Georgia State University ScholarWorks @ Georgia State University
Biology Dissertations Department of Biology
Fall 12-7-2012
Functional Study of the Threonine Phosphorylation and the Transcriptional Coactivator Role of P68 RNA Helicase
Heena T. Dey Georgia State University
Follow this and additional works at: https://scholarworks.gsu.edu/biology_diss
Recommended Citation Dey, Heena T., "Functional Study of the Threonine Phosphorylation and the Transcriptional Coactivator Role of P68 RNA Helicase." Dissertation, Georgia State University, 2012. https://scholarworks.gsu.edu/biology_diss/123
This Dissertation is brought to you for free and open access by the Department of Biology at ScholarWorks @ Georgia State University. It has been accepted for inclusion in Biology Dissertations by an authorized administrator of ScholarWorks @ Georgia State University. For more information, please contact [email protected]. FUNCTIONAL STUDY OF THE THREONINE PHOSPHORYLATION AND THE
TRANSCRIPTIONAL COACTIVATOR ROLE OF P68 RNA HELICASE
by
HEENA T. DEY
Under the Direction of Zhi-Ren Liu
ABSTRACT
P68 RNA helicase is a RNA helicase and an ATPase belonging to the DEAD-box family. It is important for the growth of normal cells, and is implicated in diverse functions ranging from pre-mRNA splicing, transcriptional activation to cell proliferation, and early organ development. The protein is documented to be phosphorylated at several amino-acid residues. It was previously demonstrated in several cancer cell-lines that p68 gets phosphorylated at threonine residues during treatments with TNF-α and TRAIL. In this study, the role of threonine phosphorylation of p68 under the treatment of anti-cancer drug, oxaliplatin in the colon cancer cells is characterized. Oxaliplatin treatment activates p38 MAP-kinase, which subsequently phosphorylates p68 at T564 and/or T446. P68 phosphorylation, at least partially, influences the role of the drug on apoptosis induction. This study shows an important mechanism of action of the anti- cancer drug which could be used for improving cancer treatment.
This study also shows that p68 is an important transcriptional regulator regulating transcription of the cytoskeletal gene TPPP/p25. Previous analyses revealed that p68
RNA helicase could regulate expression of genes responsible for controlling stability and dynamics of different cytoskeletons. P68 is found to regulate TPPP/p25 gene transcription by associating with the TPPP/p25 gene promoter. Expression of TPPP/p25 plays an important role in cellular differentiation while the involvement of p68 in the regulation of TPPP/p25 expression is an important event for neurite outgrowth. Loss of
TPPP expression contributes to the development and progression of gliomas. Thus, our studies further enhance our understanding of the multiple cellular functions of p68 and its regulation of the cellular processes.
INDEX WORDS: P68 RNA helicase, DEAD-box, ATPase, threonine phosphorylation, oxaliplatin, p38 MAP-kinase, transcriptional regulation, TPPP
FUNCTIONAL STUDY OF THE THREONINE PHOSPHORYLATION AND THE
TRANSCRIPTIONAL COACTIVATOR ROLE OF P68 RNA HELICASE
by
HEENA T. DEY
A Dissertation Submitted in Partial Fulfillment of the Requirements for the Degree of
Doctor of Philosophy
in the College of Arts and Sciences
Georgia State University
2012
Copyright by Heena T. Dey 2012 FUNCTIONAL STUDY OF THE THREONINE PHOSPHORYLATION AND THE
TRANSCRIPTIONAL COACTIVATOR ROLE OF P68 RNA HELICASE
by
HEENA T. DEY
Committee Chair: Dr. Zhi-Ren Liu
Committee: Dr. Julia Hilliard
Dr. Shyam Reddy
Electronic Version Approved:
Office of Graduate Studies
College of Arts and Sciences
Georgia State University
December 2012 iv
ACKNOWLEDGEMENTS
I sincerely thank Dr. Zhi-Ren Liu for his mentorship and support. His enthusiasm, dedication, and encouragement have urged me to strive higher. I also earnestly thank the exceptional committee members, Dr. Julia Hilliard and Dr. Shyam Reddy. I especially thank Dr .Hilliard for critical analysis of my research and for instilling in me a zest for science. I also thank Dr. Reddy for his invaluable suggestions and making me believe in my abilities. I thank Dr. Jenny Yang for her guidance and advice in improving my dissertation work.
I would like to acknowledge Debby Walthall and Sonya Young for all their technical assistance and LaTesha Warren for her valuable support and patience in all these years. I also thank Dr. David Blaustein for giving me an opportunity to teach and developing a passion for teaching. Special thanks to all my colleagues, past and present members of the Liu lab for all their support and for creating a great work environment. Thanks Ravi for being a great friend and making my graduate life so enjoyable. Thanks Vaishali and Sushma from Aneja lab for their material and technical support and Mugdha for always helping me, both inside and outside the lab.
Finally, I thank my parents for their continuous encouragement, my sister and brother for their support and last but not the least, my husband and my daughter for their love, great support, patience and sacrifices to help me achieve my career goals and for always being there for me.
v
TABLE OF CONTENTS
ACKNOWLEDGEMENTS...... iv
LIST OF TABLES………………………………..…..………………………...…..…….…...xii
LIST OF FIGURES…………………………………………………………………………...xiii
CHAPTER 1 GENERAL INTRODUCTION…………….…..……...……………….………..1
1.1 RNA HELICASES…………..………………………………………………………1
1.2 P68 RNA HELICASE…………………………..…………………………….…….2
1.2.1 P68: a DEAD-box RNA helicase……..………..…………………….2
1.2.2 Expression of p68…..……………………………………..…………..4
1.3 FUNCTIONS OF P68 RNA HELICASE………………………...………………..5
1.3.1 Function of P68 in mRNA splicing…………………………………...5
1.3.2 Function of P68 in Transcriptional Regulation…….………………7
1.3.3 Role of P68 in Post-transcriptional Processes……………...…...14
1.3.4 Role of P68 in Differentiation……………………………………..…14
1.3.5 Role of P68 in Cell proliferation and Cancer……………………..16
1.4 MODIFICATIONS OF P68…………………………………...…………………..19
1.4.1 Ubiquitylation and Sumoylation of P68………………...…..……..19
1.4.2 Phosphorylation of P68…………………………………...….………21
1.4.2.1 Phosphorylation of P68 by PKC………………..……...…23
1.4.2.2 Phosphorylation of P68 by Tlk1………………..…….…..25
1.4.2.3 Phosphorylation of P68 by c-abl kinase…….…..….…..26
1.4.2.4 A-kinase-anchoring protein (AKAP95)………………..…28
1.5 COLORECTAL CANCER (CRC)………………………………………....…….29 vi
1.5.1 Chemotherapy for Metastatic Colorectal Cancer………………..30
1.5.1.1 FOLFIRI or FOLFOX Regimen………………………….…30
1.5.1.2 Targeted Therapies…………………………………...…….31
1.5.1.3 Oxaliplatin…………………………………………………….32
1.5.2 Phosphorylation of P68 by P38 MAP-kinase……….………...…..34
1.6 CYTOSKELETON………………………………………...………………………38
1.6.1 Actin……………………………………………………………………...38
1.6.2 Intermediate Filaments……………………………………………….39
1.6.3 Microtubules…………………………………………………………....40
1.7 TPPP/P25………………………………………………………………………….41
1.7.1 Structure and Expression……………………………………………41
1.8 FUNCTIONS OF TPPP/P25………………………………………….………….44
1.8.1 Cellular Functions of TPPP/p25…………………………………….44
1.8.2 Role of TPPP/p25 in Differentiation……………………………...…48
1.8.3 Involvement of TPPP/p25 in Different Diseases…………………49
1.9 AIMS AND SIGNIFICANCES OF THE DISSERTATION…………………….50
1.10 REFERENCES………………………………………………………………..…52
CHAPTER 2 PHOSPHORYLATION OF P68 RNA HELICASE BY P38 MAP-KINASE
CONTRIBUTES TO COLON CANCER CELLS APOPTOSIS INDUCED BY
OXALIPLATIN…………………………………………………….………………………….103
2.1 ABSTRACT……………………………..……………………………...……..…103
2.2 INTRODUCTION……………………………………………………………...…103 vii
2.3 RESULTS………………………………………………………………..…….…106
2.3.1 Oxaliplatin treatment of colon cancer cells induced p68-
threonine phosphorylation……………………..…………………………106
2.3.2 P68 is phosphorylated by p38 MAP-kinase at T564 and T446
upon the drug treatment…………..………………………………………107
2.3.3 Phosphorylation of p68 at threonine mediates the effects of
oxaliplatin in induction of apoptosis…………………….…………...…110
2.4 DISCUSSION…………………………………………………………………….111
2.5 MATERIALS AND METHODS………...…………………………..…………..112
2.5.1 Cell Culture and antibodies…………………..…………………….112
2.5.2 Drug Treatment, DNA constructs, Transfections, and siRNA
Interference…………………………………………….………………….…113
2.5.3 Protein Expression and Purification………………………….…..114
2.5.4 In Vitro Kinase Assay………………………………………………..115
2.5.5 Cell Viability and Apoptosis Assay……………………………….115
2.6 REFERENCES………………………………………………………………..…116
CHAPTER 3 P68 RNA HELICASE REGULATES THE EXPRESSION OF TUBULIN
POLYMERIZATION PROMOTING PROTEIN INVOLVED IN NEURITE OUTGROWTH
AND GLIOMA SUPPRESSION………………………………….………………………...129
3.1 ABSTRACT………………………………………………………..………….….129
3.2 INTRODUCTION…………………………………………………………..….…129
3.3 RESULTS……………………………………………………………………..….131 viii
3.3.1 P68 RNA helicase regulates transcription of TPPP/p25 gene.131
3.3.2 P68 RNA helicase regulates the neurite outgrowth of PC12
neuronal cells………………………………………………………………..132
3.3.3 TPPP/p25 expression plays a role in the progression of gliomas
…………..………………………………………………………..……………133
3.4 DISCUSSION……………………………….………………………………..…..135
3.5 MATERIALS AND METHODS………………………………………………...137
3.5.1 Reagents and Antibodies………………………………………..…137
3.5.2 Cell Culture, DNA constructs, Transfections, and siRNA
Interference…………………………………………………………………..137
3.5.3 Cellular Extract Preparation, Immunoblot Analysis and
Immunofluorescence staining…………………………………………....138
3.5.4 RT-PCR………………………………………………………………...139
3.5.5 Chromatin Immunoprecipitation (ChIP)………………………….139
3.5.6 Cell Proliferation Assays……………………………………………140
3.6 REFERENCES………………………………………………………………..…140
CHAPTER 4 CONCLUSIONS AND DISCUSSIONS…….………………………………164
4.1 INTRODUCTION……….………………………………………………………..164
4.2 OXALIPLATIN TREATMENT OF CRC INDUCES P68 THREONINE
PHOSPHORYLATION…………...……………………………………………….…165
4.3 P68 IS PHOSPHORYLATED BY P38 MAP-KINASE AT T564 AND/OR T446
UPON OXALIPLATIN TREATMENT……………..…………………………….....166 ix
4.4 PHOSPHORYLATION OF P68 AT THREONINE MEDIATES THE EFFECTS
OF OXALIPLATIN IN THE INDUCTION OF APOPTOSIS……………………..167
4.5 P68 RNA HELICASE REGULATES TRANSCRIPTION OF THE TPPP/P25
GENE………………………………………………………………………………….169
4.6 P68 RNA HELICASE REGULATES PC12 NEURITE OUTGROWTH VIA
REGULATION OF TPPP/P25 EXPRESSION……………………………...... ….171
4.7 TPPP/P25 EXPRESSION IS IMPORTANT IN GLIOMA PROGRESSION.173
4.8 REFERENCES………………………………………..…………………………174
CHAPTER 5 MATERIALS AND METHODS…………………….…………………….…181
5.1 MAMMALIAN CELL CULTURE TECHNIQUES……………………….…….181
5.1.1 Mammalian Cell Culture……………………………...………….….181
5.1.2 Mammalian Cell Storage and Thawing………………………...... 181
5.1.3 Transfection………………………………..…………………..……..182
5.1.3.1 Plasmid Transfection………………………………..…….182
5.1.3.2 siRNA Transfection………………...………………..…….182
5.2 BACTERIAL CULTURE TECHNIQUES………..……….……………………184
5.2.1 Culture of Bacterial Cells and their Storage…………………….184
5.2.2 Competent Cell Preparation……………………………….……….184
5.2.3 Transformation………..…………………………………………...…185
5.3 DNA RELATED TECHNIQUES………………………………...……..………185
5.3.1 Isolation of Plasmid DNA…………………………………….…..…185
5.3.1.1 Isolation of Plasmid DNA in a Mini-Scale (Mini-prep).185 x
5.3.1.2 Isolation of Plasmid DNA in a large-scale (Midi-prep)186
5.3.2 Concentration of DNA………………………………….……………187
5.3.3 Measurement of DNA Quality and Concentration…..…….…...188
5.3.4 Agarose Gel Electrophoresis……………………………………...188
5.3.5 Gel Extraction of DNA…………………………………….…………189
5.3.6 Polymerase Chain Reaction………………………………….....…190
5.3.7 Restriction Enzyme Digestion………………………………..……190
5.3.8 DNA ligation…………………………….………………...…..………191
5.3.9 Insert DNA Phosphorylation and Vector DNA
Dephosphorylation…………………………………………………………191
5.3.10 DNA Sequencing………………………………………..………..…192
5.3.11 Cloning of TPPP/P25/p68 mutants/p38 mutants………………192
5.4 RNA RELATED TECHNIQUES……………………………………………..…193
5.4.1 RNA Isolation………………………...……………..………………...193
5.4.2 Measurement of RNA Concentration……………………………..194
5.4.3 Reverse Transcription – Polymerase Chain Reaction (RT-
PCR)…………………………………………………………………………...194
5.4.4 Real time RT-PCR…………………………………………………….195
5.5 PROTEIN RELATED TECHNIQUES………………………………………….196
5.5.1 Cell Lysate Preparation……………………………….…………….196
5.5.1.1 Whole Cell Lysate Preparation………….……………….196
5.5.1.2 Nuclear and Cytoplasmic Extract Preparation…….…196
5.5.2 Recombinant Protein Expression and Purification……………197 xi
5.5.3 Determination of Protein Concentration by Biorad Method….198
5.5.4 In Vitro Kinase Assay……………………………………….……….199
5.5.5 SDS-PolyAcrylamide Gel Electrophoresis (SDS-PAGE)…..….199
5.5.6 Coomassie Blue Staining…………………………………………..200
5.5.7 Generation of anti-p68 antibody…………..……………...…….…201
5.5.8 Immunoblotting……………………………………………………....201
5.5.9 Immunoprecipitation (IP)……………………………………………203
5.5.10 Chromatin Immunoprecipitation (ChIP) Assay………………..203
5.5.11 Immunostaining…………………………………………………….204
5.5.12 Cell Proliferation Assay……………………………………………205
5.5.12.1 MTT Assay………………………………………..………..205
5.5.12.2 BrDU Cell Proliferation Assay………………………….205
5.5.12.3 Caspase-3/CPP32 Colorimetric Assay………………..206
5.6 MATERIALS…………………………………………………………………..…206
xii
LIST OF TABLES
Table 1.1 Expression of p25 in mouse tissues…………………………….……….…102
Table 3.1 ChIP-on-ChIP analysis of cytokeletal genes regulated by p68…………144
Table 5.1 Cell-lines……………………………………………………………………….…206
Table 5.2 Bacterial Strains…………………………………………………….…………..207
Table 5.3 Antibodies………………………………………………………………………..207
Table 5.4 Chemicals/Reagents………………...…………………………………………209
Table 5.5 Experimental Kits…………………………………………………………….…213
Table 5.6 Laboratory Equipments……………………………………………...………..214
xiii
LIST OF FIGURES
Figure 1.1 DEAD-box RNA helicases in multiple cellular processes………….…94
Figure 1.2 Drawing of the structure of full-length p68…………………………..….95
Figure 1.3a Structure of the human p68 gene (EMBL accession no. AF015812)
with the distribution of exons and introns along with conserved
DEAD-box motifs……………………………………………………………..96
Figure 1.3b Schematic depiction of domains of p68 RNA helicase……………..…97
Figure 1.4 GTF assembly at a typical eukaryotic promoter………………….…….98
Figure 1.5 Depiction of functional interactions that affect basal (Upper) and
activator-dependent transcription (Lower)…………………...…….….100
Figure 1.6 Proteins interacting with p68/Dbp2 and the different biological
functions carried out by them….……………………………………..….101
Figure 2.1 Threonine phosphorylation of p68 in HCT116 cells following
oxaliplatin (Oxa) treatment……………………………………………..…122
Figure 2.2 P68 Phosphorylation by p38 MAPK……………...……………………...124
Figure 2.3 Phosphorylation site(s) of p68 by p38 MAPK………………..………..126
Figure 2.4 Effects of p68 phosphorylation on cell apoptosis……………………128
Figure 3.1A Chromatin immunoprecipitation (ChIP) of the TPPP/p25 promoter..145
Figure 3.1B & C Qualitative and quantitative RT-PCR demonstrating p68 regulation of TPPP /p25 mRNA expression………………………………………...….146
Figure 3.1D TPPP/p25 protein expression affected by p68 expression…………..147
Figure 3.1E P68 upregulates TPPP/p25 expression………………………………….148
Figure 3.2A Expression of TPPP/p25 in PC12 cells…………………………………..149 xiv
Figure 3.2B NGF treatment upregulates TPPP/p25 expression……………………150
Figure 3.2C Knockdown of TPPP/p25 in PC12 cells………………………………....151
Figure 3.2D TPPP/p25 regulates the differentiation of PC12 neuronal cells…….152
Figure 3.2E P68 upregulates TPPP/p25 expression under NGF treatment of PC12 neuronal cells at the RNA level…………………………………………………………..153
Figure 3.2F P68 upregulates TPPP/p25 expression under NGF treatment of PC12 neuronal cells ……………………………………………………………………………….154
Figure 3.2G P68 RNA helicase regulates the differentiation of PC12 neuronal cells.
………………………………………………………………………………………………….155
Figure 3.3A Immunohistochemical staining of TPPP/p25 in sections from normal brain and glioblastoma tissue sections……………………………………………..….156
Figure 3.3B Expression of TPPP/25 in different glioma cell-lines at the mRNA level……………………………………………………………………………………………157
Figure 3.3C Expression of TPPP/25 in different glioma cell-lines at the protein level…………………………………………………………………………………………...158
Figure 3.3D Analysis of TPPP/p25 expression in T98G and U87MG cells after transient over-expression of TPPP/p25…………………………………………..…….159
Figure 3.3E Effect of TPPP expression on cell proliferation and morphological features……………………………………………………………………………………….160
Figure 3.3F TPPP/p25 expression decreases cell proliferation…………………….161
Figure 3.3G Detection of caspase-3 activation in apoptosis induction in T98G and
U87MG cells upon expression of TPPP/p25…………………………………………...162
Figure 3.3H Expression of TPPP/p25 increases stable microtubule levels……...163 1
CHAPTER 1
GENERAL INTRODUCTION
1.1 RNA HELICASES
RNA is a biologically important molecule that is required in almost all aspects of genetic expression and biological processes. Biological reactions are highly dynamic, requiring modulation of RNA, DNA and protein interactions in a specific order and efficient manner. The abilities to modify these interactions and unwind RNAs have been the essential functions of RNA helicases. RNA helicases modulate the structure of
RNAs through ATP hydrolysis. Biochemical analysis has revealed that RNA helicases are ATPases and helicases (Staley and Guthrie 1998; Tanner, Cordin et al. 2003). They are expressed in almost all biological organisms ranging from bacteria and viruses to humans where the functions of RNA are involved. They are implicated in diverse biological processes involving RNA such as transcription, mRNA splicing, nuclear mRNA export, RNA editing, rRNA biosynthesis/assemby and translation (Luking, Stahl et al. 1998; Fuller-Pace 1994; Chuang, Weaver et al. 1997; de la Cruz, Kressler et al.
1999; Tanner and Linder 2001).
RNA helicases have a core helicase domain consisting of eight conserved motifs essential for helicase activity (Linder, Lasko et al. 1989) . They are classified into different families and superfamilies based on these conserved motifs (Linder, Tanner et al. 2001). DEAD-box RNA helicases derive their name from the conserved motif: Asp-
Glu-Ala-Asp (DEAD) motif (Wassarman and Steitz 1991). Members of this superfamily are ubiquitously expressed and are involved in all biological processes requiring RNA 2 metabolism. The family includes several members such as eIF-4A and Dbp10 (involved in ribosome biogenesis), Prp28, Prp5 and Sub2 (pre-mRNA splicing), Dbp5 (mRNA export), Ded1, eIF4A and Vasa (translation initiation), and Dbp2 and Dhh1 (RNA decay)
(Fuller-Pace 1994; Rocak and Linder 2004) (Figure 1.1). Eukaryotic translation initiation factor 4A (eIF-4A) is a helicase whose crystal structure has been solved. It has a dumbbell-like structure made up of two globular domains linked by a flexible linker
(Caruthers, Johnson et al. 2000). It has a function in ribosome biogenesis, and has both
ATPase and RNA-unwinding activities (Rozen, Edery et al. 1990). P68 RNA helicase is another DEAD-box protein having striking homology to eIF-4A protein (Figure 1.2)
(Ford, Anton et al. 1988; Linder, Lasko et al. 1989).
1.2 P68 RNA HELICASE
1.2.1 P68: a DEAD-box RNA Helicase
P68 is a DEAD-box RNA helicase identified as a result of cross-reaction with
DNA tumor virus nuclear oncogene SV-40 (Simian virus-40) antibody (DL3C4)
(Crawford, Leppard et al. 1982). P68 is the product of the gene DDX5 (DEAD-box polypeptide 5) that is located on the chromosome 17q21 and consists of 13 exons and
10 introns (Figure 1.3a). The cDNA is 3769bp long while the expressed protein product consists of 614 amino-acids (Hloch, Schiedner et al. 1990). P68 functions as a RNA- dependent ATPase, and also unwinds RNA duplexes in a bi-directional manner. It binds to dsRNA with stronger affinity than ssRNA (Iggo and Lane 1989; Huang and Liu 2002).
