DOCSLIB.ORG

Accession Number Description Fold Enrichment Uniquepeptidecount

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Accession Number Description Fold Enrichment UniquePeptideCount Q05BV5 OGFR protein 6.71 18 P24928 DNA-directed RNA polymerase II subunit RPB1 5.44 14 P07996 Thrombospondin-1 4.17 10 P30876 DNA-directed RNA polymerase II subunit RPB2 4.17 10 Q8WYQ5 Microprocessor complex subunit DGCR8 3.86 9 Q6IB91 PCK2 protein 3.54 8 Q9UN79 Transcription factor SOX-13 3.54 8 P18887 DNA repair protein XRCC1 3.22 7 P28331 NADH-ubiquinone oxidoreductase 75 kDa subunit mitochondrial 2.90 6 P49916 DNA ligase 3 2.90 6 P38646 Stress-70 protein mitochondrial 2.75 11 P13667 Protein disulfide-isomerase A4 2.59 5 Q9Y3Z3 SAM domain and HD domain-containing protein 1 2.59 5 Q12931 Heat shock protein 75 kDa mitochondrial 2.31 9 O00203 AP-3 complex subunit beta-1 2.27 4 O60231 Putative pre-mRNA-splicing factor ATP-dependent RNA helicase DHX16 2.27 4 P02751 Fibronectin 2.27 4 P09960 Leukotriene A-4 hydrolase 2.27 4 P10515 Dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex 2.27 4 P40763 Signal transducer and activator of transcription 3 2.27 4 P46459 Vesicle-fusing ATPase 2.27 4 P50542 Peroxisomal targeting signal 1 receptor 2.27 4 Q01082 Spectrin beta chain brain 1 2.27 4 Q15046 Lysine--tRNA ligase 2.27 4 Q2L6I2 ABC50 protein 2.27 4 Q52LR7 Enhancer of polycomb homolog 2 2.27 4 Q96L91 E1A-binding protein p400 2.27 4 Q9BYT8 Neurolysin mitochondrial 2.27 4 P43246 DNA mismatch repair protein Msh2 2.24 9 P06737 Glycogen phosphorylase liver form 2.17 8 P12956 X-ray repair cross-complementing protein 6 2.05 6 P40939 Trifunctional enzyme subunit alpha mitochondrial 2.05 11 Q15149 Plectin 2.01 7 A3RLL6 Cellular apoptosis susceptibility protein variant 2 1.96 6 P41252 Isoleucine--tRNA ligase cytoplasmic 1.96 6 A5YM55 RECQL5 protein 1.95 3 A6NKH4 Sorting nexin 1 isoform CRA_d 1.95 3 O95373 Importin-7 1.95 3 P02545 Prelamin-A/C 1.95 3 P19338 Nucleolin 1.95 3 P27694 Replication protein A 70 kDa DNA-binding subunit 1.95 3 P27708 CAD protein 1.95 3 P49915 GMP synthase [glutamine-hydrolyzing] 1.95 3 Q3LXA3 Bifunctional ATP-dependent dihydroxyacetone kinase/FAD-AMP lyase (cyclizing) 1.95 3 Q86V21 Acetoacetyl-CoA synthetase 1.95 3 Q8WVM8 Sec1 family domain-containing protein 1 1.95 3 Q96RQ3 Methylcrotonoyl-CoA carboxylase subunit alpha mitochondrial 1.95 3 Q6P996 Pyridoxal-dependent decarboxylase domain-containing protein 1 1.90 5 Q9UJS0 Calcium-binding mitochondrial carrier protein Aralar2 1.90 7 Q9NYU2 UDP-glucose:glycoprotein glucosyltransferase 1 1.83 4 P22102 Trifunctional purine biosynthetic protein adenosine-3 1.81 6 Q13263 Transcription intermediary factor 1-beta 1.81 6 Q7Z406 Myosin-14 1.80 8 P58107 Epiplakin 1.74 5 P54136 Arginine--tRNA ligase cytoplasmic 1.71 6 Q9Y2L1 Exosome complex exonuclease RRP44 1.67 4 A2A274 Aconitase 2 mitochondrial 1.63 2 A2BHY4 Complement component C4B (Childo blood group) 1.63 2 B4DRG7 Condensin complex subunit 2 1.63 2 E7EWU3 Acetyl-coenzyme A synthetase cytoplasmic 1.63 2 F8W8S0 Cytoplasmic dynein 1 intermediate chain 2 1.63 2 O00116 Alkyldihydroxyacetonephosphate synthase peroxisomal 1.63 2 O00429 Dynamin-1-like protein 1.63 2 O15381 Nuclear valosin-containing protein-like 1.63 2 O60306 Intron-binding protein aquarius 1.63 2 O75127 Pentatricopeptide repeat-containing protein 