8H). In contrast to telencephalic and diencephalic gene expression domains, midbrain expression domains, i.e. of engrailed genes or of otx2, are never caudally expanded in spg embryos (Figure 8Q). Unlike diencephalic marker expression, Results 46 - hindbrain markers are not markedly expanded towards the anterior. For instance, the anterior limit of the hindbrain expression domains of pax6 or gbx1 (Figure 9E´ and not shown) appear normal in spg embryos, and in double ISH analysis with krox20 and pax6 I find no relative expansion of the anterior border of pax6 expression in the hindbrain of spg mutants (not shown). Similarly, rostral borders of the diencephalic expression domains of dlx2, otx1, wnt8b, emx1, pax6, ephA4, six3 and anf1 were not altered during early somitogenesis stages in spg mutants (not shown).
FIGURE 9 Prosencephalic markers expand posteriorly in spg embryos. (A) emx1 is expressed in telencephalic precursors from end of gastrulation onwards in wild-type embryos. The posterior transverse expression domain marks the di-mesencephalic boundary. pax2.1 expression at the anterior MHB is shown in red. (A´) In spg embryos, defined by the impaired expression of pax2.1 at the MHB, emx1 expression is generally elevated but reduced in its spatial, lateral extent. The posterior border of emx1 expands caudally. (B) anf1, like emx1, is expressed at the anterior neural border with a patch of expression centering around the midline of the neuroectoderm. gbx2 expression at the posterior MHB is shown in red. (B´) anf1 is lost within the midline expression domain in spg embryos, defined by impaired gbx2 expression (see Fig. 3 for gbx2 expression). (C) pax6 is initiated within the forebrain at the end of gastrulation. pou2 expression at the MHB is seen in red. (C´) spg embryos, identified by loss of pou2 expression, show a posterior expansion of pax6 expression into the territory of the prospective MHB. (D,D´) Double ISH with fgfr3 (blue) and en3 (red) at the 10 somite stage show the hindbrain domain of fgfr3 (arrow in (D,D´)) is fused with the diencephalic domain of fgfr3, particularly at its ventral aspect. The MHB marker en3 is restricted to a dorsal patch in mutant embryos (D´). (E) During somitogenesis, beside the expresssion in the forebrain, pax6 is also expressed within the hindbrain and spinal cord in wild-type embryos. (E´) The prosencephalic and the rhombencephalic domain nearly fuse in spg mutang embryos mainly due to strong posterior expansion of the posterior border of the prosencephalic domain of pax6. (F,G) Anterograde filling of whole eyes with DiI (green fluorescence) or DiO (red fluorescence), respectively, show a proper, contralateral retinotectal mapping of RGC axons in spg embryos (F). The chiasma opticum is properly formed in spg mutant embryos (G). Results 47 - 2.2.7 Mesendoderm development in spg embryos In addition to the brain phenotype, spg mutants have a curved and malformed tail with misshapen somites suggesting the existence of non-neural defects. I find that myoD expression is strongly reduced in somitic precursors (Figure 8T), but unaffected in adaxial cells. Somitic expression of other markers like snail1 (Hammerschmidt and Nüsslein-Volhard 1993), eng2 (Devoto et al. 1996) and fgf4.1 (Grandel et al. 2000) are also reduced in spg embryos during somitogenesis (not shown). However, unlike in acerebellar mutant embryos (Reifers et al. 1998) somitic alterations are not morphologically distinguishable before the beginning of pharyngula stages. Because induction of muscle pioneers is dependent on signals from the notochord (Halpern et al. 1993) I analyzed markers expressed in the midline mesoderm. The expression of the pan-mesodermal gene ntl (Schulte-Merker et al. 1994), the early mesendodermal marker wnt8 (Kelly et al. 1995), and the early axial mesoderm marker flh/znot (Talbot et al. 1995) are not altered at gastrulation stages (not shown). Similar to her5 (Figure 7T), the anterior prechordal plate marker gsc (Schulte-Merker et al. 1994) is normal at 70% of epiboly and tailbud stage, but shows reduced midline expression at the 4-somite stage in the mutant. The intermediate mesodermal expression of pax2.1 is never affected in spg mutants. In contrast, the endoderm specific marker sox17 (Alexander and Stainier 1999) is strongly reduced at the tailbud stage (Figure 8S) but not at its onset around 50% of epiboly, although pou2 expression is restricted to the ectoderm during gastrulation (inset). The reduction in sox17 expression may be due to the general expression of pou2 at pregastrula stages. Expression of nkx2.5 in the heart primordium (Chen et al. 1996; Reifers et al. 2000) is only slightly reduced at the 8 somite stage (not shown). Results 48 -
TABLE 1 Summary of marker expression at the MHB in spg embryos.
2.2.8 Functional analysis of pou2 2.2.8.1 Rescue of gene expression at the MHB
Previous reports suggested that misexpression of pou2 had no effect on the developing embryo (Takeda et al. 1994). I studied pou2 function further by injecting 120 pg pou2 mRNA into one side of two cell stage embryos from a clutch of eggs derived from spghi349 or spgm216 heterozygous parents. Prior to fixation, the injected embryos looked morphologically normal. The embryos were fixed at either the tailbud or the 3-somite stage and stained for pax2.1. Injection of pou2 mRNA rescued the reduced pax2.1 expression at the MHB of mutant embryos in all embryos (Figure 10B-D; n=447). In addition, pax2.1 expression was slightly upregulated and broadened in its dorsal-ventral extent in both the wild-type and spg mutant embryos on the injected side of the embryos (Figure 10A-C). In a similar fashion, I was able to rescue the expression of the MHB markers wnt1 and her5, as well as the rhombomere marker krox20, by pou2 Results 49 - overexpression (Figure 10E-H; and not shown). This demonstrates that pou2 mRNA injection rescues the loss of pax2.1 expression and of the other MHB and HB markers, which are reduced in spg mutants, adding further proof that the loss of pou2 is what is causing the spg mutant phenotypes. Importantly, pax2.1, wnt1 and krox20 are not expressed outside their normal domain of expression on the injected side in either mutant or wild-type embryos, nor is pax2.1 expression in the intermediate mesoderm affected in these embryos (Figure 10D-H). This suggests that the induction of these genes by pou2 is specific to the MHB and hindbrain region, and that pou2 is necessary but not sufficient for their expression. In addition to rescuing expression of MHB- and hindbrain markers, higher doses of injected pou2 mRNA cause a shortened AP axis, and broadened DV axis; the basis for this phenotype is currently not clear. The morphogenetic defects may be due to non-specific effects from higher than normal early expression, specific effects on cell migration and axis formation during gastrulation, a slight dorsalizing potency or a combination of all.
FIGURE 10 pou2/Oct4 mRNA injection rescues spg mutants. (A-H) Injections of pou2 mRNA and lacZ mRNA. (A-H,J) LacZ expression is indicated by the brownish colour. A white arrowhead indicates the dorsal midline of the embryos. (A-D; J) pax2.1 staining. Wild- type embryo showing laterally expanded pax2.1 expression on the injected side. (B-D) spghi349/spghi349 mutant embryos injected into 1 cell of a 2 cell stage embryo with pou2 and lacZ mRNA and fixed at the 3-somite stage. pax2.1 staining is purple, lacZ staining in brown. pax2.1 expression at the MHB is clearly rescued on the injected side of the embryo. The dorsal midline of the injected embryos is indicated by a white arrowhead, to indicate the unilateral injection of lacZ/pou2. (D) Dorso-posterior view of a mutant embryo showing pax2.1 staining in the intermediate mesoderm. pax2.1 expression is not affected in this tissue. (E,F) Lateral expansion of wnt1 after pou2 mRNA injection in the wild-type embryo (E) and rescue of expression in the mutant embryo (F). (G,H) Rescue of krox20 expression after pou2 mRNA injection. (I) Mouse Oct4/Pou5f1 is globally expressed within the neural plate at day 8.0 p.c. (dorsal view, anterior to the left). (J) Mouse Oct4 mRNA and lacZ mRNA were co-injected into 1 cell of a 2-cell stage zebrafish embryo. pax2.1 expression can be restored in spg mutant embryos by mouse Oct4 mRNA. Results 50 -
2.2.8.2 Mouse Oct4 can functionally replace zebrafish pou2
While determining the molecular nature of spg alleles, I found that pou2 is the likely zebrafish orthologue of the mouse Oct4 gene, which is widely known for its involvement in differentiation of the inner cell mass and of germ cells, but for which a role in brain development had not been reported. I therefore examined the expression of Oct4 in mouse embryos, and find that Oct4 is expressed on day 8-8.5 p.c. throughout the neural plate, though the expression is apparently not restricted to the midbrain- hindbrain domain (Figure 10F; Schöler et al. 1989), as in zebrafish (Figure 6). I reasoned that Oct4 as an orthologue of pou2 might be able to restore the phenotype of spg mutant embryos if injected, and find that this is indeed the case. Injection of mRNA for Oct4 into 1 cell at the two-cell stage rescues the expression of pax2.1, which is normally severely reduced in spg mutants at this stage (Figure 10J), in the same manner as injection of pou2 mRNA rescues it (Figure 10B,C), suggesting that Oct4 may function in activating Pax2 expression also in normal mouse development. These data further substantiate the previous notion that the mouse Oct4 gene is the true orthologue of the zebrafish pou2 gene.
2.2.8.3 Morpholino-induced knock-down of pou2 function pou2 message is initially maternally supplied to the embryo and then supplemented with zygotic expression (Figure 6; Takeda et al. 1994; Hauptmann and Gerster 1995). Recently, anti-sense inhibition using oligos with morpholino chemistry has proven to be extremely effective in eliminating protein translation in zebrafish embryos (Nasevicius and Ekker 2000). To determine if maternally contributed pou2 message has a role, I injected two different pou2 anti-sense morpholinos into wild-type embryos (Table 2; morpholino 2 required a higher concentration to work than morpholino 1). At low doses (2-5 ng, depending on the morpholino), the injections phenocopy the spg phenotype. Injected embryos displayed a loss of cerebellar structures and a disorganization of the hindbrain as well as an ear- and tail phenotype similar to spg mutant embryos (Figure 11B, and not shown). This effect is highly specific, because control morpholinos with randomized or a 4-basepair mismatch sequence had no effect, and similar phenotypes were not observed with other morpholinos in our laboratory. Moreover, embryos injected with morpholinos show a strong reduction of pax2.1, wnt1 and krox20 at the end of gastrulation (Figure 11G-L) whereas expression of otx2 and gbx1 at 60-70% of Results 51 - epiboly and the tailbud stage is never affected by morpholinos (not shown), thus reproducing also other phenotypic traits of spg homozygous mutants. When injected with an intermediate dose (4-5 ng and 8 ng, respectively, depending on the morpholino) of pou2 anti-sense morpholinos, embryos arrested between 50% and 70% of epiboly. At high doses of pou2 anti-sense morpholino (8 ng), all embryos stopped cell division and morphogenesis during blastula stages (sphere- dome stage; Figure 11D, Table 2), which I presume reflects inactivation also of the maternally supplied pou2 mRNA. The cells remained large and failed to migrate around the yolk normally even after 10 hours post injection. By 12 hours, the blastoderm detaches from the yolk and none of the embryos survived until the next day. Embryos injected with a control morpholino displayed none of this behaviour (Figure 11C). This effect is similar to the effect caused by the injection of an RNA encoding a truncated version of the protein (Takeda et al. 1994). To determine the specificity of the morpholinos, I attempted to rescue the developmental arrest by coinjecting 16 ng morpholino-2 at the 1-cell stage together with 100pg pou2 mRNA(-5’UTR) which is devoid of the 5’UTR, and hence is not recognizable by morpholino-2 (Figure 11F). In contrast to morpholino-2, which exclusively interferes with sequences within the 5’UTR, morpholino-1 can also bind within the coding region of pou2 mRNA. Embryos coinjected with 8 ng morpholino-1 and 10 pg pou2 mRNA(-5’UTR) are released from the pre-gastrula arrest but the rescue is less efficient compared to the experiment carried out with morpholino-2 (Figure 11E). The reversion of the morpholino induced phenotype by pou2 mRNA suggests that the pre-gastrula arrest is a specific consequence of the “knockdown” of maternal and early zygotic pou2 message.
FIGURE 11 pou2 morpholinos phenocopy the spg mutant phenotype. (A-L) Results of morpholino experiments where pou2 antisense morpholinos (B,D,E,F,H,J,L) or ctrl morpholinos (A,C,G,I,K) were injected at the 1 cell stage. (A) Ctrl embryo at 26h after injection. (B) Embryos injected with lower dose of morpholinos phenocopy the phenotype of spg at 26h after injection. Loss of the MHB and reduced size of otic placode is indicated by red arrowheads. (C) Ctrl embryos at 80% of epiboly. (D) Morpholinos were injected at high concentration at the 1 cell stage. Cells arrest development at the sphere-dome stage. Embryos were photographed at the same timepoint after injection as Ctrl embryos in (C). (E) Embryos continue development after coinjecting morpholino-1 (E) or morpholino-2 (F) with a non-inhibitable pou2 mRNA(-5’UTR), showing that the observed blastula arrest after Morpholino injection is specific. (G-L) Molecular defects of morpholino-injected embryos. pax2.1, wnt1 and krox20 expression at the end of gastrulation is strongly reduced in mo injected embryos, as seen in spg mutants. Results 52 -
injected pou2 effect total morpholino number
Mo1 2ng 11% phenocopy of spg 36
Mo2 5ng 8% phenocopy of spg 48
Mo2 6ng 22% phenocopy of spg 9
Mo1 4ng 100% arrest during gastrulation 205
Mo1 6ng 100% arrest at dome-sphere stage 143
Mo2 8ng 35% arrest during gastrulation 60
Mo2 12ng 100% arrest at dome-sphere stage 120
Mo1-ctrl 5ng 100% no effect 120
Mo1-ctrl 8ng 100% no effect 73
Mo1 4ng + pou2 mRNA-5’UTR 60pg 80% reversion of blastula arrest 200 Mo2 12ng + pou2 mRNA-5’UTR 60pg 100% reversion of blastula arrest 200
TABLE 2 Summary of pou2 morpholino antisense inhibition studies. Loss of function studies by injection of two independent morpholinos against pou2 phenocopies the spg phenotype at low dose, whereas higher doses result in arrest of development at pre-gastrula stages. Mo1 seems to consistently work at somewhat lower concentration than Mo2. Mo1-ctrl is the same as Mo1 except containing a mismatch of 4 bases. Results 53 - 2.2.8.4 Cell autonomous requirement for pou2 in the neuroectoderm
The abnormal development of both the endomesodermal and ectodermal layers led me to ask in which germlayer pou2 activity is required to allow normal MHB and hindbrain development. I transplanted wild-type cells before the onset of gastrulation into the prospective ectoderm or endomesoderm of spg mutant embryos. After developing until the tailbud stage, chimaeric embryos were examined for expression of gbx2 or pax2.1. Aforementioned data indicate that both mesendodermal and neuroectodermal expression of gbx2 expression requires Fgf8 (Figure 8C-E’; Rhinn et al., 2003). In contrast, only the neuroectodermal gbx2 expression requires pou2, and expression in the underlying mesendoderm is intact (Figure 8C,D). When the transplanted wild-type cells were located in the neuroectoderm, they expressed gbx2 in spg embryos, whereas a location in the mesoderm was not sufficient to restore neuroectodermal expression (Figure 12A,B,E; Table 2); Crossections confirmed that the expressing cells were confined to the ectoderm (Figure 12B, bracket). Likewise, when embryos were depleted of involuting mesendoderm by antivin mRNA injection, gbx2 was still expressed in the ectoderm (not shown). Chimaeric spg embryos with neuroectodermal clones fixed during mid-somitogenesis also showed rescue of pax2.1 at the MHB (Figure 12C,D). I therefore conclude that the neuroectoderm of spg mutants is permissive for proper gbx2 and pax2.1 expression of wild type cells, whereas wild type cells located in the mesodermal layer do not support ectodermal expression of these markers (Figure 12E,F). Together with the fact that pou2 is expressed only in the neuroectodermal germlayer of the gastrula, these results strongly suggest that spg/pou2 specifically functions in the neuroectoderm during gastrulation, independently of its ubiquitous expression during pre-gastrula stages (Figure 12F). Results 54 -
FIGURE 12 pou2 is cell autonomously required within the neuroectoderm. (A) Transplanted wild-type cells (brown) in spg embryos express gbx2 cell autonomously. All blue cells carry the brown transplantation marker. The right half of the embryo serves as a control: it is devoid of wild-type cells. As is normally seen in spg mutants (compare with Figure 8D) gbx2 expression is found only in the mesendoderm, but not the overlying neuroectoderm. Dorsal view of a spg chimaera, anterior is up. The white line indicates the plane of the transversal section in (B) along the gbx2 domain. (B) Crossection of the embryo in (A) showing that the transplanted wild-type cells expressing gbx2 (bracket; arrow indicates the unaffected non-neural ectoderm domain, see also Figure 8D´) are located in the neuroectoderm. Other cells that are only brown lie outside of the normal domain of gbx2 expression. (C,D) Transplanted wild-type cells (brown) in spg embryos also express pax2.1 normally at the MHB. Arrows point to the residual pax2.1 expression at the MHB which is retained in spg embryos until late stages of somitogenesis. (E) Clones of wild-type cells within the mesoderm cannot restore gbx2 expression in spg mutant embryos at the tailbud stage. The plane of section is indicated in (A). Arrows point to the unaffected non-neural ectoderm domain. (F) pou2 and fgf8 are required for gbx2 initiation within the neuroectoderm, where pou2 might act in a linear or a parallel fashion with Fgf8 signaling.
2.2.8.5 Combinatorial roles for pou2 and fgf8 in the hindbrain
The phenotypic similarities between ace/fgf8 and spg/pou2 mutants raised the possibility that these genes might act in the same pathway, or in synergistic pathways. Results 55 - fgf8 transcription is initiated normally in spg mutants at 70% epiboly, but becomes downregulated by the end of gastrulation and is completely lost during somitogenesis (Figure 7I-K´). Therefore, pou2 might act in a linear fashion with fgf8, or parallel to Fgf8 signaling (Figure 12F). I therefore injected fgf8 mRNA unilaterally into wild-type and spg mutant 2-cell stage embryos to determine if fgf8 is capable of rescuing any aspect of the spg phenotype. The results of the mRNA injection experiments are summarized in Table 3. I used gbx2 and spry4, cognate early downstream targets of Fgf8, as markers to assay the effects of fgf8 mis-expression at the end of gastrulation in spg mutant embryos. In wild-type embryos, fgf8 mis-expression causes a strong dorsalization of the whole embryo (Fürthauer et al. 2001; Reifers et al. 1998) which is visible as a pronounced dorsal-ventral expansion of spry4 and gbx2 in the injected half (Figure 13A,C; arrow). As in the wild-type, fgf8 mRNA injection into spg mutants results in strong lateral expansion of the endogenous mesendodermal domain of gbx2 (Figure 13B), confirming that fgf8 can also exert its dorsalizing activity in spg embryos; the residual, weak expression of spry4 may be similarly expanded (Figure 13D). Moreover, in the neuroectoderm of wild-type embryos, fgf8-mRNA injection also causes upregulation of the endogenous expression domains of both gbx2 and spry4 (Figure 13A,C). Unexpectedly, and in contrast to the mesendodermal expression domain, the neuroectodermal expression neither of gbx2 nor of spry4 could be initiated (gbx2) or restored to the wild-type level (spry4) in spg mutant embryos injected with fgf8-mRNA (Figure 13B,D). The gbx2 expression seen in Figure 13B is the mesendodermal domain which is unaffected in spg mutants (see also Figure 8C´,D´). Equivalent results were obtained with fgf8 injection when wild-type and spg mutant embryos were fixed at early and mid-somitogenesis stages (not shown). Thus, the hindbrain and MHB primordium of spg mutant embryos appears to be insensitive to Fgf8 signaling. In mice, Fgf8 and Gbx2 are thought to act in a feedback-loop (Garda et al. 2001), and the loop could simply be interrupted between fgf8 and gbx2 by the absence of pou2, if pou2 acts within this loop upstream of gbx2. I therefore tested whether injection of pou2 mRNA into ace embryos can restore gbx2 expression, and found that this was not the case (Figure 13E,F). These findings show that both Fgf8 and Pou2 are required for gbx2 and spry4 expression in the neuroectoderm. In addition to gbx2 and spry4, I also found transcriptional activation of fkd3 within the hindbrain primordium to be dependent on both pou2 and fgf8 (not shown). To further test the notion that spg embryos might be regionally insensitive to Fgf8, I implanted beads soaked with Fgf8 protein into the prospective MHB territory of Results 56 - spg mutants. For technical reasons, these implantations were done at the 13 somite stage. In ace mutants, this treatment rescues the formation of the MHB constriction, and leads to re-expression of the target gene spry4 (unpublished data; Fürthauer et al. 2001). In wild-type embryos examined at 26hpf the MHB constriction is clearly visible. The localized source of Fgf8 protein provided by the bead was not able to restore the MHB constriction in spg embryos. However, after in situ staining, ectopic expression of spry4 was readily observed both in wild-type and in spg mutant embryos (Figure 13G; compare with Figure 7P,P´). This finding corroborates the results of the fgf8-mRNA injections, and furthermore indicates that the MAP kinase pathway through which Fgf8 exerts its effect on spry4 induction is functional at least at later stages of MHB development in spg embryos. I find normal expression of the known fgf receptors 1, 3 and 4 at tailbud stage in spg mutants (not shown), suggesting that the pathway is also intact at the normal time of gbx2 and spry4 transcriptional activation.
FIGURE 13 pou2 and fgf8 act synergistically to activate HB primordial genes. Results 57 - Embryos are depicted in a dorsal view, anterior to the top, except the embryo in (F), depicted from lateral view, anterior to the left. (A-D) Gain of fgf8 function by unilateral misexpression of fgf8 mRNA into 1 cell of 2-cell stage embryos. As a readout for the effect caused by fgf8 overexpression, gbx2 (A,B) and spry4 (C,D), both markers for the prospective hindbrain, were used. The activity of misexpressed fgf8 can be judged from dorsalization of the embryos indicated by lateral expansion of endogenous gbx2 and spry4 expression, indicated by arrows (A-E) at the injected side of the embryo. Deposition of co-injected lacZ mRNA is visualized by staining for anti-βgal antibody (brown), reflecting the location of injected fgf8 mRNA (not visualized). Distribution of injected mRNA is restricted to one half of the embryo, allowing for comparison with the contralateral side as a control. In spg embryos, neither expression of gbx2 (B) nor spry4 (D) could be rescued or upregulated, respectively, by fgf8 overexpression. (E,E´) In a vice versa experiment, pou2 misexpression into ace embryos (carried out in the same unilateral fashion described for fgf8 injection above) pou2 overexpression, likewise fgf8 itself, can provoke dorsalizaion of the injected half of the embryo (obviously seen in the wild-type embryo in (E), but not in the ace embryo in (E’) due to complete loss of the readout marker gbx2) but can not rescue expression of gbx2 in ace mutant embryos. (H) A bead soaked with Fgf8 protein can not rescue the morphology of the isthmic constriction at the MHB but can evoke ectopic spry4 expression in wild-type and spg embryos (G,H); a white circle indicates the implanted bead in (G,H).
TABLE 3. Summary of fgf8, pou2 and mOct4 overexpression studies and transplantation experiments
To examine how specific pou2 function might be for Fgf8, I studied the phenotype of spg/ace double homozygous mutants. At 90% epiboly, spg/ace double mutants embryos show no gbx2 expression, like ace single mutants (not shown; see also Figure 8E). At later stages, however, the double mutants are easily distinguishable, because their MHB as well as their ear and tail phenotypes are stronger than that of either single mutant. The prospective tectal region is strongly reduced in size, and the otic placodes are extremely small and never develop into otic vesicles (Figure 14J). In situ analysis shows that in the double mutants, pax2.1 is almost completely abolished at the MHB already during early somitogenesis stages, whereas it is still recognizably expressed in either single mutant embryos (Figure 14E,H,K). This finding suggests that at later stages, pou2 might also function independently of Fgf8, possibly in conjuction with other Fgfs. Given the often redundant nature of Fgf signaling, a stronger phenotype might arise Results 58 - from a pou2-requirement for mediating the effects of other Fgfs than Fgf8 that are also expressed at the MHB (Reifers et al. 2000). I therefore compared the double mutant phenotype to the phenotype of embryos where all Fgf signaling is blocked due to pharmacological inhibition with SU5402 in a spg/pou2 mutant background (Figure 14M-P). At the 8 somite stage pax2.1 expression is reduced at the MHB in inhibitor treated wild-type embryos, resembling pax2.1 expression in ace mutants at the same age (Reifers et al. 1998), although the expression domain is slightly more reduced than in ace mutants (Figure 14N). Inhibitor treatment of spg mutant embryos, which normally show a dorsally restricted pax2.1 MHB domain at the 8 somite stage, leads to complete abrogation of pax2.1 expression at the MHB (Figure 14O,P), almost mimicking the spg/ace double mutant phenotype (Figure 14K). These findings suggest that both additional Fgfs and non-Fgf dependent pathways contribute to the enhanced phenotype of spg/ace double mutant embryo.
FIGURE 14 The double mutant spg-ace embryo shows severe brain phenotype. (A,D,G,J) Living embryos. The double mutant spg-ace shows a more severe brain phenotype (J) than each mutant alone (D,G). (B,D-F,H,I,K,L) pax2.1 expression. At midsomitogenesis, the MHB expression of pax2.1 is severly reduced and completely missing at pharyngula stages in the double mutant embryos (K,L). (M,N,O,P) Phenocopy of the double mutant phenotype by blocking Fgf receptors using the inhibitor SU5402. (N,P) spg embryos treated with the inhibitor (+ SU5402, (P)) reveal strong Results 59 - similarity to spg/ace double mutant embryos which is reflected by pax2.1 staining (compare (P) with (K); (N,P) expression of pax2.1 within the otic placode is also strongly reduced by inhibition.
