Health Science Campus
FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Sciences
New Mechanisms of Transcriptional Regulation of the Folate Receptor and other genes by steroid Receptors
Submitted by: Aymen Shatnawi
In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Sciences
Examination Committee
Major Advisor: Manohar Ratnam, Ph.D.
Academic Robert Trumbly, Ph.D. Advisory Committee: Sonja Najjar, Ph.D.
Han-Fei Ding, M.D., Ph.D.
David Giovannucci, Ph.D.
Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D.
Date of Defense: December 10, 2007
New Mechanisms of Transcriptional Regulation of the
Folate Receptor and Other Genes
by Steroid Receptors
Aymen Shatnawi
University of Toledo/ College of Medicine
2007
DEDICATION
To the soul of my father, to my mother, my wife and lovely kids. God bless all of them
ii ACKNOWLWDGMENT
I would like to thank my major advisor, Dr. Manohar Ratnam for his time, effort
and guidance during my Ph.D study. I would like to thank all my advisory committee: Dr.
Sonia Najjar, Dr. Robert Trumbly, Dr. Han-Fei Ding, Dr. David Giovannucci and Dr
Douglas Pittman for their support and suggestions during my training.
I would like to acknowledge the significant contribution of Dr. Thuyet Tran in
manuscript one. I would like to acknowledge Dr. Xuan Zheng for the animal study that
he did in manuscript one.
I would like to thank Dr. Brian Rowan (Tulane University) for the expression plasmids of hPR, SRC-1, SRC-2, pCAF and GRE/PRE-promoter luciferase construct. I would like to thank Dr. Sumudra Periyasamy (University of Toledo) for the expression plasmids of Sp1 and Sp3. I would like to thank Dr. Guntram Suske (Institut fur
Molekularbiologie und Tumorforschung Philipps-Universitat Marburg) for the expression plasmid of Sp4. I would like to thank Dr Kathrin Horwitz (University of Colorado) for
the T47D-A and T47D-B recombinant cell lines.
I would like to thank all my lab colleagues George, Hala, Juan, Marcella,
Mesfin, Karen, Hong and Huiling for being great people to work with.
I would like to thank Mariana Stoeva for her technical contribution and for always
being there for everybody in the lab.
iii TABLE OF CONTENTS
Dedication ------ii
Acknowledgement ------iii
Table of content------iv
Introduction------1
Literature survey------7
Manuscript one: Enhancement of folate receptor alpha expression in tumor cells through
the glucocorticoid receptor: a promising means to improved tumor detection and targeting.------52
Manuscript two: R5020 and RU486 act as progesterone receptor agonists to enhance
Sp1/Sp4-dependent gene transcription by an indirect mechanism------104
Summary ------156
Bibliography ------157
Abstract ------225
iv INTRODUCTION
The folate receptor (FR) or Folate Binding Protein (FBP), is a glycopolypeptide, that has
a high binding affinity for folic acid (Kd<10-9) and its circulating metabolite, N5-
methyltetrahydrofolate (Antony et al., 1981; Antony, 1996). The expression of FR is
tissue specific and limited to the apical surface of epithelial cells where it is inaccessible
through the circulation. Three isoforms of FR have been isolated and characterized; type
α (Elwood et al., 1986; Sadasivan and Rothenberg, 1988; Elwood, 1989; Lacey et al.,
1989; Sadasivan and Rothenberg, 1989; Elwood et al., 1997), type β (Ratnam et al.,
1989) and type γ (Shen et al., 1994; Shen et al., 1995). The cell membrane associated forms of FR, FR-α and FR- β share 73% amino acid sequence identity and are attached to the plasma membrane by a glycosyl-phosphatidylinositol (GPI) anchor (Lacey et al.,
1989; Yan and Ratnam, 1995). In addition, FR-α and FR-β are localized in special membrane microdomains known as lipid rafts that serve as platforms for FR recycling
(Wang et al., 2002a). On the other hand, FR-γ as well as it is truncated form FR-γ́ are constitutively secreted due to the absence of a signal peptide for GPI attachment (Shen et al., 1994; Shen et al., 1995).
FR-α is capable of transporting folate into the cell but other pathways such as the reduced
folate carrier (RFC) are principally used for up-take of folate compounds in most adult
tissues. The restricted expression of FR-α at the luminal surface of epithelial cells in
several normal tissues results in its physical isolation from the blood stream preventing
access to circulating folate. The physiological significance of FR in those tissues is not
fully understood. However, FR-α is required for trans-placental folate uptake by the fetus
(Antony, 1992; Henderson et al., 1995; Antony, 1996) and for re-absorption of folate in
1 proximal kidney tubules (da Costa et al., 2000). Gene knockout studies showed developmental defects of the neural tube due to impairment of folate transport (Piedrahita et al., 1999; da Costa et al., 2003).
Transcription of the FR-α gene is regulated by two distinct TATA-less promoters, which
are designated as P1 and P4. The P4 promoter, which is located upstream of exon-4, is
primarily directed by a cluster of three non-canonical G/C -rich regions, each of which
contributes to promoter activity by cooperation with the down stream initiator region
(Saikawa et al., 1995). The presences of alternative promoters as well as alternative
splicing involving exons 1-4, generate several FR-α transcripts. All of them have the
same open reading frame (ORF) and 3′-untranslated region (3′ UTR) sequence but differ in their 5′-untransalted region (5′ UTR). In FR-α positive malignant tissues, the P4
promoter drives most of the FR- α mRNA transcription. Moreover, P1 promoter
transcripts have been shown to be translated less efficiently than P4 transcripts although
they are predominant in some normal tissues such as kidney and testis (Elwood et al.,
1997; Roberts et al., 1997).
Pre-clinical and clinical studies have shown that FR- α is a promising tumor target for a
wide variety of therapeutic agents and as a tumor/serum marker for the following
reasons; (I) FR-α has high binding affinity for folate, anti-folates and folate conjugated
drugs and can mediate the internalization of those agents by recycling between the cell
surface and intracellular compartments [reviewed in (Kamen and Smith, 2004)], (II) In
proliferating normal tissues the expression of FR-α is restricted to the luminal surface of
certain epithelial cells and typically isolated from the blood stream. In contrast, in certain
2 epithelial cell derived malignant tissues, FR-α is highly expressed, and accessible through
the circulation.
Many innovative therapeutic and diagnostic approaches have been successfully used for
targeting FR in solid tumors and leukemic cells including, folate conjugates of cytotoxics,
radiopharmaceuticals and pro-drugs (Leamon and Low, 1991; Leamon and Low, 2001),
folate–coated liposomes containing therapeutic drugs, genes or antisense oligonucleotides
and folate-attached nanoparticle carriers for cytotoxic agents (Leamon and Low, 1994;
Lu et al., 1999; Andersson et al., 2000; Drummond et al., 2000; Sudimack and Lee, 2000;
Ward, 2000; Atkinson et al., 2001; Lu and Low, 2002; Ratnam et al., 2003). Conjugation of macromolecules and nanoparticles does not affect folate binding affinity or drug bioavailability.
A major limitation of FR-targeted therapies is the frequently low expression of FR in
tumor tissues. Previous studies from this laboratory have demonstrated that nuclear
receptors regulate FR genes and could be modulated to elevate FR expression selectively
in various tumors. FR-α is negatively regulated by the estrogen receptor (ER) and FR-β is
positively regulated by the retinoic acid receptor (RAR). As an extension of those studies,
this thesis investigates regulation of FR-α by glucocorticoid and progesterone receptors.
In mammals, steroid receptors such as glucocorticoid receptor (GR) and progesterone receptor (PR) regulate distinct and essential biological processes in a tissue selective manner. GR, which is expressed in all tissues and induced by Glucorticoids (stress induced hormones) (Sapolsky et al., 2000), is one of the most vital receptors that regulates essential biological process including growth, metabolism, behavior and apoptosis in both males and females. On the other hand, the progesterone receptor plays
3 an important role in development and reproduction in the female (Conneely and Lydon,
2000; Conneely et al., 2000; Graham and Clarke, 2002). Two isoforms of PR are well characterized, PR-A (94kD) and PR-B (120kD); they are differentially expressed in a tissue specific manner (Graham et al., 1996; Giangrande and McDonnell, 1999;
Giangrande et al., 2000; Graham and Clarke, 2002).
Pure PR antagonists such as ZK98299 (onapristone) completely abrogate the transcriptional activity of PR whereas selective progesterone receptor modulators
(SPRMs) such as RU486 (mifepristone) have mixed effects acting as either PR agonists or antagonists in different cell and target gene contexts. Interestingly, the A and B subtypes of PR respond differently to RU486 that binds to PR-B to function as a partial agonist under certain conditions; in contrast, RU486 can only act as an antagonist of PR-
A (Meyer et al., 1990; Tung et al., 1993).
Functional analysis of the FR-α promoter did not show the presence of classical hormone response elements (HREs). The Endogenous FR-α gene and its promoter activity are negatively regulated (repressed) by the estrogen receptor (ER) (Kelley et al., 2003) and this repression is increased by estrogen treatment and reversed (de-repressed) by anti- estrogenic compounds such as Tamoxifen (Kelley et al., 2003). These findings were consistent with an earlier observation of negative correlation between FR-α expression and ER expression in primary breast cancer cells (Rochman et al., 1985). Detailed mechanistic studies underscored the importance of the initiator and the flanking sequence within the P4 core promoter as a direct target for ER repression through formation of a complex with co-repressors SMRT and/or NCOR (Hao et al., 2007). Conversely, in FR-α positive cell lines, unpublished studies from this laboratory have shown that androgens
4 such as testosterone and R1881 enhance FR-α gene expression in a dose and time
dependent manner. This regulation involves direct action of AR by interaction with
C/EBPα bound to a CCAAT element. The mechanisms by which ER and AR modulate
the FR-α gene represent novel mechanisms by which the steroid receptors regulate global
gene expression.
In this study, we demonstrate that both GR and PR activate the FR-α gene in a manner that is distinct from ER and AR. The FR-α mRNA and protein and FR-α promoter activity are up-regulated by GR and PR isoforms both in tissue cell culture and in tumor xenograft models (Tran et al., 2005; Shatnawi et al., 2007). Mechanistic studies showed that GR, PR-A and PR-B up-regulate FR-α indirectly through the protein product of
upstream target gene(s). Promoter analysis of FR-α gene showed the involvement of the
G/C-rich Sp1 binding sites of the P4 promoter in GR and PR action and an optimal
initiator context. We also showed that a clinically well tolerated HDAC inhibitor such as valporic acid (VPA) enhances FR-α induction by dexamethasone. Thus, the ubiquitous
GR could be modulated by clinically acceptable agents (eg., dexamethasone and valproic
acid) to selectively induce FR-α tumor targeting or early detection. Also, the results
support the concept of increasing FR-α expression selectively in the FR-α-positive
tumors by brief treatment with nontoxic doses of GR and PR agonist, alone or in
combination with a well-tolerated HDAC inhibitor, to increase the efficacy of various
FR-alpha-dependent therapeutic and diagnostic applications. Interestingly, the classical
PR antagonist RU486 also activated the FR-promoter but only through PR-B.
The studies were extended to the regulation of other important Sp1-dependent genes such
as p21, p27 and thymidine kinase by RU486. The agonistic action of RU486 on those
5 genes was attributed to its agonistic activity on upstream direct target of PR, the gene (s) encoding a putative Sp1 co-activator(s). Moreover, our findings contradict the current view of Sp1-dependent gene regulation by PR and point to the existence of one or more
PR target genes whose promoter and cell context(s) must be key determinants of the agonistic activity of RU486 on a large group of important Sp1-dependent downstream target genes. The upstream target gene(s) is likely encode an Sp1 co-activator(s).
6 LITERATURE SURVEY
Folate receptor:
Folate receptor (FR) or Folate Binding Protein (FBP), is a glycopolypeptide, that has a
high binding affinity for folic acid (Kd<10-9) and its circulating metabolite, N5-
methyltetrahydrofolate (Antony et al., 1981; Antony, 1996). Most normal adult tissues
lack FR and its expression is tissue specific and limited to the apical (luminal) surface of
epithelial cells where it is isolated from the blood stream. FR was originally reported in
placenta, proximal kidney tubules, choroid plexus and others (Selhub and Rosenberg,
1978; Antony et al., 1981; Suleiman and Spector, 1981; Suleiman et al., 1981; Selhub
and Franklin, 1984; Antony, 1996). In addition, certain extra-cellular fluids (milk,
amniotic fluid, urine and cerebrospinal fluid) showed significant levels of soluble folate
binding protein (sFBP) originally derived from a membrane-attached precursor due to
membrane or intracellular action of proteases and phospholipases (da Costa and Sharon,
1980; Antony et al., 1982; Elwood et al., 1986). In contrast, FR is completely absent in
normal serum and was found to be highly expressed in certain types of major malignant
tumors (Wu et al., 1999; Elnakat and Ratnam, 2004).
From cDNA cloning, three isoforms of the folate receptor were isolated and
characterized, type α (Elwood et al., 1986; Sadasivan and Rothenberg, 1988; Elwood,
1989; Lacey et al., 1989; Sadasivan and Rothenberg, 1989; Elwood et al., 1997), type β
(Ratnam et al., 1989) and type γ (Shen et al., 1994; Shen et al., 1995). The cell membrane associated forms of FR, FR-α and FR- β, share 73% amino acid sequence identity and are attached to the cell surface membrane by a glycosyl-phosphatidylinositol (GPI)
7 anchor (Lacey et al., 1989; Yan and Ratnam, 1995) through serine 234 and asparagine
230 at their c-terminal end. FR-α and FR-β are localized in special membrane
microdomains known as lipid rafts that serve as platforms for FR recycling (Wang et al.,
2002a).
FR-γ as well as it is truncated form FR-γ́ are constitutively secreted type due to the absence of the signal peptide for GPI attachment (Shen et al., 1994; Shen et al., 1995).
FR-γ was mainly detected in normal hematopoietic tissues including bone marrow, spleen and thymus as well as in certain leukemia. A fourth isoform was recently discovered by human and mouse genome data base mining and was designated as FR-δ (Spiegelstein et al., 2000). In mice, the expression of FR-δ has been found to occur in spleen and thymus.
Conversely, in humans, the tissue expression of FR-δ and its folate binding ability have not yet been characterized and very little is known about it (Spiegelstein et al., 2000;
Yamaguchi et al., 2007).
Folate receptors α and β play a crucial role in mediating the internalization of folate and
its analogs by its ability to shuttle back and forth between the cell membrane and the
cytoplasmic compartment (Leamon and Low, 1991; Turek et al., 1993). The structural
difference between α and β isoforms involving Leu-49 in FR-β and Ala-49, Val-104, and
Glu-166 in FR-α has resulted in different affinities and stereospecificities for folate and
antifolates compounds in the range of 2 fold to 100 fold (Wang et al., 1992; Shen et al.,
1997; Maziarz et al., 1999).
8 Physiological significance FR- α:
FR-α is capable of transporting folate into the cell but other pathways in adult tissues are principally used for up-take of folate compounds eg., the reduced folate carrier (RFC).
The significant of the restricted expression of FR-α at the apical surface of epithelial cells in normal tissues where it is not accessible to the circulation is not entirely clear.
However, in placenta, FR-α is required for trans-placental folate uptake by the fetus
(Antony et al., 1981; Henderson et al., 1995; Antony, 1996). In kidney, FR-α could be essential for urinary clearance of folate (da Costa et al., 2000). Moreover, the presence of sFBP in milk may have a role in intestinal absorption of folate in infants (Colman et al.,
1981; Mason and Selhub, 1988). Gene knock-out studies have shown that FR-α is essential for nerve tube development when dietary folate is limited and that deletion of the FR-α gene results in developmental defects of the neural tube due to impaired folate transport (Piedrahita et al., 1999; da Costa et al., 2003).
Clinical significance FR- α:
Pre-clinical and clinical studies have shown that FR- α is a promising target for a wide
variety of tumor therapeutic agents and as a tumor/serum marker, for several reasons. (I)
FR has high binding affinity for folate , anti-folates and folate conjugated drugs; (II) FR
can mediate the internalization of FR- α bound folate and folate conjugates by recycling
between the cell surface and the intracellular compartments [reviewed in (Kamen and
Smith, 2004)]; (III) The physical isolation of FR-α from the blood stream in normal
tissues. In proliferating normal tissues, the expression of FR-α is restricted to the luminal
surface of certain epithelial cells where it is isolated from the blood stream. In contrast, in
9 certain epithelial derived malignant tissues, FR-α is found to be highly expressed, and it
is accessible to the circulation. FR-α has been found to be highly expressed in ovarian
cancers derived from ovarian epithelial cells, endometrial adenocarcinoma, testicular
choriocarcinoma, ependymomas and meningiomas of the brain, and in some colon,
kidney and breast cancers (Weitman et al., 1992; Ross et al., 1994; Weitman et al., 1994;
Wu et al., 1999). Moreover, it has been found that in ovarian cancer FR-α expression
level is higher in high grade, undifferentiated or metastatic cancer cells than the localized
counterpart low grade type (Toffoli et al., 1997; Toffoli et al., 1998; Toffoli and Tumolo,
1999).
Folate receptor targeted therapy has been reported to be highly specific and effective.
However, the effectiveness of such therapies is highly dependent on the FR- α expression
levels in the tumor cells. Unfortunately, the expression of the FR-α varies among tumors
from different individuals. In addition, the expression of FR-α has been shown to be
heterogeneous within the tumor tissues (Wu et al., 1999). Optimal expression of FR in
malignant cells is necessary for effective tumor targeted therapies.
Many innovative therapeutic and diagnostic approaches have been successfully used for
targeting FR in solid tumors as well as leukemic cells. Such experimental approaches
includes (I) Folate conjugates of cytotoxics, radiopharmaceuticals and pro-drugs
(Leamon and Low, 1994; Leamon and Low, 2001); (II) Folate–coated liposomes
containing therapeutic drugs, genes or antisense oligonucleotides and (III) Folate-
attached nanoparticle carriers for cytotoxic drugs (Leamon and Low, 1994; Lu et al.,
1999; Andersson et al., 2000; Drummond et al., 2000; Sudimack and Lee, 2000; Ward,
10 2000; Atkinson et al., 2001; Lu and Low, 2002; Ratnam et al., 2003). In fact, none of these conjugations has been found to impede folate binding or drug bioavailability.
FR- α Gene structure:
The FR-α gene chromosomal localization has been determined to be 11q13.3-q13.5
(Ragoussis et al., 1992). In addition, the organization and the basal promoter of the FR-α gene has also been characterized (Elwood et al., 1986; Sadasivan and Rothenberg, 1988;
Elwood, 1989; Sadasivan and Rothenberg, 1989; Sadasivan et al., 1992; Saikawa et al.,
1995; Elwood et al., 1997). The FR-α gene is approximately 7 kb in length consisting of
7 exons and 6 introns (Figure-1).
FR-α gene transcription is regulated by two distinct TATA-less promoters, which interact with different transcription factors and designated as P1 and P4. The P4 promoter which is located upstream of exon-4, is primarily directed by a cluster of three functional G/C – rich regions that are non-canonical Sp1 binding sites, each of which contributes to P4 promoter activity (Saikawa et al., 1995). On the other hand, the P1 promoter, which is upstream of exon 1, has not yet been fully characterized, but it most likely does not contain a functional TATA or GC boxes. Instead, 3′-AATAATT-5′ NP3/4 binding element spanning +27nt to +33nt has been found required for P1 promoter optimal activity (Tomassetti et al., 2003). Due to alternative promoter usage as well as alternative splicing involving exons 1-4, multiple FR-α transcripts have been isolated and characterized.
11
gene organization α
i it
Figure (1): Folate receptor-
12 All of them have an identical open reading frame and 3′ UTR sequence but differ in their
5′ UTR. The P4 promoter drives most of the FR- α mRNA transcription in malignant
tissues. P1 promoter transcripts are translated less efficiently than the P4 transcript and
are present in some normal tissues including kidney and testis (Elwood et al., 1997;
Roberts et al., 1997).
Regulation of FR-α Expression:
The narrow and distinct tissue specificity of FR expression has been reported to be
governed at both transcriptional and posttranscriptional levels (Elwood et al., 1997;
Roberts et al., 1997; Zheng et al., 2003). Selective instability and degradation of FR-α
transcripts in the nuclear compartment of FR-α negative but not FR-α positive cell lines
has been related to the presence of a unique 60 base mRNA region within FR-α open reading frame (ORF) (Elwood et al., 1997; Roberts et al., 1997; Zheng et al., 2003).
In vitro, the extra-cellular concentrations of folate have been found to modulate FR-α
protein expression (McHugh and Cheng, 1979; Kane et al., 1988). FR-α positive cell lines cultured in low folate medium, showed a rapid induction of FR-α expression.
Addition of folic acid or reduced folate coenzymes reversed FR-α expression. Regulation of FR-α expression by folate at the translational level or by influencing mRNA stability has also been observed (Hsueh and Dolnick, 1993; Sun and Antony, 1996). Folate dependent up-regulation of FR-α expression in cervical carcinoma cells was found occur by interaction of a 46 kDa cytosolic protein hnRNP E1 with an 18 base cis elements in the 5’ UTR region of the FR-α transcript (Sun and Antony, 1996).
Functional analysis of the FR-α promoter did not show the presence of classical hormone
response elements (HREs). The Endogenous FR-α gene and its promoter activity are
13 negatively regulated (repressed) by the estrogen receptor (ER) (Kelley et al., 2003) and
this repression is increased by estrogen treatment and reversed (de-repressed) by anti- estrogenic compounds such as Tamoxifen (Kelley et al., 2003). These findings were consistent with an earlier observation of negative correlation between FR-α expression
and ER expression in primary breast cancer cells (Rochman et al., 1985). Detailed mechanistic studies underscored the importance of the initiator and the flanking sequence within the P4 core promoter as a direct target for ER repression through formation of a complex with co-repressors SMRT and or NCOR (Hao et al., 2007). Conversely, in FR-α
positive cell lines, unpublished studies from this laboratory have shown that androgens
such as testosterone and R1881 have enhanced FR-α gene expression in a dose and time
dependent manner. This regulation involves direct action of AR by interaction with
C/EBPα bound to a CCAAT element.
Nuclear receptors: structure and transcriptional mechanism:
In mammals, at least fifty members of the nuclear receptor (NR) super-family transcription factors have been characterized and classified into three main classes according to their cellular localization and mode of action (Escriva et al., 2004). All of them play crucial roles in cell growth, development and in physiological and cellular
homeostasis (Tsai and O'Malley, 1994; Enmark and Gustafsson, 2001; Ribot et al., 2001;
Mohan and Heyman, 2003). Class-I NRs or steroid receptors includes estrogen (ER),
progesterone (PR), testosterone /androgen (AR), glucocorticoid (GR) and
mineralcorticoid (MR) hormone receptors. In the absence of their ligands, they are
mainly localized in the cytoplasm associated with a multiple protein complex consisting
14 of heat shock proteins and immunophilins that inhibit their transcriptional activity. Upon ligand binding, the steroid receptors dissociate from the complex, homo or hetero dimerize with other NRs, translocate to the nucleus, bind to their DNA response elements
(HREs) and modulate gene transcription (DeMarzo et al., 1991; Pratt and Toft, 1997;
Pratt and Toft, 2003). The class-II NRs include thyroid hormone receptor (TR), retinoic
acid receptor (RAR), retinoid X receptor (RXR), vitamin D3 receptor (VDR) and many
others. These receptors reside mainly in the nucleus, constitutively bound to their DNA
binding elements and associated with co-repressor complexes that repress their gene
activation. In the presence of their ligands, the co-repressors dissociate from the receptor
and are replaced by co-activators leading to trans-activation (Glass et al., 1997). Orphan
nuclear receptors or class III is the largest group of NRs, most of which were identified
before identifying their natural ligands. Like class II, class III NRs are constitutively
bound to their DNA response elements and associated with co-repressors complex in a
ligand-independent manner. Moreover, their mechanisms of gene regulation have also
been found to be similar to class II. Unlike class I and class II nuclear receptors, orphan
receptors can bind as monomers to their HRE half sites with a relatively high affinity,
inducing gene transcription. Some examples of this group of nuclear receptors include
peroxisome proliferator activator receptor (PPAR), liver X receptor (LXR) and farnesoid
X receptor (FXR) that are involved in lipid and bile acid metabolism (Mohan and
Heyman, 2003; Willy et al., 2004). In addition, the pregnane X receptor (PXR) and
constitutive androstane receptor (CAR) have been found to function as xenobiotic sensors
(Mohan and Heyman, 2003; Willy et al., 2004). Besides the normal physiology of the
nuclear receptors, they have been implicated in many pathological conditions, such as
15 cancer, asthma, rheumatoid arthritis, cancer, diabetes, autoimmune and others (Shao and
Brown, 2004; Cutolo et al., 2007; Finck and Kelly, 2007; Jacobsen et al., 2007; Jiang et
al., 2007; Lonard et al., 2007; Martinez et al., 2007; Paola and Cuzzocrea, 2007; Park et
al., 2007). Nuclear receptors are fundamentally transcription factors that interact with
diverse groups of transcriptional co-regulators, produce complex patterns of gene
expression in response to ligands or extracellular signals (McKenna et al., 1998;
McKenna et al., 1999a; McKenna et al., 1999b; McKenna and O'Malley, 2000; McKenna
and O'Malley, 2001; McKenna and O'Malley, 2002b; McKenna and O'Malley, 2002a).
Nuclear receptors share a common structural organization (Figure-2). Typically, NRs are
composed of four major domains. First, the N-terminal domain (A/B region), is the most
variable region in size and sequence among nuclear receptors or within individual nuclear
receptor isoforms and contains most of the phosphorylation sites. The A/B region also
contains the activation function region 1 (AF-1) that is responsible for ligand independent
trans-activation of NRs by cross talking with other intracellular signaling pathways or by
serving as platform for certain co-regulators interaction in promoter and cell specific
manner (Rochette-Egly et al., 1991; Rochette-Egly et al., 1997; Taneja et al., 1997). For
example, in vitro, estrogen receptor N-terminal domain has been found phosphorylated
following treatment of cells with growth factors through activation Ras-MAPK cascade.
The phosphorylation of serine or threonine residue within A/B region enhances estrogen transcriptional activity (Kato et al., 1995; Patrone et al., 1996; Kato et al., 1998). Second,
The DNA binding domain (DBD) or C region is the most conserved domain of the
nuclear receptors and determine the ability of the receptor to bind its hormone response
elements (HREs) in its target gene (Figure-2). DBD domain comprises two zinc fingers
16 that span approximately 60 to 70 amino acids and a COOH-terminal extension (CTE) that
contains A and T boxes. Each finger contains four cysteines residues interact
tetrahedrically with one zinc ion. Amino acids required for discrimination of the core
DNA motifs are present within the first zinc finger and forming “P box” While the
second zinc finger is involved in the receptor dimerization through formation what is
called “D box” (Luisi et al., 1991; Fairall et al., 1993; Lee et al., 1993; Schwabe et al.,
1993a; Schwabe et al., 1993b). Third, the hinge region or D domain, serve as a hinge between the LBD and DBD and facilitate free rotation of the DBD. Moreover, the D domain contains nuclear localization signal (NLS) required for receptor shuttling as well as amino acid residue for co-repressor interaction with nuclear receptor (Figure-2).
Fourth, the C-terminal or Ligand Binding Domain (LBD) (E/F region) is a multifunctional region that contains amino acids involved in ligand binding, NRs homo or hetero dimerization, interaction with heat-shock proteins and ligand dependent co- regulator recruitment through activation function-2 (AF-2) (Figure-2). The (AF-2) region within LBD consists of eight amino acids that serve as a surface for receptor/co- regulators interaction (Wurtz et al., 1996). The LBD from different NRs has been crystallized and found to be consisted of 12 α helical regions that are folded to form complex turns and layers creating a cavity for ligand binding (Rochel et al., 2000). The spatial orientation changes of the LBD have also been found to be dependent on ligand nature (i.e agonist or antagonist) (Beato et al., 1995; Tanenbaum et al., 1998). In addition, it has been found that the LBD also contains specific tyrosine phosphorylation sites involved in ligand-independent activation of the NRs and may be a target for several signaling pathways (White et al., 1997). In the absence of hormones, the steroid receptor
17 stays transcriptionally inactive and associated with a large complex consist of heat shock
proteins including hsp90, hsp70, p23 and immunophillins. Hormone binding initiates
conformational changes in the receptor that leads to dissociation of the NRs from heat
shock proteins, dimerization, and binding to its hormone responsive element (HRE) in its
target genes. The HREs mainly present in the 5′ flanking region of the target genes close
to the core promoter, and in some cases they are located in the enhancer region several kilo bases upstream of the transcription start site (Cleutjens et al., 1997). The consensus sequence (hexameric motif) 5′-AGAACA-3′ is preferentially recognized by steroid receptors whereas 5′-AGG/TTCA-3′ serve as the recognition motifs for the rest of the nuclear receptors and specific variations within the consensus sequence are tolerated
(Beato et al., 1995). Even though some receptors can bind a single hexameric motif as monomers, most of the nuclear receptors bind as homo or hetero-dimers to HREs composed normally of two-core hexameric motifs separated by three nucleotides spacer.
Although most of the attention has been focused on binding of the nuclear receptor to
positive HREs as a mechanism of transcriptional activation, nuclear receptors such as
thyroid and glucocrticoid receptors, can also bind negative HREs (nHREs) as monomer or dimers and mediate negative regulation by the ligand indicating the important of these binding sites in feedback mechanism. nHREs are generally located close to the transcription start sites or downstream of the TATA box or even within the 3′ un- translated regions (Bigler and Eisenman, 1995; Belandia et al., 1998).
18
Hinge Region
AF-1 AF-2
N A/B C D E/F C
N-terminal Domain DNA Binding Domain Ligand Binding Domain Variable Region
Figure (2): Nuclear receptor protein structure
19 The DNA bound receptor interact directly or indirectly via co-regulators with the
transcriptional machinery and mediate chromatin remodeling leading to gene activation
or repression (Groudine et al., 1983; Weintraub, 1983; Smith et al., 1997; Lemon and
Freedman, 1999; McKenna et al., 1999a; Nie et al., 2000; Robyr et al., 2000; Deroo and
Archer, 2001b; Deroo and Archer, 2001a; Grange et al., 2001; Urnov and Wolffe, 2001c;
Urnov and Wolffe, 2001a; Heinlein and Chang, 2002; Hsia and Shi, 2002; Hsiao et al.,
2002; Smith et al., 2002; Villagra et al., 2002; Hsia et al., 2003). Two groups of
chromatin remodeling have been identified and required for NRs gene regulation. The
first group, includes histone acetylases, histone deacetylases, methylases and kinases
(Spencer et al., 1997; Wang et al., 1997; Mizzen and Allis, 1998; Mizzen et al., 1999;
Sterner and Berger, 2000; Sasaki and Yoshida, 2006; Sadaie and Nakayama, 2007), and they covalently modify the nucleoprotein structure. The second group is ATP-dependent chromatin remodeling complexes that require ATP for chromatin disruption and sliding of histone octamer. This group includes three subgroups, SWI/SNF, ISWI and Mi-2 that are classified according to the identity of the core ATPase subunits that form the major component of the complex (Phelan et al., 1999; Guyon et al., 2001; Becker and Horz,
2002; Narlikar et al., 2002). DNA binding is the primary mechanism of gene regulation by NRs. However, NRs were also found to be associated with their target genes by interaction with other DNA- bound transcription factors such as , AP-1, Sp1, Sp3, NF-
κB, GATA, STAT, CREB, KLFs and others rather than their hormone response elements
(HRE) in a DNA-independent binding manner. The protein-protein interaction of the NRs with other DNA bound co-regulators can increase or decrease the transcriptional activity of the target genes is a receptor-specific and cell or promoter context dependent manner
20 (Blobel et al., 1995; Suzuki et al., 1999; Harnish et al., 2000; Adcock and Caramori,
2001; Yang et al., 2005). NRs also control the biological processes by interacting with
other cytoplasmic signaling pathways rather than DNA binding (non-genomic pathway).
The non-genomic pathway, which is most notably seen in class I NRs, has been recently discovered as alternative pathway that regulates NRs activity in response to extra cellular signals (Boonyaratanakornkit et al., 2001). Kinases such as Src, MAPK, PI3K/AKT pathways have been reported to play a central role in AR, ER, GR and PR gene regulation in normal and cancerous cells lines (Haynes et al., 2000; Russell et al., 2000;
Simoncini et al., 2000; Haynes et al., 2003; Kousteni et al., 2003; Manolagas et al., 2004;
Vertino et al., 2005).
Glucocorticoid receptor (GR):
In mammals, GR is one of the most vital steroid receptors that regulates essential biological process including growth, metabolism, behavior and apoptosis (Barnes, 1998;
Sapolsky et al., 2000). GR is mainly localized in the cytoplasm. hGR gene is located in chromosome 5 q31-32 and composed of nine exons that generate its open reading frame
(ORF). Two alternative spliced transcripts for hGR have been characterized, hGRα and hGRβ and both of them are product of alternative splicing of the ninth exon. Both GR isoforms are identical up to amino acid 727. hGRβ is shorter than hGRα and generated by replacing the 50 carboxy terminal amino acids of hGRα by 15 non homologous amino acids (Figure-3). Moreover, the presence of several translation initiation sites within exon number 2 (Pujols et al., 2002; Schaaf and Cidlowski, 2002; Yudt and Cidlowski, 2002) proposed the existence of additional GR isoforms ending up with eight isoforms for each
21 of hGRα and hGRβ (Figur-3). In addition, the expression of each individual isoform is
highly regulated in tissue and cell specific manner. Interestingly, recombinant cells that
express each of hGRα isoforms, treated with glucocorticoid and subjected to cDNA
microarray analysis reveal that, among the 2000 hGR target genes, only 189 genes were
regulated (activated or repressed) by all hGRα isoforms. Thus, depending on the relative
expression of GR isoforms in different tissues, the GR may differentially modulate gene
expression and pointed the importance of alternative translation initiation as a mechanism
of gene regulation (Lu and Cidlowski, 2004; Lu and Cidlowski, 2005; Lu and Cidlowski,
2006).
The expression of hGRα is ubiquitous and is functional when activated by
glucocorticoids (Hollenberg et al., 1985). In addition, the expression levels of hGRα is also controlled by several physiological and pathological conditions (Hollenberg et al.,
1985). hGRs promoter regions contain neither TATA box nor CCAAT binding site (Zong et al., 1990; Encio and Detera-Wadleigh, 1991). Instead, all of them contain CpG islands and binding site for transcription factors AP-1, AP-2, Yin Yang 1 (YY1), NF-κB, Sp1 and CREB (Nobukuni et al., 1995; Breslin et al., 2001).
The primary action of GR is gene activation. Conversely, the major anti-inflammatory effect of glucocorticoids is through repression of the inflammatory and immune genes.
Functional analysis of those genes showed that few of them contain either positive or negative GRE, suggests that the inhibitory effect is mainly due to the interaction of the
activated GR with other transcription factors by protein-protein interaction rather than
direct DNA binding. such factors include AP-1 and NF-κB a strong mediators of
inflammatory and immune genes (Karin, 1998). Unlike hGRα, hGRβ isoform is
22 constitutively localized in the nucleus, unable to bind glucocorticoids and
transcriptionally inactive (Oakley et al., 1997). In addition, hGRβ expression is tissue
selective and its level of expression is much lower than hGRα (Oakley et al., 1997; Lu
and Cidlowski, 2004).
In vitro studies showed that over-expression of hGRβ act as dominant negative inhibitor
on hGRα mediated gene transactivation suggesting the role of hGRβ in regulation of
tissue sensitivity to glucocorticods possibly through the formation of GRα/GRβ heterodimer. Interestingly, the tissue specific expression and the inhibitory function of hGRβ have been identified as contributing factors in several pathological conditions such as rheumatoid arthritis, allergic rhinitis, ulcerative colitis, systemic lupus erythematosus and glucocorticoid- insensitive asthma (Chrousos, 1995; Webster and Cidlowski, 1999;
Sousa et al., 2000). The changes in hGRβ expression levels relative to hGRα leads to steroid resistance (Krett et al., 1995; Beger et al., 2003).
Physiology of Glucocorticoid receptor:
GRs are widely conserved throughout different species (Encio and Detera-Wadleigh,
1991) and they have profound effect on tissue development and differentiation and induced by Glucocorticoids (stress induced hormones). The synthesis of glucocortiocoids
in the adrenal cortex is typically controlled by the hypothalamic-pituitary- adrenal (HPA)
axis (Sapolsky et al., 2000). Stress factors such as pathogen, trauma and toxins induce a
signal from the hypothalamus to the pituitary gland to release adrenocortocotrophic
hormone (ACTH) into the blood stream.
23
Alternative translation
initiation
Figure (3): Glucocorticoid receptor gene structure and protein splicing (Lu and Cidlowski, 2006)
24 ACTH binds with specific receptors in the adrenal gland leading to production and
releasing of glucocorticoids. Due to glucocorticoids high lipid solubility, virtually they
can reach each single cell within the human body including the brain through passive
diffusion. Inside the cell, glucocorticoids activate GR to mediate the activity and the direction of a myriad of cell-tissue and organ-specific functions including maintaining of
vascular tone, immunity and inflammatory response, intermediary metabolism such as
protein; lipid and carbohydrate metabolism, tissue development and programmed cell
death as well as the effects on the central nervous system normal physiology (Barnes,
1998; Chrousos, 2004; Smoak and Cidlowski, 2004; Chrousos and Kino, 2005; Rhen and
Cidlowski, 2005).
GR knock out mice model showed sever developmental abnormalities and several
physiological functions defects and mice died within few hours after birth (Cole et al.,
1993; Cole et al., 1995). On the other hand, the knock-in mice model characterized by
GR DNA-binding and dimerization defect showed that the mice were able to survive despite the impairment of several physiological functions by glucocorticoids. The later observations support the fact that GR can also interact with other proteins or nuclear receptors as well as other signaling pathways to activate or repress gene transcription as an alternative pathway of gene regulation (Reichardt et al., 1998).
Mechanism of gene regulation by Glucocorticoid receptor:
In the absence of ligand, the cytosolic GR sequesters a multi-protein complex consisting
of several proteins including hsp90, hsp70, FKBPs, Cyp-40, p23, immunophilin and few
others that inhibit its transcriptional activity (Pratt and Toft, 1997; Pratt and Toft, 2003;
25 Kovacs et al., 2005; Murphy et al., 2005). The interaction of GR with two hsp90 is
essential for keeping the ligand-binding pocket in its optimal and high affinity
configuration. Steroids such as dexamethasone can freely diffuses across the plasma
membrane and binds to GR in the cytoplasm. However, despite the fact that GR is mainly
located in the cytoplasm, it is believed now that there is a rapid active cycling of GR
between the cytoplasm and the nucleus (Hache et al., 1999; Kumar et al., 2004; Kumar et al., 2006). Ligand binding induces conformational changes of GR leading to receptor
dissociation from its chaperone proteins and localization to the nucleus by the interaction
of the nuclear localization sequence-1 (NLS1) which is located within the hinge region of
the receptor with importing proteins termed as importins. Importin α, 7 and 8 are playing
a major role in GR nuclear localization. On the other hand, the nuclear localization sequence-2 (NLS2), which resides within the ligand-binding domain, is less effective in
GR localization to the nucleus. (Picard and Yamamoto, 1987; Savory et al., 1999; Chook and Blobel, 2001; Lee et al., 2006). Within the nucleus, a single GR can form a dimer with another GR and binds directly to the consensus DNA binding sites on its target genes, known as glucocorticoid response elements (GRE) ( GGTACAnnnTGTTCT)
(Barnes, 1998). The association of GR homodimer with its GREs on its target genes mediates GR interaction with a complex of transcription factors including SRC-1, CBP,
TIF-2, p300/CBP, GRIP-1, CREB-binding protein and others to enhance gene activation
(Karin, 1998; Ito et al., 2000; Kagoshima et al., 2001; Li and O'Malley, 2003; Li et al.,
2003). Co-activator such as CBP and CREB-binding have intrinsic histone acetyltransferase activity and such interaction resulting in acetylation of lysine 5 and 16 residues of H4 resulting in subsequent events that lead to the releasing of the tightly
26 wound DNA and allowing recruitment of further transcription factors and auxiliary
proteins to enhance gene transcription (Urnov and Wolffe, 2001b; Urnov, 2003).
