Identification and Characterization of Developmentally

IDENTIFICATION AND CHARACTERIZATION OF DEVELOPMENTALLY

REGULATED COMPONENTS OF THE STRESS AXIS IN PETROMYZON

MARINUS

A Thesis

Submitted to the Faculty of Graduate Studies and Research

In Partial Fulfillment of the Requirements

For the Degree of

Master of Science

in Biology

University of Regina

Matthew Joel Endsin

Regina, Saskatchewan

January, 2013

UNIVERSITY OF REGINA

FACULTY OF GRADUATE STUDIES AND RESEARCH

SUPERVISORY AND EXAMINING COMMITTEE

Matthew Joel Endsin, candidate for the degree of Master of Science in Biology, has presented a thesis titled, Identification and Characterization of Developmentally Regulated Components of the Stress Axis in Petromyzon Marinus, in an oral examination held on December 19, 2012. The following committee members have found the thesis acceptable in form and content, and that the candidate demonstrated satisfactory knowledge of the subject material.

External Examiner: Dr. Mohan Babu, Department of Biochemistry

Supervisor: Dr. Richard Manzon, Department of Biology

Committee Member: Dr. Josef Buttigieg, Department of Biology

Chair of Defense: Dr. Heather Ryan, Faculty of Education

ABSTRACT Genes resembling elements of the Corticotropin releasing hormone (CRH) receptor-ligand system (CRH system) have been identified in invertebrate species and suggest the CRH system has existed, in some form, for approximately a billion years. It is theorized that vertebrates inherited components of the CRH system from an invertebrate ancestor. The association of the CRH system with the stress response, however, is specific to vertebrate species and theorized to have accompanied the development of hypothalamic pituitary (HP) axes, specifically the HP interrenal (HPI) axis in fish.

A functional HPI axis has recently been suggested in the lamprey species

Petromyzon marinus, a member of the ancient vertebrate superclass agnatha, by identification of pituitary and inter-renal components corticotrophin (ACTH) and 11- deoxycortisol respectively. This study, however, is the first to identify the hypothalamic components, specifically the CRH system, of the HPI. In P. marinus the expression of six

CRH system genes, including three hormones, CRH A, CRH B and UCN III-like; two receptors, CRH Rα and CRH Rβ; and a binding protein, CRH BP, are identified by PCR and in silico methodologies.

Analysis of the P. marinus CRH system genes appear to support the occurance of the Agnathan superclass prior to a theorized second vertebrate whole genome duplication

(WGD) event. This is supported by the P. marinus CRH hormones appearing to represent two of the four vertebrate CRH family paralogues; CRH A and B both being orthologous to vertebrate CRH, and UCN III-like being orthologous to vertebrate UCN III.

Additionally, neither CRH Rα nor CRH Rβ, while identified as distinct from one another and related to other vertebrate receptors, were phylogenetically indistinguishable as either

type 1 or 2. This suggests, the two P. marinus CRH receptor genes identified appear to have arisen out of a lamprey specific duplication event they diverged separately from the formation of the type 1 and type 2 receptors. The P. marinus CRH BP deduced amino acid sequence was found to contain regions highly conserved and functionally significant in other vertebrates as well as invertebrate species, and occupies a unique phylogenetic branch. Expression of these genes in brain, gill, liver, kidney as measured by reverse transcription quantitative PCR (RT qPCR) over the life history of P. marinus (including pre-metamorphic larvae, each of the seven stages of metamorphosis, and juvenile parasites) indicated significant variation in gene expression both between tissues and through the life history. Differences in expression were observed for each P. marinus

CRH system gene and correlate with significant physiological changes occurring in the developing P. marinus. Some of these include increases in Na+/K+ -ATPase activity in the gill, possibly relating to salt water tolerance, and lipogenic and lipolytic metabolic phases in the kidney and liver. Interestingly, comparatively high expression levels of

CRH A, CRH B and CRH Rβ were observed in the JP gonad relative to other JP organs.

This suggests these genes may have a paracrine role in this organ, possibly by local regulation of sex steroids, similar to that observed in mice and humans. Interestingly,

CRH system mRNA expression did not vary in response to multiple successive acute stressors, including dewatering and salt water exposure, over a 24 hour period as measured by RT qPCR. This suggests that P. marinus CRH system genes may not respond to such stressors at the level of mRNA expression. Collectively, these data indicate that lamprey contain all necessary components of a complete HPI axis, and that the CRH system likely plays an important role in the normal development.

ACKNOWLEDGMENTS I would like to firstly thank my supervisor, Dr. Richard Manzon, for the exceptional opportunities I have undertaken and experienced over the last few years on this project. Over the course of this project he has regularly offered guidance, support and, perhaps most importantly, a fresh pot of coffee. I believe the camaraderie and cohesiveness of the students in the Manzon lab is a reflection of the attitude of Dr.

Manzon, and has made the lab somewhere I have looked forward to coming into every day. On that note, I would like to acknowledge the members of ‘Team Manzon’, both past and present, which I now have the privilege of calling my friends. Specifically, Amy

Tetlock, who assisted with animal collection and care, and fellow graduate student

‘Texas’ Dan Stefanovic, who shared my passion for football, fishing and biology and offered technical advice throughout my project. I would also like to acknowledge April

Sefton, Rebecca Eberts, and Adam Vantomme who all aided, to a varying degree, with animal collection, sample prep and animal care.

I would like to acknowledge the work of Odette Allenby, Tara Hicks and Dr. Lori

Manzon, who provided the initial sequence data on the lamprey CRH system prior to my arrival as a Masters student.

This work has been made possible by grants from the Natural Sciences and

Engineering Research Council of Canada and the Canada Foundation of Innovation to Dr.

Richard G. Manzon. Matthew Endsin was supported in part by graduate scholarships and awards from both the Faculty of Graduate Studies and Research and the department of

Biology at University of Regina.

iii

TABLE OF CONTENTS ABSTRACT ...... i ACKNOWLEDGMENTS ...... iii TABLE OF CONTENTS...... iv LIST OF FIGURES ...... vi LIST OF TABLES ...... vi LIST OF ABBREVIATIONS ...... viii 1. INTRODUCTION ...... 2 1.1 The Life History of P. marinus ...... 2 1.2 Stress ...... 4 1.3 The Corticotropin Releasing Hormone family ...... 6 1.4 The CRH receptors ...... 13 1.5 The CRH Binding Protein ...... 17 1.6 Objectives ...... 20 2. MATERIALS AND METHODS ...... 22 2.1 Animals ...... 22 2.2 Primer design ...... 23 2.3 Identification and Cloning of Transcripts ...... 24 2.4 In silico analysis ...... 28 2.5 Phylogenetic analysis ...... 29 2.6 Stress Experiment ...... 29 2.7 Developmental and tissue distribution ...... 30 2.8 Data and statistical analysis ...... 35 3. RESULTS...... 36 3.1 Cloning and analysis of P. marinus CRH family transcripts ...... 36 3.2 Cloning and analysis of P. marinus CRH Binding Protein (CRH BP) ...... 45 3.3 Cloning and analysis of P. marinus CRH receptors ...... 46 3.4 Expression Patterns of CRH system transcripts by RT-qPCR during metamorphosis in P. marinus...... 67 3.4.1 Brain ...... 67 3.4.2 Gill ...... 70

3.4.3 Kidney ...... 76 3.4.4 Liver ...... 77 3.5 Distribution of CRH system in Juvenile Parasitic P. marinus...... 82 3.6 Expression Patterns of CRH system genes in the P. marinus stress response...... 86 4. DISCUSSION ...... 92 4.1 Sequence analyses and evolutionary considerations ...... 93 4.1.1 CRH family members ...... 93 4.1.2 CRH receptors ...... 98 4.1.3 CRH Binding Protein ...... 98 4.2 Expression of CRH system transcripts through metamorphosis...... 99 4.2.1 Brain ...... 100 4.2.2 Gill ...... 103 4.2.3 Kidney ...... 105 4.2.4 Liver ...... 108 4.3 Distribution of CRH transcripts in Juvenile Parasites ...... 110 4.3.1 CRH family ...... 110 4.3.2 CRH receptors ...... 112 4.4 Response of CRH system expression to Stress in the CNS ...... 114 5. SUMMARY AND FUTURE DIRECTIONS ...... 117 6. REFERENCES ...... 121 APPENDIX A ...... 145

LIST OF FIGURES Figure 1. Diagram representing the evolution of the CRH family peptides...... 9 Figure 2. Schematic representing organizational structure of the CRH Receptors and ligands. ... 14 Figure 3. Nucleotide and deduced amino acid sequence of P. marinus CRH A...... 37 Figure 4. Nucleotide and deduced amino acid sequence of P. marinus CRH B...... 39 Figure 5. Nucleotide and deduced amino acid sequence of P. marinus UCN III-like...... 42 Figure 6. Alignment of P. marinus CRH A, B and UCN III-like with CRH family members from various species...... 47 Figure 7. Evolutionary relationships of the P. marinus CRH family member pre-propeptides. .... 49 Figure 8 Nucleotide and deduced amino acid sequence of P. marinus CRH BP...... 51 Figure 9. Alignment of Petromyzon marinus CRH BP with select orthologues...... 53 Figure 10. Evolutionary relationship of P. marinus CRH BP...... 55 Figure 11. Nucleotide and deduced amino acid sequence of P. marinus CRH Rα...... 58 Figure 12. Nucleotide and deduced amino acid sequence of P. marinus CRH Rβ...... 60 Figure 13. Alignment of Petromyzon marinus CRH Rα and CRH Rβ with Haplochromis burtoni CRH Receptors type 1 and 2...... 63 Figure 14. Evolutionary relationships of P. marinus CRH Receptors...... 65 Figure 15. Expression of CRH family mRNA in P. marinus Brain tissue by RT-qPCR ...... 72 Figure 16. Expression of CRH family mRNA in P. marinus Gill tissue by RT-qPCR ...... 74 Figure 17. Expression of CRH family mRNA in P. marinus Kidney tissue by RT-qPCR...... 78 Figure 18. Expression of CRH family mRNA in P. marinus Liver tissue by RT-qPCR...... 80 Figure 19. Expression of CRH family mRNA in various Juvenile Parasitic P. marinus tissue by RT- qPCR...... 83 Figure 20. Expression of mRNA in fore, medial and hind brain sections following exposure to multiple acute stressors in P. marinus...... 87 Figure 21. Comparison of mRNA expression between fore, medial and hind brain sections following exposure to multiple acute stressors in P. marinus...... 89 Figure 22. Standard curve and melt analysis of RT qPCR amplicons CRH A, CRH B and UCN III like...... 146 ...... 146 Figure 23. Standard curve and melt analysis of RT qPCR amplicons CRH Rα, CRH Rβ and CRH BP...... 148 Figure 24. Standard curve and melt analysis of RT qPCR amplicons β actin and GAPDH...... 150

LIST OF TABLES Table 1. Primers used to generate cDNA for RACE PCR and amplify CRH axis transcripts by RACE PCR...... 25

Table 2. Primers used to amplify CRH axis transcripts by RT qPCR...... 27 Table 3. Results of one-way ANOVA of developmental and tissue distribution of CRH Axis transcripts...... 68 Table 4. Results of one-way ANOVA and students t-test of CRH Axis expression in P. marinus in different brain regions after exposure to stress...... 69

vii

LIST OF ABBREVIATIONS 7TM 7 transmembrane domain

ACC acetyl coenzyme A carboxylase

ACTH Adrenocorticotropic hormone, or corticotropin

ANOVA Analysis of variance

ATPase Adenosine triphosphatase

BLAST Basic local alignment search tool

BLASTp protein basic local alignment search tool; uses amino acid as query. bp nucleotide base pairs cAMP Cyclic adenosine monophosphate mRNA

CDD NCBI conserved domain database for the functional annotation of proteins. cDNA complimentary deoxyribonucleic acid

CF Condition Factor; measure of body mass and length in determining likelihood of metamorphosis herein describe immediately premetamorphic P. marinus specimens.

CNS Central nervous system

CRH Corticotropin releasing hormone

CRH A P. marinus Corticotropin releasing hormone A

CRH B P. marinus Corticotropin releasing hormone B

CRHR1 Corticotropin releasing hormone receptor subtype 1

CRHR2 Corticotropin releasing hormone receptor subtype 2

CRH BP Corticotropin releasing hormone binding protein

CRH Rα P. marinus Corticotropin releasing hormone receptor A

CRH Rβ P. marinus Corticotropin releasing hormone receptor B

Cq threshold cycle

viii

dATP deoxy-adenosine triphosphate dCTP deoxy-cytosine triphosphate

ΔΔCq normalized relative expression

DEPC Diethylpyrocarbonate dGTP deoxy-guanosine triphosphate

DH Diuretic hormone

DNA Deoxyribonucleic acid dTTP deoxy-thymidine triphosphate

EC Extracellular domain

ERK ½ extracellular-signal-regulated kinases; or classical MAP kinases

EtBr Ethidium bromide

GAPDH Glyceraldehyde 3-phosphate dehydrogenase

GAS General adaptation syndrome gDNA genomic deoxyribonucleic acid

GOI Gene of interest

GPCR G-protein coupled receptor

Gs stimulatory heterotrimeric G protein subunit

GnRH Gonadotropin releasing hormone

GTHβ Beta subunit of gonadotropin

HP Hypothalamic-pituitary

HPA Hypothalamic-pituitary-adrenal axis

HPG Hypothalamic-pituitary-gonadal axis

HPI Hypothalamic-pituitary-interrenal axis

HPT Hypothalamic-pituitary-thyroid axis

HRM Hormone receptor domain

HSL Hormone-sensitive lipase

HSP Heat shock protein

IC Intracellular domain

IRC Inter-run calibrator sample

JP P. marinus specimens in the Juvenile parasitic phase of their life cycle

Na+/K+-ATPase Sodium-potassium adenosine triphosphatase

NCBI National center for biotechnology information nr Protein database Non-redundant protein database maintained by NCBI.

NRT no reverse transcriptase control nt nucleotide

NTC no template control

OD Optical density qPCR Quantitative polymerase chain reaction

PVN Paraventricular nucleus

PCR Polymerase chain reaction

RACE Rapid amplification of cDNA ends

RNA Ribonucleic acid

RT Reverse transcription

SB Sodium borate

SE Standard error in the mean tBLASTn translated nucleotide Basic local alignment search tool; translates nucleotide sequence as query

TGL Triacylglycerol lipase

TH Thyroid hormone

TRH Thyroid releasing hormone

TSH Thyroid secreting hormone

UCN Urocortin type 1

UCN II Urocortin type 2

UCN III Urocortin type 3

UI Urotensin, fish analog of UCN

UTR Untranslated region

WGD Whole Genome Duplication

WUSTL Washington University in St. Louis

1. INTRODUCTION

1.1 The Life History of P. marinus Petromyzon marinus is a living member of the ancient vertebrate superclass

Agnatha, whose ancestry has been traced back 550 million years (Gess et al., 2006;

White, 1935). Together with hagfish, lamprey are considered to be the oldest extant vertebrates on earth and are informally called living fossils, having persisted over 3 major extinction events (Gess et al., 2006; McElwain & Punyasena, 2007). Fossil evidence of lamprey dating back 360 million years suggest that extant lamprey have remained evolutionarily conserved, and, as descendants of the ostracoderms, garner the opportunity to study the evolution of fish, and ancient vertebrates, in a living species (Chang et al.,

2006; Gess et al., 2006; White, 1935).

The P. marinus life cycle is complex and includes embryonic, larval, juvenile parasitic and upstream-migrant adult phases, each with distinct morphologies and physiology (Youson, 1985). Included in the larval phase is a first or true metamorphosis, consisting of 7 definitive stages, during which the larval lamprey transform from salt water intolerant, blind filter feeders to free swimming, seeing parasites capable of living in sea water (Youson & Potter, 1979). About 1 to 3 weeks after hatching, pro- ammocoetes pass down stream and burrow into the upper level of muddy fresh water stream substrate. Pro-ammocoetes take on definitive larval form approximately 5 weeks after hatching and spend the larval period, ~ 3 to 7 years, burrowed in the substrate.

During this period larvae accumulate lipid reserves in preparation for the long non- trophic period of metamorphosis (Hardisty & Potter, 1971). The length of this pre-

metamorphic period, is determined by growth rate, which in turn is dependent on a variety of factors such as food availability, water temperature and animal density

(Youson, 1980). The lamprey endocrine system has been implicated in controlling key life cycle events, including metamorphosis and sexual maturation. While the lamprey endocrine system is the topic of many research papers, there is still a significant amount yet to decipher (Fahien & Sower, 1990; Manzon et al., 2001; Sower, 1998; Youson,

1997). For example, the onset of metamorphosis in P. marinus larvae coincides with a decline in thyroid hormone (TH) levels; distinctly in opposition to other vertebrates that undergo metamorphosis where onset coincides with a marked increase in TH levels

(Galton, 1992; Inui & Miwa, 1985; Youson, 1997).

Post metamorphosis, juvenile parasitic P. marinus migrate downstream to a large body of water either fresh (landlocked) or saltwater to feed by attaching to a host fish and ingesting blood and/or other body fluids for one to two years. Prior to reaching sexual maturity, juveniles begin upstream migration, and once reaching sexual maturity they spawn, and die (Hardisty & Potter, 1971).

During metamorphosis, P. marinus undergo such extensive and significant changes to internal organs and tissue that they do not feed for up to 10 months following the onset of metamorphosis (Potter et al., 1982). Concurrent with significant internal changes, the fish undergo clear external changes. These external morphological changes are the basis for identifying the 7 stages of metamorphosis (Youson & Potter, 1979). The external changes for metamorphic stage determination are specific to the morphology of

5 features: the appearance and development of the eye (which is covered by a dense

dermal layer prior to metamorphosis), fin growth; transformation of the mouth from the larval buccal funnel, used in filter feeding, to the adult oral disc, complete with teeth and a tongue-like piston required for parasitic feeding; changes in body colour from brown to blue-grey and silver; and changes in branchiopore shape from triangular to oval.

Physiologically, P. marinus undergo definitive periods of lipogenesis and lipolysis prior to and during metamorphosis (Lowe et al., 1973). Prior to and early in P. marinus metamorphosis there is a marked phase of lipogenesis with lipid accumulation, specifically triacylglycerols (TAG), in the kidney and liver (Kao et al., 1997; Yamamoto et al., 1986). By stage 4 a prominent decline in body weight is correlated with a phase of lipolysis over the remainder of metamorphosis which results in the depletion of lipids in the kidney and significant reduction in the liver (Kao et al., 1997). During this stage, defined periods of lipid metabolism have been found to coincide with tissue morphology and development in P. marinus. Decrease in lipid content in stages 5 and 7 coincide with the transformation and regression of the kidney and hepatopancreatic systems as well as significant growth of the definitive kidney tissue (Ooi & Youson, 1977).

1.2 Stress The concept of the stress response has evolved over the past centuries deriving its lineage from a concept described by Claude Bernard in 1865 as the ‘interior milieu’, or environment within (Bernard, 1865). Bernard described a system comprising protective mechanisms of an organism’s internal environment whose function was to prevent external influences from disturbing normal physiology. Approximately 60 years later

Walter Cannon would expand on Bernard’s concept and coin the term ‘homeostasis’

(Cannon, 1926; 1929). Cannon defined homeostasis as the coordinated physiological

reactions of an organism to regulate its internal environment, and maintain a stable state

(Cannon, 1926). In 1936, Hans Selye would incorporate the concepts of Bernard and

Cannon in defining his General Adaptation Syndrome (GAS), the prelude to the vertebrate stress response (Selye, 1936). His GAS explains a generalized effort of the organism to adapt itself in response to acute non-specific nocuous agents or stressors capable of disrupting homeostasis (Selye, 1936, 1950). Selye would also implicate the endocrine system in this response, identifying the pituitary-adrenal system and the release of corticosteroids as important for regulation of the mechanisms activated by stress

(Selye, 1946; Selye, 1950).

Selye’s GAS was further adapted to include primary, secondary and tertiary responses to stress, to better accommodate characterization of the stress response in fish

(Barton & Iwama, 1991; Donaldson, 2005). The primary response involves perception of stressors by the central nervous system (CNS) resulting in catecholamine, and corticosteroid release into the bloodstream (Barton, 2002; Donaldson, 2005; Randall,

1992). The secondary response occurs at the cellular level and is initiated by the released stress hormones, primarily cortisol, causing changes in the blood and tissue chemistry, including changes in HSP (heat shock protein) levels and metabolite ion levels (for review see Barton, 2002). Finally, the tertiary response involves aspects of the entire organism including behaviour, development, immune system function, reproductive success and mortality (Arjona et al., 2009).

While the endocrine stress response is important in modulating a broad variety of acute behavioral and physiological responses important for adaptation to changes in the

external environment, chronic stress can be significantly detrimental, and impair normal functions such as wound healing, development and cognition (Khansari et al., 1990;

Lupien et al., 2009; McEwen, 1998). These potentially detrimental effects mean that the response to stress must be tightly regulated. The following focuses on the principal endocrine system responsible for mediation of the vertebrate stress response, the hypothalamic-pituitary-interrenal (adrenal in mammals) axis, or the HPI. Emphasis is placed on the hypothalamic hormone system that mediates the stress response, the

Corticotropin Releasing Hormone (CRH) axis.

1.3 The Corticotropin Releasing Hormone family At the helm of the stress response in fish is the HPI axis, and the principle mediators of this axis are the CRH family of secreted neuropeptides and their targets

(Flik et al., 2006). In 1948, G.W. Harris described a system where the hypothalamus acts via the hypophyseal portal system to stimulated the secretion of pituitary hormones

(Harris, 1951). Following this review, attempts were made to identify releasing factors controlling the secretion of pituitary hormones. The first attempts to purify a corticotropin releasing factor was made in 1955 by two different groups independently,

Roger Guillemin and Andrew Schally (Guillerman & Rosenberg, 1955; Saffran &

Schally, 1955). In 1981, after a nearly 30 years race between the two; a former student of

Dr. Guillerman, Wylie Vale Jr. would be the first to identify the 41 amino acid hypothalamic neuropeptide CRH (Vale et al., 1981). This neuropeptide was identified as the primary regulator of the pituitary ACTH secretion, and, by extension the HPI axis

(Vale et al., 1981). Shortly after this initial discovery, three CRH paralogues, all members of the CRH family, were identified: Urotensin I, (UI; Urocortin, UCN in mammals);

Urocortin II, (UCN II) and Urocortin III (UCN III) (Lederis et al., 1982; Lewis et al.,

2001; Reyes et al., 2001a). These four paralogues would be identified as the predominant mediators of the vertebrate stress response (Flik et al., 2006; Lewis et al., 2001; Reyes et al., 2001; Vale et al., 1981).

In vertebrates, CRH has been intensively investigated, including many mammalian, amphibian, and, teleost species (Huising et al., 2005; Kuniyoshi et al., 2006;

Lederis et al., 1994; Schulkin, 2011). The evolution of this neuropeptide was believed to have coincided with the development of the HP axis; a system currently identified as unique to vertebrates, and was thus categorized as a hypophysiotrope. Recently, however, characterization of Diuretic Hormone (DH)/CRH-like and CRH Binding Protein (BP) genes in insects, and a putative CRH in two species of the tunicate genus Ciona, suggest the CRH family predates the evolution of the HP axis (Lovejoy & Barsyte-Lovejoy, 2010;

Lovejoy & Jahan, 2006). The identification of these CRH-like genes in invertebrates may indicate the hypophysiotropic role of CRH, specifically glucocorticoid regulation and energy metabolism associated with the stress response, evolved more recently than previously thought, and is not unique to vertebrate species.

The four CRH family paralogues identified in vertebrates are believed to have arisen out of Whole Genome Duplication (WGD) events (Alsop & Vijayan, 2009). The initial hypothesis, which has evolved since first postulated by Ohno in 1970, suggests two

WGD events occurred between 530 and 560 million years ago, near the divergence of the agnatha and gnathostomata (Ohno, 1999). An additional third event has been postulated to occur in ancient fish about 320 to 350 million years ago (Holland et al., 2008;

Kasahara et al., 2007; Meyer & Van de Peer, 2005). The initial WGD event is believed to have been the source of the initial split of a putative proto-CRH peptide from a metazoan ancestor into two separate lineages, a proto-CRH/UI and a proto UCNII/III

(Lovejoy, 2009; Lovejoy & Balment, 1999). From this point, a second duplication event is credited with resulting in the four members of the CRH family currently characterized

(Fig. 1). Currently, a complete set of both ligand and receptors required for completion of a typical vertebrate HP-endocrine gland (e.g. Interrenal or Thyroid) axis has not been identified in any invertebrate genome studied (Campbell et al., 2004; Carroll et al., 2008;

Lovejoy & Barsyte-Lovejoy, 2010). This has led to the hypothesis that concomitant with these vertebrate specific WGD events, the CRH system became associated with the HPI axis. Whether the second WGD event occurred before or after the divergence of Agnatha is still a matter of speculation.

In lamprey, rudimentary overlapping HPG and HPT axes have been identified and partially characterized; a full review is beyond the scope of this thesis but can be found in

Sower et al., 2009. In addition to these HP axes, a functioning HPI axis has been suggested in P. marinus through display of elevated 11-deoxycortisol levels, the putative lamprey stress glucocorticoid, in response to injection of human CRH, lamprey pituitary extracts and stress exposure (Close et al., 2010; Sower et al., 2009). Attempting to infer the most likely evolutionary forebear of the CRH paralogues is problematic. The structure of insect CRH/DHs vary between UCN II/III-like and CRH/UI-like making identification of the putative vertebrate proto-CRH unclear

Proto CRH/DH

Proto CRH/UI Proto UCNII/III z z CRH UI UCN II UCN III

Chordates Urochordata C. Intestinalis: CRH/DH like

Agnatha P. marinus: *CRH/UI and UCN II/III

C. milii: CRH1, Chondricthyes CRH2, UI, UCNIII Teleostei C. carpio: CRH1, CRH2, UI, UCNIII

H. Sapiens: CRH, UCN, Tetrapod Duplication event UCNII, UCNIII

*denotes predicted

9 Figure 1. Diagram representing the evolution of the CRH family peptides. Upper: The four vertebrate CRH paralogues are likely derived from a single Proto CRH/DH like ancestor gene by two genome duplication events (black stars upper and lower). The first duplication event, early in vertebrate evolution, likely gave rise to two separate gene lineages, a proto-CRH/UI ancestor and a proto-UCN II/III ancestor. The second round of duplication; which is believed to have occurred after the separation of agnatha and gnathostomata; generated CRH and UI from the proto-CRH/UI ancestor as well as UCN II and UCN III from the proto-UCN II/III ancestor. Lower: schematic of representative chordate species that conform to this model. representatives ranging from basal (top) to more derived (bottom) are indicated. One putative CRH/DH was identified in the urochordate C intestinalis; two CRH family members, a CRH/UI like and a UCN II/III like are predicted in the agnathan P. marinus; two CRH genes, one UI and one UCN III have currently been identified in the chondrichthyes C. milii and teleost C. carpio; all four CRH family members are identified in the tetropod mammal Homo sapiens.

(Coast et al., 2001). Recently, a CRH/DH-like gene has been identified in two species of basal chordates, Ciona intestinalis and Ciona sauvigny (Lovejoy & Barsyte-Lovejoy,

2010). Characterization of the gene in these two Ciona species indicates they are most structurally similar to vertebrate UCN II. This suggests that a UCN II/III-like gene is the likely ancestral form inherited by vertebrates, and the fore runner to the four CRH paralogues; which implies CRH and UI are the more derived of the four paralogues. The specificity of CRH/UI for the receptor 1 subtype (CRHR1), its predominant association with ACTH release, and the hypothesis that a vertebrate HPI axis-type neuroendocrine loop does not exist in tunicates, suggests that CRH/UI, and its association with the stress response, evolved with the HPI axis.

In terms of tissue distribution, the CRH paralogues and their targets vary significantly. In mammals, the expression of CRHR1 is found with CRH, and UCN, which have the highest affinity for this receptor subtype. The primary site of expression of these three genes is in the brain and pituitary; minor expression has also been found in the adrenals, testis, thymus and skin (Drolet & Rivest, 2001; Giraldi & Cavagnini, 1998;

Yao et al., 2004). While CRH and UI have moderate affinity with CRHR2, UCN II and

UCN III interact with CRHR2 with a higher binding affinity and little to no affinity to

CRHR1. Similar to CRHR1, CRH and UCN, UCN II, UCN III and CRHR2 are expressed in the CNS and pituitary. However, unlike CRH, both UCN and CRHR1 genes are expressed to a substantial degree in peripheral tissue, such the liver and kidney (Baigent,

2000). Investigations of tissue distribution of CRH system genes in non-mammalian species has only recently begun, though it appears a similar pattern is emerging as gill

tissue in fish has been identified as a site of CRH system gene expression (Aruna et al.,

2012).