In summary, analysis of the loss- and gain-of-function experiments in spg and ace embryos suggests that Fgf8 and Pou2 do not act in a simple linear pathway, but genetically act synergistically in a stage- and tissue-specific manner in order to initiate and maintain the developing MHB primordium (Figure 15).
FIGURE 15 The role of pou2 in neuroectodermal development. The first steps of brain regionalization involve the positioning of the MHB and the hindbrain, which is independent of pou2. During the establishment phase of the MHB organizer, pou2 is upstream of several cognate MHB markers like pax2.1, wnt1, her5, eng1/2. In the hindbrain primordium, pou2 and fgf8 serve a combinatorial role in the initiation of hindbrain markers like gbx2 and spry4. Results 60 - 2.3 pou2 is essential for the commitment to the endoderm lineage
2.3.1 pou2 exerts both maternal and zygotic function during zebrafish development In the wild-type embryo, pou2 mRNA is present ubiquitously in the unfertilized oocyte and early zygote (Howley and Ho 2000; Figure 16B). Zygotic expression is required for early neural development to allow activation of gene expression in development of the midbrain-hindbrain organizer in response to Fgf8 signaling (Reim and Brand 2002; and references therein). To study the function of maternal and zygotic pou2 function, I generated embryos lacking pou2 function in the germline and the zygote (MZspg; Figure 16A). As a precondition to generate embryos which are both maternally and zygotically mutant for pou2, mutant adult carriers had to be created. This was achieved by two strategies differing in the way of producing mutant carrier fish, as explained in the following. 1. MZspg mutant embryos can be derived from “germ cell mosaic carriers”. Because of technical difficulties, the straight-forward and much easier method mentioned below could not be carried out successfully at first. Therefore, the generation of adult homozygous carrier fish had to be circumvented. Primordial germ cells (PGCs) of homozygous spg mutant donor embryos were transplanted into wild-type host embryos at midblastula stages (not shown). For the labeling of donor PGCs, donor embryos were injected at the 1-cell stage with a heterologous vasa-3’UTR-gfp mRNA, where the 3’ UTR of the vasa gene confers stability to the gpf mRNA exclusively in PGCs (Wolke et al. 2002). Host embryos were best screened after 1 day of development for GFP expressing, successfully transplanted PGCs, since PGCs normally migrate to one distinct bilateral location by the end of the first day. Normal wild-type embryos develop 25-50 PGCs, depending on the wild-type strain. This strategy harbours various intrinsic limitations and is therefore highly unefficient: (a) highly mosaic PGC carriers are generated, containing 50% spg and 50% wild-type PGCs in the most successful case; (b) only 25% of transplanted carrier will harbour spg mutant PGCs because spg donor embryos can not be preselected before transplantation; (c) identification of PGCs by morphology at the time of transplantation is not possible; (d) typically, half of the host fish will develop into females; (e) identification of mutant chimaeric female carriers is only possible based on the phenotype of their progeny. To obtain MZspg mutant embryos, transplanted PGC-chimaeric adult host females are crossed to Results 61 - heterozygous spg males. However, in addition to MZspg mutant embryos, the progeny consists of Mspg and phenotypically wild-type embryos (genetically wild-type and heterozygous mutant spg). The ratio of maternal versus maternal-zygotic versus wild- type offspring differs, depending on the total number of transplanted PGCs and the total number of wild-type host PGCs. 2. Generation of homozygous mutant carriers. Injection of pou2 mRNA into homozygous mutant embryos for a null allele of the spg locus, spghi349 (Burgess et al. 2002), at the 1-cell-stage could rescue the requirement for zygotic Pou2, allowing us to generate fertile homozygous spg mutant adults (Figure 16A). Primers designed to distinguish between homozygous wild-type, homozygous mutant and heterozygous embryos for the proviral insertion were used for PCR-based genotyping. From later crosses of homozygous mutant females and males we obtained MZspg mutant embryos which lack pou2 transcripts (Figure 16A), suggesting that MZspg phenotype most likely reflects a complete loss of function situation. Instability of transcripts is a common phenomenon observed upon retroviral insertion (S. Burgess, pers. comm.). However, this is highly unlikely to be the case in the situation of MZspg mutants, since mutant pou2 mRNA can be readily detected in zygotic spghi349 mutant embryos at pharyngula stages (not shown). Therefore, complete loss of maternal pou2 message in MZspg indicates that maternal pou2 expression might be subject to early autoregulation. The phenotype of MZspg mutant embryos is constant regarding expressivity and penetrance in every egg clutch examined, and could be rescued completely by pou2 mRNA injection of MZspg embryos at the 1-cell stage. Results 62 -
FIGURE 16 Generation of MZspg and Mspg mutant embryos. (A) Schema for the generation of maternal-zygotic spg (MZ spg) or maternal spg (Mspg) mutant embryos. Homozygous spg mutants were rescued by pou2 mRNA injection at the 1-cell-stage. Viable homozygous adult females were crossed with homozygous males or wild-type males to give rise to a progeny of MZspg or Mspg, respectively. (B) pou2 is maternally supplied to the zygote (C) MZspg embryos never initiate pou2 expression.
2.3.2 The differentiation of endodermal precursors is abolished in MZspg embryos The most prominent defect I observe in MZspg mutants is a complete absence of endoderm formation (Figure 17L-V). Other defects lie in dorso-ventral patterning and epiboly movements, but appear to be independent and are described in more detail in the “Appendix”. I examined the expression of the earliest molecular markers of endoderm development including the transcription factors cas, mez, mix (bon) and gata5 (fau), by whole mount in situ hybridization (ISH) of MZspg embryos at the time of endoderm formation. Expression of these genes in the wild-type is activated at the sphere stage in the dorsal YSL and the blastoderm in direct response to Nodal signaling Results 63 - (Reiter et al. 1999; Alexander and Stainier 1999; Kikuchi et al. 2000; Reiter et al. 2001; Poulain and Lepage 2002; Warga and Stainier 2002; reviews: Warga and Stainier 2002; Ober et al. 2003). As a consequence of sustained Nodal signaling expression then expands circumferentially within the marginal most tiers of cells within the germring during the late blastula stage. In MZspg mutant embryos I find that expression of mix, mez, gata5 and cas is initiated as in wildtype embryos (Figure 17A-H and not shown), which likely reflects normal formation of endodermal progenitors in MZspg embryos. Results 64 - FIGURE 17 Marker gene expression for endodermal progenitor and precursor cells. (A-H) Expression of genes like mix, mez, gata5 and cas, identifying endodermal progenitor cells, is not affected at blastula stages in MZspg embryos. (I-V) Markers of endodermal precursors like sox17, foxA2, gata5, cas and fkd7 fail to be initiated in MZspg embryos during gastrulation and somitogenesis stages.
In the gastrulating wild-type embryo, when endodermal precursor cells become determined and commence differentiation to an endodermal fate, expression of cas, bon and gata5 is maintained in a peculiar, punctate distribution reflecting the distribution of endomesodermal precursor cells during gastrulation until the beginning of somitogenesis (Figure 17L,M,O; and not shown). In the same cells, expression of the key endodermal differentiation markers sox17 and foxA2 is activated (Strahle et al. 1993; Odenthal and Nusslein-Volhard 1998; Alexander and Stainier 1999;). In MZspg embryos during and at the end of gastrulation, expression of gata5, cas, bon, sox17 and foxA2 is absent during and at the end of gastrulation (Figure 17L-T, and not shown). Expression of foxA2 within dorsal axial cells is not affected, although the shape of this domain is altered as due to the disturbed morphology of MZspg mutant embryos, resulting from an independent pou2-requirement in dorsal axis formation (arrowheads in Figure 17M,N). Lack of endodermal marker expression at the end of gastrulation could reflect a defect of the prospective endoderm to undergo proper differentiation. Alternatively, migration of endodermal precursor cells within the moving hypoblast layer could be disrupted. I therefore examined the formation of endodermal precursor cells at the shield stage when they first become morphologically visible. sox17 is activated in emerging endodermal precursors coincident with their recruitment into the hypoblast (Alexander and Stainier 1999). Importantly, expression of sox17 is not activated in MZspg embryos at the onset of gastrulation (Figure 17I,J). Expression of sox17 within the Forerunner cells is present, although they are strongly reduced in number, and are sometimes lacking completely (arrow in Figure 17I,J,K,L). Similarly, foxA2 expression is not initiated in endodermal precursor cells in MZspg mutants (not shown), and none of the endodermal progenitor markers like gata5, bon, mez and cas are maintained in endodermal precursors. Assaying gut formation in MZspg at pharyngula stages is complicated by the abnormal morophology of the MZspg mutants at later stages. We therefore analyzed expression of fkd7 at somitogenesis stages. In the wild-type, fkd7 is expressed in the gut primordium, but also in the overlying, mesodermally derived hypochord and the floor plate (Figure 17U; Odenthal and Nusslein-Volhard 1998). In MZspg mutants, fkd7 Results 65 - epxression strongly resembles expression of the notochord marker ntl, and both ntl and fkd7 reflect morphological alteration of dorsal axial mesoderm like the notochord and the hypochord (Figure 17V; see also Figure 24C). In summary, ISH analyses suggest that MZspg embryos lack differentiating endodermal precursor cells from gastrulation onwards.
2.3.3 pou2 is required cell autonomously within the endoderm to elicit endodermal differentiation pou2 is strongly and ubiquitously expressed within the embryo during blastula stages, thereby encompassing endodermal progenitor cells, and is confined to the epiblast when gastrulation commences (Figure 18B,C; Takeda et al. 1994; Hauptmann and Gerster 1995). Therefore, pou2 might control endoderm development either at the late blastula stage, or at during gastrulation by controlling a hypothetical epiblast-derived signal that supports endoderm development in the underlying hypoblast. I therefore asked if transplanted wild-type cells are required in the epiblast or in the hypoblast to restore endoderm development in MZspg host embryos, as monitored by sox17 expression. Wild-type donor cells were transplanted from the dorso-lateral, marginal most region of the embryo into MZspg host embryos at late blastula stages (Figure 18A). This region consists of 51-80% of endodermal precursor cells, which will preferentially contribute to endodermal derivatives like the gut (Kimmel et al. 1990; Warga and Nüsslein- Volhard 1999). Host embryos were then fixed at the end of gastrulation and analyzed for sox17 expression to assay for endodermal differentiation. Depending on the location of the transplanted cells, expression of sox17 could be restored in MZspg mutant embryos. I find that sox17 expression is exclusively observed in transplanted wild-type cells located in the hypoblast, and pou2 therefore acts in a strictly cell autonomous way (Figure 18D,E). sox17 positive cells were found in close apposition to the yolk cell of MZspg embryos and displayed the morphology and spacing that is typical for endodermal cells in the wild-type embryo (compare with Figure 17S for wild-type expression pattern of sox17). Some transplanted wild-type cells also came to lie within the mesoderm, as judged from their smaller size, and roundish morphology; as expected, these cells did not express sox17 (Figure 18E, arrow). In contrast, wild-type cells transplanted into the prospective non-neural and neural ectoderm of MZspg embryos did not elicit sox17 expression in the underlying hupoblast (Figure 18F). Together, these findings demonstrate that pou2 is required at the late blastula stage for proper endoderm differentiation in a strictly cell autonomous manner at the transition from endodermal progenitor cells to endodermal precursors. Results 66 -
FIGURE 18 pou2 is cell autonomously required in the endoderm. (A) Schema of transplantation experiments. (B) pou2 is ubiquitously expressed in the wild type embryo throughout blastula stages. (C) With the onset of gastrulation, expression is restricted to the dorsal hypoblast as depicted in a transversal section at 60-70%E; arrowheads indicate the border between ectoderm and mesendoderm. (D,E) Wild-type cells transplanted into prospective endodermal regions of MZspg embryos, examined at the end of gastrulation, restore expression of sox17. (E) Same detail of the embryo depicted in (D), after the localization of transplanted cells was evidenced by immunochemistry (brown cells), demonstrating that exclusively wild-type cells express sox17 in a strict cell autonomous manner. (F) Wild-type cells (brown staining) transplanted into the prospective ectoderm of MZspg embryos can not induce sox17 expression in the mutant embryo.
2.3.4 Temporal requirement for pou2 in endoderm development The YSL is thought to induce, via the Nodal signaling pathway, endodermal markers like mix, cas and gata5 in the YSL and the overlying blastoderm, or mez solely in the blastoderm (Mizuno 1996; Erter et al. 1998; Mizuno et al. 1999; Ober et al. 1999; Rodaway et al. 1999). I find that pou2 is dispensable for the earliest phase of endoderm progenitor development. In contrast, pou2 is necessary for endodermal differentiation. The transplantation analysis above showed that wild-type cells transplanted at late blastula stages into MZspg hosts can develop into endoderm, as monitored by sox17 expression Figure 17). Because pou2 mRNA is maternally provided, but also produced in early zygotic development, it was a possibility that predominantly the maternal or the zygotic pou2 product is most important for endoderm differentiation. I therefore compared endoderm development in wild-type or MZspg embryos with that of embryos developing in the absence of only the zygotic (Zspg) or only the maternal (Mspg) function. Mspg mutant embryos are obtained by crossing spg homozygous females with wild-type males (Figure 16A), and Zspg embryos by crossing heterozygous spg carriers. Results 67 - Zspg embryos show a reduced number and intensity of sox17 expressing cells at the end of gastrulation (Figure 19B; see also Figure 8S’). Similarly, Mspg embryos show a variably reduced sox17 expression, from slight reduction to virtual elimination, reflecting a variable expressivity and penetrance of the maternal phenotype (Figure 19C,D; Reim and Brand, in preparation). Finally, MZspg embryos complety lack sox17 expression (Figure 19T). Therefore, both zygotic and maternal pou2 function contribute to sox17 activation. Later examination of living Zspg and mild Mspg embryos at the 20 somite stage revealed that they express fkd7 comparable to the wild-type and can form a gut (Figure 19E,F,G). The gut is likely functional since these larvae take up and transport food and, finally, release excrements (not shown). Mspg embryos displaying a strong mutant phenotype do not form a morphologically visible gut primordium, as seen by loss of fkd7 expression within the prospective gut region at somitogenesis stages (Figure 19H). However, in dorsal views, very faint and laterally spreading expression of fkd7 is visible close to the surface of the yolk, which might reflect a dorsalized, rudimentary population of prospective endodermal cells in these embryos (Figure 19I). Expression of non-endodermal fkd7 domains is present, although morphologically altered in these embryos, which is likely due to their strong dorsalized phenotype (Figure 19H). Like in MZspg mutants, expression of maternal pou2 message is not detected in Mspg embryos (Figure 19K). In contrast to MZspg embryos, Mspg embryos commence zygotic expression of wild-type pou2 at the late blastula, at about 40% of epiboly, and are able to restore pou2 transcription almost to the wild-type level before the onset of gastrulation (Figure 19M). This also indicates that zygotic expression of pou2 does not depend on its own maternal gene product. In Zspghi349 mutant embryos, pou2 expression decreases from 30%-40% of epiboly onwards (Figure 19O), and is lost during gastrulation (Figure 19Q), indicating persistence of maternal wild-type pou2 message until late blastula stages. Results 68 -
FIGURE 19 Maternal and zygotic pou2 is required for endoderm development. (A-D) Expression of sox17 at the tailbud stage, dorsal views. In contrast to the wild-type (A), intensity and number of sox17 expressing cells is strongly reduced affected in zygotic (B) and mild maternal (D) spg embryos, and nearly abolished in strong maternal (D) spg mutant embryos. (E-I) Expression of fkd7 at the 20-somite stage. e-h lateral views (E) fkd7 is expressed in the entire prospective gut region (red arrow) as well as in the hypochord (white arrow) and the floor plate (black arrow) in the wild-type. (F) fkd7 expression in Zspg. (G) fkd7 expression in Mspg with low expressivity of the phenotype is similar to expression in Zspg. (H) fkd7 expression in Mspg with strong expressivity of the phenotype with normal, non-endodermal gene expression. Endodermal expression can not be detected in a lateral view. (I) In a dorsal view (anterior to the top), laterally expanded fkd7 expression is faintly visible in close apposition to the surface of the yolk. (J,L,N,P) pou2 is ubiquitously expressed in the wild-type during blastula stages in the entire embryo, and in early gastrulation in the epiblast. (K) Mspg embryos lack pou2 transcipts, but commence transcription at late blastula stages (M). Conversely, Zspg mutants show normal pou2 expression until late blastula stages (O), and downregulate pou2 expression from late blastula stages onwards (Q).
2.3.4.1 pou2 is strictly required for sox17 expression mediated by ectopic Nodal signaling
To adress the level at which Pou2 might act in endoderm development, we investigated the relationship between pou2 and Nodal signaling which is essential for endoderm and mesoderm formation. MZoep mutant embryos lacking the Nodal-cofactor EGF-CFC are unable to process Nodal signals, and hence lack all endoderm and most mesoderm (Gritsman et al. 1999). The phenotype of MZoep mutants can be rescued by mis- Results 69 - expressing tar* mRNA, a constitutively active variant of the Nodal transmembrane receptor Taram A (Peyrieras et al. 1998). Moreover, tar* misexpression leads to the ectopic activation of the endodermal pathway and directs the fate of early blastomeres predominantly into endoderm when misexpressed, thereby ectopically activating expression of sox17 at the blastula stage already before its normal onset (Figure 20B; Peyrieras et al. 1998). Nodal signaling appears to be intact in MZspg embryos, as judged from marker expression of endodermal progenitor cells (Figure 17A-H) and the transplantation experiments mentioned above. Accordingly, ligand-independent, constitutive Nodal signaling by Tar* causes strong ectopic activation of mez, an immediate target of Nodal signaling (Poulain and Lepage 2002), in MZspg embryos at the sphere stage (Figure 20C). Importantly, however, the ability to activate sox17 after misexpressing tar* mRNA is totally suppressed in MZspg and pou2-morpholino injected embryos (Figure 20A,E). Therefore, Tar* constitutively activated Nodal signaling cannot bypass the requirement for functional Pou2. Since pou2 is expressed normally in Nodal pathway mutants like oep, sqt or cyc (not shown), pou2 clearly acts parallel to the Nodal signaling pathway, which is in accordance with normal marker expression in endodermal progenitors in MZspg embryos.
2.3.5 Pou2 and Cas are synergistically required for endodermal differentiation casanova (cas) plays a central role in endoderm formation. cas encodes a HMG domain protein of the Sox-transcription factor superfamily, that is necessary and sufficient for endoderm differentiation, and is suggested to be the key activator of sox17 (Kikuchi et al. 2001; Aoki 2002; Dickmeis et al. 2001). cas is the only mutation known so far that specifically affects endoderm formation in a strikingly similar way to MZspg mutant embryos (Alexander and Stainier 1999). As in MZspg embryos, however, gene expression in endodermal progenitor cells is not affected in cas mutant embryos. Thus, the profile of endodermal gene expression is comparable between cas and MZspg mutants. The striking similarity between the phenotpe of cas and MZspg mutant embryos regarding endoderm development prompted me to investigate the relationship between cas and pou2. cas expression is initiated normally in MZspg mutants (Figure 17G,H), and pou2 is expressed normally in cas mutants (not shown), indicating that both genes might act in parallel. Moreover, tar* mRNA misexpression could activate cas in MZspg mutant embryos at ectopic locations, similarly to the ectopic activation of mez (Figure Results 70 - 20C,D). This is in agreement with previous data which assign cas the role of a direct downstream target of Nodal signaling (Dickmeis et al. 2001; Aoki et al. 2002; Poulain and Lepage 2002). Furthermore, the ability of cas to restore sox17 expression after injection into MZoep embryos was totally abolished upon co-injection of morpholinos against pou2 (Figure 20E). These findings suggest that pou2 acts downstream of, or in parallel to cas to elicit endoderm formation. In order to distinguish between these possibilities I injected cas mRNA into MZspg mutants and pou2 mRNA into cas mutants, and examined the embryos for sox17 expression. Injection of cas mRNA elicits strong ectopic sox17 in the wild-type (Figure 21A; Kikuchi et al. 2001; Aoki et al. 2002), but not in MZspg embryos (Figure 21C). As expected, injection of pou2 mRNA could also not restore sox17 expression in cas mutant embryos (Figure 21D). However, when pou2 mRNA was co-injected with cas mRNA either into cas-/- or MZspg mutants, expression of sox17 is rescued and ectopically activated (Figure 21E,F; compare with Figure 21A). The endogenous punctate expression pattern of sox17 is obscured under these conditions, similarly to cas mRNA injection into the wild-type Taken together, these results strongly suggest that Pou2 and Cas act together to activate sox17 expression and endoderm differentiation.
FIGURE 20 Epistatic relationship between pou2 and endoderm promoting Nodal signaling.
(A,B) Constitutive TarA* activity, normally eliciting ectopic activation of sox17 at blastula stages (B), can not bypass the requirement for expression of intact Pou2 (A), as similarly seen in pou2-morpholino injected embryos (E), but is able to ectopically initiate pro-endodermal transcription of mez and cas in pou2-deficient embryos (C,D). Results 71 -
FIGURE 21 Epistatic relationship beween pou2 and cas
In situ analysis detecting sox17 expression at 60-70% of epiboly. As a result of cas mRNA misexpression, sox17 is activated in ectopic places in the wild-type embryo (B), whereas in MZspg embryos, ectopic activation by Cas is clearly prevented (D). (C) sox17 fails to be ectopically activated upon pou2 misexpression in the wild-type embryo. (E) pou2 misexpression can not rescue endogenous sox17 expression in cas-/- mutant embryos. (F,G) Mutual dependency of Cas and Pou2 to elicit ectopic and endogenous activation of sox17 in the endoderm deficient mutant cas-/- (F) or MZspg (G).
It has been previously suggested that the Sox transcription factor Cas regulates sox17 directly (Kikuchi et al. 2001). Sox factors often bind to adjacent or overlapping elements with Pou domain transcription factors to specifically activate or repress transcription of target genes, respectively (reviewed in Ryan and Rosenfeld 1997; Wilson et al. 2002). Indeed, detailed studies of a promotor element of the sox17 gene, which contains putative Sox and POU domain binding sites, were carried out in a collaboration with Y. Kikuchi and D. Stainier). The synergistic behaviour of Pou2 and Cas and a putative direct correlation with the activation of the sox17 promotor was assessed in a luciferase reporter assay, where a promotor element of the sox17 gene containing putative Sox17 and Pou2 domain binding sites was hooked up to a luciferase reporter gene. The following injection experiments were carried out in MZspg mutant embryos and in cas mutant embryos. The reporter construct was co-injected at the 1-cell stage with either pou2 mRNA or cas mRNA alone, or co-injected with both pou2 and Results 72 - cas mRNA. As a control, the same set of experiments was performed with a CMV- luciferase construct without any regulatory elements of the sox17 promotor. The results of the luciferase assay are depicted in Figure 22. We obtained significant increase of luciferase activity in cases where (i) both pou2- and cas mRNA was injected together with the sox17 promotor construct; (ii) pou2 mRNA was injected with the sox17 promotor into MZspg mutant embryos, which properly express cas until beginning of gastrulation; (iii) cas mRNA was injected with the sox17 promotor into cas mutant embryos, which express pou2 at wiild-type levels (not shown). These results suggest that both Cas and Pou2 are necessary to activate luciferase reporter gene expression driven by a sox17 promotor fragment, whereas either factor alone does not elicit strong activation of the reporter.
FIGURE 22 Luciferase Assay. Reporter gene expression driven by a sox17 promotor fragment significantly increases upon cas- and pou2 mRNA co-injection.
2.3.6 MZspg mutant cells develop into mesoderm Both in cas and MZspg mutant embryos, endomesodermal progenitors cannot undergo endodermal differentiation. The question remains what happens to endodermal progenitor cells of MZspg embryos at late blastula stages where differentiation is obviously intercepted. I performed transplantation experiments in order to address the fate of these progenitor cells. Wild-type cells transplanted into the dorso-lateral margin of MZspg embryos at late blastula stages form endoderm with high probability (Figure Results 73 - 3A; Warga and Nüsslein-Volhard 1999). Labelling of the transplanted cells with rhodamine-dextrane allowed me to track them in the living embryo, which I examined at pharyngula stages. Wild-type cells transplanted into the prospective endoderm predominantly colonize the gut (Figure 23A,A’; n=30). In contrast, analysis of chimaeric embryos revealed that MZspg cells are able to contribute to mesodermal derivatives like the hypochord or the notochord (Figure 23B,C; n=40), but failed to compete with wild-type cells to colonize endodermal descendents. Therefore, MZspg cells are able to contribute to mesodermal tissue, but fail to populate endodermal derivatives like the gut.
FIGURE 23 MZspg mutant endomesodermal progenitors develop into mesoderm. (A,B,C) Bright-field images of transplanted living embryos at pharyngula stages where merged with flourescent images taken at the same focal plane, whereby transplanted cells show red fluorescence. (A) Wild-type cells transplanted into the prospective endoderm of wild-type embryos colonize at a high frequency endodermal derivatives like the gut, with lower frequency mesodermal structures (not shown). (A’) Bright field image of the wt-embryo depicted in (A). Arrows indicate the gut tube in close apposition to the yolk sac extension (YSE). (B,C) MZspg cells transplanted into the prospective endodermal region of wild-type embryos populate mesodermal derivatives like the hypochord (B) or the notochord (C), but not endodermal gut regions. Results 74 - Cas not only stimulates endoderm formation, but also represses mesodermal markers like ntl when overexpressed (Figure 24A; Aoki et al. 2002). In the wild-type, Cas may therefore be required to shut down ntl in endodermal progenitors suggesting that these cells require both the activation of sox17 as well as the repression of ntl at the transition from the blastula to the gastrula to become endodermal precursor cells. This raises the possibility that Cas and Pou2 might also cooperate to repress mesoderm differentiation. To test this notion, MZspg embryos were injected with cas and assayed for ntl expression. Interestingly, ntl expression can be repressed by cas mRNA injection in absence of functional Pou2 (Figure 24B), indicating that Cas can repress ntl transcription independently of Pou2. Therefore, sole repression of the pan-mesodermal marker ntl is not sufficient to elicit endoderm differentiation. Also, it is conceivable that Cas cooperates in this case with another, as syet unknown POU family member.