1 1.63 2 O75694 Nuclear pore complex protein Nup155 1.63 2 O75717 WD repeat and HMG-box DNA-binding protein 1 1.63 2 O95965 Integrin beta-like protein 1 1.63 2 P01023 Alpha-2-macroglobulin 1.63 2 P16435 NADPH--cytochrome P450 reductase 1.63 2 P17844 Probable ATP-dependent RNA helicase DDX5 1.63 2 P31040 Succinate dehydrogenase [ubiquinone] flavoprotein subunit mitochondrial 1.63 2 P35579 Myosin-9 1.63 2 P46019 Phosphorylase b kinase regulatory subunit alpha liver isoform 1.63 2 P50895 Basal cell adhesion molecule 1.63 2 P51003 Poly(A) polymerase alpha 1.63 2 P51610 Host cell factor 1 1.63 2 P52888 Thimet oligopeptidase 1.63 2 Q07666 KH domain-containing RNA-binding signal transduction-associated protein 1 1.63 2 Q09666 Neuroblast differentiation-associated protein AHNAK 1.63 2 Q14258 E3 ubiquitin/ISG15 ligase TRIM25 1.63 2 Q58A45 PAB-dependent poly(A)-specific ribonuclease subunit 3 1.63 2 Q6ZRS2 Helicase SRCAP 1.63 2 Q7L8L6 FAST kinase domain-containing protein 5 1.63 2 Q86WA8 Lon protease homolog 2 peroxisomal 1.63 2 Q8IVF4 Dynein heavy chain 10 axonemal 1.63 2 Q8IXW5 Putative RNA polymerase II subunit B1 CTD phosphatase RPAP2 1.63 2 Q8NBJ5 Procollagen galactosyltransferase 1 1.63 2 Q8NDX5 Polyhomeotic-like protein 3 1.63 2 Q8TEX9 Importin-4 1.63 2 Q92783 Signal transducing adapter molecule 1 1.63 2 Q96AY3 Peptidyl-prolyl cis-trans isomerase FKBP10 1.63 2 Q99797 Mitochondrial intermediate peptidase 1.63 2 Q9BTW9 Tubulin-specific chaperone D 1.63 2 Q9BW19 Kinesin-like protein KIFC1 1.63 2 Q9H3P7 Golgi resident protein GCP60 1.63 2 Q9H4A4 Aminopeptidase B 1.63 2 Q9H6R0 Putative ATP-dependent RNA helicase DHX33 1.63 2 Q9NRL3 Striatin-4 1.63 2 Q9NY33 Dipeptidyl peptidase 3 1.63 2 Q9UBU9 Nuclear RNA export factor 1 1.63 2 Q9UHD8 Septin-9 1.63 2 Q9UJV9 Probable ATP-dependent RNA helicase DDX41 1.63 2 Q9Y2Z2 Protein MTO1 homolog mitochondrial 1.63 2 Q86Y56 HEAT repeat-containing protein 2 1.63 4 P35580 Myosin-10 1.61 5 P49588 Alanine--tRNA ligase cytoplasmic 1.57 3 P55265 Double-stranded RNA-specific adenosine deaminase 1.57 3 Q03701 CCAAT/enhancer-binding protein zeta 1.57 3 Q9HAV4 Exportin-5 1.57 3 Q9NTJ3 Structural maintenance of chromosomes protein 4 1.57 3 Q9UBC2 Epidermal growth factor receptor substrate 15-like 1 1.57 3 P53618 Coatomer subunit beta 1.55 14 P28370 Probable global transcription activator SNF2L1 1.53 4 O60763 General vesicular transport factor p115 1.50 5 Q92616 Translational activator GCN1 1.50 5 Q9Y4L1 Hypoxia up-regulated protein 1 1.49 6 O95486 Protein transport protein Sec24A 1.48 5 P21333 Filamin-A 1.46 6 O00410 Importin-5 1.43 3 O14980 Exportin-1 1.42 4 Q9P2J5 Leucine--tRNA ligase cytoplasmic 1.39 4 P41250 Glycine--tRNA ligase 1.38 3 Q92841 Probable ATP-dependent RNA helicase DDX17 1.35 5 P49792 E3 SUMO-protein ligase RanBP2 1.35 7 P14618 Pyruvate kinase isozymes M1/M2 1.34 4 E9PHY5 Band 4.1-like protein 2 1.32 2 O75643 U5 small nuclear ribonucleoprotein 200 kDa helicase 1.32 2 O95573 Long-chain-fatty-acid--CoA ligase 3 1.32 2 P49790 Nuclear pore complex protein Nup153 1.32 2 P50416 Carnitine O-palmitoyltransferase 1 liver isoform 1.32 2 P62979 Ubiquitin-40S ribosomal protein S27a 1.32 2 Q13085 Acetyl-CoA carboxylase 1 1.32 2 Q13618 Cullin-3 1.32 2 Q14444 Caprin-1 1.32 2 Q8TEQ6 Gem-associated protein 5 1.32 2 Q93009 Ubiquitin carboxyl-terminal hydrolase 7 1.32 2 Q9P2R3 Ankyrin