P68 protein has been found to be quite conserved throughout evolution (Lane and
Hoeffler 1980). Human and mouse p68 are 98% conserved (Lemaire and Heinlein 3
1993), while the chick homologue shares about 90% homology, being shorter by 19 amino-acids (Jost, Schwarz et al. 1999). S.cerevisiae p68, DBP2, is 55% homologous to the human protein (Iggo, Jamieson et al. 1991). There are reports of p68 homologues also in bacteria (E.coli dbpA), Drosophila (DPSE/RM62), and Arabidopsis thaliana
(AtDRH1) (Iggo, Picksley et al. 1990).
P68, like other DEAD-box proteins, has a conserved core region of 296 amino- acids flanked by variable N-terminal (from amino-acids 1-134) and C-terminal (from amino-acids 430-614) regions that share little sequence homology (Figure 1.3b) (Yang,
Yang et al. 2004). The core region has eight conserved motifs (Figure 1.3b). Both motif I
(GxGKT, Walker A motif) and motif III (DEAD, Walker B motif ), function as an ATPase responsible for ATP-binding and hydrolysis (Schneider and Hunke 1998). Motif VI
(HRIGRXXR), always found to be together with the DEAD-motif, also binds ATP and is required for its hydrolysis. Mutations in motif VI affect ATP-hydrolysis (Pause and
Sonenberg 1992). Motif IV (SAT) causes conformational changes linked to ATP-binding and hydrolysis and harbors helicase activity. Mutations in this motif affect helicase activity without affecting RNA- and ATP-binding and hydrolysis (Pause and Sonenberg
1992). Functions of the remaining motifs, i.e. motif Ia (PTREL), motif Ib (GG), motif II
(TPGR) and motif V (RGXD), are not very well characterized but may be involved in
RNA-binding (Rocak and Linder 2004). P68 also has a regulatory motif, the IQ motif, in its C-terminal that is subjected to post-translational modification (Buelt, Glidden et al.
1994). This motif is made up of nine amino-acid residues with a conserved glutamine important for ATP hydrolysis (Tanner, Cordin et al. 2003).
4
1.2.2 Expression of P68
P68 is a predominantly nuclear protein, but shows dramatic variations in nuclear localization during cell cycle stages. Immunocytochemical studies have demonstrated a weak granular distribution of p68 exclusively in the nucleus of an interphase cell, especially in the nucleoplasm, but not in the nucleolus (Lane and Hoeffler 1980; Iggo and Lane 1989). However, during the end of telophase, p68 transiently associates with the prenucleolar bodies in the nucleolus (Iggo, Jamieson et al. 1991).
P68 expression is regulated by cell growth and development, and is essential for normal cell growth (Stevenson, Hamilton et al. 1998). It is ubiquitously expressed in the developing mouse embryos and embryonic lethality is observed in p68 (DDX5) knockout mice at day 11.5 (Fukuda, Yamagata et al. 2007). P68 expression co-relates with its functions in organ maturation and in differentiation during development
(Stevenson, Hamilton et al. 1998). P68 is important for neural and mesodermal development in the brains of chick, frog, and ascidian chordate embryos (Seufert, Kos et al. 2000). Differentiation of adipocytes is blocked when p68 is knocked-down in mouse 3T3-L1 preadipocytes cells, implicating the role of p68 in potentiating the differentiation of adipocytes.(Kitamura, Nishizuka et al. 2001). Consequently, the function of p68 in cell growth and development strongly suggests that expression of p68 has a function in cellular proliferation. P68 expression is not seen in quiescent Swiss
3T3 cells, but is observed when induced by serum indicating a functional link to cellular proliferation. However, the expression levels of p68 do not necessarily match with the cellular proliferation status in the adult tissues, as p68 mRNA and protein have been found to be differentially expressed in these tissues regardless of their proliferation 5 capability, implying that p68 is regulated in a more complex fashion (Stevenson,
Hamilton et al. 1998). Moreover, p68 expression is induced in developing epithelium in wound tissues by growth factors and cytokines after transient down-regulation due to skin injury. Increased p68 expression in keratinocytes leads to an increase in expression of VEGF (vascular endothelial growth factor) and proliferation in response to serum driving wounded area re-epithelization, an essential step in wound repair
(Kahlina, Goren et al. 2004).
Higher levels of p68 protein have been found in colorectal adenocarcinomas as compared to their normal counterparts. The overexpressed p68 is poly-ubiquitylated, a form of post-translational modification, raising the possibility of defects in proteosomal degradation and consequent development of tumors (Causevic, Hislop et al. 2001).
Phosphorylation of p68 at Y593 is found to promote PDGF-mediated Epithelial-to-
Mesenchymal Transition (EMT) and to contribute to cell proliferation and tumorigenesis
(Yang, Lin et al. 2006).
1.3 FUNCTIONS OF P68 RNA HELICASE
1.3.1 Function of P68 in mRNA Splicing
Splicing is a mechanism where pre-mRNAs are modified by removal of introns and joining of protein coding exons to form mature mRNAs. Introns are removed by a macromolecular structure called a spliceosome made up of U1, U2, U4, U5 and U6 snRNPs (small nuclear ribonucleoprotein particles) and other non-snRNP splicing factors (Will and Luhrmann 2001). Splicing or spliceosome assembly follows a sequential stepwise pathway consisting of recognition and binding of 5’-splice site on 6 pre-mRNA by U1 snRNP and U2AF recognizing 3’-splice site and the E (early complex) is formed. U2 snRNP then interacts with the branch-point adenosine (BP) that leads to pre-spliceosome A complex formation. Next, U4-U6-U5 tri-snRNP enters the pre- spliceosome to form B complex first and then catalytic C complex. Various RNA and protein rearrangements take place in the spliceosome resulting in U1 and U4 release and ultimate intron cleavage and ligation of exon in an ATP-dependent manner (Will and Luhrmann 2001) (Sanford and Caceres 2004) (Wahl, Will et al. 2009).
Recent studies have identified over 300 putative spliceosomal proteins in the spliceosome (Jurica and Moore 2003). DExH/D RNA helicases are one such family of proteins responsible for modulating such interactions using energy derived from ATP- hydrolysis (Staley and Guthrie 1998) (Schwer 2001). P68 being a DEAD-box RNA helicase functions as a crucial splicing factor. It modulates U1 snRNP and 5’-splice site interaction at the intron-exon junctions and unwinds the transient U1-5’-splice site complex (Liu, Sargueil et al. 1998; Liu 2002). This step is essential for the conversion of pre-spliceosome to spliceosome (Staley and Guthrie 1998). Depletion of p68 from the system does not affect the association of U1 snRNP-5’-splice site, however, the spliceosome formation is impeded as U1 snRNP cannot dissociate from the 5’-splice site (Liu, Sargueil et al. 1998; Liu 2002). RNA helicase and ATPase functions of p68 are found to be crucial for this process. P68 mutants without RNA helicase and ATPase functions associate with the U1-5’-splice site, but inhibit U1 dissociation from 5’-splice site thereby preventing spliceosome assembly. P68 also functions in U4.U6/U5 assembly independent of its ATPase and helicase activities. P68 function has also been 7 extended in alternative splicing of the oncogene c-H-ras, besides its role in splicing
(Guil, Gattoni et al. 2003).
1.3.2 Function of P68 in Transcriptional Regulation
Gene expression is the fundamental process in which genetic information, the genotype, is converted to a functional gene product giving rise to the phenotype. Vast multitude of phenotypic differences that are observed in different cells and tissues of eukaryotes are largely due to differential gene expression. Gene expression is regulated in eukaryotic cells at many key points including activation of gene structure, transcription initiation, termination of elongation, nuclear RNA processing, mRNA transport, mRNA translation, and mRNA stability. Thus, in response to genetic controls, environmental factors and tissue specific controls, eukaryotic organisms employ highly orchestrated and elaborate transcription machinery to turn on and off genes encoding different proteins (Ogbourne and Antalis 1998).
Before transcription initiation can occur, highly organized and densely packed chromatin must be activated or opened by chromatin remodeling complexes that are themselves tightly regulated to inhibit responses to initiation factors and DNA transcription and allow for transcription. The opening or priming of chromatin may be regulated by N-terminal phosphorylation, acetylation, or methylation of free amino- groups of lysine residues of histones. Transcription is the process by which mRNA synthesis occurs from DNA in distinct phases, starting with the binding of DNA- dependent RNA polymerase to the gene promoter and ending with the formation of mRNA. The majority of gene expression regulation occurs at transcriptional initiation, 8 that is, regulating the assembly of transcription apparatus and positioning of RNA
Polymerase II at the promoter (Ogbourne and Antalis 1998).
RNA polymerase II (RNA Pol Il) is a 8-14 subunit RNA polymerase involved in the transcription of protein expressing genes. It is solely dependent on auxiliary transcription factors (TFs) to help it to initiate transcription. RNA Pol II and auxiliary TFs, together called basal transcription apparatus or general transcription factors (GTFs), assemble on the core promoter at a precise site known as the transcription initiation site to form pre-initiation complex (PIC) in a highly regulated and defined order (Figure 1.4).
In most eukaryotic core promoters, a cis-acting element, called TATA box (5’ TATAAAA
3’), located upstream of the transcription start site (roughly 30 bp), is necessary for directing the transcription initiation, but not sufficient for promoter activity. Precisely,
RNA Pol II transcription begins with the TATA-binding protein (TBP) association with the
TATA box. Subsequently, TBP-associated factors (TAFs) bind to TBP and form a complex called transcription factor II D (TFIID) sufficient to complete chromatin priming in the vicinity of the promoter. TFIIA is then recruited to the TFIID-TATA box complex to undergo conformational change to allow TFIIB and the remaining GTFs to bind. Binding of TFIIB causes TFIIF-Pol II complex to associate with the complex. TFIIE and TFIIF interact with Pol II to complete PIC assembly. Although this complex is the complete basal transcription machinery to initiate transcription, transcription initiation is further compounded by different cofactors, gene specific activators or repressors, and chromatin remodeling (Ghosh and Van Duyne 1996; Orphanides, Lagrange et al. 1996;
Nikolov and Burley 1997; Ogbourne and Antalis 1998). 9
Core promoter sequences and basal transcription apparatus are required for transcriptional initiation of any gene but gene selective transcriptional activities require activators or repressors that bind to either enhancers or silencers. These transcriptional regulators further modulate transcriptional regulation of tissue or development specific genes. Most transcriptional activators function by interacting with GTFs and stabilizing the association of GTF with core promoter. They have two separable functional domains: a DNA-binding domain that binds to specific DNA sequences or enhancer elements and an activation domain that interacts with other proteins to stimulate transcription (Mitchell and Tjian 1989; Martinez 2002). TFIID is the main target for most transcriptional activators as it is important for the formation of the transcriptional initiation complex on all promoters (Buratowski, Hahn et al. 1989).
Transcriptional repressors perform opposite functions of activators. They repress transcription in two ways: general repression or gene-specific repression. During general repression, repressors either inhibit basal transcription machinery or block the activity of transcription factors. Repressors can also modulate chromatin structure or interact with proteins that remodel chromatin so that it is not available for transcription.
In contrast, a gene-specific repressor controls transcription of genes by affecting the numbers of functional activators or by decreasing the positive effect of activators on transcription (Gaston and Jayaraman 2002).
Besides the basal transcriptional machinery and transcriptional activators and repressors, there is another group of factors that participate in transcriptional regulation.
They are called coactivators or corepressors which are dispensable for basal transcription and may not directly bind DNA (Figure 1.5). They facilitate transcription by 10 either mediating the interaction between activators and GTFs or facilitating chromatin remodeling. Prototypical classes of co-activators are TAF component of TFIID, SRB complex, SAGA or other proteins that are involved in histone acetylation and chromatin remodeling complexes (Hampsey 1998; Martinez 2002).
Numerous studies have shown that p68 functions as a transcriptional co-activator for numerous transcriptional factors (Figure 1.6) (Endoh, Maruyama et al. 1999).
Coactivator role of p68 was first elucidated in the transcriptional coactivation study of estrogen receptor alpha (ERα). P68 potentiates the activity of ERα AF-1 (activation function-1). AF1 activation domain of ERα does not require ligand while AF-2 requires estrogen to facilitate coregulator recruitment. This co-activator function of p68 for ERα
AF-1 does not require RNA unwinding activity of p68 indicating that the involvement of p68 in the regulation of transcription is not the same as its function in RNA-splicing where RNA helicase activity of p68 is indispensable (Endoh, Maruyama et al. 1999).
The ERα transcription machinery contains nuclear receptor AF-2 coactivator complex, such as CBP/p300, SRC-1/TIF2 steroid receptor coactivator, and SRA (steroid receptor
RNA activator) RNA coactivator, besides p68 (Onate, Tsai et al. 1995; Voegel, Heine et al. 1996; Torchia, Rose et al. 1997; Lanz, McKenna et al. 1999; Watanabe, Yanagisawa et al. 2001). P68 binds to the activation domain (AD2) of this AF-2 coactivator complex.
It selectively coactivates ERα-AF-1 by binding to the AD-2 domain of AF-2 complex allowing SRA and the SRC-1/TIF2 to directly bind to AF-2 of ERα, serving as a bridge between ERα and SRC/SRA (Watanabe, Yanagisawa et al. 2001). A “transcriptional clock” concept was defined in another study that showed the sequential assembly of transcriptional cofactors on the promoter of pS2, an ERα downstream gene, in 11 estrogen-dependent manner. P68 interacts with the pS2 promoter along with ERα and the transcription factors, TBP and TFIIA, demonstrating the role of p68 in transcription coactivation (Metivier, Penot et al. 2003).
Another independent study confirmed the transcriptional regulation function of p68 by demonstrating the presence of p68 in a multi-protein transcription complex containing RNA Pol II, CREB-binding protein (CBP) and p300 and showed how p68 impacts transcription of genes that are regulated by RNA Pol II and CBP/p300 (Rossow and Janknecht 2003). CBP/p300 is a transcriptional coactivator that modulates expression of genes essential for cell growth and proliferation (Goodman and Smolik
2000; Janknecht 2002). Within the transcriptional multi-protein complex, p68 interacts with CBP and RNA Pol II and stimulates CBP/p300 transcriptional activity synergistically requiring its ATPase-dependent function (Rossow and Janknecht 2003). In another study demonstrating the role of p68 as a transcriptional coactivator, p68 is identified as the first RNA helicase to be implicated as an important element in the DNA damage pathway. P68 functions as a transcriptional coactivator or a possible tumor cosuppressor by interacting with p53 to stimulate transcription mediated by p53. P68 is involved in the expression of p53-responsive genes including, p21, mdm2, and PIG3.
Chromatin immunoprecipitation experiments demonstrated the p68 interaction with the p21 promoter stimulated by the drug, etoposide, further supporting the function of p68 in transcriptional initiation (Bates, Nicol et al. 2005). Furthermore, p68 also forms a complex containing Smad 3, p68, and CBP under the stimulation of TGF-β. In this complex, helicase activity of p68 and histone acetylase activity of CBP enhance TGF-β- dependent transcriptional activation (Warner, Bhattacherjee et al. 2004). 12
Functional role of p68 in the transcription systems mentioned above can be extrapolated to transcription activation in muscle cells. P68 associates with SRA to stimulate MyoD transcriptional activity required for differentiation of skeletal muscle cells. It serves as a bridge between MyoD and SRA within this complex and its helicase activity is dispensable for this process. Reduction of p68 levels in this system impairs the recruitment of TBP, RNA Pol II, Brg-1, and SWI/SNF complex catalytic subunit, and affects chromatin remodeling. Thus, this study shows that p68 is essential for the recruitment of the transcription machinery and chromatin remodeling (Caretti, Schiltz et al. 2006). The link between p68 function and proliferation is demonstrated in keratinocytes where overexpression of p68 increases keratinocyte proliferation and
VEGF expression, while knockdown of p68 reduces serum-induced proliferation and
VEGF expression (Kahlina, Goren et al. 2004). Interestingly, the phosphorylated form of p68 also has a role in transcriptional regulation. Activation of the gene expression of cyclin D1 and c-myc occurs by p68 phosphorylation at Y593, thereby promoting cell proliferation induced by PDGF. Phospho-p68 is recruited to cyclin D1 and c-myc promoters by its interaction with β-catenin. The TCF/LEF complex and ATPase/helicase activities of p68 have been found to be required for this cyclin D1 transcription (Yang,
Lin et al. 2007). Thus, transcriptional regulation by phospho-p68 adds another dimension to the function of p68 in the transcriptional regulation.
Another report demonstrated a function of p68 besides that of transcriptional initiation. P68 can also function as a transcriptional corepressor depending on the transcriptional complex and promoter onto which it is recruited. It associates with
HDAC1 and represses transcriptional regulation mediated by it (Wilson, Bates et al. 13
2004). Another study showed that phospho-p68 interacts with HDAC1 and MBD3:Mi-
2/NuRD in the nuclear remodeling and deacetylation complex and activates the transcription of Snail1 gene from the Snail promoter. It does so by removing HDAC1 from the MBD3:Mi-2/NuRD complex. The Snail1 transcriptional regulation by p68, in turn, represses E-cadherin expression indirectly (Carter, Lin et al. 2010). In another study of the Drosophila homologue, Dmp68, p68 is found to be required for the removal of mRNA transcripts from transcription sites to shut off active genes and letting chromatin reset to an inactive state, leading to gene deactivation (Buszczak and
Spradling 2006).
Thus, several lines of evidence have established the roles of p68 as transcriptional coactivator/ corepressor and in most cases, RNA helicase and ATPase functions are not required for these functions implying that the function of p68 in transcription is different from its role in RNA-related processes. It is not a general transcriptional regulator and functions as a coactivator or corepressor based on the promoter or transcription complex. It has a function in transcriptional regulation by either acting as a link between transcription factors/ coactivators, or facilitating the rearrangement or recruitment of protein complexes at the gene promoter, or by stabilizing the transcription initiation complex, or by associating with the chromatin remodeling complexes to repress gene activation. Thus, it is a truly multifunctional protein with functions in several processes each with specific requirements.
14
1.3.3 Role of P68 in Post-transcriptional Processes.
P68 is a pleiotrophic protein with different roles in different cellular processes. A study demonstrated an important function of p68 in pre-rRNA maturation. P68 and U8 small nucleolar RNA (snoRNA) cleave pre-28S rRNA structure of pre-60S ribosomal subunit (Jalal, Uhlmann-Schiffler et al. 2007). Mouse Drosha complex contains p68, where p68 is found to be required for primary miRNA and rRNA processing and is indispensable for survival in mice (Fukuda, Yamagata et al. 2007). P68 is also found to be involved in the release of mRNA transcripts after transcription to enable condensation of chromatin causing gene inactivation (Buszczak and Spradling 2006).
Apart from gene inactivation, p68 involvement in transcript release from the transcription site is also important in cyclical transcriptional activation processes where there is combinatorial recruitment of coactivators and corepressors for gene regulation (Metivier,
Penot et al. 2003). Thus, p68 functions as an adaptor molecule that is not only involved in the transcription initiation but also in post-transcriptional processes of gene expression, such as elongation and RNA processing.
1.3.4 Role of P68 in Differentiation
Several studies have suggested the role of RNA helicases in cellular differentiation process. RNA helicases serve as potential regulators of differentiation by virtue of their ability to modulate RNA structure and interactions and their roles in RNA processing where a large number of proteins can be expressed from a smaller subset of genes (Abdelhaleem 2005). The mouse p68 is found to be expressed during organ differentiation in developing murine embryo (Stevenson, Hamilton et al. 1998). In situ 15 hybridization of 5 day old chicken embryos demonstrated a very high number of chick homologs of p68 transcripts in different embryonic tissues (Jost, Schwarz et al. 1999).
P68 is also involved in embryonic differentiation of vertebrates. Very high embryonic expression of p68 is observed in neural and mesodermal tissues in the brain and spinal cord of chordates such as chick and frog. Mesodermal p68 expression is also seen in ascidian and frog embryos during gastrulation and neurulation (Seufert, Kos et al.
2000). The p68 expression has also been observed in other organs and tissues during differentiation. Invariably, p68 expression is also seen in murine male germ cells, particularly pachytene spermatocytes and haploid spermatids (Lemaire and Heinlein
1993). The expression of p68 is regulated in these cells by germ cell-specific proteins that associate with the highly conserved 3’ UTR of the gene (Sandhu, Lemaire et al.
1995). Interestingly, rck/p54 DEAD–box RNA helicase has a role in gametogenesis
(both oogenesis and spermatogenesis) and embryogenesis (Matsumoto, Kwon et al.
2005). Moreover, p68 expression is important during early adipocyte differentiation. The in vitro model of adipocyte differentiation demonstrates the role of p68 in partially driving the differentiation into adipocytes where inhibition of p68 expression partially blocks adipocyte differentiation and simultaneously decreases expression levels of some marker genes (Kitamura, Nishizuka et al. 2001). Nonetheless, the exact mechanism by which p68 plays a role in cellular differentiation is not known. This poses several questions where future research could be targeted: What is the role of p68 in differentiation? Could p68 engage in transcriptional programs that control differentiation? What are the downstream targets of p68 in its function as differentiation regulator? 16
1.3.5 Role of P68 in Cell Proliferation and Cancer
P68 is essential for growth and proliferation of normal cells (Lane and Hoeffler
1980; Stevenson, Hamilton et al. 1998; Tanner and Linder 2001). P68 shows different localization patterns in the nucleus during different stages of the cell-cycle. It shows weak granular distribution in the nucleoplasm but not in the nucleolus during interphase
(Lane and Hoeffler 1980; Iggo and Lane 1989), However, its association with the prenucleolar bodies in the nucleolus is observed during telophase (Iggo, Jamieson et al.