FIGURE 24 cas can repress ntl independently of pou2. (A) In wild-type embryos, mRNA injection of cas leads to complete repression of the pan-mesodermal marker ntl. (B) ntl can be repressed by cas mRNA injection in MZspg mutants. Results 75 -
In summary, by phenotypical and functional data I suggest that both pou2 and cas are necessary and act in a synergistic way to initiate sox17 expression. In the absence of maternal and zygotic pou2 function, endodermal differentiation is abolished, and endo- mesodermal progenitor cells develop into mesoderm (Figure 25).
FIGURE 25 The role of pou2 in endoderm differentiation. pou2 is essential for commitment to the endodermal precursor lineage and acts cooperatively with cas to activate sox17 expression. In the absence of functional pou2, MZspg mutant endomesodermal progenitor cells are strongly biased in their fate decision and predominantly undergo mesodermal differentiation. 76 3 Discussion
In the first part of my thesis I have analyzed the function of spiel-ohne-grenzen (spg/pou2) during zebrafish brain development, and found that zygotic spg/pou2 is essential for proper development of the mid-hindbrain boundary and hindbrain territories. The analysis of early marker genes shows that spg/pou2 functions during the initial establishment of these brain regions, and may also function during their maintenance, in particular in hindbrain rhombomeres 2 and 4. In addition, spg/pou2 functions also during development of the forebrain, in particular the diencephalon, and in differentiation of the paraxial mesoderm and endoderm. Most importantly, the results of the cell transplantations, mRNA injections and bead implantation experiments together, show that spg embryos are regionally insensitive to Fgf8 in the early hindbrain neuroectoderm. I therefore suggest that spg/pou2 encodes the first example of a tissue- specific competence factor for Fgf8 signaling. In the second part of this thesis I showed that pou2 is a key factor controling endoderm differentiation. My studies suggest a cell autonomous function for Pou2 in early endodermal differentiation. The mutant phenotype of MZspg embryos reveals a complete lack of differentiating endodermal precursors as previously reported for cas mutants. Absence of endoderm development caused by lack of both maternal and zygotic Pou2 could not be rescued by injection of cas mRNA. Strikingly, the ability of Cas to ectopically induce sox17 expression strictly depends on Pou2, which thereby acts as a permissive cofactor for the activity of Cas. Functional epistasis experiments imply that both Pou2 and Cas are necessary to activate expression of sox17 in a synergistic way. Thus, I conclude that Pou2 and Cas are mutually required for the commitment of endodermal progenitor cells into the endodermal precursor cells lineage. 3.1 The function of zygotic pou2 in MHB organizer and HB primordium development
3.1.1 Nature of the spg alleles I have focussed the phenotypic and functional analysis on two strong alleles, spghi349 and spge713, which give essentially indistinguishable phenotypes. Two pieces of evidence point to the spghi349 allele as being a null allele. First, the integration disrupts an exon 3 of the Pou2 transcription factor with a 6000 base-pair proviral integration. The disruption is located in the middle of the POUs domain, essentially disrupting both DNA binding domains. Whereas an intact homeodomain is required for DNA binding of POU Discussion 77 - proteins, the contribution of the POU-specific domain varies, depending both on the DNA-binding site and on the POU protein (review: Schöler 1991). Second, in situ hybridization with pou2 antisense RNA probes on mutant embryos displayed a strong reduction in signal of gene expression, both for the insertion allele and for spge713. Pou2 may therefore be involved in positive feedback regulation of its own expression. An alternative possibility, that the insertion or mutation destabilizes pou2 mRNA, is less likely to be correct, because pou2 expression in tail somites at 26 hours is normal in homozygous spghi349 mutants (not shown).
3.1.2 pou2 serves different functions in early embryonic development The loss of ubiquitous pou2 expression in spghi349 is already apparent before onset of gastrulation, around the time of normal onset of zygotic transcription. This has two important consequences for interpretation of pou2 function: (i) prior to onset of gastrulation, pou2 apparently functions in all cells of the embryo, raising the question whether and if so, how this function contributes to the brain phenotype of the mutants. (ii) a neuroectoderm-specific role. Homozygotes for the spghi349 allele most likely lack all zygotic pou2 function, but should still have normal maternal contribution. Thus, the phenotype of spg mutants is likely the result of the embryo using the substantial maternal wild-type pou2 RNA/protein during the early stages of development, and only after the embryo switches to zygotic expression can the effects of the mutation be seen. Maternal pou2 message is localized to the oocyte cortex, and is restricted to the animal pole in the freshly laid oocyte (Howley and Ho 2000). In the zygote, the message then becomes restricted to the deep layer cells that will become the actual zebrafish embryo (Hauptmann and Gerster 1995). In situ hybridization data suggest a transition from maternal to zygotic pou2 expression between 30% and 40% of epiboly. During gastrulation, pou2 mRNA is still present throughout the epiblast, but becomes gradually restricted towards the end of gastrulation. I found that between 80% and 100% epiboly the expression domain comprises both the midbrain- and hindbrain primordium, and only later does it become restricted to the hindbrain primordium (Figure 6B,C,F,G; Takeda et al. 1994).
3.1.3 spg functions during establishment of the MHB- and hindbrain primordium Key molecules controlling MHB development like Fgf8, Pax2.1 and Wnt1, are already expressed during the earliest, establishment, phase of MHB organizer development (Reifers et al. 1998; Lun and Brand 1998). Investigation of no isthmus (noi)/pax2.1 and Discussion 78 - acerebellar (ace)/fgf8 mutant embryos revealed that pax2.1, fgf8 and wnt1define three separate and independent signaling pathways during this initial phase of MHB development around 80% of epiboly (review: Rhinn and Brand 2001). During early somitogenesis, these genes become mutually dependent, demarcating the transition from the establishment to the maintenance phase of MHB development. Fgf8 serves a key function both in the hindbrain primordium and during maintenance of the MHB organizer (Reifers et al. 1998; Fürthauer et al. 2001; Raible and Brand, 2001), and the phenotype of spg/pou2 mutants suggests that the function of spg/pou2 is closely related, but not identical to that of ace/fgf8. With respect to neuroectodermal development, the results of the transplantation experiments, along with the expression pattern of pou2, argue that the effect on the neuroectoderm is a specific function of spg/pou2, and not a secondary consequence of altered endodermal and mesodermal development. For MHB development, a crucial event is the positioning of the organizer in the gastrula neuroectoderm. In mice and chick, positioning is reflected in formation of a molecular interface between the Otx2 and Gbx2 genes (Hidalgo-Sanchez et al. 1999; Millet et al. 1999; Broccoli et al. 1999). In zebrafish, this situation is very similar, but not identical, since the function of gbx2 appears to have switched to gbx1 (Rhinn 2003; see also Rhinn and Brand 2001, for a more detailed discussion). In this respect, my observation that the otx2/gbx1 interface is formed normally in spg mutants is important, as is the finding that expression of fgf8 and wnt1 is initiated in the correct spatial domain in spg mutants. Together, this shows that the neuroectoderm is not generally defective in spg mutants.
Shortly after the initial formation of the otx2/gbx1 interface, around 70% of epiboly, the gene expression program in spg mutants becomes specifically abnormal in the MHB and the hindbrain primordium, coincident with the time and place of restricted pou2 expression in the neuroectoderm. In contrast, anterior neural plate markers like six3 or otx2 are not or only mildly affected in the mutants, consistent with the notion that spg/pou2 acts specifically within the MHB and hindbrain primordium. The strong reduction in pax2.1 staining and wnt1 staining illustrates the function in midbrain development (Figure 7A-H’). In fact, given its expression profile and requirement in pax2.1 activation, spg/pou2 encodes the first candidate regulator of pax2.1 expression; this regulation may well be direct, since a functional pax2.1 promoter fragment in the zebrafish and a functional Pax2 emhancer element contain putative POU protein Discussion 79 - binding sites (Picker et al. 2001; A. Picker and M. Brand, unpublished; Pfeffer et al. 2000). The requirement for early hindbrain development is most clearly seen by the effects on the markers gbx2, fkd3 and spry4, all of which become activated at this stage in the hindbrain primordium. Expression of these marker genes has been clearly linked to Fgf signaling (Chambers et al. 2000; Liu et al. 1999; Fürthauer et al. 2001; Darlington et al. 1999), further strengthening the case for a relation between spg/pou2 function and Fgf8 signaling. Since expression of these genes and fgf8, wnt1 and her5 becomes abnormal from 80% of epiboly onwards, this marks the time when pou2 first exerts a crucial function in the MHB and hindbrain neuroectoderm. These genes could require spg/pou2 directly or indirectly for their expression. Many of the gene expression defects I observed at later stages in spg mutants are also likely to be ultimately due to this early failure to express gbx2, spry4, pax2.1, and fkd3; e.g. the reduced eng2 and eng3 expression is probably due to loss of pax2.1 expression, since pax2.1 is absolutely required for eng gene expression (Lun and Brand 1998). In summary, these results show that spg is required for proper initiation of the MHB organizer and the hindbrain primordium, positively regulating expression of pax2.1, as well as her5, krox20, gbx2, fgf8, spry4 and fkd3 during gastrulation.
3.1.4 Competence to respond to Fgf8 in the early hindbrain requires pou2
Fgf8 is expressed in several domains in or around the early neuroectoderm, and the same molecule functions differently in different tissues. The different potential to respond must therefore be encoded by the developmental state or history of the target tissue, referred to as competence to respond in a specific way to an inductive signal, in this case Fgf8. The factors mediating competence to respond to Fgf8 are so far unknown; my analysis suggests that Pou2 is one such factor. The transplantation assays revealed that spg/pou2 is cell autonomously required in the neuroectoderm, in accordance with its expression pattern and the function of pou2 as a transcriptional regulator. While addressing the mechanism by which pou2 exerts its effects in the earlier neuroectoderm through fgf8 mRNA injection and bead implantation assays, I found that spg mutants are regionally insensitive to the effects of fgf8 expression. Providing fgf8 message or Fgf8 protein back to spg embryos was not sufficient to Discussion 80 - restore expression of the target genes gbx2 and spry4 to spg mutants, although other effects that characteristically result from Fgf8 treatment, e.g. dorsalization, were still evident. Conversely, providing pou2 message back to ace/fgf8 mutants, which normally lack gbx2 expression, failed to restore gbx2 and fkd3 expression, although pou2 injections clearly rescued the spg mutant phenotype. High levels of pou2 mis- expression slightly upregulate and expand pax2.1 expression in the DV and AP direction at the MHB. However, pax2.1 staining is not seen in other, non-neural ectopic areas upon pou2 mis-expression, and the endogenous expression of pax2.1 in other parts of the embryo is unresponsive to mis-expression of pou2, showing that pou2 is necessary and partly sufficient to expand pax2.1 expression. Together with the results of the spg/ace double mutant phenotype, these data suggest that pou2 and fgf8 do not act in a simple linear pathway leading to gbx2, fkd3 and spry4 activation, but rather are both required to synergistically activate these genes (Figure 15). Mechanistically, Pou2 might for instance require an activating signal under the control of Fgf8, such as phosphorylation, for its activity – this signal would be absent in ace mutants – or both a target of the MAP kinase pathway and Pou2 could act together in a transcriptional complex controlling gbx2 expression. Further support that pou2 is not simply downstream of fgf8 comes from the analysis of embryos where Fgf signaling has been pharmacologically inhibited, and from studying pou2 expression in ace mutants. In both conditions, pou2 expression is initially normal, and becomes only reduced from somitogenesis-stages onwards, when maintenance mechanisms start to operate (not shown). In summary, initial processes involving the spatio-temporal set up of the MHB primordium and the hindbrain during mid-gastrulation stages are independent of pou2, whereas the MHB- and hindbrain primordium is made competent to respond to the effects of Fgf8 by expressing pou2 from the establishment phase at the end of gastrulation onwards. In particular, I propose that pou2 and fgf8 are synergistically required to initiate expression of gbx2, spry4 and fkd3 in the hindbrain primordium. This work raises several new questions with respect to the issue of competence. If the spatially restricted expression of pou2 serves to make neuroectoderm competent, how in turn is the expression of pou2 set up? This question will be of particular interest, because the interface between otx2 and gbx1 that may position the MHB is forming normally in spg mutants. A further question that I have not yet addressed is whether pou2 mediates competence for other Fgfs as well, or indeed also for other classes of signaling molecules. The similarities between the acerebellar/fgf8 mutant phenotype Discussion 81 - and the spg mutant phenotype argues for a relatively high degree of specificity to mediate the effects of Fgf8. In contrast, the differences to the ace mutant phenotype for example in forebrain development or heart development, and the pou2 expression pattern argue that pou2 is not a ubiquitous competence factor for Fgf8. Furthermore, analysis of the spg/ace double mutants, and the comparison between the mutants and Fgf-inhibitor treated embryos, suggests that pou2 also serves roles that are not linked to Fgf(8) signaling. It remains an open question by what molecular mechanism pou2 mediates competence. The Fgf8 bead implantation experiments show that in other tissues or at later stages, spg mutants are able to respond to Fgf8, as evidenced by spry4 expression or dorsalisation, suggesting that the MAP kinase signaling pathway that is thought to mediate the effects of Fgf8 is not generally disrupted in the mutants. An obvious possibility is that Pou2, as a transcription factor, might control expression of some component of the MAP kinase cascade in a tissue specific manner. However, at least with respect to the fgf receptors fgfR1/3/4 I have not detected any abnormal expression in the early hindbrain primordium of spg mutants (not shown). POU type homeodomain transcription factors assemble into transcription factor complexes that include, for instance, ETS type transcription factors that serve to integrate the activity of several signaling pathways, including Fgf signaling (Fitzsimmons et al. 1996; Raible and Brand 2001). Oct4 specifically forms a complex with Ets-2, and thus silences transcription of the Tau Interferon promoter in the murine trophectoderm (Ezashi et al. 2001). An attractive mechanism of action is therefore that Pou2 might be necessary to form a stable transcription factor complex that serves as a target for Fgf signaling in downstream gene activation or repression.
3.1.5 spg/pou2 functions during maintenance of the MHB- and hindbrain primordium The lack of pou2 also has consequences for later stages of MHB development. The requirement of pou2 during the maintenance phase of MHB development can be subdivided into two aspects. During early somitogenesis stages, spg seems required for MHB development along the entire DV axis at the prospective MHB, since MHB marker expression is lost from this region in mutant embryos, increasing from ventral to dorsal. This difference may reflect a graded requirement for Fgf signaling along the DV axis (Reifers et al. 1998; Köster et al. 1997; Carl and Wittbrodt 1999). In contrast to ace mutants, however, which exhibit a gradual narrowing of MHB markers from dorsal to ventral, MHB gene expression in spg mutants is completely lost from the ventral part, but always remains detectable in a dorsal patch in the dorsal neural tube. Discussion 82 - Alternatively, this phenotype may be a later consequence of the early failure of MHB- and hindbrain gene expression domains to fuse at the midline that is already evident by the end of gastrulation. Midline marker gene expression, e.g. of shh, is not altered, raising the possibility that perception of midline signals might be affected in spg/pou2 embryos. During pharyngula stages, MHB markers recover in their expression in the dorsal-most neural tube. Morphologically, this coincides with a partial dorsal re- formation of the isthmic fold, as reflected by expression of otx2 and zath1. This recovery is observed in both weak and strong spg alleles, suggesting that alternative and pou2-independent regulatory mechanism(s) might exist that allow for later induction of dorsal parts of the MHB. The second aspect of spg/pou2 function during the maintenance period is related to the specific subdomains in the hindbrain that express pou2. From the beginning of somitogenesis until the 7 somite stage, pou2 is expressed specifically in rhombomeres 2 and 4 of the hindbrain (Takeda et al. 1994; Hauptmann and Gerster 1995). In particular, gene expression of krox20, ephA4, wnt8 or val in odd numbered rhombomeres 1, 3 and 5 strongly requires pou2, suggesting that pou2 may act on these rhombomeres in a non- autonomous fashion via a diffusible signal. Notably, fgf8 expression is strongly reduced in r2 and r4, making Fgf8 an excellent candidate for the signal controlled by pou2. The situation is likely to be more complex, since development of the even-numbered rhombomeres becomes itself abnormal, and signaling molecules like Wnt8 in odd- numbered rhombomeres are affected as well. In contrast to odd-numbered rhombomeres, which are reduced in size, r2 and 4 are not, yet they show strong downregulation of pou2 expression. Moreover, at late somitogenesis stages, r4 spatially expands at the expense of r3 and 5, as indicated by hoxb1a staining. Furthermore, we found indications that pou2 is necessary to maintain rhombomeric integrity. This is reflected by the loss of fkd3, a marker for interrhombomeric boundaries, and by the strongly reduced distance between r4 and 7, further illustrating the reduced size of r5. A key question remaining to be addressed is of course to which extend the defects in rhombencephalon development during early somitogenesis stages are due to the specific requirement of spg/pou2 within rhombomere 2 and 4, as might be suspected on the basis of its expression, or due to the failure to express early markers of the hindbrain primordium at the end of gastrulation, as I describe here. Similarly, it will be interesting to determine whether pou2 functions directly in proneural gene activation of ngn1 clusters in the rhombencephalon. With respect to the hindbrain development at pharyngula stages, the segmentation and organization of the 7 rhombomeres becomes Discussion 83 - less distinct and often it is not possible to recognize all of them. A particularly interesting observation is that the Mauthner neurons are absent in spghi349 homozygous embryos. The cell body for the Mauthner neuron resides in r4 and in situ staining shows a concentration of pou2 signal in r4 at the 3-5 somite stage which suggests pou2 may have important cell autonomous functions in establishing specific cell fates in r4. A perhaps similar situation has been observed in the determination of the NB4-2 neuroblast lineage in Drosophila (Yang et al. 1993). Pdm-1 and Pdm-2 are POU domain proteins expressed at high levels in the ganglion mother cell (GMC-1). As the level of Pdm-1 and Pdm-2 drops, the GMC-1 cell divides to form an RP2 motorneuron and a sibling cell. When Pdm-1 or Pdm-2 is overexpressed, the GMC-1 cell divides without a drop in Pdm level which generates two new GMC-1 cells. The level of Pdm then drops, and a duplication of the RP2 motorneurons results. The absence of both Pdm-1 and Pdm-2 in mutants completely prevents the formation of RP2 motorneurons. One consequence of the failure to specify the MHB and hindbrain primordia properly in spg/pou2 mutants is that these tissues are not or only partially formed in a pharyngula stage embryo. The actual loss of tissue is probably the result of two very different, basic mechanisms. The localized cell death I observe in the forming midbrain and hindbrain during late somitogenesis stages may well be a direct consequence of the earlier misspecification of these tissues. In addition, however, I also observe that neighbouring territories to the most strongly affected areas appear expanded in size. This is particularly noticeable for the posterior forebrain (Figure 9), and within the hindbrain for the rhombomeres bordering on the most strongly deleted rhombomers r2 and r4 (Figure 8G-K’). The processes maintaining the major brain subdivisions are poorly characterized, but seem to require integrity of neighbouring brain regions. Posterior forebrain expansion is, for example, also seen in the murine Pax2/Pax5 double mutants (Schwarz et al. 1997) and in the zebrafish noi/pax2.1 mutants (S. Scholpp and M. Brand, unpublished), which exhibit loss of the midbrain, the MHB and the cerebellum, coupled to a posterior expansion of the rostral pax6 domain and partial fusion with the pax6 hindbrain domain. This may result from the lack of eng2 and eng3 gene expression in the mutants, since misexpression of engrailed-type genes can suppress forebrain development during chick and medaka development (Araki and Nakamura 1999; Ristoratore et al. 1999). The lack of MHB expression during mid-late somitogenesis in spg therefore probably contributes to the observed fusion of gene expression domains of forebrain and hindbrain markers as a secondary consequence. Interestingly, however, expansion of forebrain markers is already evident during the Discussion 84 - establishment phase of the MHB primordium, raising the possibility that pou2 on its own has an active role in suppression of forebrain markers. Better fate maps and proliferation assays will be needed to address this issue further.
3.1.6 The role of pou2 in ear development spg mutant embryos typically show a slightly smaller otic vesicle. However, unlike the situation in the MHB, pax2.1 expression in the otic placode appears unaffected in the mutant embryos. It is therefore unlikely that the ear defect is a result of a failure to induce proper expression of pax2.1 in the ear. There are several examples of zebrafish mutations that affect the hindbrain initially and as a consequence of that hindbrain defect, display defects in ear development (Moens et al. 1996; Mendonsa and Riley 1999; Leger and Brand 2002). Several studies have also implicated signals emanating from the hindbrain in the induction of the otic placode (Gallagher et al. 1996; Mahmood et al. 1996; Groves and Bronner-Fraser 2000). Therefore it is likely that the defects in the ear seen in the spg mutation are a result of the primary defects in the hindbrain.
3.1.7 Control of totipotency versus differentiation switch This work presented evidence that the zebrafish pou2 is the true orthologue of the mammalian Oct4 (Pou5f1) gene. A brain-specific function of Oct4 is not known for the mouse gene; the conventional knock-out of this gene causes developmental arrest of mouse embryogenesis around implantation, which has so far precluded studying a possible later role in neural development. Although it is conceivable that the brain specific function was lost in the mammalian lineage, or was secondarily aquired in the teleost lineage, the results argue that this is less likely to be the case. I find that injection of mouse Oct4 mRNA into spg mutant zebrafish embryos rescues pax2.1 expression (Figure 10J; Table 3), and that in mice, Oct4 is strongly expressed throughout the neural plate until day 8.0-8.5 p.c. (Figure 10I). However, gene expression is not confined to the midbrain-hindbrain area in mice, as it is seen for the zebrafish orthologue pou2. Either Oct4 functions in a different way in the mouse neuroectoderm, or not at all, or the mechanism is slightly different. For instance, a pairing partner of Oct4, e.g. a Sox or Ets protein, could provide the spatial specificity in the mouse neural plate, which would alleviate the need to restrict expression to the midbrain-hindbrain domain in the mammalian lineage. Regardless of the exact evolutionary origin, the phenotype of spg mutants appears more specific than what might be expected for a gene controlling pluri/totipotency in all embryonic cells (Pesce and Schöler 2000). In zebrafish, pou2 is clearly shut down in much of the neuroectodermal primordium during early somitogenesis stages, and appears to function as a transcriptional regulator for specific Discussion 85 - target genes in the cells it is expressed in. Many, but not all cells either begin or have already undergone a significant differentiation at the time when they still express pou2. Therefore, if pou2 were to perform a similar function in controlling totipotency in zebrafish as in mice, this function would very likely be restricted to a specific, early step of differentiation. Instead of controlling totipotency, pou2 might serve more generally as a switch that controls the ability to respond to signals like Fgf8, and probably other signals of the Fgf subfamily, that act repeatedly during several developmental decisions. It is interesting to note that Fgfs are important signals also in the intitial cell divisions of the mouse embryo (e.g. Chai et al. 1998). In this view, the decision to follow the embryonic fate, and eventually the germline fate, would be a special case of the type of binary decisions controlled by this gene.