The primary action of GR is gene activation. In contrast, GR/GRE binding can also
decrease the expression of certain genes such as prolactin and osteocalcin in a ligand
dependent manner. In A549 lung epithelial cell lines treated with cyclohexamide to
prevent the secondary effect of six hours treatment with dexamethasone showed that, at
least seventy-three of GR direct genes are down regulated, some of them have been found
involved in cell proliferation, inflammation, apoptosis, and surfactant synthesis (Wang et
al., 2004a). in addition, the direction and the magnitude of the transcriptional response
to glucocorticoids is highly dependent on the number of GREs, the position of the GREs
relative to the transcriptional start site as well as the type of the GR ligand (Wang et al.,
2004a).
Interestingly, GR can bind DNA as a hetero-dimer with other transcription factors such as
STAT and ETS family distinct from GR association with STAT or ETS in DNA
independent-manner (Stocklin et al., 1996; Biola et al., 2000; Mullick et al., 2001). The
GR heterodimer can recruit either co-activator ( e.g, GRIP-1) or co-repressors (e.g,
RIP140 or HDAC) and either activate or repress gene transcription in cell specific manner (Stevens et al., 2003; Barnes et al., 2004; Garside et al., 2004).
The ligand-bound GR can also repress the gene activation by interaction with negative
GRE (nGRE). Glucocorticoids are widely used as anti-inflammatory agents through
acting as inflammatory and immune genes suppressors. Functional promoter analysis on a
large number of inflammatory and immune genes reveal that few of them have either
positive or negative GREs, discount the possibility of GR/GRE binding as a fundamental
27 mechanism of inflammatory gene suppression. Conversely, down-regulation of these
genes has been found mainly mediated by a direct interaction of GR with potent
inflammatory mediators mainly NF-κB and AP-1 in DNA independent manner (Karin,
1998). The fact that why not all NF-κB target genes are repressed by active GR within
the same cell type still unclear and need to be investigated and clarified. In addition, the
precise mechanism by which GR inhibit NF-κB or AP-1 target genes is not fully
understood and several mechanisms have been proposed to explain this repression action
by one or more of the following: (I) Recruitment of certain co-repressor with HDAC
activity such as NCoR (Nissen and Yamamoto, 2000; Rosenfeld and Glass, 2001; Luecke
and Yamamoto, 2005); (II) Hypo-phosphorylation of RNA polymerase II enzyme
(Nissen and Yamamoto, 2000; Luecke and Yamamoto, 2005), (III) Decrease immune and
inflammatory genes mRNA stability by either increasing the levels of cell ribonucleases
and the mRNA destabilizing proteins or by inducing MAP-1 phosphatase activity (Meyer
et al., 2004; Fan et al., 2005), (IV) Direct repression of co-activator complex (Nissen and
Yamamoto, 2000; Luecke and Yamamoto, 2005; Pascual et al., 2005), (V) Direct increase in the expression of NF-κB inhibitor IκB α or AP-1 inhibitor (GLIZ) in cell
specific manner (Heck et al., 1997), (VI) Binding as a monomer to AP-1 and NF-κB
(Heck et al., 1994) and finally, (VII) repression the action of the non genomic pathways of some extra-cellular signaling pathways such as ERK, Akt, PI3K and JNK (Gonzalez et al., 2000; Bruna et al., 2003).
A number of intracellular signaling pathways can activate GR in a non-genomic pathway.
G-protein-coupled receptor and some other kinases pathways have been reported to be
involved in GR non-genomic pathway of gene regulation. The presence of kinases and
28 phosphatases associated with the inactive hsp90-GR complex support the fact that these enzyme are involved in a rapid induction of tyrosine kinase that has been observed in certain cells types by glucocorticoids (Powell et al., 1999; Croxtall et al., 2000; Croxtall et al., 2002; Norman et al., 2004).
Post-translational modification of GR and their roles in GR action
Post-translational modification including , GR phsophorylation (Hoeck et al., 1989;
Webster et al., 1997; Rogatsky et al., 1998; Wang et al., 2002b), ubiquitination (Rogers et
al., 1986; Wallace and Cidlowski, 2001), SUMOylation (Jin et al., 2001; Tian et al.,
2002), acetylation and methylation of either GR or one of its chaperone proteins (Jin et
al., 2001; Aoyagi and Archer, 2005; Lee et al., 2005; Murphy et al., 2005; Aoyagi and
Archer, 2007) can negatively or positively regulate GR action.
Phosphorylation of GR: Five phosphoryaltion sites have been identified and mainly
located in the N-terminal domain of GR, serine 113, 141, 203, 211, and serine 226
(Hoeck et al., 1989; Hoeck and Groner, 1990; Ismaili and Garabedian, 2004). All of them
can be phosphorylated in ligand dependent and independent manner. Interestingly,
phosphorylation of each residue has distinct effect on GR sub-cellular localization,
receptor stability as well as gene activation (Webster et al., 1997; Wang et al., 2002b;
Zhou and Cidlowski, 2005). Moreover, kinases such as Mitogen protein kinase (MAPK), cyclin-dependent kinase CDK, glycogen synthase kinase-3 (GSK-3) and c-Jun N- terminal kinase (JNK) have distinct specificities for potential phosphoryaltion residues and could be reversed by phosphatases such as PP1, PP2a and PP5 (Krstic et al., 1997;
Bodwell et al., 1998).
29 GR Ubiquitination: the ubiquitin-proteasomal degredation pathway can also regulate GR
signaling pathway. The Covalent attachment of ubiqiutin to mouse GR and it is role in
GR destabilization and degradation by proteasome has been reported (Wallace and
Cidlowski, 2001). Interestingly, the consensus binding site for ubiquitin PEST (Pro, Glu,
Ser, an Thr) is located at Ser 412, the same target site for GR phosphorylation (Rogers et al., 1986; Rechsteiner and Rogers, 1996; Kinyamu et al., 2005) suggesting that phosphorylation of GR is prerequisite for its proteasomal-degradation. Further investigations showed that, mutation of the entire phosphorylation target sites in GR increased the receptor half-life and abolished GR down regulation. Conversely, treating the cells with GR antagonist RU486 has no effect on the phosphorylation status of GR but the protein down-regulation is maintained. These conflicting findings suggest that, phosphorylation of GR is important but other pathways may exist to target GR for degradation and highlight the need for further investigation on GR degradation mediated by ubiquitin-proteasomal pathway.
SUMOylation, addition of small ubiquitin related modifier (SUMO-1) a 98 amino acid
protein to GR can also regulate its function in both ligand dependent and independent
manner (Jin et al., 2001; Le Drean et al., 2002). Three consensus-binding sites for
SUMO-1 attachment on GR were identified. K277 and K293 are located within the N-
terminal domain while the third one K703 is located within the ligand-binding domain of
GR. Unlike ubiquitinylation, sumoylation regulate protein stability, receptor localization
and the activity of transcriptional regulators rather than directing the receptor to
proteasomal degradation. The mechanism by which sumoylation regulates gene
30 transcription activity of GR have been shown to be dependent on the cell type, promoter context and the state of the environment such as stress (Le Drean et al., 2002).
Despite the putative acetylation motif (KXKK/RXKK) where X any amino acid within
GR has been identified (amino acids 492-495), there is no evidence that GR is directly
regulated by acetylation (Kovacs et al., 2005; Murphy et al., 2005). Conversely, The GR
acetylation is an indirect effect of the hsp90 interaction with histone deacetylase 6
(HDAC6). Knocking down HDAC6 or treating the cells with HDAC inhibitor such as
trichostatin (TSA) lead to hyper-acetylation of the hsp90, disrupt hsp90 interaction with
GR and impairment of ligand binding, nuclear localization and gene trans-activation
(Kovacs et al., 2005; Murphy et al., 2005).
Methylation of GR interacting proteins but not GR play an important role in GR
transcriptional activity (Wang et al., 2004b). It has been found that, methylation of p300
leads to disrupt the interaction of p300 /GRIP1 a GR co-activator complex and modulate
GR signaling pathway (Wang et al., 2004b; Lee et al., 2005).
Progesterone Receptor (PR):
Progesterone receptor is a member of class I nuclear receptors that regulates distinct biological processes in a broad range of tissues and plays an important role in development and reproduction in female (Conneely and Lydon, 2000; Conneely et al.,
2000; Graham and Clarke, 2002). Two isoforms of progesterone receptors have been isolated and well characterized PR-A (94kD) and PR-B (120kD) (Figure-4). The expression of PR isoforms is highly regulated in a tissue specific manner (Graham et al.,
1996; Giangrande and McDonnell, 1999). PR isoforms are generated from a single gene
31 in both rodent and human (Kastner et al., 1990; Kraus et al., 1993). Structurally, PR-A is a truncated form of PR-B, lacking 164 N-terminal amino acids resulted from the presence of two alternative promoters and distinct translation initiation start codons (AUG)
(Kastner et al., 1990; Li and O'Malley, 2003) (Figure-4). PR-A and PR-B have multiple activation function domains (AF) that enhance PR transcriptional activity and an active inhibitory domain within PR-A (a.a 165-305) that represses its transcriptional activity through direct association with certain co-repressors complex (Figure-4) (McKenna and
O'Malley, 2001; McKenna and O'Malley, 2002b). In addition, both isoforms have receptor specific effects on regulation of progesterone responsive genes.
A 60-kDa N-terminally truncated progesterone isoform PR-C was identified in certain tissues and its expression is primarily restricted to the cytosolic fraction (Wei et al.,
1990; Wei et al., 1996; Wei et al., 1997). PR-C contains sequences for hormone binding, dimerization as well as nuclear localization, but lacks the first zinc finger of the DNA binding domain (Figure 4). The exact function of PR-C still unknown but few reports indicated that PR-C function is highly cell and tissue specific. PR-C could interact with
PRB to enhance PR-B transcriptional activity in T47D cell line (Wei et al., 1990; Wei et al., 1996; Wei et al., 1997). In contrast, PR-C expression in uterus has inhibitory effect on
PR-B transactivation leading to a loss of uterine quiescence and the onset of labor
(Condon et al., 2006). The expression of PRC and it is function in mammary gland normal physiology and in breast cancer development still unclear and need to be investigated.
32
Figure (4): Progesterone receptors isofoms structure (Li and O'Malley, 2003)
33
Physiology of progesterone receptor:
The primary target of progesterone biological action is the female reproductive tract. In
normal reproductive tissue, the expression of hPR in mammary glands is induced by
estrogen and reduced by progestins (Janne et al., 1975; Thi et al., 1975; Alexander et al.,
1989; Clarke, 1990; Savouret et al., 1994). Moreover, progesterone can either stimulate
or inhibit proliferation and induce differentiation depending on the cell or tissue context.
The PR knock-out mice model suggest that PR-A and PR-B function as distinct
transcription factors. PR-A is the key for ovarian and uterine development while PR-B is
necessary for mammary gland development. Mice lacking PR-A have normal mammary
gland and thymus development but sever defect in uterine development and ovarian
abnormalities (Mulac-Jericevic et al., 2000; Mulac-Jericevic et al., 2003). On the other
hand, PR-B knock out mice model showed that the ovaries and the uterus in these mice
were able to response to progesterone action through PR-A, but the mice suffer from a
major defect in mammary gland morphogenesis (Conneely et al., 2002). As a result, PR-
A is necessary to elicit progesterone dependent reproduction response while PR-B is
required for progesterone proliferative action in mammary glands. In addition, PR-B
over-expression leads to premature ductal growth arrest and insufficient lobuloalveolar
differentiation (Shyamala et al., 2002).
The ratio of PR-A to PR-B expression is also important and critical in controlling the
physiological direction of PR response to its ligands. Transgenic mice that have 3:1 (PR-
A/PR-B) develop all features associated with neoplasia including epithelial hyperplasia;
34 excessive ductal branching and errors in basement membrane organization (Mulac-
Jericevic et al., 2000; Mulac-Jericevic et al., 2003). Mice models lacking both PR
isoforms showed sever pleiotropic female reproductive abnormalities, including impaired
neuroendocrine and ovary function, uterine hyperplasia and inflammation, sever defects
of mammary glands as well as impaired thymic function and sexual behavior (Lydon et
al., 1995; Chappell et al., 1997).
Mechanism of gene regulation by progesterone receptor:
Like any other steroid receptor. In the absence of ligand the newly synthesized PR
mainly resides in the cytoplasm as an inactive protein by association with immunophillin
and chaperone molecules including hsp90, hsp70, hsp40. Upon ligand binding chaperone molecules dissociate from the complex, activate receptor nuclear localization and forming either homo or heterodimers with three possible classes A:A, A:B, B:B
(Conneely and Lydon, 2000). PR dimerization allows the receptor to bind to it is specific
progesterone response elements (PRE) within its promoter target genes and mediates the
recruitment of specific co-regulators and other general transcription factors to start gene activation (Moore et al., 1997).
It is well known that whenever PR-A is transcriptionally inactive it acts as an inhibitor
of PR-B gene activation under the effect of both progesterone agonists and antagonists
.The inhibitory effect is related to the presence of an active inhibitory domain (ID) within
the N-terminal region of PR-A. in addition, Human PR-A but not PR-B is able to inhibit glucocorticoid, androgen, and mineralcorticoid receptor mediated gene transcription
(Vegeto et al., 1993; McDonnell et al., 1994; Giangrande and McDonnell, 1999;
35 Conneely and Lydon, 2000; Giangrande et al., 2000). In general, on the classical PRE
driven genes PR-B is much stronger activator than PR-A. The stronger activation
property has been aimed at the presence of a third activation (AF-3) domain in the first
extra 164 amino acids of the PR-B N-terminal domain that counteract the inhibitory
domain. However, PR-A could be a strong activator, but this action is cell specific and
highly dependent on target gene context (Giangrande and McDonnell, 1999; Giangrande
et al., 2000; Rosenfeld and Glass, 2001). In fact, analysis the mechanism by which the
progesterone receptor agonist or antagonist actions occur on each PR isoform target
genes has provided insight into how the cell recognizes and responds to PR ligands.
PR can regulate target promoters including the natural promoters for the p21, p27,
glycodelin, and thymidine kinase (TK) genes in the absence of a functional classical
response element [progesterone response element (PRE)/glucocorticoid response element
(GRE)] through G/C-rich (Sp1 binding) elements (Thomson et al., 1990; Tung et al.,
1993; Owen et al., 1998; Gao et al., 2001; Gizard et al., 2005). Some observations
appeared to suggest that this regulation occurs by direct association of PR with DNA-
bound Sp1 (Owen et al., 1998; Gizard et al., 2005). Additional support for this suggestion
is derived from the well-established role of Sp proteins in mediating promoter activation
by the estrogen receptor (ER) by a nonclassical mechanism; it has been demonstrated that
ER is recruited by Sp1, Sp3, or Sp4 in the absence of classical estrogen response elements
to exert its genotropic effects in a variety of gene promoters in the phyisiologic context
(Safe and Kim, 2004; Stoner et al., 2004; Higgins et al., 2006). Moreover, PR has been found to interact with NF-κβ, STAT5 and C/EBPβ transcription factors and regulates gene expression (Bamberger et al., 1996; Kalkhoven et al., 1996; Edwards et al., 2000;
36 Christian et al., 2002). Interaction of PR with NF-κB is believed to be responsible for
immunosuppressive action of progesterone during pregnancy. While, interaction of PR
with AP-1, C/EBPβ and STAT5 has been found related to the proliferative and
differentiation actions of progesterone in mammary gland and uterus. In addition, trans- activation by PR independent of a PRE is of particular interest because this may underlie
the agonistic activity of RU486 on promoter activation by PR-B and the importance of this mechanism in profiling RU486 biological activity (Tung et al., 1993).
Besides the genomic gene action of PR, In vitro studies using the yeast two hybrid and
GST pull down assays showed that PR-A and PR-B contain Src/SH3 interaction motif
within their N-terminal domains (Boonyaratanakornkit et al., 2001). The presence of this interaction motif mediates a non genomic action of PR and stimulates Src/Ras-
Raf/MEK/MAPK downstream signaling pathway which regulates several cellular processes including cell proliferation and differentiation (Boonyaratanakornkit et al.,
2001).
Post-translational modification of PR and their roles in PR action:
The transcriptional activity of PR is mainly governed by ligand binding. Recently more
studies showed that post-translational modification also play additional part in PR
activity. The presence of extra six phosphorylation sites in the N-terminal domain of PR-
B compared to the truncated form PR-A suggesting a differential regulation of the PR
activity isoforms by kinases such as MAPK, CDK2 and casein kinase II (Lange et al.,
2000; Qiu and Lange, 2003; Lange, 2004). Phosphorylation of PR can increase or
decrease its transcriptional activity and this action is highly dependent on the
37 phosphorylation site. Phosphorylation of S294 was found to be important for receptor
cross talk with other growth factors, subcellular localization as well as receptor
degradation (Lange, 2004). In contrast, S400 phosphorylation by CDK2 lead to receptor stabilization (Shen et al., 2001). Despite the existence of a conserved KXKK at position
638-641 amino acids within the hinge region, progesterone receptor regulation by acetylaion has not yet been confirmed. Parallel to this, in pull-down assay TAF-Iβ and
p32 which are involved in de-acetylation process, were found to be associated with PR
(Loven et al., 2003; Loven et al., 2004). The PR is also a target for ubiquitin/proteasomal
degradation pathway in ligand dependent manner (Lange et al., 2000; Qiu and Lange,
2003). Ubiquitylation of the PR was also found to be dependent on phosphorylation of
S298. Point mutation of S298 showed that the receptor did not degrade by the
proteasomal pathway following progesterone treatment (Imhof and McDonnell, 1996;
Verma et al., 2004). PR SUMOylation is another post-translational modification that
takes place on PR and affects its activity. The site of PR sumoylation has been found
located in the N-terminal moiety at position K388. Mutation of this site resulted in
blocking of auto-inhibition in both PR isoforms (Abdel-Hafiz et al., 2002; Chauchereau
et al., 2003; Takimoto et al., 2003; Jones et al., 2006).
Progesterone Receptor Agonists, antagonists and selective modulators (SPRMs):
Three groups of ligands can modulate progesterone receptor activity and have wide therapeutic applications in female health care (Cadepond et al., 1997; Mahajan and
London, 1997; Spitz and Chwalisz, 2000; Schindler et al., 2003; Spitz, 2006). (I) Pure
38 agonist that binds to PR and enhances its transcriptional activity such as progesterone,
R5020, and cyproterone, (II) Pure antagonist that fully abrogate PR function like
onapristone (ZK98299) and (III) Compounds that bind to PR with different affinity and
have mixed agonist and antagonist activity on PR action including mifepristone (RU486)
and J-867. The third group is well known as selective progesterone receptor modulators
(SPRMs) and it is action is cell and promoter specific. PR action is predominantly
mediated by ligand binding leading to sequential events that direct its transcriptional
action. Interestingly, early observations from in vitro studies showed that in PR positive
cell line T47D cultured in stripped serum condition, both PR agonist (progesterone) and
PR antagonist (RU486) were able to induce cell proliferation suggesting that RU486
could have agonist activity (Bowden et al., 1989; Hissom et al., 1989; Moore et al., 1991;
Sartorius et al., 1993). Agonists and antagonists of PR produce profound physiological effects, principally by altering global gene expression profiles in the target tissues. The altered gene expression profiles presumably not only reflect changes in the activities of
the direct target genes of PR but also a host of downstream genes whose expression is altered as a consequence of the changes in expression of the direct PR target genes. The physiologic relevance of this indirect gene regulation by PR is clearly exemplified in both phases of the reported (Groshong et al., 1997) biphasic response of breast cancer cells to progesterone in which there is first a stimulation of the cell cycle accompanied by an induction of TK1 followed by a delayed induction of p21 and p27 associated with G1 phase arrest.
SPRMs do not affect homodimeriztion of PR or its binding to its cognate response
element in the target gene (DeMarzo et al., 1991; Skafar, 1993) but produce
39 conformational changes in the AF-2 region of PR to block the association of co-activators
and promote co-repressor recruitment [reviewed in (Edwards et al., 2000; Glass and
Rosenfeld, 2000; Leo and Chen, 2000)]. The A and B subtypes of PR respond differently
to RU486, which binds to PR-B to function as a partial agonist under certain conditions;
in contrast, RU486 can only act as an antagonist of PR-A (Meyer et al., 1990; Tung et al.,
1993). The molecular mechanism of RU486 partial agonistic activity through PR-B is not
fully understood. However, it has been proposed that the agonistic activity of RU486 is
highly dependent on the presence of an intact AF-1 region in PR-B receptor (Meyer et al.,
1990) as well as the N-terminal domain (Wardell et al., 2002) that may required for
recruitment of unknown co-activators. In addition, treating cells with the protein kinase A
(PKA) activator 8-bromo-cAMP converted RU486 from an antagonist into full agonist
suggesting that either the receptor or its coregulators are phosphorylated leading to a
loss of PR association with co-repressors NCoR and SMRT (Beck et al., 1993; Sartorius
et al., 1993; Kahmann et al., 1998; Wagner et al., 1998). The ratio of co-activator to co-
repressor in the cell was also found to influence the partial-agonistic activity of RU486
(Liu et al., 2002).
Sp/KLF family and there role in regulating gene transcription:
Sp/Krupple-like factor proteins are considered the largest transcription factor family that
regulates mammalian and viral gene transcription. Specificity protein 1 (Sp1) was
originally identified as a transcription factor that binds to the GC-box in the simian virus
(SV40) and thymidine kinase (TK) promoters and activate their gene transcription
40 (Dynan and Tjian, 1983; Jones et al., 1985; Dynan et al., 1986). Sp1 protein was the first
Sp/KLF family member to be cloned and characterized from HeLa cells by Kadogana and coworkers (Kadonaga et al., 1987). By 2005, twenty-five members of the Sp/KLF family had been identified in the mammalian genome. These were designated as Sp1-
Sp9, KLF1-KLF16 and categorized by their similar modular structures (Figure-6) (Lania et al., 1997; Philipsen and Suske, 1999; Suske, 1999; Bouwman and Philipsen, 2002;
Safe and Kim, 2004). Based on their crystal structures, all Sp/KLF family members bind to GC (GGGGCGGGG) and GT (GGTGTGGGG) rich promoter regions through a single unit consisting of three zinc finger motifs. Without exception, the three-zinc finger unit consists of 81 amino acids and is located at the C-terminal domain of the Sp/KLF protein
(Kadonaga et al., 1988; Bucher, 1990; Pavletich and Pabo, 1991; Narayan et al., 1997).
In addition, the Sp1-Sp4 subgroup contains several distinct overlapping regions that all contain glutamine (Q-rich) N-terminal activation domains (AD), serine/threonine rich central domain and C-terminal DNA binding domain (DBD) with three-zinc finger motif as mentioned before required for sequence-specific DNA binding. Additionally, Sp3 contains an inhibitory domain (ID) that is involved in its gene suppression activity in cell and promoter specific manner (De Luca et al., 1996; Majello et al., 1997). The remaining members of the Sp/KLF family are generally lower in molecular weight compared to
Sp1-Sp4 subgroup and lack the Q-rich activation domain. Sp1, Sp3, and Sp4 bind to the classical Sp1-binding elements (GC or GT boxes) with identical affinity (Hagen et al.,
1992; Hagen et al., 1995; Majello et al., 1997). On the other hand, Sp2 protein binds only to GT but not to GC rich elements in the T-cell receptor gene (Kingsley and Winoto,
1992). The role of Sp proteins in gene regulation has been extensively investigated. The
41 function of each individual Sp/KLF protein is highly dependent on tissue specificity, promoter, and cellular context. The specific physiological functions of Sp proteins have not yet been determined, but the knockout phenotypes of some Sp/KLF genes have shown critical and distinct cellular functions. Sp1 knockout mouse models demonstrate embryological growth retardation and die within the first 11 days of gestation. Sp4 knockout mice die shortly after birth due to similar developmental deficits (Supp et al.,
1996; Marin et al., 1997; Gollner et al., 2001). The Sp7 knockout phenotype exhibited blocked bone formation. The Sp3 knockout phenotype demonstrated impaired ossification, growth retardation, and late tooth formation that resulted in death after birth
(Bouwman et al., 2000; Gollner et al., 2001; Nakashima et al., 2002; Van Loo et al.,
2003). Conversely, the Sp5 knockout mouse model did not show abnormal phenotype
(Harrison et al., 2000). Sp/KLF family members differ in their ability to activate or repress gene transcription. It has also been shown that in certain cell types, disease states, and physiological conditions, the co-expressed Sp proteins compete for binding sites leading to activation or repression of gene transcription (Apt et al., 1996; Discher et al.,
1998; Hata et al., 1998).
42
Figure (6): the shared structure of Sp/KLF family (Suske et al., 2005)
43 Sp/KLF family transcriptional activity was also found to be regulated by phosphorylation, acetylation and glycosylation (Jackson et al., 1990; Roos et al., 1997;
Black et al., 1999; Braun et al., 2001; Ammanamanchi et al., 2003; Huang et al., 2005).
The phosphorylation of Sp1 by various kinases has been reported to be important for activation of some Sp1 dependent genes. Several studies reveal that, phosphorylation of
Sp1 by phosphoinosital kinase (PI3-k), mitogen-activated protein kinase (MAPK), protein kinase A (PKA) or protein kinase C (PKC) leads to an increase in Sp1 binding affinity to GC-rich regions and enhances its transcriptional activity on several genes such as VEGF and p27 (Fojas de Borja et al., 2001; Haidweger et al., 2001; Onishi et al.,
2001; Rafty and Khachigian, 2001; Milanini-Mongiat et al., 2002; Lee et al., 2003;
Banchio et al., 2004; Pore et al., 2004). Conversely, during differentiation and regeneration of liver cells, phosphorylation of Sp1 by Casein kinase II (CKII) decreases
Sp1 binding affinity for DNA and reduces target gene expression including the gene for
CKII. This results in a mechanism for CKII autoregulation (Leggett et al., 1995;
Armstrong et al., 1997). Acetylation of Sp1 and Sp3 was also found to increase trans- activation of their target genes. (Braun et al., 2001; Ammanamanchi et al., 2003; Huang et al., 2005). Sp1 glycosylation with concurrent phosphorylation has been shown to positively or negatively alter Sp1 self-association and Sp1 interaction with basal transcription factors. post-translational modifications also modulates Sp1 degradation in a tissue specific manner (Han and Kudlow, 1997; Roos et al., 1997; Haltiwanger et al.,
1998). Glycosylation is also affected by the limitation of nutrients and growth factors such as glucagon and insulin (Keembiyehetty et al., 2002). Growth of cells in glucose
44 free medium decreases Sp1 gene activation by increasing proteasomal degradation (Han
and Kudlow, 1997; Su et al., 1999).
The presence of an activation domain within Sp1-Sp4 proteins implies that transcriptional
activation involves interaction of this domain with other nuclear co-regulatory factors.
TATA –binding proteins (TBP) and TATA –binding protein associated factors (TAFs)
include TFIID, dTAF110, hTAF130, TAFII55, and TAFII250 have been found to
associate directly with trans-activation domains of Sp1 leading to gene trans-activation
(Pugh and Tjian, 1990; Smale et al., 1990; Emili et al., 1994; Gill et al., 1994; Emami et
al., 1998; Saluja et al., 1998; Rojo-Niersbach et al., 1999).
Sp1 gene trans-activation is also related to a multiple protein nuclear complex designated
as Cofactors Required for Sp1 co-activation (CRSP) (Ryu and Tjian, 1999; Ryu et al.,
1999; Naar et al., 2002; Taatjes et al., 2002). The 700 kD isolated CRSP complex contains at least nine proteins required for Sp1 transcription, including CRSP150,
CRSP200, CRSP130, CRSP100, CRSP85, CRSP77, CRSP70, CRSP34 and CRSP30.
The Sp/KLF family regulates basal/constitutive expression of genes involved in cell
proliferation, DNA synthesis, and nucleotide metabolism in both normal and cancerous
tissue (Lin et al., 1996). The primary mechanism of gene regulation by Sp/KLF proteins
involves initial DNA-dependent binding to GC rich sequences within the promoter of
target genes. DNA-independent gene regulation by Sp/KLF through protein-protein
interaction has also been reported. More than fifty co-regulators, which interact directly
with the C-terminal domain of Sp proteins enhancing or decreasing Sp/KLF gene
expression, have been identified. These include c-myc, Ah receptor, NF-YA, VHL tumor
suppressor, promyelocytic leukemia protein (PML), helix like transcription facto (HTLF),
45 p50, p52, p53, Ap-2, hepatocyte nuclear factor 3 (HNF3), HNF4, myocyte enhancer factor (mef2c), VHL, cyclin A, Rb, ZBP-89 NFAT-1, NFAT-2, TGFβ, SMAD1, SMAD-
2, SMAD-3, SMAD-4, GATA-1, GATA-2, GATA-3, GATA-4, NF-YA, MyOD,
HDAC1, PML, MDM2, MsX1, HTLF, E2F1, YY1, c-jun, NFAT-1, BRCA1, TGFβ and others were [reviewed in (Safe and Kim, 2004)].
In addition, nuclear receptors such as estrogen receptor(ER), progesterone receptor (PR), androgen receptor (AR), retinoic acid receptor (RAR), thyroid receptor (TR), vitamin D receptor (VDR), peroxisome proliferator-activated receptor gamma (PPARγ) and certain orphan receptors have also been shown to interact directly with Sp1 protein and modulate gene transcription [reviewed in (Safe and Kim, 2004)]. The biphasic action of progesterone in breast cancer cell line T47D (i.e growth stimulation followed by inhibition) has been found due to stimulation of the cell cycle activator genes such as c- myc in the first phase followed by p21 and p27 induction in the later phase. The co- immunoprecipitation result showed that the induction of p21 and p27 is due to progesterone receptor direct association with the GC elements within these gene promoters in a ligand dependent manner (Owen et al., 1998; Gizard et al., 2005).
General mechanism by which co-regulators control transcriptional activity of NRs:
In normal tissues, co-regulators play a central role in regulation of transcriptional activity by NRs (Rosenfeld and Glass, 2001). NRs Co-regulators have also been found over expressed and amplified in certain tumors including breast, colon, and lung cancer and underscore their roles in cancer therapy. Since the first co-regulator SRC1 was cloned, at least, 200 co-regulators have been identified and cloned within a short period of time
46 (McKenna et al., 1998; McKenna et al., 1999a; McKenna et al., 1999b; McKenna and
O'Malley, 2000; McKenna and O'Malley, 2001; Hermanson et al., 2002; McKenna and
O'Malley, 2002b; McKenna and O'Malley, 2002a). NRs co-regulators are divided into
two groups, co-activator such as steroid receptor co-activator (SRC)/P160 family,
DRIPs, PGC-1 and TRAP and co-repressor including SMRT and NCoR. The ability of
co-regulators to associate with nuclear receptors in a ligand dependent manner and their
role in modulation of NRs transcriptional activity was initially described by O’Malley
and Brown groups (Halachmi et al., 1994; Baniahmad et al., 1995; O'Malley, 2006;
Lonard and O'Malley B, 2007). In this mechanism, the NRs box motifs LXXLL motif,
which is found within many co-regulators (where X any amino acid), can be recruited to
the NRs AF-2 region that is located within NRs C-terminal domain (LBD) only in the
presence of the ligand (Heery et al., 1997; McInerney et al., 1998; Heery et al., 2001;
Coulthard et al., 2003). However, co-regulators are able to interact with NRs in ligand independent manner by interaction with AF-1 region within the N-terminal domain of the
NRs and modulate gene transcription. Co-regulators are able to control the transcriptional activity of NRs by five different mechanisms: (I) Acetylation of histones and transcription factors (Sterner and Berger, 2000), (II) Methylation of histones and transcription factors (Zhang and Reinberg, 2001), (III) Direct interaction with the basal transcription machinery to modulate recruitment of RNA-polymerase II, (IV) Platform or scaffolding function to recruit histone modifying enzymes, (V) ubiquitination and proteolytic activity (Zhang et al., 1998; Lonard et al., 2000). In addition, phosphorylation of the nuclear receptor or the associated co-regulators by extracellular signaling pathways
47 such as MAPK is also crucial for NRs transcriptional activity (Bai et al., 1994; Lannigan,
2003).
HDAC inhibitor and their role in cancer therapy:
DNA is acidic and negatively charged. Association of positively charged (basic) histone
proteins (H2A, H2B, H3 and H4) with negatively charged DNA maintains the DNA electrically neutral and compact (Luger et al., 1997a; Luger et al., 1997b). Acetylation of histones by histone acetyl transferase (HAT) and deacetylation by histone deacetylase
(HDAC) enzymes have been subjected to extensive studies. In this mechanism, the co- regulators with HAT activity such as CBP/p300, CREB-binding protein,TAF250 and
SRC/p160 family are recruited to the transcriptional machinery in a ligand dependent manner, resulting in hyper-acetylation and neutralization of the lysine residues of histones, releasing the tightly wound DNA, facilitating the access of the transcriptional
machinery and other accessory proteins to DNA and leading to activate gene transcription
(Figure-7) (Davie and Spencer, 1999; Kouzarides, 1999; Sterner and Berger, 2000; Strahl
and Allis, 2000). Conversely, co-regulators that are associated with HDAC activity are
recruited in both a ligand dependent and independent manner leading to hypo-acetylation
of histones and increase the winding of DNA, resulting in a dense chromatin structure
and gene trans-repression by reducing the access of transcription factors (Figure-7). In
mammals, 18 HDACs have been identified and classified into three major classes
according to their homology with yeast proteins (Taunton et al., 1996; Marks et al.,
2003). Class I HDACs includes HDAC1, 2, 3 and 8, have been found to share certain
homology to the yeast Rpd3 protein. Without exception, the expression of class I
48 members have been found to be ubiquitous in many cell lines and tissues and generally
localized in the nucleus (Dangond et al., 2001; Gray and Ekstrom, 2001). Class II
HDACs including HDAC4, 5, 6, 7, 9 and 10 were found to be homologous to yeast Hda1
and can shuttle between the nucleus and the cytoplasm (Verdin et al., 2003). In addition,
class II were found to regulate the acetylation status of non histone proteins such as α-
tubulin, p53 and Hsp90 (Hubbert et al., 2002; Matsuyama et al., 2002; Zhang et al., 2003;
Kovacs et al., 2005). Class III HDAC or siruntins (SIRT1-7) are homologous to yeast
Sir2 family (Blander and Guarente, 2004). Deacetylation by Both class I and class II require zinc for their catalytic activity while class III is NAD+ dependent (Imai et al.,
2000a; Imai et al., 2000b; Tanner et al., 2000). Unlike class I and class III, class II
members have been found lager in size (120-135 kD). Many evidences indicate that
hypo-acetylation of histones induces repression of tumor suppressor genes expression
(figure 7). Thus, restraining HDAC de-acetylation activity by using HDAC inhibitors
may enhance hyper-acetylation of histones, promote the tumor suppressor gene
expression, and exert their effect on tumor curing (Figure-7) (Marks et al., 2001; Marks
et al., 2004). HDAC inhibitors with negligible toxicity showed significant activity and
promising results against a wide spectrum of hematological and solid tumors both in
culture and animal models as well as in clinical trials (Jung, 2001; Marks et al., 2000;
Marks et al., 2001). In addition, HDAC inhibitors either isolated from natural sources or
from synthetic products have been divided into six groups depending on their molecular
structures (Hess-Stumpp, 2005). each of which has different affinity and specificity for
each HDAC class (Phiel et al., 2001). HDAC inhibitors are polar and bind to the zinc ion
of HDAC catalytic pocket and blocking the substrate interaction (Finnin et al., 1999).
49 Moreover, Hydroxamic derived compound including trichostatin (TSA) and SAHA, short chain fatty acids such as valproic acid (VPA) have been reported to induce growth arrest, inhibition of cell differentiation and apoptosis in vitro and in clinical trial phase I and phase II (Liu et al., 2006). The induction of p21 protein expression, down-regulation of anti apoptotic Bcl2 protein, up-regulation of pro-apoptotic Bax proteins and induction of caspase 3 and caspase 9 are the common charctesrtics of HDAC inhibitors actions in cancer cells line (Strait et al., 2002; Archer et al., 2005; Peltonen et al., 2005; Imre et al.,
2006).
50
Figuer (7): molecular mechanism of HDAC inhibitors as anticancer agnets (Bi and Jiang, 2006)
51
Manuscript One:
Enhancement of Folate Receptor α Expression in Tumor Cells Through the Glucocorticoid Receptor: A Promising Means to Improved Tumor Detection and Targeting@*
Thuyet Tran°, Aymen Shatnawi°, Xuan Zheng°, Karen M.M.Kelley and Manohar Ratnam#
Department of Biochemistry and Cancer Biology Medical College of Ohio 3035 Arlington Avenue Toledo, OH 43614
@ The findings in this report are covered by pending patents.
* Supported in part by NIH grants CA 80183 and CA 103964 (to M.R.). T.T was supported by NIH Institutional Pre-Doctoral NRSA grant CA 79450.
° Equal contributors
# To whom correspondence may be addressed. E-mail [email protected]
Published in: Cancer Research. 2005 May 15; 65(10):4431-41.
52 ABSTRACT
The utility of the folate receptor (FR) type α, in a broad range of targeted therapies and as a diagnostic serum marker in cancer, is confounded by its variable tumor expression levels. FR-α, its mRNA and its promoter activity were coordinately up-regulated by the glucocorticoid receptor (GR) agonist, dexamethasone (Dex). Optimal promoter activation occurred at < 50 nM Dex, was inhibited by the GR antagonist, RU486, and was enhanced by co-activators, supporting GR mediation of the Dex effect. The Dex response of the
FR-α promoter progressed even after Dex was withdrawn but this delayed effect required prior de novo protein synthesis indicating an indirect regulation. The Dex effect was mediated by the G/C-rich (Sp1 binding) element in the core P4 promoter and was optimal in the proper initiator context without associated changes in the complement of major Sp family proteins. Histone deacetylase (HDAC) inhibitors potentiated Dex induction of FR-
α independent of changes in GR levels. Dex/HDAC inhibitor treatment, did not cause de novo FR-α expression in a variety of receptor-negative cells. In a murine HeLa cell tumor xenograft model, Dex treatment increased both tumor associated and serum FR-α. The results support the concept of increasing FR-α expression selectively in the receptor- positive tumors by brief treatment with a non-toxic dose of a GR agonist, alone or in combination with a well-tolerated HDAC inhibitor, to increase the efficacy of various
FR-α-dependent therapeutic and diagnostic applications. They also offer a new paradigm for cancer diagnosis and combination therapy that includes altering a marker or a target protein expression using general transcription modulators.