1991). Strikingly, serum-stimulation of quiescent cell lines increases p68 expression suggesting that p68 expression is functionally linked to cellular proliferation (Stevenson,
Hamilton et al. 1998). In fact, overexpression of p68 in keratinocytes shows a marked increase in serum-induced proliferation of cells, whereas downregulation of p68 decreases serum-induced proliferation (Kahlina, Goren et al. 2004).
Many studies have shown that p68 is essential for cellular proliferation, and abnormal p68 may lead to uncontrolled cell proliferation leading to cancer development.
Two p68 abnormalities have been attributed to cancer. Dubey et al. identified a tumor- specific somatic mutation (C→T) that causes serine to phenylalanine transition in the coding region of p68 with phosphorylation and calmodulin-binding sites leading to a unique tumor antigen being expressed on murine UV-induced sarcoma. However, it is still not clear whether this mutation has any effect on the function of p68 or on the tumorigenesis process (Dubey, Hendrickson et al. 1997). The second type of p68 abnormality is the overexpression and post-translational modifications of p68 (Causevic,
Hislop et al. 2001; Yang, Lin et al. 2005; Shin, Rossow et al. 2007). Overexpression of p68 is observed in colorectal tumors at the protein level, as compared with normal 17 tissues with the expression of p68 increasing with the progression of the disease from hyperplastic polyps to adenomas and adenocarcinoma (Causevic, Hislop et al. 2001;
Shin, Rossow et al. 2007). Moreover, p68 in tumor tissues is different from the p68 found in normal tissues. It is poly-ubiquitylated suggesting tumor-associated post- translational modification affected proteasome-mediated degradation in tumor tissues implying that deregulation of p68 expression/ ubiquitylation leads to tumor development
(Causevic, Hislop et al. 2001). Phosphorylation of p68 is yet another post-translational modification implicated in tumor development and cellular transformation. P68 is found to be phosphorylated in six different cancer cells in comparison to normal cell counterparts and this tyrosine phosphorylation of p68 is associated with abnormal cell proliferation and cancer development (Yang, Lin et al. 2005). So the overarching question is how does overexpression and phosphorylation of p68 contribute to tumor formation? An important phenomenon during colon tumor formation is the abnormal activation and β-catenin accumulation. Almost 80% of human colorectal carcinomas show abnormal β-catenin accumulation (Mirabelli-Primdahl, Gryfe et al. 1999; Brabletz,
Jung et al. 2001; Segditsas and Tomlinson 2006; de Lau, Barker et al. 2007). The phospho-p68 binds to and promotes nuclear translocation of β-catenin. This stimulates transcription of cyclin D1 and c-myc genes leading to cellular proliferation. This interaction of p68 and β-catenin also stimulates EMT (Epithelial- Mesenchymal transition), an event that is essential not only during embryogenesis but also for invasion and metastasis (Yang, Lin et al. 2006; Yang, Lin et al. 2007; Thiery, Acloque et al. 2009). Reduction of p68 in colon cancer cells also inhibits their proliferation and diminishes their tumor-forming ability in nude mice (Yang, Lin et al. 2006; Shin, Rossow 18 et al. 2007; Yang, Lin et al. 2007). All these results collectively indicate that p68 overexpression and post-translational modifications may lead to colon carcinogenesis through β-catenin.
The emerging role of p68 in tumorigenesis other than in colorectal carcinoma can be further substantiated by the report of p68 being overexpressed in 30-58% of breast tumors (Wortham, Ahamed et al. 2009; Mooney, Grande et al. 2010). Approximately
70% of human breast tumors are ER-α-positive and current breast cancer therapy targets ER-α inhibition (Normanno, Di Maio et al. 2005; Yager and Davidson 2006).
Since p68 functions as a coactivator of ER-α transcription, it is possible that increased overexpression and probable modifications of p68 enhances the transcriptional activation of ER-α and consequently the oncogenic activities of ER-α in breast tumorigenesis. Similarly, p68 expression is elevated in prostate cancer cells in comparison with the normal prostate tissues and it enhances coactivation of androgen receptor-regulated gene expression. These results show the p68 function in the progression of prostate cancer to hormone-refractory disease (Clark, Coulson et al.
2008).
In contradiction, p68 has also been found to function as a tumor suppressor under certain situations (Bates, Nicol et al. 2005). P68 stimulates transcription from p53- responsive promoters by interacting with p53. P53 is a tumor suppressor protein encoded by the TP53 gene. It is latent transcription factor activated by genotoxic stresses like DNA damage to mediate transcriptional regulation of cell cycle and apoptosis related genes. P68 RNA helicase acts as a coactivator of p53-responsive genes. Interestingly, p68 knockdown inhibits p53-dependent transcription and apoptosis 19 triggered by the drug, etoposide, suggesting the importance of p68 in such processes.
This role is further substantiated by chromatin immunoprecipitation assay that demonstrates the association of p68 with the p21 promoter, further extending the role of p68 in transcription initiation. P21 is an inhibitor of cell-cycle progression. This shows that the transcriptional ability of p68 plays an important role in cancer. P68 may not be completely essential in this process, but possibly employed only under specific circumstances. The ability of p68 to enhance the tumorigenesis process or act as a tumor-suppressor may be dependent on the form of p68 i.e. modifications, cellular context, or upstream signaling events.
1.4 MODIFICATIONS OF P68
Mammalian cells constantly receive various signals from their environment to respond to cell growth, proliferation or differentiation. The cellular responses to these signals are mediated mainly by post-translational protein modifications and gene regulation. Post-translational modification is the process by which a protein is chemically modified, with ubiquitylation and phosphorylation being the most common ones. These modifications can modulate enzymatic activities, protein conformations, protein-protein interactions, protein-DNA interactions, and cellular localization of various proteins (Olsen, Blagoev et al. 2006).
1.4.1 Ubiquitylation and Sumoylation of P68
Ubiquitylation is an enzymatic, post-translational modification process where ubiquitin, a small regulatory protein is attached to proteins to direct them to the 20 proteasome for degradation. Ubiquitylation processes employ activating (E1), conjugating (E2), and ligase (E3) enzymes (Hershko, Heller et al. 1983). E1 enzyme activates and transfers ubiquitin to the E2 enzyme. The E3 ligase forms bond between the glycine residue of ubiquitin and lysine of substrate (Alberts et al. 2002). The presence of protein tagged with ubiquitin recruits the 26S proteasome that unfolds and hydrolyzes the polypeptide chain of the protein to small peptides using the energy derived from ATP. The ubiquitin molecule(s) is prevented from degradation by de- ubiquitinating enzymes (Hershko, Ciechanover et al. 1980; Baumeister, Walz et al.
1998; Pickart 2004).
Sumoylation is another form of post-translational modification where SUMOs
(small ubiquitin-related modifiers), which are small ubiquitin-like proteins, are conjugated to proteins in different cellular activities like transcription activation and repression, apoptosis, cell-cycle and mitosis, chromatin remodeling and nucleocytoplasmic shuttling (Rodriguez, Dargemont et al. 2001; Gill 2004; Hay 2005).
However, unlike ubiquitylation, SUMO modification does not cause protein degradation, but modulates subcellular localization of target proteins, protein-protein interactions or protein-DNA interactions (Matunis, Coutavas et al. 1996; Mahajan, Delphin et al. 1997;
Melchior 2000).
P68 undergoes post-translational modifications. It is overexpressed and poly- ubiquitylated in colorectal adenocarcinoma in comparison to normal colon tissues. This indicates a defect in proteasomal-degradation in colorectal tumors and ubiquitylation of p68 occurs in the initial stages of tumor development. However, the exact sites where p68 is ubiquitylated remain to be identified (Causevic, Hislop et al. 2001). P68 is found 21 to be preferentially sumoylated by SUMO-2 at Lys53 amino-acid, while SUMO E3-ligase
PIAS1 as one of its functions enhances its SUMO modification. This SUMO modification of p68 inhibits its ability to transcriptionally coactivate p53 by increasing its transcriptional repression function and enhancing its interaction with HDAC1 (Fuller-
Pace, Jacobs et al. 2007; Jacobs, Nicol et al. 2007).
1.4.2 Phosphorylation of P68
Phosphorylation, a form of post-translational modification, is used in signal transduction for regulating protein activity. It is involved in almost every cellular processes, such as cell growth, division, differentiation, migration, metabolism, membrane transport, organelle trafficking, muscle contraction, immunity, learning and memory (Manning, Plowman et al. 2002; Manning, Whyte et al. 2002). Protein kinases are enzymes that phosphorylate proteins by transferring γ-phosphate from ATP, the phosphoryl donor, to the specific residues in proteins, usually serine, threonine and tyrosine (Hunter 2000). Protein kinases represent one of the largest families of genes in eukaryotes. They are encoded by over 500 genes and make up ~ 2% of the genome
(Zhu, Klemic et al. 2000; Manning, Whyte et al. 2002; Caenepeel, Charydczak et al.
2004). Roughly 30% of cellular proteins are modified by phosphorylation on atleast one residue, emphasizing the importance of phosphorylation (Pinna and Ruzzene 1996;
Cohen 2000). Thus, in cells, phosphorylation (adding phosphoryl group) and dephosphorylation (removing phosphoryl group) by protein kinases and phosphatases, respectively, at specific sites are among the most general regulatory steps in the eukaryotic cells. Kinases and phosphatases modify the functions of proteins by 22 increasing or decreasing their biological activities, by stabilizing or tagging them for destruction, by enhancing or inhibiting subcellular compartment movements or modulating protein-protein interactions (Cohen 2002). In fact, abnormal phosphorylation is now identified as a cause or consequence of many pathologies such as cancer
(Hanahan and Weinberg 2000), auto-immune diseases (Gatzka and Walsh 2007), metabolic disorders (Taniguchi, Emanuelli et al. 2006) and pathogenic infections
(Sirard, Vignal et al. 2007).
Studies carried out by Yang et al showed for the first time that p68 gets phosphorylated at several residues (Yang and Liu 2004). Interestingly, p68 is found to be phosphorylated at tyrosine in six cancer cell-lines and not in the respective normal cell lines (Yang, Lin et al. 2005). This observation correlates with p68 phosphorylation status in tumor tissue samples where p68 is tyrosine phosphorylated in tumor tissues and not in the respective normal tissues. Thus, tyrosine phosphorylation in p68 is associated with abnormal cell growth leading to tumor development (Yang, Lin et al.
2005). Strikingly, p68 tyrosine phosphorylation is higher in metastatic cells in comparison to primary cells further suggesting roles of p68 tyrosine phosphorylation with respect to tumor development and progression (Carter, Lin et al. 2010).
Phosphorylation of p68 at tyrosine is found to be induced by PDGF and IL-2 and diminished by treatment with apoptosis agents such as TNF-α, TRAIL, and STI-571.
However, tyrosine phosphorylation of p68 is not influenced by other anti-cancer drugs such as piceatannol, etoposide, and taxol. In addition, ATPase and RNA helicase activities are affected by tyrosine phosphorylation of p68, thereby influencing its role in 23 splicing. This suggests the potential for use of p68 phosphorylation as a diagnostic marker and therapeutic target for cancer diagnosis and therapy (Yang, Lin et al. 2005).
Another study carried out by Yang et al. demonstrated p68 phosphorylation in
HeLa cells. TNF-α and TRAIL cause p68 to be phosphorylated at threonine and subsequently dephosphorylated upon longer exposure to TNF-α. Interestingly, TNF-α treatment causes tyrosine dephosphorylation of p68 after 15 mins of treatment. This result suggests that threonine or tyrosine phosphorylations of p68 react differently in response to TNF-α and that phosphorylation at threonine and/or tyrosine dephosphorylation of p68 may trigger apoptosis in the presence of TNF-α treatment
(Yang, Lin et al. 2005).
1.4.2.1 Phosphorylation of P68 by PKC
Protein Kinase C (PKC) is a multifunctional protein kinase that phosphorylates target proteins (Newton 1995). Phosphorylation of cellular proteins by PKC changes their activation status leading to further changes in cellular functions (Alberts et al.
2002). PKC plays essential roles in processes such as proliferation (Murray,
Baumgardner et al. 1993), differentiation (Cutler, Maizels et al. 1993), development
(Otte, Kramer et al. 1991), memory (Alkon 1989) and cancer (Ashendel 1985). PKC enzymes are present in the cytoplasm in their inactive state and upon activation translocate to cell membranes or different cellular organelles (Martelli, Faenza et al.
2003). There are atleast 10 different isoforms of PKC depending on protein structure and cofactor requirements. The conventional isoforms of PKC, α, βI, βII, γ, need Ca2+, diacylglycerol and phosphatidylglycerol for activation; the novel isoforms, δ, ε, η, θ, μ, 24 are activated by diacylglycerol and phosphatidylglycerol, but do not require Ca2+; and the last group, the atypical (ζ, ι) isoforms do not require Ca2+, but are stimulated by phosphatidylserine. Different isoforms can sometimes phosphorylate the same target substrate (Newton 1997). The general structure of a PKC molecule consists of a single polypeptide with a catalytic and a regulatory domain found at the COOH- and NH2- terminus, respectively (Way, Chou et al. 2000). Aberrant PKC activity is linked with diseases of cellular dysregulation, such as diabetes and cancer. Overexpression of different PKC isoforms have been observed in squamous cell carcinoma (PKCε)
(Wheeler, Martin et al. 2004), serous epithelial ovarian cancer (PKCι) (Eder, Sui et al.
2005), breast tumor (PKCα) (Lahn, Kohler et al. 2004), non-small cell lung carcinoma
(PKCι) (Regala, Weems et al. 2005) and multiple myeloma (PKC δ, ι, μ ζ) (Ni, Ergin et al. 2003). Downregulation of PKCδ is observed in colon cancer (Cerda, Bissonnette et al. 2001) while PKCα and PKCδ promote cell death in androgen-dependent prostate cancer cells (Gavrielides, Frijhoff et al. 2004).
The earliest reports of p68 phosphorylation were shown by the study performed by Buelt et al. In vitro and immunological studies showed that p68 can be phosphorylated by PKC in the IQ domain in the absence of RNA and it can bind calmodulin in a Ca2+-dependent manner. The phosphorylation and binding to calmodulin block RNA-dependent ATPase activity of p68, indicating that PKC negatively regulates
ATPase activity of p68. Thus, PKC phosphorylation regulates the RNA binding or helicase activity of p68 (Buelt, Glidden et al. 1994). Another study demonstrated that
PKC phosphorylation of p68 inhibits its RNA-binding ability, while dephosphorylation 25 restores the function further substantiating the role of PKC phosphorylation in regulating the function of p68 (Yang, Yang et al. 2004).
1.4.2.2 Phosphorylation of P68 by Tlk1
Mammalian Tousled-like kinase 1 (Tlk1) is a relatively recently discovered nuclear serine/threonine kinase that was identified in 1999. There are two known human
Tlks that are ubiquitously expressed. They are Tlk1 and Tlk2 that share 84% amino-acid sequence identity and act as dimers/oligomers. Tlk1 is found to be maximally active in
S-phase showing the potential role of Tlk1 in cell-cycle progression (Sillje, Takahashi et al. 1999). It is also implicated in processing replicated DNA and chromatin formation and this role of Tlk1 in regulating chromatin assembly was first noted by the discovery of human chromatin-assembly factors, Asf1a (Anti-silencing function 1) and Asf1b, as Tlk substrates (Sillje, Takahashi et al. 1999; Sillje and Nigg 2001). Tlk1 is activated in response to genotoxic stress, such as UV, ionizing radiation or treatment with hydroxyurea (Groth, Lukas et al. 2003; Krause, Jonnalagadda et al. 2003). DNA- damage generates double strand breaks (DSBs) that require Ataxia Telangiectasia
Mutated kinase (ATM) and Checkpoint protein kinase 1 (Chk1) functions. ATM phosphorylates Chk1, which in turn phosphorylates Tlk1 on serine 695 (S695) in vitro and in vivo leading to the rapid and transient deactivation of Tlk1 (Krause,
Jonnalagadda et al. 2003). Deactivation of Tlk1 causes a delay of Tlk-dependent processes in S-phase, such as activation and phosphorylation of hAsf1, essential in
DNA-repair or blockage of activation of certain transcription factors resulting in subsequent cell death (Groth, Lukas et al. 2003). Other downstream targets of Tlks 26 besides Asf1a and Asf1b include histone H3 and DEAD-box protein p68 (Sillje and Nigg
2001; Kodym, Henockl et al. 2005; De Benedetti 2009).
Like PKC, p68 gets phosphorylated by Tousled-like kinase 1 (Tlk1). In addition,
Tlk1 phosphorylation of p68 affects its RNA-binding activity, further confirming the regulatory effect of phosphorylation on p68-enzymatic activity (Kodym, Henockl et al.
2005). Tlk1 has been implicated in the UV- and ionizing-radiation-induced pathways
(Groth, Lukas et al. 2003; Krause, Jonnalagadda et al. 2003). So, p68 phosphorylation by Tlk1 may potentially link p68 in the UV- or IR-induced pathways. Tlk1 is also known to regulate chromatin assembly (Sillje, Takahashi et al. 1999; Sillje and Nigg 2001) while p68 is known to function in transcriptional co-activation. These observations suggest that Tlk1 and p68 may participate in the chromatin remodeling process by regulating the expression of chromatin remodeling genes. However, the downstream targets and substrates are not known yet.
1.4.2.3 Phosphorylation of P68 by c-abl kinase
C-abl belongs to the non-receptor tyrosine kinase family (Abelson and Rabstein
1970) (Goff, D'Eustachio et al. 1982; Shaul 2000). It is ubiquitously expressed, but is localized at different sites including cellular membranes, cytoskeleton, and in the cytoplasm (cytoplasmic c-Abl), and nucleus (nuclear c-Abl). It has nuclear localization in the fibroblasts, while cytoplasmic localization is seen primarily in haematopoietic cells and neurons (Van Etten 1999). This subcellular localization and shuttling ability of c-Abl is due to the nuclear localization signal (NLS) and a nuclear export signal (NES)
(Taagepera, McDonald et al. 1998). The NLSs and DNA-binding sequences in c-Abl are 27 crucial for its nuclear functions (Pendergast 2002). Alternative splicing leads to the formation of abl- 1a and 1b isoforms. Abl-1b isoform with predominant localization in the nucleus is myristoylated. Isoform 1a lacks myristoylation site and is mostly cytoplasmic
(Kharbanda, Pandey et al. 1997).
The functional domains of c-Abl include a myristoylation site in the N-terminus of
1b isoform, tyrosine-kinase region, Src homology 2 (SH2) domain and SH3-domain with high affinity for proline-containing regions containing the PxxP motif (Cicchetti, Mayer et al. 1992; Ren, Mayer et al. 1993; Songyang, Shoelson et al. 1993; Pawson 1994;
Songyang, Shoelson et al. 1994; Cohen, Ren et al. 1995). C-Abl also has a long C- terminal tail that consists of three PxxP motifs, three NLS and a NES, actin and DNA- binding domains. These structural domains are responsible for the ability of c-Abl to regulate different cellular processes by either direct protein-protein interactions or diverse subcellular localization (Tybulewicz, Crawford et al. 1991; Kipreos and Wang
1992; Van Etten, Jackson et al. 1994; Miao and Wang 1996). C-Abl has functions in cell growth (Sawyers, McLaughlin et al. 1994), morphogenesis and actin dynamics
(Woodring, Hunter et al. 2003), cell homeostasis (Schwartzberg, Stall et al. 1991;
Tybulewicz, Crawford et al. 1991), and migration (Woodring, Litwack et al. 2002;
Woodring, Hunter et al. 2003). C-abl also regulates cell-cycle and cell-growth arrest
(Yuan, Huang et al. 1996) and induces apoptosis (Yuan, Huang et al. 1997). Growth- factors, including PDGF (Plattner, Kadlec et al. 1999), EGF (Plattner, Kadlec et al.
1999), TGFβ (Wang, Wilkes et al. 2005) etc activate cytoplasmic c-Abl. C-Abl with cytoplasmic localization is involved in normal cell transformation and cancer progression specifically in chronic myeloid leukemia (Krause and Van Etten 2005). Cytoplasmic c- 28
Abl kinase demonstrates kinase activities in non-small cell lung cancers (Rikova, Guo et al. 2007) and breast carcinoma (Srinivasan and Plattner 2006). Studies carried out by
Yang et al. showed an unanticipated function of cytoplasmic c-Abl in epithelial- mesenchymal transition (EMT), and p68 being a substrate of this signaling process
(Yang, Lin et al. 2006). EMT is defined as a process in which epithelial cells loose cell polarity, loose cell-cell contact and acquire a fibroblastoid, invasive morphology essential for cell motility. They found that PDGF stimulation of HT-29 colon cancer cells activates c-Abl which was phosphorylated by Src. Activated c-Abl phosphorylates p68 at
Y593 in the cell nucleus. Phospho-p68 interacts with β-catenin in the nucleus after translocation and displaces β-catenin from the axin destruction complex. It does this by blocking GSK-3β-induced β-catenin phosphorylation. Phosphorylated p68 then promotes nuclear translocation of β-catenin causing stimulation of the EMT process
(Yang, Lin et al. 2006). Phosphorylated p68 also promotes cell proliferation by activating the transcription of proliferative genes, such as c-myc and cyclin D1 (Yang, Lin et al.
2007). Another study showed that phosphorylated p68 at Y593 suppresses E-cadherin expression by activating Snail 1 transcription. It does so by displacing HDAC1 from the
MBD3:Mi-2/NuRD nuclear-remodeling and deacetylation-complex assembled at the
Snail 1 promoter (Carter, Lin et al. 2010).