3.1.8 Early developmental pou2 function – a correlation to mouse Oct4 ? Based on the syntenic chromosomal position and the phylogenetic sequence comparison (Figure 4), I have argued that zebrafish pou2 and murine Oct4 are orthologous. Several additional arguments support orthology, demonstrating a similar role for zebrafish pou2 and murine Oct4. (i) Both the morpholino results and the over-expression of the truncated t-pou2 by Takeda et al. (1994) suggest that the early role of pou2 may be to maintain the cells in an undifferentiated, rapidly dividing state. In the absence of functional pou2 protein, either through anti-sense inhibition or through squelching with the truncated protein, the cells stop dividing and gastrulation is arrested. This role is very reminiscent of the murine Oct4 which is thought to control pluri- and totipotency of stem cells, e.g. the inner cell mass or ES cells derived from it, and germline determination (Schöler et al. 1989; Okazawa et al. 1991; Nichols et al. 1998 and references therein; Pesce and Scholer 2000; Hübner 2003). (ii) Precursor cells of the enveloping layer of the zebrafish embryo are the first lineage to differentiate during early cleavage stages (Kimmel et al. 1995), and as they do so, they loose pou2 expression (Hauptmann and Gerster 1995). Murine Oct4 similarly acts during an early differentiation step: Oct4 expression is restricted to the pluripotent inner cell mass (ICM) of the developing mouse blastocyst, but is excluded from the extraembryonic cells, and serves to maintain ICM in an undifferentiated state. Cells loosing Oct4 expression become trophectoderm, and ICM cells require Oct4 to maintain Fgf4 expression (Nichols et al. 1998). (iii) Mouse ES cells overexpressing Oct4 produce primitive endoderm and mesoderm (Niwa et al. 2000). Loss of pou2 function causes an early failure of endoderm differentiation, as seen with the marker sox17, which suggests Discussion 86 - that pou2/Oct4 could act more generally as a lineage switch in endoderm formation. (iv) Oct4-/- mouse embryos arrest at the expanded blastocyst stage (Nichols et al. 1998), a stage that may be analogous to the arrest shown in the morpholino injected zebrafish embryos, and controls activity of the adhesion modulator osteopontin at pre- implantation stages, which is thought to be crucial for controling migration of mouse hypoblast cells at blastocyst stages (Botquin et al. 1998). Speculatively, at the pre- gastrula stage Pou2 may act similar to Oct4, by preventing the dividing cells from restrictions in fate and hence, migration, allowing the cell number to expand enough for the embryo to develop normally. Given that pou2 is also expressed maternally and in the pregastrula zygote (Takeda et al. 1994; Hauptmann and Gerster 1995), and with respect to its ortholgy to the murine Oct4, it was important to determine whether this pregastrula expression phase influences the later neuroectodermal function of pou2. The loss of endodermal sox17 expression observed in spg mutants might reflect a pou2 function at the pregastrula-stage, because after the onset of gastrulation, pou2 is no longer expressed in the mesendoderm. This possibiliy was further examined in MZspg mutant embryos which are completely devoid of pou2 function, and is subject of the second part of my thesis. 3.2 The role of maternal and zygotic pou2 in endoderm development
3.2.1 MZspg mutant embryos reflect lack of Pou2 function Analysis of pou2 expression in MZspg embryos revealed that they do not initiate pou2 mRNA transcription at any stage of development (Figure 16, and not shown), not even after prolonged incubation of the ISH specimen within the staining reagent, which normally leads to a very strong signal of gene expression as judged by control wild-type embryos after ISH hybridization (Figure 16B). This suggests that the MZspg phenotype most likely reflects a complete loss of function situation comparable to a genetic null allele scenario. Furthermore, complete loss of maternal pou2 message in MZspg embryos suggests an autoregulation of maternal pou2 expression already at very early stages. A possible explanation for the lack of pou2 transcripts already at the zygote stage might be given by considering oocyte development. Transcripts would have to be generated and deposited into oocytes of fertile adult females, which, in turn, would contribute maternal transcripts to the early developing embryo upon fertilization. Discussion 87 - Impediment of the generation or deposition of maternal pou2 message in the germ cells of homozygous spg mutant females could account for the lack of transcripts I observe in their MZmutant embryos. Alternatively, one restriction of this interpretation might be due to a failure to detect mutant species of pou2 mRNA. However, this is highly unlikely, since mutant pou2 mRNA can be readily detected in Zspg mutant embryos at pharyngula stages within the tail region (not shown). This notion is substantiated by the finding, that pou2 cDNA could not be amplified by RT-PCR of RNA obtained from MZspg mutant embryos. MZspg mutant embryos display a pleitropic phenotype. In particular, I could find deficiencies in endoderm development, but also strong deficiencies in dorso-ventral patterning and in epibolic movements. The two latter phenotypes are discussed in more detail in the “Appendix”. Interestingly, and in contrast to the above mentioned pou2- morpholino experiments, MZspg embryos created by genetic means which are completely deficient for pou2, do not show any early developmental arrest. This raises the question, of how specific pou2-morpholinos actually function. One possibility might be that high concentrations of pou2-morpholinos also interfere with other than pou2 regulatory elements, thereby preventing gene function necessary for early developmental processes. Therefore, I consider the results obtained by high dose injections of pou2-morpholinos as preliminary, and, instead, I used genetically created MZspg mutant embryos for the examination of pou2’s early role in development.
3.2.2 pou2 is required for the first step of endoderm differentiation and acts in a cell autonomous manner Genes necessary and sufficient for endo- and mesodermal development have been previously elucidated to encode components of the Nodal signaling pathway (review: Ober et al. 2003). Mutant analysis as well as gain of function studies allocated the transcription factor coding genes cas, mez, mix and gata5 a key regulatory role in endoderm formation. A detailled ISH analysis revealed that transcriptional initiation of these genes is normal at the margin of the blastula MZspg embryo (Figure 17A-H). This suggests, that a pool of endodermal progenitors is likely to have formed in MZspg embryos during late blastula development in response to Nodal signaling comparable to the wild-type. Therefore, formation of endodermal progenitors occurs independently of pou2. However, endoderm-specific precursor markers like sox17, foxA2 and fkd7 never initiate expression in MZspg (Figure 17J,L,N,T,V). Concomitantly, expression of progenitor markers, which are normally maintained in endodermal precursors, is lost in Discussion 88 - MZspg as early as gastrulation starts (Figure 17P,R, and not shown). Therefore, the transition from the endodermal progenitor to the endodermal precursor phase appears to fail in MZspg embryos, suggesting that the commitment to the first endodermal differentiation step strictly depends on pou2 function (Figure 25).
3.2.3 pou2 acts cell autonomously, and the contribution of both maternal and zygotic pou2 is necessary in endoderm differentiation An important information for the spatio-temporal requirement of pou2 in endoderm development can be extracted from the wild-type pou2 expression: during blastula stages, pou2 is strongly and ubiquitously expressed within the embryo (Figure 18B), thereby encompassing endodermal progenitor cells from their initiation onwards. In contrast, pou2 expression is strictly confined to the epiblast when gastrulation commences (Figure 18C). Therefore, pou2 could exert its endodermal function in the late blastula embryo, when it is co-expressed with endodermal progenitor markers. Alternatively, pou2 could act at the beginning of gastrulation in a cell non-autonomous way within the ectoderm, which would involve a pou2-dependent “vertical” signal instructing sox17 activation in the underlying, involuting endoderm. By transplantation experiments I could distinguish between these two models: Transplantation of wild-type cells into the prospective mesendoderm of MZspg embryos restores sox17 expression exclusively in the transplanted wild-type cells, whereas wild-type cells can not activate sox17 expression when transplanted into the ectoderm of MZspg (Figure 18D-F). This finding argues for a strict cell autonomous role of pou2 in endodermal differentiation, which is in accordance with the wild-type expression of pou2 in endodermal progenitor cells at blastula stages. Moreover, MZspg embryos provide a permissive environment, since wild-type cells can still follow an endodermal pathway in MZspg embryos. The cell autonomous function of pou2 is in good agreement with the cell autonomous function of Nodal and of Cas in endoderm development (David and Rosa 2001; Aoki et al. 2002). The transplantation experiments also suggests that wild-type pou2 is still sufficient to activate sox17 even if provided at the very late blastula stage at 50% epiboly, just before sox17 activation. I also tried to address the relative contribution of the maternal versus the zygotic function of pou2 for endodermal differentiation. Expression of endodermal precursor markers like sox17 and fkd7 was compared between wild-type, Mspg, Zspg and MZspg embryos, which differ in the level or temporal expression behaviour of functional pou2 (Figure 19). ISH comparison revealed that Zspg and “mild” Mspg Discussion 89 - mutants are similarly affected and show reduced sox17 but normal fkd7 expression. Other endoderm mutants like fau(gata5), bon(mix) or Moep also display partially reduced sox17 expression similiar to Zspg and “mild” Mspg mutants. They also express fkd7 at somitogenesis stages and are capable to form a gut (Reiter et al. 2001; Kikuchi et al. 2001), suggesting that low levels of sox17 are still sufficient for gut development. “Strong” Mspg and MZspg mutants lack sox17 and fkd7 expression. This comparative expression analysis suggests that both maternal and zygotic pou2 is necessary for proper endoderm differentiation, which is in accordance with the spatio-temporally overlapping expression profile of maternal and zygotic pou2: zygotic pou2 commences around 40% epiboly, and restores pou2 expression almost to the wild-type level before the onset of gastrulation in Mspg mutants. Otherwise, in Zspghi349 mutant embryos, pou2 expression starts to decrease between 30% and 40% of epiboly, indicating a persistence of maternal wild-type pou2 message until late blastula stages (Figure 19). Among Mspg embryos, impediment of sox17 and fkd7 expression varies according to the variable expressivity of the phenotype. Apparently, the maternal requirement for pou2 can be bypassed, as seen in phenotypically “mild” endodermally defective Mspg embryos. This bypass might be facilitated by zygotic expression of pou2, possibly by the following scenario: The spatio-temporal overlap of maternal and zygotic pou2 expression might not be very accurate, e.g. zygotic expression might start earlier in a proportion of Mspg embryos, thereby surmounting maternal pou2 requirement and leading to a rather “mild” Mspg phenotype. Alternatively, initiation of zygotic pou2 expression might be delayed in strongly deficient Mspg embryos, which would lead to a lack of functional Pou2 at the blastula-gastrula transition, when it is normally needed for sox17 activation. In any case, the dual requirement for both maternal and zygotic pou2 may well be a safeguarding mechanism to ensure proper endoderm formation, which is obviously of crucial importance for the embryo.
3.2.4 Pou2 acts together with Cas to elicit endoderm differentiation Previous studies showed that cas mutants do not initiate any known marker expression indicative for endodermal precursor development during gastrulation and, consequently, fail to differentiate endodermal derivatives, demonstrating that cas is strictly necessary for endoderm formation. Unlike other genes necessary for endoderm formation, Cas is also sufficient for complete rescue of sox17 expression in MZoep and cas mutant embryos (Kikuchi et al. 2001; Aoki et al. 2002), suggesting that Cas is the key activator of sox17 expression. Moreover, tar* mRNA misexpression fails to activate sox17 in the Discussion 90 - cas mutant (Alexander and Stainier 1999), as we observed in MZspg mutant embryos (Figure 20A). The similarity of the phenotype of MZspg and cas mutant embryos suggested a functional relationship between both pou2 and cas. By functional epistasis experiments I demonstrated that both pou2 and cas are required in a synergistic manner for sox17 activation (Figure 21E,F). Moreover, a combined in vivo/in vitro approach involving luciferase assays (Figure 22) and DNA band shift assays (not shown; unpublished results from my collaborator Y. Kikuchi) substantiate the notion that both factors are synergistically required and bind to adjacent sites of a sox17 promotor element to activate sox17 expression. Results obtained from cell transfection assays studying murine Sox2 and Oct4 activities, suggest the following molecular model for the synergistic action of POU and Sox proteins to occur in two major steps (Ambrosetti et al. 1997; Ambrosetti et al. 2000): (1) Cooperative, stereospecific binding of both transcriptional activators to adjacent recognition sites within the enhancer/promotor mediates stable tethering to the DNA. (2) Protein-DNA and protein-protein interactions occur within the Protein-DNA complex, which may entail conformational changes, thereby exposing activation domains within each transcription factor. The mRNA injection experiments I performed show that the instructive role of Cas strictly requires Pou2 to activate sox17 expression (Figure 21A-F). Whereas pou2 is ubiquitously expressed, cas expression is spatially limited to the blastoderm margin due to its activation by the Nodal pathway. This model explains why Cas is sufficient to ectopically elicit endoderm differentiation and transfating of mesoderm into endoderm when overexpressed (Figure 21A; Kikuchi et al. 2001; Dickmeis et al. 2001), whereas misexpression of pou2 mRNA is not sufficient to trigger endoderm formation instructively (Figure 21B). This permissive role of pou2 is reminiscent to its behaviour observed in neuroectodermal development (Reim and Brand 2002; Burgess et al. 2002). The model also predicts that, since cas and pou2 transcripts are co-expressed from sphere-stage onwards, an additional as yet unknown mechanism must prevent precocious activation of sox17.
3.2.5 pou2 biases the fate decision of bipotential endo- mesodermal progenitor cells and is required for commitment to the endodermal lineage The fate of MZspg endomesodermal progenitor cells was assessed in transplantation experiments, where mutant cells were transplanted into the prospective endoderm of wild-type host embryos. MZspg cells populate mesodermal compartments, but not endodermal derivatives like the gut, suggesting that pou2 is strictly required for the fate Discussion 91 - decision of endodermal progenitors to undergo endodermal specification. In accordance with the previous transplantation experiments, MZspg mutant cells are unable to populate endodermal derivatives in the wild-type host due to the cell autonomous function of pou2 (Figure 23B,C). No cell death has been observed in MZspg cells transplanted into wild-type embryos, supporting the notion that bipotential mesendodermal progenitor cells likely exist also in MZspg mutant embryos. MZspg cells do not undergo endodermal, but exclusively mesodermal specification: the lack of Pou2 biases the specification of mesendodermal progenitors towards adopting mesodermal fate, finally enabling MZspg cells to contribute to mesodermal lineages (Figure 25). The misrouted fate decision would account for the depletion of the endodermal precursor population early in development, when wild-type progenitor cells normally change their state of differentiation. Since in the wild-type the entire number of endodermal progenitors is relatively low as compared to mesodermal progenitors, no appreciable increase of mesoderm at the expense of endoderm could be detected. Interestingly, MZspg cells can populate the branchial arches, however, branchial arches have contributions from all germ layers (not shown). Population of a fraction of the endoderm would be in agreement with the previous notion that primordial cells of pharyngeal pouches are initiated but not maintained in cas mutant embryos, indicating that anterior, i.e. respiratory tract endoderm and posterior, digestive tract endoderm is differently regulated, as it has been suggested from work with zebrafish, mouse and C. elegans (Piotrowski and Nusslein-Volhard 2000; Kanai-Azuma et al. 2002; Ober et al. 2003; Warga and Stainier 2002).
3.2.6 A conserved role for pou2 in endoderm formation? Like in the zebrafish, Xenopus sox17 also constitutes an important component of the endodermal pathway; the gene historically named pou2 in Xenopus belongs to another subclass (Hudson et al. 1997). However, Cas orthologues or true orthologues of Pou2 have not been described either in frog or chick. One possibility is that the ancestor of the Oct4/pou2 gene has been acquired by horizontal gene transfer during phylogenetic vertebrate development, as suggested for other POU factors (Aravind and Koonin 1999). The murine orthologue of Pou2 is Oct4, which has been suggested to maintain a pluripotential, or even totipotential cell phenotype (Niwa et al. 2000; Hübner et al. 2003; review: Pesce and Schöler 2000; Pesce and Schöler 2001). In agreement with this role, Oct4 has been shown in vitro to physically interact with the Forkhead domain Discussion 92 - protein Fox3D on promotor elements of the endoderm specific genes FoxA1 and FoxA2, where it acts as a co-repressor of endodermal differentiation of ES cells in culture (Guo et al. 2002). Interestingly, in addition to its role in ES cell maintenance, Oct4 has recently also been implicated in initial differentiation processes of ES cell development (Pan et al. 2002). Reminiscent to pou2’s function in zebrafish, elevated levels of murine Oct4 result in initiation of endodermal differentiation in an inducible cell culture system (Niwa et al. 2000). Moreover, analysis of the Oct4 knockout mice revealed that Oct4 is involved in the initiation of pathways controlling early differentiation of primitive endoderm from totipotent ICM. In this context, a transient increase of Oct4 within the primitive, premigratory hypoblast activates Osteopontin expression, which is a prerequisite to form a migratory endoderm at peri-implantation stages (Botquin et al. 1998). Intriguingly, Oct4 elicits transcriptional activation, whereas recruitment of the HMG transcription factor Sox2 to a DNA binding site not adjacent, but overlapping with the POU domain binding site counteracts the activating property of Oct4 in this scenario. Therefore, Oct4 seems essential for cells which decide to differentiate into defined lineages. Nevertheless, downregulation of Oct4 after fate decision is necessary for terminal differentiation. This is also in agreement with the role of pou2 in zebrafish endoderm development: high levels of pou2 expression seem to endow progenitor cells at late blastula stages with the competence to enter a precursor phase and to adopt a more differentiated state upon gastrulation. In turn, pou2 expression is cleared from the gastrulating endodermal precursor population upon commitment to their first step of endoderm differentiation. 93 4 Materials and Methods 4.1 Material
4.1.1 Animals 4.1.1.1 Fish strains
Zebrafish, Danio rerio
Wild-type strains: laboratory-maintained stocks like Tü (Tübingen), Tup lof (long fin), AB, Gol*, wik (wild-type India Klein)
Mutant strains: mutant name gene allele(s) reference(s) spiel-ohne-grenzen (spg) pou2 spgm216 Schier et al., 1996; Belting et al., 2001 spge728 Reim and Brand, 2002 spge713 Reim and Brand, 2002 spge68 Reim and Brand, 2002 spghi349 Burgess et al., 2002; Reim and Brand, 2002 acerebellar (ace) fgf8 aceti282a Brand et al., 1996; Reifers and Brand, 1999 one-eye-pinhead (oep) oep oepz1 Schier et al., 1996 ; Solnica-Krezel et al., 1996
ta56 casanova (cas) cas cas Chen et al., 1996; Alexander et al., 1999; David and Rosa, 2001; Dickmeis et al., 2001; Reiter et al., 2001; Kikuchi et al., 2001; Aoki et al., 2002 spge728,spge713 and spge68 were recovered by Christiane Klisa in the course of a haploid screen in Heidelberg (K. Klisa, N. Morita, W. Huttner, M. Brand, unpublished). Heterozygous carriers of a particular phenotype were identified either indirect, by the morphology of their homozygous offspring obtained by random intercrosses, or direct, by PCR-based genotyping. To obtain homozygous mutants and transgenics, carriers were crossed to each other. MZoep embryos were obtained by crossing homozygous carriers for oep, which were rescued by injecting oep mRNA into incrosses of homozygote carrier (Gritsman et al. 1999), which were kindly provided by Muriel Rhinn. MZspg and Mspg embryos were predominantly obtained by crossing homozygote carriers for spghi349 or by crossing homozygote female carriers for spghi349 to wild- type males, respectively. Homozygote carriers for spghi349 were obtained by pou2 mRNA mediated rescue (an alternative way to generate of MZspg or Mspg is mentioned in Section 2.1).
4.1.1.2 Mouse strain
Mice of the wild-type strain NMR1 were mated, and pregnant wild-type mice at different stages post coitum (p.c.) were supplied by the animal facility of the MPI-CBG Dresden. Materials and Methods 94 - 4.1.2 Technical equipment
Microinjectors: PV820 and PicoPump with foot pedal trigger (WPI)
Micromanipulators: Narishige MN-151; Narishige MO-155
Pipette Holders: MPH6S (Injection); MPH3 (Transplantation)
Tungsten wire: TW5-3, Ø 0.120 mm (Clark)
Glass pipettes: TW100-3F for Injection (WPI); TW100-3 for Plastic Pasteur pipettes: Transplantation (WPI) Petri Dish: 5 ml, Sarstaedt Multiwell Plates: Greiner 24 well, Nunclon Surface, NUNC, Brand Pipette Puller: Flaming/Brown Puller P-87, Sutter Instrument
Capillary Grinder: Bachofer
Centrifuges: Beckmann Avanti™ J-25, Varifuge 3.0R, Biofuge pico (Heraeus)
Photometry: Pharmacia Ultrospec 3000
PCR Machine: Peltier Thermo Cycler PTC-200, MJ Research Stratagene Robocycler Gradient 96
Microscopy: Zeiss AxioPhot und AxioScop with UV unit
Zeiss LSM Meta confocal
Olympus SZX-12
Image capturing: SONY 3CCD Color Video Camera (AVT Horn)
Scion Series 7 imaging software
Image processing: Adobe Photoshop 5.0
Printing: Oce′1115
Computer: Apple Power Macintosh G4, iMac, iBook
4.1.3 Chemicals
All chemicals, if not noted otherwise, were purchased from Applichem, Merck, Roth and Sigma. Agarose was purchased from Pharmacia, Bromophenolblue and Xylenecyanol from Serva.
4.1.3.1 Zebrafish embryo media and mounts
Experiments involving manipulation of living embryos, -except RNA-, DNA- or dye-injections into early embryos-, were casually performed in Ringer, all other experiments involving embryonic staging in 1 x E3 complemented with Methylene Blue.
10x E3 medium: 300 mM NaCl,10 mM KCl, 20 mM CaCl2/H2O,
20 mM MgSO4/7H2O, 3mM KH2PO4,
0.8 mM Na2HPO4/2H2O, Methylene Blue Materials and Methods 95 -
Ringer: 116.0 mM NaCl, 3.0 mM KCl, 4.0 mM CaCl2/6H2O,
1.0 mM MgCl2/6H2O,5.0 mM HEPES
500x NaHCO3: 357 mM NaHCO3 in H2O 10x Penicillin-Streptomycin solution: 10,000 U penicillin, 10 mg/ml streptomycin in PBS
100x PTU: 0.3% Phenylthiourea (SIGMA) in deionized water
Tricaine: 400 mg tricaine powder (SIGMA) in
100 ml H2O; pH 7 (adjusted with Tris pH 9) Embryo mounting agarose: 1-2% LMP-Agarose (GIBCO BRL) in Ringer
Embryo mounting methyl cellulose: 3% Methylcellulose (SIGMA) in E2 medium
4.1.3.2 Buffers and stock solutions
10x loading buffer: 50% Glycerol, 100mM EDTA (pH 7.5), 1.5 mM Bromophenolblue, 1.9 mM Xylenecyanol
TE: 10mM Tris/HCl pH 7.4, 1mM EDTA pH 8.0
10x TBE: 890 mM Tris, 890 mM boric acid, 20 mM EDTA pH 8.0
4.1.3.3 Lysis buffer for isolation of genomic DNA from (living or fixed) tissue
1 x Lysis buffer 100 mM Tris.HCl pH 8.5, 5 mM EDTA, 0.1% SDS, 200 mM NaCl
4.1.3.4 Culture media for bacteria
LB-medium: 0.5% Yeast extract (Gibco BRL), 1% Tryptone (Difco),
200 mM NaCl, to 1000 ml with H20 was autoclaved 20 minutes and stored at 4°C.
LB-agar: 15g Agar (Difco) to 1,000 ml LB-medium was autoclaved 20 minutes. After cooling to 50°C 75 µg/ml ampicillin, 60 µg/ml IPTG and 60 µg/ml X-Gal was added. Poured dishes were stored at 4°C.
4.1.3.5 Bacterial stocks
E.coli XL-1 Blue was used as a bacterial stock for plasmid transformation and amplification
4.1.3.6 Molecular biological reagents
Markers: Lambda-DNA/HindIII fragments 1 kb ladder;100 bp ladder (MBI) Materials and Methods 96 - Plasmids and Contructs: Several constructs used for the generation of ISH antisense RNA probes are predominantly based on the PCRII TOPO vector (Invitrogen), the pBluescript II SK+ vector (Stratagene) or the pCS2+ vector (Rupp et al. 1994), and were provided by our laboratory plasmid stock collection. Particular contstructs used for mRNA injection, ISH antisense RNA probes (*) or DNA injection (**) are listed below. If not noted otherwise, cDNA constructs contain entire open reading frames.
Plasmid name insert mRNA, probe or source DNA generation pCS2+ pou2 pou2 (2.8 kbp cDNA + UTRs partial) Bsp120/SP6 F. Reifers/G. Reim pCS2+ pou2-5UTR pou2 (2.8 kbp cDNA without 5’UTR) Bsp120/SP6 G. Reim pCS2+ pou2(m216) pou2 (2.8 kbp cDNA of spgm216) NotI/SP6 G. Reim pCRII pou2 same as first construct EcoRV/SP6 (*) F. Reifers/G. Reim pCS2+ Oct3/4 murine Oct3/4 (1.2 kbp cDNA) NotI/SP6 G. Reim pCRII Oct3/4 same as previous EcoRI/SP6 G. Reim pCS2+ opn murine Osteopontin (0.98 kbp cDNA) NotI/SP6 (*) G. Reim pCS2+ fgf8 fgf8 (cDNA) ApaI/SP6 F. Reifers pCS2+ cas cas (cDNA) NotI/SP6 Y. Kikuchi pCS2+ tarA* taramA* (cDNA for const. active form) XbaI/SP6 Y. Kikuchi pCS2+ 179.vsGFP-1 5’vasa cDNA-gfp-vasa 3’UTR XhoI/SP6 G. Weidinger pGL3 sox17-Fluc sox17 enhancer (3.1 kbp) SalI (**) Y. Kikuchi pCS2+ Rluc Renilla luciferase (2.2kbp) SalI+NotI (**) Y. Kikuchi
Enzymes All enzymes were purchased from MBI Fermentas and New England Biolabs.
Molecular biology Kits DIG RNA Labeling Kit (Roche Diagnostics) T7/SP6 mMESSAGE mMACHINE kit (Ambion) QIAquick PCR purification kit (Quiagen) QIAquick gel extraction kit (Qiagen) QIAprep-Spin-Miniprep-Kit (Qiagen) Original TA Cloning Kit (Invitrogen)
4.1.3.7 Antibodies
name antigen dilution source
Anti-Digoxigenin-AP Digoxigenin 1:4000 Roche Biochemicals Anti-Fluorescein-AP Fluorescein 1:1000 Roche Biochemicals Anti-β-Galactosidase E.coliβ-Galactosidase 1:500 Promega Anti-Acetylaed Tubulin Acetylated Tubulin 1:200 Sigma Materials and Methods 97 - 4.2 Methods
4.2.1 Fish maintenance Zebrafish were raised and maintained under standard conditions (Westerfield 1994; Brand et al. 2002). In particular, fish were maintained at 28.5°C on a 14 hrs light/10 hrs dark cycle. Embryos were collected from pairwise matings. To prevent the adult carrier fish from eating the freshly laid eggs, a grid was inserted into the mating chamber. When the fish spawn (synchronized egg clutches), the eggs sink down below the grid where the fish can not access them. Eggs where collected with a tea strainer and transferred into a petridish containing E3 medium, sorted and incubated at 28.5°C until experimental usage. To accelerate or to delay embryonic development, embryos were incubated at 33°C or at 18°C. Embryos were staged according to Kimmel et al., 1995, whereby morphological features like the numbers of somites and time of development at 28.5°C were used for staging. To prevent melanization, embryos required for whole-mount stainings were raised in E3 supplemented with 0.003% PTU at 24 hpf. 4.2.2 Test for the phenotypical complementation of mutations Carriers homozygous for the point mutated spge713 and the spge68 alleles, respectively, were tested for phenotypical complementation of their respective mutations with carriers for the insertional hi349 allele (Burgess et al, 2002). Thereby, fish carrying the point mutated alleles were mated to fish carrying the insertional allele and the offspring was examined for their phenotype. Embryos obtained from these matings showed the spg mutant phenotype in a correct mendelian distribution. Therefore, the insertional mutation could not complement the point mutation and vice versa, indicating that the insertional as well as the point mutation are affecting the same gene (intragenic non-complementation) or, alternatively, the same developmental pathway (intergenic non-complementation). 4.2.3 Radiation Hybrid (RH) mapping for the fgfr3 coding region I allocated fgfr3 to a distinct linkage group, because I considered it as a candidate for spg (LG 21) previous to its molecular identification, since Zspg were insensitive to Fgf(8), which likely signals via Fgfr3. RH mapping is one among other PCR-based mapping techniques to link an already known genetic locus or coding region to a particular genetic linkage group (or chromosome) and has been described previously (Ekker et al., 1996; Hukriede et al., 1999; Geisler et al., 1999). PCR analysis was performed on the Ekker mapping panel containing zebrafish/hamster somatic cell hybrids, allowing assignment of cloned genes (i.e. fgfr3) to specific chromosomes or chromosome regions. Briefly, PCR results are translated into a binary code and are evaluated, allocating the gene of interest to a particular linkage group. I could allocate the fgfr3 gene to linkage group 8. This result was verified later by Sleptsova-Friedrich et al., 2001.