53 INTRODUCTION
In recent years, the glycosyl-phosphatidylinositol (GPI)-anchored folate receptor (FR) type α has served as a model target for tumor specific delivery of a broad range of pharmacological and immunological experimental therapies, for the following reasons:
(i) FR-α is expressed in several cancers such as non-mucinous adenocarcinomas of the ovary and uterus, malignant pleural mesothelioma, testicular choriocarcinoma, ependymal brain tumors, non-functioning pituitary adenoma and variably in breast, colon and renal carcinoma [reviewed in (Elnakat and Ratnam, 2004)]; (ii) FR-α expression in proliferating normal tissues [reviewed in (Elnakat and Ratnam, 2004)] is restricted to the luminal surface of certain epithelial cells where it is inaccessible to the circulation whereas the receptor expressed in tumors is accessible via the circulation; FR-α-targeted low molecular weight agents that may filter through the glomerulus and bind to the receptor in proximal kidney tubules appear to be transcytosed and reabsorbed, avoiding nephrotoxicity (Gibbs et al., 2005); (iii) other FR isoforms are either expressed in a non- functional manner in mature hematopoietic cells (FR-β) (Ross et al., 1999; Pan et al.,
2002) or poorly expressed and constitutively secreted (FR-γ/γ′) (Shen et al., 1994; Shen et al., 1995) and (iv) FR-α quantitatively recycles between the cell surface and intracellular compartments [reviewed in (Kamen and Smith, 2004)], effectively internalizing receptor- bound folate/antifolate compounds and folate conjugates (Lu and Low, 2002; Theti et al.,
2003). Various FR-α-targeted therapeutics [reviewed in (Leamon and Low, 2001;
Ratnam et al., 2003; Gabizon et al., 2004; Jackman et al., 2004; Leamon and Reddy,
2004; Lu et al., 2004; Roy et al., 2004; Zhao and Lee, 2004)] and imaging agents
54 [reviewed in (Ke et al., 2004)] have shown promise in pre-clinical models and in early clinical trials. These agents include radiopharmaceutical and cytotoxic conjugates of folate including prodrugs, prodrug activating enzymes, nanoparticles and liposomal drugs
as well as potent novel antifolates that are dependent on FR-α for cellular uptake. The
FR-α-targeted immunological therapies include bifunctional antibodies and antibody- interleukin chimeras, peptide and DNA vaccines and more innovative agents such as dual specific T cells and folate-hapten conjugates. A portion of the FR-α expressed on the cell surface is released in a soluble form by the combined action of a membrane-associated protease and GPI-specific phospholipase (Antony et al., 1989; Luhrs and Slomiany, 1989;
Elwood et al., 1991; Mantovani et al., 1994; Yang et al., 1996). Soluble FR-α is low or undetected in normal human sera and therefore, the protein shed into the circulation is a potential serum marker for FR-α-positive tumors (Mantovani et al., 1994).
Even though major subtypes of malignant tissues show consistent patterns of FR-α
expression there is a considerable variability and heterogeneity in tumor expression levels
of the receptor covering a range of almost two orders of magnitude (Toffoli et al., 1997;
Wu et al., 1999). The successful experimental FR-targeted therapies in animal models
have used xenografts of human tumor cells (eg., KB cells) that express the receptor
uniformly and at levels closer to the high end of this range, underscoring the importance
of developing molecular methods of up-regulating the FR gene selectively in malignant
cells. Increased FR-α expression by the tumors may be expected to enhance the efficacy
of the receptor-targeted therapies and whole body imaging and increase the levels of
soluble FR-α for early detection as a diagnostic serum marker.
55
The FR-α gene has 7 exons and 6 introns with multiple transcripts resulting from the use
of alternative promoters as well as alternative splicing involving exons 1-4 (Saikawa et al., 1995; Elwood et al., 1997; Roberts et al., 1997; Kelley et al., 2003). The FR-α gene contains two promoters, named P1 and P4, located upstream of exons 1 and 4, respectively. Transcripts generated by both promoters encode identical proteins, but the
P4 promoter activity appears to be predominant in malignant cells (Kelley et al., 2003) and further, P1 promoter-driven transcripts appear to be translated several-fold less efficiently than the P4 promoter-driven transcript (Roberts et al., 1997). The basal
TATA-less P4 promoter activity is initiated by a cluster of three G/C-rich sequences that are non-canonical Sp1 binding sites, each of which contributes to promoter activity
(Saikawa et al., 1995).
We have previously reported that the FR-α gene is directly and negatively regulated by
the estrogen receptor (Kelley et al., 2003). Here we report that the FR-α gene is indirectly
and positively regulated at the transcriptional (P4 promoter) level by the glucocorticoid
receptor (GR) agonist, dexamethasone (Dex) and that this profound regulation is further
potentiated by inhibiting histone deacetylase (HDAC). The selectivity of this regulation
for FR-α-positive tissues, the innocuous nature of the modulating agents and the
ubiquitous expression of GR present a potential means of greatly improving the
effectiveness of all available FR-α-targeted therapeutic and diagnostic strategies by the
inclusion of GR modulators. The findings also illustrate the potential utility of general
transcription modulators in optimizing the expression of genes encoding marker proteins
56 and drug targets that are selectively expressed in tumor tissues. These considerations provided the impetus for the present study of the nature and mechanism of GR regulation of FR-α in vitro and for examining the effect of GR modulation on tumor and serum levels of the protein in vivo.
57 MATERIALS AND METHODS
Chemicals and Reagents: DMEM, RPMI and penicillin/streptomycin/L-glutamine stock
mix were purchased from Life Technologies Inc. Fetal bovine serum (FBS) was
purchased from Irvine Scientific. FuGENE 6 was purchased from Roche Diagnostics,
luciferase assay reagents from Promega, dexamethasone (Dex) from Sigma, Dex and
placebo pellets from Innovative Research of America (Sarasota FL), Trichostatin A
(TSA), valproic acid (VPA) and cycloheximide (CHX) from Sigma. Affinity-purified rabbit anti-human Sp1, anti-human Sp3, and anti-human Sp4 antibodies and rabbit
polyclonal IgG against GR were purchased from Santa Cruz Biotechnology. Mouse anti-
α tubulin clone B-5-1-2 antibody was from Sigma. Vent DNA polymerase was purchased
from New England Biolabs and custom oligonucleotide primers from Life Technologies,
Inc. The reagents for real time RT-PCR were from Applied Biosystems.
DNA constructs and expression plasmids: Construct design made use of either natural
restriction sites or restriction sites created by the addition of appropriate restriction sites
to upstream and downstream PCR primers. The PCR products were first digested at both
ends with the appropriate restriction enzymes and cloned into the PGL3-basic plasmid
(Promega) or subcloned into the FR-α-promoter construct (-3394 nt to +33 nt, relative to
the transcription initiation site at +1 nt) in the PGL3 basic plasmid. The FRα -3394nt to -
47nt/SV40(GC)6 and the FR-α -3394nt to -32nt/SV40(INR) constructs are described
elsewhere (Kelley et al., 2003). The 5’ deletion constructs of the FR-α promoter, i.e., -
272nt to +33nt, -116nt to +33nt and –49nt to +33nt were all constructed by PCR using
the appropriate primers and subcloned at Mlu1 (upstream) and Xho1 (downstream) sites
58 in the pGL3 basic plasmid. In addition the G/C-rich sequence, -49nt to –35nt within the
FR-α promoter (-49nt to +33nt)-luciferase construct was replaced by a TATA-box
element (5’-AATAATTAA-3’) using PCR. The recombinant plasmids were amplified in
E.coli strain XL1Blue and purified using the Qiagen plasmid kit (Qiagen). The entire cloned DNA sequence was verified by sequencing.
The expression plasmids for hSRC-1, hSRC-2 and hpCAF, the corresponding vector
plasmid pCR 3.1 and the GRE2e1b promoter-luciferase plasmid were provided by Dr.
Brian Rowan (Medical College of Ohio, Ohio). The expression plasmids for Sp1 and Sp3
were provided by Dr. Sumudra Periyasamy (Medical College of Ohio). The expression
plasmid for Sp4 was provided by Dr. Guntram Suske (Institut for Molekularbiologie und
Tumorforschung Philipps-Universitat Marburg).
Cell Culture and Transfection: All of the cell lines were purchased from American
Type Culture Collection (Rockville, MD) except for NB4 and KCL-22 cells, which were
provided by Dr. Philip Koeffler (University of California, Los Angeles) and Ishikawa
cells provided by Dr. Brian Rowan (Medical College of Ohio). Cells growing as
monolayers were grown in 10cm tissue culture plates at 37°C in 5% CO2 in the appropriate cell-culture media supplemented with FBS (10%), 100 U/mL penicillin, 100
µg/mL streptomycin, and 2 mM L-glutamine. Caki-1, HeLa, MG63, MCF-7, JEG, JAR,
Ishikawa, SKOV-3 and SVG cells were routinely cultured in DMEM. NB4, KCL-22,
K562, and KG-1 cells were grown in RPMI-1640. For treatment with various agents
(Dex, VPA and TSA) and for transfection, cells were grown in phenol-red free media supplemented with charcoal-stripped FBS (5% v/v), penicillin (100 units/ml),
59 streptomycin (100 mg/ml), L-glutamine (2mM), insulin (2 µg/ml), and transferrin (40
µg/ml).
Transfections with various constructs were carried out in 6-well plates (Corning) using
FuGENE 6 (Roche Diagnostics), according to the manufacturer’s suggested protocol. The
amount of plasmid DNAs used for the transfections varied as indicated in the appropriate
figure legends. Uniformity in transfection efficiencies was ascertained from
measurements of β-galactosidase activity after co-transfection with an expression plasmid
for this enzyme.
Preparation of cell lysates and luciferase assay: Cells in each well of a 6-well tissue
culture plate were washed once with phosphate buffered saline (PBS) (pH 7.5) (2mM
KH2PO4, 2.7 mM KCl, 10 mM Na2HPO4,137 mM NaCl) and lysed in 400μl of reporter
lysis buffer provided with the luciferase assay system (Promega). The samples were
centrifuged at 12,000xg for 2 min at room temperature. The supernatant was assayed for
luciferase activity in a luminometer (Lumat LB9501; Berthold) using the luciferase
substrate from Promega.
Real-time RT-PCR analysis: Total RNA for real time RT-PCR from various cell lines
was prepared using the Rneasy Mini kit purchased from Qiagen. Real-time RT-PCR was
used to measure endogenous mRNAs for FR-α as well as GAPDH in the same samples.
The reverse transcription step was carried out following standard procedure. Essentially,
200 ng of total RNA was mixed with random hexamer primers (5 x 10-4 optical density
60 units/μl), Rnase inhibitor (1 U/μl), Moloney murine leukemia virus reverse transcriptase
(5 U/μl), and deoxynucleoside triphosphates (1.0 mM each) in reverse transcriptase buffer (50 mM potassium chloride and 10 mM Tris HCl, pH 8.3). The 10-μl reaction mixture was first incubated at 25°C for 10 min, then at 42°C for 15 min, and finally at
99°C for 6.5 min. The subsequent real time PCR step for FR-α was carried out in the presence of 12.5 μl of PCR Mastermix (Applied Biosystems, Branchburg, N.J.), 0.5 μl each of the forward primer (AAGTGCCGAGTGGGAGCT) and reverse primer
(CATTGCACAGAACAGTGGGTG), and 0.5 μl of the Taqman probe (6FAM-
CCTGCCAACCTTTCCATTTCTACTTCCCC-TAMRA). The primers and the Taqman probe for the control GAPDH gene were purchased from Applied Biosystems. The PCR conditions were 2 min at 50°C, then 10 min at 95°C, followed by 40 cycles of 15s each at
95°C and finally 1 min at 60°C. Fluorescence data generated were monitored and recorded by the Gene Amp 5700 sequence detection system (Applied Biosystems). All samples were set up in triplicates and normalized to GAPDH values.
Measurement of cell surface binding of pteroyl lysine-fluorescein (PLF): The fluorescent folate analog, PLF, was kindly provided by Dr. John Hynes. HeLa cells grown in 6-well plates and subjected to appropriate treatments were washed with PBS, detached from the plate by treatment with 2mM EDTA and re-suspended in cold PBS.
The cells were then washed briefly with isotonic acid buffer (10mM sodium acetate buffer, pH 3.5/150 mM NaCl) to remove endogenous bound folate, washed again in PBS and resuspended in PBS containing PLF (10nM) and incubated on ice for 30 minutes with intermittent gentle agitation. The fluorescence on the surface of cells due to PLF binding was measured in an EPICS Elite cytometer (Beckman Coulter). Background
61 fluorescence on the cell surface due to non-specific binding of PLF was determined by
pre-incubating the cells with unlabeled folic acid (1 μM) for 10 minutes before the
addition of PLF.
[3H]Folic acid binding assay for serum FR: 20μL of mouse serum was diluted into
0.5ml of assay buffer (10mM sodium phosphate buffer, pH7.5/150 mM NaCl/1% Triton
X-100) in a 1.5 ml Eppendorf tube. To each assay tube, 2 pmol of [3H]folic acid
(Moraveck) was added and after incubation for 1 h at 37°C, the protein bound [3H]folic acid was measured by a charcoal binding method as described (6). Non-specific binding of [3H]folic acid was determined by carrying out the assay as above but after pre-
incubating the diluted serum in the assay tube for 10 minutes with a 100-fold excess of
unlabeled folic acid (200 pmol).
PI-PLC treatment: HeLa cells grown in 6-well plates and subjected to the appropriate
treatments were treated with PI-PLC (0.1u/ml) by adding the enzyme directly into the
culture medium followed by incubation for 3h at 37°C. The cell lysates, prepared by lysis
in PBS containing 1% Triton X-100 were subjected to western blot analysis.
Preparation of nuclear extracts: HeLa cells subjected to the appropriate treatments
were washed twice with PBS, scraped off the 6-well plates, snap frozen in liquid nitrogen
and stored at -80°C until the next step. Nuclear extracts were prepared as described (28),
except that the cytoplasmic fractions were retained after lysis of cells for subsequent
western blot analysis. The nuclear extracts were desalted using G-25 Sephadex columns
62 (Roche Diagnostics) following the supplier’s protocol. The protein concentrations were
determined by the Bradford assay (BioRad, Hercules, CA).
Western blot analysis: Protein samples (10-20 μg) were resolved by electrophoresis on
8% sodium dodecyl sulfate-polyacrylamide (SDS-PAGE) gels and electrophoretically
transferred to nitrocellulose filters. The blots were probed with the appropriate primary
rabbit antibodies followed by goat anti-rabbit immunoglobulin G (IgG) conjugated to
horseradish peroxidase (HRP) and visualized using the enhanced chemiluminescence
method. The same membrane was then similarly re-probed with a primary mouse anti-α
tubulin antibody and secondary goat-anti-mouse IgG conjugated to HRP and also subjected to Coomassie blue staining to ensure uniform sample loading.
Murine tumor xenograft model: Fox chase out-bred SCID female mice (29-35 day old)
purchased from Charles River Laboratories were maintained under controlled conditions
and fed with folate-free rodent chow ad libidum during the course of the experiments.
After a period of acclimation, the mice were injected with 5 x 106 HeLa cells sub-
cutaneously into the interscapular region. Dex pellets (0.001 mg/pellet for a 21 day
release schedule) or placebo pellets were implanted sub-cutaneously when the tumor
became palpable and grew to a diameter of approximately 0.5 cm. Five days after
implanting the pellets, the mice were euthanized and the blood and tumor tissue
collected. The tumors were snap-frozen in liquid nitrogen and stored at -80°C. The
frozen tumor tissue was ground using mortar and pestle, lysed in PBS containing 1%
Triton X-100 and centrifuged for separation of insoluble cell debris. The supernatant was
used for western blot analysis.
63 RESULTS
Effect of Dex on FR-α expression in HeLa cells: Treatment of HeLa cells with Dex
(100nM) resulted in a progressive increase in the expression of both endogenous FR-α mRNA, measured by real-time PCR and FR-α protein, detected by western blot using an
FR-specific rabbit antiserum (Fig.1A). This induction of FR-α began between 24h and
48h and reached up to 7-fold elevation at 96h (Fig. 1A). In HeLa cells transfected with a full-length (-3394nt to +33nt) FR-α promoter-luciferase reporter construct, Dex caused a dose-dependent increase in the promoter activity, reaching optimal activity between 5nM and 50nM Dex (Fig.1B) and a corresponding Dex dose-dependent increase in endogenous FR-α expression (Fig. 1B). These results provide evidence for positive regulation of FR-α by Dex at the transcriptional level.
The induction of FR-α in HeLa cells by Dex did not reflect a global increase in gene expression since, under these conditions, the expression level of the glyceraldehyde-3- phosphate dehydrogenase (GAPDH) gene (Fig. 1A) as well as tubulin and Sp family proteins (Fig. 1A and Fig. 5B, discussed in a later section) were unaltered. The typical plasma membrane localization and GPI membrane anchor attachment known for FR-α was confirmed for the receptor synthesized de novo following Dex treatment since, as seen by western blot, the Dex-induced FR was quantitatively cleaved from the cell surface upon treatment with phosphatidylinositol-specific phospholipase C (PI-PLC), which is a diagnostic characteristic of proteins with a GPI plasma membrane anchor (Fig.
1C). Further, the Dex-induced FR-α protein retained its ability to bind ligand on the cell
64 surface, evident from an increase in the binding of the fluorescent folate analog, pteroyl
lysine-fluorescein (PLF) on the surface of the treated cells (Fig. 1D). Thus, the
subcellular localization and function of FR-α was unaltered by Dex induction.
GR ligand-specificity of FR-α induction: RU-486, a specific antagonist of GR that
competes with Dex for binding to GR, inhibited the induction of FR-α promoter-
luciferase reporter in transfected HeLa cells in a dose-dependent manner (Fig. 2A). RU-
486 similarly inhibited Dex activation of the control GRE2e1b promoter-luciferase
reporter construct in transfected HeLa cells (Fig. 2B). The GRE2e1b promoter contains a
glucocorticoid response element (GRE) and is a classical target of Dex activation through
GR. Under similar conditions, the dose response of inhibition of the FR-α promoter
activity by RU-486 paralleled that for the GRE2e1b promoter, suggesting that the
regulation of the FR-α promoter by Dex is, at some level, mediated by GR.
Response time and reversibility of Dex induction of the FR-α promoter: HeLa cells
were transiently transfected with either GRE2e1b promoter-luciferase or FR-α promoter- luciferase and treatment of the cells with either Dex or vehicle begun at 12h post-
transfection (Fig. 3). In the transiently transfected cells, close to maximal activation of
the GRE2e1b promoter-luciferase by Dex occurred at 3h, reached the maximum value at
6h and declined between 24h and 48h (Fig. 3A). In contrast, Dex activation of transiently
transfected FR-α promoter-luciferase was relatively low at 3h and progressed gradually,
reaching its maximum value at 24h and was sustained up to 48h (Fig. 3B). Further, when
Dex was withdrawn at 6h, 12h or 24h, the activity of the GRE2e1b promoter measured at
65 48h was greatly reduced compared to the values measured at 6h, 12h and 24h, respectively (Fig. 3A). In contrast, after withdrawal of Dex at 6h, 12h or 24h, the activity of the FR-α promoter further increased as seen at 48h (Fig. 3B). This observation explains why contrary to the GRE2e1b promoter, the activity of the FR-α promoter was sustained in the later stage of transient transfection (Fig. 3A and B). This delayed activation of the FR-α promoter by Dex indicates that the Dex response is likely mediated indirectly through a product(s) of Dex/GR action on an upstream target gene(s) of Dex and that the mode of action of Dex on the FR-α promoter is thus likely fundamentally different from its activation of a GRE-driven promoter.
Effect of cycloheximide on Dex induction of the FR-α promoter: The possibility that the action of Dex on the FR-α promoter requires intermediate synthesis of a protein factor(s), was tested using cycloheximide (CHX) to inhibit de novo protein synthesis during the early stage (0-12h) of Dex treatment (Fig. 3C). The delayed induction of FR-α promoter activity observed at 72h after only a 12h treatment with Dex was abrogated when CHX was included during the Dex treatment (Fig. 3C). This result indicates that in
Dex induction of the FR-α promoter an early action of Dex is to induce de novo synthesis of some other protein(s).
Effect of co-activators on FR-α promoter activity and its induction by Dex: The effect of the nuclear receptor/GR co-activators, SRC-1, SRC-2 and pCAF on promoter activity as well as its activation by Dex was measured in HeLa cells co-transfected with expression plasmids for the individual co-activators and FR-α promoter-luciferase
66 (Table1). Each of the co-activators enhanced the basal FR-α promoter activity. However,
each of the co-activators also potentiated Dex induction of the FR-α promoter. This result
lends further support to GR mediation of the Dex effect on FR-α gene expression and the
view that this regulation, albeit indirect, is transcriptional.
Identification of the target site of Dex action in the FR-α promoter: The FR-α
promoter-luciferase reporter construct used in the above studies included the FR-α gene
sequence, -3394nt to +33nt, spanning both the P1 and the P4 promoters. 5′ deleted versions of this promoter construct, i.e., the –272nt to +33nt and the –116nt to +33nt fragments of the promoter, retained the Dex responsiveness of the full length construct in transfected HeLa cells (Fig. 4A). The time course of the Dex response was also unaltered for the truncated promoter fragments (Fig. 4A). The only functional cis elements known
to occur between the initiator sequence and –116nt are the G/C-rich Sp1 binding sites of the P4 promoter, indicated in Fig.4B. A further 5’ deletion of FR-α promoter luciferase in which all of the promoter sequence upstream of the most proximal Sp1 element was deleted retained the Dex response (Fig. 4C). Since the single Sp1 element in the FR-
α(-49nt to +33nt) construct is necessary for basal promoter activity (27), a possible role
for this G/C-rich element in mediating the Dex effect was tested by replacing this
sequence (-49nt to –35nt) with a TATA-box element (AATAATTAA) to retain basal
promoter activity (Fig. 4C). The chimeric promoter was unresponsive to Dex treatment
(Fig. 4C), implicating the Sp1 element as a mediator of the Dex effect.
67 To determine whether another Sp1-dependent promoter, similar to the FR-α promoter, would respond to Dex in a similar manner as the FR-α P4 promoter, the effect of Dex was tested on the Sp1-dependent SV40 promoter-luciferase reporter. In transfected HeLa cells Dex enhanced the activity of the SV40 promoter, with a time course that was similar to that for the FR-α promoter (Fig. 4D). It may be noted that the G/C-rich region of the
SV40 promoter is a stronger Sp1 element than that of the FR-α P4 promoter since it contains six repeat Sp1 elements. To determine the relative roles of the initiator (and the flanking) region and the Sp1 elements in the Dex response of the P4 promoter, either the
P4 initiator region (-28nt to +33nt) or the entire G/C-rich region of the P4 promoter in the full length FR-α promoter-luciferase construct was replaced by the corresponding regions of the SV40 promoter (Fig. 4D). Both the chimeric promoter constructs were responsive to Dex with a time course similar to that of the FR-α promoter; however, the magnitude of the Dex response was much greater for the FR-α promoter chimera containing the
G/C-rich region of the SV40 promoter (Fig. 4D). This suggests that whereas a G/C-rich sequence element mediates and may determine the magnitude of the delayed Dex response of a promoter, for optimal response to occur, there is a preferred initiator context.
The action of Sp family proteins on the FR-α promoter and the effect of Dex on
their expression levels: A well known mechanism of gene regulation through G/C-rich
cis elements involves changes in differential expression and transcriptional activities of
their cognate trans factors, i.e., Sp family proteins. To test this possibility, the action of major Sp family members including Sp1, Sp3 and Sp4 on the FR-α promoter activity was
68 tested by co-transfection of HeLa cells with FR-α promoter-luciferase and expression
plasmids for the Sp proteins, individually and in combination. All of the Sp proteins were equipotent activators of the FR-α promoter (Fig. 5A). Further, Dex treatment of HeLa
cells, up to 96h, did not result in any obvious substantive changes in the expression levels
of endogenous Sp1, Sp3 or Sp4 or their apparent molecular weights, under conditions in
which endogenous FR-α was up-regulated (Fig. 5B). These results exclude changes in the relative expression levels or phosphorylation levels of Sp1, Sp3 or Sp4 as a mechanism mediating the Dex effect on the FR-α gene and suggest that Dex regulates the interaction(s) of some other transcription factor(s) with the core transcription initiation complex of the P4 promoter.
The action of inhibitors of histone deacetylase on Dex induction of FR-α gene
expression: Since the transcriptional activity of nuclear receptors entails modulation of
histone acetylation, it was of interest to examine the effects of histone deacetylase
(HDAC) inhibitors on Dex induction of FR-α gene transcription. The well-tolerated drug
valproic acid (VPA) and the well-characterized laboratory reagent, trichostatin A (TSA)
were chosen as the HDAC inhibitors for these experiments. In HeLa cells transfected
with FR-α promoter-luciferase, both VPA (Fig. 6A) and TSA (Fig.6B) independently
increased the promoter activity to some extent within their pharmacological dose ranges
but they both greatly potentiated Dex induction of the FR-α promoter. VPA also
potentiated Dex induction of the endogenous FR-α in HeLa cells, in a dose-dependent
manner (Fig.6C). Finally, the potentiation of the Dex induction of the transfected FR-α
promoter-luciferase in HeLa cells by VPA occurred both during the early (0-24h) and
69 later (24-72h) stages of Dex treatment (Fig. 6D). Under the conditions of the above
treatments, the HDAC inhibitors did not affect the viability or the growth of HeLa cells
(data not shown).
Effect of Dex treatment and HDAC inhibition on endogenous FR-α gene expression
in FR-α-positive vs. FR-α-negative cell lines: In order to test whether Dex increased
FR-α gene expression in other FR-α-positive cell lines and to examine whether Dex
could alter the tissue expression pattern of FR-α by producing de novo expression of the
receptor in FR-α-negative cells, a variety of cell types were treated with Dex, TSA or a
combination of Dex and TSA. Cells in which FR-α mRNA was determined by real time
RT-PCR to be < 1/1000 of that in HeLa cells and in which the FR-α protein was
undetectable by western blot were considered to be FR-α-negative. In human
hematopoietic cells (KG-1, Kcl-22, K-562,NB-4), fibroblasts (MG-63, SVG) and
epithelial (Caki-1) cell lines that were FR-α-negative, there was no detectable increase in
the receptor mRNA expression upon Dex/TSA treatments (Table.2); however, in JAR,
Ishikawa and SKOV-3 cells, that are FR-α-positive, Dex, alone or in combination with
TSA, increased FR-α expression (Table.2).
Effect of Dex/TSA on GR expression: GR is known to be down-regulated in cells
treated with Dex. The effect of Dex/TSA on GR expression in HeLa cells was tested in
order to explore the possibility that modulation of GR expression plays a role in the
potentiation of Dex induction of the FR-α promoter by HDAC inhibition (Fig. 7). The
western blot data in Fig. 7 shows that over a period of 96h of Dex treatment, GR was
70 progressively down-regulated by Dex, alone and also by Dex in the presence of TSA.
Although TSA by itself did not alter the GR level, it did appear to decrease the extent of down-regulation of GR by Dex. However, this did not appear to be a significant factor in the synergy produced by TSA at least in the early (up to 48h) stage because the GR levels were comparable between the two treatments up to 48h.
Up-regulation of tumor and serum FR-α by Dex in a murine tumor xenograft model: A murine tumor xenograft model was used to test whether the in vitro observations of FR-α induction by Dex would extend to the regulation of the FR-α gene in the physiologic milieu. In Fig. 8A, two groups of three SCID female mice bearing subcutaneous HeLa cell tumors (~ 0.5 cm diameter) were tested. Either low dose slow release Dex pellets (to achieve a circulating concentration of 0.24 μM Dex) or placebo pellets were implanted subcutaneously in the mice for a duration of 5 days before sacrificing the mice to harvest the tumors. As expected, the Dex treatment did not cause a significant difference between the treated and placebo groups in terms of body weight and activity (data not shown). Dex treatment caused a substantial increase in FR-α protein in the tumors as seen by western blot analysis of the tumor cell lysate (Fig. 8A).
In Fig. 8B, the effect of Dex on the level of soluble FR in the serum was tested in the mouse HeLa cell tumor xenograft model and compared with control mice that did not bear the tumor. Groups of 5 mice were used in this experiment and serum FR was estimated by using [3H]folic acid binding assay. Subcutaneous inoculation of HeLa cells and treatment with Dex or placebo pellets were carried out as described above for Fig. 8B
71 and at the end of the treatment blood samples were collected from the sacrificed animals.
In mice bearing the HeLa cell tumors and treated with placebo, serum FR was slightly elevated compared to the mice that did not bear tumors (p< 0.1) (Fig. 8B). Administration of Dex to the tumor bearing mice further increased their serum FR substantially (p<0.01).
These results demonstrate that Dex induction of FR-α in a solid tumor in vivo will cause an increase in serum FR and that such a response to Dex may be considered to be indicative of the presence of an FR-α-rich tumor.
72 DISCUSSION
In view of the large number of pre-clinical and clinical studies that demonstrate the
considerable potential for the utility of FR as a target for tumor selective delivery of a
broad range of experimental therapies, there is a pressing need to address the problem of
the variable and frequently limiting expression of FR in the target tumors. Recently
published (Wang et al., 2000; Hao et al., 2003; Kelley et al., 2003) and unpublished
studies in our laboratory have shown that the FR gene family is regulated by nuclear
receptors. The specific regulatory mechanisms, however, are quite varied but none
involve classical response elements. Thus, ER acts by directly interacting with the
proximal P4 promoter of the FR-α gene to repress it and this repressive effect is
enhanced by estrogen; antiestrogens will bind to ER and de-repress FR-α transcription
(Kelley et al., 2003). Retinoid compounds act through each of the three retinoic acid receptors (RARs α, β and γ) in distinct ways, directly interacting with the FR-β gene to up-regulate its expression (Wang et al., 2000; Hao et al., 2003). Other, unpublished studies indicate positive regulation of FR-α by the androgen receptor by direct interaction with proteins bound to an enhancer element in the FR-α gene as well as indirect regulation of FR-α by the progesterone receptor. In this context, the regulation of FR-α by GR, as reported here, is particularly interesting because, unlike other steroid hormone receptors, GR is almost ubiquitously expressed (Adcock and Caramori, 2001). Further, the many clinical applications of Dex and the observation that variations in endogenous cortisol levels do not impact the physiological effects of Dex (Boonyaratanakornkit et al.,
2001; DeRijk et al., 2002) also indicate that gene activation by endogenous glucocorticoids is suboptimal.
73
The results of this study clearly demonstrate that Dex up-regulates the expression of the
endogenous FR-α gene in cell lines in which the gene is transcriptionally active but not in
a variety of cell types that are FR-α-negative; under these conditions other active genes such as those encoding GAPDH, tubulin and Sp family proteins were not regulated by
Dex. These observations are consistent with the nature of FR regulation by other nuclear receptors and are further supported by the lack of de novo FR expression in various FR-
negative tissues in mice following Dex treatment (data not shown). The Dex-induced FR-
α retained the desired characteristics of the receptor as a tumor target and a releasable
tumor marker i.e., it’s anchoring to the membrane by GPI and its ability to bind ligand. A
substantial induction of FR-α by Dex was also observed in a murine tumor xenograft
model, both within the tumor and in the serum, confirming the relevance of this
regulation to the physiologic setting.
We undertook a study of the molecular processes involved in the action of GR on the FR-
α gene, in the context of current knowledge of nuclear receptor functions, to provide a
rational approach to designing and optimizing the use of GR ligands in FR-α targeting
and FR-dependent diagnostics and to help to understand, anticipate and address
associated problems. FR-α up-regulation in response to Dex treatment was relatively
slow and progressed even after Dex was withdrawn as early as 6h of treatment. This
suggests that Dex does not act directly on the FR-α gene and that an early sequence of
events involving Dex action on some other target(s) precedes and is necessary for FR-α
up-regulation. Further evidence that the expression of an intermediary protein factor in
74 response to Dex treatment is required to mediate the action of Dex on the FR-α promoter
is provided by the observation that blocking de novo protein synthesis in the early lag
phase of Dex action abolished the delayed activation of the promoter by Dex. The Dex
action must be mediated by GR based on (i) the Dex dose-dependence; (ii) the inhibition
of its action by the GR antagonist, RU486 and (iii) potentiation of the Dex effect by co- activators. Whereas the identity of the critical immediate (direct) target(s) of Dex/GR action is unclear, the evidence points to the transcriptional nature of these early regulatory events as opposed to the more recently discovered non-genomic actions of steroid receptors (Marks et al., 2000; Simoncini et al., 2000; Boonyaratanakornkit et al.,
2001). This is evident from the GR co-activator dependence of the Dex effect as well as potentiation of Dex induction of FR-α by HDAC inhibition in the early (within 24h) as well as late (after 24h) phases of Dex action.
Among the many protein modifications that occur as intermediate steps in transcriptional
activation by nuclear receptors, histone acetylation is not only a key event for nuclear
receptor function but is reversible, acutely regulated and may be specifically modulated
by drugs that have negligible toxicity (Struhl, 1998; Marks et al., 2000; Sterner and
Berger, 2000). All of the GR co-activators that were shown in this study to synergize
with Dex to enhance FR-α promoter activity i.e., SRC-1(NcoA-1), SRC-
2(GRIP1/TIF2/NcoA-2) and pCAF directly or indirectly promote histone acetylation
(Robyr et al., 2000). Nuclear receptor co-repressors generate a transcriptionally repressed
state by recruiting class II HDACs (Kao et al., 2000; Li et al., 2000; Underhill et al.,
2000; Wen et al., 2000; Jansen et al., 2004). Indeed, short chain fatty acids have been
shown to sensitize cells to steroid hormones in vitro and in vivo both by activating the
75 MAP kinase pathway and by inhibiting HDAC (Jansen et al., 2004). Therefore it was logical to test the effect of HDAC inhibitors on Dex induction of FR-α. The short chain fatty acid, VPA (an antiepileptic and antineoplastic drug), and the hydroxamic acid, TSA
(a well characterized laboratory reagent), are both inhibitors of class I and II HDACs
(Marks et al., 2000; Gottlicher et al., 2001; Marks et al., 2001a). VPA and TSA both potentiated Dex induction of FR-α at the transcriptional level, in their pharmacologically effective milimolar and nanomolar concentration ranges, respectively (Marks et al.,
2000; Marks et al., 2001a; Marks et al., 2001b). Despite the broad role of histone acetylation in gene regulation, HDAC inhibitors do not have global effects on gene expression. It has been established that these inhibitors alter the expression of only ~ 2 percent of actively transcribed genes and that most of them have either minimal toxicity or no toxicity at their effective doses (Marks et al., 2000). The profound effects of HDAC inhibitors on Dex induction of FR-α may be used to advantage in the receptor targeted therapies and FR-dependent diagnostics in view of the fact that a variety of HDAC inhibitors that have acceptable toxicity profiles, that produce a sustained increase in the level of acetylated histones within hours (Marks et al., 2001a) and that act on HDACs functionally associated with nuclear receptors are currently available (Marks et al., 2000;
Gottlicher et al., 2001; Jung, 2001; Kramer et al., 2003).
The results also demonstrate that the ultimate downstream site of action of Dex in the
FR-α gene is the proximal P4 promoter, more specifically, the G/C-rich Sp1 elements and the initiator and flanking region. Devoid of other regulatory elements, this portion of the FR-α promoter region represents the essential elements of a basal TATA-less promoter. The results of this study demonstrated that a (Sp1 binding) G/C-rich region is
76 essential for the Dex response. The magnitude of this response not only correlated with the strength of the Sp1 element but also depended on the context of the initiator region. A common mechanism of gene regulation through G/C-rich elements involves differential levels and effects of Sp family proteins (Apt et al., 1996) but such a mechanism for the action of Dex was ruled out because in HeLa cells, the major Sp family proteins, Sp1,
Sp3 and Sp4 all regulated the FR-α promoter in a similar manner and further, Dex did not alter their expression levels or their apparent molecular weights that are influenced by their phosphorylation state. It thus appears that the ultimate action of Dex in relation to
FR-α regulation involves modulation of some component(s) of the transcription initiation complex, whose exact composition is dictated by both the G/C-rich and initiator regions.
Such a supposition is reasonable in light of the emerging view that the recruitment of several components of the pre-initiation complex is dictated by the basal promoter context (Smale and Kadonaga, 2003).
The FR-α gene thus belongs to a class of indirect target genes of Dex/GR that lack a glucocorticoid response element. Based on the foregoing studies, it is reasonable to anticipate that in individuals bearing an FR-α-positive tumor, brief treatment with the combination of innocuous doses of a GR agonist such as Dex and a HDAC inhibitor will boost FR-α expression in the tumor and will, in addition, increase the serum level of FR.
Such a treatment should greatly improve the outcome of FR-targeted therapies. GR modulation of FR-α expression also offers a means of utilizing circulating FR as a serum marker to detect and follow the treatment response of major subtypes of ovarian, endometrial and other cancers. Indeed, elevation of serum FR in response to Dex/HDAC inhibitor treatment may by itself serve as a diagnostic test for the presence of an FR-
77 positive tumor. Following detection of the induced FR-α in the serum during initial screening, the FR-positive tumors may be detected by FR-targeted whole body imaging.
Similar principles of using general transcription modulators to induce or even down- regulate gene expression, selectively in tumors, concomitant with the administration of therapeutic agents whose action is dependent on the expression level of those genes, may be of value as a general concept in combination therapies. Such an approach is also applicable to the discovery of new tumor/serum markers.
78 References
Adcock, I.M. and Caramori, G.: Cross-talk between pro-inflammatory transcription
factors and glucocorticoids. Immunol Cell Biol 79 (2001) 376-84.
Antony, A.C., Verma, R.S., Unune, A.R. and LaRosa, J.A.: Identification of a Mg2+-
dependent protease in human placenta which cleaves hydrophobic folate-binding
proteins to hydrophilic forms. J Biol Chem 264 (1989) 1911-4.
Apt, D., Watts, R.M., Suske, G. and Bernard, H.U.: High Sp1/Sp3 ratios in epithelial
cells during epithelial differentiation and cellular transformation correlate with the
activation of the HPV-16 promoter. Virology 224 (1996) 281-91.
Boonyaratanakornkit, V., Scott, M.P., Ribon, V., Sherman, L., Anderson, S.M., Maller,
J.L., Miller, W.T. and Edwards, D.P.: Progesterone receptor contains a proline-
rich motif that directly interacts with SH3 domains and activates c-Src family
tyrosine kinases. Mol Cell 8 (2001) 269-80.
DeRijk, R.H., Schaaf, M. and de Kloet, E.R.: Glucocorticoid receptor variants: clinical
implications. J Steroid Biochem Mol Biol 81 (2002) 103-22.
Elnakat, H. and Ratnam, M.: Distribution, functionality and gene regulation of folate
receptor isoforms: implications in targeted therapy. Adv Drug Deliv Rev 56
(2004) 1067-84.
79 Elwood, P.C., Deutsch, J.C. and Kolhouse, J.F.: The conversion of the human membrane-
associated folate binding protein (folate receptor) to the soluble folate binding
protein by a membrane-associated metalloprotease. J Biol Chem 266 (1991)
2346-53.
Elwood, P.C., Nachmanoff, K., Saikawa, Y., Page, S.T., Pacheco, P., Roberts, S. and
Chung, K.N.: The divergent 5' termini of the alpha human folate receptor (hFR)
mRNAs originate from two tissue-specific promoters and alternative splicing:
characterization of the alpha hFR gene structure. Biochemistry 36 (1997) 1467-
78.