1.4.2.4 A-kinase-anchoring protein (AKAP95)
A-kinase-anchoring protein (AKAP95) is a nuclear protein with zinc-finger domain. It has a docking site for PKA kinase, nuclear matrix targeting site, two zinc- finger motifs and a PKA-binding domain (Coghlan, Langeberg et al. 1994; Akileswaran, 29
Taraska kinase et al. 2001). By virtue of its binding to cAMP/PKA, AKAP95 regulates chromatin condensation during mitosis (Collas, Le Guellec et al. 1999; Steen,
Cubizolles et al. 2000). P68 binds to AKAP95 (Akileswaran, Taraska et al. 2001).
During interphase, interaction of p68 with AKAP leads to localization of p68 to the nuclear matrix, and further suggests the possibility for PKA to target p68. Since AKAP95 has the scaffolding function and a docking site for PKA, known for its established role in regulating CBP/CREB transcriptional initiation complexes, (Arias, Alberts et al. 1994;
Kwok, Lundblad et al. 1994) and p68 associates with CBP regulating CBP-mediated transcription (Endoh, Maruyama et al. 1999), it is quite possible for the involvement of this complex in the changes in chromatin structure and gene expression regulation
(Akileswaran, Taraska et al. 2001).
1.5 COLORECTAL CANCER (CRC)
Colorectal cancer (CRC) has a very high mortality rate and more than a million cases are reported every year. The incidence of colorectal cancer is equally distributed between both the sexes. The highest rate of occurrence is seen in developed nations such as North America, Australia, Western Europe, most probably due to dietary factors
(Parkin, Bray et al. 2005; Saunders and Iveson 2006). The risk factors for developing colorectal cancer are genetic, increasing age, colonic polyps and lifestyle factors such as diet (fiber deficiency, obesity, high consumption of alcohol), sedentary lifestyle, diabetes mellitus, and smoking (Cunningham, Atkin et al. 2010). The diagnosis of CRC is based on colonoscopy or sigmoidoscopy with tumor biopsy. After detection of the newly diagnosed cancer, physical examination and complete colonoscopy are 30 performed to detect tumor (Mauchley, Lynge et al. 2005). Approximately 70 to 80% of
CRC patients develop localized disease and surgery is the optimum curative treatment
(Bennouna and Douillard 2002). Adjuvant chemotherapy is used for high-risk patients after surgery to avoid recurrence. Nearly half of the CRC patients still develop disseminated, advanced disease and receive systemic chemotherapy or surgery. The survival rates have increased in the past few years due to large scale screening and early diagnosis (Saunders and Iveson 2006). Nearly 20% of CRC patients develop metastatic disease (mCRC) with the liver, lung, peritoneum, and retroperitoneum being the most common sites of CRC metastasis. The systemic chemotherapy approved by
FDA (Food & Drug Administration) includes 5-fluorouracil (5-FU), leucovorin, bevacizumab, oxaliplatin, cetuximab, irinotecan, capecitabine, and panitumumab. The systemic therapy for CRC aims at mitigating the symptoms, increasing the life expectancy and regression of the tumor in liver-only metastases for surgical resection.
Combination systemic therapy has increased the median survival of CRC patients in the last decade to roughly 2 years (Goodwin and Asmis 2009). Thus, combination of targeted treatments with conventional cytotoxic drugs and population screening has improved outcomes and has caused incremental survival advantage in the colorectal cancer treatment.
1.5.1 Chemotherapy for Metastatic Colorectal Cancer
1.5.1.1 FOLFIRI or FOLFOX Regimen
The standard chemotherapeutic agent for metastatic CRC has been 5- fluorouracil (5-FU) for over half a century (Krueger, Alexander et al. 2006) (Saunders 31 and Iveson 2006). The drug 5-FU is a cytotoxic thymidylate-synthase (essential for DNA synthesis) inhibitor and is typically administered with leucovorin. Leucovorin, a thymidylate-synthase modulator, also called folinic acid increases the antineoplastic effects of 5-FU (Goodwin and Asmis 2009). When 5-FU is administered alone, it is not very effective, with the response rate being just 20% in advanced disease and survival rate just 12 months. Leucovorin and 5-FU administered together have a slightly better response rates but the overall survival is 11 to 13 months. The latest combination therapy consisting of 5-FU-leucovorin, irinotecan or oxaliplatin has doubled the overall survival of 14 to 21 months in advanced disease (Grothey and Schmoll 2001; Grothey,
Sargent et al. 2004). Irinotecan belongs to the campothecin family, and is an inhibitor of topoisomerase I during replication. Optimal chemotherapy for metastatic CRC includes administration of 5-FU (F=fluorouracil) and leucovorin (FOL=folinic acid) combined with either oxaliplatin (OX) or irinotecan (IRI), forming FOLFIRI or FOLFOX regimens, respectively (Goodwin and Asmis 2009). Studies carried out by Tournigand et al. reported that FOLFIRI has 56% response rate and progression-free survival (PFS) of
8.5 months, while FOLFOX has 54% response rate and 8 months PFS concluding that both the regimens have similar efficacy (Tournigand, Andre et al. 2004).
1.5.1.2 Targeted Therapies
Targeted cancer therapies utilize drugs that specifically interfere with particular molecules involved in tumor growth and progression. Treatment for metastatic CRC in the last several years has included the administration of inhibitors of vascular endothelial growth factor (VEGF) and of epidermal growth factor receptor (EGFR) 32
(Patiyil and Alberts 2006). Bevacizumab is a VEGF antibody that binds to VEGF-ligand thereby blocking and inhibiting angiogenesis. It aids in more effective delivery of chemotherapy to the tumor site by normalizing abnormal tumor vasculature and inhibiting neovacularization. It is generally given in combination with 5-FU-based chemotherapy regimen since being sanctioned by US Food and Drug Administration
(FDA) in 2004 (Hurwitz, Fehrenbacher et al. 2004). According to a study carried out by
Hurwitz et al., Bevacizumab given with FOLFIRI regimen increases the RR of patients from 35% to 45% (Hurwitz, Fehrenbacher et al. 2004). Bevacizumab administered with
FOLFOX regimen does not cause any change in RR (Goodwin and Asmis 2009).
Panitumumab, a fully humanized (not chimeric) monoclonal antibody for EGFR was approved by FDA in 2006. It is normally given to patients following 5-FU, oxaliplatin and irinotecan regimens. Panitumumab has a RR of 10% and does not cause much serious infusion reactions as seen with cetaximab (3%) (Van Cutsem, Peeters et al. 2007).
However, the efficacy of panitumumab when given with systemic chemotherapy or its effect in comparison to cetaximab is still not known.
1.5.1.3 Oxaliplatin
Oxaliplatin is a platinum-based agent containing a 1,2-diaminocyclohexane ligand. It is used in colorectal cancer chemotherapy (Jung and Lippard 2007).
Oxaliplatin administered as a single agent has low activity in many tumors and is generally given in combination therapy with 5-FU and leucovorin. Exact mechanism of oxaliplatin in this complex is not known, however, it is suggested that it can downregulate dihydropyrimidine dehydrogenase, slowing the catabolism of 5-FU 33
(Fischel, Formento et al. 2002). Cellular uptake of oxaliplatin occurs through passive diffusion and carrier-mediated transport systems (Ghezzi, Aceto et al. 2004; Safaei and
Howell 2005). Oxaliplatin exerts its cytotoxic effect by causing DNA-damage brought about by platinum DNA-adducts formed by binding of oxaliplatin to guanine residues of
DNA (Raymond, Faivre et al. 2002; Chaney, Campbell et al. 2005; Hah, Sumbad et al.
2007). The DNA lesions lead to inhibition of DNA replication resulting in cell-cycle arrest and apoptosis (Di Francesco, Ruggiero et al. 2002). It also causes inhibition of RNA synthesis and triggers immunologic reactions causing immunogenic death of colon cancer cells (Todd and Lippard 2009; Tesniere, Schlemmer et al. 2010). In terms of toxicity caused by oxaliplatin, it is less neurotoxic than other platinum compounds, but still causes adverse reactions specifically in the haematopoietic system, the peripheral nerves, and the gastrointestinal system (Donzelli, Carfi et al. 2004; Alcindor and
Beauger 2011).
Oxaliplatin causes cell death through DNA-platinum adducts, which trigger massive apoptosis (Faivre, Chan et al. 2003). γ-H2AX, a marker of double-strand breaks and factor in DNA-repair process, is found to be induced by oxaliplatin via p53- dependent and -independent pathways (Chiu, Lee et al. 2009). The molecular mechanism of oxaliplatin action involves G/M arrest and apoptosis. G2/M arrest leads to reduction in both cyclin B1 expression and phosphorylated-CDC2 (Arango, Wilson et al.
2004; Chiu, Lee et al. 2009). Treatment of HCT116 colorectal cancer cells with oxaliplatin activates intrinsic-mediated apoptosis. Subsequently, there is caspase-3 activation followed by cellular apoptosis (Arango, Wilson et al. 2004). The cytotoxic effects of oxaliplatin are p53 status-dependent. One study demonstrated that p53 wild- 34 type cells, including HCT116 cells, are sensitive to oxaliplatin while p53-mutated cells are resistant to its action. Oxaliplatin effects are influenced by p21, a cyclin-dependent kinase inhibitor regulated by p53, gene status. Oxaliplatin strongly induces p21 expression and G0-G1 arrest in p53 wild-type cells (Hata, Yamamoto et al. 2005).
Oxaliplatin is also known to deactivate ERK, which induces PUMA (p53 up-regulated modulator of apoptosis), involved in apoptosis through the intrinsic pathway (Wang, Li et al. 2006). Oxaliplatin is also found to inhibit survivin expression, a protein that protects cell from apoptosis. Furthermore, the mechanism of reducing survivin expression is through p38 MAPK pathway. Oxaliplatin treatment causes activation and phosphorylation of p53, which in turn activates and phosphorylates p38 MAPK.
Phosphorylated p38 reduces survivin protein level to enhance oxaliplatin-induced cancer cell death (Liu, Hu et al. 2010; Sohn, Lee et al. 2010).
1.5.2 Phosphorylation of P68 by P38MAPK
The transmission of wide-array of extracellular stimuli to their intracellular targets is mediated through intracellular mitogen-activated protein kinase (MAPK) pathways.
MAPKs relay, amplify, and integrate these stimuli to produce required physiological responses, such as inflammation, cellular proliferation, and apoptosis (Rouse, Cohen et al. 1994). The MAPK-cascade consists of 3 canonical, parallel, serine/threonine-kinase cascades: (1) extracellular signal-regulated kinases (ERKs), (2) c-jun N-terminal or stress-activated protein kinases (JNK/SAPK), and (3) p38-group of protein kinases.
ERK promotes cellular proliferation and inhibit cell death. JNK and p38-MAPK promote cellular inflammation or programmed cell-death (Galcheva-Gargova, Derijard et al. 35
1994; Xia, Dickens et al. 1995). These MAPKs are expressed in all eukaryotic organisms in an inactive state (non-phosphorylated form). The MAPK pathway consists of three kinase cascades made up of Mitogen-activated protein kinase, Mitogen- activated protein kinase kinase and Mitogen-activated protein kinase kinase kinase.
Each MAPK is tightly regulated in the cells (Cobb and Goldsmith 1995).
P38 MAPK was first isolated after LPS stimulation (Han, Lee et al. 1993; Han,
Lee et al. 1994). P38 MAPK is activated by dual phosphorylation of two TGY motifs by upstream MAPKK-3 and MAPKK-5 in response to cellular stresses including proinflammatory cytokines, such as TNF-α, IL-1, heat shock, UV-irradiation, high osmotic stress, LPS, protein synthesis inhibitors such as anisomycin, arsenite, H2O2, anti-cancer drugs, such as cisplatin, oxaliplatin, and certain mitogens such as GM-CSF,
FGF etc (Raingeaud, Gupta et al. 1995; Jiang, Chen et al. 1996; Cuenda, Cohen et al.
1997; Jiang, Gram et al. 1997). Activated phosphorylated p38 is subsequently inactivated by dephosphorylation by protein phosphatase 2A, MAPK phosphatase etc
(Barancik, Htun et al. 1999; Lee, Kim et al. 2003; Levy-Nissenbaum, Sagi-Assif et al.
2003). There are four different isoforms of p38: α, β, γ and δ isoforms (Han, Lee et al.
1994; Lee, Laydon et al. 1994; Jiang, Chen et al. 1996; Lechner, Zahalka et al. 1996; Li,
Jiang et al. 1996; Cuenda, Cohen et al. 1997; Jiang, Gram et al. 1997; Kumar,
McDonnell et al. 1997; Enslen, Raingeaud et al. 1998). P38 α- and β-isoforms are found in all cell-types (Jiang, Chen et al. 1996) while γ and δ isoforms have a limited expression depending on the tissue type. The γ-isoform is mostly found in the skeletal muscle cells (Lechner, Zahalka et al. 1996; Li, Jiang et al. 1996; Jiang, Gram et al. 36
1997) whereas the δ-isoform is found in the small intestine, lungs, kidneys, testis, and pancreas (Jiang, Gram et al. 1997; Kumar, McDonnell et al. 1997).
P38α is belongs to the p38 MAPK family. Activated p-p38α MAPK phosphorylates and activates a number of downstream targets, notably protein kinases such as MNK1 (Fukunaga and Hunter 1997; Waskiewicz, Flynn et al. 1997), p38 regulated/activated kinase (PRAK) (New, Jiang et al. 1998), or Mitogen-and stress– activated protein kinase-1 (MSK1) (Deak, Clifton et al. 1998), transcription factors, such as SRF accessory protein (Sap1) (Janknecht and Hunter 1997), growth arrest and
DNA-damage inducible gene 153 (CHOP) (Wang and Ron 1996), activating transcription factor (ATF-1/2/6) (Tan, Rouse et al. 1996), p53 (Huang, Ma et al. 1999), myocyte enhance factor 2C (MEF2C) (Han, Jiang et al. 1997), and high-mobility group- box protein 1 (HBP1) (Yee, Paulson et al. 2004). Other p38 substrates include cPLA2
(Kramer, Roberts et al. 1996), tau (Reynolds, Nebreda et al. 1997), keratin 8 (Feng,
Zhou et al. 1999), and stathmin (Parker, Hunt et al. 1998).
P38 plays important roles in differentiation, apoptosis, inflammation, development, and cell cycle. P38 is found to be activated by a number of anti-cancer agents to trigger apoptosis. Treatment of Rat-1 cells with cisplatin induces p38 phosphorylation which leads to heat-shock protein 27 phosphorylation and subsequent apoptosis (Deschesnes, Huot et al. 2001). Retinoid CD437 induces extensive p38- mediated apoptosis in CA-OV-3 ovarian carcinoma cells (Holmes, Soprano et al. 2003).
P38 is also known to participate in G1 and G2/M cell cycle phases (Takenaka,
Moriguchi et al. 1998; Wang, McGowan et al. 2000). Activation of p38 is required for
Cdc-42 induced G1 arrest in the NIH3T3 cells (Wang, McGowan et al. 2000). 37
Furthermore, G2 cell cycle arrest induced by UV light is p38-dependent (Wang, Huang et al. 1998). P38 is implicated in cellular differentiation such as differentiation into adipocytes, cardiomyocytes, chondroblasts, erthyroblasts, myoblasts and neurons
(Nebreda and Porras 2000). Specifically, p38 is essential for the differentiation of PC12 cells into neuronal cells, mouse 3T3-L1 cells into adipocytes, and SKT6 cells into haemoglobinised cells (Engelman, Lisanti et al. 1998; Nagata, Takahashi et al. 1998; Li,
Jiang et al. 2000). P38 involvement in senescence is also reported (Bulavin, Demidov et al. 2002; Haq, Brenton et al. 2002; Wang, Chen et al. 2002). P38 has also been associated with tumorigenesis in certain cells. One study demonstrated that decreased activation of p38 in tumors results in increased proliferation and tumorigenic conversion of the cells (Brancho, Tanaka et al. 2003). P38 is also implicated in placental angiogenesis and erythropoiesis suggesting the differential role of p38 in development
(Nagata and Todokoro 1999; Mudgett, Ding et al. 2000). P38 is also implicated in inflammation and is associated with diseases such as Rheumatoid arthritis, Alzheimer’s disease, and inflammatory bowel disease (Perregaux, Dean et al. 1995; Johnson and
Bailey 2003; Hollenbach, Neumann et al. 2004).
In vitro studies carried out by Yang et al showed that p68 is a cellular target of p38 (Yang, Lin et al. 2005). They observed threonine phosphorylation of p68 following
TNF-α treatment which was inhibited with the exposure to increasing concentrations of
SB203580. SB203580 is a pyridinyl imidazole inhibitor that inhibits the phosphorylation and the activation of p38 (Cuenda, Rouse et al. 1995). In vitro kinase assay also demonstrated that p68 is phosphorylated by p38. All these results confirm the p68 threonine phosphorylation. This is in consistence with the fact that p38 usually 38 phosphorylates and activates transcription factors and protein kinases and p68 is a well known transcriptional co-activator. However, whether p38 phosphorylates p68 in vivo and the biological consequence of this phosphorylation is still unknown and warrants further investigation.
1.6 CYTOSKELETON
Cytoskeleton is an interconnected, dynamic, and adaptive filamentous network of polymeric proteins that regulate cell structure, shape, and function (Fletcher and Mullins
2010). It consists of F-actin, microtubules, and intermediate filaments which are in turn made up of chemically distinct subunits, actin, tubulin, and intermediate protein (Janmey
1998). Cytoskeleton integrates the activity of these proteins to carry out three main functions of sensing extracellular stimuli to respond to transmembrane receptors and intracellular signals, organizing the contents of the cell spatially and modulating the mechanical properties of the cell required for locomotion and cytokinesis (Condeelis
1993; Cornet, Ubl et al. 1993; Stossel 1994; Fishkind and Wang 1995). The cytoskeletal network generates forces that provide scaffolding on which molecular motors move organelles or generate internal stress. There are many regulatory proteins that control the cytoskeletal network formed by the polymers.
1.6.1 Actin
Actin is the most highly expressed protein in the eukaryotic cells and is composed of actin monomers. It is composed of three main actin isoforms: α-isoforms of skeletal, cardiac, and smooth muscles and β- and γ-isoforms of nonmuscle and 39 muscle cells. It is highly conserved and can transit between monomeric and filamentous states and associate with actin-binding proteins (Herman 1993; Dominguez and Holmes
2011). Bundles of actin filaments give support to filopodia essential during chemotaxis, cell motility, and cell-cell communication and provide polarity to the regulation of transcription (Dominguez and Holmes 2011).
1.6.2 Intermediate Filaments
Intermediate filaments belong to a class of cytoskeletal proteins that have an average diameter of 10 nm. They get their name from their diameter as their average diameter is between those of actin (7 nm) and microtubules (25 nm) (Ishikawa, Bischoff et al. 1968). They are mostly cytoplasmic with one exception of lamins that are nuclear.
Intermediate filaments are present only in multinuclear eukaryotes whereas actins and microtubules are expressed in eukaryotic and prokaryotic organisms (Erber, Riemer et al. 1998). There are atleast 65 functional genes encoding intermediate filament proteins
(Hesse, Magin et al. 2001). They are classified into 6 types: from type I to type VI.
Intermediate proteins contain α-helix rod domain and have a coiled-coil structure (Fuchs and Cleveland 1998; Herrmann, Hesse et al. 2003). A protein called plectin links intermediate filaments to each other as well as to actin and microtubules (Wiche 1998).
Keratins help the cells to resist shear stress while lamins provide mechanical strength to the nucleus and trigger nuclear membrane breakdown at the beginning of mitosis.
However, intermediate filaments cannot provide directional movement of molecular motors as they are not polarized (Tsai, Wang et al. 2006; Flitney, Kuczmarski et al.
2009). 40
1.6.3 Microtubules
Microtubules are filamentous, tubulin-containing proteins representing important part of the cytoskeleton. Microtubules are made up of α- and β- tubulins that can grow as long as 25 μm and are highly dynamic. They are involved in maintaining cell shape and structure, in the vesicular and mitochondrial transport, in the formation of spindle during mitosis and cell division and in cell signaling (Jordan and Wilson 2004).
Dynamics of microtubule polymerization are tightly regulated and many regulatory proteins such as microtubule-associated proteins (kinesin, dynein, katanin) bind to microtubules for regulating microtubule dynamics. The functional diversity of microtubules is also regulated by the expression and functions of different tubulin isoforms, and several modifications of tubulin at the post-translational level including polyglutamylation, polyglycylation, phosphorylation, and acetylation (Desai and
Mitchison 1997; Luduena 1998; Verdier-Pinard, Wang et al. 2003).
Microtubule nucleus is generated by α- and β- tubulin heterodimers which is extended by polymerization of tubulin dimers end to end to form a cylinder. This cylinder has 13 protofilaments of tubulin heterodimers. Protofilaments form the building block of the microtubule structure which can be extended by the addition of more protofilaments.
Microtubules have a distinct polarity with α-subunit [designated (-) minus end] of one tubulin dimer linked to the β-subunit [designated (+) plus end] of the next dimer. (Jordan and Wilson 2004) (Desai and Mitchison 1997).
41
1.7 TPPP/P25
TPPP/p25 (Tubulin polymerization promoting protein/p25), also known as p25α, is a small, basic, heat resistant, 219 amino-acid containing protein. It was initially purified from bovine brain in tau protein kinase II (TPKII) fraction (Takahashi, Tomizawa et al. 1991). TPPP/p25 is evolutionary conserved among mammalian species with the human homolog of TPPP/p25 sharing 90% homology with bovine TPPP/p25. TPPP/p25 is located on chromosome 5 (Seki, Hattori et al. 1999). It is found only in animals but not in prokaryotes, plants and fungi (Orosz and Ovadi 2008). It is a newly discovered tubulin targeting protein and functionally, it closely resembles the characteristics of microtubule- associated proteins (MAPs) by binding to tubulin (Hlavanda, Kovacs et al. 2002).
TPPP/p25 is also called as p25α because it binds to α-synuclein, a protein that accumulates as insoluble aggregate in cytoplasmic inclusions in Parkinson’s disease and other α-synucleinopathies (Gai, Power et al. 1999; Lindersson, Lundvig et al. 2005).