In fish, the CRH family sits atop the HPI axis hierarchy. In response to stress,

CRH family peptides are predominantly secreted by the paraventricular nucleus (PVN) of the hypothalamus. These neurohormones travel to the anterior pituitary and interact with

CRH receptors on corticotropes initiating the signalling cascade of the HPI axis. This cascade includes the initiation of Corticotropin (ACTH) release, which is transported via the blood to the interrenals where it stimulates production and release of glucocorticoids

(11-deoxycortisol in P. marinus) and catecholamines from chromaffin cells. The secreted glucocorticoids and catecholamines are important in various functions in response to stress and are usually associated with the fight or flight response as well as longer term adaptive physiological activity, including those of metabolic, cardiovascular, immune, developmental, and, of course, homeostatic functions. The glucocorticoids also down regulate CRH release in a negative feedback manner, to prevent over activation of the stress axis.

In addition to the being a key component of the stress response, the CRH family have a diverse function in other HP axes, acting as a primary stimulant of TH in many teleost and anuran species (Boorse & Denver, 2006; Breen et al., 1997; Crespi et al., 2004;

De Groef et al., 2003). The CRH family’s TH stimulating activity has predominantly been found to result from binding CRHR2 on thyrotropes. As previously indicated UCN

II and UCN III are selective ligands of CRHR2 suggesting that TH stimulation may be an important role of these two genes (Boorse et al., 2005). This thyroid stimulating ability

has also been found to be important in the initiation of metamorphosis and other developmental processes via TH secretion in both anuran and teleost (Denver, 1995;

Dufour & Rousseau, 2007; Geven et al., 2006; Kuhn et al., 2005; Pepels & Balm, 2004).

Whether the CRH family’s multiple roles is an evolutionary remnant of an ancestral proto-CRH or a more recent neo-functionalization is unknown and requires further investigation.

1.4 The CRH receptors CRH family activity is mediated through binding two distinct members of the class B1 receptors of the G protein-coupled receptor (GPCR) family denoted CRHR1 and

CRHR2, encoded on separate genes. Consistent with other B type GPCRs, CRHR1 and

CRHR2 contain a specific signature 7 transmembrane domain (7TM), characteristic of B- type of GPRCs, three extracellular loops (EC1, EC2, EC3), three intracellular loops (IC1,

IC2, IC3), an intracellular carboxyl terminus and an extracellular amino-terminus (Fig. 2)

(Harmar, 2001). The two receptors are encoded on separate genes and share a highly similar amino acid structure, suggesting they may be the result of a duplication event.

Between the two receptors the majority of similarity is found in the 7TM region, with a higher level of diversity found in the N-terminus (Grammatopoulos & Chrousos, 2002).

The amino terminal region (or N-terminus) of these receptors, responsible in conjunction with EC1 for ligand binding and receptor activation, contains a conserved hormone receptor domain (HRM) and determines the affinity for each of the CRH paralogues

(Dautzenberg et al., 2001). A two-step binding process, posited for B1 GPRC receptors and ligands, involves the initial interaction of the alpha helical carboxy terminal,

C UCN II/III

PTN8-11 N CRH/UI C N

CRH Receptor N HRM EC1 EC2 EC3 Extracellular

1 2 3 4 5 6 7

Intracellular IC1 IC2 IC3 C Signal Transduction

CORT ACTH

14 Figure 2. Schematic representing organizational structure of the CRH Receptors and ligands. The CRH receptors are comprised of a N terminal extracellular portion containing a hormone receptor domain (HRM) followed by seven transmembrane helices (numbered cylinders), which are part of a 7 transmembrane domain (7tm) consistent in all secretin type G-protein coupled receptors (GPCR). Carboxy (C) and amino (N) terminal ends are indicated for each peptide. The HRM domain is critical ligand specificity interacting with the C-terminal portion of CRH family ligands; while the three extracellular loops (EC) within the 7tm domain are involved in interaction with the N terminal portion of CRH family ligands. Intracellular loop 3 (IC3) within the 7tm domain has been identified as crucial to normal CRH receptor signalling. The mature CRH family peptides (CRH, UI; UCN II; UCN III) are comprised of an alpha helical backbone , with a kink around amino acid 25 to 27, resulting in a helix-loop-helix organization (cylinder-line-cylinder). The PTN (amino acid 11 to 13 of the mature CRH or UI peptide) or TFH (roughly amino acid 8 to 11 of the mature UCN II or UCN III peptide) amino acid motifs are important for receptor subtype 1 or 2 specificity respectively. Upon ligand binding, the receptors can activate G-protein signaling pathways including cAMP elevation and ERK 1/2 activation, and stimulate synthesis of the downstream effectors within the HPI axis including ACTH and cortisol.

(approximately amino acids 32 to 41) of the mature CRH ligand (CRH,UI,UCNII and III), with EC1 at the N terminus of the receptor, orienting the ligand and receptor for activation. Once receptor and ligand are properly oriented, the N-terminus of the CRH ligand (approximately amino acids 1 to 16) activates the receptor through interaction with the juxtamembrane region of the receptor (Grace et al., 2007; Nielsen et al., 2000). A central ‘kink’ region of the CRH ligand, (approximately amino acid 25-27) is thought to allow the proper orientation of ligand and receptor for activation (Grace et al., 2007;

Nielsen et al., 2000).

Primary receptor activity is through activation of heterotrimeric G proteins on the intracellular portion of the 7TM domain where the IC3 region of both receptors has been identified as the most critical for signalling (Grammatopoulos, 2012; Harmar, 2001;

Hillhouse & Grammatopoulos, 2006; Punn et al., 2012). Signalling by CRH receptors is primarily accomplished by coupling to the Gs-adenylate cyclase and extracellular signal- regulated kinase (ERK)-1/2 signaling pathways, though cross talk in other signalling pathways does occur (Grammatopoulos & Chrousos, 2002). Regulation of signalling, at the receptor level, is likely primarily accomplished via ligand induced internalisation of the receptors; similar to other class B GPRCs (Van Koppen & Jakobs, 2004; Walker,

1999; Widmann, 1997)

The location of the two receptors has been found to be consistent with the affinity of their ligands; while both receptors were expressed in the same anatomical region, their distribution is relatively distinct (Aruna et al., 2012; Bale & Vale, 2004; Dautzenberg &

Hauger, 2002; Mola et al., 2011; Reyes et al., 2001b; Sasaki et al., 1987). CRHR1 is

found predominantly expressed in the pituitary and brain; moderate expression has been found in the gill and comparatively lower levels of expression in other peripheral tissues, which is similar to CRH and UI localization (Arai et al., 2001; Huising et al., 2005).

Consistent with UCNII and UCN III localization, CRHR2 is expressed to a lower degree in the brain while high expression is found in peripheral tissues including the heart, gonad, gill, gut, kidney and skeletal muscle (Aruna et al., 2012; Bale & Vale, 2004;

Kalantaridou et al., 2004; Mola et al., 2011). Interestingly, CRHR2 expression is mostly lacking on peripheral corticotropes but can have significant levels on thyrotropes. This is consistent with the finding that introduction of exogenous UCN III, which has specific affinity to CRHR2 with little affinity to CRHR1, does not greatly stimulate ACTH secretion, suggesting their role may be separate from classical HPI signalling (Lovenberg et al., 1995; Fekete & Zorrilla, 2007; Venihaki et al., 2004).

1.5 The CRH Binding Protein In addition to regulation of CRH family peptide levels by hierarchical feedback mechanisms, the availability of these peptides are believed to be modulated by a CRH binding protein, CRH BP (Chen & Fernald, 2008a; Huising et al., 2004). CRH BP, unlike the CRH receptors which belong to the GPRC protein family, belongs to its own unique family of proteins which allows the identification of orthologous proteins over a much larger evolutionary distance. A version of CRHBP, highly similar to that of vertebrates, has been identified in honey bees and other insect species. This coupled with the identification of possible CRH/DH ligands, suggest a CRH system existed, at least in some form, prior to the evolution of chordates over 540 million years ago (Huising &

Flik, 2005; Liu et al., 2011).

CRH BP is a 322 amino acid long secreted glycoprotein that interacts and modulates the CRH ligands. Structurally, an approximately 23 amino acid signal peptide is found at the N-terminus; post processing, an N-linked glycosylation site is present (at approximately amino acid 204), and 10 conserved cysteine residues form 5 sequential disulphide bonds yielding the mature protein (Fischer et al., 1994; Huising, 2004).

Additionally, unlike the receptors, CRH BP is not membrane bound, suggesting its role in the stress axis may be accomplished through CRH sequestering for enzymatic degradation (Fischer et al., 1994; Valverde et al., 2001a). However, the protein’s exact function is unclear and it has been theorized that CRH BP may in fact act to protect CRH from degradation or even be involved in some manner in signalling, indicating a much more complex regulatory role (Kemp et al., 1998; Ungless et al., 2003).

The affinity of CRH BP for the CRH ligands varies; in all species studied it appears CRH BP exhibits high affinity for CRH and UI (or UCN) that is approximately equal(Westphal & Seasholtz, 2006). In mammals, specifically humans, CRH BP has no affinity for UCN II, though it does in rats and frog, and CRH BP has little to no affinity for UCN III in humans, rats or frogs (Aruna et al., 2012; Fekete & Zorrilla, 2007;

Valverde et al., 2001). Mutational analysis indicates a conserved alanine motif, (aa. 22 to

25) in CRH BP ligands is a major determinant of CRH BP interaction (Eckart et al.,

2001a; Jahn et al., 2002). While in CRH and UI this region is highly conserved, in UCN

II and UCN III it is found to be much more variable, likely accounting for the difference in affinity of CRH BP for UCN II and II between species (Eckart et al., 2001).

Additionally, photoaffinity labelling and mass spectrometry have identified two ligand contacting arginine residues on CRH BP (aa. 23 and 36), which are conserved in all CRH

BPs studied to date. Moreover, it has been suggested that upstream amino acids at position 31 to 40 of CRH BP are important for ligand interaction (Eckart et al., 2001;

Jahn et al., 2002). The varying affinity of CRH BP for the CRH ligands may be a means of regulation as high expression of one CRH BP ligand could outcompete and dislodge another from CRHBP, making it available for receptor interaction and signalling, or to modulate CRH BP signalling.

Consistent with its association with the stress axis, regulation of CRH BP coincides with the induction of stress and stress hormone release. In response to stress and an increase in glucocorticoid levels, CRH BP mRNA expression is upregulated in the pituitary and remains high for 21 hours following the acute stressor (Seasholtz et al.,

2001).

Anatomical distribution of CRH BP indicate it is present in the brain and pituitary of all species studied; although there is significant variation in peripheral distribution between species, suggesting a species specific function (Aruna et al., 2012; Kemp et al.,

1998; Mola et al., 2011; Nielsen et al., 2000). CRH BP predominantly colocalizes with

CRH ligands and receptors near corticotropes; however, co-localization with gonadotropic and lactotropic cells in the female pituitary of rats has also been observed

(Speert, 2002). The latter suggests CRH BP expression may be sexually dimorphic and may to be related to regulation of maternal aggression (Gammie et al., 2008).

Additionally, a considerable increase in CRH BP levels has been demonstrated in response to rising sex hormones, such as estrogen, and gonadotropin releasing hormone,

GnRH, suggesting significant overlap with the gonadal axis (Gammie et al., 2008;

Westphal & Seasholtz, 2005, 2006). CRH BP has also been detected in regions absent of

CRH ligands and receptors indicating the possibility of a role independent of these proteins (Chan et al., 2000). Collectively, this evidence suggests CRH BP has an extremely complex and diverse function; further research is needed to characterize the potentially multiple roles within various endocrine axes and beyond.

1.6 Objectives The CRH system and its peptides represent one of the most evolutionarily ancient peptides in the vertebrate endocrine system and carry a diverse and complex functionality that has potentially become more specific throughout vertebrate evolution. This in conjunction with the antiquity of the agnathan class, grants an exceptional opportunity to gain insight into the evolution of a fundamental vertebrate endocrine system in one of the oldest extant vertebrates. Characterization and evolutionary analysis of the genetic and deduced amino acid structures of the CRH receptors, their ligands, and CRH BP in P. marinus may help further understand the evolution of these genes, and of the HPI axis itself in vertebrate species. Additionally, identifying changes in expression of these genes, from premetamorphic larva, through metamorphosis and in the juvenile parasitic life histories of P. marinus, will help shed light on the potential role of the CRH system as an integral part of the vertebrate developmental system, and, more specifically in the development of P. marinus.

The objectives of my research are as follows:

1. Identify the complete coding sequences of the P. marinus CRH system genes.

2. Compare levels of CRH system gene expression in select organs (and tissues) of P. marinus

3. Characterize changes in expression of CRH system transcripts from premetamorphic larvae, through metamorphosis and in juvenile parasitic stages of the P. marinus life history

4. Characterize the effect multiple acute stressors have on the expression of CRH system genes in the brain of P. marinus juvenile parasites.

2. MATERIALS AND METHODS

2.1 Animals

P. marinus larvae were collected from Oshawa Creek, Ontario, Canada in May

2008 using backpack electro-fishers (Smithroot, Vancouver, WA, USA) and transported to the University of Regina aquatics facility. Larvae were housed in glass aquaria containing continuously filtered de-chlorinated tap water and 7 - 10 cm of sand, with a 12 hr light/dark cycle at 18 - 21 °C. Larvae were fed twice a week with a baker's yeast suspension equivalent to 1 g yeast per animal. Water and sand were changed twice a month or more frequently as required. Larvae were allowed to undergo spontaneous metamorphosis. Metamorphic stage (1 to 7) was determined as per Youson and Potter,

(1979). Post metamorphic juvenile lamprey (JP) were housed in 440 gal tanks and maintained as above with the exception of being allowed to feed parasitically on

Oncorhunchus mykiss from the Fort Qu’appelle fish hatchery (Fort Qu’appelle, SK,

Canada). All animal care and experimental treatments were approved by and performed in accordance with the guidelines established by the University of Regina’s President’s

Committee on Animal Care (PCAC) and were based on Canadian Council on Animal

Care (CCAC) guidelines. Immediately pre-metamorphic larvae, denoted CF, are larvae with a condition factor (CF; CF = weight (g) / (length (mm)) 3x 106) of 1.5 or greater with a length and weight greater than or equal to 120mm and 3g, respectively (Potter et al.,

1978). Immediately pre-metamorphic lamprey are hereafter referred to as CF. Tissues were collected from each metamorphic stage, CF larvae, and juvenile parasitic (JP) lamprey. Lampreys were anesthetized by immersion in 0.05% buffered solution of tricaine methane sulfonate (MS-222; Syndel Laboratories, Vancover, BC, Canada).

Lamprey were bled by caudal severance and euthanized by decapitation. Brain, gill, heart, liver, intestine, and kidney were harvested immediately following euthanasia. All tissues were immediately flash frozen in liquid nitrogen after removal and stored at -80.

Total RNA was isolated using the Trizol® Reagent (Invitrogen, Burlington, ON,

Canada), according to manufacturer's instructions using 1.0ml of Trizol® per 100 mg tissue. Purified RNA was resuspended in RNAse/DNAse free water (TekNova, Hollister,

CA) and stored at -80. All reagents and materials were certified RNAse-free or treated with 0.1 % diethylpyrocarbonate (C6H10O5; DEPC) for 24 hours followed by autoclaving to inactivate the DEPC. The yield and purity of RNA was confirmed by spectrophotometric determination at wavelengths of 230nm, 260nm and 280 nm using a

Nanodrop spectrophotometer (Thermoscientific, USA). Acceptable RNA was deemed as having absorbance ratios of between 1.8-2.1 (260nm/280nm) and greater than 1.8

(260nm/230nm). Integrity of RNA was determined by visually confirming the presence of 28S and 18S ribosomal RNA bands, at an approximate ratio of 2:1, by electrophoresis on a 1.0% agarose gel containing sodium borate (SB; 10 mM NaOH, 0.39 M boric acid, pH 8.5) as the gel and electrode buffer with 1.0μg/L ethidium bromide (EtBr) added to the gel to visualize RNA by UV fluorescence.

2.2 Primer design

Primers for CRH system transcripts were developed using sequence fragments previously identified by the Manzon lab (R.G. Manzon unpublished) and from sequences derived from 3’ and 5’ rapid amplification of complimentary DNA (cDNA) ends (RACE)

PCR experiments. Primers for P. marinus glyceraldehyde 3-phosphate dehydrogenase

(GAPDH, Genbank accession number AAT70328) were designed based on previously reported sequence (Pancer et al., 2004; Stock & Whitt, 1992). Primers for P. marinus β

Actin were designed based on mRNA sequence previously known (R.G. Manzon unpublished). All primers were designed using the using Primer3Plus web based program (Untergasser et al., 2007) (http://www.bioinformatics.nl/cgi- bin/primer3plus/primer3plus.cgi). To ensure the specific amplification of mRNA and not genomic DNA where possible, primers spanned multiple exons. Primer specificity was confirmed using the in silico PCR tool available on the University of California, Santa

Cruz (UCSC) Genome Bioinformatics site (http://genome.ucsc.edu), selecting v.3.0 of the lamprey gene assembly (March 2007), and 1% SB agarose gel electrophoresis of PCR products, or, for reverse transcription quantitative PCR (RT-qPCR) experiments, by melt curve analysis. The sequences of all primers are shown in table 1. All primers were synthesised by Sigma-Aldrich (Oakville, Ontario).

2.3 Identification and Cloning of Transcripts

Previously, partial sequences for each gene of interest (GOI; CRH A, B, UCN III- like, CRH Rα, CRH Rβ and CRH BP) were identified via degenerate and homologous

PCR cloning (R.G. Manzon unpublished). Briefly, the P. marinus genome, available through the Genome Sequencing Center at Washington University School of Medicine in

St. Louis (WUSTL) website (P. marinus draft assembly v 3.0 March 2007) was screened, in silico, using the MegaBLAST algorithm (Altschul et al., 1990) bundled within the website. The query sequences used to search the lamprey genome were CRH system sequences previously identified within the Danio rerio genome. Identified

Table 1. Primers used to generate cDNA for RACE PCR and amplify CRH axis transcripts by RACE PCR. Primer name is indicated in bold above sequence.

Volume/ Nucleotide Reaction TRANSCRIPT Primer and Sequence 5'?3' Concentration position 5' type TARGET per reaction  3' 3' RACE CDS Primer A ( 12 µM) 3'RT for AAGCAGTGGTATCAACGCAGAGTAC(T)VN 1µL ~ 3' mRNA 30 3' RACE (N = A, C, G, or T; V = A, G, or C 5' RACE CDS Primer A ( 12 µM) 5'RT for (T) VN 1µL ~ 5' mRNA 25 5' RACE (N = A, C, G, or T; V = A, G, or C) SMART II A Oligonucleotide (12 µM) 5'RT for 1µL ~ 5' mRNA AAGCAGTGGTATCAACGCAGAGTACGCGGG 5' RACE Universal Primer A Mix (UPM) (10x): Long (0.4 µM): CTAATACGACTCACTATAGGGCAAGCAGTGGTATC 3' and 5' cDNA primary 1x ~ AACGCAGAGT RACE ends Short (2 µM): PCR CTAATACGACTCACTATAGGGC Nested Universal Primer A (NUP; 10 µM) nested 3' and 5' 400nM ~ cDNA AAGCAGTGGTATCAACGCAGAGT RACE PCR ends CRHB 3 RACE 13 3' RACE 200nM 399 GAGTCGCTCTCCTCGTCGCCGTCAG GSP1 CRHB REAL 86F 3' RACE nested 100nM 520 TCACCTTTCACATTCTTCGC NGSP1 CRH B CRHB411R 5' RACE (Fig. 4) 250nM 497 CTCCGCCCTCATTTCTCTCCTCCTC GSP2 CRHB_R203 5' RACE nested 100nM 313 GATGACGAGGAGTGGCTGGAAGAGG NGSP2 CRH_C_5137 3' RACE 100nM 137 GTGAACGGGGTAGAAGACCGACAGC GSP1 UCN III CRHCF460 3' RACE 50nM 460 Like nested CGGGTCCTGTTTTCTTCGTCTTA NGSP1 (Fig.5) BPR4 3' RACE 200nM 633 CAGCGTGTGGATGCCGTC GSP1 CRHBP344F 3' RACE Nested 200nM 385 GTCAAACACCGTGAGCGAGTCCC NGSP2 CRH BP CRH BP210Rev 5' RACE 200nM 520 (Fig.8) ATCCTGTTCAACATCGCCACTCCG GSP1 BP 670F 5'RACE Nested 200nM 662 GCTTCTCCATCATCTATCCCGTG NGSP1 9958F 3'RACE 200nM 139 GACACCAGCAAGAGCGTGTACCG GSP1 CRHR28042Ex1F CRH Rα 3'RACE (Fig. 11) Nested 200nM 726 TTGTCGAGGGCTGCTACC NGSP1 CRHR2455-rev 3'RACE 200nM 952 CGGGGAAACACATCGATTAC GSP1 CRH_R2_261 3'RACE Nested 300nM 1148 CTTCTTCGTAAATCCTGGCG NGSP1 CRH Rβ CRHR5146Ex4R 3'RACE (Fig. 12) Nested 300nM 960 GTTTCCCCGCTGTTTTCC NGSP3 CRHR2REV140 3'RACE Nested 300nM 429 CATTCTCCAGACACTCTCGGTATACG NGSP2

homologous sequences within the lamprey genome were used to generate gene specific primers.

CRH system sequences were extended by 3’ and 5’ RACE PCR with nested gene specific primer pairs using cDNA generated from reverse transcription of total RNA from

P. marinus ammocoete brain tissue (Table 2). Total RNA (1.0μg) isolated from pooled brain tissue was used as a template to generate cDNA for 3’ and 5’ RACE PCR using the

SMART RACE kit (BD Clontech) following manufacturer’s protocol. Up to 2.0ul of reverse transcribed cDNA was used as template for the subsequent primary PCR reactions. For the nested reaction up to 4μl of primary PCR reaction was used with nested gene specific primers. Both primary and nested reactions were conducted using the Kapa

HiFi hotstart PCR kit following manufacturer’s protocol using 25μl final PCR volumes

(Kapa Biosystems Woburn, MA, USA). Briefly, each reaction contained 1x Kapa HiFi

Buffer, 0.2mM each of the deoxynucleotides dATP, dGTP, dCTP and dTTP, 200nM of gene specific primer and 0.5U of Kapa HiFi HotStart DNA polymerase (Kappa

Biosciences). PCR parameters for both nested and primary PCR reactions were as follows: initial denature at 95°C for 3 min followed by 25 cycles at 98°C for 30sec, 57°C for 30 sec, 70°C for 30sec followed by final extension at 72°C for 3 min. Products were identified on 1% SB agarose gels. Fragments of 0.1–1 kb were extracted from the gel using the QIAEXII Agarose Gel Extraction Kit (Qiagen, Mississauga, ON), as per manufacturer's protocol. Purified fragments were cloned into the pCR2.1 TOPO vector

(Invitrogen) as per manufacturer’s protocol. Recombinant plasmid DNA was isolated using the E.Z.N.A.® Plasmid Mini Kit I (Omega Bio-Tek, Inc. Norcross, GA). DNA

Table 2. Primers used to amplify CRH axis transcripts by RT qPCR. Reaction efficiencies and optimum concentrations were determined by standard curve; optimum concentrations of each was determined to be 200nM per reaction. All primers were synthesized by Sigma Aldrich (Ontario).

Amplicon Target Reaction Primer length Sequence 5' to 3' gene efficiency (nt) CRH A9F GAAATCCACCAGCCTTCTCGTCCTC CRH A 394 93.10% CRH A403R CGCCCTCCACCGCCCCACCA CRH B3RACE13 GAGTCGCTCTCCTCGTCGCCGTCAG CRH B 95 103.80% CRH B5RACE384 CGCCCTCATTTCTCTCCTCCTCGTC CRH CREAL192F UCN III- ATGACGAGGAGGAGGATGACGAGGA 192 102.30% CRH CREAL192R Like TGCTCAGGATGTTGGTGGGAAC CRH BP210Rev ATCCTGTTCAACATCGCCACTCCG CRH BP 114 104.30% CRHBPR4 GACGGCATCCACACGCTG CRHR28042Ex1F TTGTCGAGGGCTGCTACC CRH Rα 167 105.70% CRHR1- 168 GAAGATGAAAAGTGCTGGTTTGGGAAAA 5146AF GTCTGTAACAGCACCTTGGACGAGATCG CRH Rβ 99 90.80% 5146AR CCACGATGGGCTTACACTCCGAGTAG beta747F CACTGCCGCATCATCCTCGTCGC βActin 202 99.30% beta949R TGGCGTACAGGTCCTTGCGGATGTC GAPDHF ATGCTTACCCCATGGGATGTT GAPDH 329 104.40% GAPDHR GCCGAAGTTGTCGTTGATGACCTTGG

inserts were sequenced (BioBasics, Mississauga, ON; Eurofins Operon) using M13 forward and reverse primers, contained within the Topo vector.

2.4 In silico analysis

To extend transcripts using nucleotides from previously identified genomic sequence and determine transcript splicing, the cDNA from sequenced clones were mapped to the P. marinus genome. This was done by querying versions 3.0 and 7.0 of the

P. marinus draft assembly by MegaBLAST and BLASTn respectively with the cDNA nucleotide sequences (v.3.0 Mar. 2007 UCSC Genome Browser, http://genome.ucsc.edu/; v7.0 Ensembl release 68 July 2012, http://uswest.ensembl.org/Petromyzon_marinus/Info/Index;). Coding sequences were identified by submitting nucleotides (nt) from sequenced clones and 1000 nt in the 3’ and

5’ directions from regions identified in the P. marinus draft assemblies to the

AUGUSTUS gene prediction web interface, available on the University of Greifswald

Bioinformatics webserver (http://bioinf.uni-greifswald.de/bioinf; Stanke et al., 2008). The nucleotides from sequenced clones were submitted as cDNA sequence under expert options and P. marinus was selected as the organism for all predictions.

The deduced amino acid sequences were examined using the SignalP 4.0 web interface (http://www.cbs.dtu.dk/services/SignalP/) and Neuropred

(http://neuroproteomics.scs.illinois.edu/neuropred.html) to predict signal peptides and other processing sites (Petersen et al., 2011a; Southey et al., 2006). The two putative

CRH Receptors were examined for transmembrane helices using TMHMM version 2.0

available on the TMHMM server 2.0 (http://www.cbs.dtu.dk/services/TMHMM/) (Krogh et al., 2001) .

2.5 Phylogenetic analysis

To identify orthologous sequences and protein domain, the non-redundant (nr) protein, and conserved domain database (CDD; Marchler-Bauer et al., 2011) databases, maintained by NCBI, were queried with the deduced amino acid sequence of predicted

CRH system genes using BLASTP (31 March 2011; http://blast.ncbi.nlm.nih.pov/blast.cpi). Select orthologous sequences from classes amphibia, actinoperygii, mammalia and some invertebrate species, were aligned with the deduced amino acid sequence of the identified P. marinus CRH system transcripts using

Clustal Omega (http://www.ebi.ac.uk/Tools/msa/clustalo/; Sievers et al., 2011).

Alignments were manually optimized using BioEdit v7.1.3 (Hall, 1999). Phylogenetic reconstruction was carried out for the three CRH family transcripts (CRH A, B and UCN

III-like), two CRH family receptors (CRH Rα and Rβ) and CRH BP, using the neighbor- joining method. Bootstrap values were determined by 1000 replicates; phylogenetic analysis and output trees were generated using Mega5 software (Kumar et al., 2008). Full species names and GenBank or Uniprot accession numbers for the cDNAs are in legends for Fig. 7, 10, and 14.

2.6 Stress Experiment

Juvenile parasitic P. marinus were exposed to a prolonged (24 h) stress paradigm to identify the response of CRH system. Fish were randomly assigned to either a stress or control group (n=5 for each), and maintained in separate aquaria containing de-

chlorinated tap water kept at 11°C. Both stress and control groups were withheld food and allowed to acclimate to aquaria conditions 72h prior to stress exposure. At t=0 the fish were dewatered for 30 minutes into a dry bucket, fish were then introduced into a

35‰ salt water solution, similar to natural sea water, maintained at 11°C for 60 min prior to recovering in fresh water for 30 min. This was repeated 11 times over 24 hrs.

Immediately following the 24h stress period both stress and control groups were anaesthetized in MS-222 before euthanization by decapitation. Brain tissue was dissected into forebrain (telencephalon), mid brain (mesencephalon), and hind brain

(rhombencephalon) regions and placed into 2.0μL microcentrifuge tubes before flash freezing in liquid nitrogen storing at -80°C. Total RNA was isolated, and the quality was assessed as indicated above. RNA was stored at -80˚C prior to reverse transcription (see below).