Gabizon, A., Shmeeda, H., Horowitz, A.T. and Zalipsky, S.: Tumor cell targeting of
liposome-entrapped drugs with phospholipid-anchored folic acid-PEG conjugates.
Adv Drug Deliv Rev 56 (2004) 1177-92.
Gibbs, D.D., Theti, D.S., Wood, N., Green, M., Raynaud, F., Valenti, M., Forster, M.D.,
Mitchell, F., Bavetsias, V., Henderson, E. and Jackman, A.L.: BGC 945, a novel
tumor-selective thymidylate synthase inhibitor targeted to alpha-folate receptor-
overexpressing tumors. Cancer Res 65 (2005) 11721-8.
Gottlicher, M., Minucci, S., Zhu, P., Kramer, O.H., Schimpf, A., Giavara, S., Sleeman,
J.P., Lo Coco, F., Nervi, C., Pelicci, P.G. and Heinzel, T.: Valproic acid defines a
novel class of HDAC inhibitors inducing differentiation of transformed cells.
Embo J 20 (2001) 6969-78.
80 Hao, H., Qi, H. and Ratnam, M.: Modulation of the folate receptor type beta gene by
coordinate actions of retinoic acid receptors at activator Sp1/ets and repressor AP-
1 sites. Blood 101 (2003) 4551-60.
Jackman, A.L., Theti, D.S. and Gibbs, D.D.: Antifolates targeted specifically to the folate
receptor. Adv Drug Deliv Rev 56 (2004) 1111-25.
Jansen, M.S., Nagel, S.C., Miranda, P.J., Lobenhofer, E.K., Afshari, C.A. and
McDonnell, D.P.: Short-chain fatty acids enhance nuclear receptor activity
through mitogen-activated protein kinase activation and histone deacetylase
inhibition. Proc Natl Acad Sci U S A 101 (2004) 7199-204.
Jung, M.: Inhibitors of histone deacetylase as new anticancer agents. Curr Med Chem 8
(2001) 1505-11.
Kamen, B.A. and Smith, A.K.: A review of folate receptor alpha cycling and 5-
methyltetrahydrofolate accumulation with an emphasis on cell models in vitro.
Adv Drug Deliv Rev 56 (2004) 1085-97.
Kao, H.Y., Downes, M., Ordentlich, P. and Evans, R.M.: Isolation of a novel histone
deacetylase reveals that class I and class II deacetylases promote SMRT-mediated
repression. Genes Dev 14 (2000) 55-66.
81 Ke, C.Y., Mathias, C.J. and Green, M.A.: Folate-receptor-targeted radionuclide imaging
agents. Adv Drug Deliv Rev 56 (2004) 1143-60.
Kelley, K.M., Rowan, B.G. and Ratnam, M.: Modulation of the folate receptor alpha
gene by the estrogen receptor: mechanism and implications in tumor targeting.
Cancer Res 63 (2003) 2820-8.
Kramer, O.H., Zhu, P., Ostendorff, H.P., Golebiewski, M., Tiefenbach, J., Peters, M.A.,
Brill, B., Groner, B., Bach, I., Heinzel, T. and Gottlicher, M.: The histone
deacetylase inhibitor valproic acid selectively induces proteasomal degradation of
HDAC2. Embo J 22 (2003) 3411-20.
Leamon, C.P. and Low, P.S.: Folate-mediated targeting: from diagnostics to drug and
gene delivery. Drug Discov Today 6 (2001) 44-51.
Leamon, C.P. and Reddy, J.A.: Folate-targeted chemotherapy. Adv Drug Deliv Rev 56
(2004) 1127-41.
Li, J., Wang, J., Wang, J., Nawaz, Z., Liu, J.M., Qin, J. and Wong, J.: Both corepressor
proteins SMRT and N-CoR exist in large protein complexes containing HDAC3.
Embo J 19 (2000) 4342-50.
Lu, Y. and Low, P.S.: Folate-mediated delivery of macromolecular anticancer therapeutic
agents. Adv Drug Deliv Rev 54 (2002) 675-93.
82 Lu, Y., Sega, E., Leamon, C.P. and Low, P.S.: Folate receptor-targeted immunotherapy
of cancer: mechanism and therapeutic potential. Adv Drug Deliv Rev 56 (2004)
1161-76.
Luhrs, C.A. and Slomiany, B.L.: A human membrane-associated folate binding protein is
anchored by a glycosyl-phosphatidylinositol tail. J Biol Chem 264 (1989) 21446-
9.
Mantovani, L.T., Miotti, S., Menard, S., Canevari, S., Raspagliesi, F., Bottini, C.,
Bottero, F. and Colnaghi, M.I.: Folate binding protein distribution in normal
tissues and biological fluids from ovarian carcinoma patients as detected by the
monoclonal antibodies MOv18 and MOv19. Eur J Cancer 30A (1994) 363-9.
Marks, P.A., Richon, V.M., Breslow, R. and Rifkind, R.A.: Histone deacetylase
inhibitors as new cancer drugs. Curr Opin Oncol 13 (2001a) 477-83.
Marks, P.A., Richon, V.M. and Rifkind, R.A.: Histone deacetylase inhibitors: inducers of
differentiation or apoptosis of transformed cells. J Natl Cancer Inst 92 (2000)
1210-6.
Marks, P.A., Rifkind, R.A., Richon, V.M. and Breslow, R.: Inhibitors of histone
deacetylase are potentially effective anticancer agents. Clin Cancer Res 7 (2001b)
759-60.
83 Pan, X.Q., Zheng, X., Shi, G., Wang, H., Ratnam, M. and Lee, R.J.: Strategy for the
treatment of acute myelogenous leukemia based on folate receptor beta-targeted
liposomal doxorubicin combined with receptor induction using all-trans retinoic
acid. Blood 100 (2002) 594-602.
Ratnam, M., Hao, H., Zheng, X., Wang, H., Qi, H., Lee, R. and Pan, X.: Receptor
induction and targeted drug delivery: a new antileukaemia strategy. Expert Opin
Biol Ther 3 (2003) 563-74.
Roberts, S.J., Chung, K.N., Nachmanoff, K. and Elwood, P.C.: Tissue-specific promoters
of the alpha human folate receptor gene yield transcripts with divergent 5' leader
sequences and different translational efficiencies. Biochem J 326 ( Pt 2) (1997)
439-47.
Robyr, D., Wolffe, A.P. and Wahli, W.: Nuclear hormone receptor coregulators in action:
diversity for shared tasks. Mol Endocrinol 14 (2000) 329-47.
Ross, J.F., Wang, H., Behm, F.G., Mathew, P., Wu, M., Booth, R. and Ratnam, M.:
Folate receptor type beta is a neutrophilic lineage marker and is differentially
expressed in myeloid leukemia. Cancer 85 (1999) 348-57.
Roy, E.J., Gawlick, U., Orr, B.A. and Kranz, D.M.: Folate-mediated targeting of T cells
to tumors. Adv Drug Deliv Rev 56 (2004) 1219-31.
84 Saikawa, Y., Price, K., Hance, K.W., Chen, T.Y. and Elwood, P.C.: Structural and
functional analysis of the human KB cell folate receptor gene P4 promoter:
cooperation of three clustered Sp1-binding sites with initiator region for basal
promoter activity. Biochemistry 34 (1995) 9951-61.
Shen, F., Ross, J.F., Wang, X. and Ratnam, M.: Identification of a novel folate receptor, a
truncated receptor, and receptor type beta in hematopoietic cells: cDNA cloning,
expression, immunoreactivity, and tissue specificity. Biochemistry 33 (1994)
1209-15.
Shen, F., Wu, M., Ross, J.F., Miller, D. and Ratnam, M.: Folate receptor type gamma is
primarily a secretory protein due to lack of an efficient signal for
glycosylphosphatidylinositol modification: protein characterization and cell type
specificity. Biochemistry 34 (1995) 5660-5.
Simoncini, T., Hafezi-Moghadam, A., Brazil, D.P., Ley, K., Chin, W.W. and Liao, J.K.:
Interaction of oestrogen receptor with the regulatory subunit of
phosphatidylinositol-3-OH kinase. Nature 407 (2000) 538-41.
Smale, S.T. and Kadonaga, J.T.: The RNA polymerase II core promoter. Annu Rev
Biochem 72 (2003) 449-79.
Sterner, D.E. and Berger, S.L.: Acetylation of histones and transcription-related factors.
Microbiol Mol Biol Rev 64 (2000) 435-59.
85 Struhl, K.: Histone acetylation and transcriptional regulatory mechanisms. Genes Dev 12
(1998) 599-606.
Theti, D.S., Bavetsias, V., Skelton, L.A., Titley, J., Gibbs, D., Jansen, G. and Jackman,
A.L.: Selective delivery of CB300638, a cyclopenta[g]quinazoline-based
thymidylate synthase inhibitor into human tumor cell lines overexpressing the
alpha-isoform of the folate receptor. Cancer Res 63 (2003) 3612-8.
Toffoli, G., Cernigoi, C., Russo, A., Gallo, A., Bagnoli, M. and Boiocchi, M.:
Overexpression of folate binding protein in ovarian cancers. Int J Cancer 74
(1997) 193-8.
Underhill, C., Qutob, M.S., Yee, S.P. and Torchia, J.: A novel nuclear receptor
corepressor complex, N-CoR, contains components of the mammalian SWI/SNF
complex and the corepressor KAP-1. J Biol Chem 275 (2000) 40463-70.
Wang, H., Zheng, X., Behm, F.G. and Ratnam, M.: Differentiation-independent retinoid
induction of folate receptor type beta, a potential tumor target in myeloid
leukemia. Blood 96 (2000) 3529-36.
Wen, Y.D., Perissi, V., Staszewski, L.M., Yang, W.M., Krones, A., Glass, C.K.,
Rosenfeld, M.G. and Seto, E.: The histone deacetylase-3 complex contains
nuclear receptor corepressors. Proc Natl Acad Sci U S A 97 (2000) 7202-7.
86 Wu, M., Gunning, W. and Ratnam, M.: Expression of folate receptor type alpha in
relation to cell type, malignancy, and differentiation in ovary, uterus, and cervix.
Cancer Epidemiol Biomarkers Prev 8 (1999) 775-82.
Yang, X.Y., Mackins, J.Y., Li, Q.J. and Antony, A.C.: Isolation and characterization of a
folate receptor-directed metalloprotease from human placenta. J Biol Chem 271
(1996) 11493-9.
Zhao, X.B. and Lee, R.J.: Tumor-selective targeted delivery of genes and antisense
oligodeoxyribonucleotides via the folate receptor. Adv Drug Deliv Rev 56 (2004)
1193-204.
87
Table 1. Effect of co-activators ± Dex on FR-α promoter activitya.
Co-regulatorb Promoter activityc
Vehicle Dex
______
None 1.0 +/- 0.0 5.7 +/- 0.2
SRC-1 2.9 +/- 0.9 13.6 +/- 0.6
SRC-2 3.2 +/- 0.2 11.3 +/- 0.5
pCAF 4.6 +/- 0.7 11.5 +/- 0.8
______
a The promoter activity was determined by measuring luciferase reporter activity. The values are expressed as the ratios to that for the vehicle treated control in the absence of co-transfected co-regulator. b HeLa cells (106) were transfected with FR-α promoter-luciferase (0.5 μg plasmid) and co-transfected with an expression plasmid for SRC-1, SRC-2 or pCAF or with the empty plasmid (0.5 μg plasmid). c The transfected cells were treated with either vehicle or Dex (1μM) for a period of 48h post-transfection before harvesting them to measure luciferase activity.
88 Table 2. Effect of Dex ± TSA on endogenous FR expression in various cell lines.
Increase in FR-α expressiond ______
Cell Line Cell Type Endogenous Vehicle Dex TSA Dex FR-α +TSA
KG-1 Acute Negative a myelogeneous - b - - - leukemia Kcl-22 Myeloblastic Negative leukemia - - - - K-562 Erythroleukemia Negative - - - - NB-4 Acute Negative promyelocytic - - - - leukemia MG-63 Osteosarcoma Negative - - - - SVG Transformed Negative fibroblast - - - - Caki-1 Kidney Negative carcinoma - - - - JAR Choriocarcinoma Positive + c - - - Ishikawa Uterine Positive + + + adenocarcinoma - Skov-3 Ovarian Positive + + + carcinoma -
a FR-α mRNA levels in the FR-α-negative cell lines were at least 1000-fold less than that in HeLa cells as assessed by real time RT-PCR and the protein could not be detected by Western blot.
b The ‘-‘ sign indicates that there was no increase in FR-α mRNA as assessed by real time RT-PCR.
c The ‘+’ sign indicates that there was an increase in FR-α mRNA as assessed by real time RT-PCR.
d Treatment of the cells with Dex (0.1 μM) and/or TSA (25ng/mL) was carried out for 96h.
89 FIGURE LEGENDS
Figure 1: Induction of FR-α by Dex. A: HeLa cells were treated with either vehicle alone or Dex (100 nM) for the indicated periods at the end of which cells harvested from one triplicate set of wells for purification of total RNA and another set for preparation of cell lysates for western blot. mRNA for FR-α and GAPDH were measured in the RNA samples by real time RT-PCR (top panel). The western blots were probed with rabbit anti-FR antibody (bottom panel). The same blots were re-probed with a mouse anti- tubulin antibody (bottom panel). B: HeLa cells grown in 6-well plates were transfected with the full length FR-α promoter-luciferase reporter plasmid (0.5μg) followed by treatment either with vehicle alone or with the indicated concentrations of Dex for 96h.
The harvested cells were divided into two portions, one of which was used to measure luciferase activity (top panel) and the other subjected to western blot analysis using rabbit anti-FR antibody (bottom panel). C: HeLa cells in triplicate 6-well plates were treated with the indicated concentrations of Dex for 96h at the end of which they were incubated for a further 3h, either in the absence or in the presence of PI-PLC. The cell lysates were then subjected to western blot analysis using rabbit anti-FR antibody. Uniformity of sample loading in the blots was confirmed by Coomassie blue staining. D: HeLa cells in
6-well plates were treated with either vehicle or Dex for 96h at the end of which the cells were harvested for flow cytometric analysis of the binding of PLF. In negative controls, the cells were pre-incubated with a 1000-fold excess of unlabeled folic acid. The fluorescence shift in the negative control samples was <1 percent of the signal due to unblocked FR.
90
Figure 2: Effect of RU486 on Dex induction of promoter activity. HeLa cells were
transfected with either FR-α promoter-luciferase plasmid (A) or with a control GRE2e1b
promoter-luciferase plasmid (B), and grown for a further 72h either in the absence or in the presence of Dex (100nM) in combination with the indicated concentrations of RU-
486. The cells were then harvested to assay luciferase activity in the lysates. The fold- induction of promoter activity is plotted in each case, considering the promoter activity of the vehicle-treated control as unity.
Figure 3: Time course and reversibility of Dex induction of FR-α promoter activity and the effect of cycloheximide. HeLa cells were transfected with either the control
GRE2e1b promoter-luciferase plasmid (Panel A) or FR-α promoter-luciferase plasmid
(Panel B). 12 h post-transfection, the cells were treated for the indicated periods with
either Dex (1μM) or vehicle alone and harvested after the indicated periods for
measurement of luciferase activity in the cell lysates. In cases where Dex treatment was
terminated before harvest, Dex was removed by aspirating the media and washing the
cells with Dex-free media before replenishing the cells with media that did not contain
Dex. Panel C: HeLa cells were pre-treated with either cycloheximide (10μM) or vehicle
for 2h followed by the introduction of Dex (1μM) or vehicle as indicated. 12h later,
Dex/CHX was removed by aspirating the media and washing the cells with Dex/CHX-
free media before replenishing the cells with media that did not contain Dex/CHX. The
cells were harvested 60h later and total RNA extracted for quantification of FR-α mRNA
by real time RT-PCR.
91
Figure 4: Mapping the target site of Dex action in the FR-α promoter. A: HeLa cells
were transfected with FR-α promoter-luciferase reporter constructs containing either the
entire P1/P4 promoter region (-3394nt to +33nt) or its 5’ deleted fragments (-272nt to
+33nt or -116nt to +33nt). 12h post-transfection, the cells were treated with Dex (1μM)
for the indicated periods before harvesting for luciferase assay. Promoter activity is plotted as fold increase over that in cells that were treated with vehicle alone. B: DNA
sequence of the FR-α promoter fragment -116nt to +33nt. The numbers represent the
positions of the nucleotides relative to the position of the transcription start site (+1nt).
The Sp1 elements are indicated in bold letters. C: HeLa cells were transfected with a 5’
deleted FR-α promoter-luciferase reporter constructs containing the promoter fragment
-49nt to +33nt. A chimeric promoter construct in which a TATA-box element was
attached upstream of the FR-α promoter fragment –35nt to +33nt was also used in the
transfection. 12h post-transfection, the cells were treated with Dex (1μM) for the
indicated periods before harvesting for luciferase assay. Promoter activity is plotted as fold increase over that in cells that were treated with vehicle alone. D: HeLa cells were
transfected with FR-α or SV40 promoter-luciferase constructs containing the indicated
promoter fragments of FR-α, SV40 or FR-α/SV40 promoter chimeras. 12h post-
transfection, the cells were treated with Dex (1μM) for the indicated periods before
harvesting for luciferase assay. Promoter activity is plotted as fold increase over that in
cells that were treated with vehicle alone. The pGL3 plasmid (Promega) was used for the
SV40 promoter-luciferase contained in it. The construct, FR-α -3394nt to
-32nt/SV40(INR) is a chimera in which the initiator region of the SV40 early promoter is
92 substituted for that of the P4 promoter. The construct FR-α -3394nt to -47nt/SV40(GC)6 is a chimera in which the cluster of 6 Sp1 elements of the SV40 early promoter is substituted for Sp1 elements of the P4 promoter.
Figure 5:. Transactivation of the FR-α promoter by Sp family proteins and the effect of Dex on their expression levels. A: HeLa cells were co-transfected with FR-
α promoter-luciferase (0.5 μg) and an expression plasmid for Sp1, Sp3 or Sp4 alone or in combination as indicated. As a negative control, cells were co-transfected with the pRc vector. The cells were harvested for luciferase assay 72h post-transfection. B: HeLa cells were grown for 96h in the presence of vehicle alone or with the addition of Dex (1μM) for either the entire 96h or for the last 24h. The cells were then harvested for preparation of nuclear extracts and cytoplasmic fractions. The cytoplasmic fractions were probed by western blot with a rabbit anti-FR-α antibody or with a mouse antibody to tubulin
(bottom panels). The nuclear extracts were probed by western blot using antibodies specific for Sp1, Sp3 or Sp4.
Figure 6: Effect of HDAC inhibitors on FR-α gene regulation by Dex. A: HeLa cells were transfected with FR-α promoter-luciferase and treated for 72h with different concentrations of VPA either in the absence or in the presence of Dex (100nM) and then harvested for luciferase assay. B: HeLa cells were transfected with FR-α promoter- luciferase and treated for 72h with different concentrations of TSA either in the absence or in the presence of Dex (100nM) and then harvested for luciferase assay. C: HeLa cells that were either untreated or treated with Dex (100nM) and/or different concentrations of
93 VPA for 96h were harvested and the cell lysates probed by western blot using either a rabbit anti-FR antibody or a mouse antibody to tubulin. D: FR−α promoter-luciferase
and then treated for 72h with vehicle alone or with Dex (100nM). VPA (1mM) was
introduced for the entire 72h, the first 24h, or for the period between 24h and 72h of Dex
treatment. The cells were harvested for luciferase assay at the end of 72h.
Figure 7: Effect of Dex and TSA on GR expression. HeLa cells were treated with
vehicle, Dex (1μM) or TSA (4ng/ml) or with a combination of Dex and TSA for the
indicated periods. The cells were harvested and the cell lysates subjected to western blot
analysis using antibody to GR, FR or tubulin.
Figure 8: Effect of Dex on tumor and serum FR-α levels in a murine tumor
xenograft model. A: Two groups of 3 SCID female mice were inoculated
subcutaneously at a single site with HeLa cells (5x106). When the tumors had grown to
approximately 0.5cm diameter, the mice were implanted subcutaneously with slow
release Dex pellets or placebo pellets. After 5 days the mice were sacrificed and cell
lysates were prepared from the tumors and probed by western blot using rabbit anti-FR
antibody or a mouse antibody to tubulin. B: Groups of 5 mice bearing subcutaneous
HeLa cell tumors or without the tumors were implanted subcutaneously with slow release
Dex pellets or placebo pellets. After 5 days, the mice were sacrificed and the blood
collected. The serum folate binding protein (serum FR) was measured by a [3H]folic acid
binding assay. The normal groups represent mice that did not bear tumors. The data show
mean ± SEM for each group. Statistical differences between groups were determined
94 using Student’s t test. The level of significance for the difference between the normal groups and the placebo-treated tumor group was p<0.1 and between the Dex and placebo groups for the tumor-bearing mice was p<0.01.
95 Figure 1
A B
0.7 8 7 FRα 0.6
6 0.5
5 ) 0.4 6 4 0.3 3 0.2
2 RLUx10 (
1 Promoter activity 0.1 Fold increase in Fold increase α 0 0 FR 96h1 12h2 24h3 48h4 72h5 96h6 0 1 5 50 500 1000 0 1 5 50 500 1000 -9 Vehicle Dex (100nM) Dex (x10 M)
FRα FRα
Vehicle 0 1 5 10 50 100 1000 Tubulin
Dex (x 10-9)
96h 12h 24h 48h 72h 96h
Vehicle Dex (100nM) D 7 C No PI-PLC + PI-PLC 6
5 FRα 4 0 10 50 150 0 10 50 150 3 Dex (nM) 2 1
fluorescence) (Relative Cell surface bound PLF 0
Folic acid +- + - pre- incubation Vehicle Dex (50nM)
96
Figure 2
A
5 Vehicle 4 Dex (100nM )
3
promoter 2 α
FR 1 activity (fold increase) 0 0 4 20 100 500 -9 RU-486 (x10 M)
B 600 Vehicle 500 Dex (100nM )
400
300
e1b promoter
2 200
GRE 100 (fold increase) activity 0 0 4 20 100 500 RU-486 (x10-9M)
97 Figure 3
GRE2B e1bB promoter A 120
100
80
60
40
20 (percent of maximum) (percent of
Increase in promoter activity 0 Time of treatment (h) 0 3 6 12 24 48 6 12 24 Timeofharvest(h) 0 3 6 122448484848
B 120 FR-α promoter
100
80
60
40
20 activity (percent of activity
Increase in promoter 0
Time of treatment (h) 0 3 6 12 24 48 6 1 2 24 Time of harvest(h) 0 3 6 12 24 48 48 48 48
C 5
mRNA 4 α
3
2
1
in FR- Fold increase 0
0-2h - vehicle CHX CHX vehicle 2-14h - vehicle CHX CHX+Dex Dex 74h harvest harvest harvest harvest harvest
98
Figure 4
A B 6 0h 5 6h -116 Sp1 24h ctttcattggatctgggaaaactgagggagatgggggcagggctct 4 48h -49 Sp1 -35
3 atctgccccaggcttccgtccaggccccaccctcctggagccctg 2 +1 cacacaacttaaggccccacctccgcattccttggtgccactgaccac 1 +33
0 agctctttct Promoter activity (fold increase) increase) (fold activity Promoter FRα -116nt FRα -272nt FRα -3394nt to +33nt-luc to +33nt-luc to +33nt-luc
D C
20 7 0h 6 0h 15 6h 6h 5 24h 24h 4 48h 10 48h 3 2 5 1 Promoter activity (fold increase) (fold increase) activity Promoter (fold increase) activity Promoter 0 0 TATA box FRα -49nt PGL3 plasmid FRα -3394nt to FRα -3394nt to FRα -3394nt to + FRα -35nt to +33nt-luc (SV40 promoter-luc) +33nt –luc –32nt/SV40(INR) -47nt/SV40(GC)6 to +33nt-luc
99
Figure 5
A
3500035 ) 3 3000030
2500025 2000020
1500015 1000010
5000 5 00 FR pRc Sp1 Sp3 Sp4 Sp1 Sp1 Sp3 Sp1 (x10 units luciferase Relative alone Sp3 Sp4 Sp4 Sp3 Sp4
B
Sp1
Sp3
Sp4
Tubulin
0h 24h 96h
100 Figure 6
B A
12 25 Dex (0 nM) 10 Dex (0 nM) 20 Dex (100 nM) Dex (100 nM) ) 6 8 15 6 10 4 units (x10 5 Relative luciferase 2 Promoter activity (fold increase)
0 0
0.00 0.25 0.50 1.00 01234 Valproic acid (mM) TSA (ng/ml)
D C 20 FRα Dex (0 nM)
) 15 6 Dex (100 nM) Tubulin 10
units (x10 5
Dex (nM) 0 100 0 100 0 100 Relative luciferase 0 VPA 0 0 0.25 0.25 0.5 0.5 VPA (mM) (mM) 0111 VPA treatment (h) 00-24 24-72 0-72 Time of harvest (h) 72 72 72 72
101
Figure 7
Untreated Vehicle Dex TSA Dex+TSA
Untreate d Vehicle Dex TSA
12h
24h 48h
72h
96h
GR Tubulin
FR-α 96h
102
Figure 8
A Mouse 1 2 3 1 2 3 FRα
Tubuli n
Dex Placebo
B
H]Folic acid binding (nmol/L) binding (nmol/L) H]Folic acid 3 [
Treatment Normal Normal Tumor Tumor Groups
103
Manuscript Two:
R5020 and RU486 Act as Progesterone Receptor Agonists
to Enhance Sp1/Sp4-Dependent Gene Transcription by an
Indirect Mechanism º
Aymen Shatnawi, Thuyet Tran and Manohar Ratnam*
Department of Biochemistry and Cancer Biology Medical University of Ohio at Toledo, 3035 Arlington Avenue, Toledo, OH 43614
Running Title: Gene Activation by Progesterone Receptor Ligands
Address correspondence to: Manohar Ratnam Department of Biochemistry and Cancer Biology, Medical University of Ohio at Toledo, 3035 Arlington Avenue, Toledo, OH 43614 Tel. 419-383-3862; Fax. 419-383-6228; E-Mail: [email protected]
Key words: Folate Receptor, Thymidine Kinase 1, p27, p21, Progesterone Receptor
This work was supported by NIH grant CA 103964 to M.R.
Published in: Molecular Endocrinology. 2007 Mar; 21(3):635-50
104 ABSTRACT
It has been suggested that ligand-dependent gene activation by the progesterone receptor
(PR) can result from recruitment of PR by the promoter bound Sp1. A detailed
investigation of the Sp1-dependent agonistic activity of RU486 and R5020 on the folate
receptor (FR) type α, p27, thymidine kinase 1 (TK1) and p21 genes reveals a different
mechanism. The FR-α P4 promoter and the endogenous FR-α gene were up-regulated by the PR agonist R5020 through either PR-A or PR-B. The classical antagonist RU486 also
activated the promoter but only through PR-B. The most proximal (essential) G/C-rich
(Sp1 binding) element and the initiator region constituted the minimal promoter
responsive to PR regulation; substitution with a stronger cluster of G/C-rich elements
enhanced the magnitude of the PR response. In contrast, substitution of the G/C-rich
element with a TATA box resulted in the loss of regulation by PR. Over-expression of
Sp1 and Sp4 but not Sp3 enhanced activation of the FR-α promoter by PR; knocking
down Sp1 decreased the activation in a manner that was reversed by ectopic Sp1 or Sp4.
The ligand-dependent action of PR on the promoter was delayed compared to its
activation of a classical GRE-driven promoter and activation of both the promoter and the
endogenous FR-α gene by PR required new protein synthesis. Activation by PR
paralleled RNA polymerase II recruitment but was not accompanied by either association
of PR or a change in the association of Sp1 with the endogenous FR-α P4 promoter.
Similar observations were made for PR regulation of the genes encoding p27, TK1 and
p21. The results contradict the current view of Sp1-dependent gene regulation by PR and
point to the existence of a PR target gene(s) whose promoter and cell context(s) must thus
105 be key determinants of the agonistic activity of RU486 on a large group of important
Sp1-dependent downstream target genes.
106 INTRODUCTION
The physiological effects of progesterone and its antagonists are principally mediated by the transcriptional activity of the progesterone receptor (PR) [reviewed in (Graham and
Clarke, 1997)]. The two subtypes of PR, PR-A (94kD) and PR-B (120kD) are differentially expressed in a tissue specific manner (Rao and Wiest, 1974; Rao et al.,
1974; Lessey et al., 1983; Attia et al., 2000). PR-A is a truncated form of PR-B lacking its N-terminal 164 amino acids(Kastner et al., 1990; Giangrande and McDonnell, 1999).
The PR isoforms differentially regulate progesterone responsive genes and their transcriptional activation of a given promoter could be unequal (Tora et al., 1988; Meyer et al., 1990; Meyer et al., 1992; Vegeto et al., 1993; Giangrande et al., 1997; Conneely and Lydon, 2000; Richer et al., 2002).
Ligands that modulate PR action have clinical application in treating endocrine disorders, as anticancer agents and in terminating pregnancy [reviewed in (Cadepond et al., 1997;
Mahajan and London, 1997; Schindler et al., 2003; Spitz, 2003)]. Pure PR antagonists such as ZK98299 (onapristone) completely abrogate the transcriptional activity of PR whereas selective progesterone receptor modulators (SPRMs) such as RU486
(mifepristone) have mixed effects acting as either PR agonists or antagonists in different cell and target gene contexts. SPRMs do not affect homodimeriztion of PR or its binding to its cognate response element in the target gene (DeMarzo et al., 1992; Skafar, 1993) but produce conformational changes in the AF-2 region of PR to block the association of co-activators and promote co-repressor recruitment [reviewed in (Edwards, 2000; Glass and Rosenfeld, 2000; Leo and Chen, 2000)]. The A and B subtypes of PR respond
107 differently to RU486 which binds to PR-B to function as a partial agonist under certain conditions; in contrast, RU486 can only act as an antagonist of PR-A (Meyer et al., 1990;
Tung et al., 1993). It has been proposed that the partial agonistic activity of RU486 is dependent on the presence of an intact AF-1 region in its receptor (Meyer et al., 1990) as well as the N-terminal domain of PR-B (Wardell et al., 2002). The molecular mechanism by which RU486 works as agonist in not fully understood. Treating cells with the PKA activator 8-bromo-cAMP converted RU486 from an antagonist into an agonist (Beck et al., 1993; Sartorius et al., 1993; Kahmann et al., 1998). The ratio of co-activator to co- repressor in the cell was also found to influence the partial-agonistic activity of RU486
(Liu et al., 2002).
PR can regulate target promoters including the natural promoters for the p21, p27, glycodelin and thymidine kinase (TK) genes in the absence of a functional classical response element (PRE/GRE) through G/C-rich (Sp1 binding) elements (Thomson et al.,
1990; Tung et al., 1993; Owen et al., 1998; Gao et al., 2001; Gizard et al., 2005). Some observations appeared to suggest that this regulation occurs by direct association of PR with DNA-bound Sp1 (Owen et al., 1998; Gizard et al., 2005). Additional support for this suggestion is derived from the well established role of Sp proteins in mediating promoter activation by the estrogen receptor (ER) by a non-classical mechanism; it has been demonstrated that ER is recruited by Sp1, Sp3 or Sp4 in the absence of classical estrogen response elements to exert its genotropic effects in a variety of gene promoters in the phyisiologic context (Safe and Kim, 2004; Higgins et al., 2006). Transactivation by PR
108 independent of a PRE is of particular interest because this may underlie the agonistic
activity of RU486 on promoter activation by PR-B (Tung et al., 1993).
Our initial interest in discovering and studying the regulation of the folate receptor (FR) type α gene by PR ligands was based on the well established potential of FR-α as a tumor target in gynecological cancers for the selective delivery of therapeutic agents and the possibility of using innocuous PR ligands to selectively induce the expression of FR-α in the tumors (reviewed in (Elnakat and Ratnam, 2004; Elnakat and Ratnam, 2006). We discovered that the FR-α gene does not contain a functional hormone response element for PR and that the PR action is mediated by Sp1/Sp4 and the essential G/C-rich (Sp binding) elements within the TATA-less basal P4 promoter of the FR-α gene. The detailed mechanistic studies described in this report for the FR-α gene were extended to the genes encoding p27, thymidine kinase1 and p21. These studies contradict the prevalent view that genes regulated by PR through their Sp1 elements are direct targets of
PR action and demonstrate that they are in fact downstream targets of PR. It follows that the key event in the agonistic activity of both R5020 and RU486 on this important and potentially large class of PR target genes is an unusual regulation by PR of an upstream target gene(s) whose product(s) activates other genes through Sp1 or Sp4.
RESULTS
The FR-α promoter and the endogenous FR-α gene are activated by PR in a ligand-
dependent manner: In HeLa cells transiently transfected with PR-A or PR-B expression
vectors, the potent PR agonist R5020 (promegestone) increased FR-α promoter-luciferase
109 reporter activity in a dose-dependent manner. The maximal activation produced by PR-A
was comparable to that produced by PR-B (Fig.1A). Under similar conditions, the control
GRE2e1b-luciferase that is driven by the classical progesterone/glucocorticoid response
element (GRE) was preferentially activated by PR-B (Fig.1B). Under the conditions of transfection and treatment, the expression levels of PR-A and PR-B remained constant
(Fig.1C). The results demonstrate specific ligand and receptor-mediated activation of the
FR-α promoter by PR which differs from that of a classical PR target promoter in receptor subtype specificity.
HeLa cells transiently transfected with PR-B showed an increase in FR-α promoter-
luciferase activity upon treatment with RU486 either alone or in combination with R5020
(Fig.1D). Under similar conditions RU486 acted as an antagonist of PR-A/R5020 on the
FR-α promoter (Fig.1D). Both PR-A/R5020 and PR-B/R5020 failed to activate RU486-
treated cells when transfected with the GRE2e1b-luciferase reporter construct (Fig.1D).
The result shows selective induction of the FR-α promoter by RU486 under conditions in
which it antagonizes ligand-dependent activation of a classical GRE-dependent promoter.
In FR-α - positive recombinant T47D breast cancer cells that express either PR-A (T47D-
A cells) or PR-B (T47D-B cells), the transfected FR-α promoter-luc (Fig.2A) was up-
regulated by R5020. In contrast, RU486 acted as an antagonist of R5020 in T47D-A cells
but as an agonist in T47D-B cells in regulating the FR-α promoter activity (Fig.2A).
Consistent with these observations, R5020 increased endogenous FR-α mRNA in both
T47D-A and T47D-B cells and RU486 increased the FR-α mRNA in T47D-B cells alone
110 (Fig.2B). Thus transcription of the FR-α gene is positively regulated by R5020 through both PR-A and PR-B whereas RU486 antagonizes the activation of the FR-α gene by
R5020/PR-A but positively regulates the gene through PR-B.
The target site of PR action is the G/C-rich element in the minimal P4 promoter: Fig.
3A shows a variety of deletion and chimeric constructs of the FR-α promoter region that
were used to identify the target site for the agonistic action of R5020/PRA, R5020/PR-B
and RU486/PR-B in the FR-α gene. The full length promoter construct spanning both the
P1 and P4 promoters (-3,394nt to +33nt) could be deleted from the 5’ end up to the most proximal and essential G/C-rich (non-canonical Sp1 binding) element of the P4 promoter without the loss of its typical PR-A (Fig.3B) or PR-B (Fig.3C) dependent regulation by
R5020 or RU486 albeit to a lesser magnitude; however, the magnitude of the PR ligand
effects of the full length promoter construct was restored if the additional non-canonical
Sp1 elements of the P4 promoter were included (Fig.3B and Fig.3C). To test the requirement for a G/C-rich element in mediating the PR effects, these elements in the P4 promoter (-272nt to -35nt) were replaced with a TATA box; the chimeric TATA box - driven promoter lost the regulation by both R5020 and RU486 through either PR-A
(Fig.3B) or PR-B (Fig.3C) suggesting the requirement for at least one G/C-rich element.
A role for G/C-rich elements in the regulation of the P4 promoter by PR ligands was also evident from the observation that replacing the non-canonical Sp1 elements in the P4 promoter with a strong cluster of six canonical Sp1 elements derived from the SV40 promoter significantly increased the magnitude of the induction of the promoter by
R5020 or RU486 through PR-A (Fig.3B) or PR-B (Fig.3C). The above results
111 demonstrate that PR ligands regulate the FR-α gene through its minimal P4 promoter and
also collectively confirm the role of Sp1 binding G/C-rich elements in mediating the
ligand-dependent trans-activation of the promoter by PR.
Certain Sp family proteins support the regulation of the FR-α promoter by PR: Since
functional G/C-rich cis elements are known to bind the Sp family transcription factors,
the potential roles of the Sp family proteins, Sp1, Sp3 and Sp4, in mediating PR
regulation of the FR-α promoter was examined. Over-expression of Sp1 and Sp4 but not
Sp3 enhanced the agonistic action of R5020/PR-A, R5020/PR-B and RU486/PR-B on the
promoter (Fig.4A and Fig.4B). Over-expression of each Sp protein was confirmed by
western blot (data not shown). The functionality of all three over-expressed proteins was
evident from the fact that the basal P4 promoter activity was increased by the transfected
Sp1, Sp3 and Sp4 by 35, 26 and 103 percent, respectively (not shown in Fig. 4).
When the endogenous Sp1 in T47D-A (Fig. 4C) or T47D-B (Fig. 4D) cells was knocked
down, the activation of the FR-α promoter by R5020 or RU486 was greatly decreased.
The activation by PR ligands in both cell lines was restored upon simultaneous ectopic
expression of either Sp1 or Sp4 (Fig. 4C and Fig. 4D). In this experiment, knockdown or
overexpression of Sp proteins was confirmed by western blot (Fig. 4E).
The results show that both Sp1 and Sp4 but not Sp3 must mediate the regulation of the
FR-α gene through the G/C-rich elements of the P4 promoter.
112 PR ligand action on the FR-α promoter is delayed: The time course of action of PR
ligands on the promoter was determined in relation to the GRE2e1b promoter, a known
direct target of PR action. Fig.5A shows that the GRE2e1b promoter was activated by
R5020/PR-B close to the optimal level within 3h-6h. In contrast, under identical
conditions, activation of the FR-α promoter by R5020/PR-A (Fig.5B), R5020/PR-B
(Fig.5C) was only discernible at 12h and showed a progressive increase up to 48h. This
delayed response of the FR-α promoter suggested that this gene may not be a direct target
of PR action.
New protein synthesis is required for the regulation of the FR-α promoter by PR: The relatively slow time course of activation of the FR-α promoter by PR noted above suggested that the promoter may be an indirect or downstream target of PR action and that the protein product of one or more upstream or direct target genes of PR may be required to mediate this indirect regulation. To test this possibility, the effect of blocking de novo protein synthesis using cycloheximide (CHX) during a 12h period of treatment with PR ligands on the activity of the FR-α promoter was examined (Fig.6). In HeLa cells expressing PR-A, CHX effectively blocked the R5020-induced increase in the reporter mRNA generated from the FR-α P4 promoter plasmid (Fig. 6A). Similarly CHX also blocked the promoter activity induced by either R5020 or RU486 in cells expressing PR-
B (Fig.6B). In contrast, CHX did not affect the activity of the control GRE2e1b promoter, a known direct target promoter of PR (Fig.6C). In the presence of CHX, there was no significant increase in luciferase enzyme activity, indicating complete inhibition of
113 protein synthesis (data not shown). The results demonstrate that the ligand-dependent
action of PR on the FR-α promoter is indirect and requires intermediate protein synthesis.