4.2.4 DNA and RNA preparation 4.2.4.1 Plasmid DNA
Plasmids were transformed by the heat shock method into E. coli and amplified by the propagation of their bacterial hosts (after bacterial inoculation of 50 ml LB-Amp medium) at 37°C o/n. Plasmid DNA was isolated and purified with the QIAGEN-tip 100 (midi preps) or QIAprep Spin Kits (mini preps) according to manufacturers protocols. Plasmid DNA for zygotic injection and transgenesis was isolated and purified with the QIAGEN EndoFree Plasmid Maxi Kit (all Kits QIAGEN) according to manufacturers protocols. Materials and Methods 98 - 4.2.4.2 DNA extraction
After gel electrophoresis and staining with ethdiumbromide and, casually, after digestion with restriction enzymes, DNA bands, previously excised with a rasor blade from the gel, or the DNA restriction digest, respectively, were subjected to a QIAEX-II-Gel extraction kit (Qiagen) or minicolumns (Qiagen) according to the manufacturer’s protocol.
4.2.4.3 Generation of cDNA via previous isolation of Total RNA or poly(A)-enriched mRNAs
Homogenization of biological material: living embryos (casually freezed in liquid nitrogen and stored at –70°C before isolation of nucleic acid) were homogenized by expelling them repeatedly through a 22G hypodermic needle attached to a 5 ml syringe (Braun) or by the aid of an Eppendorf-pistill with the TRIZOL reagent (GIBCO BRL) according to the manufacturer’s protocol.
Isolation of Total RNA: homogenized embryos were subsequently subjetcted to the TRIZOL µ protocol according to the manufacturer. The RNA pellet was dissolved in 10 l DEPC-H2O and concentration was measured spectrophotometrically (for example, 1-3 µg/µl RNA can be obtained from 100 embryos at 1dpf). For the generation of cDNA, Total RNA was subsequently subjected to reverse transcription and the remaining RNA was stored at –70°C.
Generation of cDNA by reverse transcription: for the 20 µl final volume-transcriptase reaction (SuperscriptII kit from Stragagene), 3 µg of Total RNA is first mixed with 1 µl oligo d(T) primer (or, alternatively, with 1 µgl random primer or 20 pmol gene specific primer), adjusted µ ° to 12 l with DEPC-H2O, denaturated at 70 C for 10 min and put immediately on ice to prevent renaturation of the nucleic acids. Subsequently, 4 µl 5 x 1st Strand Buffer + 2 µl 0.1M DTT + 1 µl 10mM dNTPmix is added and incubated at 42°C for 2 min. Finally, 1 µl SuperscriptII reverse transcriptase is added for a 50 min incubation at 42°C. Enzymatic activity is deactivated hereafter at 70°C for 15 min. Subsequently, 2-5 µl of the cDNA containing reaction are subjected to amplification by PCR and remaining cDNA solution is stored at -70°C.
Isolation of genomic DNA: tissue or embryos are digested at 55°C at least for 3 hrs or o/n (optional: vortexed inbetween for 10min) in 40ul Lysis Buffer containing Proteinase K (200mg/ml f.c.). Specimen were zentrifuged for 5 min and the supernatant was diluted 1:50 in ° H2O and stored at –20 C. 4.2.5 Identification of homozygous spghi349 mutant carriers by genotype-specific PCR Genomic DNA was isolated (as described above) from tail biopsy from the adult carrier fish (which were immobilized by MESAB-mediated transient anaesthetization). Potentially rescued adult carrier fish have resulted from pou2-mRNA injected embryo clutches obtained by matings of heterozygous spghi349 mutant carriers. Linkage of the proviral integration to the mutant genotype was established using genotype-specific PCR (10ul f.v.) which was performed using 1ul of an 1:50 diluted, genomic DNA solution and the primer 5`ACGTCTTCTTTTAAGGAGACTCTGACTA3`, 5`ACTCACATCCTGAGGGTTCTG3` and 5`CGTGTATCCAATAAACCCTCTTGC3`. These primers differentiated between homozygous wild type, heterozygous and homozygous for the proviral locus. 4.2.6 Genetic mapping of the spg locus to the pou2 locus Verification of the genetic linkage of the spge713 locus to the pou2 locus was done by a PCR- based mapping method using genomic DNA (Knapik et al., 1996) which showed co-segregation of the spg phenotype with the SSR (simple sequence repeat) marker z13467. The mapping Materials and Methods 99 - marker serves as a PCR primer pair: z13467-F: 5’-CACAGCACCTATGCATTGCT-3’; z13467-R: 5’-CAGACAGCAACCGAGTCTGA-3’. PCR amplification products were segregated on a 2% agarose gel. For PCR, wild-type and spge713 genomic DNA of haploid embryos was used. Haploid embryos were generated under the supervision and help of Christiane Klisa as previously described (Westerfield 1994) . 4.2.7 Sequencing of mutant cDNA cDNA from homozygous mutant spg and control wild type sibling embryos were used to amplify the coding region and parts of the 5’ an 3’ UTR of mutant spg alleles by PCR. Forward primer: 5’-CGGAATTCGGACTGCGCACATTTCCACACAGGC-3’ (5’ with EcoRI site); Reverse primer: 5’-CGCAAACGTGTACTTCAGTATCCGAGGAGCTCGCC-3’ (3’ with XhoI site). PCR Amplification products obtained by three independent PCR reactions were subcloned into the pBS vector via EcoRI/XhoI and sequenced from both strands. Sequence alignment and comparison was carried out with the Mac Vector 7.0 program. Surprisingly, spgm216, spge713 and spge728 showed the same base change causing a Lys-to-Pro exchange in the POU-specific domain. The result was reproduced multiple times. Both mutations were induced in different genetic backgrounds in different laboratories, but ultimately derive from a common Oregon AB background. We recovered spge713 from a mutagenized strain that was genetically marked with the pigment mutation golden; moreover, spge713 was initially linked to a second, unrelated mutation that was induced on the same chromosome and which we subsequently removed by recombination. The same base change in pou2 was found on the chromosomes before and after the recombination event. We therefore think it unlikely that spge713 is due to contamination of our golden stock that was used in the mutagenesis. Because the two mutations carry the same molecular change, the mutation may have been present as a polymorphism in the AB wild-type population that was mutagenized; spge713 and spgm216 would then be re-isolates of a background mutation that was present in the original AB wild-type population at a low frequency. Alternatively, a mutation in this position could generate a particulary strong, and hence easily detected, phenotype (Favor et al. 1996). Until this issue is resolved, we will treat the two mutations as separate alleles. 4.2.8 Cloning of murine Oct4 (Pou5F1) and Osteopontin (Opn) cDNA From murine embryonic Total RNA (stages E8.0-10.5), cDNA was created, and full length murine Oct4 and Opn was amplified by PCR and cloned into the pBS vector and the pCS2+ vector suitable for ISH probe generation and mRNA injection, respectively. Oct3/4 PCR forward primer: 5’-CTGGACACCTGGCTTCAGACTTCG-3’; Oct3/4 PCR reverse primer: 5’-CAACAGCATCACTGAGCTTCTTTCC-3’. Opn PCR forward primer: 5’-CGGAATTCCAGGCATTCTCGGAGGAAACCAGCCAAG-3’; Opn PCR reverse primer: 5’-CCGCTCGAGCCTCTTCTTTAGTTGACCTCAGAAG-3’. 4.2.9 Dissection of mouse embryos and whole mount in situ hybridization (ISH) Pregnant mice were killed and embryos were dissected out of the uterus in ice-cold PBST supplemented with Calciumchlorid and fixed in ice cold 4% PFA. Whole mount ISH was carried out with the help of Muriel Rhinn.
4.2.10 Analysis of gene expression by whole mount ISH of zebrafish embryos Embryos at the required stage of development are fixed with ice cold 4% PFA and kept at 4°C over night or 6 hrs at room temperature. After fixation, embryos are washed briefly with PBST and transferred for at least 30 min to 100% methanol in a 500 µl Eppendorf tube (can be stored for months at –20°C), rehydrated for 5 minutes in 50% methanol/PBST at RT, washed 2 x 5 minutes in PBST, postfixed in 4% PFA for 20 minutes at RT and washed 2 x 5 minutes in PBST at RT. For permeabilization, embryos older than tailbud stage are digested with Proteinase K Materials and Methods 100 - (10 µg/ml f.c. in PBST) for 1 min (tb stage – early somitogenesis), 2 min (somitogenesis stages) or 3 minutes (pharyngula stages) at RT, washed in 2 mg/ml glycine in PBST 2 x 5 minutes at RT to hamper Proteinase K activity and refixed in 4% PFA for 30 min at RT. Embryos are washed 3 x 5 minutes in PBST at RT. Embryos are then transferred into Hyb+ solution for at least 2 hrs at 68°C on a shaker (all subsequent steps on a shaker at 68°C). After prehybridization, Hyb+ solution is replaced with the prewarmed RNA-ISH probe in Hyb+, and embryos are hybridised with the ISH probe o/n. After hybridization the probe is taken off, embryos are washed 1 x 5 minutes in Hyb-, 3 x 10 min in 25% Hyb- in 2 x SSCT, 1 x 5 min in 2 x SSCT and 2 x 30 minutes in 0.2 x SSCT (all washing steps with prewarmed solutions). Subsequent steps are carried out on a shaker at RT. Embryos are washed 1 x 5 minutes in 50% 0.2 x SSCT/50% MABT and once 5 min in MABT, blocked for 1 hr in MABT + 2% DIG block and incubated for 4 hrs at RT (or over night at 4°C) with α-DIG-AP solution (Roche Diagnostics; 1:4.000 dilution in MABT + 2% DIG block). After removal of α-DIG-AP (can be stored in 0.01% Natriumazid at 4°C and reused several times), embryos are 1 x rinsed and 4 x washed for 15 min at RT in MABT and transferred into 24-well plates for detection with BM Purple substrate (Roche Diagnostics). Reaction is stopped by repeated washing in PBST and samples are fixed in 4% PFA for 20 min at RT. For photography, embryos are cleared in 70% glycerol/PBS for flat mounts after elimination of the yolk or in 100% glycerol for whole mounts. For double ISH, embryos were hybridized with a probe mix (DIG-labelled and Fluorescein-labelled RNA-probes) and processed identically as described above. After washing the embryos 2 x 10 min in PBST, alkaline phosphatase is heat inactivated for 4 hrs at 68°C on a shaker and embryos are washed 1 x 5 min in MABT, blocked 1 hr in MABT + 2% DIG block and incubated o/n at 4°C in freshly diluted in α-fluorescein-AP (1:1,000 dilution in MABT + 2% DIG block; Roche Diagnostics). After removal of α-fluorescein-AP (cannot be reused), embryos are rinsed and washed 4 x for 15 min at RT in MABT, 1 x 15 min in 0.1 M Tris/HCl pH 8.2 and transferred into 24-well plates for detection with freshly prepared Fast Red substrate solution (Roche Diagnostics). Stainings were developed to the desired intensity in the dark, stopped with several PBST washes and finally cleared in 70% glycerol in PBS.
Hyb+: 50% deionized formamid; 5x SSC pH 6; 0.5 mg/ml torula (yeast) RNA (GIBCO BRL); 50 µg/ml heparin
Hyb-: 50% deionized formamid; 5x SSC pH 6; 0.1% Tween-20
20x SSC: 175.3 g NaCl; 88.2g Sodium citrate to 800 ml H2O, adjusted to pH 6 with 1M citric acid and adjusted volume to 1,000 ml
SSCT: SSC + 0.01% Tween-20 MAB: 100 mM maleic acid; 150 mM NaCl adjusted to pH 7.5 with NaOH and steril-filtered (Millipore Express 0.2 µm)
MABT: MAB + 0.01% Tween-20
DIG block: 2% blocking reagent (Roche diagnostics) dissolved in MABT
All solutions for RNA-ISH were filter-sterilized with either Millipore Express 0.22 µm (Millipore) or 0.45 µm syringe filters (Roth). 4.2.11 Generation of antisense RNA ISH probes 4.2.11.1 Generation of the DNA template
Typically, 7 µg of plasmid DNA is digested with a restriction enzyme to produce a linearized template with 4 µl of restriction enzyme in a final volume of 80 µl for at least 3hrs at 37°C. Materials and Methods 101 - After successive extractions with 1 x (v/v) Phenol and Chloroform the DNA was precipitated with 2.5 x (v/v) 100% ethanol + 0.1 x (v/v) 3M Natrium acetate solution (pH5.2) for at least 3 hrs at –20°C. Precipitated DNA was pelleted by 30 min zentrifugation at 13.000 rpm and was thereafter washed once with 70% ethanol, dried and dissolved in 12 µl sterile water. 1 µl is controlled on a 0.8% agarose gel for quality and concentration; the latter is also measuered with a spectrophotometer.
4.2.11.2 Transcription of the antisense RNA probe
1 µg of this template DNA is mixed with 2 µl NTP mix, 2 µl transcription buffer (all Roche Diagnostics) and 1 µl RNase inhibitor (MBI Fermentas), the volume is adjusted to 18 µl with sterile water and the reaction started with 2 µl RNA polymerase. After 2-3 hrs of incubation at 37°C, 2 µl 0.2 M EDTA pH 8, 2.5 µl 4 M LiCl and 75 µl 100% ethanol are added, shaked vigorously and incubated at least 2hrs at –20°C to precipitate the RNA, which is pelleted by 30 min centrifugation at 13,000 rpm at 4°C in a standard benchtop centrifuge. The RNA pellet is dissolved in 30 µl sterile, DEPC-containing water (0.004% f.c.), quality-controlled on a 1% agarose gel, adjusted to 300 µl Hyb+ solution and stored as a stock ISH probe at –20°C. Typically, stock probes are used for ISH hybridization in a 1:100 dilution in Hyb+, stored at –20°C and are re-used for several times. 4.2.12 Generation of poly(A) mRNA for injection For in vitro mRNA transcription, cDNAs were cloned into pCS2+ plasmids (Rupp et al. 1994) and linearized by enzymatic digestion as described for ISH probes (plasmid DNA was linearized at the 3´-end of the inserted cDNA). RNA was transcribed from the linearized plasmid using the SP6 message mMachine kit (Ambion) by restriction enzyme digestion. After extraction and precipitation of the DNA (as described above), the dried DNA pellet was dissolved in 12 µl sterile H2O. 1 µg of linearized plasmid was used for sense-mRNA transcription with the SP6 mMESSAGE mMACHINE™ Kit (Ambion) and precipitated according to manufacturers protocol. Pelleted mRNA was dissolved in 12 µl sterile H2O. Quality and concentration were determined by running on a 1% agarose gel or with a spectophotometer, respectively. Aliquots of the RNA were stored at -20°C until usage for injection. The injection solution, freshly prepared from -20°C RNA stocks immediately before injection, contained 0.25M KCl and 0.2% Phenolred. 4.2.13 Generation of morpholinos for injection Morpholinos were designed to be complementary in terms of their sequence to the region of translation initiation and were synthesized by Gene-Tools, LLC (Corvallis, OR). The sequence of the anti-pou2 morpholino-1 is 5’-CGCTCTCTCCGTCATCTTTCCGCTA-3’ (underlined bases were exchanged to generate the 4-bp mismatch control morpholino, Mo1-ctrl), the morpholino-2 is 5’-TTCAAACAAGAAAGCGTAAAGACTG-3’. The sequence of the control morpholino is 5’-CCTCTTACCTCAGTTACAATTTATA-3’. 4.2.14 Generation of DNA for injection All vector sequences were removed by restriction enzyme digestion from plasmid DNA for zygotic injection. The DNA-fragment to be injected is purified by standard agarose gel electrophoresis. The fragment was recovered and purified by QIAEX-II-Gel Extraction method for injection. 4.2.15 Injection of messenger RNA (mRNA), morpholinos, DNA and vital dyes 4.2.15.1 Preparation of injection capillaries
Thinwall borosilicate glass capillaries with an internal filament, which allows backfilling (OD = 1.0mm, WPI TW100F-3) were pulled with a Flaming/Brown Puller (P-87, Sutter Instrument) to a desired shape and tip diameter. Before filling, the tips were broken off the pipettes. RNA solution was backloaded into the injection capillary. Materials and Methods 102 - 4.2.15.2 Embryo preparation
For injection experiments embryos were harvested into petri dishes at the 1-cell stage in E3 medium directly after spawning. For chemical dechorionation, embryos were incubated in E3 medium containing Pronase (Sigma; 1mg/ml f.c.) until the first embryos were falling out of their chorions. Subsequently, Pronase treated embryos were washed twice with E3 medium. Casually, embryos were dechorionated manually using Dumont watchmaker forceps. After dechorionation, embryos were subsequently transferred with a fire-polished glass pasteur pipette into a agarose-coated injection-petridish (2% agarose in E3) covered with E3 medium. This petri dish contained depressions created by a custom made mold. to hold the embryos. 4.2.15.3 Injection
All injections were done with a pneumatic pico pump, a mechnical micromanipulator and standard pipette holders. The maximum injection pressure was 20 psi. Injection volume was regulated via the pulse duration. The amount of mRNA injected was estimated from the concentration and volume of a sphere of RNA solution injected into oil at the same pressure settings. Frequently, to transiently delay development during injection period in order to expand the time available for the injection procedure, injections were carried out at 20°C. Injection of mRNAs or plasmid-derived DNAs (Luciferases assay) was performed at the 1-cell stage into the cytoplasm. In case a comparison of an injected with an uninjected half side within the same embryo was appreciated, mRNA was injected into 1 blastomere at the 2-cell stage. Morpholinos and dyes like tetramethyl-rhodamine-dextran (2,000K, Molecular Probes D-7139; 35 µg/µl) were injected either into the blastomere at the 1-cell stage or into the yolk (without previous dechorionaten of the embryos), which allows injection up to the 32-cell stage, since small molecular components are readily distributed from the yolk into the overlying blastomeres until this stage. After injection, dechorionated embryos were transferred with a glass pipette into a new, agarose-covered petridish (alternatively, embryos with intact chorions could be transferred with a plastic pipette into a petri dish without an agarose-layer) and further developed at 28°C.
4.2.16 Analysis of protein expression by antibody staining Staining for Antibodies raised against acetylated tubulin:
This was performed according to the following protocol: Embryos are fixed 3 hours at RT in 2% trichloric acid (TCA), washed 3x5 minutes in PBS (prepared from tablets, Sigma) and stored up to 1 week at 4°C. Then, embryos are washed 3x5 minutes in PBSTw. For permeabilisation, embryos can be digested at this step with approx. icecold 0.005% trypsin in PBS for approx. 5 minutes on ice (digestion conditions must be optimized for every new batch of trypsin. Best results have been obtained by preparation of the tissue without enzymatic digestion). After trypsinisation, embryos are washed 5 x 5 minutes in PBSTw and postfixed in 2% TCA for 10 minutes at RT (can be omitted if no trypsinisation). Then, embryos are blocked with 10% normal goat serum (NGS) in PBSTx for at least 1 hour at RT, and incubated in primary antibody over night at 4°C (anti-acetylated Tubulin antibody 1:500, (mouse monoclonal; Sigma) in 1% NGS-PBSTx on a shaker. After removal of the primary antibody
(can be stored in 0.01% NaN3 at 4°C and reused several times) embryos are washed 2 x 5 minutes and then 4x30 minutes in PBSTw. Incubation with the secondary antibodies is done over night in 1% NGS-PBSTx on a shaker (anti-mouse-HRP antibody conjugate 1:200; SIGMA F-9887). After removal of the secondary antibody, embryos are washed 2x5 minutes and then 4x30 minutes in PBSTw. Prolonged washing reduces the unspecific fluorescent background. PBSTw: PBS + 0.1% Tween 20 PBSTx: PBS + 0.8% Triton X 100
Staining for anti-βgal antibodies: Nuclear lacZ mRNA is generally co-injected as a lineage tracer. Mouse-anti-βgal antibody is added to anti-DIG-AP antibody solution and incubated on at 4°C. After the appearance of the Materials and Methods 103 - ISH signal the sample is washed 4x15 min with PBST and incubated with the secondary antibody (goat-anti-mouse-HRP), diluted in 1:200 in PBST+2% normal goat serum (NGS)+2mg/ml BSA for 4 hrs at RT or o/n at 4°C. After incubation the sample is washed 4x15 min with PBST and the antibody is detected with the DAB system according to the manufacturers instruction (Sigma tablets D-4168). The reaction is stopped by several washes with PBST, and the sample is processed for documentation as described for ISH stainings. 4.2.17 Staining with vital dyes and microscopy of living embryo 4.2.17.1 Staining with Bodipy
Morphology of live embryos between the shield stage and the 20-somite stage was monitored by staining with the green vital dye Bodipy FL-Ceramide (Molecular Probes D-3521). For this, embryos were incubated at 28°C in 100µM Bodipy FL-Ceramide in E3 medium for 45-60 minutes depending on the developmental stage. Bodipy FL-Ceramide is best at stages between 50% and 100% epiboly. Stained living embryos were subjected to confocal microscopy for morphological inspection. 4.2.17.2 Staining with Acridine Orange
AO, 2µg/ml, Molecular Probes, was added into the medium for 4 hours to dechorionated embryos and photographed after washes in E3 medium. Fluorescence was monitored microscopically with a FITC filter set (Hoechst). 4.2.18 Histochemistry Embryos for histological sections were embedded in epoxide resin, sectioned with a microtome (1µm sections) and stained with methylene blue-toluidine blue and mounted as described in Kuwada et al. 1990). Photographic documentation of the brain morphology was done with the help of a Zeiss axiophot microscope. 4.2.19 Implantation of beads coated with Fgf8 protein Bead implantation was done after Reifers et al. 2000). Beads coated with recombinant mouse Fgf8b or PBS control beads were implanted at indicated regions of living wild type and spg mutant embryos at the 13 somite stage, embryos were fixed at 26hpf. For implantation, embryos were embedded into agarose and locally opened by oil drop application. The protein-coated beads were applied to the embedded embryos as a small volume of suspension. Implantation was done with a blunt tungsten needle (tip diameter 30-50 µm) through the opening in the epidermis. Coating procedure: Heparin-coated beads (SIGMA Nr. H-5263) are size selected through a nylon membrane (exclusion size 60 µm, Millipore NY 60 04 700) by transfering 600 µl bead supension into a cut off 1.5 ml tube with a nylon membrane attached to the bottom, which is put into a 15 ml falcon tube and spun briefly at 500 rpm. The flow-through (size-selected beads) was transfered to a new 1.5 ml tube and 100% ethanol is added to 1 ml. The mix is washed on a shaker at RT for 20 minutes and the beads subsequently pelleted by short centrifugation. The pellet is washed in PBS by vortexing and spinning 5 minutes at max. speed (repeat once). Finally, the supernatant is removed, the bead pellet dried briefly at RT and then mixed with 5 µl FGF8 protein (1 µg/ml) and 15 µl PBS and incubated for coating for 2 hours at RT (final concentration: 0.25 µg/ml FGF8 in PBS). The bead supsension can be stored for several weeks at 4°C without loss of activity. 4.2.20 Transplantation and detection of single cells
Transplantation of cells: Zygotes of wild-type embryos were fluorescently labelled by injection of 10% HRP-coupled tetramethylrhodaminedextran (=biotin-coupled, 10,000MW, Molecular Probes D-1817; in 0.25M KCl) in order to serve as donors and were raised together with unlabelled host embryos. The grafts were performed in E3 or Ringer medium using thinwall borosilicate glass pipettes with an internal filament (OD=1.0 mm, WPI TW100-3), Materials and Methods 104 - which were pulled as described above in agarose-coated petridishes using an air-filled assembly consisting of a pipette, the pipette holder mounted on the manipulator, which was attached to PE-tubing and a 1ml syringe to control the graft. By this, single cells or groups of cells were sucked from the donor and deposited into distinct locations of the host embryo. Transplanted cells were visualized after ISH by staining for the injected biotin-coupled dye combining the Vectastain ABC system and the DAB system (see below). Fluorescence was documented microscopically with a Texas Red filter set (Hoechst).
Detection of transplanted cells: Chimaeric zebrafish embryos, which are produced by transplantation of biotin-labelled cells or tissue, are stained after ISH using the Vectastain ABC- Kit (Vector Laboratories) as follows: after washing 3 x10 minutes in PBST, embryos are incubated 45 min at RT in diluted AB complex (8 µl A + 8 µl B in 1 ml PBST, prepared 30 minutes in advance) without shaking. After washing for 5 min, 10 min and 15 min in PBST, embryos are once rinsed in 100 mM Tris/HCl pH 7.4 and transferred to 24-well plates. The staining reaction is peformed with DAB-Tablets according to manufacturers condidtions (SIGMA). Embryos are washed several times with PBST after the staining reaction.
4.2.21 RGC axon front filling For RGC axon front filling, larvae were fixed on day 6 in 4% PFA in PBS at 4°C over night, embedded in 2% LMP agarose in PBS (GIBCO BRL) on slides and labelled by inserting glass needles covered with either molten DiI or DiO (Molecular Probes D-282, D-275) into the retina. After storage o/n at room temperature in a dark and moist chamber, larval brains were dissected and further processed for microscopy. The procedure was carried out with the help of Alexander Picker.