It is also described as p24 due to its function as a glycogen synthase kinase-3 inhibitor
(Martin, Vazquez et al. 2002).
1.7.1 Structure and Expression
TPPP/p25 has a α-helical content of 4% as against the predicted values of 30-
43% (Hlavanda, Kovacs et al. 2002). It is natively folded under physiological conditions but has a flexible structure that unfolds co-operatively under equilibrium conditions
(Otzen, Lundvig et al. 2005). However, there is a disagreement about the structure of
TPPP/p25 with another group reporting that TPPP/p25 is an unfolded protein. It has a well defined 3D structure only when it is associated with specific binding proteins such 42 as chaperones (Hlavanda, Kovacs et al. 2002; Tirian, Hlavanda et al. 2003; Orosz,
Kovacs et al. 2004). It shows an abundance of “disorder promoting amino-acids” such as Q,S,P,E,K,A,R,G but does not contain “order promoting amino-acids” such as
W,C,F,I,Y,L,N,V. TPPP/P25 has an N-terminal region which is disordered, consisting of
50 amino-acids followed by a highly flexible ordered core of 40 residues consisting of β- structure. TPPP/p25 is not very hydrophobic and has a high net charge with a pI of 9.5
(Orosz, Kovacs et al. 2004).
There are two shorter homologs of TPPP/p25 with which it shares roughly 60-
75% homology. They are TPPP/p18 consisting of 170 amino-acids with the gene name p25β and TPPP/p20 consisting of 176 amino-acids and having the gene name CGI-38.
TPPP/p18 and TPPP/p20 lack the unstructured N-terminal region (from 3-43) of
TPPP/p25 and demonstrate extensive homology in the middle and C-terminal regions including the conserved Rossmann motif GXGXXG (Shiratsuchi, Sato et al. 1995; Seki,
Hattori et al. 1999; Zhang, Wu et al. 2002; Vincze, Tokesi et al. 2006). TPPP/p18 is more ordered and shares 57% identity with TPPP/p25 with high expression in the liver and pancreas and is moderately expressed in the heart, kidney and skeletal muscle.
Interestingly, its transcript is detected only in the fetal brain. It is also detected only in breast carcinoma, pancreas adenocarcinoma and occasionally, colon adenocarcinoma
(Zhang, Wu et al. 2002). TPPP/p18 is distributed homogenously in the cytoplasm. It is more ordered and does not crosslink microtubules like TPPP/p25 implying that
TPPP/p18 does not influence microtubule network. TPPP/p20, on the other hand, behaves like a disorganized protein and has a very high microtubule bundling ability
(Vincze, Tokesi et al. 2006). 43
TPPP/p25 was first detected in the bovine brain specifically in the oligodendrocytes of the nervous tissue (Takahashi, Tomizawa et al. 1991; Takahashi,
Tomizawa et al. 1993; Kovacs, Laszlo et al. 2004). Rat brain homogenates showed that
TPPP/p25 expression begins to be detectable on E20 (embryonic day 20) in myelinating oligodendrocytes and gradually increases in the brain from 1-2 years of age to adulthood (Skjoerringe, Lundvig et al. 2006). However, Seki et al. demonstrated that
TPPP/p25 mRNA is found in various tissues (Seki, Hattori et al. 1999). Acevedo et al showed that TPPP/p25 is not exclusively expressed in the brain inspite of its high expression in the brain. They detected TPPP/p25 expression in the liver, lung and heart tissue extracts. Immunoblot analysis revealed high expression in the brain, testis, heart, skeletal muscle, and eyes (Table 1.1) (Acevedo, Li et al. 2007). In the mouse brain, specifically, TPPP/p25 is found in the oligodendrocytes and in the axons of myelinated neurons of the white matter of the cerebellum and nuclei of the granule cells of the cerebellum. TPPP/p25 is also found in the neuroglia and the neuropil and pyramidal neurons of the cerebral cortex. However, it is not expressed in the hippocampus
(Acevedo, Li et al. 2007). TPPP/p25 gene is not present in the non-ciliated organisms but is conserved in the ciliated organisms. In these ciliated organisms, TPPP/p25 could be involved in the motile or sensory functions of the cilia/basal bodies. Basal bodies are the microtubule rich cellular elements that resemble centrioles (microtubule organizing centers, MTOC). Very high concentration of TPPP/p25 is seen in the MTOC and cytokinetic cleavage furrow suggesting the TPPP/p25 involvement in the cell cycle process (Orosz and Ovadi 2008). 44
At the subcellular level, nuclear and cytoplasmic localization of TPPP is observed in the cells such as HUVEC, HeLa and NIH3T3 and it co-localizes specifically with the stabilized microtubules in the cytoplasm. However, in the migratory cells, it is detected only in the cytoplasm co-localized with the microtubules and around the nucleus
(Acevedo, Li et al. 2007). Over-expression of TPPP/p25 causes dramatic changes in the cellular morphology and leads to the formation of two major types of structures: the aggresome and the perinuclear cage observed in pathological brain tissues. The nucleus becomes bi- or multilobed in highly expressing cells with a bright aggregate of the protein and a dense network of disordered bundles of microtubules and intermediate filaments interdispersed with small cisternae of RER. These round juxtanuclear bodies are called aggresomes which are pathological inclusion like structures observed near the microtubule-organizing center (MTOC). Such superstructures (aggresome/inclusion body) may either lead to cell death or provide cytoprotecting mechanism evading cell death (Lehotzky, Tirian et al. 2004).
1.8 FUNCTIONS OF TPPP/P25
1.8.1 Cellular Functions of TPPP/p25
Tubulin/microtubule system is the main target of TPPP/p25. Brain extract harboring increased TPPP/p25 protein levels demonstrated increased tubulin polymerization activity in comparison to the muscle extract which did not exhibit any activity while neuroblastoma cells showed ~10 fold lesser activity in comparison to the brain extract (Hlavanda, Kovacs et al. 2002; Tirian, Hlavanda et al. 2003). The C- terminal has a segment that is also present in the protein tau which is the tubulin 45 binding region of tau and consequently, may also be the region where TPPP/p25 binds to tubulin (Himmler, Drechsel et al. 1989; Lee, Neve et al. 1989; Hlavanda, Klement et al. 2007). TPPP/p25 binds to both tubulin and microtubules in vitro and in the cells and perturbs the physiological tubulin assemblies and microtubular ultrastructures. In vitro binding of TPPP/p25 to tubulin, most probably, tubulin dimers influences microtubule assembly by promoting the formation of tubulin assemblies while binding to microtubules alters microtubule ultrastructures by inducing strong bundling of microtubules. TPPP/p25, at substoichiometric concentration, interacts with tubulin to cause its polymerization into intact-like microtubules, polymorphic aggregates, and bundling of paclitaxel stabilized microtubules (Hlavanda, Kovacs et al. 2002; Tirian,
Hlavanda et al. 2003).
At low expression levels in the eukaryotic cells, TPPP/p25 co-localizes with the microtubule network maintaining its physiological integrity. This co-localization is dynamic and alters during mitosis without affecting the cell cycle process. TPPP/p25 also causes bundling of microtubules in the eukaryotic cells similar to that observed in in vitro studies and the bundled microtubules counteract and resist the destabilizing function of vinblastine, a specific microtubule destabilizing agent. The stabilization of microtubule filaments/bundles mediated by TPPP/p25 denotes the basic physiological function of TPPP/p25 to strike a balance between stabilization of microtubules and their polymerization dynamics which, in fact, could play an important role during oligodendrocyte differentiation. This microtubule specific function of TPPP/p25 along with its interaction suggests that it is a microtubule associated protein (MAP) like tau protein (Lehotzky, Tirian et al. 2004). In contrast, high expression levels of TPPP/p25 46 are observed in the pathological conditions. Overexpression of TPPP/p25 rearranges microtubule network into aggresome like structure consisting of TPPP/p25 accumulation around the centrosome, protruding into the nucleus and perinuclear cage consisting of
TPPP/p25 forming a filamentous cage of microtubules surrounding the nucleus. These aberrant structures interfere with the intracellular transport processes, inhibiting cell division and ultimately, leading to cell death (Lehotzky, Tirian et al. 2004). In fact, introduction of bovine TPPP/p25 into Drosophila embryos blocks formation of mitotic spindles and breakdown of nuclear envelop during mitosis without affecting centrosome duplication and separation, nucleation of microtubules, and nuclear growth (Hlavanda,
Kovacs et al. 2002). However, GTP can modulate and inhibit the interaction of tubulin and TPPP/p25, thereby, inhibiting TPPP/p25-induced tubulin polymerization. GTP interacts with tubulin and serves as a main regulator of microtubules in brain. In addition, TPPP/p25 has GTP binding motifs and Mg2+ dependent GTPase-activity by virtue of which it specifically hydrolyzes GTP suggesting its potential role in different physiological processes (Hlavanda, Kovacs et al. 2002; Tirian, Hlavanda et al. 2003;
Zotter, Bodor et al. 2011).
Studies by Acevedo et al showed that TPPP/p25 functions in the stabilization and maintainence of the integrity of the microtubular network. They found that reduction of
TPPP/p25 by siRNA decreases acetylated tubulin and also reduces microtubule concentration affecting the ultrastructure of the microtubule network. They also found that cells stably expressing TPPP/p25 are larger in size as a consequence of greater amount of acetylated microtubules. Thus, down-regulation of TPPP/p25 decreases microtubule levels while overexpression increases stable microtubules and cell size 47
(Acevedo, Li et al. 2007). The mechanism by which TPPP/p25 enhances tubulin acetylation involves inhibition of HDAC6 which is an enzyme responsible for tubulin deacetylation. TPPP/p25 interacts with HDAC6 and inhibits its deacetylase activity and in turn promotes acetylation of the microtubule network. However, stabilization of microtubules by TPPP/p25 cannot be completely attributed to tubulin acetylation alone but also to its bundling activity (Tokesi, Lehotzky et al. 2010). TPPP/p25 decreases the growth of microtubule plus ends thereby influencing microtubule derived cell motility.
However, the precise mechanism by which it affects the cell motility is not known
(Tokesi, Lehotzky et al. 2010).
Phosphorylation of TPPP/p25 prevents microtubule assembly (Hlavanda, Kovacs et al. 2002; Tirian, Hlavanda et al. 2003; Acevedo, Li et al. 2007). Phosphorylation of
TPPP/p25 specifically in its N-terminal region dramatically affects its tubulin polymerization ability leading to the formation of only aberrant microtubules (Hlavanda,
Kovacs et al. 2002; Tirian, Hlavanda et al. 2003). LIMK1 phosphorylates TPPP/p25 to affect its ability to promote polymerization of tubulin resulting in microtubule-dissembly
(Acevedo, Li et al. 2007). ERK2 and Cdk5-mediated phosphorylation also blocks tubulin assembly mediated by TPPP/p25. Phosphorylation causes some structural changes in the tubulin binding interface of TPPP/p25 due to which it is unable to induce appropriate conformation required for the tubulin assembly into microtubules (Hlavanda, Klement et al. 2007).
48
1.8.2 Role of TPPP/p25 in Differentiation
TPPP/p25 was first found to be expressed in the oligodendrocytes of most regions of the adult brain as a tubulin binding protein (Takahashi, Tomizawa et al. 1991;
Takahashi, Tomizawa et al. 1993; Vincze, Tokesi et al. 2006). Oligodendrocytes are a type of brain cells required for axon and myelin sheath development that insulate the axons in the central nervous system (Baumann and Pham-Dinh 2001). They extend their filopodial processes to ensheath axons with myelin which consists mostly of lipids and some proteins. Myelin consists of myelin basic protein (MBP) as the main protein component during differentiation of oligodendrocytes (Hardy and Reynolds 1991; Schiff and Rosenbluth 1995; Akiyama, Ichinose et al. 2002). Oligodendrocyte progenitor cells give rise to pre-myelinating oligodendrocytes which in turn differentiate into myelin- forming oligodendrocytes with long, arborized, microtubule containing projections. Pre- myelinating oligodendrocytes do not express myelin proteins but express proteins like β-
IV-tubulin essential for the transport of myelin components (Barres and Raff 1994;
Trapp, Nishiyama et al. 1997; Terada, Kidd et al. 2005). TPPP/p25 is expressed by myelin-forming oligodendrocytes and thus, can be a marker of myelinating oligodendroglia. Oligodendrocyte progenitor cells show low expression of TPPP/p25 where it is confined to the centrosome and MTOC. It is upregulated during differentiation of oligodendrocyte progenitor cells to oligodendrocytes being found around the nucleus, in the cytoplasm and along the microtubules. It co-localizes with
MBP that is specifically expressed during oligodendrocyte differentiation (Goldbaum,
Jensen et al. 2008). TPPP/p25 knockdown by siRNA decreases oligodendrocyte differentiation (Lehotzky, Lau et al. 2010). In summary, TPPP/p25 expression during 49 differentiation and its interaction with tubulin before myelin development may be essential in the formation of tubulin-related processes and microtubule network required for transport of lipids and proteins for myelin formation in differentiating oligodendrocytes.
1.8.3 Involvement of TPPP/p25 in Different Diseases
TPPP/p25 is implicated in several neuro-degenerative diseases and could serve as a novel marker of alpha-synucleinopathies (Kovacs, Laszlo et al. 2004). Neuro- degenerative diseases are characterized by accumulation of proteinaceous aggregates of α-synuclein or hyperphosphorylated tau (Goedert, Spillantini et al. 1998; Goedert
2001). Accumulation of neuron-specific protein, α-synuclein is typical of neurodegenerative diseases such as alpha-synucleinopathies like Parkinson’s Disease
(PD), Multiple System Atrophy (MSA), Diffuse Lewy Body Disease (DLBD) etc
(Spillantini, Schmidt et al. 1997; Wakabayashi, Yoshimoto et al. 1998; Gai, Power et al.
1999). Tauopathies include progressive supranuclear palsy (PSP), Pick’s Disease
(PiD), corticobasal degeneration (CBD), Alzheimer’s Disease (AD) etc (Arai, Ikeda et al.
2001; Dickson 2009). TPPP/p25 is abnormally found in the degenerating oligodendrocytes and neurons in alpha-synucleinopathies and is identified as α- synuclein filament-binding protein. It binds to α-synuclein and participates in the tubulin- induced alpha-synuclein aggregation and fibril formation. This contributes to the degenerative process which is accompanied by cytoskeletal disruption including the microtubular system (Lindersson, Lundvig et al. 2005). In MSA, there is an altered expression of α-synuclein and α-synuclein is localized with TPPP/P25. TPPP/p25 and 50
α-synuclein are also detectable in the neuronal Lewy body inclusions of PD and Lewy body dementia (Lindersson, Lundvig et al. 2005). Unlike α-synuclein, TPPP/p25 is not linked with the phosphorylated tau and does not stimulate its aggregation in tauopathies including AD. However, high expression of TPPP/p25 is seen in the granules of granulovacuolar degeneration and is found deposited near the tau filaments in AD brain
(Kovacs, Laszlo et al. 2004).
Immunohistochemical analysis of oligodendroglial neoplasms such as oligodendroglioma, oligoastrocytoma, and central neurocytoma showed that these tumor cells lack TPPP/p25 expression. Absence of TPPP/p25 in these cells suggests that the brain tumor cells may either loose TPPP/p25 expression during histogenesis of oligodendroglial neoplasms or they may arise from TPPP/p25 immuno-negative progenitor cells (Preusser, Lehotzky et al. 2007). This shows that TPPP/p25 is not required for providing the tubulin-related processes or stabilization of microtubules in oligodendroglial neoplasms.
1.9 AIMS AND SIGNIFICANCES OF THE DISSERTATION
The purpose of this dissertation is to characterize the functional role of threonine phosphorylation of p68 and study the transcriptional regulation function of p68 in regulating the cytoskeletal gene, TPPP.
P68 RNA helicase is involved in several cellular processes from pre-mRNA splicing, transcription etc. to cell proliferation and differentiation (Liu 2002) (Endoh,
Maruyama et al. 1999) (Stevenson, Hamilton et al. 1998). P68 is also found to be overexpressed in colon cancer (Causevic, Hislop et al. 2001). Previous studies 51 demonstrated phosphorylation of p68 at several residues (Yang and Liu 2004). P68 is tyrosine-phosphorylated in several cancer cells (Yang, Lin et al. 2005). PDGF- stimulation of HT-29 cells lead to tyrosine phosphorylation of p68 at Y593 by c-abl
(Yang and Liu 2006). Also, studies by Yang et al. showed that TNF-α treatment of HeLa cells phosphorylates p68 at threonine and dephosphorylates p68 at tyrosine residues indicating that TNF-α treatment reciprocally regulates the threonine and tyrosine phosphorylations of p68 (Yang, Lin et al. 2005). All these studies imply that p68 is a pleiotrophic protein that has different biological roles in multiple cellular pathways and that phosphorylation of p68 regulates the enzymatic activity and cellular functions of p68 in different pathways in response to different external stimuli. In this dissertation study, we found that p68 gets phosphorylated at threonine residue(s) (T564 and/or 446) under the treatment of anti-cancer drug oxaliplatin in colon cancer cells. The protein is phosphorylated by p38 MAP-kinase upon the drug treatment. Further characterization of the role of threonine phosphorylation of p68 showed that it mediates, at least partially, the effects of the drug on apoptosis induction. Thus, the phosphorylation of p68, effect of phosphorylation on its cellular function, and the signaling pathway causing the phosphorylation are studied. This study shows an important mechanism of action of the anti-cancer drug which could be used for improving cancer treatment.
The second part of the dissertation involves studying the role of p68 in the transcriptional regulation of TPPP. Numerous studies have shown that p68 functions as a transcriptional co-activator for a number of genes (Endoh, Maruyama et al. 1999).
Previous reports demonstrated that p68 may regulate the expression of several genes that regulate the stability and dynamics of different cytoskeletal elements. In this 52 dissertation, the involvement of p68 in regulating TPPP expression is characterized.
P68 is found to interact with the promoter region of TPPP and regulate its mRNA and protein expression. Control of TPPP expression by p68 is found to be an important event for neuronal differentiation. Expression of TPPP is important for cellular differentiation while its loss contributes to the development and progression of cancer.
Our studies reveal an important mechanism that is critical for cellular differentiation.
1.10 REFERENCES
hAbdelhaleem, M. (2005). "RNA helicases: regulators of differentiation." Clinical
biochemistry 38(6): 499-503.
Abelson, H. T. and L. S. Rabstein (1970). "Lymphosarcoma: virus-induced thymic-
independent disease in mice." Cancer research 30(8): 2213-2222.
Acevedo, K., R. Li, et al. (2007). "The phosphorylation of p25/TPPP by LIM kinase 1
inhibits its ability to assemble microtubules." Experimental cell research 313(20):
4091-4106.
Akileswaran, L., J. W. Taraska, et al. (2001). "A-kinase-anchoring protein AKAP95 is
targeted to the nuclear matrix and associates with p68 RNA helicase." The
Journal of biological chemistry 276(20): 17448-17454.
Akiyama, K., S. Ichinose, et al. (2002). "Study of expression of myelin basic proteins
(MBPs) in developing rat brain using a novel antibody reacting with four major
isoforms of MBP." Journal of neuroscience research 68(1): 19-28.
Alcindor, T. and N. Beauger (2011). "Oxaliplatin: a review in the era of molecularly
targeted therapy." Current oncology 18(1): 18-25. 53
Alkon, D. L. (1989). "Memory storage and neural systems." Scientific American 261(1):
42-50.
Ang, W. H., M. Myint, et al. (2010). "Transcription inhibition by platinum-DNA cross-links
in live mammalian cells." Journal of the American Chemical Society 132(21):
7429-7435.
Arai, T., K. Ikeda, et al. (2001). "Distinct isoforms of tau aggregated in neurons and glial
cells in brains of patients with Pick's disease, corticobasal degeneration and
progressive supranuclear palsy." Acta neuropathologica 101(2): 167-173.
Arango, D., A. J. Wilson, et al. (2004). "Molecular mechanisms of action and prediction
of response to oxaliplatin in colorectal cancer cells." British journal of cancer
91(11): 1931-1946.
Arias, J., A. S. Alberts, et al. (1994). "Activation of cAMP and mitogen responsive genes
relies on a common nuclear factor." Nature 370(6486): 226-229.
Ashendel, C. L. (1985). "The phorbol ester receptor: a phospholipid-regulated protein
kinase." Biochimica et biophysica acta 822(2): 219-242.
Barancik, M., P. Htun, et al. (1999). "Okadaic acid and anisomycin are protective and
stimulate the SAPK/JNK pathway." Journal of cardiovascular pharmacology
34(2): 182-190.
Barres, B. A. and M. C. Raff (1994). "Control of oligodendrocyte number in the
developing rat optic nerve." Neuron 12(5): 935-942.
Bates, G. J., S. M. Nicol, et al. (2005). "The DEAD-box protein p68: a novel
transcriptional coactivator of the p53 tumour suppressor." The EMBO journal
24(3): 543-553. 54
Baumann, N. and D. Pham-Dinh (2001). "Biology of oligodendrocyte and myelin in the
mammalian central nervous system." Physiological reviews 81(2): 871-927.
Baumeister, W., J. Walz, et al. (1998). "The proteasome: paradigm of a self-
compartmentalizing protease." Cell 92(3): 367-380.
Bennouna, J. and J. Y. Douillard (2002). "Therapeutic strategies for colorectal cancer in
Europe and the United States: focus on chemotherapy for advanced colorectal
cancer." International journal of clinical oncology / Japan Society of Clinical
Oncology 7(4): 236-244.
Blijham, G. H. (1991). "Chemotherapy of colorectal cancer." Anti-cancer drugs 2(3):
233-245.
Brabletz, T., A. Jung, et al. (2001). "Variable beta-catenin expression in colorectal
cancers indicates tumor progression driven by the tumor environment."
Proceedings of the National Academy of Sciences of the United States of
America 98(18): 10356-10361.