The PR ligand effects on the endogenous genes for FR-α, thymidine kinase-1 (TK1)
and p27 are similar and also require new protein synthesis: The preceding experiments
indicate that the regulation of the FR-α promoter by PR is indirect and that this is mediated by G/C-rich rich cis-elements in the promoter and their cognate trans-factors
Sp1 or Sp4. It was therefore of interest to examine whether such an indirect mechanism
was relevant to PR regulation of the endogenous FR-α gene and as well other target genes
of PR including TK1 and p27 in which it has been previously shown that Sp1 elements
rather than classical response elements mediate induction by progestin.
Unlike TK1, the optimal increase in p27 reportedly occurs in the second phase of the
cell’s biphasic response to progestin (Groshong et al., 1997). After 48h of treatment, both
R5020 and RU486 substantially (by > 5-fold) up-regulated the endogenous mRNA for
p27 in T47D-B cells (Fig.7); R5020 also increased the p27 mRNA by ~8-fold in T47D-A
cells but RU486 was an antagonist of this effect (Fig.7).
In both T47D-A and T47D-B cells, treatment with CHX under the experimental
conditions used in Fig.8 virtually completely blocked protein synthesis as seen by the loss
of the p21 protein either in the absence or in the presence of R5020 or RU486 (Fig.8A).
In both T47D-A and T47D-B cells (Fig.8B) a 12h treatment with the appropriate PR ligand resulted in an increase in the endogenous FR-α mRNA in cells harvested 12h after
114 the treatment. However, treatment with CHX beginning 2h prior to and during the 12h treatment with PR ligands blocked this increase in the FR-α mRNA (Fig.8B). A similar experiment was performed for TK1 with the exception that since TK1 is down-regulated in the later phase of the progestin response, the mRNA was measured at the end of the
12h treatment with ligand (8C); CHX blocked the induction of the TK1 mRNA by R5020 or RU486. Similar results were obtained for the endogenous mRNA for p27 (Fig.8D). In
Fig.8, the c-myc gene which is a known direct target for PR was used as a control. CHX did not block the induction of c-myc mRNA by R5020 (Fig.8E). It is thus evident that the
endogenous genes for FRα, TK1 and p27 are all regulated by PR indirectly in a manner
that requires new protein synthesis.
PR does not associate with its target elements in the endogenous FR-α, TK1 or p27
genes either basally or in response to ligand: The preceding experiments suggested that
in contrast to the c-myc gene, the genes encoding FR-α, TK1 and p27 were regulated by
PR ligands though the product(s) of an upstream direct target gene(s). ChIP assays were designed to further test whether PR was recruited to the promoters in the endogenous genes for FR-α, TK1 and p27 either in the absence or in response to treatment of cells with PR ligands (Fig.9). Quantitative analysis by Real Time PCR of ChIP signals from immunoprecipitated chromatin fragments using antibody to PR showed strong ligand- induced signals for the PRE region in the c-myc gene that was well above the background signal obtained from PCR amplification of a distal sequence from a coding exon chosen as the irrelevant target (Fig. 9). In contrast, the ChIP signals obtained for the G/C-rich promoter regions in the FR-α, p27 and TK1 genes corresponded to the background levels
115 for their respective irrelevant targets chosen within distal coding exons (Fig. 9). Non-
immune IgG (negative control) did not give a significant ChIP signal above the
background in any case (data not shown). It was separately confirmed that all of the Real
Time PCR primers and probes used in this experiment were capable of efficiently
amplifying their target DNA sequences (Table 2). The results indicate that PR does not
specifically associate with the promoter regions of the endogenous genes encoding FR-α, p27 or TK1 in contrast to c-myc promoter either in the absence or in the presence of ligand.
PR ligands neither alter the expression of Sp proteins or change their association with
the endogenous genes encoding FR-α, TK1 and p27: Since Sp1 and Sp4 mediated the induction of the FR-α promoter by PR, the possibility that PR ligands increased either the
expression of Sp1/Sp4 or their association with the promoters for FR-α, TK1 or p27 was tested. Treating T47D-A or T47D-B cells with R5020 or RU486 did not significantly alter the expression of either Sp1 or Sp4 (data not shown). ChIP assays designed to detect a possible change in the association of Sp1 or Sp4 with the functional G/C-rich elements within the basal promoters for the endogenous genes encoding FR-α, p27 and TK1
showed a specific association of both these proteins with the promoters; however, the
Sp1/Sp4 interactions with the promoters were not significantly different in groups treated
for 30min, 90min or 180min with vehicle, R5020 or RU486 (data not shown). This result indicates that PR ligands can neither increase the association of Sp1 or Sp4 with their cognate functional cis-elements in the FR-α, p27 or TK1 genes nor induce any other
DNA binding protein that could displace them.
116
The delayed effect of R5020 on the expression of FR-α, p27, TK1 and p21 genes is temporally related to recruitment of RNA polymerase II to the G/C-rich regions in the basal promoters of the endogenous genes: To confirm the delayed activation of transcription by PR agonist, ChIP assays were used to measure the association of RNA polymerase II (Pol II) with the basal promoters of the endogenous genes for FR-α, p27,
TK1 and p21 as a function of time of treatment with R5020 (Fig. 10). The C-myc gene promoter which is a direct target of PR regulation was used as a positive control. In
T47D-B cells, there was a basal association of Pol II with the promoter region and R5020 greatly increased the specific association of Pol II within 1hour (Fig. 10A). In contrast, in the FR-α (Fig. 10B), p27 (Fig. 10C) and TK1 (Fig. 10D) gene promoters, ligand-induced association of Pol II only occurred between 6 and 12 hours of treatment. The p21 gene which also lacks a classical response element for PR and is dependent on G/C-rich elements for PR regulation was also analyzed in this manner (Fig. 10E). Although
R5020-induced association of Pol II with the p21 gene promoter was delayed compared to the C-myc gene promoter, it occurred earlier (by 6 hours) than in the FR-α, p27 and
TK1 gene promoters (Fig. 10E). This result suggests that whereas the PR ligand- dependent induction of the p21 gene may be indirect, cis-elements and trans-factors unique to the p21 gene may also play a role in mediating regulation by PR ligands.
117 DISCUSSION
Agonists and antagonists of PR produce profound physiological effects, principally by
altering global gene expression profiles in the target tissues. The altered gene expression
profiles presumably not only reflect changes in the activities of the direct target genes of
PR but also a host of downstream genes whose expression is altered as a consequence of the changes in expression of the direct PR target genes. A clinically significant aspect of
PR action is that agents such as RU486 that are used to antagonize PR action have the undesirable quality of acting as PR agonists in several situations (Bowden et al., 1989). In addition to understanding the means by which PR agonists influence global gene expression profiles it is therefore also important to fully understand the underlying
principles in the agonistic activity of RU486.
One aspect of significance in the present study is that the FR-α gene whose product is
potentially of great value in targeted drug delivery in cancer and as a diagnostic and
imaging marker may be up-regulated in the tumors using innocuous PR ligands. Inducing
FR-α in this manner is potentially of value in combination therapies using the targeted
drugs and in enhancing the sensitivity of the diagnostic and imaging agents (Elnakat and
Ratnam, 2004; Elnakat and Ratnam, 2006). It may also be noted that genes such as FR-α
that are dependent on the binding of Sp family transcription factors for their basal
promoter activities represent a large class of genes, several important members of which have been shown to be regulated by PR ligands(Groshong et al., 1997; Owen et al., 1998;
Gao et al., 2001; Tang et al., 2002; Gizard et al., 2005). The nature of RU486 action and
PR subtype specificity of Sp1-dependent gene regulation by PR are both distinct from
118 those of classical PRE-mediated regulation. It is believed that this unique Sp1-dependent
gene regulation by PR occurs by direct interaction of PR with Sp1 in the target
promoters. Therefore the broader significance of the mechanistic studies of FR-α
regulation by PR is demonstrated here by extension to the TK1, p27 and p21 genes
leading to a more accurate understanding of how PR ligands regulate genes through Sp1
and the agonistic action of RU486 on this regulation.
In contrast to a typical GRE-driven promoter that is activated by R5020 predominantly
through PR-B, both PR-A and PR-B showed a comparable ability to mediate activation of
the FR-α P4 promoter and the endogenous FR-α gene by R5020. RU486 on the other
hand behaved as an antagonist of the activation of the FR-α promoter and the FR-α gene by R5020/PR-A but as an agonist through PR-B in contrast to its antagonistic activity on a GRE-driven promoter both through PR-A and PR-B. These observations also apply to the induction of the genes encoding TK1, p27 and p21 that do not have the classical response elements for PR but whose basal promoters are Sp1-dependent. The requirement for Sp1 or Sp4 and their cognate G/C-rich cis-elements in mediating PR regulation of the
FR-α promoter is clear from the following observations: (i) the entire DNA sequence upstream of the functional Sp1 (G/C-rich) elements in the core P4 promoter could be deleted without affecting the nature or magnitude of PR regulation; (ii) Each of the three non-canonical Sp1 elements in the P4 promoter contributed to the magnitude of the PR effect; (iii) substituting the natural Sp1 elements of the P4 promoter with a stronger cluster of six Sp1 elements derived from the SV40 promoter increased the magnitude of the PR effect; (iv) substituting the Sp1 elements of the P4 promoter with a TATA-box
119 element abrogated the regulation by PR (v) over-expression of Sp1 or Sp4 but not Sp3
increased the magnitude of the PR effect and conversely, knocking down Sp1 decreased
the PR response in a manner that was reversed by ectopic over-expression of either Sp1 or Sp4.
This study undertook a reexamination of the literature data suggesting that the distinctive
activation of several Sp1-dependent genes by R5020 as well as RU486 could be mediated
by ligand-dependent association of PR with Sp1 in their basal promoters. Complementary lines of evidence used in this study indicate that the regulation of the natural FR-α
promoter by PR is actually indirect. They include the observation that the action of PR
ligands on the promoter including the increase in RNA polymerase II recruitment is
considerably delayed in comparison with their action on a GRE-driven promoter and that
intermediate new protein synthesis is required for the delayed induction of the promoter
or of endogenous FR-α mRNA. The inability of PR to associate with the endogenous
promoter examined by ChIP either in the absence or in the presence of PR ligands in contrast to the c-myc promoter further confirms that the action of PR on the FR-α gene is indirect. This study has also extended this conclusion to the TK1, p27 and p21 genes. The physiologic relevance of this indirect gene regulation by PR is clearly exemplified in both phases of the reported (Groshong et al., 1997) biphasic response of breast cancer cells to progesterone in which there is first a stimulation of the cell cycle accompanied by an induction of TK1 followed by a delayed induction of p27 associated with G1 phase arrest. The time period for the delayed response of the p21 gene, however was shorter
120 than that of the TK1 or the p27 genes, suggesting a possible influence of additional target
gene-specific factors in the PR ligand response.
The detailed studies reported here contradict the suggestion supported by limited
observations (Owen et al., 1998; Gizard et al., 2005) that Sp1 can directly recruit PR to
its target promoters to mediate ligand-dependent trans-activation. Besides the role of Sp1
binding DNA elements in promoter regulation by PR, the basis for the suggestion
included in vitro co-immunoprecipitation of PR and Sp1 (Owen et al., 1998) an observation whose relevance could be limited to physiologic situations that would mimic the over-expression systems used. The second study (Gizard et al., 2005) used ChIP
assays to show an apparent association of PR with the target promoter but did not
establish ligand-dependence for this association, was not quantitative and was not
supported by complementary data. The more extensive studies in the present report of the
delayed Sp-dependent response of several target promoters to PR ligands showed that in
no case did PR associate even basally with the promoter.
The Sp-mediated regulation of genes by PR is clearly distinct from the non-classical
mechanisms by which transcription factors such as Sp proteins (Safe and Kim, 2004) and
AP-1 (Jakacka et al., 2001) mediate direct transcriptional regulation by ER independent
of a classical estrogen-response element. Sp1, Sp3 and Sp4 are known to recruit ER to
G/C-rich elements by interacting with specific ER domains to transactivate genes in a cell
type, ER subtype and promoter context-dependent manner (Castro-Rivera and Safe,
2003; Kim et al., 2003; Safe and Kim, 2004; Stoner et al., 2004; Higgins et al., 2006).
121 Indeed, ER also regulates the FR-α gene; however this regulation is repressive consistent with the frequently opposing physiologic effects of estrogen and progesterone (Kelley et al., 2003).
PR ligands altered neither the expression levels of several Sp proteins nor the association of Sp1 or Sp4 with the promoter regions of the endogenous FR-α, TK1 or p27 genes observed by ChIP. Therefore it is unlikely that they induced some other DNA binding transcription factor that could bind to G/C-rich elements to increase transcriptional activity. The simplest explanation consistent with the observed nature of the indirect Sp1- dependent regulation of genes by PR is that the action of PR ligands results in the generation of a co-activator of Sp1-dependent trans-activation of the target genes. The gene encoding the putative co-activator may itself be either a direct or an indirect target of PR. In any event, the promoter and cell context of the direct target gene of PR in this pathway must allow RU486 to act as a PR agonist and its activation by RU486/PR-B must be the key step in the positive regulation of a variety of Sp1-dependent genes by
RU486. This direct target gene of PR must also mediate the indirect Sp1-dependent gene regulation by R5020. The broad applicability of the results in this study to a variety of indirect target genes of PR that are important in regulating cell growth and physiology presents a compelling case to attempt the identification of the putative Sp1 co-activator and as well the relevant direct target gene of PR in future studies.
122
MATERIALS AND METHODS
Chemicals and reagents.
DMEM, MEM, LipofectAMINE 2000, Opti-MEM reduced serum medium, Geneticin and the penicillin/streptomycin/L-glutamine stock mix were purchased from Life
Technologies, Inc. (Carlsbad, CA). Fetal bovine serum (FBS) was purchased from Irvine
Scientific (Santa Ana, CA). FuGENE 6 was purchased from Roche Diagnostics
(Indianapolis, IN). Promegestone (R5020) was from Berkin Elmer (Shelton, CT).
Luciferase assay reagents were from Promega (Madison, WI). Mifepristone (RU486),
100X non essential amino acids, cycloheximide (CHX) and mouse anti-tubulin clone B-
5-1-2 antibody were from Sigma (St. Louis, Mo). Protein A coated magnetic beads and
Vent DNA polymerase were from New England Biolabs (Beverly, MA). Affinity- purified rabbit anti-human antibodies to RNA polymerase II [Pol II (H-224)], Sp1
(PEP2), Sp4 (V-20), rabbit polyclonal IgG against PR (C-20) and mouse anti-human antibody to GAPDH were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).
Custom oligonucleotide primers were from Life Technologies (Carlsbad,CA). The reagents for real-time Reverse Transcription-PCR were from Applied Biosystems
(Branchburg, NJ).
Cell culture and transfection.
Hela cells were purchased from American Type Culture Collection (Rockville, MD).
Recombinant T47D cells that express either PR-A (T47D-A) or PR-B (T47D-B) were a generous gift from Dr Kathryn B. Horwitz (University of Colorado). Cells were grown in
123 10 cm tissue culture plates at 37°C in 5% CO2 in the appropriate cell culture media.
HeLa cells were routinely cultured in DMEM supplemented with FBS (10%), 100
units/mL penicillin, 100 µg/mL streptomycin, and 2 mmol/L L-glutamine. T47D-A and
T47D-B cells were cultured in MEM supplemented with 5% FBS, 1X of non essential
amino acids, 6ng/ml insulin and 200μg/ml Geneticin. For treatment with various agents
(R5020, RU486, CHX) and for transfection, cells were grown in phenol red–free DMEM
supplemented with charcoal-stripped FBS (5% v/v), penicillin (100 units/mL),
streptomycin (100 mg/mL), L-glutamine (2 mmol/L), insulin (2 µg/mL), and transferrin
(40 µg/mL). Transfections with various plasmid constructs were carried out in six-well
plates (Corning, New York, NY) using FuGENE 6 (Roche Diagnostics) for HeLa cells
and lipofectAMINE 2000 for T47D cells. The transfection method followed the
manufacturers’ suggested protocols. Uniformity of transfection with promoter constructs
attached to the firefly luciferase reporter was ensured by co-transfection with a renilla
luciferase expression plasmid and monitoring the activity of renilla luciferase.
Promoter constructs, expression plasmids and Sp1 knockdown:
Construct design made use of either natural restriction sites or restriction sites created by the addition of the appropriate sequences to upstream and downstream PCR primers. The
PCR products were first digested at both ends with the appropriate restriction enzymes and cloned into the PGL3-basic plasmid (Promega) or subcloned into the FR-α promoter construct (-3394nt to +33nt, relative to the transcription initiation site at +1nt) in the
PGL3 basic plasmid. Construction of the FR-α -3394nt to -47nt/SV40(GC)6 construct is described elsewhere (Tran et al., 2005). The 5' deletion constructs of the FR-α promoter,
124 i.e., -272nt to +33nt, -116nt to +33nt, and -49nt to +33nt were all constructed by PCR
using the appropriate primers and subcloned at MluI (upstream) and XhoI (downstream)
sites in the pGL3 basic plasmid. In the TATA+ FR-α -35nt to +33nt construct, a TATA-
box element (5'-AATAATTAA-3') was placed upstream of the most proximal Sp1 element in the FR-α promoter, i.e., upstream of FR-α -35nt to +33nt by the PCR method.
The recombinant plasmids were amplified in E. coli strain XL1Blue and purified using
the Qiagen plasmid kit (Qiagen, Chatsworth, CA). The entire cloned DNA sequence in
each construct was verified by automated DNA sequence analysis.
The GRE2e1b promoter-luciferase plasmid and the expression plasmids for PR-A and
PR-B were kindly provided by Dr. Brian Rowan (Tulane University Health Sciences
Center). The expression plasmids for Sp1 and Sp3 were provided by Dr. Sumudra
Periyasamy (Medical University of Ohio). The expression plasmid for Sp4 was provided
by Dr. Guntram Suske (Institut for Molekularbiologie und Tumorforschung Philipps-
Universitat Marburg). The shRNA expression plasmid for knocking down Sp1 was
purchased from Sigma (St. Louis, Mo). For the knockdown experiments the Amaxa
Nucleofection System (Amaxa Biosystems) was used to deliver the shRNA to T47D cells
according to the vendor’s protocol.
Preparation of cell lysates and luciferase assay.
Cells in each well of a six-well tissue culture plate were washed once with phosphate
buffered saline (PBS) of pH 7.5 (2 mmol/L KH2PO4, 2.7 mmol/L KCl, 10 mmol/L
Na2HPO4, 137 mmol/L NaCl) and lysed in 400 µL of reporter lysis buffer provided with
125 the luciferase assay system (Promega). The samples were centrifuged at 12,000 x g for 2 min at room temperature. The supernatant was assayed for luciferase activity in a luminometer (Lumat LB9501, Berthold, Wildbad, Germany) using the luciferase substrate from Promega. All luciferase experiments were done at least in triplicate.
Real-time RT-PCR and real time PCR analyses.
Total RNA for Real-time Reverse Transcription-PCR (RT-PCR) was prepared using the
RNeasy Mini kit purchased from Qiagen. Real-time RT-PCR was used to measure the mRNA for luciferase, FR-α, TK1, p27 or c-myc. The mRNA for glyceraldehyde-3- phosphate dehydrogenase (GAPDH) was also measured by real time RT-PCR in the same samples. For the real time RT-PCR, the reverse transcription step was carried out
following standard procedures. Essentially, 200 ng of total RNA was mixed with random
hexamer primers (5 x 10-4 absorbance units/µL), RNase inhibitor (1 unit/µL), Moloney
murine leukemia virus reverse transcriptase (5 units/µL), and deoxynucleoside
triphosphates (1.0 mmol/L each) in reverse transcriptase buffer [50 mmol/L potassium
chloride and 10 mmol/L Tris-HCl (pH 8.3)]. The 10 µL reaction mixture was first
incubated at 25°C for 10 min, then at 42°C for 15 min and finally at 99°C for 6.5 min.
The subsequent real-time PCR step was carried out in the presence of 12.5 µL of PCR
Mastermix (Applied Biosystems). 0.5 µL each of the forward primer and reverse primer
and 0.5 µL of the TaqMan probe were used in the reaction. The sequences of the forward
and reverse probes and the appropriate TaqMan probe for each target are listed in Table
1. The primers and the TaqMan probe for the control GAPDH gene were purchased from
Applied Biosystems. The PCR conditions were 2 min at 50°C, then 10 min at 95°C,
126 followed by 40 cycles each of 15 seconds at 90°C and 1 min at 60°C. Fluorescence data
generated were monitored and recorded on a 7500 Real Time PCR sequence detection
system (Applied Biosystems). All samples were assayed in triplicate and normalized to
GAPDH values.
Western blot analysis.
Cells were harvested after washing two times with cold PBS. The cells were lysed with
High Salt buffer (400 mM NaCl; 10 mM Tris, pH 8.0; 1 mM EDTA; 1 mM EGTA; b-
mercaptoethanol ; 0.1% Triton X-100) containing a protease inhibitor cocktail (1 mM
phenyl methyl sulphonyl fluoride and 5 µg/mL each of aprotinin, leupeptin, and pepstatinA). Protein samples (20-50 µg) were resolved by electrophoresis on 8% sodium dodecylsulfate-polyacrylamide gels and electrophoretically transferred to nitrocellulose membranes. The blots were probed with the appropriate primary antibodies followed by goat anti-rabbit IgG or goat anti-mouse IgG conjugated to horseradish peroxidase and visualized using the enhanced chemiluminescence method. The same membrane was then similarly re-probed with a primary mouse anti-tubulin antibody and secondary goat anti- mouse IgG conjugated to horseradish peroxidase. The membranes were also stained using
Coomassie blue to ensure uniform sample loading.
Quantitative chromatin immunoprecipitation (ChIP) assay.
T47D-A cells or T47D-B were grown in 10-mm plates and treated as appropriate for each experiment. For the ChIP assays, the cells were then washed twice with ice-cold PBS and fixed with formaldehyde (1% final concentration) for 15 min at room temperature. Then
127 the cells were washed with ice-cold PBS twice and collected in 100 mM Tris-HCL (pH
9.0) and 10 mM dithiothreitol. After a 15 min incubation at 30ºC the cells were washed
twice with ice-cold PBS and lysed in ChIP lysis buffer [1% sodium dodecylsulfate, 10
mM EDTA, 50 mM Tris-HCl (pH 8.1) plus protease inhibitor cocktail (1 mM PMSF; and
5 µg/mL each of aprotinin, leupeptin, and pepstatinA)]and incubated on ice. 10 min later
the samples were sonicated on ice with a sonic dismembrator (Fisher Scientific
Company, Pittsburgh, PA) at output 3 for 10 seconds pulse-on time followed by 40
seconds pulse-off time, and this procedure was repeated 3 times resulting in chromatin
fragmented to an average length of about 500 bp. The samples were then centrifuged at
16000 x g for 10 min. The supernatant was diluted 10- fold in ChIP dilution buffer (1%
Triton X-100; 2 mM EDTA; 150 mM NaCl; 20 mM Tris-HCl pH 8.1; plus the protease
inhibitor cocktail) and pre-cleared with 2 μg of normal rabbit IgG and 5 µl of Protein-A
coated magnetic beads. The beads were then separated on a magnetic rack. 10% of the
supernatant was set aside for input measurements. 2 µg of the appropriate antibody [anti-
Sp1 (sc-59), anti-PR (sc-539X), anti Pol II (sc-9001) or normal rabbit IgG from Santa
Cruz Biotechnology] was added to the supernatant and incubated overnight on a rotary shaker at 4ºC. Then the samples were mixed with sonicated salmon sperm DNA (100
µg/mL) and 5 µL of Protein A magnetic beads for a 6h incubation at 4ºC. The beads were then washed for 5 min each, first with Low Salt Buffer (0.1 % SDS; 1% Triton X-100;
2mM EDTA;20 mM Tris-HCl, pH 8.1; 150 NaCl) followed by High Salt buffer (0.1 %
SDS; 1% Triton X-100; 2mM EDTA;20 mM Tris-HCl, pH 8.1; 500 mM NaCl) and
finally with LiCl buffer (0.25 M LiCl; 1% Nonidet P-40; 1% deoxycholate; 1mM EDTA;
10 mM Tris-HCl, pH 8.1). The beads were washed with TE buffer (10 mM Tris-HCl pH
128 8.0; 1 mM EDTA) three times for 5 min each time. The immunoprecipitated chromatin complexes were removed from the beads and de-cross-linked by incubation for 6 h at
65ºC in 100 µl of 1% SDS/ 0.1 M NaHCO3 with intermittent vortexing. DNA was purified from the samples using the QIAquick Spin Kit (QIAGEN, Chatsworth,CA) according to the manufacturer’s protocol. 10 μl of the extracted DNA was used in real time PCR assays to measure the appropriate ChIP target DNA. All of the forward and reverse primers and TaqMan probes used for the various target sequences in the ChIP assays are shown in Table 1. The ability of the various PCR primers and TaqMan probes to amplify the target sequences is shown in Table 2. Every sample was assayed in triplicate.
Statistical analysis:
Results are presented as mean +/- standard error. The significance of statistical
differences (P values) between the indicated groups in each experiment was determined
using ANOVA.
ACKNOWLEDGMENT
We are grateful to Dr. Kathryn B. Horwitz for her generosity in providing the T47D-A
and T47D-B cells. We thank Dr. Brian Rowan, Dr. Sumudra Periaswamy and Dr.
Guntram Suske for sharing various expression plasmids. We thank Mariana Stoeva for
technical assistance.
129
REFERENCES
Attia, G.R., Zeitoun, K., Edwards, D., Johns, A., Carr, B.R. and Bulun, S.E.:
Progesterone receptor isoform A but not B is expressed in endometriosis. J Clin
Endocrinol Metab 85 (2000) 2897-902.
Beck, C.A., Weigel, N.L., Moyer, M.L., Nordeen, S.K. and Edwards, D.P.: The
progesterone antagonist RU486 acquires agonist activity upon stimulation of
cAMP signaling pathways. Proc Natl Acad Sci U S A 90 (1993) 4441-5.
Bowden, R.T., Hissom, J.R. and Moore, M.R.: Growth stimulation of T47D human breast
cancer cells by the anti-progestin RU486. Endocrinology 124 (1989) 2642-4.
Cadepond, F., Ulmann, A. and Baulieu, E.E.: RU486 (mifepristone): mechanisms of
action and clinical uses. Annu Rev Med 48 (1997) 129-56.
Castro-Rivera, E. and Safe, S.: 17 beta-estradiol- and 4-hydroxytamoxifen-induced
transactivation in breast, endometrial and liver cancer cells is dependent on ER-
subtype, cell and promoter context. J Steroid Biochem Mol Biol 84 (2003) 23-31.
Conneely, O.M. and Lydon, J.P.: Progesterone receptors in reproduction: functional
impact of the A and B isoforms. Steroids 65 (2000) 571-7.
130 DeMarzo, A.M., Onate, S.A., Nordeen, S.K. and Edwards, D.P.: Effects of the steroid
antagonist RU486 on dimerization of the human progesterone receptor.
Biochemistry 31 (1992) 10491-501.
Edwards, D.P.: The role of coactivators and corepressors in the biology and mechanism
of action of steroid hormone receptors. J Mammary Gland Biol Neoplasia 5
(2000) 307-24.
Elnakat, H. and Ratnam, M.: Distribution, functionality and gene regulation of folate
receptor isoforms: implications in targeted therapy. Adv Drug Deliv Rev 56
(2004) 1067-84.
Elnakat, H. and Ratnam, M.: Role of folate receptor genes in reproduction and related
cancers. Front Biosci 11 (2006) 506-19.
Gao, J., Mazella, J., Seppala, M. and Tseng, L.: Ligand activated hPR modulates the
glycodelin promoter activity through the Sp1 sites in human endometrial
adenocarcinoma cells. Mol Cell Endocrinol 176 (2001) 97-102.
Giangrande, P.H. and McDonnell, D.P.: The A and B isoforms of the human
progesterone receptor: two functionally different transcription factors encoded by
a single gene. Recent Prog Horm Res 54 (1999) 291-313; discussion 313-4.
131 Giangrande, P.H., Pollio, G. and McDonnell, D.P.: Mapping and characterization of the
functional domains responsible for the differential activity of the A and B
isoforms of the human progesterone receptor. J Biol Chem 272 (1997) 32889-900.
Gizard, F., Robillard, R., Gervois, P., Faucompre, A., Revillion, F., Peyrat, J.P., Hum,
W.D. and Staels, B.: Progesterone inhibits human breast cancer cell growth
through transcriptional upregulation of the cyclin-dependent kinase inhibitor
p27Kip1 gene. FEBS Lett 579 (2005) 5535-41.
Glass, C.K. and Rosenfeld, M.G.: The coregulator exchange in transcriptional functions
of nuclear receptors. Genes Dev 14 (2000) 121-41.
Graham, J.D. and Clarke, C.L.: Physiological action of progesterone in target tissues.
Endocr Rev 18 (1997) 502-19.
Groshong, S.D., Owen, G.I., Grimison, B., Schauer, I.E., Todd, M.C., Langan, T.A.,
Sclafani, R.A., Lange, C.A. and Horwitz, K.B.: Biphasic regulation of breast
cancer cell growth by progesterone: role of the cyclin-dependent kinase inhibitors,
p21 and p27(Kip1). Mol Endocrinol 11 (1997) 1593-607.
Higgins, K.J., Liu, S., Abdelrahim, M., Yoon, K., Vanderlaag, K., Porter, W., Metz, R.P.
and Safe, S.: Vascular endothelial growth factor receptor-2 expression is induced
by 17beta-estradiol in ZR-75 breast cancer cells by estrogen receptor alpha/Sp
proteins. Endocrinology 147 (2006) 3285-95.
132 Jakacka, M., Ito, M., Weiss, J., Chien, P.Y., Gehm, B.D. and Jameson, J.L.: Estrogen
receptor binding to DNA is not required for its activity through the nonclassical
AP1 pathway. J Biol Chem 276 (2001) 13615-21.
Kahmann, S., Vassen, L. and Klein-Hitpass, L.: Synergistic enhancement of PRB-
mediated RU486 and R5020 agonist activities through cyclic adenosine 3',5'-
monophosphate represents a delayed primary response. Mol Endocrinol 12 (1998)
278-89.
Kastner, P., Krust, A., Turcotte, B., Stropp, U., Tora, L., Gronemeyer, H. and Chambon,
P.: Two distinct estrogen-regulated promoters generate transcripts encoding the
two functionally different human progesterone receptor forms A and B. Embo J 9
(1990) 1603-14.
Kelley, K.M., Rowan, B.G. and Ratnam, M.: Modulation of the folate receptor alpha
gene by the estrogen receptor: mechanism and implications in tumor targeting.
Cancer Res 63 (2003) 2820-8.
Kim, K., Thu, N., Saville, B. and Safe, S.: Domains of estrogen receptor alpha (ERalpha)
required for ERalpha/Sp1-mediated activation of GC-rich promoters by estrogens
and antiestrogens in breast cancer cells. Mol Endocrinol 17 (2003) 804-17.
Leo, C. and Chen, J.D.: The SRC family of nuclear receptor coactivators. Gene 245
(2000) 1-11.
133 Lessey, B.A., Alexander, P.S. and Horwitz, K.B.: The subunit structure of human breast
cancer progesterone receptors: characterization by chromatography and
photoaffinity labeling. Endocrinology 112 (1983) 1267-74.
Liu, Z., Auboeuf, D., Wong, J., Chen, J.D., Tsai, S.Y., Tsai, M.J. and O'Malley, B.W.:
Coactivator/corepressor ratios modulate PR-mediated transcription by the
selective receptor modulator RU486. Proc Natl Acad Sci U S A 99 (2002) 7940-4.
Mahajan, D.K. and London, S.N.: Mifepristone (RU486): a review. Fertil Steril 68 (1997)
967-76.
Meyer, M.E., Pornon, A., Ji, J.W., Bocquel, M.T., Chambon, P. and Gronemeyer, H.:
Agonistic and antagonistic activities of RU486 on the functions of the human
progesterone receptor. Embo J 9 (1990) 3923-32.
Meyer, M.E., Quirin-Stricker, C., Lerouge, T., Bocquel, M.T. and Gronemeyer, H.: A
limiting factor mediates the differential activation of promoters by the human
progesterone receptor isoforms. J Biol Chem 267 (1992) 10882-7.
Owen, G.I., Richer, J.K., Tung, L., Takimoto, G. and Horwitz, K.B.: Progesterone
regulates transcription of the p21(WAF1) cyclin- dependent kinase inhibitor gene
through Sp1 and CBP/p300. J Biol Chem 273 (1998) 10696-701.
Rao, B.R. and Wiest, W.G.: Receptors for progesterone. Gynecol Oncol 2 (1974) 239-48.
134 Rao, B.R., Wiest, W.G. and Allen, W.M.: Progesterone "receptor" in human
endometrium. Endocrinology 95 (1974) 1275-81.
Richer, J.K., Jacobsen, B.M., Manning, N.G., Abel, M.G., Wolf, D.M. and Horwitz,
K.B.: Differential gene regulation by the two progesterone receptor isoforms in
human breast cancer cells. J Biol Chem 277 (2002) 5209-18.
Safe, S. and Kim, K.: Nuclear receptor-mediated transactivation through interaction with
Sp proteins. Prog Nucleic Acid Res Mol Biol 77 (2004) 1-36.
Sartorius, C.A., Tung, L., Takimoto, G.S. and Horwitz, K.B.: Antagonist-occupied
human progesterone receptors bound to DNA are functionally switched to
transcriptional agonists by cAMP. J Biol Chem 268 (1993) 9262-6.
Schindler, A.E., Campagnoli, C., Druckmann, R., Huber, J., Pasqualini, J.R., Schweppe,
K.W. and Thijssen, J.H.: Classification and pharmacology of progestins.
Maturitas 46 Suppl 1 (2003) S7-S16.
Skafar, D.F.: Dimerization of the RU486-bound calf uterine progesterone receptor. J
Steroid Biochem Mol Biol 44 (1993) 39-43.
Spitz, I.M.: Progesterone antagonists and progesterone receptor modulators: an overview.
Steroids 68 (2003) 981-93.
135 Stoner, M., Wormke, M., Saville, B., Samudio, I., Qin, C., Abdelrahim, M. and Safe, S.:
Estrogen regulation of vascular endothelial growth factor gene expression in ZR-
75 breast cancer cells through interaction of estrogen receptor alpha and SP
proteins. Oncogene 23 (2004) 1052-63.
Tang, M., Mazella, J., Gao, J. and Tseng, L.: Progesterone receptor activates its promoter
activity in human endometrial stromal cells. Mol Cell Endocrinol 192 (2002) 45-
53.
Thomson, A.A., Ham, J., Bakker, O. and Parker, M.G.: The progesterone receptor can
regulate transcription in the absence of a functional TATA box element. J Biol
Chem 265 (1990) 16709-12.
Tora, L., Gronemeyer, H., Turcotte, B., Gaub, M.P. and Chambon, P.: The N-terminal
region of the chicken progesterone receptor specifies target gene activation.
Nature 333 (1988) 185-8.
Tran, T., Shatnawi, A., Zheng, X., Kelley, K.M. and Ratnam, M.: Enhancement of folate
receptor alpha expression in tumor cells through the glucocorticoid receptor: a
promising means to improved tumor detection and targeting. Cancer Res 65
(2005) 4431-41.
Tung, L., Mohamed, M.K., Hoeffler, J.P., Takimoto, G.S. and Horwitz, K.B.: Antagonist-
occupied human progesterone B-receptors activate transcription without binding
136 to progesterone response elements and are dominantly inhibited by A-receptors.
Mol Endocrinol 7 (1993) 1256-65.
Vegeto, E., Shahbaz, M.M., Wen, D.X., Goldman, M.E., O'Malley, B.W. and
McDonnell, D.P.: Human progesterone receptor A form is a cell- and promoter-
specific repressor of human progesterone receptor B function. Mol Endocrinol 7
(1993) 1244-55.
Wardell, S.E., Boonyaratanakornkit, V., Adelman, J.S., Aronheim, A. and Edwards, D.P.:
Jun dimerization protein 2 functions as a progesterone receptor N-terminal
domain coactivator. Mol Cell Biol 22 (2002) 5451-66.
137 Figure legend:
Figure 1: Ligand-dependent regulation of the FR-α promoter by PR: Hela cells
grown to 80% confluence were transfected with (A) full length FR-α promoter-luc or (B)
GRE2e1b promoter-luc and with expression plasmid for either PR-A or PR-B or with
empty vector; the cells were treated with the range of concentrations of R5020 or with vehicle and harvested 48 h later to measure luciferase activity. The values represent fold increase relative to the vehicle treated control. (C) Western blots of total cell lysates from the HeLa cells transfected in A with either PR-A or PR-B probed with antibody to PR-A
(top panels) and PR-B (bottom panels) respectively and re-probed with antibody to tubulin. (D) Hela cell cells were grown to 80% confluence and transfected with either
FR-α promoter-luc or GRE2e1b promoter-luc and co-transfected with PR-A or PR-B; the
cells were treated as indicated with R5020 and/or RU486 and/or vehicle and harvested to
measure luciferase activity at 48h. The values are represented as percent of maximum
activity of either FR-α promoter-luc or GRE2e1b promoter-luc. All of the determinations
were made in triplicate and the standard deviations are indicated. In panel A, P<0.0001
for a vs c, e, g or i; b vs d, f, h or j. In panel B, P<0.001 for c vs. a or d; b vs d; f vs e; h
vs g and j vs i. In panel C, P<0.0001 for g vs a, b, d or f; c vs e or h.
Figure 2: Regulation of the FR-α promoter and induction of endogenous FR-α
mRNA in T47D-A and T47D-B cells by PR ligands: (A) T47D-A or T47D-B cells
were transfected with FR-α promoter-luc and treated with 50 nM of each ligand as
indicated. After 48h the cells were lysed to measure luciferase activity. The values
138 represent the relative luciferase activity unit (B) T47D-A or T47D-B cells were treated
with vehicle or with 50nM of either R5020 or RU486 and 48h later the cells were
harvested and total RNA extracted. The RNA was subjected to Real Time RT-PCR to
measure mRNA for FR-α or GAPDH. The values represent fold induction of FR-α
mRNA compared to vehicle treated controls and normalized to GAPDH. In panel A,
P<0.0001 for a vs b; c vs d, e or f. In panel B, P<0.0001 for a vs b; c vs d or e.
Figure 3: Mapping and characterizing the target site of PR action in the FR-α
promoter: (A) Schematic representation of various promoter-luciferase reporter
constructs. The figure shows the full-length FR-α promoter including both the P1 and P4
basal promoters (FRα-3394nt to +33 nt) and its 5’ deleted versions (FRα -272nt to +33nt)
, (FRα -116nt to +33nt) and (FRα -49nt to +33nt). The [FRα-3394nt to -47nt/
SV40(GC)6] construct represents a chimeric FR-α/SV40 promoter in which the G/C-rich
region of the FR-α promoter was replaced with six tandem G/C-rich elements from the
SV40 promoter. In (TATA- FRα -35nt to +33nt) the Sp1 binding site in construct (FRα -
49nt to +33nt) is replaced by a TATA box element. In B and C, Hela cells were transfected with the various promoter-luciferase constructs and co-transfected with PR-A
(B) or with PR-B (C) and treated as indicated with vehicle, 50nM R5020 or 50 nM
RU486 alone or in combination. After 48h of treatment the cells were lysed to measure
luciferase activity. The values for luciferase activity are expressed as the ratio to that for
the corresponding vehicle treated control. In panel B, P< 0.001 for b vs a or c; d vs c or e.