repeat and FYVE domain-containing protein 1 1.32 2 Q9UDR5 Alpha-aminoadipic semialdehyde synthase mitochondrial 1.32 2 Q9Y4C2 Protein FAM115A 1.32 2 Q8IY97 Adaptor-related protein complex 1 gamma 1 subunit 1.32 3 Q9Y2A7 Nck-associated protein 1 1.32 3 Q9Y490 Talin-1 1.32 3 P08107 Heat shock 70 kDa protein 1A/1B 1.30 6 P36776 Lon protease homolog mitochondrial 1.25 5 B5BU28 Catenin beta-1 1.24 5 O60488 Long-chain-fatty-acid--CoA ligase 4 1.23 3 Q92878 DNA repair protein RAD50 1.22 3 O43592 Exportin-T 1.20 2 Q15393 Splicing factor 3B subunit 3 1.20 2 Q68CZ2 Tensin-3 1.20 2 Q9P2I0 Cleavage and polyadenylation specificity factor subunit 2 1.20 2 P35606 Coatomer subunit beta' 1.18 2 Q86TG7 Retrotransposon-derived protein PEG10 1.17 3 P04843 Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit 1 1.16 2 P33991 DNA replication licensing factor MCM4 1.14 7 P46940 Ras GTPase-activating-like protein IQGAP1 1.14 4 P23378 Glycine dehydrogenase [decarboxylating] mitochondrial 1.13 3 Q00610 Clathrin heavy chain 1 1.13 7 O43264 Centromere/kinetochore protein zw10 homolog 1.11 3 P50570 Dynamin-2 1.11 3 O43707 Alpha-actinin-4 1.09 4 O94906 Pre-mRNA-processing factor 6 1.09 5 C0JYY2 Apolipoprotein B (Including Ag(X) antigen) 1.07 4 Q92973 Transportin-1 1.07 3 P16615 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 1.06 9 O95782 AP-2 complex subunit alpha-1 1.04 3 P45974 Ubiquitin carboxyl-terminal hydrolase 5 1.04 3 Q99460 26S proteasome non-ATPase regulatory subunit 1 1.04 3 B2ZZ83 Filamin B 1.04 4 Q6P3X3 Tetratricopeptide repeat protein 27 1.03 2 H0UID3 Adaptor-related protein complex 2 beta 1 subunit isoform CRA_d 1.02 2 P14735 Insulin-degrading enzyme 1.02 2 Q13576 Ras GTPase-activating-like protein IQGAP2 1.02 2 B7TY16 Actinin alpha 1 isoform 3 1.02 10 P26639 Threonine--tRNA ligase cytoplasmic 1.01 4 P11498 Pyruvate carboxylase mitochondrial 1.00 3 P26640 Valine--tRNA ligase 0.98 4 P13798 Acylamino-acid-releasing enzyme 0.98 2 Q96S55 ATPase WRNIP1 0.98 2 P00338 L-lactate dehydrogenase A chain 0.96 2 P38606 V-type proton ATPase catalytic subunit A 0.96 2 Q14974 Importin subunit beta-1 0.95 4 Q14152 Eukaryotic translation initiation factor 3 subunit A 0.95 4 Q12906 Interleukin enhancer-binding factor 3 0.94 4 Q14694 Ubiquitin carboxyl-terminal hydrolase 10 0.93 2 Q9UBT2 SUMO-activating enzyme subunit 2 0.93 2 Q32P28 Prolyl 3-hydroxylase 1 0.93 4 Q9Y4W2 Ribosomal biogenesis protein LAS1L 0.91 3 P07437 Tubulin beta chain 0.89 3 B4E2Z3 4F2 cell-surface antigen heavy chain 0.89 4 P46087 Putative ribosomal RNA methyltransferase NOP2 0.89 5 P53621 Coatomer subunit alpha 0.85 3 P02787 Serotransferrin 0.84 3 P52272 Heterogeneous nuclear ribonucleoprotein M 0.84 5 Q9Y4W6 AFG3-like protein 2 0.83 2 P25205 DNA replication licensing factor MCM3 0.83 6 Q9UIA9 Exportin-7 0.82 2 Q7L2E3 Putative ATP-dependent RNA helicase DHX30 0.82 3 P56192 Methionine--tRNA ligase cytoplasmic 0.81 3 P68104 Elongation factor 1-alpha 1 0.80 2 P49368 T-complex protein 1 subunit gamma 0.80 2 Q13200 26S proteasome non-ATPase regulatory subunit 2 0.80 9 P07814 Bifunctional glutamate/proline--tRNA ligase 0.80 5 Q96QK1 Vacuolar protein sorting-associated protein 35 0.79 5 A8K6F7 Unc-45 homolog A (C.
Recommended publications
  • Kinesin-14 Motor Protein KIFC1 Participates in DNA Synthesis and Chromatin Maintenance Ya-Lan Wei1 and Wan-Xi Yang 1