2.7 Developmental and tissue distribution

Brain, gill, kidney and liver tissue from CF, each stage of metamorphosis, and JP, as well as gonadal tissue from JP were used to determine the organ specific distribution of P. marinus CRH system transcripts and their variation through development. For all organ samples examined, total RNA was extracted using TRIZol reagent. RNA quality was determined as previously described (see above). Reverse transcription (RT) was performed using the QuantiTect® Reverse Transcription Kit (Qiagen, Mississauga, ON,

Canada), according to manufacturer's protocol, to generate cDNA for RT qPCR using

1μg of total RNA per reaction as template. A no reverse transcriptase control (NRT) was performed, following the same procedure as for RTs, with the exception that the

QuantiTect® Reverse Transcriptase was replaced with an equal volume of

RNAse/DNAse free water for each sample. Briefly, RT reactions were made up in 60μL reaction volumes, each containing 3μL reverse transcriptase, 6μL gDNA wipeout buffer,

3μL primer mix, 12 μL RT buffer and 3 μg total RNA with the remaining volume comprised of RNAse/DNAse free water. Required incubations were performed in a MJ

Research PTC-200 Thermo Cycler using a heated lid. Following RT, newly synthesized cDNA was stored at -20°C prior to use in RT-qPCR. RT-qPCR experiments were performed using the PerfeCTa® SYBR® Green SuperMix kit (Quanta BioSciences,

Maryland, USA) and designed to follow the guidelines outlined by the Minimum

Information for Publication of Quantitative Real-Time PCR Experiments (MIQE; Bustin et al., 2009). To determine PCR conditions, including optimum primer concentration, annealing temperature, reaction efficiency and template amount, standard curves were developed varying these conditions for each GOI. Briefly, standard curves for each GOI consisted of 5 dilution points spanning the equivalent of 100ng to 1pg of total RNA. Each dilution point was made in triplicate by serially diluting cDNA, generated by RT of total

RNA pooled from ammocoete brain tissue. Optimum conditions were defined by the following: a threshold cycle between 20 and 30, amplification efficiency between 90 and

110%, and a single amplicon as determined by melt curve analysis. Primer pairs, optimum concentration, and amplification efficiency, as determined by standard curve, are indicated in table 1. Inter-assay variation for each gene was accounted for by using an inter-run calibrator sample (IRC), comprised of cDNA generated by RT of total RNA from pooled ammocoete brain tissue. The IRC was run in triplicate for each GOI run on every plate (assay) containing the GOI.

To account for variation in RNA loading and RT efficiency, each GOI was normalized to GAPDH and β-actin, which have a stable expression in P. marinus (R.G.

Manzon, unpublished, data not shown; Shifman et al., 2009; Yu et al., 2009) and are established reference genes in RT qPCR analysis (Vandesompele et al., 2002). For each

GOI, cDNA equivalent to 100ng of total RNA was used per reaction as determined by standard curve (see above). The cDNA equivalent to 10ng per PCR reaction was determined as the optimum template amount for the two reference genes, β Actin and

GAPDH by standard curve (see above). Reactions were prepared in 25μL volumes, following manufacturer’s protocols, in triplicate, by generating a 3.3 times master mix containing all reagents and pipetting 25 μL of this into RNAse/DNAse free PCR microtubes (Axygen). Each 25μl reaction volumes contained 12.5 μL supermix, cDNA equivalent to 100 ng total RNA, 200 nmol each of the forward and reverse primer for the

GOI (table 1) and the remaining volume consisting of RNAse/DNAse free water. To ensure reactions were free from contaminating DNA a no template control (NTC) was used in each assay and contained all reagents except the template cDNA which was replaced with RNAse/DNAse free water.

RT qPCR reactions were performed using an iQTM5 Thermocycler or a CFX96

TouchTM Real-Time PCR Detection system (Bio-Rad Laboratories, Mississauga, ON,

Canada). The reaction profile for all runs are as follows: 3 min at 95 °C; 45 cycles of: 15 sec at 95 °C, 30 sec at 60 °C, 30 sec at 72 °C, with SYBr green detection at the end of each cycle. Following amplification, melt-curve analysis was performed from 55 to 95°C, increasing 0.5°C at 10 sec intervals from 55 - 95 °C with SYBr green detection at each interval. CFX Manager software (version 2.1; Life Sciences Group, 2011; Bio-Rad) was

used to determine the expression of each GOI normalized to β-actin and GAPDH to account for differences in reverse transcription and PCR efficiency.

In all cases, threshold cycle (Cq) values were determined by CFX Manager software using single threshold determination mode with the baseline determined by the software by baseline subtracted curve fit. Only the means of closely agreeing replicates were included in the data analysis. RT qPCR reactions were free of spurious transcripts, as determined through melt-curve analysis and through NTC and NRT controls (see above). Expression normalized to β-actin and GAPDH and relative to the IRC was determined using the Pfaffle method with the following formulae (Pfaffl, 2001):

Equation 1. Amplification efficiency for each primer pair

Where:

slope = Slope of the line derived from the standard curve.

GOI = Gene of Interest/primer pair.

E(GOI)= Efficiency for gene of interest/primer pair.

Equation 2. Amplification efficiency converted into percent

Where 100%=2.

Equation 3. Relative quantity (ΔCq) of the sample for the gene of interest.

Where ΔCqSample(GOI) = Relative Quantity for the individual gene of interest/ primer pair

Cq(Control) =Average Cq of the IRC on the sample plate for the primer pair

Cq(Sample) = Average Cq of the sample for the gene of interest/primer pair

Equation 4. Normalization factor for each sample.

Where:

NF = Normalization Factor for the sample

ΔCq = Relative quantity of the sample for βA (β Actin) and GAPDH.

Equation 5. Normalized relative expression (ΔΔCq) of the sample.

Where:

ΔΔCq Sample(GOI) = relative quantity of the Gene Of Interest/primer pair in the sample, normalized to the quantities of βA and GAPDH and relative to the IRC.

2.8 Data and statistical analysis

RT qPCR expression data were derived mean relative values, ΔΔCq. To better fit the required assumptions of homoscedasticity and normal distribution for a parametric one-way ANOVA, ΔΔCq values for each sample were Log transformed to the base of 2.

Homoscedasticity was assessed by Levene’s test prior to evaluation difference by one way ANOVA; Welch’s ANOVA was applied in cases where variances were found to be heteroscedastic according to Levene’s (P>0.05). Statistically significant (P<0.05) results were further analysed by either Duncan’s multiple range test (homoscedastic variance) or by Games-Howell (heteroscedastic variance) post-hoc tests to determine pair-wise differences at P<0.05. Determination of significant difference between stress and control groups was accomplished using student’s t-test with differences accepted as statistically significant when P<0.05. All statistical tests were conducted using SPSS software

(version 20, IBM). Data are reported as mean ± standard error (SE).

3. RESULTS

3.1 Cloning and analysis of P. marinus CRH family transcripts

Three CRH family transcripts, designated CRH A (599nt), B (1070nt) and UCN

III-like (801nt) were identified in P. marinus (Fig. 3, 4 and 5). Within the cloned CRH A sequence a 564bp (base pairs) coding region, terminated in an amber stop codon, was predicted and translated into an 188aa pre-propeptide by AUGUSTUS (Fig. 3). Although the complete 5’ and 3’ UTR were not obtained, a 6 bp partial 5’ UTR and 27 bp 3’ UTR were identified. Neither promotor nor poly-adenylation signals were identified in the short UTR sequences. The CRH A transcript did not map to any scaffold in the P. marinus gene build v7.0, however, it did map (99% id) to position 1051-1649 on

Contig1014 of P. marinus gene build v.3.0. Alignment with this contig indicated the entire coding sequence of CRH A was comprised of a single exon

Analysis of the cloned P. marinus CRH B sequence indicate it consists of 131 bp of 5’ UTR sequence, 489 bp of coding sequence, an amber stop codon, and a 447bp 3’

UTR, which contained a polyadenylation signal (position 1020–1026; Fig. 4). No in frame stop codon was identified upstream of the predicted start codon, as such the predicted start codon also was confirmed using the AUGUSTUS gene prediction software. This CRH B transcript mapped to scaffold GL480439 (position 163-1222) in the P. marinus gene build v7.0. An alignment of the CRH B transcript with this region indicated the gene is encoded on a single exon.

37 Figure 3. Nucleotide and deduced amino acid sequence of P. marinus CRH A. The nucleotide sequence is displayed in lower case above the encoding amino acid (aa). Nucleotides were determined by the sequencing of cDNA clones generated by PCR and RACEs. Important functional regions are indicated: dibasice proteolytic cleavage site (outlined), putative region of receptor specificity (outlined and shaded), putative region of CRH BP binding (double outline), C terminal amidation site (outlined with double underline), in frame stop codon (-). The predicted start codon was determined by submitting the cDNA sequence to Augustus gene prediction software, using the web interface on the University of Griefswald server selecting P. marinus as the organism and alignment with sequences from other species.

38 39 Figure 4. Nucleotide and deduced amino acid sequence of P. marinus CRH B. The nucleotide sequence is displayed in lower case above the encoding amino acid (aa). Nucleotides were determined by the sequencing of cDNA clones generated by PCR and RACE. Important functional regions are indicated: monobasic proteolytic cleavage site (outlined), putative region of receptor specificity (outlined and shaded), putative region of CRH BP binding (double outline), C terminal amidation site (outlined with double underline), in frame stop codon (-), polyadenylation site underlined nucleic sequence. The predicted start codon was determined by submitting the cDNA sequence to Augustus gene prediction software, using the web interface on the University of Griefswald server selecting P. marinus as the organism and alignment with sequences from other species.

The 504 bp UCN III like coding sequence; generated by appending 120 bp from v.7.0 of the lamprey gene build (scaffold GL 483347 position 8982-9102; July 2012) to the 5’ end of a partial 681 bp UCN III-like transcript from sequenced clones, was identified by the AUGUSTUS gene prediction software (Fig. 5). The UCN III-like gene was terminated by an in frame amber stop codon, followed by a 297bp 3’ UTR. The resulting comparison of the UCN III-like coding sequence with the genomic sequence indicate the gene spanned two contigs (AEFG01040189, AEFG01040190) of scaffold GL

483347 in v. 7.0 of the lamprey gene build; as such it was unclear whether or not the

UCN III-like gene was encoded on multiple exons.

CRH A and B transcripts, which encode 188aa (CRH A) and 163aa (CRH B) peptides, contain a conserved signal peptide (M1-G25 and M1-S23 respectively), consistent with secreted neuropeptides, as deduced by SignalP4.0 (Petersen et al., 2011b). A CRF domain (CDD: smart00039), important for high affinity binding to the CRHR1 receptor, was found in the mature peptide of both sequences, by querying the CDD database.

Absent from both pre-propeptides, when compared to CRH pre-propeptides in other species, a second conserved region within the cryptic peptide (Fig.4). The mature P. marinus CRH peptides are ﬂanked by a dibasic (CRH A; Fig. 3) or monobasic R/K-X2-

R/K (CRH B; Fig. 4) proteolytic cleavage sites and C-terminal amidation sites, as predicted by Neuropred (Southey et al., 2006), and by comparison with orthologous CRH sequences. After processing, the CRH A and CRH B mature active neuropeptides are predicted to be 41aa long (S146–I186 and A121-V161 respectively; Figs. 3, 4). Alignment of the complete (pre-propeptide) deduced amino acid sequences of CRH A and B indicate

42 Figure 5. Nucleotide and deduced amino acid sequence of P. marinus UCN III-like. The nucleotide sequence is displayed in lower case above the encoding amino acid (aa). Nucleotides were determined by the sequencing of cDNA clones generated by PCR and RACE and by appending genomic sequence from scaffold GL 483347 (contig AEFG01040189) in v7.0 of the Petromyzon marinus genome assembly to the 5’ end. Important functional regions are indicated: genomic sequence (underlined), proteolytic cleavage motif (outlined), putative region of receptor specificity (outlined and shaded), putative region of CRH BP binding (double outline), C terminal amidation site (outlined with double underline), in frame stop codon (-). The predicted start codon was determined by submitting the combined cDNA and gDNA sequence to Augustus gene prediction software, using the web interface on the University of Griefswald server selecting P. marinus as the organism and by alignment with sequences from other species.

43 the two share 30.3% identity with each other, and 61% identity in the mature peptide region. Both CRH A and B contain the highly conserved ‘TFH’ amino acid motifs

(positions 11 – 13 of the mature peptides), an important determinant of CRH receptor 1 affinity (Fig.6a) (Grace et al., 2007; Jahn et al., 2004) and, a conserved Alanine motif,

(A22-26) critical for CRH BP interaction (Eckart et al., 2001b; Jahn et al., 2002). The two

P. marinus CRH mature peptides showed high identity at the amino acid level with mammalian CRH peptides within the NCBI “nr protein database”. CRH A was similar, by identity (~85%), to several mammalian CRH sequences, including Homo sapiens

CRH (GenBank accession number: NP_000747). In contrast, CRH B was 70% identical to mammalian Sus scrofa CRH (NCBI GI: 224996). Phylogenetic analysis of the two P. marinus CRHs indicate that both cluster with other vertebrate CRHs separate from vertebrate UCN and UI members, with the exception of a UI fragment identified in the genome of C. milii (Fig. 7).

The P. marinus UCN III-like amino acid sequence contains a 21aa signal peptide

(M1-S21), predicted by SignalP4.0, and a monobasic proteolytic site (K123) with a C- terminal amidation site (GRRK164-168) predicted by Neuropred. The in silico predicted processing resulted in a 41 AA mature active neuropeptide (G124–I164). Although not predicted by Neuropred, a second possible proteolytic R/K-X2-R/K cleavage motif is present (KGAK122-126) by homology with orthologous UCN III pre-propeptides resulting in a 38aa mature peptide (Figs. 5, 6b). A UCN2 domain (CDD: Pfam11613), containing a highly conserved PTN amino acid motif, a determinant of CRH type 2 receptor binding affinity, was identified at positions 11 – 13 of the mature peptide (Fig. 5) (Grace et al.,

2007; Jahn et al., 2004). Additionally, a conserved Alanine motif, critical for CRH BP

interaction, is present at amino acid positions 19 to 22 of the mature peptide (Eckart et al.,

2001b; Jahn et al., 2002). Alignment of the complete deduced amino acid sequence of

UCN III-like indicate it shares 27.1% and 24.1% identity with P. marinus CRH A and B respectively and 26.8% identity to each in the mature peptide indicating clear divergence of these genes. A comparison of UCN III-like with putative orthologues in the nr database indicated the predicted UCN III like peptide from Oreochromis niloticus

(accession number: XP_003442715) was most identical, sharing 73% of the same amino acids in the mature peptide. Comparison of the P. marinus UCN III-like mature peptide with vertebrate UCN II and III mature peptides suggest that, while the length of the processed peptide is unclear, UCN III-like is an orthologue of vertebrate UCN III (Fig.

6B). Additionally, phylogenetic analysis indicates that UCN III-like clusters with other

UCN III peptides (Fig. 7).

By exhaustive search of v.7.0 of the P. marinus gene build, a region with similarity to Bos taurus UCN II was identified. However, no product was produced by by RT PCR using specific primers and no gene was predicted by the AUGUSTUS gene prediction software (data not shown). As such it was determined that this region did not represent a functional gene

3.2 Cloning and analysis of P. marinus CRH Binding Protein (CRH BP)

The P. marinus CRH BP gene was identified in a 1250 bp transcript cloned from P. marinus brain tissue. The cloned CRH BP sequence contains 48bp of 5’UTR (with an in frame amber stop codon upstream of the predicted start codon), a 969 bp coding sequence terminated in an amber stop codon, and a 213 bp 3’UTR containing a putative

polyadenylation signal (Fig. 8). The CRH BP transcript was mapped to scaffold

GL476532 (Position 148,946-151,756) in v7.0 of the lamprey gene build (Ensembl release 68 July 2012); where CRH BP transcript ENSPMAP00000005266 is predicted by

Ensembl. Comparison of cDNA sequence with the genomic sequence indicated eight exons were predicted with the coding sequence found in the first seven exons (Fig. 8). A conserved signal peptide (M1-G23) in the deduced amino acid sequence was identified by

SignalP4.0 (Fig. 8). Consistent with other characterized vertebrate CRH BP proteins, ten cysteine residues are present in the P. marinus CRH BP amino acid sequence (Fig. 8, 9).

These have been implicated as forming 5 consecutive disulphide bonds (C58–C79, C102–

C139, C182–C204, C244–C270, C283–C318; Fig. 8, 9; Fischer et al., 1994). Additionally, the P. marinus CRH BP has conserved Arginine residues at positions 45, 54, and 57, and a conserved Asparagine (at position 60); which, in mammalian CRH BP, are important for

CRH ligand interaction (Fig. 9; Jahn et al., 2002). Phylogenetic analysis of the deduced

AA sequence of the CRH BP transcript indicates that it occupies a unique branch in between teleost and insect (Fig. 10).

3.3 Cloning and analysis of P. marinus CRH receptors

The complete coding sequence of two distinct CRH Receptors, CRH Rα (1355nt) and CRH Rβ (1612nt) was identified in P. marinus. The coding sequence for the P. marinus CRH Rα gene was identified within 1355 bp of sequence by AUGUSTUS gene prediction and by v.7.0 of the lamprey gene build. The 1355 bp CRH Rα sequence was comprised of a chimera of two fragments. A 979 bp 5’ fragment, obtained from sequenced clone cDNA, mapped to transcript ENSPMAT00000009958 in the P. marinus

47 Figure 6. Alignment of P. marinus CRH A, B and UCN III-like with CRH family members from various species. A. Amino acid alignment of P. marinus CRH A and B with CRH and UI/UCN prepropeptides. Conserved box in the cryptic peptide of CRH first outline. Putative cleavage to mature peptide shaded grey. The mature peptide is seen in the second outlined box. A conserved putative determinant of receptor binding affinity is outlined and shaded. Accession of aligned peptides are: CRH Homo sapiens NP_000747.1; CRH Phyllomedusa sauvagii AAT70729.1 CRH Xenopus laevis NP_001165680.1; CRH Haplochromis burtoni ABN41555.1; CRH Oncorhynchus mykiss NP_001117758.1; UI Danio rerio AAI24469.1; UI Cyprinus carpio P01146.1; UI Oncorhynchus mykiss NP_001117815.1 B. Amino acid alignment of the mature peptide of P. marinus UCN III-like processed at K123 with UCN II and UCN III peptides from other species. Potential second cleavage site, K126 shaded grey. A conserved putative determinant of receptor specificity is outlined. Accesion of aligned peptides are UCN II Bos Taurus NP_001069998.1; UCN II Homo Sapiens NP_149976.1; UCN II Oryzias latipes NP_001121991.1; UCN III like Oreochromis niloticus XP_003442715.1;UCN III-like Xenopus tropicalis XP_002931892.1; UCN III Homo sapiens NP_444277.2; UCN III Bos taurus BAE94178.1; Callorhinchus milii(Nock, Chand, & Lovejoy, 2011)

48 CRH Pongo Abelii 57 CRH Gallus Gallus CRH Homo sapiens 22 CRH A Petromyzon marinus CRH Microtus ochrogaster

38 65 CRH Spea hammondii CRH Phyllomedusa sauvagii CRH Xenopus laevis CRH Danio rerio 41 CRH Cyprinus carpio CRH 37 CRF1 Callorhinchus milii CRHII Oncorhynchus mykiss CRH Oncorhynchus mykiss 60 CRH Salmo salar 14 CRF2 Callorhinchus milli UI fragment Callorinchus milii 38 CRH B Petromyzon marinus

64 35 CRH Haplochromis burtoni CRH Solea senegalensis

96 UCN Homo Sapiens

65 UCN Mus musculus UCN Xenopus laevis

29 50 UI Platichthys flesus UI-like Oreochromis niloticus 19 74 UI Cyprinus carpio UCN/UI UI Carassius auratus 33 UI Danio rerio 41 UI Oryzias latipes UI Oncorhynchus mykiss 67 54 UI Anguilla japonica UCN II Homo Sapiens 72 UCN II Bos Taurus UCN II

35 31 UCN III Callorhinchus milii

30 UCN III-like Petromyzon marinus UCN II Oryzias latipes 91 UCN III like Oreochromis niloticus

47 73 UCN III Oryzias latipes UCN III Danio rerio UCN III 31 UCN III like Xenopus tropicalis 49 UCN III Homo sapiens 55 UCN III Canis familiaris 50 UCN III like Loxodonta africana sauvagine Phyllomedusa sauvagii 49 DH Manduca sexta

43 CRH/DH like Ciona intestinalis CRH/DH like Ciona savigny 50 DH Tribolium castaneum CRH/DH 41 DH Schistocerca gregaria 51 CRH/DH Bombyx mori like 51 CRH like Rhodnius prolixus

0.05

49 Figure 7. Evolutionary relationships of the P. marinus CRH family member pre- propeptides. The evolutionary history was inferred using the Neighbor-Joining method. CRH family paralogues clustered together according to type as indicated by brackets. The bootstrap consensus tree inferred from 1000 replicates is taken to represent the evolutionary history of select CRH family members. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches. The evolutionary distances were computed using the p-distance method and are presented as the number of amino acid differences per site. The analysis involved 50 amino acid sequences. All positions containing gaps and missing data were eliminated. There were a total of 24 positions in the final dataset. Evolutionary analyses were conducted in MEGA5. CRH member, species and Genbank accession number are as follows: CRH Homo sapiens NP_000747.1; CRH Microtus ochrogaster ADN07452.1; CRH Phyllomedusa sauvagii AAT70729.1; CRH Spea hammondii AAP20883.1; CRH Xenopus laevis NP_001165680.1; CRH Haplochromis burtoni ABN41555.1; CRH Oncorhynchus mykiss NP_001117758.1; CRHII Oncorhynchus mykiss NP_001118099.1; CRH Danio rerio XP_001336597.3; CRH Pongo Abelii XP_002819186.1; CRH Gallus Gallus NP_001116503.1; CRH Salmo salar NP_001135062.1; CRH Cyprinus carpio CAC84859.1; CRH Solea senegalensis CBY78066.1; UI Platichthys flesus CAD56905.1; UI Danio rerio AAI24469.1; UI Cyprinus carpio P01146.1; UI Oncorhynchus mykiss NP_001117815.1; UI Anguilla japonica BAC75661.1; UI Oryzias latipes BAC75661.1; UI Carassius auratus Q9PTQ4.1; UI-like Oreochromis niloticus XP_003459370.1; UCN Homo Sapiens NP_003344.1; UCN Mus musculus NP_067265.1; UCN Xenopus laevis NP_001086429.1; UCN III Oryzias latipes NP_001121992.1; UCN III Canis familiaris XP_003638933.1; UCN III Danio rerio NP_001076423.1; UCN II Oryzias latipes NP_001121991.1; UCN III like Oreochromis niloticus XP_003442715.1; UCN III like Loxodonta Africana XP_003410649.1; UCN III Homo sapiens NP_444277.2; UCN II Bos Taurus NP_001069998.1; UCN II Homo Sapiens NP_149976.1; UCN III like Xenopus tropicalis XP_002931892.1; CRH Ciona intestinalis BW312781; CRH Ciona savigny BW181191; DH Schistocerca gregaria AEX60845.1; CRH/DH Bombyx mori NP_001124368.1; DH Tribolium castaneum NP_001164096.1; 1 CRH like Rhodnius prolixus ADM26617.; Sauvagine Phyllomedusa sauvagii AAY21509.1; DH Manduca sexta P21819.2

50 51 Figure 8 Nucleotide and deduced amino acid sequence of P. marinus CRH BP. The nucleotide sequence is displayed in lower case above the encoding amino acid (aa). Nucleotides were determined by the sequencing of cDNA clones generated by PCR and RACE. Exons were identified by comparison with genomic sequence from scaffold GL476532 (Position 148,946-151,756) in v 7.0 of the P. marinus genome assembly (Ensembl release 68 July 2012) and are marked by thick vertical lines. Important functional regions are indicated: Conserved cysteine residues (outlined shaded), conserved arginine residues (outlined speckled), upstream stop codon (italics), in frame stop codon (-), polyadenylation signal (underlined nucleic acids). The predicted start codon was determined by submitting the cDNA sequence to Augustus gene prediction software, using the web interface on the University of Griefswald server selecting P. marinus as the organism and alignment with sequences from other species..

52 53 Figure 9. Alignment of Petromyzon marinus CRH BP with select orthologues. Alignment was conducted using Clustal Omega. Conserved cysteines in all vertebrate CRH BP proteins shaded grey. Arginine residues important for ligand binding outlined. Genbank accession number of compared sequences are: Homo sapiens P24387; Haplochromis burtoni C9DZN2; Danio rerio Q6DG79..

54 Mammalia Anura Actinopterygii Agnatha Maxillopoda Insecta CRH BP CRH Haplochromis burtoni CRH BP CRH Tigriopus japonicus CRH BP CRH rubipres Takifugu CRH BP Petromyzon marinus CRH BP CRH Mus musculus CRH BP Ovis aries CRH BP CRH Bos taurus CRH BP CRH Cricetulus griseus CRH BP laevis CRH Xenopus CRH BP Oncorhynchus mykiss Oncorhynchus BP CRH CRH BP CRH Salmo salar CRH BP CRH Cyprinus carpio CRH BP CRH Homo sapiens CRH BP Apis mellifera CRH CRH BP Danio rerio CRH BP CRH Macaca mulata CRH BP CRH Camponotus floridanus 99 100 100 100 100 99 59 100 84 100 99 100 100 0.05 100

55 Figure 10. Evolutionary relationship of P. marinus CRH BP. The evolutionary history was inferred using the Neighbor-Joining method. All CRH BP amino acid sequences clustered with their corresponding class as indicated next to brackets. P. marinus CRH BP (bold italics) branched outside of other vertebrate CRH BPs though closer to vertebrate than putative arthropod CRH BP. The bootstrap consensus tree inferred from 1000 replicates is taken to represent the evolutionary history of CRHBP in select species. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) is shown next to the branches. The evolutionary distances were computed using the p-distance method and are in the units of the number of amino acid differences per site. The analysis involved 17 amino acid sequences. All positions containing gaps and missing data were eliminated. There were a total of 212 positions in the final dataset. Evolutionary analyses were conducted in MEGA5. Uniprot accession numbers of sequences as follows: Homo sapiens P24387; Cricetulus griseus G3H325; Macaca mulatta F7DGB5; Takifugu rubripes Q24JN9; Mus musculus Q60571 ; Xenopus laevis Q91653; Ovis aries Q28557; Bos taurus A7MBA3; Oryzias latipes H2LDL4; Oncorhynchus mykiss Q5J878; Haplochromis burtoni C9DZN2; Danio rerio Q6DG79; Cyprinus carpio Q6KF37; Salmo salar C0HB23; Camponotus floridanus E2A941; Apis mellifera Q5F4H9; Tigriopus japonicus B9TXQ5.

56 gene build v7.0 (Ensembl release 68, July 2012), and was identified as containing the 5’ end of the CRH Rα gene by AUGUSTUS gene prediction software. A 375 bp fragment, derived from the 3’ end of the aligned ENSEMBL transcript with the CRH Rα sequenced clone cDNA, was appended to the 3’ end of the 979 bp cloned sequence resulting in a

1355 bp chimera. The CRH Rα sequence chimera contained 178 bp of 5’UTR with an ochre stop codon at bp position 104, upstream of the start methionine codon predicted by the AUGUSTUS gene prediction software, and 1203bp of coding sequence terminated by an amber stop codon (Fig. 10). No 3’ UTR was identified by either experimental, or in silico approaches (Fig. 11). Comparison of the CRH Rα coding sequence with the genomic sequence indicated the gene was comprised of at least eleven exons; though the initial 30 nucleotides of the coding sequence; identified from sequenced clones; did not map to any region of the gene build suggesting at least one additional exon.

Analysis of the 1612 bp P. marinus CRH Rβ transcript revealed a 128 bp 5’ UTR, a 1269 bp coding sequence terminated by an amber stop codon, followed by a 209 bp 3’

UTR with a polyadenylation signal (Fig. 12). The coding sequence of CRH RΒ was identified as transcript ENSPMAT00000003797 within the lamprey gene assembly v7.0 via BLASTn (Ensembl release 68, July 2012). Comparison of the CRH RΒ coding sequence with the gene build indicate the CRH RΒ gene is encoded on at least seven exons; however, 531 bp from the 3’ end of the coding sequence did not map to any region of the gene build making exon identification incomplete (Fig. 12). In the case of any ambiguity between the Ensembl transcript and sequenced cDNA the sequenced cDNA was deemed accurate.

58 Figure 11. Nucleotide and deduced amino acid sequence of P. marinus CRH Rα. The nucleotide sequence is displayed in lower case above the encoding amino acid (aa). Nucleotides were determined by the sequencing of cDNA clones generated by PCR and RACEs and by appending genomic sequence from scaffold GL477206 (contig AEFG0104383) in v7.0 of the Petromyzon marinus genome assembly to the 3’ end. Exons were identified by comparison with genomic sequence from scaffold GL477206 (positions 37,870-64,312 contig AEFG0104383) in v 7.0 of the P. marinus genome assembly (Ensembl release 68 July 2012) and are marked by thick vertical lines. Important functional regions are indicated: upstream stop codon (italics), in frame stop codon (-). Hormone receptor (HRM) and secretin type 7 transmembrane domains (7 transmembrane domain; double underlined) conserved in all CRH receptors are indicated. The predicted start codon was determined by submitting the combined gDNA and cDNA sequence to Augustus gene prediction software, using the web interface on the University of Griefswald server selecting P. marinus as the organism and alignment with sequences from other species. Sequence derived from the P. marinus gene assembly (transcript ENSPMAT00000009958) is single underlined.