In panel C, P< 0.001 for d vs a or g; g vs m; e vs b or h; k vs h or n; f vs c or i; l vs i or o.
139 Figure 4: Effect of Sp family proteins on ligand-dependent activation of the FR-α P4
promoter by PR: HeLa cells were co-transfected with FRα -272nt to +33nt -luc and
expression plasmid for Sp1, Sp3 or Sp4 or with the empty vector and with expression
plasmid for PR-A (A) or PR-B (B). The cells were then treated with vehicle or with
R5020 (50nM) or RU486 (50nM) alone or in combination as indicated. The cells were
harvested to measure luciferase activity 48 h post-transfection. The data represent fold
increase in the luciferase activity compared to the corresponding vehicle control. T47D-A
cells (C) and T47D-B cells (D) were nucleofected with FRα -272nt to +33nt -luc and expression plasmid for Sp1, Sp4 or siRNA for Sp1 in the indicated combinations. 12 h later the cells were treated with vehicle, R5020 (50nM) or RU486 (50nM). After 48h of treatment the cells were harvested and assayed for luciferase activity. The data represent relative luciferase units. Panel E shows a western blot of total cell lysates from the T47D-
B cells nucleofected with expression vectors for Sp1, Sp4, Sp1 siRNA or a scrambled
siRNA control and probed with antibody to Sp1 (top panel) and Sp4 (middle panel) and
re-probed with antibody to GAPDH (bottom panel). In panel A, P < 0.0001 for a vs b or
c. In panel B, P< 0.0001 for a vs d or g; b vs e or h; c vs f or i. In panel C, P< 0.0001 for a vs c, e, or g; d vs b, f or h. In panel D, P< 0.0001 for a vs d, g, or j; b vs e; c vs f; e vs h
or k; f vs i or l.
Figure 5: Time course of R5020-dependent promoter activation by PR: Hela cells
were transfected with GRE2e1b promoter-luc (A) or FRα -272nt to +33nt-luc (B and C).
The cells were co-transfected with expression plasmid for PR-A (B) or PR-B (A and C).
24h after transfection, the cells were treated with either vehicle or R5020 (50nM) and
140 harvested at the indicated times. The luciferase activities measured in the cell lysates are expressed as ratios to the corresponding vehicle treated controls. In panel A, P< 0.001 for b vs a, c or d; d vs f. In panel B, P< 0.01 for b vs a or c; c vs d. In panel C, P< 0.001 for b vs a or c; c vs d.
Figure 6: Effect of cycloheximide on activation of the FR-α promoter by PR ligands:
Hela cells were transfected with (A) FRα -272nt to +33nt-luc (B) FRα -272nt to +33nt - luc and (C) GRE2e1b- promoter-luc. The cells were co-transfected with PR-A (A) or PR-
B (B and C). 48 h later the cells were pre-treated with either vehicle or cycloheximide (10
μM ) for 2h. At the end of the 2h pre-treatment, R5020 (50nM) or RU486 (50nM) was
introduced alone or in combination with cycloheximide and the incubation continued for
12 h. The cells were then harvested and total RNA was extracted. The mRNAs for
luciferse and GAPDH were measured by Real Time RT-PCR. The values for the reporter
were normalized to GAPDH. In panel A, P< 0.0001 for b vs a or c. In panel B, P< 0.001 for a vs b or c; b vs d; c vs e. In panel C, P< 0.0001 for a vs b or c.
Figure 7: Induction of endogenous p27 in T47D-A and T47D-B cells by PR ligands:
TA7D-A or T47D-B cells were treated with vehicle, R5020 (50nM) or RU486 (50nM).
48 h later the cells were harvested and the total RNA was extracted from the cells and
subjected to Real Time RT-PCR to measure the mRNAs for p27 and GAPDH. The
values for p27 mRNA are normalized to those for GAPDH. P<0.0001 for a vs b; c vs d or
e.
141 Figure 8: Effect of cycloheximide on activation of the endogenous genes for FR-α,
TK1 and p27: (A) T47D-A (left panel) or T47D-B cells (right panel) were pre-treated
with vehicle or with CHX (20 µmol/L) for 2h followed by the inclusion of vehicle,
R5020 (50nM) or RU486 (50nM) as indicated and incubated for a further 12h. The cells
were then harvested and the lysates subjected to western blot analyses to probe for p21
and the blots re-probed for tubulin. In B-E, T47D-A or T47D-B were pre-treated with
either cycloheximide (CHX) (20 µmol/L) or vehicle (V) for 2h followed by the addition
of vehicle, R5020 (50 nM) (R) or RU486 (50 nM) (RU) as indicated. Where indicated,
12h later after the treatment, CHX, R5020 and RU486 were removed by replacing with fresh media. The cells were harvested at the indicated times and total RNA extracted. The mRNAs for FR-α (B), TK1 (C), p27 (D) or c-myc (E) were measured by Real-Time RT-
PCR together with the mRNA for GAPDH. The mRNA values are normalized to those
for GAPDH. In panel B, P< 0.001 for b vs a or c; e vs d or f. In panel C, P< 0.001 for a
vs c; b vs d or e; d vs g; c vs f; e vs h. In panel D, P< 0.0005 for a vs b or c; b vs d; c vs e.
In panel E, P< 0.0001 for a vs b or c.
Figure 9: Quantitative chromatin immunoprecipitation assays to detect association of PR with endogenous genes: T47D-B cells were treated with vehicle, R5020 (50nM)
or RU486 (50nM) for 1.5h. The cells were subjected to ChIP assays as described under
Experimental Procedures using antibody against PR or normal IgG (negative control).
The target sequences for measurement of ChIP signals by Real Time PCR include the
PRE region in the c-myc promoter, Sp1 elements in the basal promoters of the genes
encoding FR-α , p27 and TK1 and as well sequences (irrelevant targets) distal to the
142 promoters of the c-myc, FR-α , p27 and TK1 genes (i.e., within their coding exons). The
ChIP signals are expressed as fold difference in relation to the corresponding irrelevant targets in the vehicle treated controls. The normal IgG control did not produce ChIP signals (data not shown). P< 0.0001 for b vs a, c or d.
Figure 10: Time course of induction of RNA polymerase II recruitment to various gene promoters by R5020: T47D-B cells were treated with vehicle or R5020 (50nM) for
1h, 3h, 6h, 12h, and 24h. The cells were subjected to ChIP assays as described under
Experimental Procedures using antibody against Pol II or normal IgG (negative control).
The target sequences for measurement of ChIP signals by real time PCR include the PRE elements in the basal promoter of the c-myc gene (A) or Sp1 elements in the basal promoters of the genes encoding FR-α (B), p27 (C), TK1 (D) and p21 (E) and as well coding exon sequences (irrelevant targets) distal to the promoters of the c-myc, FR-α, p27, TK1 and p21 genes. The ChIP signals are expressed as percent of the signal for the corresponding input. In panel A, P< 0.0001 for b vs a or c; d vs c or e; e vs f . In panel B,
P<0.0001 for a vs d or e; b vs d or e; c vs d. In panel C, P<0.0001 for a vs d or e; b vs d or e; c vs d. In panel D, P<0.0001 for d vs a, b or c. In panel E, P<0.0001 for a vs d,e or f; b vs d, e or f ; c vs d.
143 Figure 1 A B
14 GRE2e1b promoter-Luciferase 14 FR-α promoter-Luciferase 350 350 f Vector 12 12 i h g 300300 PR-A j Vector PR-B 10 d 10 250250 PR-A j PR-B 8 8 e h 200200
6 c 6 f 150 150
4 4 d 100100
2 b 50 Luciferase activity (fold increase) 2 a 50 c e g i Luciferase activity (fold increase) 0 a b 0 0 0
R5020(nM) 0 0.1 0.5 1 5 R5020(nM) 0 0.1 0.5 1 5
D C FR-α promoter-Luc +PR-A FR-α promoter-Luc +PR-B 120 120 GRE2e1b promoter-Luc +PR-A GRE2e1b promoter-Luc +PR-B c g Empty 100100 Expression plasmid Transfection Vector 80 80 R5020(nM) 0 0 0.1 0.5 1 5 PR-A 60 60 a b Tubulin 40 40 PR-B 20 20 Tubulin f h d e Luciferase activity (Percent of maximum) 0.0 0
R5020 (50nM) ---- +++ ---- +++ RU486 (50nM) ------+++ +++
144 Figure 2
A
12120000 Vehicle
4 R5020 10100000 b Ru486 R5020+Ru486 f
800008 e
60000 6 d
400004
c 200002 a Relative luciferase units x 10
0 0 12 T47D-A T47D-B Cells Cells
B
3.5 b Vehicle d e 33 R5020 RU486 2.5
ression p 22
1.5 a c
11 mRNA ex
α
0.5 FR-
0 0 12 T47D-A T47D-B Cells Cells
145 Figure 3 A
B
Vehicle PR-A e 12 R5020 Ru486 R5020+Ru486 8 b a c 4 d
0 Fold increase in promoter activity FRα -3394 FRα -272 FRα -116 FRα -49 FR-α -3394 TATA+FRα nt to +33nt nt to +33nt nt to +33nt nt to +33nt nt to -47 nt/ -35 nt to SV40(GC)6 +33 nt
C PR-B Vehicle o R5020 16 n Ru486 R5020+Ru486 12 e 8 f h b c d i k m 4 l a g j 0
Fold increase in promoter activity FRα -3394 FRα -272 FRα -116 FRα -49 FR-α -3394 TATA+FRα nt to +33nt nt to +33nt nt to +33nt nt to +33nt nt to -47 nt/ -35 nt to SV40(GC)6 +33 nt
146 Figure 4 A B Vehicle Vehicle 8 8 PR-A/Hela cells PR-B/Hela cells c R5020 R5020 7 b 12 Ru486 6 Ru486 ) R5020+Ru486 ) e f R5020+Ru486 6 6 10 h i 5 8 4 4 4 a d 6 b c 3 g 24 2 2 a
2 1 Luciferase activity Luciferase activity Times vehicle Control Times vehicle Control ( 0 ( 0 0 0 PCR SP1 SP4 SP3 PCR SP1 SP4 SP13 Vector Sp1 Sp4 Sp3 Vector Sp1 Sp4 Sp3
C D 500000
5 5 5.0 T47D-B cells h T47D-A cells 350000 h 450000 i l 400000 b 300000 4.0 3.0 Vehicle f c Vehicle k b 350000 250000 R5020 R5020 Ru486 3.0300000 Ru486
200000 2.0 250000
200000 150000 2.0 150000 e f g j 1.0100000 g d e 100000 a 1.0 a 50000 d Relative luciferase units x 10 c Relative luciferase units x 10 50000
0.0 0 0.0 0 Scr siRNA + - - - Scr siRNA + - - -
Sp1 siRNA - + + + Sp1 siRNA - + + + Sp1 - - + - Sp1 - - + - Sp4 - - - + Sp4 - - - +
E
scr siRNA Sp1 siRNA Sp1 siRNA+Sp1 Sp1 siRNA+Sp4 Sp1
Sp4
GAPDH
147 Figure 5 A ity
450 GRE2e1b promoter-luc +PR-B e 400 d 400 350 c
300300 f 250
200200
150 b
100100
50 a
Fold increase in luciferase activ 0 0.0 0HR 3HR 6HR 12HR 24HR 48HR Time (h) 0 3 6 12 24 48
B 3030 FR-α promoter-luc +PR-A d 2525
2020
c 1515
10 10
5 5 b a
0 Fold increase in luciferase activity 0 0HR 3HR 6HR 12HR 24HR 48HR Time (h) 0 3 6 12 24 48
C 25 25 FR-α promoter-luc +PR-B d
20 20
15 15
10 10 c 5 5 b
a
Fold increase in luciferase activity 0 0 0HR 3HR 6HR 12HR 24HR 48HR Time (h) 0 3 6 12 24 48 148
Figure 6 FR-α P4 promoter-luc + PR-A A 3.5 b 33
2.5
2 2
1.5 c a 11
0.5
00
0-2h Reporter mRNA (Fold increase) vehicle CHX vehicle vehicle CHX CHX 2-14h vehicle CHX R5020 RU486 CHX+R5020 CHX+RU486 14h harvest harvest harvest harvest harvest harvest B 33 FR-α P4 promoter-luc + PR-B
2.5 c
22 b
1. 5 d a e
1 1
0.5
00
0-2h Reporter mRNA (fold increase) vehicle CHX vehicle vehicle CHX CHX 2-14h vehicle CHX R5020 RU486 CHX+R5020 CHX+RU486 14h harvest harvest harvest harvest harvest harvest C 2525 GRE2e1b promoter-luc + PR-B b c
2020
1515
1010
55 a 00
0-2h Reporter mRNA (fold increase) vehicle CHX vehicle vehicle CHX CHX 2-14h vehicle CHX R5020 RU486 CHX+R5020 CHX+RU486 14h harvest harvest harvest harvest harvest harvest 149
Figure 7
1212
b 1010 Vehicle R5020 88 RU486
d 66 e
44
2
p27 mRNA (times vehicle control) 2 a c
0 0 12 T47D-A T47D-B cells cells
150 Figure 8
T47D-A cells T47D-B cells A
Vehicle R5020 RU486 CHX CHX+R5020 CHX+RU486 Vehicle R5020 CHX CHX+R5020 CHX+RU486 RU486 p21 Tubulin
B C TK1 FR-α 3 2.5 e T47D-A 3 T47D-A T47D-B e T47D-B 2.5 2 2 b c 2 2 d 1.5 a d f 1.5 c a b g h 1 1 1 1 f
0.5 0.5 Fold increase in mRNA Fold increase in mRNA
0 0 0 0 VEHICLL R5020 RU486 CHX CHX+R CHX+RU VEHICLL R5020 RU486 CHX CHX+R CHX+RU 0-2h V V V CHX CHX CHX 0-2h V V V CHX CHX CHX 2-14 h V R RU CHX CHX+R CHX+RU 2-14 h V R RU CHX CHX+R CHX+RU 26 h harvest 14 h harvest
D E b Cmyc/T47D-B 2 c p27/T47D-B 3 c b e a d 2 1 a 1 Fold increase in mRNA Fold increase in mRNA 0 0 0-2h V V V CHX CHX CHX 0-2h V V CHX CHX 2-14 h V R RU CHX CHX+R CHX+RU 2-14 h V R CHX CHX+R 26 h harvest 14 harvest
151
Figure 9
99 c Irrelevant target /vehicle 8 d 8 Irrelevant target /R5020
77 Irrelevant target /RU486 Promoter target /vehicle 66 Promoter target /R5020 5 Promoter target /RU486 5
44
33 b 22
Fold increase in ChIP signal a 11
00 CmycC-MYC FR-FR α p27p27 TK1TK1
152 Figure 10
A C-myc gene 0.160.16 c 0.14
0.120.12
Normal IgG/promoter target (vehicle) 0.1 f Normal IgG/promoter target (R5020) 0.08 b Anti Pol II /Irrelevant target (vehicle) 0.08 d Anti Pol II /Irrelevant target (R5020) 0.06 Anti Pol II /Promoter target (vehicle) e 0.040.04 a Anti Pol II /Promoter target (R5020) 0.02
ChIP signal (% of input) 0.000 Time 1h 3h 6h 12h 24h
C B
0.160.16 e 0.45 e FR-α gene 0.4 P27 gene 0.14 d 0.40
0.35 d 0.120.12 0.300.3 0.1
0.25 0.080.08 0.200.2 0.06 0.15
0.04 0.04 0.100.1
0.02 a c c 0.05 a b b ChIP signal (% of input) ChIP signal (% of input) 0.000 0.00 0
Time 1h 3h 6h 12h 24h Time 1h 3h 6h 12h 24h
D E 0.035 d 0.14 TK1 gene p21 gene f 0.030.03 e 0.300.12
0.025 0.1 d
0.02 0.02 0.200.08
0.015 0.06
0.010.01 0.100.04 c a 0.005 0.02 b a b c ChIP signal (% of input) ChIP signal (% of input) 0 0.000 0.00 Time 1h 3h 6h 12h 24h Time 1h 3h 6h 12h 24h
153
Table 1: DNA Sequences of Primers and TaqMan Probes for Real Time PCR Assays
Gene Target Forward primer TaqMan Probe Reverse primer sequence 5’-3’ 5’-3’ 5’-3’
AGGTGCGCAGTGGGA FAM-CCTTGCCCAACCTTTCCA CATTGCACAGAACAGTG Coding exon GCT TTTCTACTTCCCC-TAM GGTG
FR-α Sp1 promoter CCCCCATCTCCCTCA FAM-TGGTGTCTAATCCTACCTTT CCACCTGGAGAAGGCA element GTTTT CATTGGA-TAMRA ATGA
CGGTGGACCACGAAG FAM-CGGGACTTGGA GGCTCGCCTCTTCCATG Coding exon AGTTAA GAAGCACTGCA-TAMRA TC p27
Sp1 promoter CGCCGCAACCAATGG FAM-TCCTCCTCTGTTTAAAT GAGGCTGACGAAGAAG element AT AGACTCGCCGTGTC-TAM AAAATGA
GCCCCACGCTGTTGA FAM-CAGCCTGCTTCT GAACAGAAACTCAGCA Coding exon Thymidine CA TCCCCTCTG-TAMRA GTGAAAGC
Kinase 1 TCCGCCCACCAAGTTTA Sp1 promoter CGTGCGTCCCTCTGT FAM-AGAGCCCGCCTCG AAG element TTATATG CTCGCC-TAMRA
CTGGAGACTCTCAGG FAM-ACGGCGGCAGACCA GGATTAGGGCTTCC Coding exon GTCGAA GCATGA-TAMRA TGGA p21
Sp1 promoter TCAGCTGCATTGGGT FAM-CCAGAGTGGGTCAGCGG ACTGTTAGAATGAGCCC element AAATCC TGAGCC-TAMRA CCTTTC
CGTCTCCACACATCA FAM-ACGCAGCGCCTCC TGTTGGCAGCAGGATAG Coding exon GCACAA CTCCAACTC-BHQ TTCCTT C-myc PRE TCCTCTTTCTTCGGAC FAM-AGCCAACCTGAAAGAATAA CAGGCGGTTCCTTAAAA promoter CTTCTG CAAGGAGGAGGTG-TAMRA CAAGT region
Luciferase CGCAGGTCTTCCCGA FAM-ACGCCGGTGAACT TTCCGTGCTCCAAAACA Coding exon CG TCCCGCC-TAMRA ACA
GAPDH CAACGGATTTGGTCG FAM-CGCCTGGTCACCAGGGCT GCAACAATATCCACTTT Coding exon TATTGG GCT-TAMRA ACCAGAGTTAA
154
Table 2: Amplification of Target Genomic DNA by the Real Time PCR Primers and a TaqMan Probes
Gene Fr-α p27 TK1 p21 c-myc Coding SP1 Coding SP1 Coding SP1 Coding Sp1 Coding PRE Target sequence exon region exon region exon region exon region exon region 18.3±0 18.2±0.1 18.0±0.1 17.3±0.1 13.3±0.1 13.6±0.1 17.8±0.1 17.9±0.1 18.1±0 17.9± C Value b 0.1 t .1 .2
a Genomic DNA from untreated T47D-B cells was prepared as described for ChIP assays under Material and Methods and subjected to Real Time PCR as described under Material and Methods.
b The Ct values are the average of triplicate measurements. The Ct values for negative controls (without target DNA sequence) were > 35.
155
SUMMARY
This study showed that the endogenous FR- α gene expression is up-regulated by GR
and PR nuclear receptors through a unique mechanism and has laid the basis for using steroids such as dexamethasone and R5020 for improving the efficiency of tumor targeting as well as for screening of certain cancers alone or in combination with a well tolerated HDAC inhibitors. The study also added new insight into the partial agonist activity of RU486 and uncovered a large set of important genes that could be regulated in the same manner as FR-α. The results also clearly showed that the ultimate action of GR and PR on those genes requires the activation of intermediate (up-stream) target genes that are components of the transcription initiation complex acting as co-activators of Sp1.
156 BIBLIOGRAPHY
Abdel-Hafiz, H., Takimoto, G.S., Tung, L. and Horwitz, K.B.: The inhibitory function in
human progesterone receptor N termini binds SUMO-1 protein to regulate
autoinhibition and transrepression. J Biol Chem 277 (2002) 33950-6.
Adcock, I.M. and Caramori, G.: Cross-talk between pro-inflammatory transcription
factors and glucocorticoids. Immunol Cell Biol 79 (2001) 376-84.
Alexander, I.E., Clarke, C.L., Shine, J. and Sutherland, R.L.: Progestin inhibition of
progesterone receptor gene expression in human breast cancer cells. Mol
Endocrinol 3 (1989) 1377-86.
Ammanamanchi, S., Freeman, J.W. and Brattain, M.G.: Acetylated sp3 is a
transcriptional activator. J Biol Chem 278 (2003) 35775-80.
Andersson, H., Lindegren, S., Back, T., Jacobsson, L., Leser, G. and Horvath, G.:
Radioimmunotherapy of nude mice with intraperitoneally growing ovarian cancer
xenograft utilizing 211At-labelled monoclonal antibody MOv18. Anticancer Res
20 (2000) 459-62.
Antony, A.C.: The biological chemistry of folate receptors. Blood 79 (1992) 2807-20.
Antony, A.C.: Folate receptors. Annu Rev Nutr 16 (1996) 501-21.
157 Antony, A.C., Utley, C., Van Horne, K.C. and Kolhouse, J.F.: Isolation and
characterization of a folate receptor from human placenta. J Biol Chem 256
(1981) 9684-92.
Antony, A.C., Utley, C.S., Marcell, P.D. and Kolhouse, J.F.: Isolation, characterization,
and comparison of the solubilized particulate and soluble folate binding proteins
from human milk. J Biol Chem 257 (1982) 10081-9.
Aoyagi, S. and Archer, T.K.: Modulating molecular chaperone Hsp90 functions through
reversible acetylation. Trends Cell Biol 15 (2005) 565-7.
Aoyagi, S. and Archer, T.K.: Dynamic histone acetylation/deacetylation with
progesterone receptor-mediated transcription. Mol Endocrinol 21 (2007) 843-56.
Apt, D., Watts, R.M., Suske, G. and Bernard, H.U.: High Sp1/Sp3 ratios in epithelial
cells during epithelial differentiation and cellular transformation correlate with the
activation of the HPV-16 promoter. Virology 224 (1996) 281-91.
Archer, S.Y., Johnson, J., Kim, H.J., Ma, Q., Mou, H., Daesety, V., Meng, S. and Hodin,
R.A.: The histone deacetylase inhibitor butyrate downregulates cyclin B1 gene
expression via a p21/WAF-1-dependent mechanism in human colon cancer cells.
Am J Physiol Gastrointest Liver Physiol 289 (2005) G696-703.
158 Armstrong, S.A., Barry, D.A., Leggett, R.W. and Mueller, C.R.: Casein kinase II-
mediated phosphorylation of the C terminus of Sp1 decreases its DNA binding
activity. J Biol Chem 272 (1997) 13489-95.
Atkinson, S.F., Bettinger, T., Seymour, L.W., Behr, J.P. and Ward, C.M.: Conjugation of
folate via gelonin carbohydrate residues retains ribosomal-inactivating properties
of the toxin and permits targeting to folate receptor positive cells. J Biol Chem
276 (2001) 27930-5.
Bai, W., Tullos, S. and Weigel, N.L.: Phosphorylation of Ser530 facilitates hormone-
dependent transcriptional activation of the chicken progesterone receptor. Mol
Endocrinol 8 (1994) 1465-73.
Bamberger, A.M., Bamberger, C.M., Gellersen, B. and Schulte, H.M.: Modulation of AP-
1 activity by the human progesterone receptor in endometrial adenocarcinoma
cells. Proc Natl Acad Sci U S A 93 (1996) 6169-74.
Banchio, C., Schang, L.M. and Vance, D.E.: Phosphorylation of Sp1 by cyclin-dependent
kinase 2 modulates the role of Sp1 in CTP:phosphocholine cytidylyltransferase
alpha regulation during the S phase of the cell cycle. J Biol Chem 279 (2004)
40220-6.
Baniahmad, A., Leng, X., Burris, T.P., Tsai, S.Y., Tsai, M.J. and O'Malley, B.W.: The
tau 4 activation domain of the thyroid hormone receptor is required for release of
159 a putative corepressor(s) necessary for transcriptional silencing. Mol Cell Biol 15
(1995) 76-86.
Barnes, P.J.: Anti-inflammatory actions of glucocorticoids: molecular mechanisms. Clin
Sci (Lond) 94 (1998) 557-72.
Barnes, P.J., Ito, K. and Adcock, I.M.: Corticosteroid resistance in chronic obstructive
pulmonary disease: inactivation of histone deacetylase. Lancet 363 (2004) 731-3.
Beato, M., Herrlich, P. and Schutz, G.: Steroid hormone receptors: many actors in search
of a plot. Cell 83 (1995) 851-7.
Beck, C.A., Weigel, N.L., Moyer, M.L., Nordeen, S.K. and Edwards, D.P.: The
progesterone antagonist RU486 acquires agonist activity upon stimulation of
cAMP signaling pathways. Proc Natl Acad Sci U S A 90 (1993) 4441-5.
Becker, P.B. and Horz, W.: ATP-dependent nucleosome remodeling. Annu Rev Biochem
71 (2002) 247-73.
Beger, C., Gerdes, K., Lauten, M., Tissing, W.J., Fernandez-Munoz, I., Schrappe, M. and
Welte, K.: Expression and structural analysis of glucocorticoid receptor isoform
gamma in human leukaemia cells using an isoform-specific real-time polymerase
chain reaction approach. Br J Haematol 122 (2003) 245-52.
160 Belandia, B., Latasa, M.J., Villa, A. and Pascual, A.: Thyroid hormone negatively
regulates the transcriptional activity of the beta-amyloid precursor protein gene. J
Biol Chem 273 (1998) 30366-71.
Bi, G. and Jiang, G.: The molecular mechanism of HDAC inhibitors in anticancer effects.
Cell Mol Immunol 3 (2006) 285-90.
Bigler, J. and Eisenman, R.N.: Novel location and function of a thyroid hormone
response element. Embo J 14 (1995) 5710-23.
Biola, A., Andreau, K., David, M., Sturm, M., Haake, M., Bertoglio, J. and Pallardy, M.:
The glucocorticoid receptor and STAT6 physically and functionally interact in T-
lymphocytes. FEBS Lett 487 (2000) 229-33.
Black, A.R., Jensen, D., Lin, S.Y. and Azizkhan, J.C.: Growth/cell cycle regulation of
Sp1 phosphorylation. J Biol Chem 274 (1999) 1207-15.
Blander, G. and Guarente, L.: The Sir2 family of protein deacetylases. Annu Rev
Biochem 73 (2004) 417-35.
Blobel, G.A., Sieff, C.A. and Orkin, S.H.: Ligand-dependent repression of the erythroid
transcription factor GATA-1 by the estrogen receptor. Mol Cell Biol 15 (1995)
3147-53.
161 Bodwell, J.E., Webster, J.C., Jewell, C.M., Cidlowski, J.A., Hu, J.M. and Munck, A.:
Glucocorticoid receptor phosphorylation: overview, function and cell cycle-
dependence. J Steroid Biochem Mol Biol 65 (1998) 91-9.
Boonyaratanakornkit, V., Scott, M.P., Ribon, V., Sherman, L., Anderson, S.M., Maller,
J.L., Miller, W.T. and Edwards, D.P.: Progesterone receptor contains a proline-
rich motif that directly interacts with SH3 domains and activates c-Src family
tyrosine kinases. Mol Cell 8 (2001) 269-80.
Bouwman, P., Gollner, H., Elsasser, H.P., Eckhoff, G., Karis, A., Grosveld, F., Philipsen,
S. and Suske, G.: Transcription factor Sp3 is essential for post-natal survival and
late tooth development. Embo J 19 (2000) 655-61.
Bouwman, P. and Philipsen, S.: Regulation of the activity of Sp1-related transcription
factors. Mol Cell Endocrinol 195 (2002) 27-38.
Bowden, R.T., Hissom, J.R. and Moore, M.R.: Growth stimulation of T47D human breast
cancer cells by the anti-progestin RU486. Endocrinology 124 (1989) 2642-4.
Braun, H., Koop, R., Ertmer, A., Nacht, S. and Suske, G.: Transcription factor Sp3 is
regulated by acetylation. Nucleic Acids Res 29 (2001) 4994-5000.
162 Breslin, M.B., Geng, C.D. and Vedeckis, W.V.: Multiple promoters exist in the human
GR gene, one of which is activated by glucocorticoids. Mol Endocrinol 15 (2001)
1381-95.
Bruna, A., Nicolas, M., Munoz, A., Kyriakis, J.M. and Caelles, C.: Glucocorticoid
receptor-JNK interaction mediates inhibition of the JNK pathway by
glucocorticoids. Embo J 22 (2003) 6035-44.
Bucher, P.: Weight matrix descriptions of four eukaryotic RNA polymerase II promoter
elements derived from 502 unrelated promoter sequences. J Mol Biol 212 (1990)
563-78.
Cadepond, F., Ulmann, A. and Baulieu, E.E.: RU486 (mifepristone): mechanisms of
action and clinical uses. Annu Rev Med 48 (1997) 129-56.
Chappell, P.E., Lydon, J.P., Conneely, O.M., O'Malley, B.W. and Levine, J.E.: Endocrine
defects in mice carrying a null mutation for the progesterone receptor gene.
Endocrinology 138 (1997) 4147-52.
Chauchereau, A., Amazit, L., Quesne, M., Guiochon-Mantel, A. and Milgrom, E.:
Sumoylation of the progesterone receptor and of the steroid receptor coactivator
SRC-1. J Biol Chem 278 (2003) 12335-43.
163 Chook, Y.M. and Blobel, G.: Karyopherins and nuclear import. Curr Opin Struct Biol 11
(2001) 703-15.
Christian, M., Pohnke, Y., Kempf, R., Gellersen, B. and Brosens, J.J.: Functional
association of PR and CCAAT/enhancer-binding protein beta isoforms: promoter-
dependent cooperation between PR-B and liver-enriched inhibitory protein, or
liver-enriched activatory protein and PR-A in human endometrial stromal cells.
Mol Endocrinol 16 (2002) 141-54.
Chrousos, G.P.: The hypothalamic-pituitary-adrenal axis and immune-mediated
inflammation. N Engl J Med 332 (1995) 1351-62.
Chrousos, G.P.: The glucocorticoid receptor gene, longevity, and the complex disorders
of Western societies. Am J Med 117 (2004) 204-7.
Chrousos, G.P. and Kino, T.: Intracellular glucocorticoid signaling: a formerly simple
system turns stochastic. Sci STKE 2005 (2005) pe48.
Clarke, C.L.: Cell-specific regulation of progesterone receptor in the female reproductive
system. Mol Cell Endocrinol 70 (1990) C29-33.
Cleutjens, K.B., van der Korput, H.A., van Eekelen, C.C., van Rooij, H.C., Faber, P.W.
and Trapman, J.: An androgen response element in a far upstream enhancer region
164 is essential for high, androgen-regulated activity of the prostate-specific antigen
promoter. Mol Endocrinol 11 (1997) 148-61.
Cole, T.J., Blendy, J.A., Monaghan, A.P., Krieglstein, K., Schmid, W., Aguzzi, A.,
Fantuzzi, G., Hummler, E., Unsicker, K. and Schutz, G.: Targeted disruption of
the glucocorticoid receptor gene blocks adrenergic chromaffin cell development
and severely retards lung maturation. Genes Dev 9 (1995) 1608-21.
Cole, T.J., Blendy, J.A., Schmid, W., Strahle, U. and Schutz, G.: Expression of the mouse
glucocorticoid receptor and its role during development. J Steroid Biochem Mol
Biol 47 (1993) 49-53.
Colman, N., Hettiarachchy, N. and Herbert, V.: Detection of a milk factor that facilitates
folate uptake by intestinal cells. Science 211 (1981) 1427-9.
Condon, J.C., Hardy, D.B., Kovaric, K. and Mendelson, C.R.: Up-regulation of the
progesterone receptor (PR)-C isoform in laboring myometrium by activation of
nuclear factor-kappaB may contribute to the onset of labor through inhibition of
PR function. Mol Endocrinol 20 (2006) 764-75.
Conneely, O.M. and Lydon, J.P.: Progesterone receptors in reproduction: functional
impact of the A and B isoforms. Steroids 65 (2000) 571-7.
165 Conneely, O.M., Lydon, J.P., De Mayo, F. and O'Malley, B.W.: Reproductive functions
of the progesterone receptor. J Soc Gynecol Investig 7 (2000) S25-32.
Conneely, O.M., Mulac-Jericevic, B., DeMayo, F., Lydon, J.P. and O'Malley, B.W.:
Reproductive functions of progesterone receptors. Recent Prog Horm Res 57
(2002) 339-55.
Coulthard, V.H., Matsuda, S. and Heery, D.M.: An extended LXXLL motif sequence
determines the nuclear receptor binding specificity of TRAP220. J Biol Chem 278
(2003) 10942-51.
Croxtall, J.D., Choudhury, Q. and Flower, R.J.: Glucocorticoids act within minutes to
inhibit recruitment of signalling factors to activated EGF receptors through a
receptor-dependent, transcription-independent mechanism. Br J Pharmacol 130
(2000) 289-98.
Croxtall, J.D., van Hal, P.T., Choudhury, Q., Gilroy, D.W. and Flower, R.J.: Different
glucocorticoids vary in their genomic and non-genomic mechanism of action in
A549 cells. Br J Pharmacol 135 (2002) 511-9.
Cutolo, M., Otsa, K., Uprus, M., Paolino, S. and Seriolo, B.: Vitamin D in rheumatoid
arthritis. Autoimmun Rev 7 (2007) 59-64.
166 da Costa, M., Rothenberg, S.P., Sadasivan, E., Regec, A. and Qian, L.: Folate deficiency
reduces the GPI-anchored folate-binding protein in rat renal tubules. Am J Physiol
Cell Physiol 278 (2000) C812-21.
da Costa, M., Sequeira, J.M., Rothenberg, S.P. and Weedon, J.: Antibodies to folate
receptors impair embryogenesis and fetal development in the rat. Birth Defects
Res A Clin Mol Teratol 67 (2003) 837-47.
da Costa, M. and Sharon, M.: The synthesis of folate-binding protein in lymphocytes
during transformation. Br J Haematol 46 (1980) 575-9.
Dangond, F., Henriksson, M., Zardo, G., Caiafa, P., Ekstrom, T.J. and Gray, S.G.:
Differential expression of class I HDACs: roles of cell density and cell cycle. Int J
Oncol 19 (2001) 773-7.
Davie, J.R. and Spencer, V.A.: Control of histone modifications. J Cell Biochem Suppl
32-33 (1999) 141-8.
De Luca, P., Majello, B. and Lania, L.: Sp3 represses transcription when tethered to
promoter DNA or targeted to promoter proximal RNA. J Biol Chem 271 (1996)
8533-6.
DeMarzo, A.M., Beck, C.A., Onate, S.A. and Edwards, D.P.: Dimerization of
mammalian progesterone receptors occurs in the absence of DNA and is related to
167 the release of the 90-kDa heat shock protein. Proc Natl Acad Sci U S A 88 (1991)
72-6.
Deroo, B.J. and Archer, T.K.: Glucocorticoid receptor-mediated chromatin remodeling in
vivo. Oncogene 20 (2001a) 3039-46.
Deroo, B.J. and Archer, T.K.: Glucocorticoid receptor activation of the I kappa B alpha
promoter within chromatin. Mol Biol Cell 12 (2001b) 3365-74.
Discher, D.J., Bishopric, N.H., Wu, X., Peterson, C.A. and Webster, K.A.: Hypoxia
regulates beta-enolase and pyruvate kinase-M promoters by modulating Sp1/Sp3
binding to a conserved GC element. J Biol Chem 273 (1998) 26087-93.
Drummond, D.C., Hong, K., Park, J.W., Benz, C.C. and Kirpotin, D.B.: Liposome
targeting to tumors using vitamin and growth factor receptors. Vitam Horm 60
(2000) 285-332.
Dynan, W.S., Sazer, S., Tjian, R. and Schimke, R.T.: Transcription factor Sp1 recognizes
a DNA sequence in the mouse dihydrofolate reductase promoter. Nature 319
(1986) 246-8.
Dynan, W.S. and Tjian, R.: The promoter-specific transcription factor Sp1 binds to
upstream sequences in the SV40 early promoter. Cell 35 (1983) 79-87.
168 Edwards, D.P., Leonhardt, S.A. and Gass-Handel, E.: Novel mechanisms of progesterone
antagonists and progesterone receptor. J Soc Gynecol Investig 7 (2000) S22-4.
Elnakat, H. and Ratnam, M.: Distribution, functionality and gene regulation of folate
receptor isoforms: implications in targeted therapy. Adv Drug Deliv Rev 56
(2004) 1067-84.
Elwood, P.C.: Molecular cloning and characterization of the human folate-binding
protein cDNA from placenta and malignant tissue culture (KB) cells. J Biol Chem
264 (1989) 14893-901.
Elwood, P.C., Kane, M.A., Portillo, R.M. and Kolhouse, J.F.: The isolation,
characterization, and comparison of the membrane-associated and soluble folate-
binding proteins from human KB cells. J Biol Chem 261 (1986) 15416-23.
Elwood, P.C., Nachmanoff, K., Saikawa, Y., Page, S.T., Pacheco, P., Roberts, S. and
Chung, K.N.: The divergent 5' termini of the alpha human folate receptor (hFR)
mRNAs originate from two tissue-specific promoters and alternative splicing:
characterization of the alpha hFR gene structure. Biochemistry 36 (1997) 1467-
78.
Emami, K.H., Burke, T.W. and Smale, S.T.: Sp1 activation of a TATA-less promoter
requires a species-specific interaction involving transcription factor IID. Nucleic
Acids Res 26 (1998) 839-46.
169 Emili, A., Greenblatt, J. and Ingles, C.J.: Species-specific interaction of the glutamine-
rich activation domains of Sp1 with the TATA box-binding protein. Mol Cell Biol
14 (1994) 1582-93.
Encio, I.J. and Detera-Wadleigh, S.D.: The genomic structure of the human
glucocorticoid receptor. J Biol Chem 266 (1991) 7182-8.
Enmark, E. and Gustafsson, J.A.: Comparing nuclear receptors in worms, flies and
humans. Trends Pharmacol Sci 22 (2001) 611-5.
Escriva, H., Bertrand, S. and Laudet, V.: The evolution of the nuclear receptor
superfamily. Essays Biochem 40 (2004) 11-26.
Fairall, L., Schwabe, J.W., Chapman, L., Finch, J.T. and Rhodes, D.: The crystal
structure of a two zinc-finger peptide reveals an extension to the rules for zinc-
finger/DNA recognition. Nature 366 (1993) 483-7.
Fan, J., Heller, N.M., Gorospe, M., Atasoy, U. and Stellato, C.: The role of post-
transcriptional regulation in chemokine gene expression in inflammation and
allergy. Eur Respir J 26 (2005) 933-47.
Finck, B.N. and Kelly, D.P.: Peroxisome proliferator-activated receptor gamma
coactivator-1 (PGC-1) regulatory cascade in cardiac physiology and disease.
Circulation 115 (2007) 2540-8.