    Kinesin-14 Motor Protein KIFC1 Participates in DNA Synthesis and Chromatin Maintenance Ya-Lan Wei1 and Wan-Xi Yang 1

    Wei and Yang Cell Death and Disease (2019) 10:402 https://doi.org/10.1038/s41419-019-1619-9 Cell Death & Disease ARTICLE Open Access Kinesin-14 motor protein KIFC1 participates in DNA synthesis and chromatin maintenance Ya-Lan Wei1 and Wan-Xi Yang 1 Abstract The nuclear localization signal (NLS) in kinesin-14 KIFC1 is associated with nuclear importins and Ran gradient, but detailed mechanism remains unknown. In this study, we found that KIFC1 proteins have specific transport characteristics during cell cycle. In the absence of KIFC1, cell cycle kinetics decrease significantly with a prolonged S phase. After KIFC1 overexpression, the duration of S phase becomes shorten. KIFC1 may transport the recombinant/ replicate-related proteins into the nucleus, meanwhile avoiding excessive KIFC1 in the cytoplasm, which results in aberrant microtubule bundling. Interestingly, the deletion of kifc1 in human cells results in a higher ratio of aberrant nuclear membrane, and the degradation of lamin B and lamin A/C. We also found that kifc1 deletion leads to defects in metaphase mitotic spindle assembly, and then results in chromosome structural abnormality. The kifc1-/- cells finally form micronuclei in daughter cells, and results in aneuploidy and chromosome loss in cell cycle. In this study, we demonstrate that kinesin-14 KIFC1 proteins involve in regulating DNA synthesis in S phase, and chromatin maintenance in mitosis, and maintain cell growth in a nuclear transport-independent way. 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; Introduction KIFC1 mainly cluster the spindles involving in chromo- Kinesin-14 KIFC1 transports various cargos along the some alignment and segregation. While chromokinesins microtubule to the minus ends1.
  • Viewed Under 23 (B) Or 203 (C) fi M M Male Cko Mice, and Largely Unaffected Magni Cation; Scale Bars, 500 M (B) and 50 M (C)

    Viewed Under 23 (B) Or 203 (C) fi M M Male Cko Mice, and Largely Unaffected Magni Cation; Scale Bars, 500 M (B) and 50 M (C)

    BRIEF COMMUNICATION www.jasn.org Renal Fanconi Syndrome and Hypophosphatemic Rickets in the Absence of Xenotropic and Polytropic Retroviral Receptor in the Nephron Camille Ansermet,* Matthias B. Moor,* Gabriel Centeno,* Muriel Auberson,* † † ‡ Dorothy Zhang Hu, Roland Baron, Svetlana Nikolaeva,* Barbara Haenzi,* | Natalya Katanaeva,* Ivan Gautschi,* Vladimir Katanaev,*§ Samuel Rotman, Robert Koesters,¶ †† Laurent Schild,* Sylvain Pradervand,** Olivier Bonny,* and Dmitri Firsov* BRIEF COMMUNICATION *Department of Pharmacology and Toxicology and **Genomic Technologies Facility, University of Lausanne, Lausanne, Switzerland; †Department of Oral Medicine, Infection, and Immunity, Harvard School of Dental Medicine, Boston, Massachusetts; ‡Institute of Evolutionary Physiology and Biochemistry, St. Petersburg, Russia; §School of Biomedicine, Far Eastern Federal University, Vladivostok, Russia; |Services of Pathology and ††Nephrology, Department of Medicine, University Hospital of Lausanne, Lausanne, Switzerland; and ¶Université Pierre et Marie Curie, Paris, France ABSTRACT Tight control of extracellular and intracellular inorganic phosphate (Pi) levels is crit- leaves.4 Most recently, Legati et al. have ical to most biochemical and physiologic processes. Urinary Pi is freely filtered at the shown an association between genetic kidney glomerulus and is reabsorbed in the renal tubule by the action of the apical polymorphisms in Xpr1 and primary fa- sodium-dependent phosphate transporters, NaPi-IIa/NaPi-IIc/Pit2. However, the milial brain calcification disorder.5 How- molecular identity of the protein(s) participating in the basolateral Pi efflux remains ever, the role of XPR1 in the maintenance unknown. Evidence has suggested that xenotropic and polytropic retroviral recep- of Pi homeostasis remains unknown. Here, tor 1 (XPR1) might be involved in this process. Here, we show that conditional in- we addressed this issue in mice deficient for activation of Xpr1 in the renal tubule in mice resulted in impaired renal Pi Xpr1 in the nephron.
  • Plasma Membrane Ca2+–Atpase in Rat and Human Odontoblasts Mediates Dentin Mineralization