4.2.22 Inhibiton of Fgf signaling For pharmacological inhibition of the Fgf signaling, wild type and spg embryos were incubated with the chemical inhibitor SU5402 which blocks activity of all Fgf receptors (Calbiochem No. 572630; Mohammadi et al. 1997). The inhibitor was applied at 20µM into E3 medium at 28°C in the dark and embryos were incubated from end of gastrulation until fixation at the 8 somite stage. SU5402 was stored in a light-protected box as a 8mM stock in DMSO at –20°C. Control experiments with DMSO dilution without the inhibitor had no effect (not shown). For a positive control estimating the efficiency of the inhibitor treatment, an aliquot of treated embryos was analyzed for spry4 expression: efficiently inhibited embryos do not show any spry4 expression after 30 min of treatment.
4.2.23 Dual-Luciferase Reporter Assay (DLRA) Preparation of DNA-reporter fragments: The sox17 promotor-containing pGL3 plasmid (Y. Kikuchi, unpublished) and the control pCS2+ Rluc plasmid were transformed and amplified into E. coli and purified by an endotoxin eliminating method noted above. The sox17 promotor-containing pGL3 plasmid was cut with SalI, the control pCS2+ Rluc plasmid was cut with SalI+Not and both DNA fragments were purified from gel and controlled by a 0.8% agarose gel and photospectrometric measurement. Co-injection of reporter constructs into MZspg mutant embryos at the 1-cell stage: DNA fragments of 50pg sox17 promotor-firefly luciferase and 2pg of CMV-Renilla luciferase (as an internal control) were a) co-injected, b) co-injected with 3pg cas mRNA, c) co-injected with 3pg cas mRNA + 30pg pou2 mRNA. Homogenization of injected MZspg embryos: Injected embryos were allowed to develop until shield stage. Of each particular injection type (a, b, c), 8 x 10 embryos were pooled, rinsed with distilled water and freed from liquid as good as possible. In the following, reagents from the DLRA kit (Promega) were used. 200 µl Passive Materials and Methods 105 - Lysis Buffer were add to each pool of 10 embryos which were completely homogenized with the aid of an Eppedorf pistil and incubated for 15 min at RT. Homogenized embryos were vortexed and centrifuged at 13.000 rpm for 5 min, the supernatant was transferred into a new tube, freezed in liquid nitrogen and stored at -70°C.
Luminometric measurement of Luciferase activities: 8 samples (each sample containing Luciferase activity of 10 embryos) of each type of injection (a, b, c) were measured. 20 µl of each supernatant was measured according to the manufacturers protocol (Promega). The luciferase activity of the firefly (Photinus pyralis) and of the sea pansy (Renilla reniformis) were measured sequentially from a single sample and displayed as “Relative Light Units” (RLU). 106 5 Appendix
In the main part of my thesis, I described the role of pou2/spg in neuroectodermal and endodermal development. Here, two additional phenotypes of MZspg mutant embryos are briefly described. Analyses to understand further aspects of early pou2 function affiliated with these phenotypes are in progress. 5.1 MZspg embryos reveal new functions of pou2 in dorso- ventral (DV) patterning
5.1.1 Establishment of axes in the early embryo The earliest asymmetries in ontogenetic development occur already during oocyte stages, and in both invertebrates and vertebrates, the deposition of maternal mRNAs to the unfertilized egg is a common mechanism used to initiate developmental processes like axis formation. In particular, different mRNA localization patterns have been found in the zebrafish oocyte which establish an animal-vegetal axis during oogenesis (Howley and Ho 2000). During embryonic development, the embryo of early cleavage and blastula stages becomes furthermore patterned along a dorso-ventral (DV) axis, and continues patterning along an anterior-posterior (AP) axis with the onset of gastrulation. The DV axis becomes first morphologically visible at late blastula stages, however, lithium, UV- and cold shock experiments suggest that the DV axis is likely determined already prior to the onset of zygotic transcription at the phase of mid-blastula transition (Schmitz and Nagel 1995; Stachel et al. 1993; Strähle and Jesuthasan 1993; Jesuthasan et al. 1997). During blastula stages, a specialized group of cells at the dorsal blastodermal margin becomes induced by the underlying YSL (the presumed functional equivalent of the Nieuwkoop center in Amphibians) by maternal factors previously deposited into the egg (reviewed by Hibi et al. 2002). This region is morphologically reflected by the formation of the dorsal shield in the zebrafish, which is functionally equivalent to the Spemann-Mangold organizer, which governs the establishment of the three germlayers (Spemann 1938). In particular, the organizer establishes a coarse DV axis through interactions between secreted, ventrally expressed BMPs (members of the TGFβ superfamiliy) with their dorsal antagonists Chordin, Noggin and Follistatin (Furthauer et al. 1999). The establishment of BMP gradient(s) plays a crucial role in DV patterning. In a first, maternally controlled phase involving the TGFβ molecule Radar, a ventral identity is set up by bmp activation during early embryonic (blastula) Appendix 107 - development, where the embryo is predominantly ventrally specified, except a very dorsal portion, where the Spemann organizer is induced (Sidi et al. 2003). In a second phase, BMP antagonists emanating from the organizer like Chordin and Noggin directly diminish BMP at the dorsal side by binding to and preventing BMPs from activating their cognate receptors (review: De Robertis et al. 2000). In addition, maternal Wnt signal(s) contribute to the dorsal identity of the early embryo by feeding into the canonical Wnt pathway and activating transcriptional targets like bozozok, which in turn represses transcription of bmps. Mutant analysis has shown that zygotic dorsal and ventral determinants are crucial to keep DV polarity in a distinct equilibrium (review: Hammerschmidt and Mullins 2002). Genetic evidence for this model comes from zebrafish mutants lacking activity of Bmp7 (snh), Bmp2b (swrl) or Smad5 (sbn), which fail to develop ventral tissues due to the dorsalization of the embryo (Mullins et al. 1996; Kishimoto et al. 1997; Dick et al. 2000). On the other hand, dorsal identity is lost in ventralized embryos mutated in chd (dino) or sizzled (ogon/mercedes) (Hammerschmidt et al. 1996; Yabe et al. 2003).
5.1.2 pou2 is necessary for early dorso-ventral (DV) patterning In addition to the failure of endoderm formation, phenotypical analysis of MZ spg embryos also revealed severe defects in DV patterning. One hallmark of the MZspg mutant phenotype is an extreme dorsalization after completion of gastrulation, which is reminiscent of bmp mutants like snh or swrl. This is illustrated by ISH analysis of neuroectodermal (krox20) and mesodermal markers highlighting the somites (myoD) or the notochord (ntl) (Figure 24A-E), showing a ventrally fused hindbrain-primordium (B), ventrally displaced somites (E), and a partially split notochord (C). The ventral displacement of somitic muscle progenitors likely reflects a ventral shift of BMP concentration: the ventral side, with the highest BMP concentration in the wild-type might be replaced by a reduced BMP concentration in MZspg mutants, leading to somite formation on ectopic, ventral locations of the embryo. Appendix 108 -
FIGURE 26 MZspg embryos appear strongly dorsalized. (A-C) Double ISH for ntl and krox20 at the tailbud-stage. (A) ntl and krox20 (red arrows) are expressed in the wild-type in the notochord and the hindbrain, respectively. (B) In MZspg krox20 (red arrow) is tremendously displaced to the ventral side, and expression is strongly downregulated. Anterior-most ntl expression is indicated by the white arrowhead (C) The ntl domain appears bifurcated and displaced to the ventral side. (D,E) Double ISH for myoD and pax2.1 at the 7-som stage. (D) myoD is expressed in the somites and in adaxial mesodermal cells of the wild-type embryo. pax2.1 marks the pronephros and the otic placodes (o.p.), whereas MHB expression is obscured in this dorsal view. (E) MZspg mutants display strong dorsalization (or ventral displacement) of the somites and the pronephros (white arrows).
In order to examine whether the severe disorganization of the body axis is preceded by an altered positional information affecting early DV patterning, I performed ISH analysis with markers expressed in a DV specific manner from blastula stages onwards. At the oblong-sphere stage, living MZspg mutant embryos are not yet morphologically distinguishable from wild-type embryos. However, ISH analysis revealed that dorsal expression of nog1, encoding the secreted factor Noggin1, is initiated precociously at the oblong-sphere stage, and its expression is stronger and expanded to the ventral side in MZspg embryos as compared to the wild-type (Figure 25A’ inset), which initiates nog1 slightly later and very faint, at sphere-dome stage at the dorsal side of the embryo. Ventro-lateral expansion of nog1 expression continues during blastula stages (Figure 27A-B’). Expression of an other BMP antagonist, chordin (chd), starts between sphere- and dome stage. Initiation appears normal in MZspg embryos (Figure 27C,C’). However, at dome stage-30%E epiboly, chd starts to be extremely expanded to the ventro-lateral side of the embryo (Figure 27D-E’). A similar expansion is also observed in MZspg embryos for gsc from 30% epiboly onwards, which is normally expressed at the dorsal side of the blastula embryo (Figure 27F-G’, and not shown). However, ectopic expansion of gsc is restricted to the germ ring. At approximately the same time when dorsal markers start to expand to the ventral side, Appendix 109 - expression of ventral markers are suppressed. bmp genes like bmp2/4/7 are normally activated at the ventro-lateral side of the blastula embryo (Figure 25H, and not shown). MZspg embryos show a strong reduction (bmp2/7) or complete loss (bmp4) around 30% epiboly (Figure 27H’, and not shown). As a consequence, ventrally expressed, immediate bmp effectors like the homeobox genes vent and vox, which normally repress dorsal genes like chd and gsc (Imai et al. 2001), are repressed during blastula and gastrula stages, similar to the ventral marker eve1 (Figure 27I-K’; and not shown). Interestingly, repression of vox and vent is already seen at blastula stages, when their expression is independent of bmp, which first becomes dependent at midgastrula stages (Figure 27I’,J’). Therefore, the failure to establish proper ventral identity can not be simply attributed to the reduction/loss of bmp and its effectors. In addition to organizer- derived secreted factors, Fgf signaling also modulates BMP activity by suppression at the transcriptional level (M. Fürthauer, pers. comm.). However, overactivated or ectopically expanded expression of fgfs is not observed in MZspg embryos, suggesting that the observed transcriptional repression of bmps does not involve Fgf signaling. Otherwise, indirect transcriptional repression of bmps has been reported in Xenopus and mouse, where repression of BMPs at the protein level causes breakdown of a bmp- autoregulatory loop at the transcriptional level (Ghosh-Choudhury et al. 2001; von Bubnoff and Cho 2001). Despite a strong dorsalization of blastula and early gastrula embryos, some dorsal characteristics appear intact, since axial dorsal morphology like the shield, or expression of the organizer-dependent marker boz is not altered in MZspg embryos (not shown). However, from early gastrulation onwards, dorso-axial mesodermal markers like nog, ntl or foxA2 are dorsalized (Figure 27L,L’, and not shown). Data obtained from blastula and early gastrula stages are summarized in Figure 25M. Appendix 110 -
FIGURE 27 Gene expression in MZspg embryos at blastula stages. If not noted otherwise, embryos are depicted in animal views, dorsal to the right. Dorsal markers like (A- B’) nog, (C-E’) chd, (F-G’) gsc are ectopically expanded to the ventral side from blastula stages onwards. nog is the first marker which is pre-early initiated and ventrally expanded at the sphere-dome stage (A’), small inset. Concomitantly, ventral markers are strongly reduced from blastula stages onwards (H-L’). During gastrulation, dorsal axial markers like nog (L) are ventrally expanded in reduced in its AP extension (L’). (M) A summary of the dorsalization events in MZspg embryos at blastula and gastrula stages.
In summary, these results indicate that maternal pou2 is required in the embryo for early DV patterning. Since bmp2 is activated normally, and nog appears to be the first marker altered in MZspg embryos, it is likely that pou2 is needed to repress dorsal determinants, rather than to activate ventral markers. However, pou2 might also act in the activation of ventral markers. Furthermore, the dorsalizing effect observed in absence of functional pou2 can be strictly attributed to the maternal pou2 function for several reasons: (i) Mspg embryos display early marker expression identically to MZspg embryos until the beginning of gastrulation, when zygotic pou2 expression starts to provide the embryo with functional Pou2. (ii) Mspg mutants with high penetrance of the mutation display a significant dorsalization phenotype reminiscent to dorsalized mutants at later, pharyngula stages (iii) Zspg mutans show no dorsalization at all. It is noteworthy, that pou2 may function in the establishment of DV polarity already in the unfertilized egg: in the wild-type embryo, pou2 transcripts are localized to the future animal pole (Howley and Ho 2000). Since MZspg embryos do not express pou2 Appendix 111 - (Figure 16C), the lack of pou2 transcripts, or any presence of mutant maternal protein, might interfere with early polarization of the egg, and consequently, with the establishment of a proper polarity in the developing embryo. Therefore, it would be interesting to see if the maternal deposition of particular transcripts described so far is affected in unfertilized oocytes derived from homozygous spg females. This early aspect of maternal pou2 function is under current investigation.
5.1.3 Behaviour of cell movements of MZspg mutant cells Positional information controls both cell fates and movements. A coordination of both processes is mediated by BMP activity: During blastula and gastrula development, gradual BMP activity establishes cell fates. In parallel, previous studies revealed that the BMP gradient controls morphogenetic gastrulation movements of convergence- extension (CE) (Mullins et al. 1996; Myers et al. 2002; review: Myers et al. 2002). In these studies, dorsalized swirl (bmp2b) or somitabun (smad5) mutants show impaired convergence and enhanced extension movements, partially mediated by ventrally expanded wnt11 and wnt5a expression domains, which are implicated in CE movements (Heisenberg et al. 2000; Kilian et al. 2003). Conversely, in dino (chd) mutants, extension movements are impaired, and the expression domain of wnt11 is restricted to the dorsal side. In summary, Myers et al. suggest, that highest BMP activity (ventral side of the embryos) specifies ventral regions and inhibits CE movements by downregulation of wnt11, whereas lowest BMP activity (dorsal side of the embryo) leads to high extension, but low convergence, and intermediate BMP activity (lateral regions of the embryo) increase both convergence and extension. For proper comparison of wild-type and MZspg cell behaviour, wild-type and MZspg mutant cells were differently labelled (egfp mRNA or rhodamine dextrane injected), and transplanted together into host embryos at the early shield stage (Figure 28A). To challenge convergence and extension movements, cells were transplanted to lateral or adaxial marginal regions. Wild-type and MZspg cells transplanted into MZspg embryos behave the same and show reduced convergence, similar to the migration behaviour of cells in CE mutants like slb (wnt11) (Figure 28B,C; Heisenberg et al. 2000). Transplanted wild-type and mutant cells stay together in clusters, suggesting that extension of these cells is also impaired. This is in contradiction to the above mentioned BMP studies: MZspg embryos display strong reduction/loss of bmp expression (Figure 27H,H’). According to Myers et al., low/no level of BMP should give rise to pronounced extension movements, as it is typical for the dorsal axis of the wild-type Appendix 112 - (Figure 28D,E). However, extension might be obscured by an additional impairment of epibolic movmement in MZspg embryos (see next part). MZspg cells transplanted into wild-type hosts undergo normal convergence and extension, as wild-type cells do (Figure 28D,E). This also indicates that extension is indeed obscured by epiboly defects in MZspg embryos. Transplantation experiments with Mspg donor cells lead to similar results, however, convergence is impaired due to the dorsalization of these embryos (Figure 28F).
FIGURE 28 Cell movement behaviour of MZspg embryos. Bright-field images of transplanted living embryos where merged with flourescent images taken at the same focal plane, whereby transplanted cells show red (wild-type) or green (MZspg) fluorescence. (A) Embryos depicted in (B-H) were transplanted similarly to the embryo depicted in (A), which is shown in an animal pole view. Wild-type and MZspg mutant cells were co-transplanted (white arrow) into dorso- lateral regions of the germ ring at the early shield stage. The forming shield is indicated by dashed circle. (B-H) Host embryos at the tailbud-stage, anterior is to the top. The dorsal axis is indicated by a dashed line. (B-E) dorsal views, (F-H) lateral views. (B,C) The genotype of the host embryos is indicated. (B-H) MZspg mutant cells are indistinguishable in their migration behaviour from co-transplanted wild-type cells. (B,C) In MZspg mutants, convergence of cells towards the dorsal midline is affected of both MZspg and wild-type transplanted cells. Extension of transplanted cells seems also affected in MZspg embryos. (D,E) Convergence and extension of MZspg and wild-type cells appears normal. (F) Convergence is affected, whereas extension appears normal in Mspg host embryos. (G,H) In MZoep mutant host embryos, which are devoid of a involuting hypoblast, transplanted wild-type and MZspg mutant cells move together, however, movement is impaired to some extent in MZoep embryos. Appendix 113 -
Like the DV patterning defect, and because DV patterning is tightly linked to CE movements, the migration behaviour is also attributable to the maternal disruption of pou2. Moreover, migration behaviour strictly depends on the genotype of the host embryo, but not of the donor cells. This cell non-autonomous behaviour is likely due to a cell non-autonomous function of Wnt11 (Heisenberg et al. 2000). The non- autonomous migration behaviour is also seen upon transplantation into MZoep embryos (Figure 28G,H). However, the non-autonomous effect can not be attributed to Wnt11 function, since MZoep mutant lack mesendoderm, where wnt11 is normally expressed. Importantly, wild-type and MZspg cells always migrate in the same manner, independent of the host genotype (Figure 28B-H). This suggests, that pou2 does not truly control CE movements. However, impaired convergence and normal extension movements observed in MZspg are attributable to downregulated/lost bmp expression, and the altered migration behaviour is likely mediated by the dorsalized wnt11/wnt5a expression domains in the gastrulating MZspg embryo. 5.2 Epiboly movement is differentially affected in MZspg mutants
Epiboly is a teleost-specific movement of cells, starting at the dome stage and finishing at the end of gastrulation. In particular, epiboly means the spreading of the EVL, the blastoderm and the YSL to engulf the yolk cell (Figure 29A; see also Figure 1). Previous work suggested that the enveloping layer (EVL), an epithelial monolayer which gives rise to the periderm or embryonic skin, and the blastoderm are attached to the underlying yolk syncytial layer (YSL). The yolk cell, in particular its microtubules and microfilaments, are strictly required for epiboly and act as a towing motor in this morphogenetic process, and nuclei of the YSL undergo convergence-extension movements independent of the overlying blastoderm (Trinkaus 1951; Trinkaus et al. 1993; Solnica-Krezel and Driever 1994; review: Kane and Adams, 2002; D'Amico et al. 2001). To date, epiboly is poorly understood in terms of genetics and morphology. Previously, four mutants affecting epiboly have been phenotypically described, however, the molecular nature of their mutations remain unknown (Kane et al. 1996). These mutants show delayed epiboly, which is arrested before the completion of gastrulation. In addition to affected endoderm formation and DV patterning, a third aspect of the phenotype can be distinguished in MZspg embryos, which affects the epibolic Appendix 114 - movement. Epiboly of the gastrulating wild-type blastoderm shows a subtle delay relative to epibolic movement of the YSL and the EVL (Figure 29B). In MZspg embryos, the EVL including the forerunner cells, and the YSL undergo normal epibolic movements, whereas epiboly of the blastoderm between these layers is extremely disrupted and arrests at 70-80% of epiboly (Figure 29C; the blue arrow indicates the level of epiboly of the blastoderm, the red arrow the level of epiboly of the YSL and EVL). The MZspg mutant epiboly phenotype is similar to the phenotype of the epiboly mutants avalanche, lawine, half baked and weg, where the blastoderm arrests epibloy to different extents, depending on the mutant, whereas the EVL and the YSL undergo fairly normal epiboly (Kane et al. 1996). Preliminary analysis suggests that the YSL and its nuclei, implicated in proper epibolic movements, form and move normally during epiboly, as evidenced by the following observations. (i) The YSL forms normally in MZspg as judged from fluorescent dye injection (rhodamine dextrane) into the prospective YSL of living mutant embryos shortly after MBT, and examination of YSL movement during gastrulation. (ii) YSL nuclei (YSN) form in a normal spatio-temporal manner and in terms of numbers: The vital dye Sytox Green was injected into the YSL soon after its formation around MBT. The dye subsequently incorporates to the nuclei of the YSL. The behaviour of YSN of wild-type and mutants was analyzed during blastula and gastrula stages under the UV microscope (Figure 27D-I; D'Amico et al. 2001). Interestingly, I observed a subtle difference in YSN movement behaviour between 30% and 50% epiboly. At this phase, wild-type YSN undergo “compaction”, i.e. a relative broad band of YSN protruding the vegetal margin of the blastoderm during late blastula stages retracts and comes to lie animally of the blastoderm margin (Figure 29D,F,H). In MZspg embryos, compaction of YSN fails (Figure 29E,G,I). However, YSN undergo further epibolic movements indistinguishable from the wild-type, and readily complete epiboly at the same time as wild-type embryos (not shown). (iii) Expression of YSL specific genes, predominantly implicated in mes-endodermal induction, is not affected in MZspg mutants. The largely normal development of the YSL/YSN is in accordance with the previously described autonomous development of the YSL, independent from the overlying blastoderm, as well as the fact that pou2 mRNA is not found within the YSL, although maternally derived Pou2 protein could be there. Similarly to the DV patterning phenotype, the epiboly phenotype can as well be attributed strictly to the maternal function of pou2, since Zspg mutant embryos show now epiboly defect, and Mspg embryos display initial epiboly defects. However, the impairment of epibolic Appendix 115 - movement is apparently rescued in Mspg embryos in the course of gastrulation due to zygotic wild-type pou2 function.
FIGURE 29 Epiboly movement is affected in MZspg embryos. (A) The cartoon illustrates epibolic movements of the enveloping layer (EVL), the blastoderm and the yolk syncytial nuclei (YSN) within the YSL toward the vegetal pole of the embryo; modified after Trinkaus et al. 1993). If not noted otherwise, embryos are depicted from the lateral view, animal is to the top. (B,D,E,F,F’,H) wild-type embryos; (C,E,G,G’,I) MZspg mutant embryos. (C) Epiboly of the blastoderm of MZspg mutants is strongly retarded, whereas epiboly of the EVL and YSL is similar to the wild-type (B). (D) In the wild-type embryo, compaction of YSN starts around 30% of epiboly, and YSN are contracted into a narrow band (bracket). As a consequence, the marginal-most YSL beneath the germ Appendix 116 - ring is cleared (bracket in (F,F’)) from YSN at the shield stage, which can be also seen in an animal view (H), where the outer margin of the germring is indicated by a dashed line. (E) Compaction of the YSN is affected in MZspg mutants at 30%E. As a consequence, YSN are spread into marginal-most regions of the YSL (bracket in (G,G’),, which can be also seen in an animal view, upper half picture of (I). Because MZspg embryos have a relative thick blastoderm as compared to wild-type embryos (compare (B,C,F’,G’)), the YSN of the internal YSL are not properly in focus. For a proper visualization of internally located YSN, MZspg embryos are photographed from the vegetal view in the lower half picture of (I), which shows that number and spacing of YSN are comparable to the wild-type (H).