170 Finnin, M.S., Donigian, J.R., Cohen, A., Richon, V.M., Rifkind, R.A., Marks, P.A.,
Breslow, R. and Pavletich, N.P.: Structures of a histone deacetylase homologue
bound to the TSA and SAHA inhibitors. Nature 401 (1999) 188-93.
Fojas de Borja, P., Collins, N.K., Du, P., Azizkhan-Clifford, J. and Mudryj, M.: Cyclin
A-CDK phosphorylates Sp1 and enhances Sp1-mediated transcription. Embo J 20
(2001) 5737-47.
Gao, J., Mazella, J., Seppala, M. and Tseng, L.: Ligand activated hPR modulates the
glycodelin promoter activity through the Sp1 sites in human endometrial
adenocarcinoma cells. Mol Cell Endocrinol 176 (2001) 97-102.
Garside, H., Stevens, A., Farrow, S., Normand, C., Houle, B., Berry, A., Maschera, B.
and Ray, D.: Glucocorticoid ligands specify different interactions with NF-
kappaB by allosteric effects on the glucocorticoid receptor DNA binding domain.
J Biol Chem 279 (2004) 50050-9.
Giangrande, P.H., Kimbrel, E.A., Edwards, D.P. and McDonnell, D.P.: The opposing
transcriptional activities of the two isoforms of the human progesterone receptor
are due to differential cofactor binding. Mol Cell Biol 20 (2000) 3102-15.
Giangrande, P.H. and McDonnell, D.P.: The A and B isoforms of the human
progesterone receptor: two functionally different transcription factors encoded by
a single gene. Recent Prog Horm Res 54 (1999) 291-313; discussion 313-4.
171 Gill, G., Pascal, E., Tseng, Z.H. and Tjian, R.: A glutamine-rich hydrophobic patch in
transcription factor Sp1 contacts the dTAFII110 component of the Drosophila
TFIID complex and mediates transcriptional activation. Proc Natl Acad Sci U S A
91 (1994) 192-6.
Gizard, F., Robillard, R., Gervois, P., Faucompre, A., Revillion, F., Peyrat, J.P., Hum,
W.D. and Staels, B.: Progesterone inhibits human breast cancer cell growth
through transcriptional upregulation of the cyclin-dependent kinase inhibitor
p27Kip1 gene. FEBS Lett 579 (2005) 5535-41.
Glass, C.K., Rose, D.W. and Rosenfeld, M.G.: Nuclear receptor coactivators. Curr Opin
Cell Biol 9 (1997) 222-32.
Glass, C.K. and Rosenfeld, M.G.: The coregulator exchange in transcriptional functions
of nuclear receptors. Genes Dev 14 (2000) 121-41.
Gollner, H., Dani, C., Phillips, B., Philipsen, S. and Suske, G.: Impaired ossification in
mice lacking the transcription factor Sp3. Mech Dev 106 (2001) 77-83.
Gonzalez, M.V., Jimenez, B., Berciano, M.T., Gonzalez-Sancho, J.M., Caelles, C.,
Lafarga, M. and Munoz, A.: Glucocorticoids antagonize AP-1 by inhibiting the
Activation/phosphorylation of JNK without affecting its subcellular distribution. J
Cell Biol 150 (2000) 1199-208.
172 Graham, J.D. and Clarke, C.L.: Expression and transcriptional activity of progesterone
receptor A and progesterone receptor B in mammalian cells. Breast Cancer Res 4
(2002) 187-90.
Graham, J.D., Yeates, C., Balleine, R.L., Harvey, S.S., Milliken, J.S., Bilous, A.M. and
Clarke, C.L.: Progesterone receptor A and B protein expression in human breast
cancer. J Steroid Biochem Mol Biol 56 (1996) 93-8.
Grange, T., Cappabianca, L., Flavin, M., Sassi, H. and Thomassin, H.: In vivo analysis of
the model tyrosine aminotransferase gene reveals multiple sequential steps in
glucocorticoid receptor action. Oncogene 20 (2001) 3028-38.
Gray, S.G. and Ekstrom, T.J.: The human histone deacetylase family. Exp Cell Res 262
(2001) 75-83.
Groshong, S.D., Owen, G.I., Grimison, B., Schauer, I.E., Todd, M.C., Langan, T.A.,
Sclafani, R.A., Lange, C.A. and Horwitz, K.B.: Biphasic regulation of breast
cancer cell growth by progesterone: role of the cyclin-dependent kinase inhibitors,
p21 and p27(Kip1). Mol Endocrinol 11 (1997) 1593-607.
Groudine, M., Eisenman, R., Gelinas, R. and Weintraub, H.: Developmental aspects of
chromatin structure and gene expression. Prog Clin Biol Res 134 (1983) 159-82.
173 Guyon, J.R., Narlikar, G.J., Sullivan, E.K. and Kingston, R.E.: Stability of a human SWI-
SNF remodeled nucleosomal array. Mol Cell Biol 21 (2001) 1132-44.
Hache, R.J., Tse, R., Reich, T., Savory, J.G. and Lefebvre, Y.A.: Nucleocytoplasmic
trafficking of steroid-free glucocorticoid receptor. J Biol Chem 274 (1999) 1432-
9.
Hagen, G., Dennig, J., Preiss, A., Beato, M. and Suske, G.: Functional analyses of the
transcription factor Sp4 reveal properties distinct from Sp1 and Sp3. J Biol Chem
270 (1995) 24989-94.
Hagen, G., Muller, S., Beato, M. and Suske, G.: Cloning by recognition site screening of
two novel GT box binding proteins: a family of Sp1 related genes. Nucleic Acids
Res 20 (1992) 5519-25.
Haidweger, E., Novy, M. and Rotheneder, H.: Modulation of Sp1 activity by a cyclin
A/CDK complex. J Mol Biol 306 (2001) 201-12.
Halachmi, S., Marden, E., Martin, G., MacKay, H., Abbondanza, C. and Brown, M.:
Estrogen receptor-associated proteins: possible mediators of hormone-induced
transcription. Science 264 (1994) 1455-8.
Haltiwanger, R.S., Grove, K. and Philipsberg, G.A.: Modulation of O-linked N-
acetylglucosamine levels on nuclear and cytoplasmic proteins in vivo using the
174 peptide O-GlcNAc-beta-N-acetylglucosaminidase inhibitor O-(2-acetamido-2-
deoxy-D-glucopyranosylidene)amino-N-phenylcarbamate. J Biol Chem 273
(1998) 3611-7.
Han, I. and Kudlow, J.E.: Reduced O glycosylation of Sp1 is associated with increased
proteasome susceptibility. Mol Cell Biol 17 (1997) 2550-8.
Hao, H., d'Alincourt-Salazar, M., Kelley, K.M., Shatnawi, A., Mukherjee, S., Shah, Y.M.
and Ratnam, M.: Estrogen-induced and TAFII30-mediated gene repression by
direct recruitment of the estrogen receptor and co-repressors to the core promoter
and its reversal by tamoxifen. Oncogene (2007).
Harnish, D.C., Scicchitano, M.S., Adelman, S.J., Lyttle, C.R. and Karathanasis, S.K.: The
role of CBP in estrogen receptor cross-talk with nuclear factor-kappaB in HepG2
cells. Endocrinology 141 (2000) 3403-11.
Harrison, S.M., Houzelstein, D., Dunwoodie, S.L. and Beddington, R.S.: Sp5, a new
member of the Sp1 family, is dynamically expressed during development and
genetically interacts with Brachyury. Dev Biol 227 (2000) 358-72.
Hata, Y., Duh, E., Zhang, K., Robinson, G.S. and Aiello, L.P.: Transcription factors Sp1
and Sp3 alter vascular endothelial growth factor receptor expression through a
novel recognition sequence. J Biol Chem 273 (1998) 19294-303.
175 Haynes, M.P., Li, L., Sinha, D., Russell, K.S., Hisamoto, K., Baron, R., Collinge, M.,
Sessa, W.C. and Bender, J.R.: Src kinase mediates phosphatidylinositol 3-
kinase/Akt-dependent rapid endothelial nitric-oxide synthase activation by
estrogen. J Biol Chem 278 (2003) 2118-23.
Haynes, M.P., Sinha, D., Russell, K.S., Collinge, M., Fulton, D., Morales-Ruiz, M.,
Sessa, W.C. and Bender, J.R.: Membrane estrogen receptor engagement activates
endothelial nitric oxide synthase via the PI3-kinase-Akt pathway in human
endothelial cells. Circ Res 87 (2000) 677-82.
Heck, S., Bender, K., Kullmann, M., Gottlicher, M., Herrlich, P. and Cato, A.C.: I
kappaB alpha-independent downregulation of NF-kappaB activity by
glucocorticoid receptor. Embo J 16 (1997) 4698-707.
Heck, S., Kullmann, M., Gast, A., Ponta, H., Rahmsdorf, H.J., Herrlich, P. and Cato,
A.C.: A distinct modulating domain in glucocorticoid receptor monomers in the
repression of activity of the transcription factor AP-1. Embo J 13 (1994) 4087-95.
Heery, D.M., Hoare, S., Hussain, S., Parker, M.G. and Sheppard, H.: Core LXXLL motif
sequences in CREB-binding protein, SRC1, and RIP140 define affinity and
selectivity for steroid and retinoid receptors. J Biol Chem 276 (2001) 6695-702.
176 Heery, D.M., Kalkhoven, E., Hoare, S. and Parker, M.G.: A signature motif in
transcriptional co-activators mediates binding to nuclear receptors. Nature 387
(1997) 733-6.
Heinlein, C.A. and Chang, C.: Androgen receptor (AR) coregulators: an overview.
Endocr Rev 23 (2002) 175-200.
Henderson, G.I., Perez, T., Schenker, S., Mackins, J. and Antony, A.C.: Maternal-to-fetal
transfer of 5-methyltetrahydrofolate by the perfused human placental cotyledon:
evidence for a concentrative role by placental folate receptors in fetal folate
delivery. J Lab Clin Med 126 (1995) 184-203.
Hermanson, O., Glass, C.K. and Rosenfeld, M.G.: Nuclear receptor coregulators:
multiple modes of modification. Trends Endocrinol Metab 13 (2002) 55-60.
Hess-Stumpp, H.: Histone deacetylase inhibitors and cancer: from cell biology to the
clinic. Eur J Cell Biol 84 (2005) 109-21.
Higgins, K.J., Liu, S., Abdelrahim, M., Yoon, K., Vanderlaag, K., Porter, W., Metz, R.P.
and Safe, S.: Vascular endothelial growth factor receptor-2 expression is induced
by 17beta-estradiol in ZR-75 breast cancer cells by estrogen receptor alpha/Sp
proteins. Endocrinology 147 (2006) 3285-95.
177 Hissom, J.R., Bowden, R.T. and Moore, M.R.: Effects of progestins, estrogens, and
antihormones on growth and lactate dehydrogenase in the human breast cancer
cell line T47D. Endocrinology 125 (1989) 418-23.
Hoeck, W. and Groner, B.: Hormone-dependent phosphorylation of the glucocorticoid
receptor occurs mainly in the amino-terminal transactivation domain. J Biol Chem
265 (1990) 5403-8.
Hoeck, W., Rusconi, S. and Groner, B.: Down-regulation and phosphorylation of
glucocorticoid receptors in cultured cells. Investigations with a monospecific
antiserum against a bacterially expressed receptor fragment. J Biol Chem 264
(1989) 14396-402.
Hollenberg, S.M., Weinberger, C., Ong, E.S., Cerelli, G., Oro, A., Lebo, R., Thompson,
E.B., Rosenfeld, M.G. and Evans, R.M.: Primary structure and expression of a
functional human glucocorticoid receptor cDNA. Nature 318 (1985) 635-41.
Hsia, S.C. and Shi, Y.B.: Chromatin disruption and histone acetylation in regulation of
the human immunodeficiency virus type 1 long terminal repeat by thyroid
hormone receptor. Mol Cell Biol 22 (2002) 4043-52.
Hsia, S.C., Tomita, A., Obata, K., Paul, B., Buchholz, D. and Shi, Y.B.: Role of
chromatin disruption and histone acetylation in thyroid hormone receptor action:
178 implications in the regulation of HIV-1 LTR. Histol Histopathol 18 (2003) 323-
31.
Hsiao, P.W., Deroo, B.J. and Archer, T.K.: Chromatin remodeling and tissue-selective
responses of nuclear hormone receptors. Biochem Cell Biol 80 (2002) 343-51.
Hsueh, C.T. and Dolnick, B.J.: Altered folate-binding protein mRNA stability in KB cells
grown in folate-deficient medium. Biochem Pharmacol 45 (1993) 2537-45.
Huang, W., Zhao, S., Ammanamanchi, S., Brattain, M., Venkatasubbarao, K. and
Freeman, J.W.: Trichostatin A induces transforming growth factor beta type II
receptor promoter activity and acetylation of Sp1 by recruitment of PCAF/p300 to
a Sp1.NF-Y complex. J Biol Chem 280 (2005) 10047-54.
Hubbert, C., Guardiola, A., Shao, R., Kawaguchi, Y., Ito, A., Nixon, A., Yoshida, M.,
Wang, X.F. and Yao, T.P.: HDAC6 is a microtubule-associated deacetylase.
Nature 417 (2002) 455-8.
Imai, S., Armstrong, C.M., Kaeberlein, M. and Guarente, L.: Transcriptional silencing
and longevity protein Sir2 is an NAD-dependent histone deacetylase. Nature 403
(2000a) 795-800.
179 Imai, S., Johnson, F.B., Marciniak, R.A., McVey, M., Park, P.U. and Guarente, L.: Sir2:
an NAD-dependent histone deacetylase that connects chromatin silencing,
metabolism, and aging. Cold Spring Harb Symp Quant Biol 65 (2000b) 297-302.
Imhof, M.O. and McDonnell, D.P.: Yeast RSP5 and its human homolog hRPF1
potentiate hormone-dependent activation of transcription by human progesterone
and glucocorticoid receptors. Mol Cell Biol 16 (1996) 2594-605.
Imre, G., Gekeler, V., Leja, A., Beckers, T. and Boehm, M.: Histone deacetylase
inhibitors suppress the inducibility of nuclear factor-kappaB by tumor necrosis
factor-alpha receptor-1 down-regulation. Cancer Res 66 (2006) 5409-18.
Ismaili, N. and Garabedian, M.J.: Modulation of glucocorticoid receptor function via
phosphorylation. Ann N Y Acad Sci 1024 (2004) 86-101.
Ito, K., Barnes, P.J. and Adcock, I.M.: Glucocorticoid receptor recruitment of histone
deacetylase 2 inhibits interleukin-1beta-induced histone H4 acetylation on lysines
8 and 12. Mol Cell Biol 20 (2000) 6891-903.
Jackson, S.P., MacDonald, J.J., Lees-Miller, S. and Tjian, R.: GC box binding induces
phosphorylation of Sp1 by a DNA-dependent protein kinase. Cell 63 (1990) 155-
65.
180 Jacobsen, K.X., Macdonald, H., Lemonde, S., Daigle, M., Grimes, D.A., Bulman, D.E.
and Albert, P.R.: A Nurr1 point mutant, implicated in Parkinson's disease,
uncouples ERK1/2-dependent regulation of tyrosine hydroxylase transcription.
Neurobiol Dis (2007).
Janne, O., Kontula, K., Luukkainen, T. and Vihko, R.: Oestrogen-induced progesterone
receptor in human uterus. J Steroid Biochem 6 (1975) 501-9.
Jiang, T., Wang, X.X., Scherzer, P., Wilson, P., Tallman, J., Takahashi, H., Li, J.,
Iwahashi, M., Sutherland, E., Arend, L. and Levi, M.: Farnesoid X receptor
modulates renal lipid metabolism, fibrosis, and diabetic nephropathy. Diabetes 56
(2007) 2485-93.
Jin, C., Shiyanova, T., Shen, Z. and Liao, X.: Heteronuclear nuclear magnetic resonance
assignments, structure and dynamics of SUMO-1, a human ubiquitin-like protein.
Int J Biol Macromol 28 (2001) 227-34.
Jones, K.A., Yamamoto, K.R. and Tjian, R.: Two distinct transcription factors bind to the
HSV thymidine kinase promoter in vitro. Cell 42 (1985) 559-72.
Jones, M.C., Fusi, L., Higham, J.H., Abdel-Hafiz, H., Horwitz, K.B., Lam, E.W. and
Brosens, J.J.: Regulation of the SUMO pathway sensitizes differentiating human
endometrial stromal cells to progesterone. Proc Natl Acad Sci U S A 103 (2006)
16272-7.
181 Kadonaga, J.T., Carner, K.R., Masiarz, F.R. and Tjian, R.: Isolation of cDNA encoding
transcription factor Sp1 and functional analysis of the DNA binding domain. Cell
51 (1987) 1079-90.
Kadonaga, J.T., Courey, A.J., Ladika, J. and Tjian, R.: Distinct regions of Sp1 modulate
DNA binding and transcriptional activation. Science 242 (1988) 1566-70.
Kagoshima, M., Wilcke, T., Ito, K., Tsaprouni, L., Barnes, P.J., Punchard, N. and
Adcock, I.M.: Glucocorticoid-mediated transrepression is regulated by histone
acetylation and DNA methylation. Eur J Pharmacol 429 (2001) 327-34.
Kahmann, S., Vassen, L. and Klein-Hitpass, L.: Synergistic enhancement of PRB-
mediated RU486 and R5020 agonist activities through cyclic adenosine 3',5'-
monophosphate represents a delayed primary response. Mol Endocrinol 12 (1998)
278-89.
Kalkhoven, E., Wissink, S., van der Saag, P.T. and van der Burg, B.: Negative interaction
between the RelA(p65) subunit of NF-kappaB and the progesterone receptor. J
Biol Chem 271 (1996) 6217-24.
Kamen, B.A. and Smith, A.K.: A review of folate receptor alpha cycling and 5-
methyltetrahydrofolate accumulation with an emphasis on cell models in vitro.
Adv Drug Deliv Rev 56 (2004) 1085-97.
182 Kane, M.A., Elwood, P.C., Portillo, R.M., Antony, A.C., Najfeld, V., Finley, A.,
Waxman, S. and Kolhouse, J.F.: Influence on immunoreactive folate-binding
proteins of extracellular folate concentration in cultured human cells. J Clin Invest
81 (1988) 1398-406.
Karin, M.: New twists in gene regulation by glucocorticoid receptor: is DNA binding
dispensable? Cell 93 (1998) 487-90.
Kastner, P., Krust, A., Turcotte, B., Stropp, U., Tora, L., Gronemeyer, H. and Chambon,
P.: Two distinct estrogen-regulated promoters generate transcripts encoding the
two functionally different human progesterone receptor forms A and B. Embo J 9
(1990) 1603-14.
Kato, S., Endoh, H., Masuhiro, Y., Kitamoto, T., Uchiyama, S., Sasaki, H., Masushige,
S., Gotoh, Y., Nishida, E., Kawashima, H., Metzger, D. and Chambon, P.:
Activation of the estrogen receptor through phosphorylation by mitogen-activated
protein kinase. Science 270 (1995) 1491-4.
Kato, S., Kitamoto, T., Masuhiro, Y. and Yanagisawa, J.: Molecular mechanism of a
cross-talk between estrogen and growth-factor signaling pathways. Oncology 55
Suppl 1 (1998) 5-10.
183 Keembiyehetty, C.N., Candelaria, R.P., Majumdar, G., Raghow, R., Martinez-Hernandez,
A. and Solomon, S.S.: Paradoxical regulation of Sp1 transcription factor by
glucagon. Endocrinology 143 (2002) 1512-20.
Kelley, K.M., Rowan, B.G. and Ratnam, M.: Modulation of the folate receptor alpha
gene by the estrogen receptor: mechanism and implications in tumor targeting.
Cancer Res 63 (2003) 2820-8.
Kingsley, C. and Winoto, A.: Cloning of GT box-binding proteins: a novel Sp1 multigene
family regulating T-cell receptor gene expression. Mol Cell Biol 12 (1992) 4251-
61.
Kinyamu, H.K., Chen, J. and Archer, T.K.: Linking the ubiquitin-proteasome pathway to
chromatin remodeling/modification by nuclear receptors. J Mol Endocrinol 34
(2005) 281-97.
Kousteni, S., Han, L., Chen, J.R., Almeida, M., Plotkin, L.I., Bellido, T. and Manolagas,
S.C.: Kinase-mediated regulation of common transcription factors accounts for
the bone-protective effects of sex steroids. J Clin Invest 111 (2003) 1651-64.
Kouzarides, T.: Histone acetylases and deacetylases in cell proliferation. Curr Opin Genet
Dev 9 (1999) 40-8.
184 Kovacs, J.J., Murphy, P.J., Gaillard, S., Zhao, X., Wu, J.T., Nicchitta, C.V., Yoshida, M.,
Toft, D.O., Pratt, W.B. and Yao, T.P.: HDAC6 regulates Hsp90 acetylation and
chaperone-dependent activation of glucocorticoid receptor. Mol Cell 18 (2005)
601-7.
Kraus, W.L., Montano, M.M. and Katzenellenbogen, B.S.: Cloning of the rat
progesterone receptor gene 5'-region and identification of two functionally
distinct promoters. Mol Endocrinol 7 (1993) 1603-16.
Krett, N.L., Pillay, S., Moalli, P.A., Greipp, P.R. and Rosen, S.T.: A variant
glucocorticoid receptor messenger RNA is expressed in multiple myeloma
patients. Cancer Res 55 (1995) 2727-9.
Krstic, M.D., Rogatsky, I., Yamamoto, K.R. and Garabedian, M.J.: Mitogen-activated
and cyclin-dependent protein kinases selectively and differentially modulate
transcriptional enhancement by the glucocorticoid receptor. Mol Cell Biol 17
(1997) 3947-54.
Kumar, S., Chaturvedi, N.K., Nishi, M., Kawata, M. and Tyagi, R.K.: Shuttling
components of nuclear import machinery involved in nuclear translocation of
steroid receptors exit nucleus via exportin-1/CRM-1* independent pathway.
Biochim Biophys Acta 1691 (2004) 73-7.
185 Kumar, S., Saradhi, M., Chaturvedi, N.K. and Tyagi, R.K.: Intracellular localization and
nucleocytoplasmic trafficking of steroid receptors: an overview. Mol Cell
Endocrinol 246 (2006) 147-56.
Lacey, S.W., Sanders, J.M., Rothberg, K.G., Anderson, R.G. and Kamen, B.A.:
Complementary DNA for the folate binding protein correctly predicts anchoring
to the membrane by glycosyl-phosphatidylinositol. J Clin Invest 84 (1989) 715-
20.
Lange, C.A.: Making sense of cross-talk between steroid hormone receptors and
intracellular signaling pathways: who will have the last word? Mol Endocrinol 18
(2004) 269-78.
Lange, C.A., Shen, T. and Horwitz, K.B.: Phosphorylation of human progesterone
receptors at serine-294 by mitogen-activated protein kinase signals their
degradation by the 26S proteasome. Proc Natl Acad Sci U S A 97 (2000) 1032-7.
Lania, L., Majello, B. and De Luca, P.: Transcriptional regulation by the Sp family
proteins. Int J Biochem Cell Biol 29 (1997) 1313-23.
Lannigan, D.A.: Estrogen receptor phosphorylation. Steroids 68 (2003) 1-9.
186 Le Drean, Y., Mincheneau, N., Le Goff, P. and Michel, D.: Potentiation of glucocorticoid
receptor transcriptional activity by sumoylation. Endocrinology 143 (2002) 3482-
9.
Leamon, C.P. and Low, P.S.: Delivery of macromolecules into living cells: a method that
exploits folate receptor endocytosis. Proc Natl Acad Sci U S A 88 (1991) 5572-6.
Leamon, C.P. and Low, P.S.: Selective targeting of malignant cells with cytotoxin-folate
conjugates. J Drug Target 2 (1994) 101-12.
Leamon, C.P. and Low, P.S.: Folate-mediated targeting: from diagnostics to drug and
gene delivery. Drug Discov Today 6 (2001) 44-51.
Lee, B.J., Cansizoglu, A.E., Suel, K.E., Louis, T.H., Zhang, Z. and Chook, Y.M.: Rules
for nuclear localization sequence recognition by karyopherin beta 2. Cell 126
(2006) 543-58.
Lee, M.S., Kliewer, S.A., Provencal, J., Wright, P.E. and Evans, R.M.: Structure of the
retinoid X receptor alpha DNA binding domain: a helix required for homodimeric
DNA binding. Science 260 (1993) 1117-21.
Lee, T.H., Chang, H.C., Chuang, L.Y. and Hung, W.C.: Involvement of PKA and Sp1 in
the induction of p27(Kip1) by tamoxifen. Biochem Pharmacol 66 (2003) 371-7.
187 Lee, Y.H., Coonrod, S.A., Kraus, W.L., Jelinek, M.A. and Stallcup, M.R.: Regulation of
coactivator complex assembly and function by protein arginine methylation and
demethylimination. Proc Natl Acad Sci U S A 102 (2005) 3611-6.
Leggett, R.W., Armstrong, S.A., Barry, D. and Mueller, C.R.: Sp1 is phosphorylated and
its DNA binding activity down-regulated upon terminal differentiation of the
liver. J Biol Chem 270 (1995) 25879-84.
Lemon, B.D. and Freedman, L.P.: Nuclear receptor cofactors as chromatin remodelers.
Curr Opin Genet Dev 9 (1999) 499-504.
Leo, C. and Chen, J.D.: The SRC family of nuclear receptor coactivators. Gene 245
(2000) 1-11.
Li, X. and O'Malley, B.W.: Unfolding the action of progesterone receptors. J Biol Chem
278 (2003) 39261-4.
Li, X., Wong, J., Tsai, S.Y., Tsai, M.J. and O'Malley, B.W.: Progesterone and
glucocorticoid receptors recruit distinct coactivator complexes and promote
distinct patterns of local chromatin modification. Mol Cell Biol 23 (2003) 3763-
73.
188 Lin, S.Y., Black, A.R., Kostic, D., Pajovic, S., Hoover, C.N. and Azizkhan, J.C.: Cell
cycle-regulated association of E2F1 and Sp1 is related to their functional
interaction. Mol Cell Biol 16 (1996) 1668-75.
Liu, T., Kuljaca, S., Tee, A. and Marshall, G.M.: Histone deacetylase inhibitors:
multifunctional anticancer agents. Cancer Treat Rev 32 (2006) 157-65.
Liu, Z., Auboeuf, D., Wong, J., Chen, J.D., Tsai, S.Y., Tsai, M.J. and O'Malley, B.W.:
Coactivator/corepressor ratios modulate PR-mediated transcription by the
selective receptor modulator RU486. Proc Natl Acad Sci U S A 99 (2002) 7940-4.
Lonard, D.M., Lanz, R.B. and O'Malley, B.W.: Nuclear receptor coregulators and human
disease. Endocr Rev 28 (2007) 575-87.
Lonard, D.M., Nawaz, Z., Smith, C.L. and O'Malley, B.W.: The 26S proteasome is
required for estrogen receptor-alpha and coactivator turnover and for efficient
estrogen receptor-alpha transactivation. Mol Cell 5 (2000) 939-48.
Lonard, D.M. and O'Malley B, W.: Nuclear receptor coregulators: judges, juries, and
executioners of cellular regulation. Mol Cell 27 (2007) 691-700.
Loven, M.A., Davis, R.E., Curtis, C.D., Muster, N., Yates, J.R. and Nardulli, A.M.: A
novel estrogen receptor alpha-associated protein alters receptor-deoxyribonucleic
189 acid interactions and represses receptor-mediated transcription. Mol Endocrinol
18 (2004) 2649-59.
Loven, M.A., Muster, N., Yates, J.R. and Nardulli, A.M.: A novel estrogen receptor
alpha-associated protein, template-activating factor Ibeta, inhibits acetylation and
transactivation. Mol Endocrinol 17 (2003) 67-78.
Lu, J.Y., Lowe, D.A., Kennedy, M.D. and Low, P.S.: Folate-targeted enzyme prodrug
cancer therapy utilizing penicillin-V amidase and a doxorubicin prodrug. J Drug
Target 7 (1999) 43-53.
Lu, N.Z. and Cidlowski, J.A.: The origin and functions of multiple human glucocorticoid
receptor isoforms. Ann N Y Acad Sci 1024 (2004) 102-23.
Lu, N.Z. and Cidlowski, J.A.: Translational regulatory mechanisms generate N-terminal
glucocorticoid receptor isoforms with unique transcriptional target genes. Mol
Cell 18 (2005) 331-42.
Lu, N.Z. and Cidlowski, J.A.: Glucocorticoid receptor isoforms generate transcription
specificity. Trends Cell Biol 16 (2006) 301-7.
Lu, Y. and Low, P.S.: Folate-mediated delivery of macromolecular anticancer therapeutic
agents. Adv Drug Deliv Rev 54 (2002) 675-93.
190 Luecke, H.F. and Yamamoto, K.R.: The glucocorticoid receptor blocks P-TEFb
recruitment by NFkappaB to effect promoter-specific transcriptional repression.
Genes Dev 19 (2005) 1116-27.
Luger, K., Mader, A.W., Richmond, R.K., Sargent, D.F. and Richmond, T.J.: Crystal
structure of the nucleosome core particle at 2.8 A resolution. Nature 389 (1997a)
251-60.
Luger, K., Rechsteiner, T.J., Flaus, A.J., Waye, M.M. and Richmond, T.J.:
Characterization of nucleosome core particles containing histone proteins made in
bacteria. J Mol Biol 272 (1997b) 301-11.
Luisi, B.F., Xu, W.X., Otwinowski, Z., Freedman, L.P., Yamamoto, K.R. and Sigler,
P.B.: Crystallographic analysis of the interaction of the glucocorticoid receptor
with DNA. Nature 352 (1991) 497-505.
Lydon, J.P., DeMayo, F.J., Funk, C.R., Mani, S.K., Hughes, A.R., Montgomery, C.A.,
Jr., Shyamala, G., Conneely, O.M. and O'Malley, B.W.: Mice lacking
progesterone receptor exhibit pleiotropic reproductive abnormalities. Genes Dev 9
(1995) 2266-78.
Mahajan, D.K. and London, S.N.: Mifepristone (RU486): a review. Fertil Steril 68 (1997)
967-76.
191 Majello, B., De Luca, P. and Lania, L.: Sp3 is a bifunctional transcription regulator with
modular independent activation and repression domains. J Biol Chem 272 (1997)
4021-6.
Manolagas, S.C., Kousteni, S., Chen, J.R., Schuller, M., Plotkin, L. and Bellido, T.:
Kinase-mediated transcription, activators of nongenotropic estrogen-like signaling
(ANGELS), and osteoporosis: a different perspective on the HRT dilemma.
Kidney Int Suppl (2004) S41-9.
Marin, M., Karis, A., Visser, P., Grosveld, F. and Philipsen, S.: Transcription factor Sp1
is essential for early embryonic development but dispensable for cell growth and
differentiation. Cell 89 (1997) 619-28.
Marks, P., Rifkind, R.A., Richon, V.M., Breslow, R., Miller, T. and Kelly, W.K.: Histone
deacetylases and cancer: causes and therapies. Nat Rev Cancer 1 (2001) 194-202.
Marks, P.A., Miller, T. and Richon, V.M.: Histone deacetylases. Curr Opin Pharmacol 3
(2003) 344-51.
Marks, P.A., Richon, V.M., Kelly, W.K., Chiao, J.H. and Miller, T.: Histone deacetylase
inhibitors: development as cancer therapy. Novartis Found Symp 259 (2004) 269-
81; discussion 281-8.
192 Martinez, A., Marquez, A., Mendoza, J., Taxonera, C., Fernandez-Arquero, M., Diaz-
Rubio, M., de la Concha, E.G. and Urcelay, E.: Role of the PXR gene locus in
inflammatory bowel diseases. Inflamm Bowel Dis (2007).
Mason, J.B. and Selhub, J.: Folate-binding protein and the absorption of folic acid in the
small intestine of the suckling rat. Am J Clin Nutr 48 (1988) 620-5.
Matsuyama, A., Shimazu, T., Sumida, Y., Saito, A., Yoshimatsu, Y., Seigneurin-Berny,
D., Osada, H., Komatsu, Y., Nishino, N., Khochbin, S., Horinouchi, S. and
Yoshida, M.: In vivo destabilization of dynamic microtubules by HDAC6-
mediated deacetylation. Embo J 21 (2002) 6820-31.
Maziarz, K.M., Monaco, H.L., Shen, F. and Ratnam, M.: Complete mapping of divergent
amino acids responsible for differential ligand binding of folate receptors alpha
and beta. J Biol Chem 274 (1999) 11086-91.
McDonnell, D.P., Shahbaz, M.M., Vegeto, E. and Goldman, M.E.: The human
progesterone receptor A-form functions as a transcriptional modulator of
mineralocorticoid receptor transcriptional activity. J Steroid Biochem Mol Biol 48
(1994) 425-32.
McHugh, M. and Cheng, Y.C.: Demonstration of a high affinity folate binder in human
cell membranes and its characterization in cultured human KB cells. J Biol Chem
254 (1979) 11312-8.
193 McInerney, E.M., Rose, D.W., Flynn, S.E., Westin, S., Mullen, T.M., Krones, A.,
Inostroza, J., Torchia, J., Nolte, R.T., Assa-Munt, N., Milburn, M.V., Glass, C.K.
and Rosenfeld, M.G.: Determinants of coactivator LXXLL motif specificity in
nuclear receptor transcriptional activation. Genes Dev 12 (1998) 3357-68.
McKenna, N.J., Lanz, R.B. and O'Malley, B.W.: Nuclear receptor coregulators: cellular
and molecular biology. Endocr Rev 20 (1999a) 321-44.
McKenna, N.J., Nawaz, Z., Tsai, S.Y., Tsai, M.J. and O'Malley, B.W.: Distinct steady-
state nuclear receptor coregulator complexes exist in vivo. Proc Natl Acad Sci U
S A 95 (1998) 11697-702.
McKenna, N.J. and O'Malley, B.W.: From ligand to response: generating diversity in
nuclear receptor coregulator function. J Steroid Biochem Mol Biol 74 (2000) 351-
6.
McKenna, N.J. and O'Malley, B.W.: Nuclear receptors, coregulators, ligands, and
selective receptor modulators: making sense of the patchwork quilt. Ann N Y
Acad Sci 949 (2001) 3-5.
McKenna, N.J. and O'Malley, B.W.: Combinatorial control of gene expression by nuclear
receptors and coregulators. Cell 108 (2002a) 465-74.
194 McKenna, N.J. and O'Malley, B.W.: Minireview: nuclear receptor coactivators--an
update. Endocrinology 143 (2002b) 2461-5.
McKenna, N.J., Xu, J., Nawaz, Z., Tsai, S.Y., Tsai, M.J. and O'Malley, B.W.: Nuclear
receptor coactivators: multiple enzymes, multiple complexes, multiple functions.
J Steroid Biochem Mol Biol 69 (1999b) 3-12.
Meyer, M.E., Pornon, A., Ji, J.W., Bocquel, M.T., Chambon, P. and Gronemeyer, H.:
Agonistic and antagonistic activities of RU486 on the functions of the human
progesterone receptor. Embo J 9 (1990) 3923-32.
Meyer, S., Temme, C. and Wahle, E.: Messenger RNA turnover in eukaryotes: pathways
and enzymes. Crit Rev Biochem Mol Biol 39 (2004) 197-216.
Milanini-Mongiat, J., Pouyssegur, J. and Pages, G.: Identification of two Sp1
phosphorylation sites for p42/p44 mitogen-activated protein kinases: their
implication in vascular endothelial growth factor gene transcription. J Biol Chem
277 (2002) 20631-9.
Mizzen, C.A. and Allis, C.D.: Linking histone acetylation to transcriptional regulation.
Cell Mol Life Sci 54 (1998) 6-20.
195 Mizzen, C.A., Brownell, J.E., Cook, R.G. and Allis, C.D.: Histone acetyltransferases:
preparation of substrates and assay procedures. Methods Enzymol 304 (1999)
675-96.
Mohan, R. and Heyman, R.A.: Orphan nuclear receptor modulators. Curr Top Med Chem
3 (2003) 1637-47.
Moore, M.R., Hathaway, L.D. and Bircher, J.A.: Progestin stimulation of thymidine
kinase in the human breast cancer cell line T47D. Biochim Biophys Acta 1096
(1991) 170-4.
Moore, M.R., Zhou, J.L., Blankenship, K.A., Strobl, J.S., Edwards, D.P. and Gentry,
R.N.: A sequence in the 5' flanking region confers progestin responsiveness on
the human c-myc gene. J Steroid Biochem Mol Biol 62 (1997) 243-52.
Mulac-Jericevic, B., Lydon, J.P., DeMayo, F.J. and Conneely, O.M.: Defective mammary
gland morphogenesis in mice lacking the progesterone receptor B isoform. Proc
Natl Acad Sci U S A 100 (2003) 9744-9.
Mulac-Jericevic, B., Mullinax, R.A., DeMayo, F.J., Lydon, J.P. and Conneely, O.M.:
Subgroup of reproductive functions of progesterone mediated by progesterone
receptor-B isoform. Science 289 (2000) 1751-4.
196 Mullick, J., Anandatheerthavarada, H.K., Amuthan, G., Bhagwat, S.V., Biswas, G.,
Camasamudram, V., Bhat, N.K., Reddy, S.E., Rao, V. and Avadhani, N.G.:
Physical interaction and functional synergy between glucocorticoid receptor and
Ets2 proteins for transcription activation of the rat cytochrome P-450c27
promoter. J Biol Chem 276 (2001) 18007-17.
Murphy, P.J., Morishima, Y., Kovacs, J.J., Yao, T.P. and Pratt, W.B.: Regulation of the
dynamics of hsp90 action on the glucocorticoid receptor by
acetylation/deacetylation of the chaperone. J Biol Chem 280 (2005) 33792-9.
Naar, A.M., Taatjes, D.J., Zhai, W., Nogales, E. and Tjian, R.: Human CRSP interacts
with RNA polymerase II CTD and adopts a specific CTD-bound conformation.
Genes Dev 16 (2002) 1339-44.
Nakashima, K., Zhou, X., Kunkel, G., Zhang, Z., Deng, J.M., Behringer, R.R. and de
Crombrugghe, B.: The novel zinc finger-containing transcription factor osterix is
required for osteoblast differentiation and bone formation. Cell 108 (2002) 17-29.
Narayan, V.A., Kriwacki, R.W. and Caradonna, J.P.: Structures of zinc finger domains
from transcription factor Sp1. Insights into sequence-specific protein-DNA
recognition. J Biol Chem 272 (1997) 7801-9.
Narlikar, G.J., Fan, H.Y. and Kingston, R.E.: Cooperation between complexes that
regulate chromatin structure and transcription. Cell 108 (2002) 475-87.
197 Nie, Z., Xue, Y., Yang, D., Zhou, S., Deroo, B.J., Archer, T.K. and Wang, W.: A
specificity and targeting subunit of a human SWI/SNF family-related chromatin-
remodeling complex. Mol Cell Biol 20 (2000) 8879-88.
Nissen, R.M. and Yamamoto, K.R.: The glucocorticoid receptor inhibits NFkappaB by
interfering with serine-2 phosphorylation of the RNA polymerase II carboxy-
terminal domain. Genes Dev 14 (2000) 2314-29.
Nobukuni, Y., Smith, C.L., Hager, G.L. and Detera-Wadleigh, S.D.: Characterization of
the human glucocorticoid receptor promoter. Biochemistry 34 (1995) 8207-14.