    Plasma Membrane Ca2+–Atpase in Rat and Human Odontoblasts Mediates Dentin Mineralization

    biomolecules Article Plasma Membrane Ca2+–ATPase in Rat and Human Odontoblasts Mediates Dentin Mineralization Maki Kimura 1,†, Hiroyuki Mochizuki 1,†, Ryouichi Satou 2, Miyu Iwasaki 2, Eitoyo Kokubu 3, Kyosuke Kono 1, Sachie Nomura 1, Takeshi Sakurai 1, Hidetaka Kuroda 1,4,† and Yoshiyuki Shibukawa 1,*,† 1 Department of Physiology, Tokyo Dental College, 2-9-18, Kanda-Misaki-cho, Chiyoda-ku, Tokyo 101-0061, Japan; [email protected] (M.K.); [email protected] (H.M.); [email protected] (K.K.); [email protected] (S.N.); [email protected] (T.S.); [email protected] (H.K.) 2 Department of Epidemiology and Public Health, Tokyo Dental College, Chiyodaku, Tokyo 101-0061, Japan; [email protected] (R.S.); [email protected] (M.I.) 3 Department of Microbiology, Tokyo Dental College, Chiyodaku, Tokyo 101-0061, Japan; [email protected] 4 Department of Dental Anesthesiology, Kanagawa Dental University, 1-23, Ogawacho, Kanagawa, Yokosuka-shi 238-8570, Japan * Correspondence: [email protected] † These authors contributed equally to this study. Abstract: Intracellular Ca2+ signaling engendered by Ca2+ influx and mobilization in odontoblasts is critical for dentinogenesis induced by multiple stimuli at the dentin surface. Increased Ca2+ is exported by the Na+–Ca2+ exchanger (NCX) and plasma membrane Ca2+–ATPase (PMCA) to Citation: Kimura, M.; Mochizuki, H.; maintain Ca2+ homeostasis. We previously demonstrated a functional coupling between Ca2+ Satou, R.; Iwasaki, M.; Kokubu, E.; extrusion by NCX and its influx through transient receptor potential channels in odontoblasts. Kono, K.; Nomura, S.; Sakurai, T.; Although the presence of PMCA in odontoblasts has been previously described, steady-state levels of Kuroda, H.; Shibukawa, Y.
  • Kinesin Family Member 18B Regulates the Proliferation and Invasion Of

    Kinesin Family Member 18B Regulates the Proliferation and Invasion Of

    Wu et al. Cell Death and Disease (2021) 12:302 https://doi.org/10.1038/s41419-021-03582-2 Cell Death & Disease ARTICLE Open Access Kinesin family member 18B regulates the proliferation and invasion of human prostate cancer cells Yu-Peng Wu 1,Zhi-BinKe 1, Wen-Cai Zheng 1, Ye-Hui Chen 1,Jun-MingZhu 1,FeiLin 1,Xiao-DongLi 1, Shao-Hao Chen 1,HaiCai 1, Qing-Shui Zheng 1, Yong Wei 1, Xue-Yi Xue 1 and Ning Xu 1 Abstract Expression of kinesin family member 18B (KIF18B), an ATPase with key roles in cell division, is deregulated in many cancers, but its involvement in prostate cancer (PCa) is unclear. Here, we investigated the expression and function of KIF18B in human PCa specimens and cell lines using bioinformatics analyses, immunohistochemical and immunofluorescence microscopy, and RT-qPCR and western blot analyses. KIF18B was overexpressed in PCa specimens compared with paracancerous tissues and was associated with poorer disease-free survival. In vitro, KIF18B knockdown in PCa cell lines promoted cell proliferation, migration, and invasion, and inhibited cell apoptosis, while KIF18B overexpression had the opposite effects. In a mouse xenograft model, KIF18B overexpression accelerated and promoted the growth of PCa tumors. Bioinformatics analysis of control and KIF18B-overexpressing PCa cells showed that genes involved in the PI3K–AKT–mTOR signaling pathway were significantly enriched among the differentially expressed genes. Consistent with this observation, we found that KIF18B overexpression activates the PI3K–AKT–mTOR signaling pathway in PCa cells both in vitro and in vivo. Collectively, our results suggest that KIF18B plays a crucial role – – 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; in PCa via activation of the PI3K AKT mTOR signaling pathway, and raise the possibility that KIF18B could have utility as a novel biomarker for PCa.
  • Electronic Supplementary Material (ESI) for Molecular Biosystems