59 60 Figure 12. Nucleotide and deduced amino acid sequence of P. marinus CRH Rβ. The nucleotide sequence is displayed in lower case above the encoding amino acid (aa). Nucleotides were determined by the sequencing of cDNA clones generated by PCR and RACE. Exons were identified by comparison with genomic sequence from scaffold GL477934 (positions 1,164-14,009) in v 7.0 of the P. marinus genome assembly (Ensembl release 68 July 2012) and are marked by thick vertical lines. Important functional regions are indicated: in frame stop codon (-), polyadenylation signal (underlined nucleic acid sequence). Hormone receptor (HRM, shaded under sequence) and secretin type 7 transmembrane domains (7 transmembrane domain; double underlined) conserved in all CRH receptors are indicated. The predicted start codon was determined by submitting the cDNA sequence to Augustus gene prediction software, using the web interface on the University of Griefswald server selecting P. marinus as the organism and alignment with sequences from other species.

A signal peptide is predicted by SignalP4.0 at M1 to S25 and M1 to S31 for CRH

Rα and RB, respectively. The CRH receptors are classified as members of class B, or secretin, of the G protein coupled receptor family (GPCR). Consistent with this both

CRH Rα and Rβ contained a signature 7TM, characteristic of class B, or secretin, G coupled protein coupled receptors (GPCRs) near the C terminus and a hormone binding domain (HRM) near the N-terminus (Figs 11, 12, 13). The predicted 7TM and HRM domains were identified by homology with A.burtoni CRF receptors (Fig. 13) (Chen &

Fernald, 2008b; Huising, 2004). The third intracellular loop (IC3) of the 7TM domain has been found to be identical in nearly all vertebrate CRH receptors; with variation significantly affecting G protein and cAMP pathway signalling (Punn et al., 2012). While in CRH RΒ this region was conserved, in CRH Rα a substitution of A268 to T268 was found.

Phylogenetic analysis of P. marinus CRH Rα and Rβ indicated the two receptors cluster outside of other vertebrate CRH receptors and do not branch with either CRH receptor subtype. Since the receptor sub types have different ligand affinity, association of CRH Rα and Rβ with a CRH family ligand is difficult (Fig. 14). Comparisons of the deduced amino acid sequence of the two P. marinus CRH receptors indicate they are

65.6% identical in the pre-proprotein and 68.4% identity in the mature peptide; suggesting an early duplication event in the Agnathan lineage. Comparison of CRH Rα and Rβ pre-proproteins with those in the NCBI nr protein database indicate both receptors were most identical to type 2 receptors; with CRH Rα 70.4% identical to the predicted CRF

Type 2 receptor 2 receptor Type CRH R CRH R 1 receptor Type 2 receptor Type CRH R CRH R 1 receptor Type 2 receptor Type CRH R CRH R 1 receptor Type 2 receptor Type CRH R CRH R 1 receptor Type 2 receptor Type CRH R CRH R 1 receptor Type 2 receptor Type CRH R CRH R 1 receptor Type 2 receptor Type CRH R CRH R 1 receptor Type 2 receptor Type CRH R CRH R 1 receptor Type β α β α β α β α β α β α β α β α Petromyzon marinus Petromyzon marinus Petromyzon marinus Petromyzon marinus Petromyzon marinus Petromyzon marinus Petromyzon marinus Petromyzon marinus Petromyzon marinus Petromyzon marinus Petromyzon marinus Petromyzon marinus Petromyzon marinus Petromyzon marinus Petromyzon marinus Petromyzon marinus Haplochromis burtoni Haplochromis burtoni Haplochromis burtoni Haplochromis Haplochromis burtoni Haplochromis burtoni Haplochromis burtoni Haplochromis burtoni Haplochromis burtoni Haplochromis burtoni Haplochromis burtoni Haplochromis burtoni Haplochromis burtoni Haplochromis burtoni Haplochromis burtoni Haplochromis burtoni Haplochromis burtoni Haplochromis W M N V V Y Y T - - - ...... Q G N D A A A E T T F L - - - ...... I I TM5 G R H R R P P A T L L - - - ...... I G G H R R A P K V K T T - - - ...... I TM2 W M M M M G G G V V A S S S S V T T L - - - ...... I I N N N S E V Y S V T L ...... I I I I D V S Y A S E L L L L - ...... I I I I M M M M Q D D D P V E V S S T T L L ...... I I Q G N V S E A V T T T T T L L L ...... I I I G C S E V S S S A Y A P P V T T T F L L ...... Q Q G R P S E K E V Y P A T F F F L ...... I HRM N C S V V P P A E E V T T T L L ...... I I R D N N N D R C V F L L ...... I I G R R V A V K V A S A V F L L ...... I I I I I N D S E E V S V A T T T F L L L L ...... I R N R Y V S A E S V T F L L L L ...... M M G H R D N V K K K K S T F F L ...... W W G G N R N R C C S K E E E T F L ...... M N V S V V Y K E S V S P F F - ...... I I I I G K V Y S S K E V T F F F L L L - ...... I I I Q R R V P S T T T L L L L L L L - - - - ...... I TM4 M M Q Q Q Q C C R S E V P T T T T F F - ...... I W Q H S S S T T T L L L - ...... I I TM7 M G N A A S Y P T F L L L L - - - - ...... W M Q Q R V V V K E K S S S T IC3 L L - ...... I I I I W G G C D D D N V K V S T - - - ...... I H V P A S P E A T F F L L - - - ...... I R N R P A S S A V V T F L L L - - - ...... G C C V A A V V S A T T F - - - ...... I I Q Q Q H R R S S P V E S T - - - ...... I N S V E V V T L - - - ...... I I R S A Y V T T F - - - ...... I I N Y S V E S S L - - - ...... I I Q G C R E A E E E S - - - ...... I TM1 W Q H P P P V P T F - - - ...... W C C A V A L - - ...... I M Q N C D V P E F L ...... I I G G G G Q C R D S Y V S E A E L ...... Q G R R D E K V V Y T F F L L ...... I G Q C V K V A F L L ...... I I I R H N D A Y S A E T ...... I G S V Y A S A T T T T F F L ...... M G D A K E E E V V V V V T F L L ...... I I I I TM3 Q D N R H V A Y V K S T F L L ...... I I I R N D E A Y A V T L ...... Q G N D N K K Y E A F L L ...... R C V A S T T F L - - ...... I I TM6 W W Q R H H S S T T L L L - - ...... I H H R R N N A V K F F L L L - - ...... I W M G N R R P S S S T T F L - - ...... W G N C C R S K A V T L L - - ...... Q R S E Y A T T F L L L L - - ...... G D R R R P P A T F - - - ...... W G N N R R E T L ------...... I M H C A K K K V S T L - - - ...... M M Q H A A A S Y Y V F L - - - ...... I M M G R D V V V E A V T L L - - - ...... I I I R D C D N E T L L - - - ...... G G N V A S Y A T F L - - - ...... Q R C R S T T T F - - - ...... I

63 Figure 13. Alignment of Petromyzon marinus CRH Rα and CRH Rβ with Haplochromis burtoni CRH Receptors type 1 and 2. Sequences were aligned using Clustal Omega and then manually optimized. Conserved cysteines within the hormone receptor domain (CDD: pfam02793; first thick outline) are outlined and shaded. The 7 transmembrane helices of the secretin type 7 transmembrane domain (7TM; CDD: 00002), located in the C terminal direction relative to the HRM, are outlined. Helices were initially identified by the TMHMM 2.0 algorithm and optimized by location in orthologues. Intracellular domain 3(IC3), important in Gs protein coupled signalling, is shaded and indicated above sequence. Genbank accession numbers of the compared sequences are: CRF type 1 receptor Haplochromis burtoni ACV53953.1; CRF type 2 receptor Haplochromis burtoni ACV53954.1.

64 CRH Receptor type 1 CRH Receptor type 2

Petromyzon marinus Petromyzon Petromyzon marinus Petromyzon

CRF CRF 1 Haplochromisburtoni

CRF 2 BETA intestinalis 2 Ciona 2 BETA CRF

CRF rubripes 1 Takifugu CRF belangeri 1 Tupaia CRF

CRF 1 Microtus oeconomus 1 Microtus CRF

CRF sapiens Homo 1.2 CRF mulatta Macaca 1 CRF CRF CRF 1 aethiops Chlorocebus CRF 1 Mus 1 Mus CRF musculus

CRF CRF 1 keta Oncorhynchus

CRF gallus 1 Gallus CRF CRH Rβ CRH Rα

CRF CRF 1 nebulosus Ameiurus 88

CRF CRF 2 BETA1 intestinalis Ciona CRF CRF 2 nebulosus Ameiurus

CRF CRF 1 auratus Carassius CRF CRF carpio 1.1 Cyprinus 72 CRF rerio 2 Danio CRF

CRF abelii 2 Pongo CRF 53 CRF 1.2 Carassius auratus auratus Carassius 1.2 CRF

CRF 2 Xenopus tropicalis 2 Xenopus CRF

CRF 2.1 Macaca mulatta Macaca 2.1 CRF CRF 2.2 Macaca mulatta Macaca 2.2 CRF

CRF CRF carpio 2.2 Cyprinus

CRF taurus 2 Bos CRF CRF CRF 2 melanoleucaAiluropoda

CRF 2 Xenopus laevis 2 Xenopus CRF

CRF catesbeiana 2 Rana CRF CRF CRF carpio 2.1 Cyprinus

CRF CRF 2 keta Oncorhynchus

100

CRF CRF 2 Haplochromis burtoni 89

96 CRF gallus 2 Gallus CRF gallopavo 2 Meleagris CRF

CRF CRF guttata 2 Taeniopygia 100

100 50 97 97 43 89 54 78 75 80 100 100 98 65 100 100 92 65 49 69 99 43 43 100 0.02 Figure 14. Evolutionary relationships of P. marinus CRH Receptors. The evolutionary history of CRH receptors was inferred using the Neighbor-Joining method. Receptor subtypes clustered together as indicated by brackets; P. marinus (bold italics) and Ciona Intestinalis receptors clustered outside of these groups. The bootstrap consensus tree inferred from 1000 replicates is taken to represent the evolutionary history of select CRH Receptors. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates are collapsed. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches. The evolutionary distances were computed using the p-distance method and are presented as the number of amino acid differences per site. The analysis involved 35 amino acid sequences. All positions containing gaps and missing data were eliminated. There were a total of 340 positions in the final dataset. Evolutionary analyses were conducted in MEGA5. Accession numbers of sequences are as follows CRF2 β Ciona intestinalis KH.C5.115.v1.A.ND1-1; CRF2 Taeniopygia guttata XP_002196377.1; CRF2 Xenopus laevis NP_001079300.1; CRF2 Bos taurus NP_001179474.1; CRF2 Meleagris gallopavo XP_003206970.1; CRF2 Danio rerio XP_002667894.2; CRF2.2 Cyprinus carpio ACV67273.1]; CRF2.1 Cyprinus carpio ACV67272.1; CRF2 Ailuropoda melanoleuca XP_002919303.1; CRF2B Tupaia belangeri CAD19579.1; CRF2 Xenopus (Silurana) tropicalis XP_002938049.1; CRF2 Pongo abelii XP_002818127.1; CRF2.2 Macaca mulatta XP_002803379.1; CRF2.1 Macaca mulatta XP_001085987.2; CRF 2 Gallus gallus NP_989785.1; CRF2 Ameiurus nebulosus AAK01069.1; CRF2 Haplochromis burtoni ACV53954.1; CRF2 Rana catesbeiana BAD36784.1; CRF2 Oncorhynchus keta CAC81754.1; CRF1 Mus musculus NP_031788.1; CRF1.2 Homo sapiens NP_004373.2; CRF1 Gallus gallus NP_989652.1; CRF1 Macaca mulatta NP_001027975.1; CRF1.1 Cyprinus carpio ACV67270.1; CRF 1 Chlorocebus aethiops AAY87929.2; CRF1 Ameiurus nebulosus AAK01068.1; CRF1 Haplochromis burtoni ACV53953.1; CRF1.2 Carassius auratus AAV98393.1; CRF1 Carassius auratus AAV98392.1; CRF1 Microtus oeconomus ABP01570.1; CRF1 Takifugu rubripes CAC82924.2; CRF1 Oncorhynchus keta CAC81753.1; CRH2β Ciona intestinalis F6X8W4; CRF1 Tupaia belangeri CAD19577.1.

Receptor 2-like peptide from Oreochromis niloticus and CRH RΒ 68.6% identical to

CRF receptor type 2 from Haplochromis burtoni.

3.4 Expression Patterns of CRH system transcripts by RT-qPCR during metamorphosis in P. marinus.

Expression of CRH A, B, UCN III-like, CRH Rα, CRH Rβ and CRH BP transcripts were detected in brain, gill, kidney and liver tissues throughout development, from CF larvae, through the seven stages of metamorphosis, and in the juvenile parasitic phase. Amplification was linear over at least five orders of magnitude for all amplicons, including β-actin and GAPDH. Generation of single product amplicons were confirmed by melt curve analysis for all runs, NTC and NRT controls were free of amplification products after 45 cycles (data not shown). Data are presented relative to IRC following normalization to two reference genes (β-actin and GAPDH) (Figs 15- 20). Details of statistical analysis performed and results of one way ANOVA are presented in Tables 3 and 4. In general, the CRH family members showed similar patterns of expression while the two receptors, CRH Rα and CRH Rβ, and the binding protein, CRH BP had unique patterns of expression

3.4.1 Brain The expression of all CRH system genes was highest at the onset of and early in metamorphosis (CF and stage 1) and relatively low over the remaining stages of metamorphosis. (Fig 15). Two exceptions were identified during stage 3 and 5 where expression of CRH B, UCN III-like and CRH BP were elevated. While a general trend of increase was seen in these genes in stage 3 and 5, the expression levels in stage 3 were not significantly different from CF levels; and expression in stage 5 did not

Table 3. Results of one-way ANOVA of developmental and tissue distribution of CRH Axis transcripts. ANOVA tests were performed using SPSS version 20 (IBM). ‘Sig.’ represents probability (P) of significant difference between expression through metamorphosis of P. marinus, or between juvenile parasitic (JP) tissue. Results were deemed significance at P<0.05.

DF DF (within Transcript Tissue (between F Sig. groups) groups) Brain 8 36 1.402 0.229 Gill 8 36 20.363 0.000 CRHA Kidney 4 18 12.211 0.000 Liver 3 13 16.432 0.000 Parasite 4 20 148.428 0.000 Brain 8 36 5.949 0.000 Gill 8 36 38.108 0.000 CRHB Kidney 8 36 25.144 0.000 Liver 2 12 0.953 0.413 Parasite 3 15 60.636 0.000 Brain 8 36 19.304 0.000 Gill 8 36 119.24 0.000 UCN III- Kidney 8 36 111.878 0.000 Like Liver 3 15 8.283 0.002 Parasite 3 16 389.646 0.000 Brain 8 36 15.083 0.000 Gill 8 36 31.149 0.000 CRHBP Kidney 3 14 63.116 0.000 Liver 4 18 80.418 0.000 Parasite 4 19 88.816 0.000 Brain 8 36 3.787 0.003 Gill 8 36 40.426 0.000 CRH Rα Kidney 8 35 6.804 0.000 Liver 4 18 18.066 0.000 Parasite 4 20 94.384 0.000 Brain 8 36 3.262 0.007 Gill 8 36 31.19 0.000 CRH Rβ Kidney 8 36 11.865 0.000 Liver 5 24 21.56 0.000 Parasite 4 20 27.722 0.000

68 Table 4. Results of one-way ANOVA and students t-test of CRH Axis expression in P. marinus in different brain regions after exposure to stress. ANOVA and student’s t-tests were performed using SPSS version 20 (IBM). ‘Sig.’ represents probability (P) of significant difference between expression of stress group to control, or between brain region. Results were deemed significance at P<0.05.

DF (between DF (within Transcript Group Region groups groups; F Sig. ANOVA) ANOVA) Frontal 5.133 12.729 0.181 Stress/Control Medial 4 6.738 0.296 CRHA Hind 4.348 8.149 0.362 Stress Between 2 11 3.268 0.077 Control region 2 12 39.477 0.000 Frontal 8 2.039 0.068 Stress/Control Medial 5.213 6.557 0.068 CRHB Hind 6 0.003 0.857 Stress Between 2 11 5.343 0.024 Control region 2 12 1.581 0.246 Frontal 8 2.905 0.191 Stress/Control Medial 4.065 20.901 0.075 - UCN III Hind 8 1.455 0.311 Like Stress Between 2 11 3.282 0.760 Control region 2 12 2.11 0.164 Frontal 8 0.073 0.140 Stress/Control Medial 8 2.694 0.393 CRHBP Hind 8 2.039 0.987 Stress Between 2 11 6.823 0.012 Control region 2 12 3.792 0.530 Frontal 8 0.773 0.407 Stress/Control Medial 8 0.894 0.996 CRH Rα Hind 8 1.313 0.113 Stress Between 2 11 5.451 0.023 Control region 2 12 7.923 0.006 Frontal 8 0.982 0.267 Stress/Control Medial 8 4.918 0.229 CRH Rβ Hind 7 3.486 0.310 Stress Between 2 11 2.376 0.139 Control region 2 12 3.298 0.072

69 represent a significant increase from stage 4. Additional increases in CRH B, UCN III and CRH BP levels were observed in JP relative to stage 7. CRH B and CRH BP expression levels in JP were significantly higher than in stage 7; though CRH B levels were comparable to those seen at the onset of metamorphosis while CRH BP levels were intermediate between CF and stage 7. An increase in UCN III-like expression was observed in JP this did not represent a significant increase relative to stage 7.

The pattern of expression of CRH Rα was similar to these genes, except a trend of decreasing expression was observed from stage 3 to 6, with no increase in stage 5 like that which was observed in CRH B, UCN III-like and CRH BP. Additionally, unlike

CRH B, UCN III-like and CRH BP, no increase in CRH Rα was observed in JP.

Expression of CRH Rβ was similar to the other CRH system genes (excluding CRH A), with the exception of a trend of increasing expression from stage 2 to stage 5, prior to declining in stage 6, as opposed to the punctuated increases in stage 3 and 5 previously noted (see above).

Expression of the CRH A gene in the brain did not vary to a significant degree as determined by one-way ANOVA (Fig. 3). In all genes, in addition to the previously indicated trends, expression was lowest in stages 6 (nearly 1/27th of peak levels, in stage

3, in the case of CRH BP), with levels remaining comparably low in stage 7 and JP, with the previously noted exception of CRH B and CRH BP.

3.4.2 Gill In general, CRH system transcripts followed a similar trend of expression to that observed in the brain of high expression in CF and early in metamorphosis and declining

levels late in metamorphosis and in JP, with isolated stage specific increases during metamorphosis. However, in the gill, significant increases in CRH system expression were observed in different stages of metamorphosis from those observed in the brain.

Most CRH system gene expression levels peaked in the gill at some point during metamorphosis; the exception being CRH A and CRH Rβ, which were at highest levels in CF. The lowest expression levels for all CRH genes were observed in late metamorphosis and JP, from stage 5 or 6 on (Fig. 16). Patterns of expression of CRH BP, and two of its potential ligands, UCN III-like and CRH B, were highly similar throughout metamorphosis in the gill. Expression of each of these transcripts spiked in stage 2 of metamorphosis, which, interestingly, were the highest levels detected of these genes in all tissues studied, from CF through metamorphosis and in JP (Figs. 15-18). The increase in stage 2 of these three transcripts represented as much as a 13 fold increase over CF levels and was followed by a rapid decline (nearly 18-fold) in transcript levels at stage 3 of metamorphosis. CRH A also exhibited an increase in stage 2; however, levels were comparable to those observed in CF gill. While in general, the patterns of CRH B, UCN

III-like and CRH BP expression were similar, an increase of CRH BP expression was identified in stage 1 and 4, to levels intermediate of CF and stage 2, whereas no increases were observed in CRH B and UCN III-like in these stages.

Contrary to CRH B, UCN III-like and CRH BP, high levels of CRH A, CRH Rα and CRH Rβ were observed in immediately pre-metamorphic CF relative to metamorphosis and JP (Fig. 16). Both CRH Rα and CRH Rβ expression did not increase in stage 2, unlike their putative ligands, CRH A, CRH B, UCN III-like, and the CRH BP

Brain CRH A1 CRH B 7 45 ab 6 40 35 5 30 ab 4 25 a 3 20 15 ab 2 ab a 10 b 1 5 b b 0 0 CF 1 2 3 4 5 6 7 JP CF 1 2 3 4 5 6 7 JP

UCN III-like CRH BP 100 Units 50 ab ac 45 90 40 80 ab 70 35 ab a 30 60 25 50 abd 20 40 ab 15 b 30 20 abd bc 10 bc cd b 5 c c c 10 d d 0 0 CF 1 2 3 4 5 6 7 JP CF 1 2 3 4 5 6 7 JP Arbitrary Expression CRH Rα CRH Rβ 35 30 ab ab ab 30 ab 25 25 20 ab a 20 ab 15 ab 15 ab a 10 ab 10 ab ab b b 5 b b 5 b 0 0 CF 1 2 3 4 5 6 7 JP CF 1 2 3 4 5 6 7 JP Stage

71 Figure 15. Expression of CRH family mRNA in P. marinus Brain tissue by RT-qPCR Arbitrary expression units represent expression normalized to β-actin and GAPDH relative to a pooled control sample. Developmental stage is indicated on the x-axis and includes immediately premetamorphic larvae (CF), stages 1 to 7 of metamorphosis and Parasitic Juveniles (JP). For all stages n=5. Error bars represent SEM. Transcript levels were determined by RT-qPCR analysis as indicated in Material and Methods, with three technical replicates per sample. Statistically significant differences were determined by one way ANOVA (P<0.05). Bars with different letters above indicate statistically significant differences exit between the means as determined by ANOVA by Games-Howell post hoc test (P<0.05). (1No significant difference at P<0.05)

72 Gill CRH A CRH B 1.00 160 a b 0.80 ab 120 0.60 80 0.40 a bc 40 a a 0.20 c d a d de e d c d d d 0.00 0 CF 1 2 3 4 5 6 7 JP CF 1 2 3 4 5 6 7 JP Units UCN III-like CRH BP 500 b 600 c 400 500 400 300 300 200 b a 200 b a 100 a a 100 a a c d d e ac cd e de 0 0 CF 1 2 3 4 5 6 7 JP CF 1 2 3 4 5 6 7 JP Arbitrary Expression

CRH Rα CRH Rβ 16 2,000 a b 1,800 14 abc 1,600 12 1,400 10 1,200 8 1,000 800 ab 6 abc ab abc 600 b 4 acd ! 400 bcd 2 ad e f 200 bcd dc c d 0 0 CF 1 2 3 4 5 6 7 JP CF 1 2 3 4 5 6 7 JP Stage

73 Figure 16. Expression of CRH family mRNA in P. marinus Gill tissue by RT-qPCR Arbitrary expression units represent expression normalized to β-actin and GAPDH relative to a pooled control sample. Developmental stage is indicated on the x-axis and includes immediately premetamorphic larvae (CF), stages 1 to 7 of metamorphosis and Parasitic Juveniles (JP). For all stages n=5. Error bars represent SEM. Transcript levels were determined by RT-qPCR analysis as indicated in Material and Methods, with three technical replicates per sample. Statistically significant differences were determined by one way ANOVA (P<0.05). Bars with different letters above indicate statistically significant differences exist between the means as determined by ANOVA by Duncan’s multiple range (P<0.05) or Games-Howell post hoc test (P<0.05). ! Indicates mean did not differ from any groups.

all of which, as previously noted, reached peak (or near peak as with CRH A) levels.

CRH Rα levels were highest in stage 4, declining over stages 5 and 6 to lowest levels in stage 7. Expression of other P. marinus receptor, CRH Rβ, was highest prior to metamorphosis in the gill; this expression represented the highest observed levels of CRH

Rβ relative to all organs studied, from CF through metamorphosis and in JP. CRH Rβ expression declined from this peak in stage 1 of metamorphosis and, while some variation was observed, generally declined over the remaining duration of metamorphosis

(stage 1 to 7). Interestingly, while expression of CRH A, CRH Rα and CRH Rβ genes were low in JP compared to pre stage 5 levels a significant increase over stage 7 levels was observed. In the case of UCN III-like, expression declined nearly 53 times in JP relative to stage 7 levels.

3.4.3 Kidney Each CRH system transcript showed a relatively unique pattern of expression in the metamorphosing P. marinus kidney (Fig. 17). CRH A was expressed at low levels in

CF larvae; its expression increased significantly in stages 1 and 2 but then decreased to levels below detection in stages 3 to 6 of metamorphosis. Detection returned in stage 7 and JP, at high levels relative to CF and JP, however, expression in stage 7 of the kidney was highly variable compared to the other stages as evident by the large standard error. In the case of CRH B expression levels were low and variable from CF to stage 7 of metamorphosis but increased over 26 fold in JP. Expression of the UCN III-like transcript in the kidney was low prior to and early in metamorphosis, but showed a consistent increase from CF to stage 5 reaching levels over 900 times CF levels in stage 5 (Fig. 17).

Expression subsequently declined over the remaining duration of metamorphosis and, in

JP kidney, UCN III-like expression was below the limit of detection. This significant fluctuation suggests a developmentally dependant role for P. marinus UCN III-like transcript.

In the developing P. marinus kidney, CRH BP expression was detected in CF larvae, stages 2, 4 of metamorphosis and in JP but was below the limit of detection in stages 1, 3, 5, 6 and 7 (Fig. 15). Of the detectable stages, CRH BP transcript was expressed at low levels in CF and at comparatively higher levels in stage 2 and 4. Highest expression was found in JP kidney, though not significantly different from stage 4.

Expression levels for both receptor transcripts were lowest in the kidney as compared with other organs examined (Figs 15 to 18). Expression of CRH Rα and Rβ in was the lowest in CF relative to throughout metamorphosis and in JP. Both CRH Rα and

Rβ increased significantly from CF to stage 2 of metamorphosis. CRH Rα remained high, relative to CF, for the remainder of metamorphosis and in JP. CRH Rβ levels remained relatively constant from stages 1 to 6 of metamorphosis until a significant decline was observed in stage 7 prior to returning to levels similar to stage 6 in JP.

3.4.4 Liver Expression of all P. marinus CRH system transcripts was low but variable in the metamorphosing P. marinus liver (Fig. 16). CRH A and B were detected in CF to stage 2 and were below the limit of detection for the remainder of metamorphosis. In contrast to this, UCN III- like was below the limit of detection from CF to stage 4 of metamorphosis, appearing at detectable levels in stage 5 with a significant increase in expression observed in JP. CRH A was expressed at highest levels in pre-metamorphic CF larva

Kidney CRH A CRH B 0.0040 bc 4.0 g 0.0035 c 3.5 0.0030 3.0 0.0025 bc 2.5 0.0020 2.0 0.0015 b 1.5 0.0010 1.0 e bd de de 0.0005 a 0.5 af bc cf ND ND ND ND a 0 0 *CF *1 2 3 4 5 6 7 JP CF *1 2 3 4 5 6 7 JP

Units UCN III-like e CRHBP 16 0.025 14 c 12 0.020 10 0.015 bc 8 de de b 6 cd 0.010 4 cd c 0.005 2 b a ND a 0 0 ND ND ND ND ND CF 1 2 3 4 5 6 7 JP * CF 1 2 3 * 4 5 6 7 JP Arbitrary Expression

CRH Rβ CRH Rβ ab 0.06 5.0 bc bc b 0.05 4.5 b 4.0 0.04 3.5 ab b bc bc ab b 3.0 0.03 2.5 bcd b b 2.0 0.02 1.5 cd d 0.01 1.0 a a 0.5 0 0 CF *1 2 3 4 5 6 7 JP CF 1 2 3 4 5 6 7 JP * n=4 Stage

78 Figure 17. Expression of CRH family mRNA in P. marinus Kidney tissue by RT-qPCR. Arbitrary expression units represent expression normalized to β-actin and GAPDH relative to a pooled control sample. Developmental stage is indicated on the x-axis and includes immediately premetamorphic larvae (CF), stages 1 to 7 of metamorphosis and Parasitic Juveniles (JP). For all stages n=5, unless otherwise indicated. ND indicates transcript was undetected. Error bars represent SEM. Transcript levels were determined by RT-qPCR analysis as indicated in Material and Methods, with three technical replicates per sample. Statistically significant differences were determined by one way ANOVA (P<0.05). Bars with different letters above indicate statistically significant differences exist between the means as determined by Duncan’s multiple range (P<0.05) or Games-Howell post hoc test (P<0.05).