Norman, A.W., Mizwicki, M.T. and Norman, D.P.: Steroid-hormone rapid actions,
membrane receptors and a conformational ensemble model. Nat Rev Drug Discov
3 (2004) 27-41.
O'Malley, B.W.: Molecular biology. Little molecules with big goals. Science 313 (2006)
1749-50.
Oakley, R.H., Webster, J.C., Sar, M., Parker, C.R., Jr. and Cidlowski, J.A.: Expression
and subcellular distribution of the beta-isoform of the human glucocorticoid
receptor. Endocrinology 138 (1997) 5028-38.
Onishi, T., Yamakawa, K., Franco, O.E., Kawamura, J., Watanabe, M., Shiraishi, T. and
Kitazawa, S.: Mitogen-activated protein kinase pathway is involved in alpha6
198 integrin gene expression in androgen-independent prostate cancer cells: role of
proximal Sp1 consensus sequence. Biochim Biophys Acta 1538 (2001) 218-27.
Owen, G.I., Richer, J.K., Tung, L., Takimoto, G. and Horwitz, K.B.: Progesterone
regulates transcription of the p21(WAF1) cyclin- dependent kinase inhibitor gene
through Sp1 and CBP/p300. J Biol Chem 273 (1998) 10696-701.
Paola, R.D. and Cuzzocrea, S.: Peroxisome proliferator-activated receptors and acute
lung injury. PPAR Res 2007 (2007) 63745.
Park, J., Kim, M., Na, G., Jeon, I., Kwon, Y.K., Kim, J.H., Youn, H. and Koo, Y.:
Glucocorticoids modulate NF-kappaB-dependent gene expression by up-
regulating FKBP51 expression in Newcastle disease virus-infected chickens. Mol
Cell Endocrinol 278 (2007) 7-17.
Pascual, G., Fong, A.L., Ogawa, S., Gamliel, A., Li, A.C., Perissi, V., Rose, D.W.,
Willson, T.M., Rosenfeld, M.G. and Glass, C.K.: A SUMOylation-dependent
pathway mediates transrepression of inflammatory response genes by PPAR-
gamma. Nature 437 (2005) 759-63.
Patrone, C., Ma, Z.Q., Pollio, G., Agrati, P., Parker, M.G. and Maggi, A.: Cross-coupling
between insulin and estrogen receptor in human neuroblastoma cells. Mol
Endocrinol 10 (1996) 499-507.
199 Pavletich, N.P. and Pabo, C.O.: Zinc finger-DNA recognition: crystal structure of a
Zif268-DNA complex at 2.1 A. Science 252 (1991) 809-17.
Peltonen, K., Kiviharju, T.M., Jarvinen, P.M., Ra, R. and Laiho, M.: Melanoma cell lines
are susceptible to histone deacetylase inhibitor TSA provoked cell cycle arrest
and apoptosis. Pigment Cell Res 18 (2005) 196-202.
Phelan, M.L., Sif, S., Narlikar, G.J. and Kingston, R.E.: Reconstitution of a core
chromatin remodeling complex from SWI/SNF subunits. Mol Cell 3 (1999) 247-
53.
Phiel, C.J., Zhang, F., Huang, E.Y., Guenther, M.G., Lazar, M.A. and Klein, P.S.:
Histone deacetylase is a direct target of valproic acid, a potent anticonvulsant,
mood stabilizer, and teratogen. J Biol Chem 276 (2001) 36734-41.
Philipsen, S. and Suske, G.: A tale of three fingers: the family of mammalian Sp/XKLF
transcription factors. Nucleic Acids Res 27 (1999) 2991-3000.
Picard, D. and Yamamoto, K.R.: Two signals mediate hormone-dependent nuclear
localization of the glucocorticoid receptor. Embo J 6 (1987) 3333-40.
Piedrahita, J.A., Oetama, B., Bennett, G.D., van Waes, J., Kamen, B.A., Richardson, J.,
Lacey, S.W., Anderson, R.G. and Finnell, R.H.: Mice lacking the folic acid-
200 binding protein Folbp1 are defective in early embryonic development. Nat Genet
23 (1999) 228-32.
Pore, N., Liu, S., Shu, H.K., Li, B., Haas-Kogan, D., Stokoe, D., Milanini-Mongiat, J.,
Pages, G., O'Rourke, D.M., Bernhard, E. and Maity, A.: Sp1 is involved in Akt-
mediated induction of VEGF expression through an HIF-1-independent
mechanism. Mol Biol Cell 15 (2004) 4841-53.
Powell, C.E., Watson, C.S. and Gametchu, B.: Immunoaffinity isolation of native
membrane glucocorticoid receptor from S-49++ lymphoma cells: biochemical
characterization and interaction with Hsp 70 and Hsp 90. Endocrine 10 (1999)
271-80.
Pratt, W.B. and Toft, D.O.: Steroid receptor interactions with heat shock protein and
immunophilin chaperones. Endocr Rev 18 (1997) 306-60.
Pratt, W.B. and Toft, D.O.: Regulation of signaling protein function and trafficking by
the hsp90/hsp70-based chaperone machinery. Exp Biol Med (Maywood) 228
(2003) 111-33.
Pugh, B.F. and Tjian, R.: Mechanism of transcriptional activation by Sp1: evidence for
coactivators. Cell 61 (1990) 1187-97.
201 Pujols, L., Mullol, J., Roca-Ferrer, J., Torrego, A., Xaubet, A., Cidlowski, J.A. and
Picado, C.: Expression of glucocorticoid receptor alpha- and beta-isoforms in
human cells and tissues. Am J Physiol Cell Physiol 283 (2002) C1324-31.
Qiu, M. and Lange, C.A.: MAP kinases couple multiple functions of human progesterone
receptors: degradation, transcriptional synergy, and nuclear association. J Steroid
Biochem Mol Biol 85 (2003) 147-57.
Rafty, L.A. and Khachigian, L.M.: Sp1 phosphorylation regulates inducible expression of
platelet-derived growth factor B-chain gene via atypical protein kinase C-zeta.
Nucleic Acids Res 29 (2001) 1027-33.
Ragoussis, J., Senger, G., Trowsdale, J. and Campbell, I.G.: Genomic organization of the
human folate receptor genes on chromosome 11q13. Genomics 14 (1992) 423-30.
Ratnam, M., Hao, H., Zheng, X., Wang, H., Qi, H., Lee, R. and Pan, X.: Receptor
induction and targeted drug delivery: a new antileukaemia strategy. Expert Opin
Biol Ther 3 (2003) 563-74.
Ratnam, M., Marquardt, H., Duhring, J.L. and Freisheim, J.H.: Homologous membrane
folate binding proteins in human placenta: cloning and sequence of a cDNA.
Biochemistry 28 (1989) 8249-54.
202 Rechsteiner, M. and Rogers, S.W.: PEST sequences and regulation by proteolysis. Trends
Biochem Sci 21 (1996) 267-71.
Reichardt, H.M., Kaestner, K.H., Tuckermann, J., Kretz, O., Wessely, O., Bock, R., Gass,
P., Schmid, W., Herrlich, P., Angel, P. and Schutz, G.: DNA binding of the
glucocorticoid receptor is not essential for survival. Cell 93 (1998) 531-41.
Rhen, T. and Cidlowski, J.A.: Antiinflammatory action of glucocorticoids--new
mechanisms for old drugs. N Engl J Med 353 (2005) 1711-23.
Ribot, J., Felipe, F., Bonet, M.L. and Palou, A.: Changes of adiposity in response to
vitamin A status correlate with changes of PPAR gamma 2 expression. Obes Res
9 (2001) 500-9.
Roberts, S.J., Chung, K.N., Nachmanoff, K. and Elwood, P.C.: Tissue-specific promoters
of the alpha human folate receptor gene yield transcripts with divergent 5' leader
sequences and different translational efficiencies. Biochem J 326 ( Pt 2) (1997)
439-47.
Robyr, D., Gegonne, A., Wolffe, A.P. and Wahli, W.: Determinants of vitellogenin B1
promoter architecture. HNF3 and estrogen responsive transcription within
chromatin. J Biol Chem 275 (2000) 28291-300.
203 Rochel, N., Wurtz, J.M., Mitschler, A., Klaholz, B. and Moras, D.: The crystal structure
of the nuclear receptor for vitamin D bound to its natural ligand. Mol Cell 5
(2000) 173-9.
Rochette-Egly, C., Adam, S., Rossignol, M., Egly, J.M. and Chambon, P.: Stimulation of
RAR alpha activation function AF-1 through binding to the general transcription
factor TFIIH and phosphorylation by CDK7. Cell 90 (1997) 97-107.
Rochette-Egly, C., Lutz, Y., Saunders, M., Scheuer, I., Gaub, M.P. and Chambon, P.:
Retinoic acid receptor gamma: specific immunodetection and phosphorylation. J
Cell Biol 115 (1991) 535-45.
Rochman, H., Selhub, J. and Karrison, T.: Folate binding protein and the estrogen
receptor in breast cancer. Cancer Detect Prev 8 (1985) 71-5.
Rogatsky, I., Waase, C.L. and Garabedian, M.J.: Phosphorylation and inhibition of rat
glucocorticoid receptor transcriptional activation by glycogen synthase kinase-3
(GSK-3). Species-specific differences between human and rat glucocorticoid
receptor signaling as revealed through GSK-3 phosphorylation. J Biol Chem 273
(1998) 14315-21.
Rogers, S., Wells, R. and Rechsteiner, M.: Amino acid sequences common to rapidly
degraded proteins: the PEST hypothesis. Science 234 (1986) 364-8.
204 Rojo-Niersbach, E., Furukawa, T. and Tanese, N.: Genetic dissection of hTAF(II)130
defines a hydrophobic surface required for interaction with glutamine-rich
activators. J Biol Chem 274 (1999) 33778-84.
Roos, M.D., Su, K., Baker, J.R. and Kudlow, J.E.: O glycosylation of an Sp1-derived
peptide blocks known Sp1 protein interactions. Mol Cell Biol 17 (1997) 6472-80.
Rosenfeld, M.G. and Glass, C.K.: Coregulator codes of transcriptional regulation by
nuclear receptors. J Biol Chem 276 (2001) 36865-8.
Ross, J.F., Chaudhuri, P.K. and Ratnam, M.: Differential regulation of folate receptor
isoforms in normal and malignant tissues in vivo and in established cell lines.
Physiologic and clinical implications. Cancer 73 (1994) 2432-43.
Russell, K.S., Haynes, M.P., Sinha, D., Clerisme, E. and Bender, J.R.: Human vascular
endothelial cells contain membrane binding sites for estradiol, which mediate
rapid intracellular signaling. Proc Natl Acad Sci U S A 97 (2000) 5930-5.
Ryu, S. and Tjian, R.: Purification of transcription cofactor complex CRSP. Proc Natl
Acad Sci U S A 96 (1999) 7137-42.
Ryu, S., Zhou, S., Ladurner, A.G. and Tjian, R.: The transcriptional cofactor complex
CRSP is required for activity of the enhancer-binding protein Sp1. Nature 397
(1999) 446-50.
205 Sadaie, M. and Nakayama, J.: [Histone methylation in the formation of higher-order
chromatin structure]. Tanpakushitsu Kakusan Koso 52 (2007) 739-46.
Sadasivan, E., Cedeno, M. and Rothenberg, S.P.: Genomic organization of the gene and a
related pseudogene for a human folate binding protein. Biochim Biophys Acta
1131 (1992) 91-4.
Sadasivan, E. and Rothenberg, S.P.: Molecular cloning of the complementary DNA for a
human folate binding protein. Proc Soc Exp Biol Med 189 (1988) 240-4.
Sadasivan, E. and Rothenberg, S.P.: The complete amino acid sequence of a human folate
binding protein from KB cells determined from the cDNA. J Biol Chem 264
(1989) 5806-11.
Safe, S. and Kim, K.: Nuclear receptor-mediated transactivation through interaction with
Sp proteins. Prog Nucleic Acid Res Mol Biol 77 (2004) 1-36.
Saikawa, Y., Price, K., Hance, K.W., Chen, T.Y. and Elwood, P.C.: Structural and
functional analysis of the human KB cell folate receptor gene P4 promoter:
cooperation of three clustered Sp1-binding sites with initiator region for basal
promoter activity. Biochemistry 34 (1995) 9951-61.
206 Saluja, D., Vassallo, M.F. and Tanese, N.: Distinct subdomains of human TAFII130 are
required for interactions with glutamine-rich transcriptional activators. Mol Cell
Biol 18 (1998) 5734-43.
Sapolsky, R.M., Romero, L.M. and Munck, A.U.: How do glucocorticoids influence
stress responses? Integrating permissive, suppressive, stimulatory, and preparative
actions. Endocr Rev 21 (2000) 55-89.
Sartorius, C.A., Tung, L., Takimoto, G.S. and Horwitz, K.B.: Antagonist-occupied
human progesterone receptors bound to DNA are functionally switched to
transcriptional agonists by cAMP. J Biol Chem 268 (1993) 9262-6.
Sasaki, K. and Yoshida, M.: [Histone modification enzymes]. Tanpakushitsu Kakusan
Koso 51 (2006) 2069-75.
Savory, J.G., Hsu, B., Laquian, I.R., Giffin, W., Reich, T., Hache, R.J. and Lefebvre,
Y.A.: Discrimination between NL1- and NL2-mediated nuclear localization of the
glucocorticoid receptor. Mol Cell Biol 19 (1999) 1025-37.
Savouret, J.F., Rauch, M., Redeuilh, G., Sar, S., Chauchereau, A., Woodruff, K., Parker,
M.G. and Milgrom, E.: Interplay between estrogens, progestins, retinoic acid and
AP-1 on a single regulatory site in the progesterone receptor gene. J Biol Chem
269 (1994) 28955-62.
207 Schaaf, M.J. and Cidlowski, J.A.: AUUUA motifs in the 3'UTR of human glucocorticoid
receptor alpha and beta mRNA destabilize mRNA and decrease receptor protein
expression. Steroids 67 (2002) 627-36.
Schindler, A.E., Campagnoli, C., Druckmann, R., Huber, J., Pasqualini, J.R., Schweppe,
K.W. and Thijssen, J.H.: Classification and pharmacology of progestins.
Maturitas 46 Suppl 1 (2003) S7-S16.
Schwabe, J.W., Chapman, L., Finch, J.T. and Rhodes, D.: The crystal structure of the
estrogen receptor DNA-binding domain bound to DNA: how receptors
discriminate between their response elements. Cell 75 (1993a) 567-78.
Schwabe, J.W., Fairall, L., Chapman, L., Finch, J.T., Dutnall, R.N. and Rhodes, D.: The
cocrystal structures of two zinc-stabilized DNA-binding domains illustrate
different ways of achieving sequence-specific DNA recognition. Cold Spring
Harb Symp Quant Biol 58 (1993b) 141-7.
Selhub, J. and Franklin, W.A.: The folate-binding protein of rat kidney. Purification,
properties, and cellular distribution. J Biol Chem 259 (1984) 6601-6.
Selhub, J. and Rosenberg, I.H.: Demonstration of high-affinity folate binding activity
associated with the brush border membranes of rat kidney. Proc Natl Acad Sci U
S A 75 (1978) 3090-3.
208 Shao, W. and Brown, M.: Advances in estrogen receptor biology: prospects for
improvements in targeted breast cancer therapy. Breast Cancer Res 6 (2004) 39-
52.
Shatnawi, A., Tran, T. and Ratnam, M.: R5020 and RU486 act as progesterone receptor
agonists to enhance Sp1/Sp4-dependent gene transcription by an indirect
mechanism. Mol Endocrinol 21 (2007) 635-50.
Shen, F., Ross, J.F., Wang, X. and Ratnam, M.: Identification of a novel folate receptor, a
truncated receptor, and receptor type beta in hematopoietic cells: cDNA cloning,
expression, immunoreactivity, and tissue specificity. Biochemistry 33 (1994)
1209-15.
Shen, F., Wang, H., Zheng, X. and Ratnam, M.: Expression levels of functional folate
receptors alpha and beta are related to the number of N-glycosylated sites.
Biochem J 327 ( Pt 3) (1997) 759-64.
Shen, F., Wu, M., Ross, J.F., Miller, D. and Ratnam, M.: Folate receptor type gamma is
primarily a secretory protein due to lack of an efficient signal for
glycosylphosphatidylinositol modification: protein characterization and cell type
specificity. Biochemistry 34 (1995) 5660-5.
Shen, T., Horwitz, K.B. and Lange, C.A.: Transcriptional hyperactivity of human
progesterone receptors is coupled to their ligand-dependent down-regulation by
209 mitogen-activated protein kinase-dependent phosphorylation of serine 294. Mol
Cell Biol 21 (2001) 6122-31.
Shyamala, G., Chou, Y.C., Louie, S.G., Guzman, R.C., Smith, G.H. and Nandi, S.:
Cellular expression of estrogen and progesterone receptors in mammary glands:
regulation by hormones, development and aging. J Steroid Biochem Mol Biol 80
(2002) 137-48.
Simoncini, T., Hafezi-Moghadam, A., Brazil, D.P., Ley, K., Chin, W.W. and Liao, J.K.:
Interaction of oestrogen receptor with the regulatory subunit of
phosphatidylinositol-3-OH kinase. Nature 407 (2000) 538-41.
Skafar, D.F.: Dimerization of the RU486-bound calf uterine progesterone receptor. J
Steroid Biochem Mol Biol 44 (1993) 39-43.
Smale, S.T., Schmidt, M.C., Berk, A.J. and Baltimore, D.: Transcriptional activation by
Sp1 as directed through TATA or initiator: specific requirement for mammalian
transcription factor IID. Proc Natl Acad Sci U S A 87 (1990) 4509-13.
Smith, C.L., Htun, H., Wolford, R.G. and Hager, G.L.: Differential activity of
progesterone and glucocorticoid receptors on mouse mammary tumor virus
templates differing in chromatin structure. J Biol Chem 272 (1997) 14227-35.
210 Smith, C.M., Haimberger, Z.W., Johnson, C.O., Wolf, A.J., Gafken, P.R., Zhang, Z.,
Parthun, M.R. and Gottschling, D.E.: Heritable chromatin structure: mapping
"memory" in histones H3 and H4. Proc Natl Acad Sci U S A 99 Suppl 4 (2002)
16454-61.
Smoak, K.A. and Cidlowski, J.A.: Mechanisms of glucocorticoid receptor signaling
during inflammation. Mech Ageing Dev 125 (2004) 697-706.
Sousa, A.R., Lane, S.J., Cidlowski, J.A., Staynov, D.Z. and Lee, T.H.: Glucocorticoid
resistance in asthma is associated with elevated in vivo expression of the
glucocorticoid receptor beta-isoform. J Allergy Clin Immunol 105 (2000) 943-50.
Spencer, T.E., Jenster, G., Burcin, M.M., Allis, C.D., Zhou, J., Mizzen, C.A., McKenna,
N.J., Onate, S.A., Tsai, S.Y., Tsai, M.J. and O'Malley, B.W.: Steroid receptor
coactivator-1 is a histone acetyltransferase. Nature 389 (1997) 194-8.
Spiegelstein, O., Eudy, J.D. and Finnell, R.H.: Identification of two putative novel folate
receptor genes in humans and mouse. Gene 258 (2000) 117-25.
Spitz, I.M.: Progesterone receptor antagonists. Curr Opin Investig Drugs 7 (2006) 882-
90.
Spitz, I.M. and Chwalisz, K.: Progesterone receptor modulators and progesterone
antagonists in women's health. Steroids 65 (2000) 807-15.
211 Sterner, D.E. and Berger, S.L.: Acetylation of histones and transcription-related factors.
Microbiol Mol Biol Rev 64 (2000) 435-59.
Stevens, A., Garside, H., Berry, A., Waters, C., White, A. and Ray, D.: Dissociation of
steroid receptor coactivator 1 and nuclear receptor corepressor recruitment to the
human glucocorticoid receptor by modification of the ligand-receptor interface:
the role of tyrosine 735. Mol Endocrinol 17 (2003) 845-59.
Stocklin, E., Wissler, M., Gouilleux, F. and Groner, B.: Functional interactions between
Stat5 and the glucocorticoid receptor. Nature 383 (1996) 726-8.
Stoner, M., Wormke, M., Saville, B., Samudio, I., Qin, C., Abdelrahim, M. and Safe, S.:
Estrogen regulation of vascular endothelial growth factor gene expression in ZR-
75 breast cancer cells through interaction of estrogen receptor alpha and SP
proteins. Oncogene 23 (2004) 1052-63.
Strahl, B.D. and Allis, C.D.: The language of covalent histone modifications. Nature 403
(2000) 41-5.
Strait, K.A., Dabbas, B., Hammond, E.H., Warnick, C.T., Iistrup, S.J. and Ford, C.D.:
Cell cycle blockade and differentiation of ovarian cancer cells by the histone
deacetylase inhibitor trichostatin A are associated with changes in p21, Rb, and Id
proteins. Mol Cancer Ther 1 (2002) 1181-90.
212 Su, K., Roos, M.D., Yang, X., Han, I., Paterson, A.J. and Kudlow, J.E.: An N-terminal
region of Sp1 targets its proteasome-dependent degradation in vitro. J Biol Chem
274 (1999) 15194-202.
Sudimack, J. and Lee, R.J.: Targeted drug delivery via the folate receptor. Adv Drug
Deliv Rev 41 (2000) 147-62.
Suleiman, S.A. and Spector, R.: Purification and characterization of a folate binding
protein from porcine choroid plexus. Arch Biochem Biophys 208 (1981) 87-94.
Suleiman, S.A., Spector, R. and Cancilla, P.: Partial purification and characterization of a
folate-binding protein from human choroid plexus. Neurochem Res 6 (1981) 333-
41.
Sun, X.L. and Antony, A.C.: Evidence that a specific interaction between an 18-base cis-
element in the 5'-untranslated region of human folate receptor-alpha mRNA and a
46-kDa cytosolic trans-factor is critical for translation. J Biol Chem 271 (1996)
25539-47.
Supp, D.M., Witte, D.P., Branford, W.W., Smith, E.P. and Potter, S.S.: Sp4, a member of
the Sp1-family of zinc finger transcription factors, is required for normal murine
growth, viability, and male fertility. Dev Biol 176 (1996) 284-99.
Suske, G.: The Sp-family of transcription factors. Gene 238 (1999) 291-300.
213 Suske, G., Bruford, E. and Philipsen, S.: Mammalian SP/KLF transcription factors: bring
in the family. Genomics 85 (2005) 551-6.
Suzuki, Y., Shimada, J., Shudo, K., Matsumura, M., Crippa, M.P. and Kojima, S.:
Physical interaction between retinoic acid receptor and Sp1: mechanism for
induction of urokinase by retinoic acid. Blood 93 (1999) 4264-76.
Taatjes, D.J., Naar, A.M., Andel, F., 3rd, Nogales, E. and Tjian, R.: Structure, function,
and activator-induced conformations of the CRSP coactivator. Science 295 (2002)
1058-62.
Takimoto, G.S., Tung, L., Abdel-Hafiz, H., Abel, M.G., Sartorius, C.A., Richer, J.K.,
Jacobsen, B.M., Bain, D.L. and Horwitz, K.B.: Functional properties of the N-
terminal region of progesterone receptors and their mechanistic relationship to
structure. J Steroid Biochem Mol Biol 85 (2003) 209-19.
Taneja, R., Rochette-Egly, C., Plassat, J.L., Penna, L., Gaub, M.P. and Chambon, P.:
Phosphorylation of activation functions AF-1 and AF-2 of RAR alpha and RAR
gamma is indispensable for differentiation of F9 cells upon retinoic acid and
cAMP treatment. Embo J 16 (1997) 6452-65.
Tanenbaum, D.M., Wang, Y., Williams, S.P. and Sigler, P.B.: Crystallographic
comparison of the estrogen and progesterone receptor's ligand binding domains.
Proc Natl Acad Sci U S A 95 (1998) 5998-6003.
214 Tanner, K.G., Landry, J., Sternglanz, R. and Denu, J.M.: Silent information regulator 2
family of NAD- dependent histone/protein deacetylases generates a unique
product, 1-O-acetyl-ADP-ribose. Proc Natl Acad Sci U S A 97 (2000) 14178-82.
Taunton, J., Hassig, C.A. and Schreiber, S.L.: A mammalian histone deacetylase related
to the yeast transcriptional regulator Rpd3p. Science 272 (1996) 408-11.
Thi, M.T., Baulieu, E.E. and Milgrom, E.: Comparison of the characteristics and of the
hormonal control of endometrial and myometrial progesterone receptors. J
Endocrinol 66 (1975) 349-56.
Thomson, A.A., Ham, J., Bakker, O. and Parker, M.G.: The progesterone receptor can
regulate transcription in the absence of a functional TATA box element. J Biol
Chem 265 (1990) 16709-12.
Tian, S., Poukka, H., Palvimo, J.J. and Janne, O.A.: Small ubiquitin-related modifier-1
(SUMO-1) modification of the glucocorticoid receptor. Biochem J 367 (2002)
907-11.
Toffoli, G., Cernigoi, C., Russo, A., Gallo, A., Bagnoli, M. and Boiocchi, M.:
Overexpression of folate binding protein in ovarian cancers. Int J Cancer 74
(1997) 193-8.
215 Toffoli, G., Russo, A., Gallo, A., Cernigoi, C., Miotti, S., Sorio, R., Tumolo, S. and
Boiocchi, M.: Expression of folate binding protein as a prognostic factor for
response to platinum-containing chemotherapy and survival in human ovarian
cancer. Int J Cancer 79 (1998) 121-6.
Toffoli, G. and Tumolo, S.: [Prognostic significance of folate binding protein in ovarian
neoplasms]. Tumori 85 (1999) S39-41.
Tomassetti, A., Mangiarotti, F., Mazzi, M., Sforzini, S., Miotti, S., Galmozzi, E., Elwood,
P.C. and Canevari, S.: The variant hepatocyte nuclear factor 1 activates the P1
promoter of the human alpha-folate receptor gene in ovarian carcinoma. Cancer
Res 63 (2003) 696-704.
Tran, T., Shatnawi, A., Zheng, X., Kelley, K.M. and Ratnam, M.: Enhancement of folate
receptor alpha expression in tumor cells through the glucocorticoid receptor: a
promising means to improved tumor detection and targeting. Cancer Res 65
(2005) 4431-41.
Tsai, M.J. and O'Malley, B.W.: Molecular mechanisms of action of steroid/thyroid
receptor superfamily members. Annu Rev Biochem 63 (1994) 451-86.
Tung, L., Mohamed, M.K., Hoeffler, J.P., Takimoto, G.S. and Horwitz, K.B.: Antagonist-
occupied human progesterone B-receptors activate transcription without binding
216 to progesterone response elements and are dominantly inhibited by A-receptors.
Mol Endocrinol 7 (1993) 1256-65.
Turek, J.J., Leamon, C.P. and Low, P.S.: Endocytosis of folate-protein conjugates:
ultrastructural localization in KB cells. J Cell Sci 106 ( Pt 1) (1993) 423-30.
Urnov, F.D.: Chromatin remodeling as a guide to transcriptional regulatory networks in
mammals. J Cell Biochem 88 (2003) 684-94.
Urnov, F.D. and Wolffe, A.P.: An array of positioned nucleosomes potentiates thyroid
hormone receptor action in vivo. J Biol Chem 276 (2001a) 19753-61.
Urnov, F.D. and Wolffe, A.P.: Chromatin remodeling and transcriptional activation: the
cast (in order of appearance). Oncogene 20 (2001b) 2991-3006.
Urnov, F.D. and Wolffe, A.P.: A necessary good: nuclear hormone receptors and their
chromatin templates. Mol Endocrinol 15 (2001c) 1-16.
Van Loo, P.F., Bouwman, P., Ling, K.W., Middendorp, S., Suske, G., Grosveld, F.,
Dzierzak, E., Philipsen, S. and Hendriks, R.W.: Impaired hematopoiesis in mice
lacking the transcription factor Sp3. Blood 102 (2003) 858-66.
Vegeto, E., Shahbaz, M.M., Wen, D.X., Goldman, M.E., O'Malley, B.W. and
McDonnell, D.P.: Human progesterone receptor A form is a cell- and promoter-
217 specific repressor of human progesterone receptor B function. Mol Endocrinol 7
(1993) 1244-55.
Verdin, E., Dequiedt, F. and Kasler, H.G.: Class II histone deacetylases: versatile
regulators. Trends Genet 19 (2003) 286-93.
Verma, S., Ismail, A., Gao, X., Fu, G., Li, X., O'Malley, B.W. and Nawaz, Z.: The
ubiquitin-conjugating enzyme UBCH7 acts as a coactivator for steroid hormone
receptors. Mol Cell Biol 24 (2004) 8716-26.
Vertino, A.M., Bula, C.M., Chen, J.R., Almeida, M., Han, L., Bellido, T., Kousteni, S.,
Norman, A.W. and Manolagas, S.C.: Nongenotropic, anti-apoptotic signaling of
1alpha,25(OH)2-vitamin D3 and analogs through the ligand binding domain of
the vitamin D receptor in osteoblasts and osteocytes. Mediation by Src,
phosphatidylinositol 3-, and JNK kinases. J Biol Chem 280 (2005) 14130-7.
Villagra, A., Gutierrez, J., Paredes, R., Sierra, J., Puchi, M., Imschenetzky, M., Wijnen
Av, A., Lian, J., Stein, G., Stein, J. and Montecino, M.: Reduced CpG methylation
is associated with transcriptional activation of the bone-specific rat osteocalcin
gene in osteoblasts. J Cell Biochem 85 (2002) 112-22.
Wagner, B.L., Norris, J.D., Knotts, T.A., Weigel, N.L. and McDonnell, D.P.: The nuclear
corepressors NCoR and SMRT are key regulators of both ligand- and 8-bromo-
218 cyclic AMP-dependent transcriptional activity of the human progesterone
receptor. Mol Cell Biol 18 (1998) 1369-78.
Wallace, A.D. and Cidlowski, J.A.: Proteasome-mediated glucocorticoid receptor
degradation restricts transcriptional signaling by glucocorticoids. J Biol Chem 276
(2001) 42714-21.
Wang, J., Gunning, W., Kelley, K.M. and Ratnam, M.: Evidence for segregation of
heterologous GPI-anchored proteins into separate lipid rafts within the plasma
membrane. J Membr Biol 189 (2002a) 35-43.
Wang, J.C., Derynck, M.K., Nonaka, D.F., Khodabakhsh, D.B., Haqq, C. and Yamamoto,
K.R.: Chromatin immunoprecipitation (ChIP) scanning identifies primary
glucocorticoid receptor target genes. Proc Natl Acad Sci U S A 101 (2004a)
15603-8.
Wang, L., Mizzen, C., Ying, C., Candau, R., Barlev, N., Brownell, J., Allis, C.D. and
Berger, S.L.: Histone acetyltransferase activity is conserved between yeast and
human GCN5 and is required for complementation of growth and transcriptional
activation. Mol Cell Biol 17 (1997) 519-27.
Wang, X., Shen, F., Freisheim, J.H., Gentry, L.E. and Ratnam, M.: Differential
stereospecificities and affinities of folate receptor isoforms for folate compounds
and antifolates. Biochem Pharmacol 44 (1992) 1898-901.
219 Wang, Y., Wysocka, J., Sayegh, J., Lee, Y.H., Perlin, J.R., Leonelli, L., Sonbuchner,
L.S., McDonald, C.H., Cook, R.G., Dou, Y., Roeder, R.G., Clarke, S., Stallcup,
M.R., Allis, C.D. and Coonrod, S.A.: Human PAD4 regulates histone arginine
methylation levels via demethylimination. Science 306 (2004b) 279-83.
Wang, Z., Frederick, J. and Garabedian, M.J.: Deciphering the phosphorylation "code" of
the glucocorticoid receptor in vivo. J Biol Chem 277 (2002b) 26573-80.
Ward, C.M.: Folate-targeted non-viral DNA vectors for cancer gene therapy. Curr Opin
Mol Ther 2 (2000) 182-7.
Wardell, S.E., Boonyaratanakornkit, V., Adelman, J.S., Aronheim, A. and Edwards, D.P.:
Jun dimerization protein 2 functions as a progesterone receptor N-terminal
domain coactivator. Mol Cell Biol 22 (2002) 5451-66.
Webster, J.C. and Cidlowski, J.A.: Mechanisms of Glucocorticoid-receptor-mediated
Repression of Gene Expression. Trends Endocrinol Metab 10 (1999) 396-402.
Webster, J.C., Jewell, C.M., Bodwell, J.E., Munck, A., Sar, M. and Cidlowski, J.A.:
Mouse glucocorticoid receptor phosphorylation status influences multiple
functions of the receptor protein. J Biol Chem 272 (1997) 9287-93.
Wei, L.L., Gonzalez-Aller, C., Wood, W.M., Miller, L.A. and Horwitz, K.B.: 5'-
Heterogeneity in human progesterone receptor transcripts predicts a new amino-
220 terminal truncated "C"-receptor and unique A-receptor messages. Mol Endocrinol
4 (1990) 1833-40.
Wei, L.L., Hawkins, P., Baker, C., Norris, B., Sheridan, P.L. and Quinn, P.G.: An amino-
terminal truncated progesterone receptor isoform, PRc, enhances progestin-
induced transcriptional activity. Mol Endocrinol 10 (1996) 1379-87.
Wei, L.L., Norris, B.M. and Baker, C.J.: An N-terminally truncated third progesterone
receptor protein, PR(C), forms heterodimers with PR(B) but interferes in PR(B)-
DNA binding. J Steroid Biochem Mol Biol 62 (1997) 287-97.
Weintraub, H.: Tissue-specific gene expression and chromatin structure. Harvey Lect 79
(1983) 217-44.
Weitman, S.D., Frazier, K.M. and Kamen, B.A.: The folate receptor in central nervous
system malignancies of childhood. J Neurooncol 21 (1994) 107-12.
Weitman, S.D., Lark, R.H., Coney, L.R., Fort, D.W., Frasca, V., Zurawski, V.R., Jr. and
Kamen, B.A.: Distribution of the folate receptor GP38 in normal and malignant
cell lines and tissues. Cancer Res 52 (1992) 3396-401.
White, R., Sjoberg, M., Kalkhoven, E. and Parker, M.G.: Ligand-independent activation
of the oestrogen receptor by mutation of a conserved tyrosine. Embo J 16 (1997)
1427-35.
221 Willy, P.J., Murray, I.R., Qian, J., Busch, B.B., Stevens, W.C., Jr., Martin, R., Mohan, R.,
Zhou, S., Ordentlich, P., Wei, P., Sapp, D.W., Horlick, R.A., Heyman, R.A. and
Schulman, I.G.: Regulation of PPARgamma coactivator 1alpha (PGC-1alpha)
signaling by an estrogen-related receptor alpha (ERRalpha) ligand. Proc Natl
Acad Sci U S A 101 (2004) 8912-7.
Wu, M., Gunning, W. and Ratnam, M.: Expression of folate receptor type alpha in
relation to cell type, malignancy, and differentiation in ovary, uterus, and cervix.
Cancer Epidemiol Biomarkers Prev 8 (1999) 775-82.
Wurtz, J.M., Bourguet, W., Renaud, J.P., Vivat, V., Chambon, P., Moras, D. and
Gronemeyer, H.: A canonical structure for the ligand-binding domain of nuclear
receptors. Nat Struct Biol 3 (1996) 206.
Yamaguchi, T., Hirota, K., Nagahama, K., Ohkawa, K., Takahashi, T., Nomura, T. and
Sakaguchi, S.: Control of immune responses by antigen-specific regulatory T cells
expressing the folate receptor. Immunity 27 (2007) 145-59.
Yan, W. and Ratnam, M.: Preferred sites of glycosylphosphatidylinositol modification in
folate receptors and constraints in the primary structure of the hydrophobic
portion of the signal. Biochemistry 34 (1995) 14594-600.
Yang, J., Croniger, C.M., Lekstrom-Himes, J., Zhang, P., Fenyus, M., Tenen, D.G.,
Darlington, G.J. and Hanson, R.W.: Metabolic response of mice to a postnatal
222 ablation of CCAAT/enhancer-binding protein alpha. J Biol Chem 280 (2005)
38689-99.
Yudt, M.R. and Cidlowski, J.A.: The glucocorticoid receptor: coding a diversity of
proteins and responses through a single gene. Mol Endocrinol 16 (2002) 1719-26.
Zhang, J., Guenther, M.G., Carthew, R.W. and Lazar, M.A.: Proteasomal regulation of
nuclear receptor corepressor-mediated repression. Genes Dev 12 (1998) 1775-80.
Zhang, Y., Li, N., Caron, C., Matthias, G., Hess, D., Khochbin, S. and Matthias, P.:
HDAC-6 interacts with and deacetylates tubulin and microtubules in vivo. Embo J
22 (2003) 1168-79.
Zhang, Y. and Reinberg, D.: Transcription regulation by histone methylation: interplay
between different covalent modifications of the core histone tails. Genes Dev 15
(2001) 2343-60.
Zheng, X., Kelley, K., Elnakat, H., Yan, W., Dorn, T. and Ratnam, M.: mRNA instability
in the nucleus due to a novel open reading frame element is a major determinant
of the narrow tissue specificity of folate receptor alpha. Mol Cell Biol 23 (2003)
2202-12.
Zhou, J. and Cidlowski, J.A.: The human glucocorticoid receptor: one gene, multiple
proteins and diverse responses. Steroids 70 (2005) 407-17.
223 Zong, J., Ashraf, J. and Thompson, E.B.: The promoter and first, untranslated exon of the
human glucocorticoid receptor gene are GC rich but lack consensus
glucocorticoid receptor element sites. Mol Cell Biol 10 (1990) 5580-5.
224 ABSTRACT
The folate receptor α (FR-α) is a cell surface protein that expressed in tissue selective
manner and is capable of transporting folate, antifolates and folate conjugated molecules
and nanoparticles into the cells. In contrast to the normal tissues where its expression is
limited to the apical surface of epithelial tissues and isolated from the bloodstream, FR-α
is over-expressed in certain gynecological tumors such as ovarian cancer where it is
highly accessible via the circulation. Therefore, FR-α is a promising means for selective
tumor targeting.
We have shown that the glucocorticoid (GR) and progesterone (PR) receptors positively
regulate FR-α gene expression in cell culture and in tumor xenograft models. The
expression of FR-α is enhanced further by combination of GR agonist with well-tolerated
HDAC inhibitors such as valproic acid (VPA). Time course experiments and the use of
protein synthesis inhibitor cycloheximide, showed that GR, PR-A and PR-B up-regulate
FR-α expression indirectly in a ligand dependent manner. The promoter analysis of the
FR-α gene showed the involvement of the G/C-rich Sp1 binding sites of the P4 promoter
for the action of GR and PR and regulation by both receptors was optimal in the proper
initiator context. Interestingly, the classical GR and PR receptor antagonist RU486 also
activates FR-α expression but only through PR-B. Similar observations were made for PR
regulation of the genes encoding p27, thymidine kinase 1, and p21. The results support
the concept of increasing FR-alpha expression selectively in the receptor-positive tumors by brief treatment with a nontoxic dose of a GR and PR agonist, alone or in combination with a well-tolerated HDAC inhibitor, to increase the efficacy of various FR-alpha- dependent therapeutic and diagnostic applications. In addition, our findings contradict the
225 current view of Sp1-dependent gene regulation by PR and point to the existence of one or more PR target genes whose promoter and cell context(s) must be key determinants of the agonistic activity of RU486 on a large group of important Sp1-dependent downstream target genes.
226