5.3 The MZspg mutant phenotypes affecting endoderm, DV patterning and epiboly can be disentangled from each other
MZspg mutant embryos display a pleiotropic phenotype. I will discuss major, mainly theoretical considerations, which substantiate the independency of the three preponderant phenotypes in MZspg mutant embryos. (i) DV patterning is affected already at blastula stages, whereas endoderm development (initiation) is normal in MZspg. (ii) Dorsalized embryos mutated in BMP signaling are not affected in early differentiation of endodermal precursors, and mutants affected in endodermal differentiation display no failure of DV patterning. (iii) DV patterning mutants, including strongly dorsalized Mspg mutants, display no epiboly defects, and epiboly mutants exert normal DV patterning. (iv) Mutants affected in endoderm formation, including strongly dorsalized Mspg mutant embryos, have no concomitant arrest in epiboly, and vice versa. The proposed independency of the three phenotypes of MZspg could be substantiated more directly by the following experiments: (a) Rescue of the dorsalized phenotype of MZspg, e.g. by bmp mRNA injection or repression of dorsal determinants, should restore DV patterning without any rescue of the endodermal or the epiboly phenotype. (b) Rescue of endodermal differentiation, e.g. by sox17 mRNA injection, should not be able to rescue DV patterning or epiboly defects. In summary, the data presented here suggest that the phenotypes observed in MZspg mutant embryos are independent of each other and likely reflect the role of pou2 in different processes during early development, whereby pou2 might act with different co-factors that remain to be investigated in more detail. 117 6 References
Alexander, J. and Stainier, D.Y. (1999). A molecular pathway leading to endoderm formation in zebrafish. Curr Biol 9(20): 1147-57. Ambrosetti, D.C., Basilico, C. and Dailey, L. (1997). Synergistic activation of the fibroblast growth factor 4 enhancer by Sox2 and Oct-3 depends on protein-protein interactions facilitated by a specific spatial arrangement of factor binding sites. Mol Cell Biol 17(11): 6321-9. Ambrosetti, D.C., Scholer, H.R., Dailey, L. and Basilico, C. (2000). Modulation of the activity of multiple transcriptional activation domains by the DNA binding domains mediates the synergistic action of Sox2 and Oct-3 on the fibroblast growth factor-4 enhancer. J Biol Chem 275(30): 23387-97. Amirthalingam, K., Lorens, J.B., Saetre, B.O., Salaneck, E. and Fjose, A. (1995). Embryonic expression and DNA-binding properties of zebrafish pax-6. Biochem Biophys Res Commun 215(1): 122-8. Amsterdam, A., Hopkins, N., Streit, A., Berliner, A.J., Papanayotou, C., Sirulnik, A. and Stern, C.D. (1999). Retrovirus-mediated insertional mutagenesis in zebrafish. Methods Cell Biol 60(6791): 87-98. Aoki, T.O., David, N.B., Minchiotti, G., Saint-Etienne, L., Dickmeis, T., Persico, G.M., Strahle, U., Mourrain, P. and Rosa, F.M. (2002). Molecular integration of casanova in the Nodal signaling pathway controlling endoderm formation. Development 129(2): 275-86. Araki, I. and Brand, M. (2001). Antisense-morpholino-induced knockdown of fgf8 phenocopies the acerebellar (ace) phenotype. Genesis: 30(3):157-59. Araki, I. and Nakamura, H. (1999). Engrailed defines the position of dorsal di-mesencephalic boundary by repressing diencephalic fate. Development 126(22): 5127-35. Aravind, L. and Koonin, E.V. (1999). DNA-binding proteins and evolution of transcription regulation in the archaea. Nucleic Acids Res 27(23): 4658-70. Barth, K.A., Kishimoto, Y., Rohr, K.B., Seydler, C., Schulte-Merker, S. and Wilson, S.W. (1999). Bmp activity establishes a gradient of positional information throughout the entire neural plate. Development 126(22): 4977-4987. Basilico, C. and Moscatelli, D. (1992). The FGF family of growth factors and oncogenes. Adv. Cancer Res. 59: 115-165. Bauer, H., Meier, A., Hild, M., Stachel, S., Economides, A., Hazelett, D., Harland, R.M. and Hammerschmidt, M. (1998). Follistatin and noggin are excluded from the zebrafish organizer. Dev Biol 204(2): 488-507. Belting, H.G., Hauptmann, G., Meyer, D., Abdelilah-Seyfried, S., Chitnis, A., Eschbach, C., Soll, I., Thisse, C., Thisse, B., Artinger, K.B., Lunde, K. and Driever, W. (2001). spiel ohne grenzen/pou2 is required during establishment of the zebrafish midbrain-hindbrain boundary organizer. Development 128(21): 4165-76. Botquin, V., Hess, H., Fuhrmann, G., Anastassiadis, C., Gross, M.K., Vriend, G. and Scholer, H.R. (1998). New POU dimer configuration mediates antagonistic control of an osteopontin preimplantation enhancer by Oct-4 and Sox-2. Genes Dev 12(13): 2073-2090. Brand, M., Granato, M. and Nüsslein-Volhard, C. (2002). Keeping and raising zebrafish. Zebrafish: A practical approach. C. Nüsslein-Volhard and R. Dahm. Oxford, Oxford University Press. Brand, M., Heisenberg, C.-P., Jiang, Y.-J., Beuchle, D., Lun, K., van Eeden, F.J.M., Furutani-Seiki, M., Granato, M., Haffter, P., Hammerschmidt, M., Kane, D.A., Kelsh, R.N., Mullins, M.C., Odenthal, J. and Nüsslein-Volhard, C. (1996). Mutations in zebrafish genes affecting the formation of the boundary between midbrain and hindbrain. Development 123: 179-190. Broccoli, V., Boncinelli, E. and Wurst, W. (1999). The caudal limit of Otx2 expression positions the isthmic organizer. Nature 401(6749): 164-8. Burgess, S., Reim, G., Chen, W., Hopkins, N. and Brand, M. (2002). The zebrafish spiel-ohne-grenzen (spg) gene encodes the POU domain protein Pou2 related to mammalian Oct4 and is essential for formation of the midbrain and hindbrain, and for pre-gastrula morphogenesis. Development 129(4): 905-16. Carl, M. and Wittbrodt, J. (1999). Graded interference with FGF signaling reveals its dorsoventral asymmetry at the mid-hindbrain boundary. Development 126(24): 5659-67. Chai, N., Patel, Y., Jacobson, K., McMahon, J., McMahon, A. and Rappolee, D.A. (1998). FGF is an essential regulator of the fifth cell division in preimplantation mouse embryos. Dev Biol 198(1): 105-15. References 118 - Chambers, D., Medhurst, A.D., Walsh, F.S., Price, J. and Mason, I. (2000). Differential display of genes expressed at the midbrain - hindbrain junction identifies sprouty2: an FGF8-inducible member of a family of intracellular FGF antagonists. Mol Cell Neurosci 15(1): 22-35. Chen, J.-N., Haffter, P., Odenthal, J., Vogelsang, E., Brand, M., van Eeden, F.J.M., Furutani-Seiki, M., Granato, M., Hammerschmidt, M., Heisenberg, C.-P., Jiang, Y.-J., Kane, D.A., Kelsh, R.N., Mullins, M.C. and Nüsslein-Volhard, C. (1996). Mutations affecting the cardiovascular system and other internal organs in the zebrafish. Development 123: 293-302. Chen, S. and Kimelman, D. (2000). The role of the yolk syncytial layer in germ layer patterning in zebrafish. Development 127(21): 4681-9. Chen, Y. and Schier, A.F. (2001). The zebrafish Nodal signal Squint functions as a morphogen. Nature 411(6837): 607-10. Cordes, S.P. and Barsh, G.S. (1994). The mouse segmentation gene kr encodes a novel basic domain- leucine zipper transcription factor. Cell 79(6): 1025-1034. Crossley, P.H., Martinez, S. and Martin, G.R. (1996). Midbrain development induced by FGF8 in the chick embryo. Nature 380(6569): 66-68. D'Amico, L.A., Cooper, M.S., Heisenberg, C.P., Tada, M., Rauch, G.J., Saude, L., Concha, M.L., Geisler, R., Stemple, D.L., Smith, J.C. and Wilson, S.W. (2001). Morphogenetic domains in the yolk syncytial layer of axiating zebrafish embryos. Dev Dyn 222(4): 611-24. Darlington, G.J., Hidalgo-Sanchez, M., Millet, S., Bloch-Gallego, E. and Alvarado-Mallart, R.M. (1999). Molecular mechanisms of liver development and differentiation. Curr Opin Cell Biol 11(6): 678- 82. David, N.B. and Rosa, F.M. (2001). Cell autonomous commitment to an endodermal fate and behaviour by activation of Nodal signaling. Development 128(20): 3937-47. Davidson, E.H. (1993). Later embryogenesis: regulatory circuitry in morphogenetic fields. Development 118(3): 665-90. De Robertis, E.M., Larrain, J., Oelgeschlager, M., Wessely, O., Sidi, S., Goutel, C., Peyrieras, N. and Rosa, F.M. (2000). The establishment of Spemann's organizer and patterning of the vertebrate embryo. Nat Rev Genet 1(3): 171-81. genes encoding BMP antagonists. Devoto, S.H., Melancon, E., Eisen, J.S. and Westerfield, M. (1996). Identification of separate slow and fast muscle precursor cells in vivo, prior to somite formation. Development 122(11): 3371-3380. Dick, A., Hild, M., Bauer, H., Imai, Y., Maifeld, H., Schier, A.F., Talbot, W.S., Bouwmeester, T. and Hammerschmidt, M. (2000). Essential role of Bmp7 (snailhouse) and its prodomain in dorsoventral patterning of the zebrafish embryo. Development 127(2): 343-54. Dickmeis, T., Mourrain, P., Saint-Etienne, L., Fischer, N., Aanstad, P., Clark, M., Strahle, U. and Rosa, F. (2001). A crucial component of the endoderm formation pathway, CASANOVA, is encoded by a novel sox-related gene. Genes Dev 15(12): 1487-92. Driever, W., Solnica Krezel, L., Schier, A.F., Neuhauss, S.C., Malicki, J., Stemple, D.L., Stainier, D.Y., Zwartkruis, F., Abdelilah, S., Rangini, Z., Belak, J. and Boggs, C. (1996). A genetic screen for mutations affecting embryogenesis in zebrafish. Development 123: 37-46. Driever, W., Solnica-Krezel, L., Abdelilah, S., Meyer, D., Stemple, D., Streit, A., Berliner, A.J., Papanayotou, C., Sirulnik, A. and Stern, C.D. (1997). Genetic analysis of pattern formation in the zebrafish neural plate. Cold Spring Harb Symp Quant Biol 62(6791): 523-34. York 10032, USA. Erter, C.E., Solnica-Krezel, L. and Wright, C.V. (1998). Zebrafish nodal-related 2 encodes an early mesendodermal inducer signaling from the extraembryonic yolk syncytial layer. Dev Biol 204(2): 361-72. Ezashi, T., Ghosh, D. and Roberts, R.M. (2001). Repression of Ets-2-induced transactivation of the tau interferon promoter by Oct-4. Mol Cell Biol 21(23): 7883-91. Favor, J., Sandulache, R., Neuhäuser-Klaus, A., Pretsch, W., Chatterjee, B., Senft, E., Wurst, W., Blanquet, V., Grimes, P., Spörle, R. and Schughart, K. (1996). The mouse Pax21Neu mutation is identical to a human PAX2 mutation in a family with renal-coloboma syndrome and results in developmental defects of the brain, ear, eye and kidney. PNAS 93: 13870-13875. Fekany-Lee, K., Gonzalez, E., Miller-Bertoglio, V. and Solnica-Krezel, L. (2000). The homeobox gene bozozok promotes anterior neuroectoderm formation in zebrafish through negative regulation of BMP2/4 and Wnt pathways. Development 127(11): 2333-45. Fitzsimmons, D., Hodsdon, W., Wheat, W., Maira, S.M., Wasylyk, B. and Hagman, J. (1996). Pax-5 (BSAP) recruits Ets proto-oncogene family proteins to form functional ternary complexes on a B-cell-specific promoter. Genes Dev 10(17): 2198-211. References 119 - Force, A., Lynch, M., Pickett, F.B., Amores, A., Yan, Y.L. and Postlethwait, J. (1999). Preservation of duplicate genes by complementary, degenerative mutations. Genetics 151(4): 1531-45. Freeman, M. and Gurdon, J.B. (2002). Regulatory principles of developmental signaling. Annu Rev Cell Dev Biol 18: 515-39. Fürthauer, M., Reifers, F., Brand, M., Thisse, B. and Thisse, C. (2001). sprouty4 acts in vivo as a feedback-induced antagonist of Fgf signaling in zebrafish. Development 128: 2175-2186. Fürthauer, M., Thisse, B. and Thisse, C. (1999). Three different noggin genes antagonize the activity of bone morphogenetic proteins in the zebrafish embryo. Dev Biol 214(1): 181-96. Gaiano, N., Allende, M., Amsterdam, A., Kawakami, K. and Hopkins, N. (1996). Highly efficient germ- line transmission of proviral insertions in zebrafish. Proc Natl Acad Sci U S A 93(15): 7777-82. Gaiano, N., Amsterdam, A., Kawakami, K., Allende, M., Becker, T. and Hopkins, N. (1996). Insertional mutagenesis and rapid cloning of essential genes in zebrafish. Nature 383(6603): 829-32. Gallagher, B.C., Henry, J.J. and Grainger, R.M. (1996). Inductive processes leading to inner ear formation during Xenopus development. Developmental Biology 175: 95-107. Garda, A.L., Echevarria, D. and Martinez, S. (2001). Neuroepithelial co-expression of Gbx2 and Otx2 precedes Fgf8 expression in the isthmic organizer. Mech Dev 101(1-2): 111-8. Geisler, R., Rauch, G.J., Baier, H., van Bebber, F., Brobeta, L., Dekens, M.P., Finger, K., Fricke, C., Gates, M.A., Geiger, H., Geiger-Rudolph, S., Gilmour, D., Glaser, S., Gnugge, L., Habeck, H., Hingst, K., Holley, S., Keenan, J., Kirn, A., Knaut, H., Lashkari, D., Maderspacher, F., Martyn, U., Neuhauss, S., Haffter, P. and et al. (1999). A radiation hybrid map of the zebrafish genome. Nat Genet 23(1): 86-89. Ghosh-Choudhury, N., Choudhury, G.G., Harris, M.A., Wozney, J., Mundy, G.R., Abboud, S.L. and Harris, S.E. (2001). Autoregulation of mouse BMP-2 gene transcription is directed by the proximal promoter element. Biochem Biophys Res Commun 286(1): 101-8. Gilbert, S.F. (1997). Developmental Biology, 5th Edition. Sunderland, Mass., USA, Sinauer Associates, Inc. Third edition Grandel, H., Draper, B.W. and Schulte-Merker, S. (2000). dackel acts in the ectoderm of the zebrafish pectoral fin bud to maintain AER signaling. Development 127(19): 4169-78. Gritsman, K., Zhang, J., Cheng, S., Heckscher, E., Talbot, W.S., Schier, A.F., Burgess, S., Reim, G., Chen, W., Hopkins, N. and Brand, M. (1999). The EGF-CFC protein one-eyed pinhead is essential for nodal signaling. Cell 97(1): 121-32. Groves, A.K. and Bronner-Fraser, M. (2000). Competence, specification and commitment in otic placode induction. Development 127(16): 3489-99. Guo, Y., Costa, R., Ramsey, H., Starnes, T., Vance, G., Robertson, K., Kelley, M., Reinbold, R., Scholer, H. and Hromas, R. (2002). The embryonic stem cell transcription factors Oct-4 and FoxD3 interact to regulate endodermal-specific promoter expression. Proc Natl Acad Sci U S A 99(6): 3663-7. Haffter, P., Granato, M., Brand, M., Mullins, M.C., Hammerschmidt, M., Kane, D.A., Odenthal, J., van Eeden, F.J.M., Jiang, Y.-J., Heisenberg, C.-P., Kelsh, R.N., Furutani-Seiki, M., Vogelsang, E., Beuchle, D., Schach, U., Fabian, C. and Nüsslein-Volhard, C. (1996). Identification of genes with unique and essential functions in the development of the zebrafish, Danio rerio. Development 123: 1-36. Halpern, M.E., Ho, R.K., Walker, C. and Kimmel, C.B. (1993). Induction of muscle pioneers and floor plate is distinguished by the zebrafish no tail mutation. Cell 75(1): 99-111. Hammerschmidt, M. and Mullins, M.C. (2002). Dorsoventral patterning in the zebrafish: bone morphogenetic proteins and beyond. Results Probl Cell Differ 40: 72-95. Hammerschmidt, M. and Nüsslein-Volhard, C. (1993). The expression of a zebrafish gene homologous to Drosophila snail suggests a conserved function in invertebrate and vertebrate gastrulation. Development 119(4): 1107-1118. Hammerschmidt, M., Pelegri, F., Kane, D.A., Mullins, M.C., Serbedzija, G., Beuchle, D., Brand, M., Furutani-Seiki, M., Granato, M., Haffter, P., Heisenberg, C.-P., Jiang, Y.-J., Kelsh, R.N., Odenthal, J., van Eeden, F.J.M., Vogelsang, E., Warga, R.M. and Nüsslein-Volhard, C. (1996). dino and mercedes, two genes regulating dorsal development in the zebrafish embryo. Development 123: 95-102. Hauptmann, G. and Gerster, T. (1995). Pou-2--a zebrafish gene active during cleavage stages and in the early hindbrain. Mech Dev 51(1): 127-38. References 120 - Heisenberg, C.P., Tada, M., Rauch, G.J., Saude, L., Concha, M.L., Geisler, R., Stemple, D.L., Smith, J.C. and Wilson, S.W. (2000). Silberblick/Wnt11 mediates convergent extension movements during zebrafish gastrulation. Nature 405(6782): 76-81. Hibi, M., Hirano, T., Dawid, I.B., Jesuthasan, S., Stahle, U., Aravind, L. and Koonin, E.V. (2002). Organizer formation and function. Results Probl Cell Differ 40: 48-71. Hidalgo-Sanchez, M., Simeone, A. and Alvarado-Mallart, R.M. (1999). Fgf8 and Gbx2 induction concomitant with Otx2 repression is correlated with midbrain-hindbrain fate of caudal prosencephalon. Development 126(14): 3191-203. Ho, R.K. and Kimmel, C.B. (1993). Commitment of cell fate in the early zebrafish embryo. Science 261(5117): 109-11. Houart, C., Westerfield, M. and Wilson, S.W. (1998). A small population of anterior cells patterns the forebrain during zebrafish gastrulation [see comments]. Nature 391(6669): 788-792. Howley, C. and Ho, R.K. (2000). mRNA localization patterns in zebrafish oocytes. Mech Dev 92(2): 305- 9. Hübner, K., Fuhrmann, G., Christenson, L.K., Kehler, J., Reinbold, R., De La Fuente, R., Wood, J., Strauss, J.F., 3rd, Boiani, M. and Schöler, H.R. (2003). Derivation of oocytes from mouse embryonic stem cells. Science 300(5623): 1251-6. Hudson, C., Clements, D., Friday, R.V., Stott, D., Woodland, H.R., Gad, J.M., Tajima, Y., Taya, C., Kurohmaru, M., Sanai, Y., Yonekawa, H., Yazaki, K., Tam, P.P. and Hayashi, Y. (1997). Xsox17alpha and -beta mediate endoderm formation in Xenopus. Cell 91(3): 397-405. Imai, Y., Gates, M.A., Melby, A.E., Kimelman, D., Schier, A.F. and Talbot, W.S. (2001). The homeobox genes vox and vent are redundant repressors of dorsal fates in zebrafish. Development 128(12): 2407-20. Jesuthasan, S., Stahle, U., Aravind, L. and Koonin, E.V. (1997). Dynamic microtubules and specification of the zebrafish embryonic axis. Curr Biol 7(1): 31-42. Kanai-Azuma, M., Kanai, Y., Gad, J.M., Tajima, Y., Taya, C., Kurohmaru, M., Sanai, Y., Yonekawa, H., Yazaki, K., Tam, P.P. and Hayashi, Y. (2002). Depletion of definitive gut endoderm in Sox17- null mutant mice. Development 129(10): 2367-79. Kane, D.A., M., H., Mullins, M.C., Maischein, H.-M., Brand, M., van Eeden, F.J.M., Furutani-Seiki, M., Granato, M., Haffter, P., Heisenberg, C.-P., Jiang, Y.-J., Kelsh, R.N., Odenthal, J., Warga, R.M. and Nüsslein-Volhard, C. (1996). The zebrafish epiboly mutants. Development 123: 47-55. Kazanskaya, O.V., Severtzova, E.A., Barth, K.A., Ermakova, G.V., Lukyanov, S.A., Benyumov, A.O., Pannese, M., Boncinelli, E., Wilson, S.W. and Zaraisky, A.G. (1997). Anf: a novel class of vertebrate homeobox genes expressed at the anterior end of the main embryonic axis. Gene 200(1-2): 25-34. Kelly, G.M., Greenstein, P., Erezyilmaz, D.F. and Moon, R.T. (1995). Zebrafish wnt8 and wnt8b share a common activity but are involved in distinct developmental pathways. Development 121(6): 1787-99. Kelly, G.M. and Moon, R.T. (1995). Involvement of wnt1 and pax2 in the formation of the midbrain- hindbrain boundary in the zebrafish gastrula. Dev. Genet. 17(2): 129-140. Kelly, O.G. and Melton, D.A. (1995). Induction and patterning of the vertebrate nervous system. Trends Genet 11(7): 273-8. Kelly, P.D., Chu, F., Woods, I.G., Ngo-Hazelett, P., Cardozo, T., Huang, H., Kimm, F., Liao, L., Yan, Y.L., Zhou, Y., Johnson, S.L., Abagyan, R., Schier, A.F., Postlethwait, J.H. and Talbot, W.S. (2000). Genetic linkage mapping of zebrafish genes and ESTs. Genome Res 10(4): 558-567. Kikuchi, Y., Agathon, A., Alexander, J., Thisse, C., Waldron, S., Yelon, D., Thisse, B. and Stainier, D.Y. (2001). casanova encodes a novel Sox-related protein necessary and sufficient for early endoderm formation in zebrafish. Genes Dev 15(12): 1493-505. Kikuchi, Y., Trinh, L.A., Reiter, J.F., Alexander, J., Yelon, D. and Stainier, D.Y. (2000). The zebrafish bonnie and clyde gene encodes a Mix family homeodomain protein that regulates the generation of endodermal precursors. Genes Dev 14(10): 1279-89. Kilian, B., Mansukoski, H., Barbosa, F.C., Ulrich, F., Tada, M. and Heisenberg, C.P. (2003). The role of Ppt/Wnt5 in regulating cell shape and movement during zebrafish gastrulation. Mech Dev 120(4): 467-76. Kimelman, D., Griffin, K.J., Mione, M., Shanmugalingam, S. and Griffin, K. (2000). Vertebrate mesendoderm induction and patterning. Curr Opin Genet Dev 10(4): 350-6. Kimmel, C.B. (1989). Genetics and early development of zebrafish. Trends in Genetics 5: 283-288. References 121 - Kimmel, C.B. (1993). Patterning the brain of the zebrafish embryo. Annu Rev Neurosci 16(707): 707-732. Kimmel, C.B., Ballard, W.W., Kimmel, S.R., Ullmann, B. and Schilling, T.F. (1995). Stages of embryonic development of the zebrafish. Dev. Dyn. 203(3): 253-310. Kimmel, C.B., Warga, R.M. and Kane, D.A. (1994). Cell cycles and clonal strings during formation of the zebrafish central nervous system. Development 120(2): 265-76. Kimmel, C.B., Warga, R.M. and Schilling, T.F. (1990). Origin and organization of the zebrafish fate map. Development 108(4): 581-94. Kishimoto, Y., Lee, K.H., Zon, L., Hammerschmidt, M. and Schulte Merker, S. (1997). The molecular nature of zebrafish swirl: BMP2 function is essential during early dorsoventral patterning. Development 124(22): 4457-66. Klemm, J.D., Rould, M.A., Aurora, R., Herr, W. and Pabo, C.O. (1994). Crystal structure of the Oct-1 POU domain bound to an octamer site: DNA recognition with tethered DNA-binding modules. Cell 77(1): 21-32. Kodjabachian, L., Lemaire, P., Sasai, Y. and De Robertis, E.M. (1998). Embryonic induction: is the Nieuwkoop centre a useful concept? Curr Biol 8(25): R918-21. point of view of the classical experiments of Nieuwkoop that defined an activation and a transformation step during neural induction. Koster, R., Stick, R., Loosli, F. and Wittbrodt, J. (1997). Medaka spalt acts as a target gene of hedgehog signaling. Development 124(16): 3147-56. Kozmik, Z., Holland, N.D., Kalousova, A., Paces, J., Schubert, M. and Holland, L.Z. (1999). Characterization of an amphioxus paired box gene, AmphiPax2/5/8: developmental expression patterns in optic support cells, nephridium, thyroid-like structures and pharyngeal gill slits, but not in the midbrain-hindbrain boundary region. Development 126(6): 1295-1304. Krauss, S., Johansen, T., Korzh, V. and Fjose, A. (1991). Expression of the zebrafish paired box gene pax[zf-b] during early neurogenesis. Development 113(4): 1193-1206. Krauss, S., Johansen, T., Korzh, V., Moens, U., Ericson, J.U. and Fjose, A. (1991). Zebrafish pax(zf-a): a paired box-containing gene expressed in the neural tube. Embo Journal 10(12): 3609-19. Kuwada, J.Y., Bernhardt, R.R. and Nguyen, N. (1990). Development of spinal neurons and tracts in the zebrafish embryo. J Comp Neurol 302(3): 617-28. Leger, S. and Brand, M. (2002). Fgf8 and Fgf3 are required for zebrafish ear placode induction, maintenance and inner ear patterning. Mech Dev 119(1): 91. Lewin, B. 2000. Genes VII. Oxford Univ. Press, Oxford. Li, H.S., Yang, J.M., Jacobson, R.D., Pasko, D. and Sundin, O. (1994). Pax-6 is first expressed in a region of ectoderm anterior to the early neural plate: implications for stepwise determination of the lens. Dev Biol 162(1): 181-94. Lin, S., Gaiano, N., Culp, P., Burns, J.C., Friedmann, T., Yee, J.K. and Hopkins, N. (1994). Integration and germ-line transmission of a pseudotyped retroviral vector in zebrafish. Science 265(5172): 666-9. Liu, A., Joyner, A.L., Fekany-Lee, K., Gonzalez, E., Miller-Bertoglio, V. and Solnica-Krezel, L. (2001). Early anterior/posterior patterning of the midbrain and cerebellum. Annu Rev Neurosci 24(11): 869-96. B, Nashville, TN 37235, USA. Liu, A., Losos, K. and Joyner, A.L. (1999). FGF8 can activate Gbx2 and transform regions of the rostral mouse brain into a hindbrain fate. Development 126(21): 4827-38. Lumsden, A. and Krumlauf, R. (1996). Patterning the vertebrate neuraxis. Science 274: 1109-1123. Lun, K. and Brand, M. (1998). A series of no isthmus (noi) alleles of the zebrafish pax2.1 gene reveals multiple signaling events in development of the midbrain-hindbrain boundary. Development 125: 