79 Liver CRH A CRH B1 0.040 a 0.6 0.035 0.5 0.030 0.025 0.4 0.020 0.3 b 0.015 0.2 0.010 c 0.005 b 0.1 ND ND ND ND ND ND 0 ND ND ND ND ND 0 CF** 1 * 2 3 4 5 6 7 JP CF 1 2 3 4 5 6 7 JP

UCN III-like CRH BP b 1.0 2.5 d 0.9 0.8 2.0 0.7 0.6 1.5 0.5 0.4 1.0 c 0.3 a 0.2 a 0.5 a b 0.1 ND ND ND ND ND a b ND ND ND ND 0 0 CF 1 2 3 4 5 6 7 JP CF 1 2 3 4 5 6 **7 JP

Arbitrary Expression Units CRH Rα CRH Rβ 0.16 250 b b 0.14 200 0.12 0.10 abc 150 0.08 0.06 100 0.04 ab a a 50 ab 0.02 NDND ND ND ab ND c a ND ND ND c 0 0 CF 1 2 **3 4 5 6 7 JP CF 1 2 3 4 5 6 7 JP *n=4 **n=3 Stage

80 Figure 18. Expression of CRH family mRNA in P. marinus Liver tissue by RT-qPCR. Arbitrary expression units represent expression normalized to β-actin and GAPDH relative to a pooled control sample. Developmental stage is indicated on the x-axis and includes immediately premetamorphic larvae (CF), stages 1 to 7 of metamorphosis and Parasitic Juveniles (JP). For all stages n=5, unless otherwise indicated. ND indicates transcript was undetected. Error bars represent SEM. Transcript levels were determined by RT-qPCR analysis as indicated in Material and Methods, with three technical replicates per sample. Statistically significant differences were determined by one way ANOVA (P<0.05). Bars with different letters above indicate statistically significant differences exist between the means as determined by Duncan’s multiple range (P<0.05) or Games-Howell post hoc test (P<0.05). (1No significant difference at P<0.05)

81 prior to declining in stage 1. As noted, CRH A was below the limit of detection for the remaining duration of metamorphosis until reappearing at low levels in JP. Unlike CRH

A, CRH B expression did not vary significantly from CF to stage 3, also, unlike CRH A,

CRH B was below the limit of detection in JP. The CRH BP gene was expressed at low levels in CF, declined in stage 1, before rising significantly to levels intermediate of JP and CF in stage 2 of metamorphosis. Similar to CRH A and B, CRH BP was below the limit of detection in stages 3 to 6 of metamorphosis; however, unlike CRH A and B, CRH

BP was detectable at low levels in stage 7 and rose to peak levels in JP, similar to UCN

III-like.

The two CRH receptors were expressed in a similar manner in the developing P. marinus liver being detected in CF and early metamorphosis before declining to levels below the limit of detection in later stages. A significant increase in CRH Rα levels was observed in stage 2 relative to stage 1 remaining at comparable levels in stage 3 before declining to levels below the limit of detection for the remaining duration of metamorphosis. Levels of CRH Rβ showed a continual increase from CF to stage 4 reaching peak levels in stage 4 prior to declining to levels below the limit of detection for the duration of metamorphosis. Both CRH Rα and CRH Rβ were once again detected in

JP tissue at the lowest levels of those observed in the developing liver.

3.5 Distribution of CRH system in Juvenile Parasitic P. marinus.

Generally the expression CRH system genes in JP were much lower than the other stages examined. To better understand the role of these genes we sought to explore the differing expression in organs during the JP period (Fig. 17).

Juvenile Parasite CRH A CRH B d 10 25 a b c c a 1 5 c ac b ND 0.1 1

0.01 0.2

0.001 *Gonad Gill

0.04 Brain Liver Kidney Kidney Gill Brain Liver Gonad

UCN III-like CRH BP 10 a 100 b c d ND a ab 1 10 b c bc 0.1 1 0.01 0.1 0.001 * Gill Liver Brain Kidney Liver Gonad Gonad Kidney Gill 0.0001 Brain 0.01

CRH Rα CRH Rβ Arbitrary Expression Units 10 a 100 a b c d bcd 1 10 a a a 0.1 b 1 0.01 Liver Liver Kidney Brain Gonad Gonad Kidney Gill Brain 0.001 Gill 0.1

Tissue

83 Figure 19. Expression of CRH family mRNA in various Juvenile Parasitic P. marinus tissue by RT-qPCR. Arbitrary expression units represent expression normalized to β-actin and GAPDH relative to a pooled control sample. Tissue type is indicated on the x-axis. For all stages n=5, unless otherwise indicated. ND indicates transcript was undetected. Error bars represent SEM. Transcript levels were determined by RT-qPCR analysis as indicated in Materials and Methods, with three technical replicates per sample. Statistically significant differences were determined by one way ANOVA (P<0.05). Bars with different letters above indicate statistically significant differences exist between the means as determined by Duncan’s multiple range (P<0.05) or Games-Howell post hoc test (P<0.05). *n=4

By in large, all CRH system transcripts were expressed at high levels in the brain relative to other organs, however, expression levels similar to, and, in some cases, higher than brain levels were observed in other P. marinus organs studied. Additionally, the

CRH family genes (CRH A, CRH B and UCN III-like) shared a similar distribution pattern to each other, albeit with a few exceptions. While CRH A expression was relatively high in the brain, in JP P. marinus, CRH A expression was significantly higher in the gonad (Fig. 17). Expression of CRH A was observed at relatively low levels in the gill, liver and kidney, compared to the brain and gonad, though levels in the gill were significantly higher than those observed in the kidney and liver. Similar to CRH A, CRH

B was expressed at relatively high levels in the brain and gonad, at lower levels in the gill and liver (below the limit of detection in the liver). However, unlike CRH A, CRH B was highly expressed in the kidney, at levels comparable to that observed in the gonad (Fig.

19). The distribution of UCN III-like expression differed from that of the other CRH family transcripts. While expression was high in the brain, and relatively lower in the gill,

UCN III expression was low in the kidney. Additionally, while relatively low levels of

CRH A and B expression were observed in the liver, UCN III-like expression was intermediate of brain and gill levels. In the gonad UCN III-like was below the limit of detection, whereas, as indicated above, CRH A and B were expressed at relatively high levels.

Comparison of JP tissue distribution of CRH BP shows higher expression in brain, gill and liver relative to gonad and, more so, kidney levels. The distribution of CRH Rα and CRH Rβ genes also differed in JP organs. CRH Rα expression was significantly higher in brain relative to the other tissues examined, with lowest expression observed in

the liver. In contrast CRH Rβ expression was comparable between brain, gill, kidney and gonad organs; though also significantly lower in the liver. Overall CRH A, UCN III-like and CRH Rα showed similar patterns of distribution, with the exception of UCN III-like expression in the gonad and liver, while CRH B, CRH BP and CRH Rβ each exhibited a unique pattern of distribution.

3.6 Expression Patterns of CRH system genes in the P. marinus stress response.

Expression of CRH system transcripts showed either an upward or downward trend after exposure to multiple acute stressors, although these changes were below the level of significance as determined by student’s t-test (P<0.05; Fig 20, Table 4). In the forebrain, CRH A, CRH B and UCN III (the putative ligands of CRH Rα, RB and CRH

BP) all exhibited a downward trend of expression in the stress group as compared to the control while the expression of CRH Rα and RB, and CRH BP increased (Fig 20 upper).

Expression trends in the stressed medial, or mid-brain relative to the non-stressed control was similar to that observed in the fore brain with the exception of CRH A and

CRH Rα, where no change was apparent, and CRH Rβ which declined in the stress group relative to the control. In the hind brain expression of CRH A and CRH B was low and no difference was observed between stress and control groups, while UCN III-like declined slightly. No change in CRH BP expression in the hind brain was apparent in the stress group compared to control, while CRH Rα, similar to in the fore brain increased and CRH Rβ, similar to in the mid brain, declined.

In the P. marinus brain, CRH system transcripts were found to localize to specific regions as evident by variable expression in fore, mid, and hind brain sections of the

4.5 4 3.5 FORE 3 2.5 2 CONTROL 1.5 STRESS 1 0.5 0 CRHA CRH B UCN III CRHBP CRH Rα CRH Rβ like

25 20 MEDIAL 15 CONTROL 10 STRESS 5 0 CRHA CRH B UCN III CRHBP CRH Rα CRH Rβ -5 like Arbitrary Expression Units

6 5 HIND 4 3 CONTROL STRESS 2 1 0 CRHA CRH B UCN III CRHBP CRH Rα CRH Rβ like

87 Figure 20. Expression of mRNA in fore, medial and hind brain sections following exposure to multiple acute stressors in P. marinus. Expression of CRH axis genes are presented alongside of a non stressed control. The control group contained juvenile parasitic P. marinus housed at 11 degrees celsius. The stress group was comprised of juvenile parasitic P.marinus that were exposed to multiple repeated acute stressors over a 24 hr period. The acute stressor involved dewatering for thirty minutes before introducing into 35% salt water and then recovering for x. This was repeated 12 times over a 24 hour period. Arbitrary expression units represent expression normalized to β-actin and GAPDH relative to a pooled control sample. CRH axis transcript is indicated on the x-axis. For all bars n=5, unless otherwise indicated. Error bars represent SEM. Transcript levels were determined by RT-qPCR analysis as indicated in Materials and Methods, with three technical replicates per sample. Statistically significant differences between stress and control groups were not observed.

88 100 Control

ab 10 a a b a a ab ab b a ab b b a b 1 Fore Medial 0.1 Hind

0.01

0.001 CRHA CRH B UCN III CRH BP CRH Rα CRH Rβ like

Stress

10 a a a a ab b ab b b Arbitrary Expression Units a b b 1

Fore 0.1 Medial

Hind 0.01

0.001 CRHA CRH B UCN III CRH BP CRH Rα CRH Rβ like

89 Figure 21. Comparison of mRNA expression between fore, medial and hind brain sections following exposure to multiple acute stressors in P. marinus. Arbitrary expression units represent expression normalized to β-actin and GAPDH relative to a pooled control sample. CRH axis transcript is indicated on the x-axis. For all bars n=5, unless otherwise indicated. Error bars represent SEM. Transcript levels were determined by RT-qPCR analysis as indicated in Materials and Methods, with three technical replicates per sample. Statistically significant differences were determined between CRH axis expression in frontal medial and hind brain sections by one-way ANOVA (P<0.05). Bars with different letters above indicate statistically significant differences exist between the means as determined by Duncan’s multiple range (P<0.05). Data was charted on a base 10 logarithmic y axis to allow visual comparison of low expression levels.

90 control (unstressed) group. Expression of CRH A had a unique pattern of expression, localizing primarily in the fore brain section; lower expression, though not significant, was observed in the midbrain and hind brain CRH A expression was significantly lower than in the fore brain. In contrast, the other CRH system transcripts were expressed in a relatively similar pattern to each other primarily expressed in the midbrain. The lowest expression of all transcripts was in the hind brain section, with the exception of CRH Rβ, which did not have significantly different expression in any of the three sections.

The expression pattern of CRH transcripts in the stress group was similar to the control group with a few exceptions in the stress group: CRH A expression in frontal was significantly higher than in the medial section; CRH BP expression in frontal was not significantly different from medial transcript expression; no significant difference in

CRH B and UCN III-like was found between frontal, medial and hind tissues; expression of CRH Rα in frontal was dissimilar to expression in hind; and expression of CRH Rβ was found to be statistically higher in medial than in hind sections as compared to control where no significant difference was present (Fig. 21).

4. DISCUSSION

The development of the hypothalamic pituitary axis in vertebrate species was an epoch-making physiological event that would allow for the evolution and specialization of complex endocrine systems such as the thyroid, gonadal and stress axes which control a variety of biological processes (Blanton & Specker, 2007; Fort et al., 2007; Guillerman

& Rosenberg, 1955; Sower et al., 2009). There are many models describing how the development of vertebrate HP –endocrine axes took place. One that is certainly plausible, given the discovery of HP components in insects which predate the development of an

HP, is bridging innovation (Campbell et al., 2004). Under this concept pre-existing ligand-receptor systems are ‘bridged’ forming a functional pathway, such as the HPT axis.

Following this model, development and specialization of these pathways can be measured to some extent through analysis in common ancestors. As a member of the most ancient extant vertebrate group, agnatha, P. marinus represents the phylogenetic root of vertebrate evolution and represent a unique opportunity to study this system in a living fossil.

It has been previously shown that lamprey possess primitive, though functional, overlapping HPG and HPT axes. Like teleost species, lampreys lack a hypophyseal portal system, however unlike teleosts, where neurohormones are carried by nerve fibers projecting from the hypothalamus to the pituitary, there is no innervation of the pituitary by the hypothalamus. As such it has been posited that transport of hypophysiotropins from the hypothalamus to the adenohypophysis occurs via a diffusion mechanism

(Nozaki et al., 1994). The effect this has on the functionality of the HP axes however remains unclear.

In addition to both HPT and HPG axes, it has been suggested that P. marinus possess a complete functional HPI. This was demonstrated through measurement of the glucocorticoid 11-deoxycortisol levels in response to stress, injection of P. marinus pituitary extracts and exogenous human CRH (Close et al., 2010). However, the key modulators of the HPI, the CRH system which includes the CRH family of peptides, two receptors, CRHR1, CRHR2 and a binding protein, CRH BP, have not been previously identified in P. marinus. Here, I provide evidence that these CRH system genes, including three CRH family members, two CRH receptors, and a CRH binding protein, exist in the ancient agnathan P. marinus. Additionally, these results indicate that these genes are expressed at varying levels over the course of metamorphosis of P. marinus and exhibit differential organ distribution in P. marinus.

4.1 Sequence analyses and evolutionary considerations

4.1.1 CRH family members

Here, I report the identification of the coding sequence of three distinct CRH family genes expressed in the agnathan, P. marinus; and demonstrate that the deduced amino acid sequences are highly conserved across all vertebrates. Two of these genes,

CRH A and CRH B, appear to be orthologues of the CRH peptide, while the other, UCN

III-like, appears to be a UCN type III orthologue. Orthologues of both UI and UCN II were not identified by PCR cloning or in silico approaches.

The deduced amino acid structure of the two P. marinus CRH genes, CRH A and

B, follow the same architecture of all CRH orthologues currently studied in vertebrate species. A short signal peptide is evident at the N terminus succeeded by a variable length cryptic peptide and a 41 amino acid mature peptide present at the C terminal. The highest level of amino acid consensus, as with other orthologues, was evident in the mature peptide. Interestingly, a second conserved region within the cryptic peptide, conserved in all vertebrate CRH propeptides, is absent in both lamprey CRHs. CRH sequences identified in invertebrate species also lack this second conserved region, as does a CRF II variant identified by in silico approaches in the elephant shark (Nock et al., 2011). The functional significance of this region is unclear as it is dissimilar to any known protein functional domain. It has been suggested that this region of the cryptic peptide may act as

‘urophysin’, posited to have similar carrier protein function to neurophysins, which transport oxytocin and vasopressin from the hypothalamus to the pituitary (Moore et al.,

1975). Further study is, however, required before any functionality can be accurately inferred to this region.

Both CRH A and CRH B contain, in the putative mature peptide, a three amino acid motif which has been shown to confer specificity of binding to the CRHR1 receptor, the predominant mediator of signalling via the HPI axis pathway (Fig 1,2,4)(Jahn et al.,

2004). The three amino acid motif, ‘TFH’, is found in both CRH A and B and is conserved in all vertebrate CRH and UI peptides currently identified and implicated in

CRH receptor subtype 1 affinity when compared with UCN II and III. Functional studies, in P. marinus, have indicated that mature human CRH, which contains the ‘TFH’ motif, can trigger elevation in 11-deoxycortisol levels (Close et al., 2010). This suggests that the

putative mature CRH A and B proteins, which share this motif and are similar to human

CRH at the amino acid level (Fig. 6), are functionally similar to other vertebrates CRHs.

Currently, the consensus is that two waves of gene duplication events gave rise to the full complement of vertebrate paralogues (Ohno, 1999). Temporally, one event is believed to have occurred prior to the divergence of agnatha and a second event after the divergence of gnathosomata; though the period of occurrence of the second event is still a matter of debate (Dehal & Boore, 2005). The identification of two separate CRH genes in

P. marinus suggests the second duplication event may have occurred prior to the gnathostomata divergence, resulting in two CRHs. Following this logic, one of these P. marinus CRHs, likely CRH B which clusters with the putative elephant shark, C. milli,

UI fragment, could be the precursor to UI; as compared to CRH A which clusters with other mammalian CRHs (Fig 5). The clustering of CRH A with tetrapod CRHs, specifically mammalian CRHs, as opposed to osteicthyan or chondrichtyan CRHs is somewhat unexpected considering the evolutionary relationship of the phylogenetic groups, though this is likely not functionally significant, as H. sapiens CRH was shown to induce a response in the P. marinus HPI axis (Close et al., 2010; Durand, 2003).

The second possibility with regards to the timing of the second WGD event follows the more commonly held belief that the second WGD event occurred after the divergence of Gnathostomata. This theory would imply a gene specific duplication event occurred at some point in Agnatha resulting in the two CRH genes. Similarly, CRH family genes identified by in silico approaches in the genome of the elephant shark revealed the presence of two CRH like genes, though this was in addition to a UI gene

fragment. There are also other reports of duplicate CRH genes in teleost species, such as

Oncorrynchus mykiss, rainbow trout, which are believed to have arisen out of a teleost specific WGD event.

There have been few reports of a UCN II gene in fish species. Although a putative

UCNII was identified in Oryzias latipes (medaka), it appears to cluster more closely with

UCN III than UCN II (Kawaguchi et al, unpublished; Raine et al., 2001). While a sequence similar to UCN II was identified by exhaustive in silico search of the P. marinus genome, I was unable to amplify this gene by RT PCR using specific primers and inferred it was not transcribed and therefore non-functioning (data not shown).

Similarly, a UCN II-like sequence identified in the genome of the elephant shark was suggested to be non-functional, suggesting that a functional UCN II gene may have arisen later in vertebrate evolution (Nock et al., 2011).

While no functional UCN II gene was identified, a UCN III gene, denoted UCN

III-like, was identified in P. marinus (Fig. 2). As with the CRHA and B genes UCN III- like contains signal peptide, and amidation site consistent with the CRH family.

Interestingly, the UCN III-like pre-propeptide is predicted to be processed by in silico models to a 41 amino acid mature peptide, making it slightly longer than most UCN II/III peptides. However, processing may occur at a basic arginine residue, forming an R/K-

X2-R/K processing signal resulting in the more common 38 amino acid long mature peptide (Fig 5). The functional significance of a three amino acid addition of CRH/UI compared to most UCN II/III is unclear, though the N-terminus region is important for ligand induced receptor signalling. Astressin, which lacks 12 amino acids in this N-

terminal region is able to interact with both CRHR1 andCRHR2 (Perrin, 1998).

Phylogenetic analyses of this gene reveals it clusters together with UCN III identified in the elephant shark C. milli (Fig 5), consistent with their evolutionary relationship. The

UCN II/III mature peptides appear to show less amino acid conservation than CRH/ UI.

This may be the reason that clear delineation of UCN II and UCN III peptides has not been explicitly defined. However, differences in the three amino acid motif, responsible for receptor specificity (approximately aa 8 to 11 of the mature UCN II or III peptide), appear to enable delineation of the two. The mature UCN II peptide contains the amino acid ‘PIG’ motif, corresponding to a location similar to the ‘T11FH’ motif in CRH and UI.

In UCN II, the ‘PIG’ motif confers specificity for the CRHR2 receptor and little to no affinity for the CRHR1 receptor (Jahn et al., 2004). In comparison, the UCN III mature peptide contains a ‘PTN’ amino acid motif in the corresponding region. This motif has been found to confer specificity, as with UCN II, to CRHR2 receptor types. However, unlike the UCN II which has no affinity to CRHR1, UCN III has some affinity, albeit reduced compared to CRH or UCN, with the CRHR1 receptor (Jahn et al., 2004). This reduced affinity has been suggested to result from the substitution of a proline residue, found in both UCN II and III in the ‘PTN’ or ‘PIG’ motifs as compared to threonine

(TFH motif) in CRH and UCN. This substitution has been suggested to reduce the alpha helicity of the mature peptide and thus decreasing the affinity of UCN II and UCN III for

CRHR1 ( Jahn et al., 2004). As previously indicated (see above) no functional UCN II gene has been identified in P. marinus, which is consistent with other fish species such as the elephant shark. This suggests that a UCN III-like gene is the progenitor of the vertebrate UCN II and UCN III peptides.

4.1.2 CRH receptors

The two P. marinus CRH receptors have been denoted CRH Rα and CRH Rβ.

Although, phylogenetic analysis indicates that there is clear delineation of CRHR1 and

CRHR2 subtypes, the two P. marinus receptors, which show characteristics of both receptors, cluster together outside of either receptor subtype (Fig 11, 12). Both P. marinus receptors share high amino identity with CRHR2 receptors. Since the P. marinus

CRH receptors are a phylogenetically distinct group outside of the other receptors, it is possible the two receptors are the result of an agnathan specific duplication event. This precludes phylogenetic characterization of CRH Rα and CRH Rβ as either CRHR1 or

CRHR2 receptor subtypes, each of which have different affinities for the four CRH family ligands. Structurally, both CRH Rα and CRH Rβ share the highly conserved N- terminus HRM and C terminal 7TM domains, which is consistent with type B1 GPRC receptors. Important for G-coupled signaling, the IC3 domain of the CRH receptors is highly conserved (Punn et al., 2012). While in both CRH Rα and CRH Rβ this region was found intact, a substitution of R268T is found in the CRH Rα (Fig. 11). Variation in this region has been shown to affect cAMP and Gs protein interaction, although it is unclear what the effect of this substitution in CRH Rα is in P. marinus.

4.1.3 CRH Binding Protein

Phylogenetic analysis of the P. marinus CRH BP amino acid sequence indicate it groups more closely with other vertebrate CRH BPs as compared to those found in invertebrates (Fig. 8). However, the P. marinus CRH BP gene was identified as distinct from currently studied vertebrate CRH BP and is consistent with the placement of P. marinus as a basal vertebrate species (Fig. 10). While identified as a phylogenetically

distinct relative of other known vertebrate CRH BP proteins, the P. marinus CRH BP contains functional regions, highly conserved in vertebrate CRH BP, such as conserved arginine residues at amino acid positions 45 and 57. In addition, 10 cysteine residues, identified as forming consecutive disulphide bridges and conserved in all vertebrates are also present (Fig. 10) (Huising & Flik, 2005). Previous identification, by crosslinking assay with 125I Xenopus laevis CRH, indicates that CRH BP is functional in P. marinus. It has been shown that a single amino acid, A22 of the mature CRH family peptides, serves as a ‘switch’ which determines whether CRH BP will interact with the peptide (Eckart et al., 2001). Additionally, the three amino acids following this alanine A22RAE25 appear to be important determinants of the ligand binding affinity of CRH BP for CRH family ligands. CRH A and B have the highest similarity to this motif, with likely tolerant substitution of R23K (CRH A) and A24V (CRHB). UCN III-like contains two tolerant substitutions resulting in an AKAS motif in the corresponding region (Fig 4) (Eckart et al., 2001; Ng & Henikoff, 2001). Although it is unclear as to the effect of these substitutions and the specificity of the P. marinus CRH BP peptide for the putative P. marinus CRH family peptides, by homology, it is probable that this protein will have some affinity for all three peptides.

4.2 Expression of CRH system transcripts through metamorphosis.

In general, CRH system transcripts were expressed at highest levels in premetamorphic P. marinus tissue and during the early stages metamorphosis. This suggests an early developmental role of the CRH system in P. marinus, possibly similar to those of other vertebrate species (Denver, 1995; Dufour & Rousseau, 2007; Kuhn et al.,

2005). While in other vertebrates the early developmental role has been found to be

closely related to CRHs ability to act as a thyrotropic agent, this connection has yet to be identified in P. marinus. The morphology of each tissue studied undergoes significant changes during the course of metamorphosis. It is unclear as to the exact role that the

CRH system plays in these changes in P. marinus.

4.2.1 Brain

The P. marinus brain undergoes significant changes through metamorphosis and nearly doubles in size. Despite this growth, the P. marinus brain, especially the telencephalon, is very small compared with the jawed gnathastomes perhaps relating to its primitive nature (Cole & Youson, 1982; Northcutt, 2002). As the location of the hypothalamus, the brain represents the pinnacle of HP axes hierarchies. The differential expression of CRH system genes during metamorphosis in the brain therefore directly implicates the stress axis as an integral part of lamprey development. In other vertebrate species, integration and coordination of HP axes, such as the HPT, has been identified as crucial to normal development of CRF neurons and the brain (Ciechanowska et al., 2011;

Porterfield & Hendrich, 1993; de Jesus et al., 1991; Dakine et al., 2000). In addition, TH and CRH levels have been identified as directly and/or indirectly affecting neuronal development in the vertebrate brain (Ebbesson et al., 2011; Porterfield & Hendrich, 1993).

In non-mammalian vertebrates, the CRH system has been identified as a major stimulant of TH hormone release (Boorse & Denver, 2002; Denver, 1993). While thyroid hormones in amphibians and flat fish are the main effectors of metamorphosis, cortisol acts synergistically with TH to initiate and accelerate metamorphosis (Szisch et al., 2005; de Jesus et al., 1990). Paradoxically, no active thyrotropin releasing hormone (TRH)

100

which, in mammals stimulates TH synthesis by inducing thyrotropin (TSH) secretion, has been found in amphibians. Rather in amphibians, (as well as other non-mammalian vertebrates) studies have demonstrated that CRH can control both thyroid and interrenal

(or adrenal) axes (De Groef et al., 2003; De Groef et al., 2006; Geven et al., 2006; Larsen et al., 1998). The dual hypophysiotropic role of CRH has been identified as dependant on receptor type. CRHR1, to which CRH and UI have high affinity, is primarily responsible cortisol stimulation while CRHR2, to which UCN II and III are primary ligands, is responsible for TH stimulation ( in addition to cortisol stimulation) via inducing release of TSH) from the pituitary (De Groef et al., 2003; De Groef et al., 2006). While little to no CRHR1 receptor expression has currently been identified on thyrotropes, CRHR2 has been found to be expressed on both corticotropes and thyrotropes (Groef et al., 2006).

However, in P. marinus, the situation is a little more complex. While in all species studied, that undergo a true metamorphosis, levels of TH increase at the onset of metamorphosis, in P. marinus these levels decline. Similarly, immediately following the onset of metamorphosis, from CF to stage 2, a significant declined in CNS expression of

CRH B, UCN III-like and CRH Rα was seen.

Currently, no TRH has been identified in P. marinus suggesting, similar to the situation in larval anurans, where TRH has no TH regulating ability; P. marinus CRH may fill this role. While a putative TSH receptor has been found, no TSH, responsible for

CRH mediated TH stimulation, has been identified in P. marinus (Sower et al., 2009).

Recently, a beta sub-unit of gonadotropin (GTHβ) has been identified and it has been posited that it may function as a TSH in lamprey (Sower et al., 2006). Functional studies,

101

on this topic have yet to be forthcoming. As such, while a potent stimulant of TH in fish and frog species, it is unclear whether this functionality occurs in P. marinus as well.

In addition to possible interaction with the HPT axis, evidence suggests that CRH interacts with the HPG axis by directly or indirectly affecting gonadotropin-releasing hormone (GnRH) (Ciechanowska et al., 2011; Hayes, 1994; Westphal & Seasholtz, 2005).

In lamprey, GnRH synthesis and secretion patterns vary with life history type, that is they differ for parasitic (i.e., P. marinus) and non-parasitic (i.e., L. richardsoni) species

(Youson et al., 2006). While GnRH expression has been identified as important in premetamorphic lamprey, expression is relatively low until later stages of metamorphosis or the post-metamorphic period. This coincides with the acceleration of gonadal development in the later stages of metamorphosis (Youson et al., 1995; Youson & Sower,

1991). Attempts at correlating ACTH with GnRH have been made, though further investigation is required (Youson et al., 2006). While interaction of CRH and the HPG axis has yet to been identified, overlap of the HPT and HPG axes has been suggested. It is possible that integration of the HPG, HPT and HPG axes are important for the normal development of P. marinus, although the primary function of CRH in the brain of all vertebrates, to date, is associated with stimulation of the pituitary-interrenal (Bonga,

1997).

Except for CRH A, all P. marinus CRH system transcripts appear to be developmentally regulated throughout metamorphosis in the P. marinus brain. High levels of CRH system transcripts in immediately premetamorphic P. marinus indicates a possible stress dependant mechanism of metamorphosis similar to that posited for

102

anurans. Although a dramatic decline in transcript levels, similar to the decline in TH at the onset of metamorphosis, was not observed (Suzuki, 1987; Youson et al., 1994;

Denver, 1999). Additionally, a decline in CRH system expression may correlate to the previously observed increase in GnRH system transcripts observed late in metamorphosis

(Ciechanowska et al., 2011a; Youson & Sower, 1991). The variation in CRH system components over the duration of metamorphosis in P. marinus suggests a model of stress induced phenotypic plasticity, modulated by the CRH system, similar to that identified in anurans ( Denver, 1997; Denver, 1999; Seasholtz et al. 2002).

4.2.2 Gill

Fish gills contain a widespread and delicate epithelium separating blood and water. The function of fish gills are multipurpose, accommodating respiration, osmoregulation, nitrogen excretion and acid-base balance. Additionally, the gills in fish have a significant role in endocrine system regulation and metabolism (Evans et al.,

2005). The gill system of P. marinus is relatively similar to other fish, with some exceptions. One example of such an exception relates to the flow of water in post metamorphic lamprey where muscles pump water in and out of external gill pores in a tidal fashion. This is unlike the typical unidirectional mouth to gill water path found in larval lamprey and all other fish, which is unavailable in post-metamorphic P. marinus due to their parasitic feeding (Evans et al., 2005).