    Electronic Supplementary Material (ESI) for Molecular Biosystems

    Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is © The Royal Society of Chemistry 2015 Table S5 Mass data of proteins identified with label free shotgun proteomics a #Alt. Proteins; b Scores; c #Peptides; d SC [%]; e RMS90 [ppm]; f Rank; g Median(Controls:GLP1); h #(Controls:GLP1); i CV [%](Controls:GLP1); l Median(Controls:Palmitate); m #(Controls:Palmitate) ; n CV [%](Controls:Palmitate); o Median(Controls:GLP1 + Palmitate); p #(Controls:GLP1 + Palmitate); q CV [%](Controls:GLP1 + Palmitate) MW OK Accession Protein pI a b c d e f g h i l m n o p q [kDa] 78 kDa glucose-regulated protein OS=Rattus 1672.6 true GRP78_RAT 72.3 4.9 1 22 39 1.48 1 1.16 6 20.53 1.18 9 9.56 1.24 10 13.52 norvegicus GN=Hspa5 PE=1 SV=1 (M:1672.6) Endoplasmin OS=Rattus norvegicus 1253.0 true ENPL_RAT 92.7 4.6 1 23 29 3.34 2 0.85 8 33.34 1.19 6 39.58 1.18 10 28.11 GN=Hsp90b1 PE=1 SV=2 (M:1253.0) Stress-70 protein, mitochondrial OS=Rattus 1138.8 true GRP75_RAT 73.8 5.9 1 17 28.7 1.18 3 1.21 5 7.62 0.78 1 1.1 8 8.04 norvegicus GN=Hspa9 PE=1 SV=3 (M:1138.8) Protein disulfide-isomerase A3 OS=Rattus 1035.4 true PDIA3_RAT 56.6 5.8 1 16 35.2 2.84 4 0.94 3 17.22 1.15 4 26.62 1.25 4 7.86 norvegicus GN=Pdia3 PE=1 SV=2 (M:1035.4) Aconitate hydratase, mitochondrial 983.8 true ACON_RAT OS=Rattus norvegicus GN=Aco2 PE=1 85.4 8.7 1 19 31.4 2.72 5 0.89 2 23.6 1.21 2 9.25 0.89 3 32.87 (M:983.8) SV=2 60 kDa heat shock protein, mitochondrial 906.9 true CH60_RAT OS=Rattus norvegicus GN=Hspd1 PE=1 60.9 5.8 1 13 32.5 3.26 6 1.05 5 13.15 1.01 2 32.54 1.01
  • Cellular and Molecular Signatures in the Disease Tissue of Early

    Cellular and Molecular Signatures in the Disease Tissue of Early

    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
  • Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses

    Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses

    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes.
  • Molecular Genetics of Microcephaly Primary Hereditary: an Overview