Brancho, D., N. Tanaka, et al. (2003). "Mechanism of p38 MAP-kinaseactivation in
vivo." Genes & development 17(16): 1969-1978.
Buelt, M. K., B. J. Glidden, et al. (1994). "Regulation of p68 RNA helicase by calmodulin
and protein kinase C." The Journal of biological chemistry 269(47): 29367-29370.
Bulavin, D. V., O. N. Demidov, et al. (2002). "Amplification of PPM1D in human tumors
abrogates p53 tumor-suppressor activity." Nature genetics 31(2): 210-215.
Buratowski, S., S. Hahn, et al. (1989). "Five intermediate complexes in transcription
initiation by RNA polymerase II." Cell 56(4): 549-561. 55
Buszczak, M. and A. C. Spradling (2006). "The Drosophila P68 RNA helicase regulates
transcriptional deactivation by promoting RNA release from chromatin." Genes &
development 20(8): 977-989.
Buyse, M., A. Zeleniuch-Jacquotte, et al. (1988). "Adjuvant therapy of colorectal cancer.
Why we still don't know." JAMA : the journal of the American Medical Association
259(24): 3571-3578.
Caenepeel, S., G. Charydczak, et al. (2004). "The mouse kinome: discovery and
comparative genomics of all mouse protein kinases." Proceedings of the National
Academy of Sciences of the United States of America 101(32): 11707-11712.
Caretti, G., R. L. Schiltz, et al. (2006). "The RNA helicases p68/p72 and the noncoding
RNA SRA are coregulators of MyoD and skeletal muscle differentiation."
Developmental cell 11(4): 547-560.
Carter, C. L., C. Lin, et al. (2010). "Phosphorylated p68 RNA helicase activates Snail1
transcription by promoting HDAC1 dissociation from the Snail1 promoter."
Oncogene 29(39): 5427-5436.
Caruthers, J. M., E. R. Johnson, et al. (2000). "Crystal structure of yeast initiation factor
4A, a DEAD-box RNA helicase." Proceedings of the National Academy of
Sciences of the United States of America 97(24): 13080-13085.
Causevic, M., R. G. Hislop, et al. (2001). "Over-expression and poly-ubiquitylation of the
DEAD-box RNA helicase p68 in colorectal tumours." Oncogene 20(53): 7734-
7743. 56
Cerda, S. R., M. Bissonnette, et al. (2001). "PKC-delta inhibits anchorage-dependent
and -independent growth, enhances differentiation, and increases apoptosis in
CaCo-2 cells." Gastroenterology 120(7): 1700-1712.
Chaney, S. G., S. L. Campbell, et al. (2005). "Recognition and processing of cisplatin-
and oxaliplatin-DNA adducts." Critical reviews in oncology/hematology 53(1): 3-
11.
Chiu, S. J., J. I. Chao, et al. (2008). "Regulation of gamma-H2AX and securin contribute
to apoptosis by oxaliplatin via a p38 mitogen-activated protein kinase-dependent
pathway in human colorectal cancer cells." Toxicology letters 179(2): 63-70.
Chiu, S. J., Y. J. Lee, et al. (2009). "Oxaliplatin-induced gamma-H2AX activation via
both p53-dependent and -independent pathways but is not associated with cell
cycle arrest in human colorectal cancer cells." Chemico-biological interactions
182(2-3): 173-182.
Cicchetti, P., B. J. Mayer, et al. (1992). "Identification of a protein that binds to the SH3
region of Abl and is similar to Bcr and GAP-rho." Science 257(5071): 803-806.
Clark, E. L., A. Coulson, et al. (2008). "The RNA helicase p68 is a novel androgen
receptor coactivator involved in splicing and is overexpressed in prostate
cancer." Cancer research 68(19): 7938-7946.
Cobb, M. H. and E. J. Goldsmith (1995). "How MAP kinases are regulated." The Journal
of biological chemistry 270(25): 14843-14846.
Coghlan, V. M., L. K. Langeberg, et al. (1994). "Cloning and characterization of AKAP
95, a nuclear protein that associates with the regulatory subunit of type II cAMP- 57
dependent protein kinase." The Journal of biological chemistry 269(10): 7658-
7665.
Cohen, G. B., R. Ren, et al. (1995). "Modular binding domains in signal transduction
proteins." Cell 80(2): 237-248.
Cohen, P. (2000). "The regulation of protein function by multisite phosphorylation--a 25
year update." Trends in biochemical sciences 25(12): 596-601.
Cohen, P. (2002). "The origins of protein phosphorylation." Nature cell biology 4(5):
E127-130.
Collas, P., K. Le Guellec, et al. (1999). "The A-kinase-anchoring protein AKAP95 is a
multivalent protein with a key role in chromatin condensation at mitosis." The
Journal of cell biology 147(6): 1167-1180.
Condeelis, J. (1993). "Life at the leading edge: the formation of cell protrusions." Annual
review of cell biology 9: 411-444.
Cornet, M., J. Ubl, et al. (1993). "Cytoskeleton and ion movements during volume
regulation in cultured PC12 cells." The Journal of membrane biology 133(2): 161-
170.
Crawford, L., K. Leppard, et al. (1982). "Cellular proteins reactive with monoclonal
antibodies directed against simian virus 40 T-antigen." Journal of virology 42(2):
612-620.
Cuenda, A., P. Cohen, et al. (1997). "Activation of stress-activated protein kinase-3
(SAPK3) by cytokines and cellular stresses is mediated via SAPKK3 (MKK6);
comparison of the specificities of SAPK3 and SAPK2 (RK/p38)." The EMBO
journal 16(2): 295-305. 58
Cuenda, A., J. Rouse, et al. (1995). "SB 203580 is a specific inhibitor of a MAP kinase
homologue which is stimulated by cellular stresses and interleukin-1." FEBS
letters 364(2): 229-233.
Cunningham, D., W. Atkin, et al. (2010). "Colorectal cancer." Lancet 375(9719): 1030-
1047.
Cutler, R. E., Jr., E. T. Maizels, et al. (1993). "Regulation of delta protein kinase C
during rat ovarian differentiation." Biochimica et biophysica acta 1179(3): 260-
270.
De Benedetti, A. (2009). "Tousled kinase TLK1B counteracts the effect of Asf1 in
inhibition of histone H3-H4 tetramer formation." BMC research notes 2: 128.
De Chiara, G., M. E. Marcocci, et al. (2006). "Bcl-2 Phosphorylation by p38 MAPK:
identification of target sites and biologic consequences." The Journal of biological
chemistry 281(30): 21353-21361. de Lau, W., N. Barker, et al. (2007). "WNT signaling in the normal intestine and
colorectal cancer." Frontiers in bioscience : a journal and virtual library 12: 471-
491.
Deak, M., A. D. Clifton, et al. (1998). "Mitogen- and stress-activated protein kinase-1
(MSK1) is directly activated by MAPK and SAPK2/p38, and may mediate
activation of CREB." The EMBO journal 17(15): 4426-4441.
Desai, A. and T. J. Mitchison (1997). "Microtubule polymerization dynamics." Annual
review of cell and developmental biology 13: 83-117. 59
Deschesnes, R. G., J. Huot, et al. (2001). "Involvement of p38 in apoptosis-associated
membrane blebbing and nuclear condensation." Molecular biology of the cell
12(6): 1569-1582.
Di Francesco, A. M., A. Ruggiero, et al. (2002). "Cellular and molecular aspects of drugs
of the future: oxaliplatin." Cellular and molecular life sciences : CMLS 59(11):
1914-1927.
Dickson, D. W. (2009). "Neuropathology of non-Alzheimer degenerative disorders."
International journal of clinical and experimental pathology 3(1): 1-23.
Diskin, R., N. Askari, et al. (2004). "Active mutants of the human p38alpha mitogen-
activated protein kinase." The Journal of biological chemistry 279(45): 47040-
47049.
Dominguez, R. and K. C. Holmes (2011). "Actin structure and function." Annual review
of biophysics 40: 169-186.
Donzelli, E., M. Carfi, et al. (2004). "Neurotoxicity of platinum compounds: comparison
of the effects of cisplatin and oxaliplatin on the human neuroblastoma cell line
SH-SY5Y." Journal of neuro-oncology 67(1-2): 65-73.
Dubey, P., R. C. Hendrickson, et al. (1997). "The immunodominant antigen of an
ultraviolet-induced regressor tumor is generated by a somatic point mutation in
the DEAD-box helicase p68." The Journal of experimental medicine 185(4): 695-
705.
Eder, A. M., X. Sui, et al. (2005). "Atypical PKCiota contributes to poor prognosis
through loss of apical-basal polarity and cyclin E over-expression in ovarian 60
cancer." Proceedings of the National Academy of Sciences of the United States
of America 102(35): 12519-12524.
Endoh, H., K. Maruyama, et al. (1999). "Purification and identification of p68 RNA
helicase acting as a transcriptional coactivator specific for the activation function
1 of human estrogen receptor alpha." Molecular and cellular biology 19(8): 5363-
5372.
Engelman, J. A., M. P. Lisanti, et al. (1998). "Specific inhibitors of p38 mitogen-activated
protein kinase block 3T3-L1 adipogenesis." The Journal of biological chemistry
273(48): 32111-32120.
Enslen, H., J. Raingeaud, et al. (1998). "Selective activation of p38 mitogen-activated
protein (MAP) kinase isoforms by the MAP kinase kinases MKK3 and MKK6."
The Journal of biological chemistry 273(3): 1741-1748.
Erber, A., D. Riemer, et al. (1998). "Molecular phylogeny of metazoan intermediate
filament proteins." Journal of molecular evolution 47(6): 751-762.
Faivre, S., D. Chan, et al. (2003). "DNA strand breaks and apoptosis induced by
oxaliplatin in cancer cells." Biochemical pharmacology 66(2): 225-237.
Faivre, S., T. Le Chevalier, et al. (2002). "Phase I-II and pharmacokinetic study of
gemcitabine combined with oxaliplatin in patients with advanced non-small-cell
lung cancer and ovarian carcinoma." Annals of oncology : official journal of the
European Society for Medical Oncology / ESMO 13(9): 1479-1489.
Feng, L., X. Zhou, et al. (1999). "Pervanadate-mediated tyrosine phosphorylation of
keratins 8 and 19 via a p38 mitogen-activated protein kinase-dependent
pathway." Journal of cell science 112 ( Pt 13): 2081-2090. 61
Fischel, J. L., P. Formento, et al. (2002). "Impact of the oxaliplatin-5 fluorouracil-folinic
acid combination on respective intracellular determinants of drug activity." British
journal of cancer 86(7): 1162-1168.
Fishkind, D. J. and Y. L. Wang (1995). "New horizons for cytokinesis." Current opinion
in cell biology 7(1): 23-31.
Fletcher, D. A. and R. D. Mullins (2010). "Cell mechanics and the cytoskeleton." Nature
463(7280): 485-492.
Flitney, E. W., E. R. Kuczmarski, et al. (2009). "Insights into the mechanical properties
of epithelial cells: the effects of shear stress on the assembly and remodeling of
keratin intermediate filaments." FASEB journal : official publication of the
Federation of American Societies for Experimental Biology 23(7): 2110-2119.
Ford, M. J., I. A. Anton, et al. (1988). "Nuclear protein with sequence homology to
translation initiation factor eIF-4A." Nature 332(6166): 736-738.
Fuchs, E. and D. W. Cleveland (1998). "A structural scaffolding of intermediate
filaments in health and disease." Science 279(5350): 514-519.
Fukuda, T., K. Yamagata, et al. (2007). "DEAD-box RNA helicase subunits of the
Drosha complex are required for processing of rRNA and a subset of
microRNAs." Nature cell biology 9(5): 604-611.
Fukunaga, R. and T. Hunter (1997). "MNK1, a new MAP kinase-activated protein
kinase, isolated by a novel expression screening method for identifying protein
kinase substrates." The EMBO journal 16(8): 1921-1933.
Fuller-Pace, F. V. (1994). "RNA helicases: modulators of RNA structure." Trends in cell
biology 4(8): 271-274. 62
Fuller-Pace, F. V. (2006). "DExD/H box RNA helicases: multifunctional proteins with
important roles in transcriptional regulation." Nucleic acids research 34(15):
4206-4215.
Fuller-Pace, F. V., A. M. Jacobs, et al. (2007). "Modulation of transcriptional activity of
the DEAD-box family of RNA helicases, p68 (Ddx5) and DP103 (Ddx20), by
SUMO modification." Biochemical Society transactions 35(Pt 6): 1427-1429.
Gai, W. P., J. H. Power, et al. (1999). "Alpha-synuclein immunoisolation of glial
inclusions from multiple system atrophy brain tissue reveals multiprotein
components." Journal of neurochemistry 73(5): 2093-2100.
Galcheva-Gargova, Z., B. Derijard, et al. (1994). "An osmosensing signal transduction
pathway in mammalian cells." Science 265(5173): 806-808.
Gatzka, M. and C. M. Walsh (2007). "Apoptotic signal transduction and T cell
tolerance." Autoimmunity 40(6): 442-452.
Gavrielides, M. V., A. F. Frijhoff, et al. (2004). "Protein kinase C and prostate
carcinogenesis: targeting the cell cycle and apoptotic mechanisms." Current drug
targets 5(5): 431-443.
Ghezzi, A., M. Aceto, et al. (2004). "Uptake of antitumor platinum(II)-complexes by
cancer cells, assayed by inductively coupled plasma mass spectrometry (ICP-
MS)." Journal of inorganic biochemistry 98(1): 73-78.
Ghosh, G. and G. D. Van Duyne (1996). "Pieces of the puzzle: assembling the
preinitiation complex of Pol II." Structure 4(8): 891-895.
Gill, G. (2004). "SUMO and ubiquitin in the nucleus: different functions, similar
mechanisms?" Genes & development 18(17): 2046-2059. 63
Goedert, M. (2001). "Alpha-synuclein and neurodegenerative diseases." Nature
reviews. Neuroscience 2(7): 492-501.
Goedert, M., M. G. Spillantini, et al. (1998). "Filamentous nerve cell inclusions in
neurodegenerative diseases." Current opinion in neurobiology 8(5): 619-632.
Goff, S. P., P. D'Eustachio, et al. (1982). "Chromosomal assignment of the endogenous
proto-oncogene C-abl." Science 218(4579): 1317-1319.
Goldbaum, O., P. H. Jensen, et al. (2008). "The expression of tubulin polymerization
promoting protein TPPP/p25alpha is developmentally regulated in cultured rat
brain oligodendrocytes and affected by proteolytic stress." Glia 56(16): 1736-
1746.
Gong, X., X. Ming, et al. (2010). "Mechanisms regulating the nuclear translocation of
p38 MAP kinase." Journal of cellular biochemistry 110(6): 1420-1429.
Gonzalez-Mejia, M. E., O. H. Voss, et al. (2010). "Apigenin-induced apoptosis of
leukemia cells is mediated by a bimodal and differentially regulated residue-
specific phosphorylation of heat-shock protein-27." Cell death & disease 1: e64.
Goodman, R. H. and S. Smolik (2000). "CBP/p300 in cell growth, transformation, and
development." Genes & development 14(13): 1553-1577.
Goodwin, R. A. and T. R. Asmis (2009). "Overview of systemic therapy for colorectal
cancer." Clinics in colon and rectal surgery 22(4): 251-256.
Gould, G. W., A. Cuenda, et al. (1995). "The activation of distinct mitogen-activated
protein kinase cascades is required for the stimulation of 2-deoxyglucose uptake
by interleukin-1 and insulin-like growth factor-1 in KB cells." The Biochemical
journal 311 ( Pt 3): 735-738. 64
Groth, A., J. Lukas, et al. (2003). "Human Tousled like kinases are targeted by an ATM-
and Chk1-dependent DNA damage checkpoint." The EMBO journal 22(7): 1676-
1687.
Grothey, A., D. Sargent, et al. (2004). "Survival of patients with advanced colorectal
cancer improves with the availability of fluorouracil-leucovorin, irinotecan, and
oxaliplatin in the course of treatment." Journal of clinical oncology : official journal
of the American Society of Clinical Oncology 22(7): 1209-1214.
Grothey, A. and H. J. Schmoll (2001). "New chemotherapy approaches in colorectal
cancer." Current opinion in oncology 13(4): 275-286.
Guil, S., R. Gattoni, et al. (2003). "Roles of hnRNP A1, SR proteins, and p68 helicase in
c-H-ras alternative splicing regulation." Molecular and cellular biology 23(8):
2927-2941.
Hah, S. S., R. A. Sumbad, et al. (2007). "Characterization of oxaliplatin-DNA adduct
formation in DNA and differentiation of cancer cell drug sensitivity at microdose
concentrations." Chemical research in toxicology 20(12): 1745-1751.
Hampsey, M. (1998). "Molecular genetics of the RNA polymerase II general
transcriptional machinery." Microbiology and molecular biology reviews : MMBR
62(2): 465-503.
Han, J., Y. Jiang, et al. (1997). "Activation of the transcription factor MEF2C by the MAP
kinase p38 in inflammation." Nature 386(6622): 296-299.
Han, J., J. D. Lee, et al. (1994). "A MAP kinase targeted by endotoxin and
hyperosmolarity in mammalian cells." Science 265(5173): 808-811. 65
Han, J., J. D. Lee, et al. (1993). "Endotoxin induces rapid protein tyrosine
phosphorylation in 70Z/3 cells expressing CD14." The Journal of biological
chemistry 268(33): 25009-25014.
Hanahan, D. and R. A. Weinberg (2000). "The hallmarks of cancer." Cell 100(1): 57-70.
Haq, R., J. D. Brenton, et al. (2002). "Constitutive p38HOG mitogen-activated protein
kinase activation induces permanent cell cycle arrest and senescence." Cancer
research 62(17): 5076-5082.
Hardy, R. and R. Reynolds (1991). "Proliferation and differentiation potential of rat
forebrain oligodendroglial progenitors both in vitro and in vivo." Development
111(4): 1061-1080.
Hata, T., H. Yamamoto, et al. (2005). "Role of p21waf1/cip1 in effects of oxaliplatin in
colorectal cancer cells." Molecular cancer therapeutics 4(10): 1585-1594.
Hay, R. T. (2005). "SUMO: a history of modification." Molecular cell 18(1): 1-12.
Herman, I. M. (1993). "Actin isoforms." Current opinion in cell biology 5(1): 48-55.
Herrmann, H., M. Hesse, et al. (2003). "Functional complexity of intermediate filament
cytoskeletons: from structure to assembly to gene ablation." International review
of cytology 223: 83-175.
Hershko, A., A. Ciechanover, et al. (1980). "Proposed role of ATP in protein breakdown:
conjugation of protein with multiple chains of the polypeptide of ATP-dependent
proteolysis." Proceedings of the National Academy of Sciences of the United
States of America 77(4): 1783-1786. 66
Hershko, A., H. Heller, et al. (1983). "Components of ubiquitin-protein ligase system.
Resolution, affinity purification, and role in protein breakdown." The Journal of
biological chemistry 258(13): 8206-8214.
Hesse, M., T. M. Magin, et al. (2001). "Genes for intermediate filament proteins and the
draft sequence of the human genome: novel keratin genes and a surprisingly
high number of pseudogenes related to keratin genes 8 and 18." Journal of cell
science 114(Pt 14): 2569-2575.
Himmler, A., D. Drechsel, et al. (1989). "Tau consists of a set of proteins with repeated
C-terminal microtubule-binding domains and variable N-terminal domains."
Molecular and cellular biology 9(4): 1381-1388.
Hlavanda, E., E. Klement, et al. (2007). "Phosphorylation blocks the activity of tubulin
polymerization-promoting protein (TPPP): identification of sites targeted by
different kinases." The Journal of biological chemistry 282(40): 29531-29539.
Hlavanda, E., J. Kovacs, et al. (2002). "Brain-specific p25 protein binds to tubulin and
microtubules and induces aberrant microtubule assemblies at substoichiometric
concentrations." Biochemistry 41(27): 8657-8664.
Hloch, P., G. Schiedner, et al. (1990). "Complete cDNA sequence of the human p68
protein." Nucleic acids research 18(10): 3045.
Hollenbach, E., M. Neumann, et al. (2004). "Inhibition of p38 MAP kinase- and
RICK/NF-kappaB-signaling suppresses inflammatory bowel disease." FASEB
journal : official publication of the Federation of American Societies for
Experimental Biology 18(13): 1550-1552. 67
Holmes, W. F., D. R. Soprano, et al. (2003). "Early events in the induction of apoptosis
in ovarian carcinoma cells by CD437: activation of the p38 MAP-kinasesignal
pathway." Oncogene 22(41): 6377-6386.
Huang, C., W. Y. Ma, et al. (1999). "p38 kinase mediates UV-induced phosphorylation
of p53 protein at serine 389." The Journal of biological chemistry 274(18): 12229-
12235.
Huang, Y. and Z. R. Liu (2002). "The ATPase, RNA unwinding, and RNA binding
activities of recombinant p68 RNA helicase." The Journal of biological chemistry
277(15): 12810-12815.
Hunter, T. (2000). "Signaling--2000 and beyond." Cell 100(1): 113-127.
Hurwitz, H., L. Fehrenbacher, et al. (2004). "Bevacizumab plus irinotecan, fluorouracil,
and leucovorin for metastatic colorectal cancer." The New England journal of
medicine 350(23): 2335-2342.
Iggo, R., S. Picksley, et al. (1990). "Identification of a putative RNA helicase in E.coli."
Nucleic acids research 18(18): 5413-5417.
Iggo, R. D., D. J. Jamieson, et al. (1991). "p68 RNA helicase: identification of a
nucleolar form and cloning of related genes containing a conserved intron in
yeasts." Molecular and cellular biology 11(3): 1326-1333.
Iggo, R. D. and D. P. Lane (1989). "Nuclear protein p68 is an RNA-dependent ATPase."
The EMBO journal 8(6): 1827-1831.
