A Change in the Structure of Vβ Chromatin Associated with TCR β Allelic Exclusion Rajkamal Tripathi, Annette Jackson and Michael S. Krangel This information is current as J Immunol 2002; 168:2316-2324; ; of September 28, 2021. doi: 10.4049/jimmunol.168.5.2316 http://www.jimmunol.org/content/168/5/2316 Downloaded from References This article cites 69 articles, 29 of which you can access for free at: http://www.jimmunol.org/content/168/5/2316.full#ref-list-1
Why The JI? Submit online.
http://www.jimmunol.org/ • Rapid Reviews! 30 days* from submission to initial decision
• No Triage! Every submission reviewed by practicing scientists
• Fast Publication! 4 weeks from acceptance to publication
*average by guest on September 28, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2002 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. A Change in the Structure of V Chromatin Associated with TCR  Allelic Exclusion1
Rajkamal Tripathi, Annette Jackson, and Michael S. Krangel2
To investigate chromatin control of TCR  rearrangement and allelic exclusion, we analyzed TCR  chromatin structure in double negative (DN) thymocytes, which are permissive for TCR  recombination, and in double positive (DP) thymocytes, which are postallelic exclusion and nonpermissive for V to DJ recombination. Histone acetylation mapping and DNase I sensitivity studies indicate V and DJ segments to be hyperacetylated and accessible in DN thymocytes. However, they are separated from each other by hypoacetylated and inaccessible trypsinogen chromatin. The transition from DN to DP is accompanied by selective down-regulation of V acetylation and accessibility. The level of DP acetylation and accessibility is minimal for five of six V segments studied but remains substantial for one. Hence, the observed changes in V chromatin structure appear sufficient to account for allelic exclusion of many V segments. They may contribute to, but not by themselves fully account for, allelic Downloaded from exclusion of others. The Journal of Immunology, 2002, 168: 2316Ð2324.
uring T and B lymphocyte development, TCR and Ig on the assembly of a membrane Ig polypeptide into a pre-B cell gene variable (V), diversity (D), and joining (J) seg- receptor (BCR) complex (12, 13). Pre-TCR and pre-BCR signaling D ments are assembled by the process of V(D)J recombi- also induces critical developmental transitions during T and B
nation (1, 2). In both lineages, V(D)J recombination occurs in a lymphocyte development (from DN to DP and pro-B to pre-B, http://www.jimmunol.org/ highly ordered and tightly regulated fashion (3–6). In the B lin- respectively), as well as the proliferative expansion of developing eage, IgH locus rearrangement initiates in pro-B cells and occurs lymphocytes (14, 15). How pre-TCR- and pre-BCR-derived sig- in two steps, first DH to JH, and then VH to DJH. Rearrangement of nals impact the process of V(D)J recombination to inhibit V to DJ Ig L chain loci (Ig and Ig) initiates subsequently, at the pre-B rearrangement at the TCR  and IgH loci is not well understood. cell stage, and occurs in a single step (V to J or V to J). In V(D)J recombination is initiated by the recombinase-activating similar fashion, V(D)J recombination occurs at two distinct stages gene (RAG)-1 and RAG-2 proteins, which introduce double-strand in the development of ␣ T lineage cells. TCR  locus rearrange- breaks at recombination signal sequences (RSSs) flanking Ig and Ϫ Ϫ ment initiates in CD4 CD8 double negative (DN)3 thymocytes TCR gene segments (1, 2). One level at which V(D)J recombina- and occurs in two steps, first D to J and then V to DJ. TCR tion can be regulated is by developmental activation and inactiva- by guest on September 28, 2021 ϩ ϩ ␣ locus rearrangement initiates subsequently in CD4 CD8 tion of RAG gene expression. For example, developmental inac- double positive (DP) thymocytes and occurs in a single step tivation of RAG gene expression can account for the termination (V␣ to J␣). of V␣ to J␣ rearrangement upon transition of DP thymocytes to the A striking regulatory feature of V(D)J recombination is the phe- single positive stage, and for termination of Ig L chain rearrange- nomenon of allelic exclusion, which restricts precursor lympho- ment on transition of pre-B cells to the immature B cell stage (6, cytes to the production of a single, functional Ag receptor gene at 16). However, other developmental changes in V(D)J recombina- a given locus. Allelic exclusion functions in highly analogous fash- tion can occur in the face of ongoing RAG gene expression and ion at the IgH and TCR  loci. In each case, the presence of a   recombinase activity. The inhibition of V to DJ and VH to DJH functional VDJ rearrangement on one allele inhibits the V to DJ rearrangement that characterizes allelic exclusion falls into this step of rearrangement on the second allele by a feedback mecha- category. Although pre-TCR and pre-BCR signaling down-regu- nism (7–9). For TCR , the feedback signal depends on the as- lates RAG expression in late-stage DN thymocytes and pro-B sembly of a TCR  polypeptide into a pre-TCR complex with cells, respectively, allelic exclusion is enforced despite the subse- pre-T␣ and CD3, and on the activity of the nonreceptor protein quent up-regulation of RAG expression that is associated with V␣ tyrosine kinase lck (10, 11). Similarly, for IgH this signal depends to J␣ rearrangement in DP thymocytes, and with V to J and V to J rearrangement in pre-B cells (6, 16). In general, develop- Department of Immunology, Duke University Medical Center, Durham, NC 27710 mental changes in recombinase targeting have been attributed to Received for publication November 9, 2001. Accepted for publication December developmental changes in locus accessibility to the recombinase, 21, 2001. with chromatin structure under the control of specific promoters The costs of publication of this article were defrayed in part by the payment of page and enhancers (3–6, 17–19). However, data addressing the role of charges. This article must therefore be hereby marked advertisement in accordance chromatin structure in the process of allelic exclusion have been with 18 U.S.C. Section 1734 solely to indicate this fact. 1 limited (20). This work was supported by National Institutes of Health Grants GM41052 and  Ј AI49934. The TCR locus spans roughly 700 kb (21). At the 3 end are     2 Address correspondence and reprint requests to Dr. Michael S. Krangel, Department two D -J -C clusters, as well as a single, inverted V gene of Immunology, Duke University Medical Center, PO Box 3010, Durham, NC 27710. segment. The majority of V segments are scattered across a re- E-mail address: [email protected] gion that extends from 250 to 500 kb upstream of the D-J-C 3 Abbreviations used in this paper: DN, double negative; DP, double positive; clusters. This V domain is flanked on the 5Ј side and, remarkably, ␣AcH3, anti-diacetylated histone H3; BCR, B cell receptor; CHIP, chromatin immu- Ј noprecipitation; RAG, recombinase-activating gene; RSS, recombination signal se- on the 3 side as well, by extended arrays of trypsinogen genes and quence; B, bound; U, unbound. gene fragments. Moreover, one V segment is located upstream of