In the complex P. marinus life history, pre-metamorphic larvae spend several years as salt water intolerant freshwater dwellers prior to undergoing metamorphosis and becoming salt water tolerant allowing migration to the ocean. During metamorphosis

103

osmoregulatory changes in premetamorphic and transforming metamorphic larvae occur in anticipation of downstream migration to salt water. The ability of P. marinus to maintain homeostatic conditions by increasing osmoregulatory competence parallels branchial Na+/K+ -ATPase and chloride cell abundance which increase in P. marinus over the course of metamorphosis. Pre-metamorphic P. marinus larvae can tolerate approximately 10 ‰ salinity. Saline conditions above this are acutely lethal (Beamish et al., 1978; Mathers & Beamish, 1974). By stages 3 -5, salinity tolerance increases to around 25‰, coinciding with increases in branchial plasma ion levels and Na+/K+ -

ATPase expression. Metamorphosing larvae remain intolerant to higher salinity levels until stage 6 when salinity levels of 35‰ or greater are no longer fatal, which corresponds to the differentiation of adult chloride cells and maximal branchial Na+/K+

(Peek & Youson, 1979). The ability to acclimate to increasing salinity additionally correlates with branchial chloride cell development; development of these cells has been found to occur later in P. marinus metamorphosis, though physiological changes likely allow for some salinity tolerance around stages 1-2 (Bartels et al., 2009).

A role for the HPI axis in saltwater acclimation was recently characterized in tilapia (Aruna et al., 2012). It was deduced that salinity stress induced specific and different responses in gill and brain as compared to other stressors. Expression of HPI axis components, including CRH, its receptors, and glucocorticoid and mineralocorticoid receptors were shown to be significantly responsive under these conditions (Pfeiler, 1984;

Reis-Santos et al., 2008). In addition, a linear relationship between Na+/K+ ATPase levels and cortisol has been characterized (Kiilerich et al., 2007; Shrimpton & Mccormick,

1999). Interestingly, unlike other anadromous fish species, P. marinus does not acclimate

104

to salt water conditions, rather salinity tolerance, acquired during metamorphosis, pre- empts migration to salt water (McCormick et al., 1998; Reis-Santos et al., 2008; Reis-

Santos et al., 2008). Coinciding with physiological changes in the P. marinus gill during metamorphosis, related to the acquisition of salinity tolerance, expression of CRH system genes were found to vary significantly throughout P. marinus metamorphosis in the gill

(Fig14). High transcript expression is present in CF larvae to stage 4 for all CRH ligands as well as CRH BP and CRH Rβ with a spike in CRH A, B UCN III-like and CRH BP expression observed in stage 2. These high levels of expression may play a role in prompting the increases in Na+/K+ -ATPase expression and activity, through increasing levels of 11- deoxycortisol, responsible for the increase in salt water tolerance in stages

3- 5 of metamorphosis. While the high levels of CRH system expression from CF to stage

4 possibly correlates with increasing Na+/K+ -ATPase expression and activity, low levels of CRH system expression from stage 5 on suggest that they do not have an effect in the development of chloride cells in stage 6, found to coincide with the full ability of P. marinus to acclimate to sea water. The correlation of CRH system expression early in metamorphosis, and the previous implication of 11-deoxycortisol in Na+/K+ -ATPase activity and expression, suggests that the HPI axis may be involved in salt water acclimation in the gills of P. marinus.

4.2.3 Kidney

The P. marinus kidney is a site of significant morphological change as three generations of kidney are seen throughout the P. marinus life cycle. The pronephric kidney, found early in larval life, begins to regress in the third year of larval life, and, at the onset of metamorphosis has been completely replaced by the developing larval

105

opisthonephros (Ellis & Youson, 1990). Through metamorphosis the larval opisthonephros degenerates while the adult opisthonephros simultaneously develops from undifferentiated nephrogenic tissue (Ooi & Youson, 1977). Both the larval and adult opisthonephric kidneys are, together with the gill, involved in osmoregulation and the absorption of solutes, which allows for the homeostatic preservation of the ionic composition of fluids.

Larval P. marinus, in order to undergo metamorphosis, need to accumulate sufficient lipid reserves (Potter, et al., 1978a). These accumulated lipids supply the energy required for the non-trophic phase of metamorphosis (Potter et al. 1978b).

Accommodating lipid accumulation and depletion is a two phase tissue specific pattern of lipid metabolism occurring in the kidney, liver and gut. In the kidney and liver, the first phase is characterized by major lipid deposition from a phase of lipogenesis in immediately pre-metamorphic larvae to approximately stage 3 of metamorphosis. In the kidney the majority of lipid deposition is triacylglycerol (TAG), resulting from a decrease of triacylglycerol lipase, TGL, and increase in acetyl coenzyme A carboxylase, ACC

(Kao et al., 1997). Following this lipogenic phase, a phase of lipolysis persists in the kidney until stage 5 (stage 6 in the liver) resulting from an increase in TGL and a decrease in ACC.

Cortisol, 11-deoxycortisol in P. marinus, the end product of the HPI axis signalling cascade, in addition to its previously demonstrated role in osmoregulation, plays a role in lipid metabolism by increasing hormone sensitive lipase (HSL) and TGL activity, favoring lipolysis, in fish, mammalian and anuran species (Glenny & Brindley,

106

1978; Sheridan & Kao, 1998; Sheridan, 1986). This suggests potential involvement for

CRH system in the lipolytic phase of metamorphosis in P. marinus. However, the situation is much more complex, as cortisol, in addition to ACTH and CRH directly have been also found to have lipogenic effects (Dimitris, 2008; Glenny & Brindley, 1978;

Sheridan, 1986). Consequently, CRH may have both lipogenic and lipolytic effects via its

TH stimulatory role in non-mammalian vertebrates (De Groef et al., 2003; De Groef et al.,

2006; Geris et al., 1999; Kuhn et al., 2005; Larsen et al., 1998b). The potential dual role of the CRH system in lipid metabolism suggests that the CRH system is important to both lipogenic and lipolytic phases of lipid metabolism in the kidney. However, this role has not been fully characterized and the major function of the CRH system peptides in the P. marinus kidney is likely as a regulator of osmoregulation, likely a remnant of its putative ancestor, insect DH (Gutkowska, 2000; Lovejoy & Barsyte-Lovejoy, 2010).

Despite stimulating synthesis and release of the major downstream product of the

P. marinus HPI axis, 11-deoxycortisol, CRH system gene expression is at very low levels in the kidney, compared to the gill and brain, suggesting a limited paracrine role. Levels of CRH system transcripts in the kidney exhibit a complex pattern of expression, CRH A,

CRH Rα, and UCN III-like increase from CF to stage 2 coinciding with the lipogenic phase of P. marinus metamorphosis (Fig 15). At the onset of the lipolytic phase, stage 4,

CRH A decreases to undetectable levels further suggesting a role in lipid metabolism.

CRH Rα and UCN III-like however, show varying expression after stage 3 (Fig 15).

Though low in stage 3 at the onset of lipolysis, UCN III-like expression rises in stage 4 and spikes in in stage 5; coinciding with elongation of the proximal portion of the renal tubule and an expansion of the renal tubular network in distal cells, and possibly

107

indicating a role in lipolysis (Fig. 15) (Youson, 1984). From peak levels in stage 5, UCN

III-like declines over the duration of metamorphosis and is undetectable in JP; suggesting a larval phase metamorphosis specific role for UCN III. Counter to this CRH A, B, CRH

BP and CRH Rβ peak in JP in the kidney, indicate a JP specific role, possibly due to the differences in the morphology of the newly formed gill and adult opisthonephros.

Interestingly, CRH BP shows a punctuated expression profile being present in CF, stage

2, stage 4 and as mentioned JP, while otherwise undetected, implying a stage specific role.

4.2.4 Liver

The liver is a vital organ which is responsible for a diverse range of functions, from metabolism, to detoxification, serum protein synthesis, iron storage and production of digestive bio-chemicals. Similar to the kidney, the liver is home to two stages of lipid metabolism during P. marinus metamorphosis; including a lipogenic phase, occupying

CF to stage 3, and followed by a lipolytic phase, that lasts from stage 4 until approximately stage 6 to 7.

CRH system expression has been found to be limited in the liver of fish (Chen &

Fernald, 2008). Consistent with fish species, low level expression of CRH system transcripts was found in the P. marinus liver (Fig 16, 17). Recently, CRH has been implicated in apoptosis of liver cells, likely mediated through interaction with CRHR1 receptor (Paschos et al., 2010). During P. marinus metamorphosis, the bile ducts in the liver undergo significant degeneration, most dramatically between stages 3-5 of metamorphosis, being replaced by hepatocyte cords (Sidon & Youson, 1983). Despite this, cholestasis is avoided until P. marinus begins upstream spawning migration, likely

108

via renal excretion and increase in intestinal bile salt synthesis (Yeh et al., 2012). Due to the correlation of CRH with apoptosis of liver cells in other species, and the biliary atresia observed in the P. marinus liver during metamorphosis, hepatic CRH system expression was measured in P. marinus in CF larvae, through the 7 stages of metamorphosis and in JP (Paschos et al., 2010). Levels of each P. marinus CRH ligand transcript were undetected at the peak of biliary degeneration. While this suggests the degeneration of the biliary tree during metamorphosis is not directly affected by the CRH system, it is possible that the expression of CRH A and B observed in stages 1 and 2 were sufficient to induce CRH mediated apoptosis of liver cells which begins to appear in stages 3 to 5. Conversely, CRH transcript expression did coincide well with the 2 stages of lipid metabolism occurring in the liver. All CRH system transcripts except for UCN

III-like are expressed in during the lipogenic phase of lipid metabolism in the liver, CF to stage 2. Following this in stage 3, CRH A, B and CRH BP are undetected through the remainder of metamorphosis, which coincides with the lipolytic phase of metamorphic lipid metabolism in then liver. Unlike the CRH ligands, CRH Rα expression is observed in stage 3 of the liver and CRH Rβ is expressed in stage 3 and 4. These are stages when

CRHR ligands were below the limit of detection. Interestingly UCN III-like expression is undetectable until stage 5, where it shows a low level of expression, before spiking similar to CRH BP levels, in JP. The reciprocal patterns of expression of CRH A and B and UCN III-like suggests opposing roles in the liver. Indeed, the potential for such opposing roles have been observed in cholestasis-induced liver cell apoptosis in rats

(Paschos et al., 2010). In rats, it was noted that CRH, via CRHR1 interaction, induced apoptosis and CRHR2, possibly through interaction with UCN III, may mediate anti-

109

apoptotic signalling, likely via its ligand UCNIII (Paschos et al., 2010). The appearance of UCN III-like following the absence of CRH A and B, and similar expression of UCN

III-like in the kidney relative to CRH A and B, suggests a role contrary to CRH A and B.

It is possible this pattern of UCN III-like expression is integral to the lipolytic phase, while CRH A and B expression is important to lipogenesis. Further characterization of the peripheral role and mode of action of the CRH system will enable better understanding of their developmental role.

4.3 Distribution of CRH transcripts in Juvenile Parasites

An organism’s survival is dependent on its ability to maintain homeostatic conditions in response to a dynamically changing environment. To maintain these homeostatic conditions requires integration and actions of molecular, cellular, physiological and behavioural systems. A stressor represents an external or internal threat to this equilibrium and the adaptive stress response which acts to maintain this equilibrium, has conferred a survival advantage. Activation, regulation and control of the stress response are imperative to an organism’s ability to reach equilibrium which results in increases or decreases in stress components. However, due to ever changing conditions and the plurality of component roles, a complex pattern of expression of stress axis components is required even in the absence of stress (Cokkinos et al., 2012).

4.3.1 CRH family

As previously indicated (see above section 4.2), the CRH system has been implicated in a multitude of contrasting roles both directly and indirectly in development and normal physiological function. Some of these roles include correlation with Na+/K+ -

110

ATPase activity, and differential roles in cholestasis induced liver apoptosis. Additionally, the CRH system also has a complex role in the immune response, acting in both an anti- inflammatory role, via the actions of downstream glucocorticoids, and in stimulating inflammation directly in a paracrine manner by peripherally expressed CRH (Almeida et al., 2003; Mastorakos et al., 2006). The plurality of roles has been related to receptor type, as in the HPT axis, CRH family ligands stimulate TH release primarily through

CRH R2 interaction, and in the HPG axis, although interaction of CRH family ligands can both stimulate and inhibit GnRH release through both CRHR1 and CRHR2 interaction (Ciechanowska et al., 2011b; De Groef et al., 2006; Kageyama et al., 2012; Li et al., 2005; Traslaviña & Franci, 2012a).

Expression of P. marinus CRH family transcripts in non-metamorphosing JP is organ specific (Fig. 19). In this study, each transcript showed a unique pattern of distribution suggesting a different physiological role. The predominant site of expression for each CRH family transcript was in the brain, except for CRHA, which, although it was expressed at high levels in the brain, had higher expression in the gonad. Overall, the distribution of CRH B in JP organs is similar to that of CRH A, although a notable difference was identified in the kidney, where CRH B was prevalent, but CRH A was relatively low (Fig19). The similarities in tissue distribution of CRH A and B likely relates to the similarities in the mature peptide (Fig. 4), which suggest the two share a similar function. The uniquely high expression of CRH B in the kidney, however, is interesting; neither CRH A nor UCN III-like was highly expressed here; suggesting that, despite amino acid similarity, CRH B has a unique role in the kidney as compared to

CRH A.

111

While the gonad was not studied prior to and during metamorphosis expression was observed in JP P. marinus. In the gonad, CRH A, CRH B and CRH Rβ were expressed at relatively high levels as compared to other organs. The high expression of

CRH A, B and CRH Rβ in gonadal tissue suggest a role in the P. marinus HPG axis that may be similar to other species, namely to regulate steroid production by a paracrine mechanism of action (Heinrich, 1998; Kageyama et al., 2012; Li et al., 2005;

SLOMINSKI et al., 2001; Traslaviña & Franci, 2012). Indeed it has been shown that chronic 11-dexycortisol levels causes a decrease in sex steroids in JP P. marinus (Close et al., 2010). Due to the complexity of CRH system mechanisms, both the observed decrease in CRH system levels in the P. marinus brain and high levels of these genes in the JP gonad may relate to the acceleration of gonadal development in JP and increasing of GnRH levels late in metamorphosis in JP. (Youson & Sower, 1991; Wright et al.,

1994). This may be due to the paracrine effects of the CRH system differing from those mediated by classical endocrine mechanisms.

4.3.2 CRH receptors

While delineation of the two identified CRH receptor transcripts by phylogeny is ambiguous, delineating by localization of expression has yielded more promising results.

In other vertebrate species the subtype 2 receptor shows the highest level of expression in the periphery, while subtype 1 is localized to the CNS (Palchaudhuri et al., 1998; Vita et al., 1993; de Groef et al., 2004; Chen & Fernald, 2008b). Thus from a functional perspective the data suggests that CRH Rβ in P. marinus is a CRHR2 type receptor and

CRH Rα is the P. marinus CRHR1 type receptor (Fig. 19). Following this line of reasoning, CRH Rα was found to have a similar distribution to CRH A in the investigated

112

P. marinus JP organs, which is its putative primary ligand (Fig. 19). CRH Rβ distribution in the same JP P. marinus organs indicates that CRH Rβ expression is more widespread, consistent with a CRHR2 type receptor. In the gill, CRH family expression has been associated with osmoregulation (Aruna et al., 2012). Relatively high levels of CRH Rβ in this tissue supports an important role in normal gill function; although no ligand showed a similarly high level of expression in this tissue. As with all P. marinus CRH family genes, except UCN III, expression of both CRH Rα and RB were lowest in the liver where it is associated with metabolism.

4.3.3 CRH BP CRH BP activity in P. marinus brain tissue was previously identified by chemical crosslinking using125I labeled Xenopus laevis CRH. Reports of CRH BP mRNA tissue distribution vary with species. In X. laevis a broad expression profile was found with expression in brain, pituitary, liver and intestine (Valverde et al. 2001b). Conversely, in

Oncorrynchus mykiss CRH BP expression was widely expressed in the CNS but apparently absent in peripheral tissue (Alderman et al., 2008). In Cyprinus carpio CRH

BP was found to be expressed in the gill and skin and broadly in the brain, retina, pituitary, and muscle (Mazon et al., 2006). In Astatotilapia burtoni, expression was also observed in the brain, retina, and pituitary as well as in the muscle, gill, spleen, liver, kidney, and heart (Chen & Fernald, 2008). This variation in expression profiles between species is curious, as it suggests that CRH BP may influence the immune, digestive, circulatory, and osmoregulatory systems depending on the species. In P. marinus, expression of CRH BP in the JP hind brain (Figs. 20, 21) is similar to that observed in D. rerio and O. mykiss, and implies a similar functionality where it has been identified as

113

important to locomotor activity (Alderman & Bernier, 2007; Clements et al., 2003).

Additionally, wide distribution in P. marinus gill, liver, kidney and gonadal tissue similarly positions CRH BP to influence a diverse set of functions including osmoregulation, digestion, immune function and possibly steroid hormone production

(Fig. 20). Interestingly, CRH BP expression parallels UCN III-like in the liver; where

CRH A expression is low and CRH B is undetectable (Fig 19). CRH BP also coincides with UCN III-like expression in medial and hind brain sections of JP tissue (Figs 20, 21).

This suggests that compared to other species, where UCN III is a lower affinity ligand for

CRH BP, in P. marinus CRH BP may interact with UCN III-like (Westphal & Seasholtz,

2006).

4.4 Response of CRH system expression to Stress in the CNS

Currently, expression of CRH system transcripts have been found to be responsive to many paradigms of acute stress in fish species (Alderman et al., 2008;

Ando et al., 1999; Bernier et al., 2008; Fuzzen et al., 2011; Mazon et al., 2006). In order to examine the change in CRH system gene expression in response to acute stress, juvenile parasitic P. marinus were exposed to multiple successive acute stressors by dewatering and exposure to a salt water environment (12 times over a 24 hr period). This dewatering and salt water exposure had previously been shown to elicit an increase in downstream effectors of the stress response (11-deoxycortisol) (Close et al., 2010).

Repeated exposure of the JP P. marinus specimens was expected to exacerbate the stress response at the level of CRH system transcription by exhausting levels of the CRH system peptides in the brain and requiring an up-regulation of gene expression (Barton et al., 1986; Huising et al., 2004). However, a significant change in the expression of any P.

114

marinus transcripts, relative to the unstressed control, was not observed in the frontal hind or medial sections in brain tissue (Fig 20, 21).

Though this does not preclude the regulation of CRH system genes by stressors, it does indicate that, under these conditions, a significant response at the level of CRH system gene expression does not occur. This, however, account for potential differences between transcription and translation, as an increase in the CRH peptide by regulation of translation may increase CRH levels though no change is observed in mRNA expression levels. While it is possible that in other fish species, prolonged exposure to multiple stressors served to exacerbate variation in CRH transcript expression, in P. marinus, this prolonged period may have served to desensitize the organisms to the stressors and thus not elicit a variation in expression.

Another potential reason of an insignificant variation in CRH system gene expression relates to a pattern of response that has been observed in other fish species during the stress response. The level of cortisol, downstream effectors of the stress response mediated by CRH, in response to stress appears to be significantly higher in more derived species, such as trout and walleye as compared to more basal vertebrates.

This is apparent by an increase in cortisol in trout and walleye as much as 94 times as compared to sturgeon, where cortisol levels increased only 1.3 times (Barton, 2002;

Manire et al., 2007). Recently, this trend has been found to be similar in the acute stress response of P. marinus where levels increased under 3 fold after exposure to acute dewatering and saltwater stressors (Close et al., 2010). As such, it is possible that the change in CRH system expression in response to stress is too minor to be detected, even

115

by RT qPCR methods. The HP axes appear to have become more specialized over vertebrate evolution with significant overlap of these axes in basal vertebrates (Blanton &

Specker, 2007; Fort et al., 2007; Geven et al., 2006; Mcnabb, 2007; Sower et al., 2009).

While speculative, the lack of significant response in expression of CRH system genes in

P. marinus and basal vertebrates may be due to a need for tighter regulation of axes components due to their broad overlapping effects.

116

5. SUMMARY AND FUTURE DIRECTIONS

The innovation of the hypothalamic pituitary axes in vertebrate evolution is a pivotal event. Some of the many functions that HP axes are responsible for include endocrine regulation of stress and growth as well as reproductive, osmoregulatory, and metabolic systems. The identification and characterization of CRH system genes in P. marinus, coupled with previously described HPI axis components, ACTH and 11- deoxycortisol, suggests that a complete set of the components required for HP control of the stress axis are conserved in this ancient extant vertebrate (Close et al., 2010). The identification of CRH system genes in protostomes indicates that CRH predates the divergence of deuterostomes, approximately 700 million years ago (De Loof et al., 2012).

While present in insects, the association of the CRH system with the stress, and other endocrine axes, appears to be an acquisition specific to vertebrates, possibly relating to the acquisition of a hypothalamic pituitary system (De Loof et al., 2012; Sower et al.,

2009). In additionally, by fossil analysis, lamprey have been suggested to be relatively conserved over the past 360 million years (De Loof et al., 2012). Given the antiquity of both the CRH system and lamprey, it is anticipated that characterization of CRH system genes in the lamprey, P. marinus, will contribute to the understanding of the functional specialization of these genes from vertebrate ancestors to more derived vertebrates such as fish and mammals.

In the lamprey species, P. marinus, I identified three CRH family members, two

CRH receptors and one CRH BP gene from both cloning and in silico approaches. The conservation of the encoding amino acids of these genes throughout evolution implies a

117

functionality that is also conserved in vertebrate evolution. The three identified P. marinus CRH family genes represent orthologues of distinct paralogues within the CRH family, each identified as having distinct binding and functional properties in other vertebrates. The P. marinus CRH A and B genes appear to be orthologues of vertebrate

CRH, while the UCN III-like gene appears to be an orthologue of vertebrate UCN III. No

UI or UCN II, two other CRH family paralogues identified in mammalian vertebrates, was identified by PCR cloning or exhaustive search of the lamprey genome. Each of the two P. marinus CRH receptors, CRH Rα and CRH Rβ, were identified as being distinct.

However, by phylogenetic comparison of their amino acid structures, neither of these receptors was classified as members of the functionally and structurally distinct CRHR1 or CRHR2 receptor subtypes. The P. marinus CRH BP gene contained several conserved regions in the deduced amino acid sequence identified as functionally significant in vertebrates. This gene was identified as basal to other vertebrate CRH BPs and distinct from the putative invertebrate CRH BPs by phylogenetic analysis.

Recently, the plurality of the CRH system, including roles in HPG and HPT axes by both classical endocrine and paracrine mechanisms, has begun to be explored and widespread tissue distribution of CRH system genes has been identified (Chen & Fernald,

2008; Ciechanowska et al., 2011; Kuhn et al., 2005). In P. marinus, all CRH system genes showed organ and developmentally specific periods of expression. Similar to other vertebrates the major organ of CRH system gene expression was in the P. marinus brain, coinciding with their role in the HPI axis. In addition, expression of all CRH transcripts was observed in peripheral organs including high levels of expression in the gill and varying degrees of expression in the liver, kidneys and gonad. This peripheral distribution

118

suggests a localized paracrine effect of CRH system in these organs, which is consistent with such activity observed in several vertebrate species; including mice, humans and tilapia (Aruna et al., 2012; Heinrich, 1998; Zouboulis et al., 2002).

The expression of each P. marinus CRH system gene was found to be variable from pre-metamorphic larvae, through the seven stages of metamorphosis and into the juvenile parasitic life history. The patterns of expression of P. marinus CRH system genes coincide with some significant physiological changes that occur in P. marinus through metamorphosis such as Na+/K+ -ATPase activity in the gill and lipogenic/lipolytic phases through metamorphosis in the kidney and liver. The variation in expression observed in these organs suggests the CRH system may play an integral part in mediating these changes.

The research presented here suggests several avenues worthy of further study.

While the identification and developmental regulation of the P. marinus CRH system genes provides reasonable evidence that these genes likely encode functional proteins, it does not substantiate this hypothesis absolutely. Identification of these proteins by radio immune assay or immunohistochemical approaches will further corroborate the processing and functionality of these genes as active neuropeptides. Additionally, measurement of P. marinus CRH system peptides in response to stress exposure, where in this study little effect was seen at the level of gene expression, may help indicate whether the CRH system is important in regulating stress in P. marinus.

The P. marinus CRH receptors were unable to be classified as either CRHR1 or

CRHR2 subtypes. As such, differences in affinity of the putative P. marinus family genes

119

for receptor, as is observed in other vertebrates, could not be ascertained. A binding kinetics assay of the P. marinus CRH family members with CRH Rα and CRH Rβ may assist in discerning the functional properties of these two receptors. Additionally, colocalization of the receptors with specific CRH system member or other HP axis members in specific cell types (i.e. gonadotrope cells and thyrotrope cells) will help elucidate any overlapping roles similar to those observed in other vertebrates.

120

6. REFERENCES

Alderman, S L, Raine, J. C., & Bernier, N. J. (2008). Distribution and regional stressor- induced regulation of corticotrophin-releasing factor binding protein in rainbow trout (Oncorhynchus mykiss). Journal of neuroendocrinology, 20(3), 347–58. doi:10.1111/j.1365-2826.2008.01655.x

Alderman, Sarah L, & Bernier, N. J. (2007). Localization of corticotropin-releasing factor, urotensin I, and CRF-binding protein gene expression in the brain of the zebrafish, Danio rerio. The Journal of comparative neurology, 502(5), 783–93. doi:10.1002/cne.21332

Almeida, O. F. X., Canoine, V., Ali, S., Holsboer, F., & Patchev, V. K. (2003). Activational Effects of Gonadal Steroids on Hypothalamo-Pituitary-Adrenal Regulation in the Rat Disclosed by Response to Dexamethasone Suppression. Journal of Neuroendocrinology, 9(2), 129–134. doi:10.1046/j.1365-2826.1997.00556.x

Alsop, D., & Vijayan, M. (2009). The zebrafish stress axis: molecular fallout from the teleost-specific genome duplication event. General and comparative endocrinology, 161(1), 62–6. doi:10.1016/j.ygcen.2008.09.011

Altschul, S., Gish, W., Miller, W., Myers, E., & Lipman, D. (1990). Basic local alignment search tool. Journal of Molecular Biology, 215(3), 403–410. doi:10.1016/S0022- 2836(05)80360-2

Ando, H., Hasegawa, M., Ando, J., & Urano, A. (1999). Expression of salmon corticotropin-releasing hormone precursor gene in the preoptic nucleus in stressed rainbow trout. General and comparative endocrinology, 113(1), 87–95. doi:10.1006/gcen.1998.7182

Arai, M., Assil, I. Q., & Abou-Samra, A. B. (2001). Characterization of three corticotropin- releasing factor receptors in catfish: A novel third receptor is predominantly expressed in pituitary and urophysis. Endocrinology, 142(1), 446–454. Retrieved from ISI:000166308700051

Arjona, F. J., Vargas-Chacoff, L., Ruiz-Jarabo, I., Gonçalves, O., Páscoa, I., Martín del Río, M. P., & Mancera, J. M. (2009). Tertiary stress responses in Senegalese sole (Solea senegalensis Kaup, 1858) to osmotic challenge: Implications for osmoregulation, energy metabolism and growth. Aquaculture, 287(3-4), 419–426. doi:10.1016/j.aquaculture.2008.10.047

121

Aruna, A., Nagarajan, G., & Chang, C.-F. (2012). Involvement of corticotrophin-releasing hormone and corticosteroid receptors in the brain-pituitary-gill of tilapia during the course of seawater acclimation. Journal of neuroendocrinology, 24(5), 818–30. doi:10.1111/j.1365-2826.2012.02282.x

Baigent, S. (2000). mRNA expression profiles for corticotrophin-releasing factor (CRF), urocortin, CRF receptors and CRF-binding protein in peripheral rat tissues. Journal of Molecular Endocrinology, 25(1), 43–52. doi:10.1677/jme.0.0250043

Bale, T. L., & Vale, W. W. (2004). CRF and CRF receptors: role in stress responsivity and other behaviors. Annual review of pharmacology and toxicology, 44, 525–57. doi:10.1146/annurev.pharmtox.44.101802.121410

Bartels, H., Schmiedl, A., Rosenbruch, J., & Potter, I. C. (2009). Exposure of the gill epithelial cells of larval lampreys to an ion-deficient environment: a stereological study. Journal of Electron Microscopy, 58(4), 253–260. Retrieved from WOS:000268113300003

Barton, B. A. (2002). Stress in fishes: a diversity of responses with particular reference to changes in circulating corticosteroids. Integrative and comparative biology, 42(3), 517–25. doi:10.1093/icb/42.3.517

Barton, B. A., & Iwama, G. K. (1991). Physiological changes in fish from stress in aquaculture with emphasis on the response and effects of corticosteroids. Annual Review of Fish Diseases, 1(null), 3–26. doi:10.1016/0959-8030(91)90019-G

Barton, B. A., Schreck, C. B., & Sigismondi, L. A. (1986). Multiple Acute Disturbances Evoke Cumulative Physiological Stress Responses in Juvenile Chinook Salmon. Transactions of the American Fisheries Society, 115(2), 245–251. doi:10.1577/1548- 8659(1986)115<245:MADECP>2.0.CO;2

Beamish, F. W. H. W. H., Strachan, P. D. D., & Thomas, E. (1978). Osmotic and ionic performance of anadromous sea lamprey, Petromyzon marinus. Comparative Biochemistry and Physiology A-Physiology, 60(4), 435–443. doi:10.1016/0300- 9629(78)90013-0

Bernard, C. (1865). Introduction à l’étude de la médecine expérimentale. Paris: J. B. Ballière et Fils.