3049-3062. Macdonald, R., Xu, Q., Barth, K.A., Mikkola, I., Holder, N., Fjose, A., Krauss, S. and Wilson, S.W. (1994). Regulatory gene expression boundaries demarcate sites of neuronal differentiation in the embryonic zebrafish forebrain. Neuron 13(5): 1039-1053. Maduro, M.F., Meneghini, M.D., Bowerman, B., Broitman-Maduro, G. and Rothman, J.H. (2001). Restriction of mesendoderm to a single blastomere by the combined action of SKN-1 and a GSK-3beta homolog is mediated by MED-1 and -2 in C. elegans. Mol Cell 7(3): 475-85. Mahmood, R., Mason, I.J. and Morriss-Kay, G.M. (1996). Expression of Fgf-3 in relation to hindbrain segmentation, otic pit position and pharyngeal arch morphology in normal and retinoic acid- exposed mouse embryos. Anat Embryol (Berl) 194(1): 13-22. References 122 - Manzanares, M., Trainor, P.A., Nonchev, S., Ariza-McNaughton, L., Brodie, J., Gould, A., Marshall, H., Morrison, A., Kwan, C.T., Sham, M.H., Wilkinson, D.G. and Krumlauf, R. (1999). The role of kreisler in segmentation during hindbrain development. Dev Biol 211(2): 220-37. Martinez, S. and Alvarado-Mallart, R.M. (1990). Expression of the homeobox Chick-en gene in chick/quail chimeras with inverted mes-metencephalic grafts. Dev Biol 139(2): 432-436. Martinez, S., Wassef, M. and Alvarado-Mallart, R.M. (1991). Induction of a mesencephalic phenotype in the 2-day-old chick prosencephalon is preceded by the early expression of the homeobox gene en. Neuron 6(6): 971-981. McCallum, C.M., Comai, L., Greene, E.A. and Henikoff, S. (2000). Targeted screening for induced mutations. Nat Biotechnol 18(4): 455-7. Meinhardt, H. (1983). Cell determination boundaries as organizing: regions for secondary embryonic fields. Dev. Biol. 96: 375-385. Mendonsa, E.S. and Riley, B.B. (1999). Genetic analysis of tissue interactions required for otic placode induction in the zebrafish. Dev Biol 206(1): 100-12. Meyers, E.N., Lewandoski, M. and Martin, G.R. (1998). An Fgf8 mutant allelic series generated by Cre- and Flp-mediated recombination. Nat Genet 18(2): 136-141. Millen, K.J., Wurst, W., Herrup, K. and Joyner, A. (1994). Abnormal embryonic cerebellar development and patterning of postnatal foliation in two mouse Engrailed-2 mutants. Development 120: 695- 706. Millet, S., Campbell, K., Epstein, D.J., Losos, K., Harris, E. and Joyner, A.L. (1999). A role for Gbx2 in repression of Otx2 and positioning the mid/hindbrain organizer. Nature 401(6749): 161-4. Mizuno, T., Yamaha, E., Kuroiwa, A., Takeda, H., Burgess, S., Reim, G., Chen, W., Hopkins, N. and Brand, M. (1999). Removal of vegetal yolk causes dorsal deficencies and impairs dorsal- inducing ability of the yolk cell in zebrafish. Mech Dev 81(1-2): 51-63. Moens, C.B., Yan, Y.L., Appel, B., Force, A.G. and Kimmel, C.B. (1996). valentino: a zebrafish gene required for normal hindbrain segmentation. Development 122(12): 3981-3990. Mohammadi, M., McMahon, G., Sun, L., Tang, C., Hirth, P., Yeh, B.K., Hubbard, S.R. and Schlessinger, J. (1997). Structures of the tyrosine kinase domain of fibroblast growth factor receptor in complex with inhibitors. Science 276(5314): 955-60. Moon, A.M. and Capecchi, M.R. (2000). Fgf8 is required for outgrowth and patterning of the limbs. Nat Genet 26(4): 455-9. Mori, H., Miyazaki, Y., Morita, T., Nitta, H. and Mishina, M. (1994). Different spatio-temporal expressions of three otx homeoprotein transcripts during zebrafish embryogenesis. Brain Res Mol Brain Res 27(2): 221-31. Morita, T., Nitta, H., Kiyama, Y., Mori, H. and Mishina, M. (1995). Differential expression of two zebrafish emx homeoprotein mRNAs in the developing brain. Neurosci Lett 198(2): 131-4. Müller, M., v. Weizsäcker, E. and Campos-Ortega, J.A. (1996). Transscription of a zebrafish gene of the hairy-Enhancer of split family delineates the midbrain anlage in the neural plate. Dev Genes Evol 206: 153-160. Mullins, M.C., Hammerschmidt, M., Kane, D.A., Odenthal, J., Brand, M., Furutani-Seiki, M., Granato, M., Haffter, P., Heisenberg, C.-P., Jiang, Y.-J., Kelsh, R.N., van Eeden, F.J.M. and Nüsslein- Volhard, C. (1996). Genes establishing dorsoventral pattern formation in the zebrafish embryo: the ventral determinants. Development 123: 81-93. Mullins, M.C. and Nusslein, V.C. (1993). Mutational approaches to studying embryonic pattern formation in the zebrafish. Curr Opin Genet Dev 3(4): 648-54. Myers, D.C., Sepich, D.S. and Solnica-Krezel, L. (2002). Bmp activity gradient regulates convergent extension during zebrafish gastrulation. Dev Biol 243(1): 81-98. Myers, D.C., Sepich, D.S. and Solnica-Krezel, L. (2002). Convergence and extension in vertebrate gastrulae: cell movements according to or in search of identity? Trends Genet 18(9): 447-55. Nasevicius, A. and Ekker, S.C. (2000). Effective targeted gene 'knockdown' in zebrafish. Nat Genet 26(2): 216-220. Nelsen, O.E. (1953). Comparative Embryology of the Vertebrates, [U of Penn] Nichols, J., Zevnik, B., Anastassiadis, K., Niwa, H., Klewe-Nebenius, D., Chambers, I., Scholer, H. and Smith, A. (1998). Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4. Cell 95(3): 379-91. Nieuwkoop, P.D. (1973). The 'organization center' of the amphibian embryo: Its orgin, spatial organization, and morphogenetic action. Adv. Morphogen. 10: 1-39. References 123 - Nieuwkoop, P.D. (1999). The neural induction process; its morphogenetic aspects. Int J Dev Biol 43(7 Spec No): 615-23. Niwa, H., Miyazaki, J. and Smith, A.G. (2000). Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet 24(4): 372-6. Ober, E.A., Field, H.A., Stainier, D.Y., Kikuchi, Y., Trinh, L.A., Reiter, J.F., Alexander, J. and Yelon, D. (2003). From endoderm formation to liver and pancreas development in zebrafish. Mech Dev 120(1): 5-18. Ober, E.A., Schulte-Merker, S., Burgess, S., Reim, G., Chen, W., Hopkins, N. and Brand, M. (1999). Signals from the yolk cell induce mesoderm, neuroectoderm, the trunk organizer, and the notochord in zebrafish. Dev Biol 215(2): 167-81. E17-340, 77 Massachusetts Avenue, Cambridge, MA 02139, USA. Odenthal, J. and Nüsslein-Volhard, C. (1998). fork head domain genes in zebrafish. Dev Genes Evol 208(5): 245-58. Okazawa, H., Okamoto, K., Ishino, F., Ishino-Kaneko, T., Takeda, S., Toyoda, Y., Muramatsu, M. and Hamada, H. (1991). The oct3 gene, a gene for an embryonic transcription factor, is controlled by a retinoic acid repressible enhancer. Embo J 10(10): 2997-3005. Oppenheimer, J.M. (1936). Structures Developed in Amphibians by Implantation of Living Fish Organizer. Proc. Soc. exp. Biol. N. Y. 34: 461-463. Pan, G.J., Chang, Z.Y., Scholer, H.R. and Pei, D. (2002). Stem cell pluripotency and transcription factor Oct4. Cell Res 12(5-6): 321-9. Papan, C., Campos-Ortega, J.A., Fekany-Lee, K., Gonzalez, E., Miller-Bertoglio, V. and Solnica-Krezel, L. (1999). Region-specific cell clones in the developing spinal cord of the zebrafish. Dev Genes Evol 209(3): 135-44. Pesce, M. and Scholer, H.R. (2000). Oct-4: control of totipotency and germline determination. Mol Reprod Dev 55(4): 452-7. Pesce, M. and Scholer, H.R. (2001). Oct-4: gatekeeper in the beginnings of mammalian development. Stem Cells 19(4): 271-8. Peyrieras, N., Strahle, U., Rosa, F., Burgess, S., Reim, G., Chen, W., Hopkins, N. and Brand, M. (1998). Conversion of zebrafish blastomeres to an endodermal fate by TGF-beta-related signaling. Curr Biol 8(13): 783-6. E17-340, 77 Massachusetts Avenue, Cambridge, MA 02139, USA. Pfeffer, P.L., Gerster, T., Lun, K., Brand, M. and Busslinger, M. (1998). Characterization of three novel members of the zebrafish Pax2/5/8 family: dependency of Pax5 and Pax8 expression on the Pax2.1(noi) function. Development 125: 3063-3074. Picker, A., Brennan, C., Reifers, F., Böhli, H., Holder, N. and Brand, M. (1999). Requirement for zebrafish acerebellar/FGF8 in midbrain polarization, mapping and confinement of the retinotectal projection. Development 126: 2967-2978. Picker, A., Scholpp, S., Böhli, H., Takeda, H. and Brand, M. (2001). Analysis of the zebrafish pax2.1 promoter in transgenic lines reveals a positive transcriptional feedback loop in mid-hindbrain boundary development.: in revision. Piotrowski, T. and Nusslein-Volhard, C. (2000). The endoderm plays an important role in patterning the segmented pharyngeal region in zebrafish (Danio rerio). Dev Biol 225(2): 339-56. Poulain, M. and Lepage, T. (2002). Mezzo, a paired-like homeobox protein is an immediate target of Nodal signaling and regulates endoderm specification in zebrafish. Development 129(21): 4901- 14. Puelles, L., Marín, F., Martinez-de-la-Torre, M. and Martínez, S. (1996). The midbrain-hindbrain junction: a model system for brain regionalization through morphogenetic neuroepithelial interactions. Mammalian Development. P.Lonai, Harwood: 173-197. Raible, F. and Brand, M. (2001). Tight transcriptional control of the ETS domain factors Erm and Pea3 by FGF signaling during early zebrafish nervous system development. Mechanisms of Development 107 (1-2): 105-117. Reifers, F., Adams, J., Mason, I., Schulte-Merker, S. and Brand, M. (2000). Overlapping and distinct functions provided by fgf17, a new zebrafish member of the Fgf8/17/18 subgroup of Fgfs. Mechanisms of Development 99: 39-49. Reifers, F., Böhli, H., Walsh, E.C., Crossley, P.H., Stainier, D.Y.R. and Brand, M. (1998). Fgf8 is mutated in zebrafish acerebellar mutants and is required for maintenance of midbrain-hindbrain boundary development and somitogenesis. Development 125: 2381-2395. References 124 - Reifers, F., Walsh, E.C., Léger, S., Stainier, D.Y.R. and Brand, M. (2000). Induction and differentiation of the zebrafish heart requires Fibroblast Growth Factor 8 (Fgf8/acerebellar). Development 127: 225-235. Reim, G. and Brand, M. (2002). spiel-ohne-grenzen/pou2 mediates regional competence to respond to Fgf8 during zebrafish early neural development. Development 129(4): 917-33. Reiter, J.F., Alexander, J., Rodaway, A., Yelon, D., Patient, R., Holder, N. and Stainier, D.Y. (1999). Gata5 is required for the development of the heart and endoderm in zebrafish. Genes Dev 13(22): 2983-95. Reiter, J.F., Kikuchi, Y. and Stainier, D.Y. (2001). Multiple roles for Gata5 in zebrafish endoderm formation. Development 128(1): 125-35. Rhee, J.M., Gruber, C.A., Brodie, T.B., Trieu, M. and Turner, E.E. (1998). Highly cooperative homodimerization is a conserved property of neural POU proteins. J Biol Chem 273(51): 34196- 205. Rhinn, M. and Brand, M. (2001). The midbrain-hindbrain organizer. Current Opinion in Neurobiology 11(1): 34-42. Ristoratore, F., Carl, M., Deschet, K. and al., e. (1999). The midbrain-hindbrain boundary genetic cascade is activated ectopically in the diencephalon in response to the widespread expression of one of its components, the medaka gene Ol-eng2. Development 126(17): 3769-3779. Roberts, D.J. (2000). Molecular mechanisms of development of the gastrointestinal tract. Dev Dyn 219(2): 109-20. Rodaway, A., Patient, R., David, N.B. and Rosa, F.M. (2001). Mesendoderm. an ancient germ layer? Cell 105(2): 169-72. Rodaway, A., Takeda, H., Koshida, S., Broadbent, J., Price, B., Smith, J.C., Patient, R. and Holder, N. (1999). Induction of the mesendoderm in the zebrafish germ ring by yolk cell-derived TGF-beta family signals and discrimination of mesoderm and endoderm by FGF. Development 126(14): 3067-78. Roehl, H. and Nüsslein-Volhard, C. (2001). Zebrafish pea3 and erm are general targets of FGF8 signaling. Curr Biol 11(7): 503-7. Rossant, J. and Hopkins, N. (1992). Of fin and fur: mutational analysis of vertebrate embryonic development. Genes Dev 6(1): 1-13. Ruiz i Altaba, A. (1994). Pattern formation in the vertebrate neural plate. TINS 17(6): 233-243. Rupp, R.A.W., Snider, L. and Weintraub, H. (1994). Xenopus embryos regulatie the nuclear localization of XMyoD. Genes and Development 8: 1311-1323. Ryan, A.K. and Rosenfeld, M.G. (1997). POU domain family values: flexibility, partnerships, and developmental codes. Genes Dev 11(10): 1207-25. Salazar-Ciudad, I., Jernvall, J. and Newman, S.A. (2003). Mechanisms of pattern formation in development and evolution. Development 130(10): 2027-37. Sasai, Y. and De Robertis, E.M. (1997). Ectodermal patterning in vertebrate embryos. Dev Biol 182(1): 5- 20. Schier, A.F., Neuhauss, S.C.F., Harvey, M., Malicki, J., Solnica-Krezel, L., Stainier, D.Y.R., Zwartkruis, F., Abdelilah, S., Stemple, D.L., Rangini, Z., Yang, H. and Driever, W. (1996). Mutations affecting development of the embryonic zebrafish brain. Development 123: 165-178. Schmitz, A. and Nagel, R. (1995). Influence of 3,4-dichloroaniline (3,4-DCA) on benthic invertebrates in indoor experimental streams. Ecotoxicol Environ Safety 30(1): 63-71. Schöler, H.R. (1991). Octamania: the POU factors in murine development. Trends Genet 7(10): 323-9. Schöler, H.R., Hatzopoulos, A.K., Balling, R., Suzuki, N. and Gruss, P. (1989). A family of octamer- specific proteins present during mouse embryogenesis: evidence for germline-specific expression of an Oct factor. Embo J 8(9): 2543-50. Scholpp, S. and Brand, M. (2001). Morpholino-induced knock-down of zebrafish engrailed genes eng2 and eng3 reveals redundant and unique function in midbrain-hindbrain boundary development. Genesis: 30(3):129-33. Schulte-Merker, S., van-Eeden, F.J., Halpern, M.E., Kimmel, C.B. and Nusslein-Volhard, C. (1994). no tail (ntl) is the zebrafish homologue of the mouse T (Brachyury) gene. Development 120(4): 1009-15. References 125 - Schulte-Merker, S.S., Hammerschmidt, M., Beuchle, D., Cho, K.W., De Robertis, E.M. and Nüsslein- Volhard, C. (1994). Expression of zebrafish goosecoid and no tail gene products in wild-type and mutant no tail embryos. Development 120: 843-852. Schwarz, M., Alvarez Bolado, G., Urbanek, P., Busslinger, M. and Gruss, P. (1997). Conserved biological function between Pax-2 and Pax-5 in midbrain and cerebellum development: evidence from targeted mutations. Proc Natl Acad Sci U S A 94(26): 14518-14523. Shanmugalingam, S., Houart, C., Picker, A., Reifers, F., MacDonald, R., Barth, A.K., Brand, M. and Wilson, S.W. (2000). Ace/Fgf8 is required for forebrain commissure formation and patterning of the telencephalon. Development 127: 2549-2561. Shimamura, K. and Rubenstein, J.L. (1997). Inductive interactions direct early regionalization of the mouse forebrain. Development 124(14): 2709-2718. Shimozaki, K., Nakashima, K., Niwa, H. and Taga, T. (2003). Involvement of Oct3/4 in the enhancement of neuronal differentiation of ES cells in neurogenesis-inducing cultures. Development 130(11): 2505-12. Sidi, S., Goutel, C., Peyrieras, N. and Rosa, F.M. (2003). Maternal induction of ventral fate by zebrafish radar. Proc Natl Acad Sci U S A 100(6): 3315-20. Simeone, A. (1998). Otx1 and Otx2 in the development and evolution of the mammalian brain. EMBO J 17(23): 6790-6798. Sleptsova-Friedrich, I., Li, Y., Emelyanov, A., Ekker, M., Korzh, V. and Ge, R. (2001). fgfr3 and regionalization of anterior neural tube in zebrafish. Mech Dev 102(1-2): 213-7. Solnica-Krezel, L. (1999). Pattern formation in zebrafish--fruitful liaisons between embryology and genetics. Curr Top Dev Biol 41: 1-35. Solnica-Krezel, L., Cooper, M.S., Wilson, S.W., Brand, M., Eisen, J.S., Fekany-Lee, K., Gonzalez, E. and Miller-Bertoglio, V. (2002). Cellular and genetic mechanisms of convergence and extension. Results Probl Cell Differ 40(11): 136-65. Solnica-Krezel, L. and Driever, W. (1994). Microtubule arrays of the zebrafish yolk cell: organization and function during epiboly. Development 120(9): 2443-55. Solnica-Krezel, L., Schier, A.F. and Driever, W. (1994). Efficient Recovery of ENU-Induced Mutations From the Zebrafish Germline. Genetics 136: 1401-1420. Spemann, H. (1938). Embryonic Development and Induction. New Haven, Connecticut, Yale University Press Spemann, H., Mangold, H., Papan, C., Campos-Ortega, J.A., Fekany-Lee, K., Gonzalez, E., Miller- Bertoglio, V. and Solnica-Krezel, L. (2001). Induction of embryonic primordia by implantation of organizers from a different species. 1923. Int J Dev Biol 45(1 Spec No): 13-38. Stachel, S.E., Grunwald, D.J. and Myers, P.Z. (1993). Lithium perturbation and goosecoid expression identify a dorsal specification pathway in the pregastrula zebrafish. Development 117(4): 1261- 74. Strahle, U., Blader, P., Henrique, D. and Ingham, P.W. (1993). Axial, a zebrafish gene expressed along the developing body axis, shows altered expression in cyclops mutant embryos. Genes Dev 7(7B): 1436-46. Strahle, U. and Jesuthasan, S. (1993). Ultraviolet irradiation impairs epiboly in zebrafish embryos: evidence for a microtubule-dependent mechanism of epiboly. Development 119(3): 909-19. Streisinger, G., Walker, C., Dower, N., Knauber, D. and Singer, F. (1981). Production of clones of homozygous diploid zebra fish (Brachydanio rerio). Nature 291(5813): 293-6. Streit, A., Berliner, A.J., Papanayotou, C., Sirulnik, A. and Stern, C.D. (2000). Initiation of neural induction by FGF signaling before gastrulation. Nature 406(6791): 74-8. Sun, L., Bradford, C.S., Ghosh, C., Collodi, P. and Barnes, D.W. (1995). ES-like cell cultures derived from early zebrafish embryos. Mol Mar Biol Biotechnol 4(3): 193-9. Takeda, H., Matsuzaki, T., Oki, T., Miyagawa, T. and Amanuma, H. (1994). A novel POU domain gene, zebrafish pou2: expression and roles of two alternatively spliced twin products in early development. Genes Dev 8(1): 45-59. Talbot, W.S., Trevarrow, B., Halpern, M.E., Melby, A.E., Farr, G., Postlethwait, J.H., Jowett, T., Kimmel, C.B. and Kimelman, D. (1995). A homeobox gene essential for zebrafish notochord development. Nature 378(6553): 150-7. Tallafuss, A., Wilm, T.P., Crozatier, M., Pfeffer, P., Wassef, M. and Bally-Cuif, L. (2001). The zebrafish buttonhead-like factor Bts1 is an early regulator of pax2.1 expression during mid-hindbrain development. Development 128(20): 4021-34. References 126 - Trinkaus, J.P. (1951). J. Exp. Zool. 118: 269-320. Trinkaus, J.P., Heisenberg, C.P., Tada, M., Rauch, G.J., Saude, L., Concha, M.L., Geisler, R., Stemple, D.L., Smith, J.C. and Wilson, S.W. (1993). The yolk syncytial layer of Fundulus: its origin and history and its significance for early embryogenesis. J Exp Zool 265(3): 258-84. Urbanek, U., Fetka, I., Meisler, M.H. and Busslinger, M. (1997). Cooperation of Pax2 and Pax5 in midbrain and cerebellum development. PNAS 94: 5703-5703. van Leeuwen, H.C., Rensen, M. and van der Vliet, P.C. (1997). The Oct-1 POU homeodomain stabilizes the adenovirus preinitiation complex via a direct interaction with the priming protein and is displaced when the replication fork passes. J Biol Chem 272(6): 3398-405. van Leeuwen, H.C., Strating, M.J., Rensen, M., de Laat, W. and van der Vliet, P.C. (1997). Linker length and composition influence the flexibility of Oct-1 DNA binding. Embo J 16(8): 2043-53. Veenstra, G.J., Mathu, M.T. and Destree, O.H. (1999). The Oct-1 POU domain directs developmentally regulated nuclear translocation in Xenopus embryos. Biol Chem 380(2): 253-7. von Bubnoff, A. and Cho, K.W. (2001). Intracellular BMP signaling regulation in vertebrates: pathway or network? Dev Biol 239(1): 1-14. Wada, H., Saiga, H., Satoh, N. and Holland, P.W. (1998). Tripartite organization of the ancestral chordate brain and the antiquity of placodes: insights from ascidian Pax-2/5/8, Hox and Otx genes. Development 125(6): 1113-1122. Warga, R.M. and Kimmel, C.B. (1990). Cell movements during epiboly and gastrulation in zebrafish. Development 108(4): 569-80. Warga, R.M. and Nusslein-Volhard, C. (1999). Origin and development of the zebrafish endoderm. Development 126(4): 827-38. Warga, R.M. and Stainier, D.Y. (2002). The guts of endoderm formation. Results Probl Cell Differ 40(10): 28-47. Wassarman, K.M., Lewandoski, M., Campbell, K., Joyner, A.L., Rubenstein, J.L., Martinez, S. and Martin, G.R. (1997). Specification of the anterior hindbrain and establishment of a normal mid/hindbrain organizer is dependent on Gbx2 gene function. Development 124(15): 2923-2934. Watanabe, M. and Whitman, M. (1999). The role of transcription factors involved in TGFbeta superfamily signaling during development. Cell Mol Biol (Noisy-le-grand) 45(5): 537-43. Westerfield, M. (1994). The zebrafish book. Oregon, University of Oregon Press. 2nd ed. Wilson, M., Koopman, P., Peyrieras, N., Strahle, U., Rosa, F., Burgess, S., Reim, G., Chen, W., Hopkins, N. and Brand, M. (2002). Matching SOX: partner proteins and co-factors of the SOX family of transcriptional regulators. Curr Opin Genet Dev 12(4): 441-6. Wilson, S.W., Brand, M., Eisen, J.S., Fekany-Lee, K., Gonzalez, E., Miller-Bertoglio, V. and Solnica- Krezel, L. (2002). Patterning the zebrafish central nervous system. Results Probl Cell Differ 40(11): 181-215. Wolke, U., Weidinger, G., Koprunner, M. and Raz, E. (2002). Multiple levels of posttranscriptional control lead to germ line-specific gene expression in the zebrafish. Curr Biol 12(4): 289-94. Wolpert, L. (1981). Positional information and pattern formation. Philos Trans R Soc Lond B Biol Sci 295(1078): 441-50. Woo, K. and Fraser, S.E. (1995). Order and coherence in the fate map of the zebrafish nervous system. Development 121(8): 2595-609. Woods, I.G., Kelly, P.D., Chu, F., Ngo-Hazelett, P., Yan, Y.L., Huang, H., Postlethwait, J.H. and Talbot, W.S. (2000). A comparative map of the zebrafish genome. Genome Res 10(12): 1903-14. Wurst, W., Auerbach, A.B. and Joyner, A.L. (1994). Multiple developmental defects in Engrailed-1 mutant mice: an early mid-hindbrain deletion and patterning defects in forelimbs and sternum. Development 120(7): 2065-2075. Wurst, W. and Bally-Cuif, L. (2001). Neural plate patterning: upstream and downstream of the isthmic organizer. Nat Rev Neurosci 2(2): 99-108. Yabe, T., Shimizu, T., Muraoka, O., Bae, Y.K., Hirata, T., Nojima, H., Kawakami, A., Hirano, T. and Hibi, M. (2003). Ogon/Secreted Frizzled functions as a negative feedback regulator of Bmp signaling. Development 130(12): 2705-2716. Yang, X., Yeo, S., Dick, T. and Chia, W. (1993). The role of a Drosophila POU homeo domain gene in the specification of neural precursor cell identity in the developing embryonic central nervous system. Genes Dev 7(3): 504-16. 127 7 Publications
Reim G, Brand M. spiel-ohne-grenzen/pou2 mediates regional competence to respond to Fgf8 during zebrafish early neural development. Development. 2002 Feb;129(4):917-33
Burgess S*, Reim G*, Chen W, Hopkins N, Brand M (* equal contribution) The zebrafish spiel-ohne-grenzen (spg) gene encodes the POU domain protein Pou2 related to mammalian Oct4 and is essential for formation of the midbrain and hindbrain, and for pre-gastrula morphogenesis. Development. 2002 Feb;129(4):905-16.
Reim G, Mizoguchi T, Stainier D, Kikuchi Y, Brand M. The POU domain protein Pou2 (Oct4) is essential for endoderm formation in cooperation with the HMG protein Casanova. (2003; submitted)
Reim G, Brand M. MZspg mutant embryos reveal new functions of the zebrafish pou2 in dorso-ventral patterning and Epiboly movement. (2003; in preparation) Versicherung zur eingereichten Dissertation
Hiermit versichere ich, dass ich die vorliegende Arbeit ohne unzulässige Hilfe Dritter und ohne Benutzung anderer als der angegebenen Hilfsmittel angefertigt habe; die aus fremden Quellen direkt oder indirekt übernommenen Gedanken sind als solche kenntlich gemacht. Die Arbeit wurde bisher weder im Inland noch im Ausland in gleicher oder ähnlicher Form einer anderen Prüfungsbehörde vorgelegt.
Dresden, den 6. Juni 2003
Dipl.-Biol. Gerlinde Reim