Copyright © 2002 by The American Association of Immunologists 0022-1767/02/$02.00 The Journal of Immunology 2317 the 5Ј trypsinogen cluster, ϳ650 kb away from the D-J-C 0.7% agarose, transferred to nylon, and assayed by hybridization with 32P- clusters. To date, V(D)J recombination at the TCR  locus has labeled probes generated by random priming. DNA fragments DJ  (MMAE00665 153,405–153,996), T4T5 (MMAE00663 92,771–93,461), been shown to depend on two cis-elements. E , situated down-        V 11 (MMAE00664 23,621–24,290), V 12 (MMAE00664 14,657– stream of C 2, is required for all D to J and V to DJ rear- 15,446), and V13 (MMAE00664 7,916–8,370) were produced by PCR. rangement events (22, 23), whereas a germline promoter (PD1), Hybridization was quantified using a PhosphorImager. situated upstream of D1, is required specifically for rearrange- ment events involving the D1-J1 cluster (24, 25). Thus, E and Results PD1 cooperate to promote rearrangement of D1 and J1 seg- Strategy ments, but the extent to which this regulation occurs at the level of Acetylation is structural modification of the amino-terminal tails of accessibility, vs at a later step in the reaction, is not fully resolved core histones that is associated with an open, nuclease-sensitive (24–27). chromatin configuration (33–37). A variety of approaches have TCR  allelic exclusion appears not to involve a developmental recently established a very tight relationship between histone hy- transition involving D-J-C chromatin and the activities of E peracetylation and accessibility for V(D)J recombination (18, 19, and PD1. First, signal ends associated with D to J rearrange- 27, 30, 38–42). Based on these results, we used acetylation map- ment are present even in DP thymocytes, suggesting that these ping in the current study to evaluate changes in the structure of segments maintain accessibility to the recombinase at this stage TCR  locus chromatin that might be associated with TCR  al- Ϫ Ϫ (24). Second, in RAG / thymocytes induced to differentiate to lelic exclusion. the DP stage, D-J-C chromatin maintains the germline tran- We used a CHIP assay to measure the acetylation status of TCR scription and CpG hypomethylation that characterizes the DN  locus chromatin before and after allelic exclusion. As a source of Downloaded from compartment (28). These results leave open the possibility that V nonallelically excluded chromatin we used thymocytes of chromatin is regulated independently of E, and that allelic ex- RAGϪ/Ϫ mice (43). These thymocytes are primarily DNIII, a stage clusion is regulated at the level of V chromatin. Indeed, recent in which V to DJ rearrangement is normally permitted. How- data indicate that accessibility and transcription of upstream and ever, an allelic exclusion signal cannot be generated in these mice downstream V segments are maintained in DN thymocytes of due to the lack of TCR  rearrangement and pre-TCR expression Ϫ Ϫ EϪ/Ϫ mice (27). However, only limited data speak to the status on the RAG / background. As a source of allelically excluded http://www.jimmunol.org/ of V segments in DP thymocytes: levels of germline transcripts chromatin we used thymocytes of RAGϪ/Ϫ mice complemented for several upstream V segments (but not the downstream V) with a rearranged TCR  transgene (44). These thymocytes are were found to decline on transition from DN to DP (28, 29). Thus, almost exclusively DP and would already have received an allelic the notion that TCR  allelic exclusion is associated with a change exclusion signal from the TCR -containing pre-TCR at the DN in the structure of V chromatin remains largely untested. In this stage. The lack of V(D)J recombination on the RAGϪ/Ϫ and study we present a detailed comparison of TCR  locus chromatin RAGϪ/Ϫ ϫ TCR  backgrounds ensures that endogenous TCR  structure both before and subsequent to allelic exclusion signals gene segments will be uniformly in germline configuration and that addresses this issue in some detail. therefore directly comparable in both chromatin preparations. by guest on September 28, 2021 Mononucleosomes prepared from RAGϪ/Ϫ and RAGϪ/Ϫ ϫ TCR Materials and Methods  chromatin were immunoprecipitated with anti-AcH3 or a control CHIP serum, and PCR was used to assess the representation of particular  Chromatin immunoprecipitation (CHIP) analysis was performed as de- segments of TCR locus chromatin in equivalent quantities of scribed (30), using rabbit antisera to diacetylated histone H3 (␣AcH3), DNA isolated from the Ab bound and unbound fractions. tetraacetylated histone H4 (Upstate Biotechnology, Lake Placid, NY), and  control rabbit IgG (Sigma-Aldrich, St. Louis, MO). Serial 3-fold dilutions Structure of TCR locus chromatin in DN thymocytes of nucleosomal DNA (20, 6.7, and 2.2 ng) isolated from Ab bound and Because the DNIII compartment is permissive for V to DJ unbound fractions were amplified by 25 cycles of PCR (45 s at 94°C, 1 min    at 51°C, 2 min at 72°C) in a 25-l reaction. PCR products were electro- rearrangement, both V chromatin and D J chromatin were ex- phoresed through 1.5% agarose gels, transferred to nylon, and detected by pected to be in an open or accessible configuration in this com- hybridization with DNA fragments labeled by random priming. PCR prim- partment. To assay V chromatin, we initially analyzed a series of ers used to amplify mononucleosomal DNA or to produce probes for hy- sites spanning 40 kb of the V locus, including five functional V  bridization are listed in Table I. TCR locus primers were designed with segments, that is situated ϳ400 kb upstream of E (Fig. 1). Within reference to GenBank files MMAE000663, MMAE000664, and MMAE000665. Primers for analysis of Oct-2 were described previously this region, we assayed the conserved decamer sequence (45, 46) (30). Blots were washed in 1ϫ SSC and 0.5% SDS for 20 min at 23°C with in several V promoters (V12P, V11P, V9P), the RSS ele- one change. A single serial dilution series produced from each DNA frac- ments flanking V segments (V13R, V12R,V11R, V9R, tion was used for all PCR included in a single experiment. Quantification V6R), and several intergenic sites located between V segments. was accomplished using a PhosphorImager (Molecular Dynamics, Sunny-    vale, CA). Raw acetylation values were derived by determining the dis- To assay D J chromatin we analyzed a site in PD 1 (47, 48), just placement between titration curves for the bound fraction of the ␣AcH3 upstream of the D1 gene segment. Acetylation at these sites was immunoprecipitation and unbound fraction of the control immunoprecipi- compared with that of Oct-2 as a negative control not expressed in tation. Several factors insured that PCR signals were specific. First, there thymocytes (30), and to CD3⑀ as a positive control expressed at is typically only 50–70% sequence homology among V coding segments  Ͻ Ј high levels in thymocytes. All TCR locus sites were chosen so and 50% sequence homology in promoter and 3 flank regions. Second,  repetitive elements in noncoding regions were avoided. Third, our