Bernier, N. J., Alderman, S. L., & Bristow, E. N. (2008). Heads or tails? Stressor-specific expression of corticotropin-releasing factor and urotensin I in the preoptic area and caudal neurosecretory system of rainbow trout. The Journal of endocrinology, 196(3), 637–48. doi:10.1677/JOE-07-0568

122

Blanton, M. L., & Specker, J. L. (2007). The hypothalamic-pituitary-thyroid (HPT) axis in fish and its role in fish development and reproduction. Critical Reviews in Toxicology, 37(1-2), 97–115. Retrieved from ISI:000244377100005

Boorse, G C, Crespi, E. J., Dautzenberg, F. M., & Denver, R. J. (2005). Urocortins of the South African clawed frog, Xenopus laevis: Conservation of structure and function in tetrapod evolution. Endocrinology, 146(11), 4851–4860. Retrieved from WOS:000232585200032

Boorse, G C, & Denver, R. J. (2002). Acceleration of Ambystoma tigrinum metamorphosis by corticotropin-releasing hormone. Journal of Experimental Zoology, 293(1), 94– 98. Retrieved from ISI:000176013100011

Boorse, Graham C, & Denver, R. J. (2006). Widespread tissue distribution and diverse functions of corticotropin-releasing factor and related peptides. General and Comparative Endocrinology, 146(1), 9–18. Retrieved from http://www.sciencedirect.com/science/article/B6WG0-4J2KTB4- 2/2/cbc59357f392adae0b2661703fe5ab6a

Breen, J. J., Hickok, N. J., & Gurr, J. A. (1997). The rat TSH beta gene contains distinct response elements for regulation by retinoids and thyroid hormone. Molecular and Cellular Endocrinology, 131(2), 137–146. Retrieved from ISI:A1997XR02400002

Bustin, S. A., Benes, V., Garson, J. A., Hellemans, J., Huggett, J., Kubista, M., Mueller, R., et al. (2009). The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clinical chemistry, 55(4), 611–22. doi:10.1373/clinchem.2008.112797

Campbell, R., Satch, N., & Degnan, B. (2004). Piecing together evolution of the vertebrate endocrine system. Trends in Genetics, 20(8), 359–366. Retrieved from http://www.sciencedirect.com.libproxy.uregina.ca:2048/science/article/pii/S01689 52504001556

Cannon, W. (1926). Physiological regulation of normal states: some tentative postulates concerning biological homeostatics in The Scientific Jubilee of Charles Richet. Science, 64(1644), 91–93.

Cannon, W. B. (1929). ORGANIZATION FOR PHYSIOLOGICAL HOMEOSTASIS. Physiol Rev, 9(3), 399–431. Retrieved from http://physrev.physiology.org/content/9/3/399.full.pdf+html

123

Carroll, S. M., Bridgham, J. T., & Thornton, J. W. (2008). Evolution of hormone signaling in elasmobranchs by exploitation of promiscuous receptors. Molecular biology and evolution, 25(12), 2643–52. doi:10.1093/molbev/msn204

Chan, R. K., Vale, W. W., & Sawchenko, P. E. (2000). Paradoxical activational effects of a corticotropin-releasing factor-binding protein “ligand inhibitor” in rat brain. Neuroscience, 101(1), 115–29. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/11068141

Chang, M., Zhang, J., & Miao, D. (2006). A lamprey from the Cretaceous Jehol biota of China. Nature, 441(7096), 972–4. doi:10.1038/nature04730

Chen, C.-C., & Fernald, R. D. (2008). Sequences, expression patterns and regulation of the corticotropin-releasing factor system in a teleost. General and comparative endocrinology, 157(2), 148–55. doi:10.1016/j.ygcen.2008.04.003

Ciechanowska, M., Łapot, M., Malewski, T., Mateusiak, K., Misztal, T., & Przekop, F. (2011). Effects of corticotropin-releasing hormone and its antagonist on the gene expression of gonadotrophin-releasing hormone (GnRH) and GnRH receptor in the hypothalamus and anterior pituitary gland of follicular phase ewes. Reproduction, fertility, and development, 23(6), 780–7. doi:10.1071/RD10341

Clements, S., Moore, F. L., & Schreck, C. B. (2003). Evidence that acute serotonergic activation potentiates the locomotor-stimulating effects of corticotropin-releasing hormone in juvenile chinook salmon (Oncorhynchus tshawytscha)( small star, filled ). Hormones and behavior, 43(1), 214–21. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/12614652

Close, D. A., Yun, S.-S., McCormick, S. D., Wildbill, A. J., & Li, W. (2010). 11-deoxycortisol is a corticosteroid hormone in the lamprey. Proceedings of the National Academy of Sciences of the United States of America, 107(31), 13942–7. doi:10.1073/pnas.0914026107

Coast, G., Webster, S., Schegg, K., Tobe, S., & Schooley, D. (2001). The Drosophila melanogaster homologue of an insect calcitonin-like diuretic peptide stimulates V- ATPase activity in fruit fly Malpighian tubules. J. Exp. Biol., 204(10), 1795–1804. Retrieved from http://jeb.biologists.org/cgi/content/abstract/204/10/1795

Cokkinos, D., Tzanavari, T., Varela, A., Pantos, C., & Karalis, K. (2012). CRH Regulates Cardiac Function in Normal Conditions and Infection. Journal of the American College of Cardiology, 59(13s1), 1057–1057.

124

Cole, W. C., & Youson, J. H. (1982). Morphology of the pineal complex of the anadromous sea lamprey, Petromyzon marinus L. American Journal of Anatomy, 165(2), 131–163. Retrieved from ISI:A1982PL73200004

Crespi, E. J., Vaudry, H., & Denver, R. J. (2004). Roles of corticotropin-releasing factor, neuropeptide Y and corticosterone in the regulation of food intake in Xenopus laevis. Journal of Neuroendocrinology, 16(3), 279–288. Retrieved from ISI:000220486100012

Dakine, N., Oliver, C., & Grino, M. (2000). Effects of experimental hypothyroidism on the development of the hypothalamo-pituitary-adrenal axis in the rat. Life sciences, 67(23), 2827–44. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/11105998

Dautzenberg, F. M., & Hauger, R. L. (2002). The CRF peptide family and their receptors: yet more partners discovered. Trends in Pharmacological Sciences, 23(2), 71–77. doi:10.1016/S0165-6147(02)01946-6

Dautzenberg, F. M., Kilpatrick, G. J., Hauger, R. L., & Moreau, J.-L. (2001). Molecular biology of the CRH receptors— in the mood. Peptides, 22(5), 753–760. doi:10.1016/S0196-9781(01)00388-6

De Groef, B, Goris, N., Arckens, L., Kuhn, E. R., & Darras, V. M. (2003). Corticotropin- releasing hormone (CRH)-induced thyrotropin release is directly mediated through CRH receptor type 2 on thyrotropes. Endocrinology, 144(12), 5537–5544. Retrieved from ISI:000186771800049

De Groef, Bert, Goris, N., Arckens, L., Kuhn, E. R., & Darras, V. M. (2003). Corticotropin- releasing hormone (CRH)-induced thyrotropin release is directly mediated through CRH receptor type 2 on thyrotropes. Endocrinology, 144(12), 5537–5544. doi:10.1210/en.2003-0526

De Groef, Bert, Grommen, S. V. H., Mertens, I., Schoofs, L., Kühn, E. R., Darras, V. M., Kuhn, E. R., et al. (2004). Cloning and tissue distribution of the chicken type 2 corticotropin-releasing hormone receptor. General and Comparative Endocrinology, 138(1), 89–95. doi:10.1016/j.ygcen.2004.05.006

De Groef, Bert, Van der Geyten, S., Darras, V. M., & Knhn, E. R. (2006). Role of corticotropin-releasing hormone as a thyrotropin-releasing factor in non- mammalian vertebrates. General and Comparative Endocrinology, 146(1), 62–68. Retrieved from http://www.sciencedirect.com/science/article/B6WG0-4HS3BRD- 2/2/c00eb2b39750829b68ae89ff3800cfd1

125

De Jesus, E. G., Hirano, T., & Inui, Y. (1991). Changes in cortisol and thyroid hormone concentrations during early development and metamorphosis in the Japanese flounder, Paralichthys olivaceus. General and comparative endocrinology, 82(3), 369–76. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/1879653

De Jesus, E. G., Inui, Y., & Hirano, T. (1990). Cortisol enhances the stimulating action of thyroid hormones on dorsal fin-ray resorption of flounder larvae in vitro. General and Comparative Endocrinology, 79(2), 167–173. Retrieved from ISI:A1990DQ90400001

De Loof, A., Lindemans, M., Liu, F., De Groef, B., & Schoofs, L. (2012). Endocrine archeology: do insects retain ancestrally inherited counterparts of the vertebrate releasing hormones GnRH, GHRH, TRH, and CRF? General and comparative endocrinology, 177(1), 18–27. doi:10.1016/j.ygcen.2012.02.002

Dehal, P., & Boore, J. L. (2005). Two rounds of whole genome duplication in the ancestral vertebrate. (P. Holland, Ed.)PLoS biology, 3(10), e314. doi:10.1371/journal.pbio.0030314

Denver, R J. (1993). Acceleration of Anuran Amphibian Metamorphosis by Corticotropin- Releasing Hormone-Like Peptides. General and Comparative Endocrinology, 91(1), 38–51. Retrieved from ISI:A1993LM65000005

Denver, R J. (1995). Environment-Neuroendocrine Interactions in the Control of Amphibian Metamorphosis. Netherlands Journal of Zoology, 45(1-2), 195–200. Retrieved from ISI:A1995RY90400047

Denver, R J. (1997). Environmental stress as a developmental cue: Corticotropin- releasing hormone is a proximate mediator of adaptive phenotypic plasticity in amphibian metamorphosis (vol 31, pg 169, 1997). Hormones and Behavior, 32(1), 68. Retrieved from ISI:A1997YE51700008

Denver, ROBERT J. (1999). Evolution of the Corticotropin-releasing Hormone Signaling System and Its Role in Stress-induced Phenotypic Plasticity. Annals of the New York Academy of Sciences, 897(1 NEUROPEPTIDES), 46–53. doi:10.1111/j.1749- 6632.1999.tb07877.x

Dimitris, G. (2008). The family of corticotropin-releasing hormone (CRH) peptides: important regulators of adipocyte function. Retrieved from http://www.endocrine- abstracts.org/ea/0016/ea0016s19.1.htm

126

Donaldson, E. M. (2005). The pituitary-interrenal axis as an indicator of stress in fish. In A. D. Pickering (Ed.), Stress and Fish (Vol. 93, pp. 11–47). New York: Academic Press. Retrieved from http://profiles.wizfolio.com/AlaaOsman/publications/2598/31581/

Drolet, G., & Rivest, S. (2001). Corticotropin-releasing hormone and its receptors: an evaluation at the transcription level in vivo. Peptides, 22(5), 761–767. Retrieved from ISI:000168556600008

Dufour, S., & Rousseau, K. (2007). Neuroendocrinology of fish metamorphosis and puberty: Evolutionary and ecophysiological perspectives. Journal of Marine Science and Technology-Taiwan, 15, 55–68. Retrieved from ISI:000255858600006

Durand, D. (2003). Vertebrate evolution: doubling and shuffling with a full deck. Trends in Genetics, 19(1), 2–5. Retrieved from ISI:000180294900001

Ebbesson, L. O. E., Nilsen, T. O., Helvik, J. V, Tronci, V., & Stefansson, S. O. (2011). Corticotropin-releasing factor neurogenesis during midlife development in salmon: genetic, environmental and thyroid hormone regulation. Journal of neuroendocrinology, 23(8), 733–41. doi:10.1111/j.1365-2826.2011.02164.x

Eckart, K., Jahn, O., Radulovic, J., Tezval, H., Van Werven, L., & Spiess, J. (2001). A single amino acid serves as an affinity switch between the receptor and the binding protein of corticotropin-releasing factor: implications for the design of agonists and antagonists. Proceedings of the National Academy of Sciences of the United States of America, 98(20), 11142–7. doi:10.1073/pnas.211424998

Ellis, L. C., & Youson, J. H. (1990). Pronephric regression during larval life in the sea lamprey, Petromyzon marinus L. Anatomy and Embryology, 182(1). doi:10.1007/BF00187526

Evans, D. H., Piermarini, P. M., & Choe, K. P. (2005). The multifunctional fish gill: Dominant site of gas exchange, osmoregulation, acid-base regulation, and excretion of nitrogenous waste. Physiological Reviews, 85(1), 97–177. Retrieved from ISI:000225945100004

Fahien, C. M., & Sower, S. A. (1990). Relationship Between Brain Gonadotropin- Releasing-Hormone and Final Reproductive Period of the Adult Male Sea Lamprey, Petromyzon-Marinus. General and Comparative Endocrinology, 80(3), 427–437. Retrieved from ISI:A1990EL97300012

Fekete, E. M., & Zorrilla, E. P. (2007). Physiology, pharmacology, and therapeutic relevance of urocortins in mammals: ancient CRF paralogs. Frontiers in neuroendocrinology, 28(1), 1–27. doi:10.1016/j.yfrne.2006.09.002

127

Fischer, W. H., Behan, D. P., Park, M., Potter, E., Lowry, P. J., & Vale, W. (1994). Assignment of disulfide bonds in corticotropin-releasing factor-binding protein. The Journal of biological chemistry, 269(6), 4313–6. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/8307998

Flik, G., Klaren, P. H. M., Van den Burg, E. H., Metz, J. R., & Huising, M. O. (2006). CRF and stress in fish. General and Comparative Endocrinology, 146(1), 36–44. Retrieved from http://www.sciencedirect.com/science/article/B6WG0-4HYV03X- 1/2/011daf2002ba1eb23fff1bb678553425

Fort, D. J., Degitz, S., Tietge, J., & Touart, L. W. (2007). The hypothalamic-pituitary- thyroid (HPT) axis in frogs and its role in frog development and reproduction. Critical Reviews in Toxicology, 37(1-2), 117–161. Retrieved from ISI:000244377100006

Fuzzen, M. L. M., Alderman, S. L., Bristow, E. N., & Bernier, N. J. (2011). Ontogeny of the corticotropin-releasing factor system in rainbow trout and differential effects of hypoxia on the endocrine and cellular stress responses during development. General and comparative endocrinology, 170(3), 604–12. doi:10.1016/j.ygcen.2010.11.022

Galton, V. A. (1992). The role of thyroid hormone in amphibian metamorphosis. Trends in Endocrinology and Metabolism, 3(3), 96–100. doi:10.1016/1043-2760(92)90020- 2

Gammie, S. C., Seasholtz, A. F., & Stevenson, S. A. (2008). Deletion of corticotropin- releasing factor binding protein selectively impairs maternal, but not intermale aggression. Neuroscience, 157(3), 502–12. doi:10.1016/j.neuroscience.2008.09.026

Geris, K. L., Laheye, A., Berghman, L. R., Kuhn, E. R., & Darras, V. M. (1999). Adrenal inhibition of corticotropin-releasing hormone-induced thyrotropin release: A comparative study in pre- and posthatch chicks. Journal of Experimental Zoology, 284(7), 776–782. Retrieved from ISI:000083494600007

Gess, R. W., Coates, M. I., & Rubidge, B. S. (2006). A lamprey from the Devonian period of South Africa. Nature, 443(7114), 981–4. doi:10.1038/nature05150

Geven, E J W, Verkaar, F., Flik, G., & Klaren, P. H. M. (2006). Experimental hyperthyroidism and central mediators of stress axis and thyroid axis activity in common carp (Cyprinus carpio L.). Journal of Molecular Endocrinology, 37(3), 443– 452. Retrieved from ISI:000243355600007

128

Geven, Edwin J W, Verkaar, F., Flik, G., & Klaren, P. H. M. (2006). Experimental hyperthyroidism and central mediators of stress axis and thyroid axis activity in common carp (Cyprinus carpio L.). Journal of molecular endocrinology, 37(3), 443– 52. doi:10.1677/jme.1.02144

Giraldi, F. P., & Cavagnini, F. (1998). Corticotropin-releasing hormone is produced by rat corticotropes and modulates ACTH secretion in a paracrine/autocrine fashion. Journal of Clinical Investigation, 101(11), 2478–2484. Retrieved from ISI:000074165900020

Glenny, H. P., & Brindley, D. N. (1978). The effects of cortisol, corticotropin and thyroxine on the synthesis of glycerolipids and on the phosphatidate phosphohydrolase activity in rat liver. The Biochemical journal, 176(3), 777–84. Retrieved from http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1186300&tool=pmcen trez&rendertype=abstract

Grace, C. R. R., Perrin, M. H., Cantle, J. P., Vale, W. W., Rivier, J. E., & Riek, R. (2007). Common and divergent structural features of a series of corticotropin releasing factor-related peptides. Journal of the American Chemical Society, 129(51), 16102– 14. doi:10.1021/ja0760933

Grammatopoulos, D K, & Chrousos, G. P. (2002). Functional characteristics of CRH receptors and potential clinical applications of CRH-receptor antagonists. Trends in Endocrinology and Metabolism, 13(10), 436–444. Retrieved from ISI:000179238200006

Grammatopoulos, Dimitris K. (2012). Insights into mechanisms of corticotropin-releasing hormone receptor signal transduction. British journal of pharmacology, 166(1), 85– 97. doi:10.1111/j.1476-5381.2011.01631.x

Guillerman, R., & Rosenberg, B. (1955). HUMORAL HYPOTHALAMIC CONTROL OF ANTERIOR PITUITARY: A STUDY WITH COMBINED TISSUECULTURES. Endocrinology, 57(5), 599–607. doi:10.1210/endo-57-5-599

Gutkowska, J. (2000). Corticotropin-releasing hormone causes antidiuresis and antinatriuresis by stimulating vasopressin and inhibiting atrial natriuretic peptide release in male rats. Proceedings of the National Academy of Sciences, 97(1), 483– 488. doi:10.1073/pnas.97.1.483

Hall, T. A. (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids. Symp. Ser., 41, 95–98.

129

Hardisty, M. W., & Potter, I. C. (1971). The general biology of adult lampreys. In I. C. Potter (Ed.), The Biology of Lampreys. Volume 1 (Vol. 1, pp. 127–206). London: Academic Press.

Harmar, A. J. (2001). Family-B G-protein-coupled receptors. Genome biology, 2(12), REVIEWS3013. Retrieved from http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=138994&tool=pmcent rez&rendertype=abstract

Harris, G. W. (1951). Neural control of the pituitary gland. I. The neurohypophysis. British medical journal, 2(4731), 559–64. Retrieved from http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2070089&tool=pmcen trez&rendertype=abstract

Hayes, W. P. (1994). The frog gonadotropin-releasing hormone-I (GnRH-I) gene has a mammalian- like expression pattern and conserved domains in GnRH-associated peptide, but brain onset is delayed until metamorphosis. Endocrinology, 134(4), 1835–1845. doi:10.1210/en.134.4.1835

Heinrich, N. (1998). Corticotropin-Releasing Factor (CRF) Agonists Stimulate Testosterone Production in Mouse Leydig Cells through CRF Receptor-1. Endocrinology, 139(2), 651–658. doi:10.1210/en.139.2.651

Hillhouse, E. W., & Grammatopoulos, D. K. (2006). The molecular mechanisms underlying the regulation of the biological activity of corticotropin-releasing hormone receptors: implications for physiology and pathophysiology. Endocrine reviews, 27(3), 260–86. doi:10.1210/er.2005-0034

Holland, L. Z., Albalat, R., Azumi, K., Benito-Gutiérrez, E., Blow, M. J., Bronner-Fraser, M., Brunet, F., et al. (2008). The amphioxus genome illuminates vertebrate origins and cephalochordate biology. Genome research, 18(7), 1100–11. doi:10.1101/gr.073676.107

Huising, M. (2004). Structural characterisation of a cyprinid (Cyprinus carpio L.) CRH, CRH-BP and CRH-R1, and the role of these proteins in the acute stress response. Journal of Molecular Endocrinology, 32(3), 627–648. doi:10.1677/jme.0.0320627

Huising, M., Metz, J. R., Van Schooten, C., Taverne-Thiele, A. J., Hermsen, T., Verburg- van Kemanade, B. M. L., & Flik, G. (2004). Structural characterisation of a cyprinid (Cyprinus carpio L.) CRH, CRH-BP and CRH-R1, and the role of these proteins in the acute stress response. Journal of Molecular Endocrinology, 32(3), 627–648. doi:10.1677/jme.0.0320627

130

Huising, M. O., & Flik, G. (2005). The remarkable conservation of corticotropin-releasing hormone (CRH)-binding protein in the honeybee (Apis mellifera) dates the CRH system to a common ancestor of insects and vertebrates. Endocrinology, 146(5), 2165–70. doi:10.1210/en.2004-1514

Huising, M. O., Metz, J. R., De Mazon, A. F., Verburg-van Kemenade, B. M. L., & Flik, G. (2005). Regulation of the stress response in early vertebrates. Annals of the New York Academy of Sciences, 1040, 345–7. doi:10.1196/annals.1327.057

Inui, Y., & Miwa, S. (1985). Thyroid hormone induces metamorphosis of flounder larvae. General and Comparative Endocrinology, 60(3), 450–454. doi:10.1016/0016- 6480(85)90080-2

Jahn, O, Eckart, K., Brauns, O., Tezval, H., & Spiess, J. (2002). The binding protein of corticotropin-releasing factor: Ligand-binding site and subunit structure. Proceedings of the National Academy of Sciences of the United States of America, 99(19), 12055–12060. Retrieved from ISI:000178187000014

Jahn, Olaf, Tezval, H., Van Werven, L., Eckart, K., & Spiess, J. (2004). Three-amino acid motifs of urocortin II and III determine their CRF receptor subtype selectivity. Neuropharmacology, 47(2), 233–42. doi:10.1016/j.neuropharm.2004.03.018

Kageyama, K., Hasegawa, G., Akimoto, K., Yamagata, S., Tamasawa, N., & Suda, T. (2012). Differential regulation of gonadotropin-releasing hormone by corticotropin- releasing factor family peptides in hypothalamic N39 cells. Peptides, 33(1), 149–55. doi:10.1016/j.peptides.2011.11.020

Kalantaridou, S. N., Makrigiannakis, A., Zoumakis, E., & Chrousos, G. P. (2004). Reproductive functions of corticotropin-releasing hormone. Research and potential clinical utility of antalarmins (CRH receptor type 1 antagonists). American journal of reproductive immunology (New York, N.Y. : 1989), 51(4), 269–74. doi:10.1111/j.1600-0897.2004.00155.x

Kao, Y. H., Youson, J. H., Holmes, J. A., & Sheridan, M. A. (1997). Changes in lipolysis and lipogenesis in selected tissues of the landlocked lamprey, Petromyzon marinus, during metamorphosis. Journal of Experimental Zoology, 277(4), 301–312. Retrieved from ISI:A1997WQ87000004

Kao, Y.-H. H., Youson, J. H., Holmes, J. A., & Sheridan, M. A. (1997). Changes in lipolysis and lipogenesis in selected tissues of the landlocked lamprey, Petromyzon marinus, during metamorphosis. Journal of Experimental Zoology, 277(4), 301–312. doi:10.1002/(SICI)1097-010X(19970301)277:4<301::AID-JEZ4>3.0.CO;2-T

131

Kasahara, M., Naruse, K., Sasaki, S., Nakatani, Y., Qu, W., Ahsan, B., Yamada, T., et al. (2007). The medaka draft genome and insights into vertebrate genome evolution. Nature, 447(7145), 714–9. doi:10.1038/nature05846

Kawaguchi, N., Okubo, K., & Aida, K. (2004). Molecular cloning of CRH family of peptides and their receptors in medaka, Oryzias latipes. unpublished.

Kemp, C. F., Woods, R. J., & Lowry, P. J. (1998). The corticotrophin-releasing factor- binding protein: an act of several parts. Peptides, 19(6), 1119–28. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/9700765

Khansari, D. N., Murgo, A. J., & Faith, R. E. (1990). Effects of stress on the immune system. Immunology Today, 11(null), 170–175. doi:10.1016/0167-5699(90)90069-L

Kiilerich, P., Kristiansen, K., & Madsen, S. S. (2007). Cortisol regulation of ion transporter mRNA in Atlantic salmon gill and the effect of salinity on the signaling pathway. The Journal of endocrinology, 194(2), 417–27. doi:10.1677/JOE-07-0185

Krogh, A., Larsson, B., Von Heijne, G., & Sonnhammer, E. L. (2001). Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. Journal of molecular biology, 305(3), 567–80. doi:10.1006/jmbi.2000.4315

Kuhn, E. R., De Groef, B., Van der Geyten, S., & Darras, V. M. (2005). Corticotropin- releasing hormone-mediated metamorphosis in the neotenic axolotl Ambystoma mexicanum: Synergistic involvement of thyroxine and corticoids on brain type II deiodinase. General and Comparative Endocrinology, 143(1), 75–81. Retrieved from ISI:000230421900009

Kumar, S., Nei, M., Dudley, J., & Tamura, K. (2008). MEGA: a biologist-centric software for evolutionary analysis of DNA and protein sequences. Briefings in bioinformatics, 9(4), 299–306. doi:10.1093/bib/bbn017

Kuniyoshi, H., Fukui, Y., & Sakai, Y. (2006). Cloning of full-length cDNA of teleost corticotropin-releasing hormone precursor by improved inverse PCR. Bioscience, biotechnology, and biochemistry, 70(8), 1983–6. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/16926514

Larsen, D. A., Swanson, P., Dickey, J. T., Rivier, J., & Dickhoff, W. W. (1998). In vitro thyrotropin-releasing activity of corticotropin-releasing hormone-family peptides in coho salmon, Oncorhynchus kisutch. General and Comparative Endocrinology, 109(2), 276–285. doi:10.1006/gcen.1997.7031

132

Lederis, K., Fryer, J., Okawara, Y., C, S., & Richter, D. (1994). 2 Corticotropin-Releasing Factors Acting on the Fish Pituitary: Experimental and Molecular Analysis. Fish Physiology, 13, 67–100. doi:10.1016/S1546-5098(08)60063-1

Lederis, K., Letter, A., McMaster, D., Moore, G., & Schlesinger, D. (1982). Complete amino acid sequence of urotensin I, a hypotensive and corticotropin-releasing neuropeptide from Catostomus. Science (New York, N.Y.), 218(4568), 162–5. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/6981844

Lewis, K., Li, C., Perrin, M. H., Blount, A., Kunitake, K., Donaldson, C., Vaughan, J., et al. (2001). Identification of urocortin III, an additional member of the corticotropin- releasing factor (CRF) family with high affinity for the CRF2 receptor. Proceedings of the National Academy of Sciences of the United States of America, 98(13), 7570– 7575. Retrieved from ISI:000169456600103

Li, X. F., Bowe, J. E., Lightman, S. L., & O’Byrne, K. T. (2005). Role of corticotropin- releasing factor receptor-2 in stress-induced suppression of pulsatile luteinizing hormone secretion in the rat. Endocrinology, 146(1), 318–22. doi:10.1210/en.2004- 0950

Liu, L., Yu, X., Meng, F., Guo, X., & Xu, B. (2011). Identification and characterization of a novel corticotropin-releasing hormone-binding protein (CRH-BP) gene from Chinese honeybee (Apis cerana cerana). Archives of insect biochemistry and physiology, 78(3), 161–75. doi:10.1002/arch.20451

Lovejoy, D A. (2009). Structural evolution of urotensin-I: Reflections of life before corticotropin releasing factor. General and Comparative Endocrinology, 164(1), 15– 19. Retrieved from ISI:000268698000005

Lovejoy, D A, & Balment, R. J. (1999). Evolution and physiology of the corticotropin- releasing factor (CRF) family of neuropeptides in vertebrates. General and comparative endocrinology, 115(1), 1–22. doi:10.1006/gcen.1999.7298

Lovejoy, David A, & Barsyte-Lovejoy, D. (2010). Characterization of a corticotropin- releasing factor (CRF)/diuretic hormone-like peptide from tunicates: insight into the origins of the vertebrate CRF family. General and comparative endocrinology, 165(2), 330–6. doi:10.1016/j.ygcen.2009.07.013

Lovejoy, David A, & Jahan, S. (2006). Phylogeny of the corticotropin-releasing factor family of peptides in the metazoa. General and Comparative Endocrinology, 146(1), 1–8. Retrieved from http://www.sciencedirect.com/science/article/B6WG0- 4J7H42F-1/2/4696bdad309fdcb4bb16a66439e4192a

133

Lovenberg, T. W., Chalmers, D. T., Liu, C., & De Souza, E. B. (1995). CRF2 alpha and CRF2 beta receptor mRNAs are differentially distributed between the rat central nervous system and peripheral tissues. Endocrinology, 136(9), 4139–42. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/7544278

Lowe, D. R., Beamish, F. W. H., & Potter, I. C. (1973). Changes in proximate body composition of landlocked sea lamprey Petromyzon marinus (L) during larval life and metamorphosis. Journal of Fish Biology, 5(6), 673–682. Retrieved from ISI:A1973R302300004

Lupien, S. J., McEwen, B. S., Gunnar, M. R., & Heim, C. (2009). Effects of stress throughout the lifespan on the brain, behaviour and cognition. Nature reviews. Neuroscience, 10(6), 434–45. doi:10.1038/nrn2639

Manire, C. A., Rasmussen, L. E. L., Maruska, K. P., & Tricas, T. C. (2007). Sex, seasonal, and stress-related variations in elasmobranch corticosterone concentrations. Comparative biochemistry and physiology. Part A, Molecular & integrative physiology, 148(4), 926–35. doi:10.1016/j.cbpa.2007.09.017

Manzon, R. G., Holmes, J. A., & Youson, J. H. (2001). Variable effects of goitrogens in inducing precocious metamorphosis in sea lampreys (Petromyzon marinus). Journal of Experimental Zoology, 289(5), 290–303. Retrieved from ISI:000167265200003

Marchler-Bauer, A., Lu, S., Anderson, J. B., Chitsaz, F., Derbyshire, M. K., DeWeese-Scott, C., Fong, J. H., et al. (2011). CDD: a Conserved Domain Database for the functional annotation of proteins. Nucleic acids research, 39(Database issue), D225–9. doi:10.1093/nar/gkq1189

Mastorakos, G., Karoutsou, E. I., & Mizamtsidi, M. (2006). Corticotropin Releasing Hormone and the immune/ inflammatory response. European Journal of Endocrinology, 155, S77–S84.