Ishikawa, H., R. Bischoff, et al. (1968). "Mitosis and intermediate-sized filaments in
developing skeletal muscle." The Journal of cell biology 38(3): 538-555. 68
Jacobs, A. M., S. M. Nicol, et al. (2007). "SUMO modification of the DEAD-box protein
p68 modulates its transcriptional activity and promotes its interaction with
HDAC1." Oncogene 26(40): 5866-5876.
Jalal, C., H. Uhlmann-Schiffler, et al. (2007). "Redundant role of DEAD-box proteins p68
(Ddx5) and p72/p82 (Ddx17) in ribosome biogenesis and cell proliferation."
Nucleic acids research 35(11): 3590-3601.
Janknecht, R. (2002). "The versatile functions of the transcriptional coactivators p300
and CBP and their roles in disease." Histology and histopathology 17(2): 657-
668.
Janknecht, R. and T. Hunter (1997). "Convergence of MAP kinase pathways on the
ternary complex factor Sap-1a." The EMBO journal 16(7): 1620-1627.
Janmey, P. A. (1998). "The cytoskeleton and cell signaling: component localization and
mechanical coupling." Physiological reviews 78(3): 763-781.
Jiang, Y., C. Chen, et al. (1996). "Characterization of the structure and function of a new
mitogen-activated protein kinase (p38beta)." The Journal of biological chemistry
271(30): 17920-17926.
Jiang, Y., H. Gram, et al. (1997). "Characterization of the structure and function of the
fourth member of p38 group mitogen-activated protein kinases, p38delta." The
Journal of biological chemistry 272(48): 30122-30128.
Johnson, G. V. and C. D. Bailey (2003). "The p38 MAP-kinasesignaling pathway in
Alzheimer's disease." Experimental neurology 183(2): 263-268.
Jordan, M. A. and L. Wilson (2004). "Microtubules as a target for anticancer drugs."
Nature reviews. Cancer 4(4): 253-265. 69
Jost, J. P., S. Schwarz, et al. (1999). "A chicken embryo protein related to the
mammalian DEAD-box protein p68 is tightly associated with the highly purified
protein-RNA complex of 5-MeC-DNA glycosylase." Nucleic acids research
27(16): 3245-3252.
Jung, Y. and S. J. Lippard (2007). "Direct cellular responses to platinum-induced DNA
damage." Chemical reviews 107(5): 1387-1407.
Jurica, M. S. and M. J. Moore (2003). "Pre-mRNA splicing: awash in a sea of proteins."
Molecular cell 12(1): 5-14.
Kahlina, K., I. Goren, et al. (2004). "p68 DEAD-box RNA helicase expression in
keratinocytes. Regulation, nucleolar localization, and functional connection to
proliferation and vascular endothelial growth factor gene expression." The
Journal of biological chemistry 279(43): 44872-44882.
Kharbanda, S., P. Pandey, et al. (1997). "Functional interaction between DNA-PK and
c-Abl in response to DNA damage." Nature 386(6626): 732-735.
Kipreos, E. T. and J. Y. Wang (1992). "Cell cycle-regulated binding of c-Abl tyrosine
kinase to DNA." Science 256(5055): 382-385.
Kitamura, A., M. Nishizuka, et al. (2001). "Expression of p68 RNA helicase is closely
related to the early stage of adipocyte differentiation of mouse 3T3-L1 cells."
Biochemical and biophysical research communications 287(2): 435-439.
Kodym, R., C. Henockl, et al. (2005). "Identification of the human DEAD-box protein p68
as a substrate of Tlk1." Biochemical and biophysical research communications
333(2): 411-417. 70
Kovacs, G. G., L. Laszlo, et al. (2004). "Natively unfolded tubulin polymerization
promoting protein TPPP/p25 is a common marker of alpha-synucleinopathies."
Neurobiology of disease 17(2): 155-162.
Kramer, R. M., E. F. Roberts, et al. (1996). "p38 mitogen-activated protein kinase
phosphorylates cytosolic phospholipase A2 (cPLA2) in thrombin-stimulated
platelets. Evidence that proline-directed phosphorylation is not required for
mobilization of arachidonic acid by cPLA2." The Journal of biological chemistry
271(44): 27723-27729.
Krause, D. R., J. C. Jonnalagadda, et al. (2003). "Suppression of Tousled-like kinase
activity after DNA damage or replication block requires ATM, NBS1 and Chk1."
Oncogene 22(38): 5927-5937.
Krause, D. S. and R. A. Van Etten (2005). "Tyrosine kinases as targets for cancer
therapy." The New England journal of medicine 353(2): 172-187.
Krueger, G. M., L. L. Alexander, et al. (2006). "Arnoldus Goudsmit, MD, PhD:
chemotherapist, visionary, founder of the American Society of Clinical Oncology,
1909-2005." Journal of clinical oncology : official journal of the American Society
of Clinical Oncology 24(24): 4033-4036.
Kumar, S., P. C. McDonnell, et al. (1997). "Novel homologues of CSBP/p38 MAP
kinase: activation, substrate specificity and sensitivity to inhibition by pyridinyl
imidazoles." Biochemical and biophysical research communications 235(3): 533-
538.
Kwok, R. P., J. R. Lundblad, et al. (1994). "Nuclear protein CBP is a coactivator for the
transcription factor CREB." Nature 370(6486): 223-226. 71
Lahn, M., G. Kohler, et al. (2004). "Protein kinase C alpha expression in breast and
ovarian cancer." Oncology 67(1): 1-10.
Lane, D. P. and W. K. Hoeffler (1980). "SV40 large T shares an antigenic determinant
with a cellular protein of molecular weight 68,000." Nature 288(5787): 167-170.
Lanz, R. B., N. J. McKenna, et al. (1999). "A steroid receptor coactivator, SRA,
functions as an RNA and is present in an SRC-1 complex." Cell 97(1): 17-27.
Lechner, C., M. A. Zahalka, et al. (1996). "ERK6, a mitogen-activated protein kinase
involved in C2C12 myoblast differentiation." Proceedings of the National
Academy of Sciences of the United States of America 93(9): 4355-4359.
Lee, G., R. L. Neve, et al. (1989). "The microtubule binding domain of tau protein."
Neuron 2(6): 1615-1624.
Lee, J. C., J. T. Laydon, et al. (1994). "A protein kinase involved in the regulation of
inflammatory cytokine biosynthesis." Nature 372(6508): 739-746.
Lee, J. H., S. B. Rho, et al. (2005). "GABAA receptor-associated protein (GABARAP)
induces apoptosis by interacting with DEAD (Asp-Glu-Ala-Asp/His) box
polypeptide 47 (DDX 47)." Biotechnology letters 27(9): 623-628.
Lee, T., S. J. Kim, et al. (2003). "Role of PP2A in the regulation of p38 MAPK activation
in bovine aortic endothelial cells exposed to cyclic strain." Journal of cellular
physiology 194(3): 349-355.
Lehotzky, A., P. Lau, et al. (2010). "Tubulin polymerization-promoting protein
(TPPP/p25) is critical for oligodendrocyte differentiation." Glia 58(2): 157-168.
Lehotzky, A., L. Tirian, et al. (2004). "Dynamic targeting of microtubules by TPPP/p25
affects cell survival." Journal of cell science 117(Pt 25): 6249-6259. 72
Lemaire, L. and U. A. Heinlein (1993). "High-level expression in male germ cells of
murine P68 RNA helicase mRNA." Life sciences 52(11): 917-926.
Levy-Nissenbaum, O., O. Sagi-Assif, et al. (2003). "Over-expression of the dual-
specificity MAPK phosphatase PYST2 in acute leukemia." Cancer letters 199(2):
185-192.
Li, Y., B. Jiang, et al. (2000). "Myogenic differentiation requires signalling through both
phosphatidylinositol 3-kinase and p38 MAP kinase." Cellular signalling 12(11-12):
751-757.
Li, Z., Y. Jiang, et al. (1996). "The primary structure of p38 gamma: a new member of
p38 group of MAP kinases." Biochemical and biophysical research
communications 228(2): 334-340.
Lin, C., L. Yang, et al. (2005). "ATPase/helicase activities of p68 RNA helicase are
required for pre-mRNA splicing but not for assembly of the spliceosome."
Molecular and cellular biology 25(17): 7484-7493.
Linder, P., P. F. Lasko, et al. (1989). "Birth of the D-E-A-D box." Nature 337(6203): 121-
122.
Linder, P., N. K. Tanner, et al. (2001). "From RNA helicases to RNPases." Trends in
biochemical sciences 26(6): 339-341.
Lindersson, E., D. Lundvig, et al. (2005). "p25alpha Stimulates alpha-synuclein
aggregation and is co-localized with aggregated alpha-synuclein in alpha-
synucleinopathies." The Journal of biological chemistry 280(7): 5703-5715. 73
Liu, H. F., H. C. Hu, et al. (2010). "Oxaliplatin down-regulates survivin by p38 MAP-
kinaseand proteasome in human colon cancer cells." Chemico-biological
interactions 188(3): 535-545.
Liu, W. M., R. J. Liu, et al. (2010). "[GammaH2AX-mediated repair of DNA damaged
sperm in the zygote]." Zhonghua nan ke xue = National journal of andrology
16(4): 349-353.
Liu, Z. R. (2002). "p68 RNA helicase is an essential human splicing factor that acts at
the U1 snRNA-5' splice site duplex." Molecular and cellular biology 22(15): 5443-
5450.
Liu, Z. R., B. Sargueil, et al. (1998). "Detection of a novel ATP-dependent cross-linked
protein at the 5' splice site-U1 small nuclear RNA duplex by methylene blue-
mediated photo-cross-linking." Molecular and cellular biology 18(12): 6910-6920.
Lu, Q., T. F. Rau, et al. (2011). "Increased p38 mitogen-activated protein kinase
signaling is involved in the oxidative stress associated with oxygen and glucose
deprivation in neonatal hippocampal slice cultures." The European journal of
neuroscience 34(7): 1093-1101.
Luduena, R. F. (1998). "Multiple forms of tubulin: different gene products and covalent
modifications." International review of cytology 178: 207-275.
Mahajan, R., C. Delphin, et al. (1997). "A small ubiquitin-related polypeptide involved in
targeting RanGAP1 to nuclear pore complex protein RanBP2." Cell 88(1): 97-
107.
Manning, G., G. D. Plowman, et al. (2002). "Evolution of protein kinase signaling from
yeast to man." Trends in biochemical sciences 27(10): 514-520. 74
Manning, G., D. B. Whyte, et al. (2002). "The protein kinase complement of the human
genome." Science 298(5600): 1912-1934.
Martelli, A. M., I. Faenza, et al. (2003). "Nuclear protein kinase C isoforms: key players
in multiple cell functions?" Histology and histopathology 18(4): 1301-1312.
Martin, C. P., J. Vazquez, et al. (2002). "P24, a glycogen synthase kinase 3 (GSK 3)
inhibitor." Biochimica et biophysica acta 1586(1): 113-122.
Martinez, E. (2002). "Multi-protein complexes in eukaryotic gene transcription." Plant
molecular biology 50(6): 925-947.
Matsumoto, K., O. Y. Kwon, et al. (2005). "Expression of rck/p54, a DEAD-box RNA
helicase, in gametogenesis and early embryogenesis of mice." Developmental
dynamics : an official publication of the American Association of Anatomists
233(3): 1149-1156.
Matunis, M. J., E. Coutavas, et al. (1996). "A novel ubiquitin-like modification modulates
the partitioning of the Ran-GTPase-activating protein RanGAP1 between the
cytosol and the nuclear pore complex." The Journal of cell biology 135(6 Pt 1):
1457-1470.
Mauchley, D. C., D. C. Lynge, et al. (2005). "Clinical utility and cost-effectiveness of
routine preoperative computed tomography scanning in patients with colon
cancer." American journal of surgery 189(5): 512-517; discussion 517.
Melchior, F. (2000). "SUMO--nonclassical ubiquitin." Annual review of cell and
developmental biology 16: 591-626. 75
Metivier, R., G. Penot, et al. (2003). "Estrogen receptor-alpha directs ordered, cyclical,
and combinatorial recruitment of cofactors on a natural target promoter." Cell
115(6): 751-763.
Miao, Y. J. and J. Y. Wang (1996). "Binding of A/T-rich DNA by three high mobility
group-like domains in c-Abl tyrosine kinase." The Journal of biological chemistry
271(37): 22823-22830.
Mirabelli-Primdahl, L., R. Gryfe, et al. (1999). "Beta-catenin mutations are specific for
colorectal carcinomas with microsatellite instability but occur in endometrial
carcinomas irrespective of mutator pathway." Cancer research 59(14): 3346-
3351.
Misset, J. L., H. Bleiberg, et al. (2000). "Oxaliplatin clinical activity: a review." Critical
reviews in oncology/hematology 35(2): 75-93.
Mitchell, P. J. and R. Tjian (1989). "Transcriptional regulation in mammalian cells by
sequence-specific DNA binding proteins." Science 245(4916): 371-378.
Mooney, S. M., J. P. Grande, et al. (2010). "Sumoylation of p68 and p72 RNA helicases
affects protein stability and transactivation potential." Biochemistry 49(1): 1-10.
Mudgett, J. S., J. Ding, et al. (2000). "Essential role for p38alpha mitogen-activated
protein kinase in placental angiogenesis." Proceedings of the National Academy
of Sciences of the United States of America 97(19): 10454-10459.
Murray, N. R., G. P. Baumgardner, et al. (1993). "Protein kinase C isotypes in human
erythroleukemia (K562) cell proliferation and differentiation. Evidence that beta II
protein kinase C is required for proliferation." The Journal of biological chemistry
268(21): 15847-15853. 76
Nagata, Y., N. Takahashi, et al. (1998). "Activation of p38 MAP-kinaseand JNK but not
ERK is required for erythropoietin-induced erythroid differentiation." Blood 92(6):
1859-1869.
Nagata, Y. and K. Todokoro (1999). "Requirement of activation of JNK and p38 for
environmental stress-induced erythroid differentiation and apoptosis and of
inhibition of ERK for apoptosis." Blood 94(3): 853-863.
Nebreda, A. R. and A. Porras (2000). "p38 MAP kinases: beyond the stress response."
Trends in biochemical sciences 25(6): 257-260.
New, L. and J. Han (1998). "The p38 MAP-kinasepathway and its biological function."
Trends in cardiovascular medicine 8(5): 220-228.
New, L., Y. Jiang, et al. (1998). "PRAK, a novel protein kinase regulated by the p38
MAP kinase." The EMBO journal 17(12): 3372-3384.
Newton, A. C. (1995). "Protein kinase C: structure, function, and regulation." The
Journal of biological chemistry 270(48): 28495-28498.
Newton, A. C. (1997). "Regulation of protein kinase C." Current opinion in cell biology
9(2): 161-167.
Ni, H., M. Ergin, et al. (2003). "Protein kinase C-delta is commonly expressed in multiple
myeloma cells and its downregulation by rottlerin causes apoptosis." British
journal of haematology 121(6): 849-856.
Nikolov, D. B. and S. K. Burley (1997). "RNA polymerase II transcription initiation: a
structural view." Proceedings of the National Academy of Sciences of the United
States of America 94(1): 15-22. 77
Normanno, N., M. Di Maio, et al. (2005). "Mechanisms of endocrine resistance and
novel therapeutic strategies in breast cancer." Endocrine-related cancer 12(4):
721-747.
Ogbourne, S. and T. M. Antalis (1998). "Transcriptional control and the role of silencers
in transcriptional regulation in eukaryotes." The Biochemical journal 331 ( Pt 1):
1-14.
Olsen, J. V., B. Blagoev, et al. (2006). "Global, in vivo, and site-specific phosphorylation
dynamics in signaling networks." Cell 127(3): 635-648.
Onate, S. A., S. Y. Tsai, et al. (1995). "Sequence and characterization of a coactivator
for the steroid hormone receptor superfamily." Science 270(5240): 1354-1357.
Orosz, F., G. G. Kovacs, et al. (2004). "TPPP/p25: from unfolded protein to misfolding
disease: prediction and experiments." Biology of the cell / under the auspices of
the European Cell Biology Organization 96(9): 701-711.
Orosz, F. and J. Ovadi (2008). "TPPP orthologs are ciliary proteins." FEBS letters
582(27): 3757-3764.
Orphanides, G., T. Lagrange, et al. (1996). "The general transcription factors of RNA
polymerase II." Genes & development 10(21): 2657-2683.
Otte, A. P., I. M. Kramer, et al. (1991). "Protein kinase C and regulation of the local
competence of Xenopus ectoderm." Science 251(4993): 570-573.
Otzen, D. E., D. M. Lundvig, et al. (2005). "p25alpha is flexible but natively folded and
binds tubulin with oligomeric stoichiometry." Protein science : a publication of the
Protein Society 14(6): 1396-1409. 78
Parker, C. G., J. Hunt, et al. (1998). "Identification of stathmin as a novel substrate for
p38 delta." Biochemical and biophysical research communications 249(3): 791-
796.
Parkin, D. M., F. Bray, et al. (2005). "Global cancer statistics, 2002." CA: a cancer
journal for clinicians 55(2): 74-108.
Patiyil, S. and S. R. Alberts (2006). "Metastatic colorectal cancer: Therapeutic options."
Current treatment options in oncology 7(5): 389-398.
Pause, A. and N. Sonenberg (1992). "Mutational analysis of a DEAD-box RNA helicase:
the mammalian translation initiation factor eIF-4A." The EMBO journal 11(7):
2643-2654.
Pawson, T. (1994). "SH2 and SH3 domains in signal transduction." Advances in cancer
research 64: 87-110.
Pendergast, A. M. (2002). "The Abl family kinases: mechanisms of regulation and
signaling." Advances in cancer research 85: 51-100.
Perfettini, J. L., M. Castedo, et al. (2005). "Essential role of p53 phosphorylation by p38
MAPK in apoptosis induction by the HIV-1 envelope." The Journal of
experimental medicine 201(2): 279-289.
Perfettini, J. L., M. Castedo, et al. (2005). "Mechanisms of apoptosis induction by the
HIV-1 envelope." Cell death and differentiation 12 Suppl 1: 916-923.
Perregaux, D. G., D. Dean, et al. (1995). "Inhibition of interleukin-1 beta production by
SKF86002: evidence of two sites of in vitro activity and of a time and system
dependence." Molecular pharmacology 48(3): 433-442.
Pickart, C. M. (2004). "Back to the future with ubiquitin." Cell 116(2): 181-190. 79
Pinna, L. A. and M. Ruzzene (1996). "How do protein kinases recognize their
substrates?" Biochimica et biophysica acta 1314(3): 191-225.
Plattner, R., L. Kadlec, et al. (1999). "c-Abl is activated by growth factors and Src family
kinases and has a role in the cellular response to PDGF." Genes & development
13(18): 2400-2411.
Podtcheko, A., A. Ohtsuru, et al. (2003). "The selective tyrosine kinase inhibitor,
STI571, inhibits growth of anaplastic thyroid cancer cells." The Journal of clinical
endocrinology and metabolism 88(4): 1889-1896.
Preusser, M., A. Lehotzky, et al. (2007). "TPPP/p25 in brain tumours: expression in non-
neoplastic oligodendrocytes but not in oligodendroglioma cells." Acta
neuropathologica 113(2): 213-215.
Raingeaud, J., S. Gupta, et al. (1995). "Pro-inflammatory cytokines and environmental
stress cause p38 mitogen-activated protein kinase activation by dual
phosphorylation on tyrosine and threonine." The Journal of biological chemistry
270(13): 7420-7426.
Rakitina, T. V., I. A. Vasilevskaya, et al. (2007). "Inhibition of G1/S transition potentiates
oxaliplatin-induced cell death in colon cancer cell lines." Biochemical
pharmacology 73(11): 1715-1726.
Raymond, E., S. Faivre, et al. (2002). "Cellular and molecular pharmacology of
oxaliplatin." Molecular cancer therapeutics 1(3): 227-235.
Raymond, E., S. Faivre, et al. (1998). "Oxaliplatin: mechanism of action and
antineoplastic activity." Seminars in oncology 25(2 Suppl 5): 4-12. 80
Regala, R. P., C. Weems, et al. (2005). "Atypical protein kinase Ciota plays a critical
role in human lung cancer cell growth and tumorigenicity." The Journal of
biological chemistry 280(35): 31109-31115.
Ren, R., B. J. Mayer, et al. (1993). "Identification of a ten-amino acid proline-rich SH3
binding site." Science 259(5098): 1157-1161.
Reynolds, C. H., A. R. Nebreda, et al. (1997). "Reactivating kinase/p38 phosphorylates
tau protein in vitro." Journal of neurochemistry 69(1): 191-198.
Rikova, K., A. Guo, et al. (2007). "Global survey of phosphotyrosine signaling identifies
oncogenic kinases in lung cancer." Cell 131(6): 1190-1203.
Rocak, S. and P. Linder (2004). "DEAD-box proteins: the driving forces behind RNA
metabolism." Nature reviews. Molecular cell biology 5(3): 232-241.
Rodriguez, M. S., C. Dargemont, et al. (2001). "SUMO-1 conjugation in vivo requires
both a consensus modification motif and nuclear targeting." The Journal of
biological chemistry 276(16): 12654-12659.
Rossow, K. L. and R. Janknecht (2003). "Synergism between p68 RNA helicase and the
transcriptional coactivators CBP and p300." Oncogene 22(1): 151-156.
Rouse, J., P. Cohen, et al. (1994). "A novel kinase cascade triggered by stress and heat
shock that stimulates MAPKAP kinase-2 and phosphorylation of the small heat
shock proteins." Cell 78(6): 1027-1037.
Rozen, F., I. Edery, et al. (1990). "Bidirectional RNA helicase activity of eucaryotic
translation initiation factors 4A and 4F." Molecular and cellular biology 10(3):
1134-1144. 81
Safaei, R. and S. B. Howell (2005). "Copper transporters regulate the cellular
pharmacology and sensitivity to Pt drugs." Critical reviews in
oncology/hematology 53(1): 13-23.