detec- as to exclude the TCR transgene from analysis. tion strategy involved multiple steps, each imparting a degree of specific- Analysis of histone H3 acetylation in DN thymocytes revealed, ity: an initial PCR step to generate products from mononucleosomes, a as expected, a hyperacetylated CD3⑀ gene and a hypoacetylated second PCR step using one primer from the first step and one new primer Oct-2 gene. With respect to the TCR  locus, all sites assayed in to generate an overlapping probe, and, finally, detection of PCR products    by hybridization with radiolabeled PCR probe. both V and D J chromatin displayed levels of acetylation sig- nificantly elevated over that of Oct-2 (Fig. 2). Hence, both V and Assay for general sensitivity to DNase I digestion DJ chromatin display characteristics of active chromatin in DN Thymocytes were permeabilized and treated with DNase I as described (31, thymocytes, a finding consistent with a permissive V(D)J recom- 32). Purified DNA (4 g) was restriction digested, electrophoresed through bination phenotype and with the results of previous studies (27, 2318 CHROMATIN STRUCTURE AND TCR  ALLELIC EXCLUSION
Table I. Primers and probes for CHIP analysis
Oligonucleotide Pairs for PCR Oligonucleotide Pairs for PCR Site from Mononucleosomes to Generate Probes
V13R 3 ACAGCCACCTATCTCTGT 1 ATAATTCACAGTTGCCCTCG 4 GGAGTATAAGAAATAGTCCC 4 V12P 1 CATCCAGCCCTACTTGC 1 2 GTGACATCTATTGGTCAGTG 4 GATGAGCACTGATGTGACA V12R 3 TCAGCTGTGTATCTGTGTG 1 GGCTTTCAAGGATCGATTC 4 AAAGTTCAGAACTGGTGGG 4 V11P 3 GCAGTGACGGAGACAGT 1 CATGCCTGTACCAGAACAA 4 CAGTGGCTTCACTCATAGA 4 V11R 1 AAGGAACGATTCTCAGCTC 1 2 CTCTGTGTCTAAGCTGCTT 4 TTGAGAACAGCTTCTGGGA V9P 1 GAAGCAGTGATACCTAAGG 1 2 AGGAGAGTCACTGCTCATT 4 CCTTACCCTACTTCTGGTT V9R 1 GAGAAGTTCCAATCCAGTC 1 2 TGTGTCTCTACTGCTAGCA 4 AGAGAAGAGGGATGGTTCT V6R 1 AAGGCGATCTATCTGAAGG 1 2 TCCACTGTGCTATACTGCT 4 GAACTGAAAGTACAGGGGT V23GAAGAATTCCCAGTATCCC 1 CTTGTTTCAGACCCCACA 4 GGGAAGAGATTTGACCTCT 4 Downloaded from 12/11-1 1 GGACTCATCATCTGGATTAT 1 2 TGTGCTGACTATCACAGAC 4 CATCATCTAATTTCCTCTGC 12/11-2 3 AGAGAACTTTGAGGAGGTG 1 GTTTTATGAAGAGGTTCCCT 4 GACACTCCTCAGCAAGAAT 4 11/9-1 3 CACATGAATCTCAGAGCCA 1 TACTCCAGATGTGAGCATC 4 TATCTTTCACCCAAAGGCC 4
11/9-2 1 AGAGCAAAGGGAGACAAAC 1 http://www.jimmunol.org/ 2 TTGCTGTCCTCACTTCAGA 4 AGAGCTAACAGTATCTACAC Ϫ1300 3 TTCACTTAAAATTCCAGGTGG 1 TCTTACCTCTAACTTGCCC 4 CAGCTGTACTTGTGAGACT 4 Ϫ600 3 TGGTCATTCAATTCTCCATGA 1 TTAGACAGTTAAATGGCAGAG 4 GGAATTTCCTCTATGTGGTTA 4 ϩ650 1 AGAGGATAAAGCTCTTACAGT 1 2 GATTCTCTCATATGTAGTTGTC 4 AACATATACTCTCATGTGCCT ϩ1350 1 ACTAATTTCTTGGTCACCTCT 1 2 ACCAAGATTTCTGACATTGAC 4 TAAGAACATGGTCATGACCAT T1 1 CAGGCAACAGATAAGGAATC 1 2 AAGCCTTTGACATCACAGAAA 4 TCTTCTAGCCAAAGACCCT by guest on September 28, 2021 T4 1 CTTGCCTTCTTTTTTCTCTC 1 2 ACATATTGCTGGTAATCTGG 4 GTAGAAAGAGTCAAAGAACAC T4/T5 3 CTGAAGTAGTTTCTGGGCA 1 GCCAGTACCTCTTAGACAA 4 ACTTGAGAGGAACTTCAGG 4 T7 3 CAGATTGCAAGTTGTTACTTG 1 TGGAGTTGTCCATTGCAGA 4 GGTGTAGGTCTGTAAGAAAG 4 T9 1 ACAGGTTTCGCTGAATCTG 1 2 ACCTGTCTTTGAAACAGAAAG 4 ACTTTGCAAAGCCACAGAG T14/T15 1 CAAATATGCTAGAGCTGGTA 1 2 GAAGAGCTTCTTATGTCTCA 4 TTGGCTTTAAGGCTATCTTC T20 3 CCTACAGAACCTGATACTG 1 AGGTAATTCTTGCTGTCCC 4 ATCTGGGTATTGGAGGTTC 4 PD13CATTTCAATGACACCCAGC 1 TTGAGAAGGGCGGATACAA 4 GATAAGGAAGGTGACATCC 4 CD3⑀ 5 TTCATCCTTATGGGAAGGC 1 TATGCATAAGGAAGGCTCC 6 ACACAGGAAGTGTAGAGG 6 Actin 1 TTGCTTAGCCCCATCCAGG 1 2 AGGGCGGCTCCAAGCATTT 6 TGTTTGGACCTTGGCATCTTTG
28). A striking feature of V chromatin is the dramatic variation in least 1 kb upstream of the promoter to 1 kb downstream of H3 acetylation across the region analyzed. Acetylation at individ- the RSS. ual V segments varies widely, with acetylation at V11 10-fold For a more complete picture of TCR  locus chromatin structure higher than at V12. Moreover, acetylation oscillates along V in the DN compartment, we analyzed acetylation within the chromatin, with levels locally elevated over V promoters and trypsinogen regions that flank the V cluster on both its 5Ј and 3Ј RSSs and reduced, although still above background, at positions ends (Figs. 1 and 3B). T20 in the 3Ј trypsinogen region is known between V segments. to encode preprotrypsin and to be expressed in pancreatic acinar To better define the domains of elevated H3 acetylation associ- cells (49), but we are unaware of expression data for other murine ated with V segments, we analyzed a series of sites that extended trypsinogen genes. Our analysis revealed the majority of sites as- upstream and downstream of V9 but nevertheless remained quite sayed in both trypsinogen clusters to display H3 acetylation es- distant from flanking V segments (Fig. 3A). We found acetylation sentially equivalent to that of the negative control Oct-2 gene. The to be elevated over a relatively broad region extending from at only exception was the T1 gene at the distal end of the 5Ј cluster, The Journal of Immunology 2319 Downloaded from http://www.jimmunol.org/
FIGURE 1. Schematic of the TCR  locus. f, Gene segments; ‚, RSSs; F,E; arrows, promoters. Dots identify sites analyzed by CHIP. which displayed H3 acetylation that was slightly above back- ments but was as little as 54% for V11. Importantly, these re- ground. Nevertheless, acetylation at T1 was clearly lower than at ductions occur despite elevated acetylation of PD1 in the same any site assayed in either V or DJ chromatin. Thus, we conclude samples. Hence, there is a striking and highly selective change in that in contrast to the V and DJ regions, the 5Ј and 3Ј trypsinogen the structure of V chromatin that accompanies allelic exclusion. by guest on September 28, 2021 clusters have characteristics of inactive chromatin. Consistent with Similar results were obtained when many of the same sites were this, we failed to detect thymic expression of T1 and T4 by Northern analyzed in independent experiments (Fig. 4A and data not blot (data not shown). shown). V2 is isolated from all other V segments at the extreme 5Ј end of the TCR  locus, upstream of the 5Ј trypsinogen cluster (Fig. 1). It was therefore of interest to characterize the structure of Comparison of TCR  locus chromatin structure in thymocytes V2 chromatin. As for V segments in the main cluster, V2 was and non-T cells found to be hyperacetylated in DN thymocytes (Fig. 4A). We did Although acetylation at V11 was reduced in DP as compared not analyze V14, which is isolated at the 3Ј end of the locus, with DN thymocytes, acetylation in the DP compartment was still because we could not distinguish endogenous V14 from a copy substantial (Figs. 2 and 4A). To evaluate the significance of this contained in the TCR  transgene used to induce the DN to DP observation, we compared acetylation in DN and DP cells to that transition. in non-T cells at selected sites across the locus (Fig. 4). As a source Ϫ Ϫ Ϫ Ϫ Comparison of TCR  locus chromatin structure in DN and DP of non-T cells, we examined splenocytes of either C / C␦ / Ϫ Ϫ thymocytes mice (Fig. 4A)orC / mice (Fig. 4B), both of which lack ␣ T cells (50, 51). These splenocytes consist primarily of B cells and To determine whether a change in TCR  locus chromatin struc-  ture accompanies allelic exclusion, we compared H3 acetylation macrophages