Mathers, J. S., & Beamish, F. W. H. (1974). Changes in Serum Osmotic and Ionic Concentration in Landlocked Petromyzon-Marinus. Comparative Biochemistry and Physiology, 49(NA4), 677–688. Retrieved from ISI:A1974U519600008

Mazon, A. F., Verburg-van Kemenade, B. M. L., Flik, G., & Huising, M. O. (2006). Corticotropin-releasing hormone-receptor 1 (CRH-R1) and CRH-binding protein (CRH-BP) are expressed in the gills and skin of common carp Cyprinus carpio L. and respond to acute stress and infection. The Journal of experimental biology, 209(Pt 3), 510–7. doi:10.1242/jeb.01973

134

McCormick, S. D., Hansen, L. P., Quinn, T. P., & Saunders, R. L. (1998). Movement, migration, and smolting of Atlantic salmon (Salmo salar). Canadian Journal of Fisheries and Aquatic Sciences, 55, 77–92. Retrieved from ISI:000079802300006

McElwain, J. C., & Punyasena, S. W. (2007). Mass extinction events and the plant fossil record. Trends in ecology & evolution, 22(10), 548–57. doi:10.1016/j.tree.2007.09.003

McEwen, B. S. (1998). Protective and damaging effects of stress mediators. The New England journal of medicine, 338(3), 171–9. doi:10.1056/NEJM199801153380307

Mcnabb, F. M. A. (2007). The hypothalamic-pituitary-thyroid (HPT) axis in birds and its role in bird development and reproduction. Critical Reviews in Toxicology, 37(1-2), 163–193. Retrieved from ISI:000244377100007

Meyer, A., & Van de Peer, Y. (2005). From 2R to 3R: evidence for a fish-specific genome duplication (FSGD). BioEssays : news and reviews in molecular, cellular and developmental biology, 27(9), 937–45. doi:10.1002/bies.20293

Mola, L., Gambarelli, A., & Pederzoli, A. (2011). Immunolocalization of corticotropin- releasing factor (CRF) and corticotropin-releasing factor receptor 2 (CRF-R2) in the developing gut of the sea bass (Dicentrarchus labrax L.). Acta histochemica, 113(3), 290–3. doi:10.1016/j.acthis.2009.11.002

Moore, G., Burford, G., & Lederis, K. (1975). Properties of urophysial proteins (urophysins) from the white sucker, Catostomus commersoni. Molecular and Cellular Endocrinology, 3(4), 297–307. doi:10.1016/0303-7207(75)90011-8

Ng, P. C., & Henikoff, S. (2001). Predicting deleterious amino acid substitutions. Genome research, 11(5), 863–74. doi:10.1101/gr.176601

Nielsen, S. M., Nielsen, L. Z., Hjorth, S. A., Perrin, M. H., & Vale, W. W. (2000). Constitutive activation of tethered-peptide/corticotropin-releasing factor receptor chimeras. Proceedings of the National Academy of Sciences of the United States of America, 97(18), 10277–81. Retrieved from http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=27874&tool=pmcentr ez&rendertype=abstract

Nock, T. G., Chand, D., & Lovejoy, D. A. (2011, April 1). ScienceDirect.com - General and Comparative Endocrinology - Identification of members of the gonadotropin- releasing hormone (GnRH), corticotropin-releasing factor (CRF) families in the genome of the holocephalan, Callorhinchus milii (elephant shark). General and comparative endocrinology. doi:10.1016/j.ygcen.2011.02.001

135

Northcutt, R. G. (2002). Understanding vertebrate brain evolution. Integrative and comparative biology, 42(4), 743–56. doi:10.1093/icb/42.4.743

Nozaki, M., Gorbman, A., & Sower, S. A. (1994). Diffusion Between the Neurohypophysis and the Adenohypophysis of Lampreys, Petromyzon-Marinus. General and Comparative Endocrinology, 96(3), 385–391. Retrieved from ISI:A1994PW84100007

Ohno, S. (1999). Gene duplication and the uniqueness of vertebrate genomes circa 1970-1999. Seminars in Cell & Developmental Biology, 10(5), 517–522. Retrieved from ISI:000083733400010

Ooi, E. C., & Youson, J. H. (1977). Morphogenesis and growth of the definitive opisthonephros during metamorphosis of anadromous sea lamprey, Petromyzon marinus L. Journal of Embryology and Experimental Morphology, 42(DEC), 219–235. Retrieved from ISI:A1977EF42200017

Palchaudhuri, M. R., Wille, S., Mevenkamp, G., Spiess, J., Fuchs, E., & Dautzenberg, F. M. (1998). Corticotropin-releasing factor receptor type 1 from Tupaia belangeri-- cloning, functional expression and tissue distribution. European journal of biochemistry / FEBS, 258(1), 78–84. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/9851694

Pancer, Z., Amemiya, C. T., Ehrhardt, G. R. A., Ceitlin, J., Gartland, G. L., & Cooper, M. D. (2004). Somatic diversification of variable lymphocyte receptors in the agnathan sea lamprey. Nature, 430(6996), 174–180. Retrieved from ISI:000222470600035

Paschos, K. A., Charsou, C., Constantinidis, T. C., Anagnostoulis, S., Lambropoulou, M., Papachristou, F., Simopoulos, K., et al. (2010). Corticotropin-releasing hormone receptors mediate opposing effects in cholestasis-induced liver cell apoptosis. Endocrinology, 151(4), 1704–12. doi:10.1210/en.2009-1208

Peek, W. D., & Youson, J. H. (1979). Transformation of the interlamellar epithelium of the gills of the anadromous sea lamprey, Petromyzon marinus L, during metamorphosis. Canadian Journal of Zoology-Revue Canadienne de Zoologie, 57(6), 1318–1332. Retrieved from ISI:A1979HD21900020

Pepels, P. P. L. M., & Balm, P. H. M. (2004). Ontogeny of corticotropin-releasing factor and of hypothalamic-pituitary-interrenal axis responsiveness to stress in tilapia (Oreochromis mossambicus; Teleostei). General and Comparative Endocrinology, 139(3), 251–265. Retrieved from ISI:000225615500008

136

Perrin, M. H. (1998). The First Extracellular Domain of Corticotropin Releasing Factor-R1 Contains Major Binding Determinants for Urocortin and Astressin. Endocrinology, 139(2), 566–570. doi:10.1210/en.139.2.566

Petersen, T. N., Brunak, S., Von Heijne, G., & Nielsen, H. (2011). SignalP 4.0: discriminating signal peptides from transmembrane regions. Nature methods, 8(10), 785–6. doi:10.1038/nmeth.1701

Pfaffl, M. W. (2001). A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research, 29(9). Retrieved from ISI:000168605800024

Pfeiler, E. (1984). Effect of Salinity on Water and Salt Balance in Metamorphosing Bonefish (Albula) Leptocephali. Journal of Experimental Marine Biology and Ecology, 82(2-3), 183–190. Retrieved from ISI:A1984TW08200007

Porterfield, S. P., & Hendrich, C. E. (1993). The role of thyroid hormones in prenatal and neonatal neurological development--current perspectives. Endocrine reviews, 14(1), 94–106. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/8491157

Potter, I C, Hilliard, R. W., & Bird, D. J. (1982). Stages in metamorphosis. In M W Hardisty & I. C. Potter (Eds.), Biology of Lampreys. Volume 4b (pp. 137 –164). London: Academic Press.

Potter, I C, Percy, R., & Youson, J. H. (1978). A proposal for the adaptive significance of the development of the lamprey fat column. Acta Zoologica, 59(1), 63–67. Retrieved from ISI:A1978EQ60500007

Potter, I C, Wright, G. M., & Youson, J. H. (1978). Metamorphosis in the anadromous sea lamprey, Petromyzon-marinus L. Canadian Journal of Zoology-Revue Canadienne de Zoologie, 56(4), 561–570. Retrieved from ISI:A1978EX20600006

Punn, A., Chen, J., Delidaki, M., Tang, J., Liapakis, G., Lehnert, H., Levine, M. A., et al. (2012). Mapping structural determinants within third intracellular loop that direct signaling specificity of type 1 corticotropin-releasing hormone receptor. The Journal of biological chemistry, 287(12), 8974–85. doi:10.1074/jbc.M111.272161

Raag, R., Appelt, K., Xuong, N. H., & Banaszak, L. (1988). Structure of the Lamprey Yolk Lipid Protein Complex Lipovitellin Phosvitin at 2.8-A Resolution. Journal of Molecular Biology, 200(3), 553–569. Retrieved from ISI:A1988M885900010

Raine, J. C., Takemura, A., & Leatherland, J. F. (2001). Assessment of thyroid function in adult medaka (Oryzias latipes) and juvenile rainbow trout (Oncorhynchus mykiss)

137

using immunostaining methods. Journal of Experimental Zoology, 290(4), 366–378. Retrieved from ISI:000170875400008

Randall, D. J. (1992). Catecholamines. In W. S. Hoar & D. J. Randall (Eds.), Fish Physiology (12B ed., Vol. 12, pp. 255–300). New York: Academic Press. doi:10.1016/S1546- 5098(08)60011-4

Reis-Santos, P, McCormick, S. D., & Wilson, J. M. (2008). Ionoregulatory changes during metamorphosis and salinity exposure of juvenile sea lamprey (Petromyzon marinus L.). Journal of Experimental Biology, 211(6), 978–988. Retrieved from WOS:000254462700020

Reis-Santos, Patrick, McCormick, S. D., & Wilson, J. M. (2008). Ionoregulatory changes during metamorphosis and salinity exposure of juvenile sea lamprey (Petromyzon marinus L.). Journal of Experimental Biology, 211(6), 978–988. doi:10.1242/jeb.014423

Reyes, T. M., Lewis, K., Perrin, M. H., Kunitake, K. S., Vaughan, J., Arias, C. A., Hogenesch, J. B., et al. (2001). Urocortin II: A member of the corticotropin-releasing factor (CRF) neuropeptide family that is selectively bound by type 2 CRF receptors. Proceedings of the National Academy of Sciences of the United States of America, 98(5), 2843– 2848. doi:10.1073/pnas.051626398

Saffran, M., & Schally, A. V. (1955). THE RELEASE OF CORTICOTROPHIN BY ANTERIOR PITUITARY TISSUE IN VITRO. Canadian Journal of Biochemistry and Physiology, 33(3), 408–415. Retrieved from http://www.nrcresearchpress.com/doi/abs/10.1139/o55- 054?journalCode=cjbp#.UHonKW-0KSo

Sasaki, A., Sato, S., Murakami, O., Go, M., Inoue, M., Shimizu, Y., Hanew, K., et al. (1987). Immunoreactive corticotropin-releasing hormone present in human plasma may be derived from both hypothalamic and extrahypothalamic sources. The Journal of clinical endocrinology and metabolism, 65(1), 176–82. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/3294879

Schulkin, J. (2011). Evolutionary conservation of glucocorticoids and corticotropin releasing hormone: behavioral and physiological adaptations. Brain research, 1392, 27–46. doi:10.1016/j.brainres.2011.03.055

Seasholtz, A. F., Burrows, H. L., Karolyi, I. J., & Camper, S. A. (2001). Mouse models of altered CRH-binding protein expression. Peptides, 22(5), 743–751. Retrieved from ISI:000168556600006

138

Seasholtz, A. F., Valverde, R. A., & Denver, R. J. (2002). Corticotropin-releasing hormone- binding protein: biochemistry and function from fishes to mammals. Journal of Endocrinology, 175(1), 89–97. Retrieved from ISI:000178814800009

Selye, H. (1936). A syndrome produced by diverse nocuous agents. Nature, 138(32).

Selye, H. (1946). THE GENERAL ADAPTATION SYNDROME AND THE DISEASES OF ADAPTATION. Journal of Clinical Endocrinology & Metabolism, 6(2), 117–230. doi:10.1210/jcem-6-2-117

Selye, H. (1950). Stress and the General Adaptation Syndrome. BMJ, 1(4667), 1383–1392. doi:10.1136/bmj.1.4667.1383

Sheridan, M. A. (1986). Effects of thyroxin, cortisol, growth hormone, and prolactin on lipid metabolism of coho salmon, Oncorhynchus kisutch, during smoltification. General and comparative endocrinology, 64(2), 220–38. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/3557090

Sheridan, M. A., & Kao, Y. H. (1998). Regulation of metamorphosis-associated changes in the lipid metabolism of selected vertebrates. American Zoologist, 38(2), 350–368. Retrieved from ISI:000073440100009

Shifman, M. I., Yumul, R. E., Laramore, C., & Selzer, M. E. (2009). Expression of the repulsive guidance molecule RGM and its receptor neogenin after spinal cord injury in sea lamprey. Experimental neurology, 217(2), 242–51. doi:10.1016/j.expneurol.2009.02.011

Shrimpton, J., & Mccormick, S. (1999). Responsiveness of gill Na+/K+-ATPase to cortisol is related to gill corticosteroid receptor concentration in juvenile rainbow trout. The Journal of experimental biology, 202 (Pt 8), 987–95. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/10085271

Sidon, E. W., & Youson, J. H. (1983). Morphological changes in the liver of the sea lamprey, Petromyzon marinus L., during metamorphosis: I. Atresia of the bile ducts. Journal of morphology, 177(1), 109–24. doi:10.1002/jmor.1051770109

Sievers, F., Wilm, A., Dineen, D., Gibson, T. J., Karplus, K., Li, W., Lopez, R., et al. (2011). Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Molecular systems biology, 7, 539. doi:10.1038/msb.2011.75

SLOMINSKI, A., Wortsman, J., Pisarchik, A., Zbytek, B., Linton, E. A., Mazurkiewicz, J. E., & Wei, E. T. (2001). Cutaneous expression of corticotropin-releasing hormone

139

(CRH), urocortin, and CRH receptors. Faseb Journal, 15(10), 1678–1693. doi:10.1096/fj.00-0850rev

Southey, B. R., Amare, A., Zimmerman, T. A., Rodriguez-Zas, S. L., & Sweedler, J. V. (2006). NeuroPred: a tool to predict cleavage sites in neuropeptide precursors and provide the masses of the resulting peptides. Nucleic acids research, 34(Web Server issue), W267–72. doi:10.1093/nar/gkl161

Sower, S. A. (1998). Brain and pituitary hormones of lampreys, recent findings and their evolutionary significance. American Zoologist, 38(1), 15–38. Retrieved from ISI:000073037900002

Sower, S. A., Freamat, M., & Kavanaugh, S. I. (2009). The origins of the vertebrate hypothalamic-pituitary-gonadal (HPG) and hypothalamic-pituitary-thyroid (HPT) endocrine systems: New insights from lampreys. General and Comparative Endocrinology, 161(1), 20–29. Retrieved from ISI:000264012300004

Sower, S. A., Moriyama, S., Kasahara, M., Takahashi, A., Nozaki, M., Uchida, K., Dahstrom, J. M., et al. (2006). Identification of sea lamprey GTH beta-like cDNA and its evolutionary implications. General and Comparative Endocrinology, 148(1), 22– 32. Retrieved from ISI:000238627700004

Speert, D. B. (2002). Sexually Dimorphic Expression of Corticotropin-Releasing Hormone- Binding Protein in the Mouse Pituitary. Endocrinology, 143(12), 4730–4741. doi:10.1210/en.2002-220556

Stanke, M., Diekhans, M., Baertsch, R., & Haussler, D. (2008). Using native and syntenically mapped cDNA alignments to improve de novo gene finding. Bioinformatics (Oxford, England), 24(5), 637–44. doi:10.1093/bioinformatics/btn013

Stock, D. W., & Whitt, G. S. (1992). Evidence from 18S ribosomal RNA sequences that lampreys and hagfishes form a natural group. Science (New York, N.Y.), 257(5071), 787–9. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/1496398

Suzuki, S. (1987). Induction of metamorphosis and thyroid function in the larval lamprey (Vol. 1, pp. 220–221).

Szisch, V., Papandroulakis, N., Fanouraki, E., & Pavlidis, M. (2005). Ontogeny of the thyroid hormones and cortisol in the gilthead sea bream, Sparus aurata. General and Comparative Endocrinology, 142(1-2), 186–192. Retrieved from ISI:000228908200021

140

Traslaviña, G. A. A., & Franci, C. R. (2012). Divergent Roles of the CRH Receptors in the Control of Gonadotropin Secretion Induced by Acute Restraint Stress at Proestrus. Endocrinology, 153(10), 4838–48. doi:10.1210/en.2012-1333

Ungless, M. A., Singh, V., Crowder, T. L., Yaka, R., Ron, D., & Bonci, A. (2003). Corticotropin-releasing factor requires CRF binding protein to potentiate NMDA receptors via CRF receptor 2 in dopamine neurons. Neuron, 39(3), 401–7. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/12895416

Untergasser, A., Nijveen, H., Rao, X., Bisseling, T., Geurts, R., & Leunissen, J. A. M. (2007). Primer3Plus, an enhanced web interface to Primer3. Nucleic acids research, 35(Web Server issue), W71–4. doi:10.1093/nar/gkm306

Vale, W., Spiess, J., Rivier, C., & Rivier, J. (1981). Characterization of a 41-residue ovine hypothalamic peptide that stimulates secretion of corticotropin and beta- endorphin. Science, 213(4514), 1394–1397. doi:10.1126/science.6267699

Valverde, R. A., Seasholtz, A. F., Cortright, D. N., & Denver, R. J. (2001). Biochemical characterization and expression analysis of the Xenopus laevis corticotropin- releasing hormone binding protein. Molecular and Cellular Endocrinology, 173(1-2), 29–40. Retrieved from ISI:000167478600003

Van Koppen, C. J., & Jakobs, K. H. (2004). Arrestin-Independent Internalization of G Protein-Coupled Receptors. Mol. Pharmacol., 66(3), 365–367. Retrieved from http://molpharm.aspetjournals.org/content/66/3/365.full

Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., & Speleman, F. (2002). Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome biology, 3(7), RESEARCH0034. Retrieved from http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=126239&tool=pmcent rez&rendertype=abstract

Venihaki, M., Sakihara, S., Subramanian, S., Dikkes, P., Weninger, S. C., Liapakis, G., Graf, T., et al. (2004). Urocortin III, a brain neuropeptide of the corticotropin-releasing hormone family: modulation by stress and attenuation of some anxiety-like behaviours. Journal of neuroendocrinology, 16(5), 411–22. doi:10.1111/j.1365- 2826.2004.01170.x

Vita, N., Laurent, P., Lefort, S., Chalon, P., Lelias, J. M., Kaghad, M., Le Fur, G., et al. (1993). Primary structure and functional expression of mouse pituitary and human brain corticotrophin releasing factor receptors. FEBS letters, 335(1), 1–5. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/8243652

141

Walker, J. K. L. (1999). Properties of Secretin Receptor Internalization Differ from Those of the beta 2-Adrenergic Receptor. Journal of Biological Chemistry, 274(44), 31515– 31523. doi:10.1074/jbc.274.44.31515

Wendelaar Bonga, S. E. (1997). The stress response in fish. Physiological reviews, 77(3), 591–625. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/9234959

Westphal, N. J., & Seasholtz, A. F. (2005). Gonadotropin-releasing hormone (GnRH) positively regulates corticotropin-releasing hormone-binding protein expression via multiple intracellular signaling pathways and a multipartite GnRH response element in alphaT3-1 cells. Molecular endocrinology (Baltimore, Md.), 19(11), 2780–97. doi:10.1210/me.2004-0519

Westphal, N. J., & Seasholtz, A. F. (2006). CRH-BP: the regulation and function of a phylogenetically conserved binding protein. Frontiers in bioscience : a journal and virtual library, 11, 1878–91. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/16368564

White, E. I. (1935). The Ostracoderm Pteraspis Kner and the Relationships of the Agnathous Vertebrates. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences, 225(527), 381–457.

Widmann, C. (1997). Internalization and Homologous Desensitization of the GLP-1 Receptor Depend on Phosphorylation of the Receptor Carboxyl Tail at the Same Three Sites. Molecular Endocrinology, 11(8), 1094–1102. doi:10.1210/me.11.8.1094

Wright, G. M., Mcburney, K. M., Youson, J. H., & Sower, S. A. (1994). Distribution of lamprey gonadotropin-releasing-hormone in the brain and pituitary gland of larval, metamorphic, and adult sea lampreys, Petromyzon marinus. Canadian Journal of Zoology-Revue Canadienne de Zoologie, 72(1), 48–53. Retrieved from ISI:A1994NK85100008

Yamamoto, K., Sargent, P. A., Fisher, M. M., & Youson, J. H. (1986). Periductal fibrosis and lipocytes (fat-storing cells or Ito cells) during biliary atresia in the lamprey. Hepatology, 6(1), 54–59. Retrieved from ISI:A1986AZK2400010

Yao, M., Westphal, N. J., & Denver, R. J. (2004). Distribution and acute stressor-induced activation of corticotrophin-releasing hormone neurones in the central nervous system of Xenopus laevis. Journal of Neuroendocrinology, 16(11), 880–893. Retrieved from ISI:000226255500002

Yeh, C.-Y., Chung-Davidson, Y.-W., Wang, H., Li, K., & Li, W. (2012). Intestinal synthesis and secretion of bile salts as an adaptation to developmental biliary atresia in the

142

sea lamprey. Proceedings of the National Academy of Sciences of the United States of America, 109(28), 11419–24. doi:10.1073/pnas.1203008109

Youson, J. (1985). Organ development and specialization in lamprey species . In R. E. Foreman, A. Gorbman, J. M. Dodd, & R. Olsson (Eds.), The evolutionary biology of primitive fishes (pp. 141–156). New York: Plenum.

Youson, J. H. (1980). Morphology and physiology of lamprey metamorphosis. Canadian Journal of Fisheries and Aquatic Sciences, 37(11), 1687–1710. Retrieved from ISI:A1980LF69300012

Youson, J. H. (1984). Differentiation of the segmented tubular nephron and excretory duct during lamprey metamorphosis. Anatomy and Embryology, 169(3), 275–292. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/6476401

Youson, J. H. (1993, October 28). The endocrine system and lamprey metamorphosis. Messina, Italy: Accademia Peloritana Dei Pericolanti.

Youson, J. H. (1997). Is lamprey metamorphosis regulated by thyroid hormones? American Zoologist, 37(6), 441–460. Retrieved from ISI:000071686700002

Youson, J. H., Docker, M. F., & Sower, S. A. (1995). Concentration of gonadotropin- releasing hormones in brain of larval and metamorphosing lampreys of two species with different adult life histories. In F. W. Goetz & P. Thomas (Eds.), Proceedings of the 5th International Symposium on the Reproductive Physiology of Fish. (p. 83). Austin: University of Texas Press.

Youson, J. H., Heinig, J. A., Khanam, S. F., Sower, S. A., Kawauchi, H., & Keeley, F. W. (2006). Patterns of proopiomelanotropin and prooplocortin gene expression and of immunohistochemistry for gonadotropin-releasing hormones (1GnRH-I and III) during the life cycle of a nonparasitic lamprey: relationship to this adult life history type. General and Comparative Endocrinology, 148(1), 54–71. Retrieved from ISI:000238627700008

Youson, J. H., Plisetskaya, E. M., & Leatherland, J. F. (1994). Concentrations of insulin and thyroid hormones in the serum of landlocked sea lampreys (Petromyzon marinus) of three larval year classes, in larvae exposed to two temperature regimes, and in individuals during and after metamorphosis. General and Comparative Endocrinology, 94(3), 294–304. Retrieved from ISI:A1994NT53800002

Youson, J. H., & Potter, I. C. (1979). Description of the stages in the metamorphosis of the anadromous sea lamprey, Petromyzon marinus L. Canadian Journal of Zoology-

143

Revue Canadienne de Zoologie, 57(9), 1808–1817. Retrieved from ISI:A1979HT10000014

Youson, J. H., & Sower, S. A. (1991). Concentration of gonadotropin-releasing-hormone in the brain during metamorphosis in the lamprey, Petromyzon marinus. Journal of Experimental Zoology, 259(3), 399–404. Retrieved from ISI:A1991GG68000015

Yu, C., Ehrhardt, G. R. A., Alder, M. N., Cooper, M. D., & Xu, A. (2009). Inhibitory signaling potential of a TCR-like molecule in lamprey. European journal of immunology, 39(2), 571–9. doi:10.1002/eji.200838846

Zouboulis, C. C., Seltmann, H., Hiroi, N., Chen, W., Young, M., Oeff, M., Scherbaum, W. A., et al. (2002). Corticotropin-releasing hormone: an autocrine hormone that promotes lipogenesis in human sebocytes. Proceedings of the National Academy of Sciences of the United States of America, 99(10), 7148–53. doi:10.1073/pnas.102180999

144

APPENDIX A

145 146 Figure 22. Standard curve and melt analysis of RT qPCR amplicons. Left: Charting of standard curves for amplicons generated from primer pairs indicated in Table 2. Plotted values were Log starting quantity (arbitrary units) vs amplification cycle (Cq) for serial dilutions of cDNA template of 1/4n; where n = 5 or 6, following 45 amplification cycles. Efficiency was determined by CFX Manager 3.0 software using Eq. 1 and 2. Linearity was accepted as R2 > 0.98. Right: Melt curve analysis of RT qPCR product after 45 cycles. Melt curves were plotted as the negative first derivative of the detected fluorescence versus the temperature (-dRFU/dT). Peaks indicate single product amplicon by single consistent peak at all dilutions. Standard curve and melt curves are presented for CRH A (top), CRH B (middle) and UCN III-like (bottom). All plots were generated using CFX Manager 3.0

147 148 Figure 23. Standard curve and melt analysis of RT qPCR amplicons. Left: Charting of standard curves for amplicons generated from primer pairs indicated in Table 2. Plotted values were Log starting quantity (arbitrary units) vs amplification cycle (Cq) for serial dilutions of cDNA template of 1/4n; where n = 5 or 6, following 45 amplification cycles. Efficiency was determined by CFX Manager 3.0 software using Eq. 1 and 2. Linearity was accepted as R2 > 0.98. Right: Melt curve analysis of RT qPCR product after 45 cycles. Melt curves were plotted as the negative first derivative of the detected fluorescence versus the temperature (-dRFU/dT). Peaks indicate single product amplicon by single consistent peak at all dilutions. Standard curve and melt curves are presented for CRH Rα (top), CRH Rβ (middle) and CRH BP (bottom). All plots were generated using CFX Manager 3.0

149 150 Figure 24. Standard curve and melt analysis of RT qPCR amplicons. Left: Charting of standard curves for amplicons generated from primer pairs indicated in Table 2. Plotted values were Log starting quantity (arbitrary units) vs amplification cycle (Cq) for serial dilutions of cDNA template of 1/4n; where n = 5 or 6, following 45 amplification cycles. Efficiency was determined by CFX Manager 3.0 software using Eq. 1 and 2. Linearity was accepted as R2 > 0.98. Right: Melt curve analysis of RT qPCR product after 45 cycles. Melt curves were plotted as the negative first derivative of the detected fluorescence versus the temperature (-dRFU/dT). Peaks indicate single product amplicon by single consistent peak at all dilutions. Standard curve and melt curves are presented for Beta Actin (top) and GAPDH (bottom). All plots were generated using CFX Manager 3.0

151