    Molecular Genetics of Microcephaly Primary Hereditary: an Overview

    brain sciences Review Molecular Genetics of Microcephaly Primary Hereditary: An Overview Nikistratos Siskos † , Electra Stylianopoulou †, Georgios Skavdis and Maria E. Grigoriou * Department of Molecular Biology & Genetics, Democritus University of Thrace, 68100 Alexandroupolis, Greece; [email protected] (N.S.); [email protected] (E.S.); [email protected] (G.S.) * Correspondence: [email protected] † Equal contribution. Abstract: MicroCephaly Primary Hereditary (MCPH) is a rare congenital neurodevelopmental disorder characterized by a significant reduction of the occipitofrontal head circumference and mild to moderate mental disability. Patients have small brains, though with overall normal architecture; therefore, studying MCPH can reveal not only the pathological mechanisms leading to this condition, but also the mechanisms operating during normal development. MCPH is genetically heterogeneous, with 27 genes listed so far in the Online Mendelian Inheritance in Man (OMIM) database. In this review, we discuss the role of MCPH proteins and delineate the molecular mechanisms and common pathways in which they participate. Keywords: microcephaly; MCPH; MCPH1–MCPH27; molecular genetics; cell cycle 1. Introduction Citation: Siskos, N.; Stylianopoulou, Microcephaly, from the Greek word µικρoκεϕαλi´α (mikrokephalia), meaning small E.; Skavdis, G.; Grigoriou, M.E. head, is a term used to describe a cranium with reduction of the occipitofrontal head circum- Molecular Genetics of Microcephaly ference equal, or more that teo standard deviations
  • Murine Neonatal Ketogenesis Preserves Mitochondrial Energetics by Preventing Protein Hyperacetylation

    Murine Neonatal Ketogenesis Preserves Mitochondrial Energetics by Preventing Protein Hyperacetylation

    ARTICLES https://doi.org/10.1038/s42255-021-00342-6 Murine neonatal ketogenesis preserves mitochondrial energetics by preventing protein hyperacetylation Yuichiro Arima 1,2,13 ✉ , Yoshiko Nakagawa3,13, Toru Takeo 3,13, Toshifumi Ishida 1, Toshihiro Yamada1, Shinjiro Hino4, Mitsuyoshi Nakao4, Sanshiro Hanada 2, Terumasa Umemoto 2, Toshio Suda2, Tetsushi Sakuma 5, Takashi Yamamoto5, Takehisa Watanabe6, Katsuya Nagaoka6, Yasuhito Tanaka6, Yumiko K. Kawamura7,8, Kazuo Tonami7, Hiroki Kurihara7, Yoshifumi Sato9, Kazuya Yamagata9,10, Taishi Nakamura 1,11, Satoshi Araki1, Eiichiro Yamamoto1, Yasuhiro Izumiya1,12, Kenji Sakamoto1, Koichi Kaikita1, Kenichi Matsushita 1, Koichi Nishiyama2, Naomi Nakagata3 and Kenichi Tsujita1,10 Ketone bodies are generated in the liver and allow for the maintenance of systemic caloric and energy homeostasis during fasting and caloric restriction. It has previously been demonstrated that neonatal ketogenesis is activated independently of starvation. However, the role of ketogenesis during the perinatal period remains unclear. Here, we show that neonatal ketogen- esis plays a protective role in mitochondrial function. We generated a mouse model of insufficient ketogenesis by disrupting the rate-limiting hydroxymethylglutaryl-CoA synthase 2 enzyme gene (Hmgcs2). Hmgcs2 knockout (KO) neonates develop microvesicular steatosis within a few days of birth. Electron microscopic analysis and metabolite profiling indicate a restricted energy production capacity and accumulation of acetyl-CoA in Hmgcs2 KO mice. Furthermore,
  • SERCA in Genesis of Arrhythmias: What We Already Know and What Is New?

    SERCA in Genesis of Arrhythmias: What We Already Know and What Is New?

    Review 43 SERCA in genesis of arrhythmias: what we already know and what is new? Nilüfer Erkasap Department of Physiology, Medical Faculty, Eskiflehir Osmangazi University, Eskiflehir, Turkey ABSTRACT This review mainly focuses on the structure, function of the sarco(endo)plasmic reticulum calcium pump (SERCA) and its role in genesis of arrhythmias. SERCA is a membrane protein that belongs to the family of P-type ion translocating ATPases and pumps free cytosolic calcium into intracellular stores. Active transport of Ca2+ is achieved, according to the E1-E2 model, changing of SERCA structure by Ca2+. The affinity of Ca2+ -binding sites varies from high (E1) to low (E2). Three different SERCA genes were identified-SERCA1, SERCA2, and SERCA3. SERCA is mainly represented by the SERCA2a isoform in the heart. In heart muscle, during systole, depolarization triggers the release of Ca2+ from the sarcoplasmic reticulum (SR) and starts contraction. During diastole, muscle relaxation occurs as Ca2+ is again removed from cytosol, predominantly by accumulation into SR via the action of SERCA2a. The main regulator of SERCA2a is phospholamban and another regulator proteolipid of SERCA is sarcolipin. There are a lot of studies on the effect of decreased and/or increased SERCA activity in genesis of arrhythmia. Actually both decrease and increase of SERCA activity in the heart result in some pathological mechanisms such as heart failure and arrhythmia. (Anadolu Kardiyol Derg 2007: 7 Suppl 1; 43-6) Key words: sarco(endo)plasmic reticulum, SERCA, arrhythmia, calcium channels Introduction from cytosol, predominantly by accumulation into sarcoplasmic reticulum via the action of sarco(endo)plasmic reticulum Cardiac physiology is a major area of research in basic and Ca ATPase (SERCA).
  • A Common Analgesic Enhances the Anti-Tumour Activity of 5-Aza-2’- Deoxycytidine Through Induction of Oxidative Stress