and should retain the entire V locus in germline along V and DJ chromatin in DN and DP thymocytes (Fig. 2). configuration. To insure equivalence of the DN, DP, and non-T  We found the control Oct-2 gene to be equivalently hypoacetylated cell samples, we analyzed acetylation at a site in -actin (data not  in the DN and DP compartments, confirming the DN and DP sam- shown) and normalized the acetylation values for TCR locus  ples to be comparable. CD3⑀ acetylation was 3-fold higher in DP chromatin on the basis of the -actin data. The validity of this thymocytes than in DN thymocytes. With respect to the TCR  approach was confirmed by the equivalent levels of histone H3 locus, we found acetylation at PD1 to be nearly twice as high in (Fig. 4A) and H4 (Fig. 4B) acetylation calculated for sites within the DP as the DN compartment. Thus DJ chromatin appears to trypsinogen chromatin, which appears to be inactive in all three be active in both thymocyte populations, consistent with inferences cell populations. drawn from previous studies (24, 28). However, quite different Analysis of histone H3 (Fig. 4A) and H4 (Fig. 4B) acetylation in results were obtained for V chromatin. At all points assayed, non-T cells revealed the TCR  locus acetylation profiles to be including both V segments and sites between V segments, H3 largely T cell-specific. Strikingly, the residual H3 acetylation at acetylation was lower in the DP compartment than in the DN com- V11 in DP cells was found to be still elevated with respect to partment. This drop was in the 82–92% range for most V seg- non-T cells. A similar result was obtained for V9, although the 2320 CHROMATIN STRUCTURE AND TCR  ALLELIC EXCLUSION Downloaded from http://www.jimmunol.org/
FIGURE 3. V9 and trypsinogen H3 acetylation in DN thymocytes. A, Acetylation was measured as in Fig. 2 at a series of sites across the V9 region. Sites are identified based on their distance upstream of V9P or by guest on September 28, 2021 downstream of V9R. The site designated Ϫ2500 is identical to 11/9-2 in Fig. 2 and is 8 kb downstream of V11. Site ϩ1350 is 10 kb upstream of V23. B, Acetylation was measured at sites spanning the 5Ј and 3Ј trypsinogen clusters. T4/T5 and T14/T15 are intergenic sites.
H3. Moreover, for V13 and V9, H4 acetylation in the DP com- partment was somewhat elevated in DP cells as compared with non-T cells. We conclude that V11, in particular, appears to be in FIGURE 2. TCR  locus H3 acetylation in DN and DP thymocytes. A, an intermediate rather than a fully repressed state in DP thymo- Serial 3-fold dilutions of bound (B) and unbound (U) fractions of anti-  AcH3 and control immunoprecipitated DNA were analyzed by PCR at the cytes. Several other V segments may display low-level activity indicated sites. VxP and VxR designate a promoter and an RSS site, as well. respectively, associated with a particular V, and 12/11-1, 12/11-2, 11/9-1, One exception to the T cell specificity of the TCR  locus acet- and 11/9-2 designate intergenic sites. B, H3 acetylation is plotted as B/U, ylation patterns was V2. As for most other V segments, H3 with B representing the bound fraction of the anti-AcH3 immunoprecipi- acetylation at this site was dramatically down-regulated on transi- tate and U representing the unbound fraction of the control immunopre- tion from DN to DP. However, V2 acetylation was slightly cipitate (taken as equivalent to input). Although results of a single exper- higher in non-T cells than in DP thymocytes (Fig. 4A). Perhaps iment are plotted, almost all TCR  locus sites analyzed here were consistent with this, recent data indicated that V2 displays pro- analyzed in two or three independent CHIP experiments starting from in- miscuous activity in other lineages, as V2 germline transcripts dependent mononucleosome preparations. Statistical analysis revealed were identified in NK cells and in a myeloid-enriched population only minor variability at all sites except those displaying the highest acet- ylation values (V11R in DN and PD in DP). Thus, site to site and DN of bone marrow cells (52). to DP comparisons are highly reliable at low to moderate acetylation val- DNase I sensitivity of TCR  locus chromatin in DN and DP ues. Experimental variation observed at V11R and PD does not impact conclusions about changes between DN and DP (compare B to Fig. 4A). thymocytes To understand whether the above documented structural transition in V chromatin reflects a functionally relevant difference in V level of residual DP acetylation was much lower in this case. Anal- segment accessibility, we directly probed the accessibility of TCR ysis of H4 acetylation yielded a similar picture. At two sites as-  locus chromatin by measuring its general sensitivity to DNase I sociated with V segments and two intergenic sites, H4 acetylation digestion (Fig. 5, A–F). Thymocytes were mildly permeabilized was substantially reduced in DP relative to DN thymocytes. How- with detergent and incubated briefly with increasing concentra- ever, the reductions in H4 acetylation were not as great as those for tions of DNase I, following which genomic DNA was purified, The Journal of Immunology 2321
sidual hybridization signals for other fragments were expressed relative to the trypsinogen signal at each point (Fig. 5, B–F). In comparing DN to DP thymocytes, we found that DP thymocytes routinely require less DNase I than DN thymocytes to produce equivalent digests of bulk genomic DNA (data not shown). This may result from increased intrinsic fragility and permeability of DP thymocytes to DNase I or increased sensitivity to detergent permeabilization. Concentrations of DNase I that produced equiv- alent digests of bulk DNA revealed DJ chromatin to have roughly similar sensitivity to DNase I digestion, relative to trypsinogen chromatin, in the two compartments (Fig. 5, compare B to C and D to E). However, relative to trypsinogen and DJ chromatin, the DNase I sensitivity of sites within V chromatin was found to vary between DN and DP thymocytes. V12 and V13 display sensitivities in the DN compartment that are nearly equivalent to that of DJ chromatin, but they display sensitivities in the DP compartment that are much more like that of trypsinogen chromatin (Fig. 5, B and C). Thus, both V segments are highly accessible in DN thymocytes, with V12 accessibility slightly less Downloaded from than that of V13. V12 is converted to an inaccessible configu- ration in DP thymocytes, whereas V13 displays residual, albeit much diminished, accessibility. V11 is notable for its unusually high level of acetylation in DP thymocytes (Figs. 2 and 4). DNase I analysis revealed V11 to be
highly accessible in DN thymocytes and to display only a modest http://www.jimmunol.org/ reduction in accessibility on transition to DP (Fig. 5, D and E). Strikingly, although V11 is significantly more accessible than trypsinogen chromatin in DP thymocytes, it is as inaccessible as trypsinogen chromatin in non T cells (Fig. 5, E and F). Overall, the conclusions drawn from DNase I sensitivity analysis of V11, V12, and V13 match well with the conclusions drawn from acetylation mapping.
Discussion by guest on September 28, 2021 To gain a better understanding of the role of chromatin structure in FIGURE 4. TCR  locus H3 and H4 acetylation in DN thymocytes, DP the developmental regulation of TCR  locus rearrangement and thymocytes, and non-T cells. A, H3 acetylation is plotted as B/U with allelic exclusion, we have analyzed the structure of TCR  locus normalization to the acetylation level of -actin in the same sample. Non-T chromatin in DN thymocytes, a stage that is permissive for TCR  Ϫ/Ϫ ␦Ϫ/Ϫ cells were splenocytes of C C mice. B, H4 acetylation is plotted recombination, and in DP thymocytes, a stage which is postallelic Ϫ/Ϫ as in A. Non-T cells were splenocytes of C mice. exclusion and nonpermissive for V to DJ recombination. Our results are summarized schematically in Fig. 6. We find that both V segments and DJ segments reside in accessible chromatin in digested with restriction enzymes, and analyzed by Southern blot. the DN compartment but that accessible chromatin domains are To minimize artifactual differences in sensitivity to DNase I di- separated from each other by large stretches of inaccessible gestion, we chose to compare fragments that avoided known pro- trypsinogen chromatin. The transition to DP occurs without any moters and thereby avoided potential hypersensitive sites, that reduction in accessibility of DJ chromatin but is accompanied were of similar size and therefore provided similar targets for by conversion of V chromatin to a less-accessible configuration. DNase I digestion, and that were analyzed on a single blot. Digest Of note, this conversion is not uniform for all V segments. Thus, and probe combinations were chosen so as to exclude the TCR  V12 and V13 undergo rather dramatic changes in accessibility transgene from analysis. as defined by DNase I sensitivity. Based on the observed parallels Sample DNase I sensitivity analysis of trypsinogen, DJ, and between the acetylation and accessibility transitions of these V V12 chromatin in DP thymocytes was obtained by probing si- segments, we predict that V2, V6, and V9, which were only multaneously for all three sequences (Fig. 5A). Trypsinogen chro- studied at the level of acetylation, undergo dramatic changes in matin was revealed to be relatively resistant to DNase I digestion accessibility as well. In contrast, the accessibility change at V11 and DJ chromatin relatively sensitive, consistent with their is rather mild, and significant V11 accessibility is maintained in quite distinct acetylation profiles in the DP compartment. By this DP thymocytes. Thus we document changes in V chromatin criterion, trypsinogen chromatin is inaccessible and DJ chro- structure that appear sufficient to account for allelic exclusion of matin is accessible in DP thymocytes. Because V12 chromatin several V segments and that may contribute to, but may not by displays DNase I sensitivity similar to that of trypsinogen chro- themselves fully account for, allelic exclusion of V11. matin and distinct from that of DJ chromatin, it appears to be An important issue raised, by our studies is the mechanism by inaccessible in DP thymocytes as well. which V chromatin structure is controlled. Although E and For additional comparative analyses that eliminated DNA load- PD1 are critical regulators of DJC chromatin, these elements ing as a variable, hybridization signals for trypsinogen chromatin appear not to play significant roles as regulators of V chromatin were normalized to 100% at all DNase I concentrations, and re- (24, 25, 27). V chromatin could theoretically be regulated by the 2322 CHROMATIN STRUCTURE AND TCR  ALLELIC EXCLUSION Downloaded from http://www.jimmunol.org/
FIGURE 5. TCR  locus sensitivity to DNase I digestion. Permeabilized thymocytes were incubated with increasing concentrations of DNase I. Genomic DNA was prepared and digested with PstI and PvuII for analysis of fragments V12 (2.66 kb), V13 (1.85 kb), T4/T5 (2.19 kb), and DJ (1.97 kb), or with PstI and HindIII for analysis of fragments V11 (2.29 kb), T4/T5 (2.76 kb), and DJ (1.97 kb). A, Sample analysis of V12, DJ, and T4/T5 by guest on September 28, 2021 in DP thymocytes. Shown are the results of simultaneous probing for all three fragments on a Southern blot (upper panel) and PhosphorImager quanti- fication of residual signal for each fragment as a function of DNase I concentration (lower panel). B and C, PhosphorImager quantification of relative DNase I sensitivities of V12, V13, DJ, and T4/T5 in DN and DP thymocytes. Signals for T4/T5 are normalized to 100% at all DNase I concentrations, and residual signals for other fragments are expressed as a percentage of the residual T4/T5 signal at each concentration (i.e., percentage of V12 remaining/ percentage of T4/T5 remaining ϫ 100). Two independent blots prepared from independent restriction digests were each serially probed with the same sets of probes and analyzed by PhosphorImager several times, and mean and SE of five to seven total analyses of the two blots are provided. Similar conclusions were also drawn from an independent DNase I digestion series. D–F, PhosphorImager quantification of relative DNase I sensitivities of V11, DJ, and T4/T5 in DN thymocytes, DP thymocytes, and CϪ/Ϫ splenocytes. Analysis was as for B and C, except that only three replicates were conducted for F. promoters of individual V segments, by some form of global regu- the level observed for inactive chromatin at both V segments and lation that affects the entire V cluster or by interactions between intergenic sites, it can be deduced that there is a global change in individual V promoters and a global regulator. Two aspects of the structure that affects the entire V domain. Second, because acetyla- acetylation pattern across the V cluster are worth emphasizing in this tion is locally elevated over V segments and at intermediate levels regard. First, because acetylation in DN thymocytes is elevated over between V segments, there is evidence of local influence that is superimposed on the global influence. In fact, the pattern of acetyla- tion across V chromatin is reminiscent of that across the human -globin locus (37). In this case, acetylation was found to be induced relatively evenly across the locus under the control of an undefined global regulator and to be further elevated over individual transcrip- tion units in association with locus control region-dependent promoter activation. As in the -globin locus, the compound acetylation pattern detected in our experiments seems compatible with the effects of both local and long distance regulators. That locally elevated acetylation over individual V segments might reflect V promoter function begs the question of the rela- tionship between acetylation levels and transcriptional activity. We ⑀  FIGURE 6. Schematic representation of TCR  locus chromatin structure note that although CD3 and V 11 are both heavily acetylated in ⑀ in DN and DP thymocytes. A cartoon version of the H3 acetylation profile DN thymocytes, CD3 transcripts are detectable by Northern blot, across prototypical regions of trypsinogen, V, and DJC chromatin is whereas V11 transcripts are not (data not shown). Moreover, al- presented. though we find substantial acetylation of V6 in DN thymocytes, The Journal of Immunology 2323