    A Common Analgesic Enhances the Anti-Tumour Activity of 5-Aza-2’- Deoxycytidine Through Induction of Oxidative Stress

    bioRxiv preprint doi: https://doi.org/10.1101/2020.03.31.017947; this version posted April 1, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. A common analgesic enhances the anti-tumour activity of 5-aza-2’- deoxycytidine through induction of oxidative stress Hannah J. Gleneadie1,10, Amy H. Baker1, Nikolaos Batis2, Jennifer Bryant2, Yao Jiang3, Samuel J.H. Clokie4, Hisham Mehanna2, Paloma Garcia5, Deena M.A. Gendoo6, Sally Roberts5, Alfredo A. Molinolo7, J. Silvio Gutkind8, Ben A. Scheven1, Paul R. Cooper1, Farhat L. Khanim9 and Malgorzata Wiench1, 5,*. 1School of Dentistry, Institute of Clinical Studies, College of Medical and Dental Sciences, The University of Birmingham, Birmingham, B5 7EG, UK; 2Institute of Head and Neck Studies and Education (InHANSE), The University of Birmingham, Birmingham, B15 2TT, UK; 3School of Biosciences, The University of Birmingham, Birmingham, B15 2TT, UK; 4West Midlands Regional Genetics Laboratory, Birmingham Women’s and Children’s Hospital, Birmingham, B15 2TG, UK; 5Institute of Cancer and Genomic Sciences, College of Medical and Dental Sciences, The University of Birmingham, Birmingham, B15 2TT, UK; 6Centre for Computational Biology, Institute of Cancer and Genomic Sciences, The University of Birmingham, Birmingham, B15 2TT, UK; 7Moores Cancer Center and Department of Pathology, University of California San Diego, La Jolla, CA 92093, USA; 8Department of Pharmacology and Moores Cancer
  • Supplementary Tables and Figures

    Supplementary Tables and Figures

    SUPPLEMENTARY DATA Supplementary Table 1. SiRNA sequence (5’-3’) Gene Forward Reverse si-HRD1-1# GCAUGGCAGUCCUGUACAU dTdT AUGUACAGGACUGCCAUGC dTdT si-HRD1-2# GAGCCAUCCGCAACAUGAA dTdT UUCAUGUUGCGGAUGGCUC dTdT si-MafA CCAUCGAGUACGUCAACGA dTdT UCGUUGACGUACUCGAUGG dTdT ©2020 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db19-1060/-/DC1 SUPPLEMENTARY DATA Supplementary Table 2. Primer sequences for qRT-PCR (5’-3’) Gene Forward Reverse human HRD1 GCTCACGCCTACTACCTCAAA GCCAGACAAGTCTCTGTGACG mouse mafA AAGCGGCGCACGCTCAAGAA GGTCCCGCTCCTTGGCCAGA mouse insulin1 CACTTCCTACCCCTGCTGG ACCACAAAGATGCTGTTTGACA mouse β-actin AGGCCAACCGTGAAAAGATG AGAGCATAGCCCTCGTAGATGG human β-actin CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT ©2020 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db19-1060/-/DC1 SUPPLEMENTARY DATA Supplementary Table 3. Primer sequences for ChIP (5’-3’) Gene promoter Forward Reverse mouse Insulin1, 2 GGAACTGTGAAACAGTCCAAGG CCCCCTGGACTTTGCTGTTTG ©2020 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db19-1060/-/DC1 SUPPLEMENTARY DATA Supplementary Table 4. Primer sequences for PCR (5’-3’) Gene Forward Reverse HRD1-pDsred CCCAAGCTTATGTTCCGCACCGCAGT GGGGTACCCAGTGGGCAACAGGGG HRD1-pCMV- Flag GGGGTACCATGTTCCGCACCGCAGT CCCAAGCTTGTGGGCAACAGGGGACT C HRD1-pCMV-HA GGCCATGGGCCATATGGGATCCTTCC AGGGATGCCACCCGGGGATCCTCAGT GCACCGCAGTGATG GGGCAACAGGGGAC HRD1-N-HA GGCCATGGGCCATATGGGATCCTTCC