V6 transcripts were not detected by RT-PCR (52). Although sug- segments to display greater sensitivity to DNase I digestion in gestive that acetylation and transcription do not correlate, an im- pro-B cells as compared with pre-B or mature T cells (67). Taken portant caveat is that these approaches measure steady state levels together, these studies support the existence of a general mecha- of V transcripts rather than rates of V transcription. Neverthe- nism for the allelic exclusion process. Nevertheless, given the am- less, discordance between acetylation and transcription is certainly biguous data for V11, we cannot exclude the possibility that possible, because recruitment of histone acetyltransferases to pro- allelic exclusion is controlled, at least in part, by a non-chromatin- moters can precede, and can be experimentally segregated from, based mechanism that inhibits V to DJ rearrangement on an transcriptional activity per se (53, 54). Additional work will be allele in which V and DJ segments retain some degree of required to clarify this issue. accessibility to RAG. How this might occur is unclear, but one An important finding of ours is the down-regulated but nevertheless possibility is suggested by recent data demonstrating that V re- Ј  heterogeneous nature of V accessibility in the DP compartment. All arrangement can be mediated by the 12-bp RSS 5 of D 1, but not  V segments analyzed displayed reduced accessibility in the DP as those associated with J segments (68, 69). This raises the possi-    compared with the DN compartment. Nevertheless, whereas most an- bility of a coupling factor for V to D J rearrangement that alyzed V segments (i.e., V12, V13, and, we predict, V2, V6, might itself be developmentally regulated. In summary, we have  and V9 as well) become either inaccessible or nearly so, V11 demonstrated clear structural and functional changes in V chro-  clearly displays residual accessibility, at least as defined by sensitivity matin in thymocytes undergoing TCR allelic exclusion. Addi- to DNase I digestion. Thus, whereas the changes in chromatin struc- tional studies will be required to carefully evaluate the relative ture at V2, V6, V9, V12, and V13 have the potential to ac- roles of chromatin-based and non-chromatin-based regulation in Downloaded from count for allelic exclusion of these gene segments, it is unclear this process.  whether the change at V 11 is sufficient to account for its allelic Acknowledgments exclusion. We considered the possibility that allelic exclusion might We thank Dr. Barry Sleckman for helpful comments on the manuscript. not be complete for V11, but V11 was shown to be efficiently allelically excluded in previous work (11). References An important issue with respect to V11 is how accurately mea- 1. Fugmann, S. D., A. I. Lee, P. E. Shockett, I. J. Villey, and D. G. Schatz. 2000. http://www.jimmunol.org/ sures of general accessibility within chromatin (i.e., acetylation, The RAG proteins and V(D)J recombination: complexes, ends and transposition. Annu. Rev. Immunol. 18:495. DNase I sensitivity) predict the frequency of RAG cleavage. Al- 2. Grawunder, U., and E. Harfst. 2001. How to make ends meet in V(D)J recom- though acetylation seems to correlate well with accessibility for bination. Curr. Opin. Immunol. 13:186. 3. Sleckman, B. P., J. R. Gorman, and F. W. Alt. 1996. Accessibility control of V(D)J recombination in numerous instances, another chromatin antigen receptor variable region gene assembly: role of cis-acting elements. Annu. modification (55, 56) could be most relevant for accessibility to Rev. Immunol. 14:459. RAG. In addition, RSS positioning with respect to the underlying 4. Schlissel, M. S., and P. Stanhope-Baker. 1997. Accessibility and the develop- mental regulation of V(D)J recombination. Semin. Immunol. 9:161. nucleosome can significantly impact RAG access and cleavage 5. Hempel, W. M., I. Leduc, N. Mathieu, R. K. Tripathi, and P. Ferrier. 1998. (41, 57). We note as well that accessibility is clearly not the only Accessibility control of V(D)J recombination: lessons from gene targeting. Adv. Immunol. 69:309. factor governing RAG cleavage in chromatin. Sequence variation by guest on September 28, 2021 6. Hesslein, D. G. T., and D. G. Schatz. 2001. Factors and forces controlling V(D)J among natural RSS heptamer and nonamers (58, 59), spacer regions recombination. Adv. Immunol. 78:169. (60), and coding flanks (61–64) can significantly impact rearrange- 7. Weaver, D., F. Costantini, T. Imanishi-Kari, and D. Baltimore. 1985. A trans-  genic immunoglobulin gene prevents rearrangement of endogenous genes. Cell ment frequencies as well. It is notable that V 12, which is inacces- 42:117. sible in the DP compartment, carries a nonamer (GCAAAAACA) 8. Nussenzweig, M. C., A. C. Shaw, E. Sinn, D. B. Danner, K. L. Holmes, that diverges from the consensus (ACAAAAACC) at only the end H. C. Morse III, and P. Leder. 1987. Allelic exclusion in transgenic mice that express the membrane form of immunoglobulin . Science 236:816. positions. In contrast, V13, which displays low DP accessibility, and 9. Uematsu, Y., S. Ryser, Z. Dembic, P. Borgulya, P. Krimpenfort, A. Berns, V11, which displays substantial DP accessibility, carry more diver- H. von Boehmer, and M. Steinmetz. 1988. In transgenic mice the introduced functional T cell receptor  gene prevents expression of endogenous  genes. gent nonamers (GCACAAAGC and GCAAGAAAC, respectively), Cell 52:831. with substitutions at positions known to significantly inhibit recom- 10. Aifantis, I., J. Buer, H. von Boehmer, and O. Azogui. 1997. Essential role of the bination in test substrates (65, 66). Similarly, V12 has a permissive pre-T cell receptor in allelic exclusion of the T cell receptor  locus. Immunity 7:601. Ј  11. Anderson, S. J., S. D. Levin, and R. M. Perlmutter. 1993. Protein tyrosine kinase C nucleotide immediately 5 of the heptamer, whereas V 13 has a T p56lck controls allelic exclusion of T-cell receptor -chain genes. Nature 365:552. nucleotide that in some studies appears to inhibit recombination (61, 12. Kitamura, D., and K. Rajewsky. 1992. Targeted disruption of chain membrane 64). Thus, chromatin accessibility, as defined here, may integrate exon causes loss of heavy-chain allelic exclusion. Nature 356:154. 13. Loffert, D., A. Ehlich, W. Muller, and K. Rajewsky. 1996. Surrogate light chain with factors like RSS positioning with respect to nucleosomes and expression is required to establish immunoglobulin heavy chain allelic exclusion with variation in RSS or flanking sequences to equalize V seg- during early B cell development. Immunity 4:133. 14. von Boehmer, H., and H. J. Fehling. 1997. Structure and function of the pre-T cell ments as recombination substrates in DP cells. In this manner, receptor. Annu. Rev. Immunol. 15:433. V11 could have a frequency of RAG cleavage in DP cells that is 15. Meffre, E., R. Casellas, and M. C. Nussenzweig. 2000. Antibody regulation of B essentially equivalent to that of V12, despite the difference in cell development. Nat. Immunol. 1:379. 16. Nagaoka, H., W. Yu, and M. C. Nussenzweig. 2000. Regulation of RAG expres- general chromatin accessibility. sion in developing lymphocytes. Curr. Opin. Immunol. 12:187. As a cautionary note, we point out that the fully germline TCR 17. Hernandez-Munain, C., M. McMurry, and M. S. Krangel. 1999. Regulation of    chromatin accessibility for V(D)J recombination. Cold Spring Harbor Symp. locus alleles analyzed in our study are not identical to the D J Quant. Biol. 64:183. rearranged alleles that are the physiological substrates for allelic 18. Roth, D. B., and Y. Roth. 2000. Unequal access: regulating V(D)J recombination exclusion. Fully down-regulated V accessibility could conceiv- through chromatin remodeling. Cell 103:699.   19. Krangel, M. S. 2001. V(D)J recombination becomes accessible. J. Exp. Med. ably require prior D to J rearrangement, a possibility we cannot 193:F27. exclude at the present time. 20. Stanhope-Baker, P., K. M. Hudson, A. L. Shaffer, A. Constantinescu, and The notion that TCR  allelic exclusion is enforced primarily at M. S. Schlissel. 1996. Cell type-specific chromatin structure determines the tar- geting of V(D)J recombinase activity in vitro. Cell 85:887. the level of V segment accessibility would be consistent with prior 21. Rowen, L., B. F. Koop, and L. Hood. 2000. The complete 685-kilobase DNA sequence of the human  T cell receptor locus. Science 272:1755. analyses of the IgH locus, which demonstrated VH RSSs to serve 22. Bouvier, G., F. Watrin, M. Naspetti, C. Verthuy, P. Naquet, and P. Ferrier. 1996. as substrates for exogenously introduced RAG in isolated nuclei of Deletion of the mouse T-cell receptor  gene enhancer blocks ␣ T-cell devel- pro-B cells but not mature B cells (20), and demonstrated VH opment. Proc. Natl. Acad. Sci. USA 93:7877. 2324 CHROMATIN STRUCTURE AND TCR  ALLELIC EXCLUSION
23. Bories, J.-C., J. Demengeot, L. Davidson, and F. W. Alt. 1996. Gene-targeted 47. Sikes, M. L., R. J. Gomez, J. Song, and E. M. Oltz. 1998. A developmental deletion and replacement of the T-cell receptor -chain enhancer: the role of stage-specific promoter directs germline transcription of DJ gene segments in enhancer elements in controlling V(D)J recombination accessibility. Proc. Natl. precursor T lymphocytes. J. Immunol. 161:1399. Acad. Sci. USA 93:7871. 48. Sikes, M. L., C. C. Suarez, and E. M. Oltz. 1999. Regulation of V(D)J recom- 24. Whitehurst, C. E., S. Chattopadhyay, and J. Chen. 1999. Control of V(D)J re- bination by transcriptional promoters. Mol. Cell. Biol. 19:2773. combinational accessibility of the D 1 gene segment at the TCR locus by a 49. Stevenson, B. J., O. Hagenbuchle, and P. K. Wellauer. 1986. Sequence organi- germline promoter. Immunity 10:313. sation and transcriptional regulation of the mouse elastase II and trypsin genes. 25. Whitehurst, C. E., M. S. Schlissel, and J. Chen. 2000. Deletion of germline Nucleic Acids Res. 14:8307.    promoter PD 1 from the TCR locus causes hypermethylation that impairs D 1 50. Mombaerts, P., A. R. Clarke, M. A. Rudnicki, J. Iacomini, S. Itohara, recombination by multiple mechanisms. Immunity 13:703. J. J. Lafaille, L. Wang, Y. Ichikawa, R. Jaenisch, M. L. Hooper, and 26. Hempel, W. M., P. Stanhope-Baker, N. Mathieu, F. Huang, M. S. Schlissel, and S. Tonegawa. 1992. Mutations in T-cell antigen receptor genes ␣ and  block  P. Ferrier. 1998. Enhancer control of V(D)J recombination at the TCR locus: thymocyte development at different stages. Nature 360:225. differential effects on DNA cleavage and joining. Genes Dev. 12:2305. 51. Itohara, S., P. Mombaerts, J. Lafaille, J. Iacomini, A. Nelson, A. R. Clarke, 27. Mathieu, N., W. M. Hempel, S. Spicuglia, C. Verthuy, and P. Ferrier. 2000. M. L. Hooper, A. Farr, and S. Tonegawa. 1993. T cell receptor ␦ gene mutant  Chromatin remodeling by the T cell receptor (TCR)- gene enhancer during early mice: independent generation of ␣ T cells and programmed rearrangements of  T cell development: implications for the control of TCR- locus recombination. ␥␦ TCR genes. Cell 72:337. J. Exp. Med. 192:625. 52. Chen, F., L. Rowen, L. Hood, and E. V. Rothenberg. 2001. Differential tran- 28. Chattopadhyay, S., C. E. Whitehurst, F. Schwenk, and J. Chen. 1998. Biochem- scriptional regulation of individual TCR V segments before gene rearrange- ical and functional analysis of chromatin changes at the TCR- gene locus during ment. J. Immunol. 166:1771. CD4ϪCD8Ϫ to CD4ϩCD8ϩ thymocyte differentiation. J. Immunol. 160:1256. 53. Kuo, M.-H., E. vom Baur, K. Struhl, and C. D. Allis. 2000. Gcn4 activator targets 29. Senoo, M., and Y. Shinkai. 1998. Regulation of V germline transcription in Gcn5 histone acetyltransferase to specific promoters independently of transcrip- RAG-deficient mice by the CD3⑀-mediated signals: implications of V transcrip- tion. Mol. Cell 6:1309. tional regulation in TCR  allelic exclusion. Int. Immunol. 10:553. 30. McMurry, M. T., and M. S. Krangel. 2000. A role for histone acetylation in the 54. Agalioti, T., S. Lomvardas, B. Parekh, J. Yie, T. Maniatis, and D. Thanos. 2000. developmental regulation of V(D)J recombination. Science 287:495. Ordered recruitment of chromatin modifying and general transcription factors to  Downloaded from 31. Boyes, J., and G. Felsenfeld. 1996. Tissue-specific factors additively increase the the IFN- promoter. Cell 103:667. probability of the all-or-none formation of a hypersensitive site. EMBO J. 15:2496. 55. Strahl, B. D., and D. Allis. 2000. The language of covalent histone modifications. 32. Hernandez-Munain, C., B. P. Sleckman, and M. S. Krangel. 1999. A develop- Nature 403:41. mental switch from TCR␦ enhancer to TCR␣ enhancer function during thymo- 56. Jenuwein, T., and C. D. Allis. 2001. Translating the histone code. Science 293: cyte maturation. Immunity 10:723. 1074. 33. Lee, D., J. J. Hayes, D. Pruss, and A. P. Wolffe. 1993. A positive role for histone 57. Kwon, J., A. N. Imbalzano, A. Matthews, and M. A. Oettinger. 1998. Accessi- acetylation in transcription factor access to nucleosomal DNA. Cell 72:73. bility of nucleosomal DNA to V(D)J cleavage is modulated by RSS positioning 34. Hebbes, T. R., A. L. Clayton, A. W. Thorne, and C. Crane-Robinson. 1994. Core and HMG1. Mol. Cell 2:829.
histone hyperacetylation co-maps with generalized DNase I sensitivity in the 58. Ramsden, D. A., and G. Wu. 1991. Mouse light-chain recombination signal http://www.jimmunol.org/ chicken -globin chromosomal domain. EMBO J. 13:1823. sequences mediate recombination more frequently than those of light chain. 35. Vettese-Dadey, M., P. A. Grant, T. R. Hebbes, C. Crane-Robinson, C. D. Allis, and Proc. Natl. Acad. Sci. USA 88:10721. J. L. Workman. 1996. Acetylation of histone H4 plays a primary role in enhancing 59. Connor, A. M., L. J. Fanning, J. W. Celler, L. K. Hicks, D. A. Ramsden, and transcription factor binding to nucleosomal DNA in vitro. EMBO J. 15:2508. G. E. Wu. 1995. Mouse VH7183 recombination signal sequences mediate re- 36. Krajewski, W. A., and P. B. Becker. 1998. Reconstitution of hyperacetylated, combination more frequently than those of VHJ558. J. Immunol. 155:5268. DNase I-sensitive chromatin characterized by high conformational flexibility of 60. Nadel, B., A. Tang, G. Escuro, G. Lugo, and A. J. Feeney. 1998. Sequence of the nucleosomal DNA. Proc. Natl. Acad. Sci. USA 95:1545. spacer in the recombination signal sequence affects V(D)J rearrangement fre- 37. Schubeler, D., C. Francastel, D. M. Cimbora, A. Reik, D. I. K. Martin, and quency and correlates with nonrandom V usage in vitro. J. Exp. Med. 187:1495. M. Groudine. 2000. Nuclear localization and histone acetylation: a pathway for 61. Gerstein, R. M., and M. R. Lieber. 1993. Coding end sequence can markedly  chromatin opening and transcriptional activation of the human -globin locus. affect the initiation of V(D)J recombination. Genes Dev. 7:1459. Genes Dev. 14:940. 62. Boubnov, N. V., Z. P. Wills, and D. T. Weaver. 1995. Coding sequence com- 38. Durum, S. K., S. Candeias, H. Nakajima, W. J. Leonard, A. M. Baird, L. J. Berg, position flanking either signal element alters V(D)J recombination efficiency. by guest on September 28, 2021 ␥ and K. Muegge. 1998. Interleukin 7 receptor control of T cell receptor gene Nucleic Acids Res. 23:1060. rearrangement: role of receptor-associated chains and locus accessibility. J. Exp. 63. Ezekiel, U., P. Engler, D. Stern, and U. Storb. 1995. Asymmetric processing of Med. 188:2233. coding ends and the effect of coding end nucleotide composition on V(D)J re- 39. Cherry, S. R., and D. Baltimore. 1999. Chromatin remodeling directly activates combination. Immunity 2:381. V(D)J recombination. Proc. Natl. Acad. Sci. USA 96:10788. 64. Ezekiel, U. R., T. Sun, G. Bozek, and U. Storb. 1997. The composition of coding 40. McBlane, F., and J. Boyes. 2000. Stimulation of V(D)J recombination by histone joints formed in V(D)J recombination is strongly affected by the nucleotide se- acetylation. Curr. Biol. 10:483. quence of the coding ends and their relationship to the recombination signal 41. Kwon, J., K. B. Morshead, J. R. Guyon, R. E. Kingston, and M. A. Oettinger. sequences. Mol. Cell. Biol. 17:4191. 2000. Histone acetylation and hSWI/SNF remodeling act in concert to stimulate V(D)J cleavage of nucleosomal DNA. Mol. Cell 6:1037. 65. Hesse, J. E., M. R. Lieber, K. Mizuuchi, and M. Gellert. 1989. V(D)J recombi- 42. Agata, Y., T. Katakai, S.-K. Ye, M. Sugai, H. Gonda, T. Honjo, K. Ikuta, and nation: a functional definition of the joining signals. Genes Dev. 3:1053. A. Shimizu. 2001. Histone acetylation determines the developmentally regulated 66. Akamatsu, Y., N. Tsurushita, F. Nagawa, M. Matsuoka, K. Okazaki, M. Imai, and accessibility for T cell receptor-␥ gene recombination. J. Exp. Med. 193:873. H. Sakano. 1994. Essential residues in V(D)J recombination signals. J. Immunol. 43. Shinkai, Y., G. Rathbun, K.-P. Lam, E. M. Oltz, V. E. Stewart, M. Mendelsohn, 153:4520. J. Charron, M. Datta, F. Young, A. M. Stall, and F. W. Alt. 1992. RAG-2- 67. Maes, J., L. P. O’Neill, P. Cavelier, B. M. Turner, F. Rougeon, and M. deficient mice lack mature lymphocytes owing to inability to initiate V(D)J re- Goodhardt. 2001. Chromatin remodeling at the Ig loci prior to V(D)J recombi- arrangement. Cell 68:855. nation. J. Immunol. 167:866. 44. Shinkai, Y., S. Koyasu, K.-I. Nakayama, K. M. Murphy, D. Y. Loh, 68. Sleckman, B. P., C. H. Bassing, M. M. Hughes, A. Okada, M. D’Auteuil, E. L. Reinherz, and F. W. Alt. 1993. Restoration of T cell development in RAG- T. D. Wehrly, B. B. Woodman, L. Davidson, J. Chen, and F. W. Alt. 2000. 2-deficient mice by functional TCR transgenes. Science 259:822. Mechanisms that direct ordered assembly of T cell receptor  locus V, D, and J 45. Anderson, S. J., H. S. Chou, and D. Y. Loh. 1988. A conserved sequence in the gene segments. Proc. Natl. Acad. Sci. USA 97:7975. T-cell receptor -chain promoter region. Proc. Natl. Acad. Sci. USA 85:3551. 69. Bassing, C. H., F. W. Alt, M. M. Hughes, M. D’Auteuil, T. D. Wehrly, 46. Anderson, S. J., S. Miyake, and D. Y. Loh. 1989. Transcription from a murine B. B. Woodman, F. Gartner, J. M. White, L. Davidson, and B. P. Sleckman. 2000. T-cell receptor V promoter depends on a conserved decamer motif similar to the Recombination signal sequences restrict chromosomal V(D)J recombination be- cyclic AMP response element. Mol. Cell. Biol. 9:4835. yond the 12/23 rule. Nature 405:583.