Sandhu, H., L. Lemaire, et al. (1995). "Male germ cell extracts contain proteins binding
to the conserved 3'-end of mouse p68 RNA helicase mRNA." Biochemical and
biophysical research communications 214(2): 632-638.
Sanford, J. R. and J. F. Caceres (2004). "Pre-mRNA splicing: life at the centre of the
central dogma." Journal of cell science 117(Pt 26): 6261-6263.
Saunders, M. and T. Iveson (2006). "Management of advanced colorectal cancer: state
of the art." British journal of cancer 95(2): 131-138.
Sawyers, C. L., J. McLaughlin, et al. (1994). "The nuclear tyrosine kinase c-Abl
negatively regulates cell growth." Cell 77(1): 121-131.
Schiff, R. and J. Rosenbluth (1995). "Distribution of myelin lipid antigens in adult and
developing rat spinal cord." Brain research 686(2): 143-149.
Schneider, E. and S. Hunke (1998). "ATP-binding-cassette (ABC) transport systems:
functional and structural aspects of the ATP-hydrolyzing subunits/domains."
FEMS microbiology reviews 22(1): 1-20.
Schwartzberg, P. L., A. M. Stall, et al. (1991). "Mice homozygous for the ablm1 mutation
show poor viability and depletion of selected B and T cell populations." Cell
65(7): 1165-1175.
Schwer, B. (2001). "A new twist on RNA helicases: DExH/D box proteins as RNPases."
Nature structural biology 8(2): 113-116. 82
Segditsas, S. and I. Tomlinson (2006). "Colorectal cancer and genetic alterations in the
Wnt pathway." Oncogene 25(57): 7531-7537.
Seki, N., A. Hattori, et al. (1999). "A novel human gene whose product shares significant
homology with the bovine brain-specific protein p25 on chromosome 5p15.3."
Journal of human genetics 44(2): 121-122.
Seufert, D. W., R. Kos, et al. (2000). "p68, a DEAD-box RNA helicase, is expressed in
chordate embryo neural and mesodermal tissues." The Journal of experimental
zoology 288(3): 193-204.
Shaul, Y. (2000). "c-Abl: activation and nuclear targets." Cell death and differentiation
7(1): 10-16.
Shin, S., K. L. Rossow, et al. (2007). "Involvement of RNA helicases p68 and p72 in
colon cancer." Cancer research 67(16): 7572-7578.
Shiratsuchi, A., S. Sato, et al. (1995). "cDNA cloning of a novel brain-specific protein
p25." Biochimica et biophysica acta 1251(1): 66-68.
Shtil, A. A., S. Mandlekar, et al. (1999). "Differential regulation of mitogen-activated
protein kinases by microtubule-binding agents in human breast cancer cells."
Oncogene 18(2): 377-384.
Sillje, H. H. and E. A. Nigg (2001). "Identification of human Asf1 chromatin assembly
factors as substrates of Tousled-like kinases." Current biology : CB 11(13): 1068-
1073.
Sillje, H. H., K. Takahashi, et al. (1999). "Mammalian homologues of the plant Tousled
gene code for cell-cycle-regulated kinases with maximal activities linked to
ongoing DNA replication." The EMBO journal 18(20): 5691-5702. 83
Sirard, J. C., C. Vignal, et al. (2007). "Nod-like receptors: cytosolic watchdogs for
immunity against pathogens." PLoS pathogens 3(12): e152.
Skjoerringe, T., D. M. Lundvig, et al. (2006). "P25alpha/Tubulin polymerization
promoting protein expression by myelinating oligodendrocytes of the developing
rat brain." Journal of neurochemistry 99(1): 333-342.
Sohn, W. J., J. W. Lee, et al. (2010). "Change in Expression of Survivin Caused by
Using Oxaliplatin in HCT116 Colon Cancer Cells." Journal of the Korean Society
of Coloproctology 26(4): 246-253.
Songyang, Z., S. E. Shoelson, et al. (1993). "SH2 domains recognize specific
phosphopeptide sequences." Cell 72(5): 767-778.
Songyang, Z., S. E. Shoelson, et al. (1994). "Specific motifs recognized by the SH2
domains of Csk, 3BP2, fps/fes, GRB-2, HCP, SHC, Syk, and Vav." Molecular and
cellular biology 14(4): 2777-2785.
Spillantini, M. G., M. L. Schmidt, et al. (1997). "Alpha-synuclein in Lewy bodies." Nature
388(6645): 839-840.
Srinivasan, D. and R. Plattner (2006). "Activation of Abl tyrosine kinases promotes
invasion of aggressive breast cancer cells." Cancer research 66(11): 5648-5655.
Staley, J. P. and C. Guthrie (1998). "Mechanical devices of the spliceosome: motors,
clocks, springs, and things." Cell 92(3): 315-326.
Steen, R. L., F. Cubizolles, et al. (2000). "A kinase-anchoring protein (AKAP)95 recruits
human chromosome-associated protein (hCAP)-D2/Eg7 for chromosome
condensation in mitotic extract." The Journal of cell biology 149(3): 531-536. 84
Stevenson, R. J., S. J. Hamilton, et al. (1998). "Expression of the 'DEAD-box' RNA
helicase p68 is developmentally and growth regulated and correlates with organ
differentiation/maturation in the fetus." The Journal of pathology 184(4): 351-359.
Stossel, T. P. (1994). "The machinery of cell crawling." Scientific American 271(3): 54-
55, 58-63.
Taagepera, S., D. McDonald, et al. (1998). "Nuclear-cytoplasmic shuttling of C-ABL
tyrosine kinase." Proceedings of the National Academy of Sciences of the United
States of America 95(13): 7457-7462.
Takahashi, M., K. Tomizawa, et al. (1993). "A brain-specific protein p25 is localized and
associated with oligodendrocytes, neuropil, and fiber-like structures of the CA3
hippocampal region in the rat brain." Journal of neurochemistry 60(1): 228-235.
Takahashi, M., K. Tomizawa, et al. (1991). "A novel brain-specific 25 kDa protein (p25)
is phosphorylated by a Ser/Thr-Pro kinase (TPK II) from tau protein kinase
fractions." FEBS letters 289(1): 37-43.
Takenaka, K., T. Moriguchi, et al. (1998). "Activation of the protein kinase p38 in the
spindle assembly checkpoint and mitotic arrest." Science 280(5363): 599-602.
Tan, Y., J. Rouse, et al. (1996). "FGF and stress regulate CREB and ATF-1 via a
pathway involving p38 MAP-kinaseand MAPKAP kinase-2." The EMBO journal
15(17): 4629-4642.
Taniguchi, C. M., B. Emanuelli, et al. (2006). "Critical nodes in signalling pathways:
insights into insulin action." Nature reviews. Molecular cell biology 7(2): 85-96. 85
Tanner, N. K., O. Cordin, et al. (2003). "The Q motif: a newly identified motif in DEAD-
box helicases may regulate ATP binding and hydrolysis." Molecular cell 11(1):
127-138.
Tanner, N. K. and P. Linder (2001). "DExD/H box RNA helicases: from generic motors
to specific dissociation functions." Molecular cell 8(2): 251-262.
Tanno, M., R. Bassi, et al. (2003). "Diverse mechanisms of myocardial p38 mitogen-
activated protein kinase activation: evidence for MKK-independent activation by a
TAB1-associated mechanism contributing to injury during myocardial ischemia."
Circulation research 93(3): 254-261.
Tanos, T., M. J. Marinissen, et al. (2005). "Phosphorylation of c-Fos by members of the
p38 MAPK family. Role in the AP-1 response to UV light." The Journal of
biological chemistry 280(19): 18842-18852.
Terada, N., G. J. Kidd, et al. (2005). "Beta IV tubulin is selectively expressed by
oligodendrocytes in the central nervous system." Glia 50(3): 212-222.
Tesniere, A., F. Schlemmer, et al. (2010). "Immunogenic death of colon cancer cells
treated with oxaliplatin." Oncogene 29(4): 482-491.
Thiery, J. P., H. Acloque, et al. (2009). "Epithelial-mesenchymal transitions in
development and disease." Cell 139(5): 871-890.
Tirian, L., E. Hlavanda, et al. (2003). "TPPP/p25 promotes tubulin assemblies and
blocks mitotic spindle formation." Proceedings of the National Academy of
Sciences of the United States of America 100(24): 13976-13981.
Todd, R. C. and S. J. Lippard (2009). "Inhibition of transcription by platinum antitumor
compounds." Metallomics : integrated biometal science 1(4): 280-291. 86
Tokesi, N., A. Lehotzky, et al. (2010). "TPPP/p25 promotes tubulin acetylation by
inhibiting histone deacetylase 6." The Journal of biological chemistry 285(23):
17896-17906.
Torchia, J., D. W. Rose, et al. (1997). "The transcriptional co-activator p/CIP binds CBP
and mediates nuclear-receptor function." Nature 387(6634): 677-684.
Tournigand, C., T. Andre, et al. (2004). "FOLFIRI followed by FOLFOX6 or the reverse
sequence in advanced colorectal cancer: a randomized GERCOR study." Journal
of clinical oncology : official journal of the American Society of Clinical Oncology
22(2): 229-237.
Trapp, B. D., A. Nishiyama, et al. (1997). "Differentiation and death of premyelinating
oligodendrocytes in developing rodent brain." The Journal of cell biology 137(2):
459-468.
Tsai, M. Y., S. Wang, et al. (2006). "A mitotic lamin B matrix induced by RanGTP
required for spindle assembly." Science 311(5769): 1887-1893.
Tybulewicz, V. L., C. E. Crawford, et al. (1991). "Neonatal lethality and lymphopenia in
mice with a homozygous disruption of the c-abl proto-oncogene." Cell 65(7):
1153-1163.
Uhlmann-Schiffler, H., S. Kiermayer, et al. (2009). "The DEAD-box protein Ddx42p
modulates the function of ASPP2, a stimulator of apoptosis." Oncogene 28(20):
2065-2073.
Van Cutsem, E., M. Peeters, et al. (2007). "Open-label phase III trial of panitumumab
plus best supportive care compared with best supportive care alone in patients
with chemotherapy-refractory metastatic colorectal cancer." Journal of clinical 87
oncology : official journal of the American Society of Clinical Oncology 25(13):
1658-1664.
Van Etten, R. A. (1999). "Cycling, stressed-out and nervous: cellular functions of c-Abl."
Trends in cell biology 9(5): 179-186.
Van Etten, R. A., P. K. Jackson, et al. (1994). "The COOH terminus of the c-Abl tyrosine
kinase contains distinct F- and G-actin binding domains with bundling activity."
The Journal of cell biology 124(3): 325-340.
Verdier-Pinard, P., F. Wang, et al. (2003). "Direct analysis of tubulin expression in
cancer cell lines by electrospray ionization mass spectrometry." Biochemistry
42(41): 12019-12027.
Vincze, O., N. Tokesi, et al. (2006). "Tubulin polymerization promoting proteins
(TPPPs): members of a new family with distinct structures and functions."
Biochemistry 45(46): 13818-13826.
Voegel, J. J., M. J. Heine, et al. (1996). "TIF2, a 160 kDa transcriptional mediator for the
ligand-dependent activation function AF-2 of nuclear receptors." The EMBO
journal 15(14): 3667-3675. von Mikecz, A., S. Zhang, et al. (2000). "CREB-binding protein (CBP)/p300 and RNA
polymerase II colocalize in transcriptionally active domains in the nucleus." The
Journal of cell biology 150(1): 265-273.
Wahl, M. C., C. L. Will, et al. (2009). "The spliceosome: design principles of a dynamic
RNP machine." Cell 136(4): 701-718. 88
Wakabayashi, K., M. Yoshimoto, et al. (1998). "Alpha-synuclein immunoreactivity in glial
cytoplasmic inclusions in multiple system atrophy." Neuroscience letters 249(2-
3): 180-182.
Wang, D., H. Li, et al. (2005). "Humanin delays apoptosis in K562 cells by
downregulation of P38 MAP kinase." Apoptosis : an international journal on
programmed cell death 10(5): 963-971.
Wang, D. and S. J. Lippard (2005). "Cellular processing of platinum anticancer drugs."
Nature reviews. Drug discovery 4(4): 307-320.
Wang, S., M. C. Wilkes, et al. (2005). "Imatinib mesylate blocks a non-Smad TGF-beta
pathway and reduces renal fibrogenesis in vivo." FASEB journal : official
publication of the Federation of American Societies for Experimental Biology
19(1): 1-11.
Wang, W., J. X. Chen, et al. (2002). "Sequential activation of the MEK-extracellular
signal-regulated kinase and MKK3/6-p38 mitogen-activated protein kinase
pathways mediates oncogenic ras-induced premature senescence." Molecular
and cellular biology 22(10): 3389-3403.
Wang, X., M. Li, et al. (2006). "The BH3-only protein, PUMA, is involved in oxaliplatin-
induced apoptosis in colon cancer cells." Biochemical pharmacology 71(11):
1540-1550.
Wang, X., C. H. McGowan, et al. (2000). "Involvement of the MKK6-p38gamma
cascade in gamma-radiation-induced cell cycle arrest." Molecular and cellular
biology 20(13): 4543-4552. 89
Wang, X. Z. and D. Ron (1996). "Stress-induced phosphorylation and activation of the
transcription factor CHOP (GADD153) by p38 MAP Kinase." Science 272(5266):
1347-1349.
Wang, Y., S. Huang, et al. (1998). "Cardiac muscle cell hypertrophy and apoptosis
induced by distinct members of the p38 mitogen-activated protein kinase family."
The Journal of biological chemistry 273(4): 2161-2168.
Warner, D. R., V. Bhattacherjee, et al. (2004). "Functional interaction between Smad,
CREB binding protein, and p68 RNA helicase." Biochemical and biophysical
research communications 324(1): 70-76.
Waskiewicz, A. J., A. Flynn, et al. (1997). "Mitogen-activated protein kinases activate
the serine/threonine kinases Mnk1 and Mnk2." The EMBO journal 16(8): 1909-
1920.
Wassarman, D. A. and J. A. Steitz (1991). "RNA splicing. Alive with DEAD proteins."
Nature 349(6309): 463-464.
Watanabe, M., J. Yanagisawa, et al. (2001). "A subfamily of RNA-binding DEAD-box
proteins acts as an estrogen receptor alpha coactivator through the N-terminal
activation domain (AF-1) with an RNA coactivator, SRA." The EMBO journal
20(6): 1341-1352.
Way, K. J., E. Chou, et al. (2000). "Identification of PKC-isoform-specific biological
actions using pharmacological approaches." Trends in pharmacological sciences
21(5): 181-187.
Wheeler, D. L., K. E. Martin, et al. (2004). "Protein kinase C epsilon is an endogenous
photosensitizer that enhances ultraviolet radiation-induced cutaneous damage 90
and development of squamous cell carcinomas." Cancer research 64(21): 7756-
7765.
Wiche, G. (1998). "Role of plectin in cytoskeleton organization and dynamics." Journal
of cell science 111 ( Pt 17): 2477-2486.
Will, C. L. and R. Luhrmann (2001). "Spliceosomal UsnRNP biogenesis, structure and
function." Current opinion in cell biology 13(3): 290-301.
Wilson, B. J., G. J. Bates, et al. (2004). "The p68 and p72 DEAD-box RNA helicases
interact with HDAC1 and repress transcription in a promoter-specific manner."
BMC molecular biology 5: 11.
Wood, L. J., L. M. Nail, et al. (2006). "The cancer chemotherapy drug etoposide (VP-16)
induces proinflammatory cytokine production and sickness behavior-like
symptoms in a mouse model of cancer chemotherapy-related symptoms."
Biological research for nursing 8(2): 157-169.
Woodring, P. J., T. Hunter, et al. (2003). "Regulation of F-actin-dependent processes by
the Abl family of tyrosine kinases." Journal of cell science 116(Pt 13): 2613-2626.
Woodring, P. J., E. D. Litwack, et al. (2002). "Modulation of the F-actin cytoskeleton by
c-Abl tyrosine kinase in cell spreading and neurite extension." The Journal of cell
biology 156(5): 879-892.
Wortham, N. C., E. Ahamed, et al. (2009). "The DEAD-box protein p72 regulates
ERalpha-/oestrogen-dependent transcription and cell growth, and is associated
with improved survival in ERalpha-positive breast cancer." Oncogene 28(46):
4053-4064. 91
Xia, Z., M. Dickens, et al. (1995). "Opposing effects of ERK and JNK-p38 MAP kinases
on apoptosis." Science 270(5240): 1326-1331.
Yager, J. D. and N. E. Davidson (2006). "Estrogen carcinogenesis in breast cancer."
The New England journal of medicine 354(3): 270-282.
Yang, L., C. Lin, et al. (2005). "Phosphorylations of DEAD-box p68 RNA helicase are
associated with cancer development and cell proliferation." Molecular cancer
research : MCR 3(6): 355-363.
Yang, L., C. Lin, et al. (2005). "Signaling to the DEAD-box--regulation of DEAD-box p68
RNA helicase by protein phosphorylations." Cellular signalling 17(12): 1495-
1504.
Yang, L., C. Lin, et al. (2006). "P68 RNA helicase mediates PDGF-induced epithelial
mesenchymal transition by displacing Axin from beta-catenin." Cell 127(1): 139-
155.
Yang, L., C. Lin, et al. (2007). "A double tyrosine phosphorylation of P68 RNA helicase
confers resistance to TRAIL-induced apoptosis." Oncogene 26(41): 6082-6092.
Yang, L., C. Lin, et al. (2007). "Phosphorylation of p68 RNA helicase plays a role in
platelet-derived growth factor-induced cell proliferation by up-regulating cyclin D1
and c-Myc expression." The Journal of biological chemistry 282(23): 16811-
16819.
Yang, L. and Z. R. Liu (2004). "Bacterially expressed recombinant p68 RNA helicase is
phosphorylated on serine, threonine, and tyrosine residues." Protein expression
and purification 35(2): 327-333. 92
Yang, L., J. Yang, et al. (2004). "Phosphorylation of p68 RNA helicase regulates RNA
binding by the C-terminal domain of the protein." Biochemical and biophysical
research communications 314(2): 622-630.
Yang, T. T., Q. Xiong, et al. (2002). "Phosphorylation of NFATc4 by p38 mitogen-
activated protein kinases." Molecular and cellular biology 22(11): 3892-3904.
Yee, A. S., E. K. Paulson, et al. (2004). "The HBP1 transcriptional repressor and the
p38 MAP kinase: unlikely partners in G1 regulation and tumor suppression."
Gene 336(1): 1-13.
Yuan, Z. M., Y. Huang, et al. (1997). "Regulation of DNA damage-induced apoptosis by
the c-Abl tyrosine kinase." Proceedings of the National Academy of Sciences of
the United States of America 94(4): 1437-1440.
Yuan, Z. M., Y. Huang, et al. (1996). "Role for c-Abl tyrosine kinase in growth arrest
response to DNA damage." Nature 382(6588): 272-274.
Zarubin, T. and J. Han (2005). "Activation and signaling of the p38 MAP-
kinasepathway." Cell research 15(1): 11-18.
Zhang, Z., C. Wu, et al. (2002). "A novel human gene whose product shares homology
with bovine brain-specific protein p25 is expressed in fetal brain but not in adult
brain." Journal of human genetics 47(5): 266-268.
Zhu, H., J. F. Klemic, et al. (2000). "Analysis of yeast protein kinases using protein
chips." Nature genetics 26(3): 283-289.
Zotter, A., A. Bodor, et al. (2011). "Disordered TPPP/p25 binds GTP and displays
Mg2+-dependent GTPase activity." FEBS letters 585(5): 803-808. 93
Zunino, F., P. Perego, et al. (1997). "Role of apoptotic response in cellular resistance to
cytotoxic agents." Pharmacology & therapeutics 76(1-3): 177-185.
Zunino, F., P. Perego, et al. (1997). "Role of apoptotic response in cellular resistance to
cytotoxic agents." Pharmacology & therapeutics 76(1-3): 177-185.
94
s
Figure 1.1 DEAD-box RNA helicases in multiple cellular processes.
DEAD-box RNA helicases are involved in ribosome biogenesis (Fal1, Rok1, Spb4 and
Dbp10), pre-mRNA splicing (Prp28, Prp5 and Sub2), mRNA export (Dbp5 and Sub2), translation initiation (eIF4A, Ded1 and Vasa), organellar gene expression (Mss116,
Mrh4 and Cyt-19), and RNA decay (RhlB, Dbp2 and Dhh1). Some of these RNA helicases is involved in two or more biological processes serving as a consequent link or control element for those processes. [Figure taken from Rocak et al. (2004). Nature reviews molcellbio. 5:232-241]. (Rocak and Linder 2004).
95
Figure 1.2 Drawing of the structure of full-length p68.
The figure shows typical DEAD-box structure and it is refined to 2.6Aₒ resolution. The
DEAD domain has a central 8-stranded β-sheet between 5 α-helices on each face and
ADP molecule in the nucleotide binding pocket. [Figure taken from SGC - http://www.thesgc.org/structures/details?pdbid=3FE2/]
96
Figure 1.3a Structure of the human p68 gene (EMBL accession no. AF015812) with the distribution of exons and introns along with conserved DEAD-box motifs.
Filled boxes with roman numbers on the top denote exons while introns and flanking regions are represented by thin lines (bar=500nt). The amino-acid sequences of conserved motifs are given in single letter code. [Figure taken from Rossler et al.
(2000). Nucleic acids Research. 28(4): 932-939]. (Rossler, Hloch et al. 2000).
97
Figure 1.3b Schematic depiction of domains of p68 RNA helicase
P68 is a 614 amino-acids containing protein. The bottom panel represents the domain structure of p68 consisting of N-terminal, C-terminal and helicase core region. Different sequence motifs are labeled while amino-acids are represented by numbers. The panel on the top denotes the core domain of p68 (134-430 amino-acid). [Figure taken from
Yang et al. (2004). Biochemical and Biophysical Research Communications. 314: 622-
630]. (Yang and Liu 2004).
98
Figure 1.4 GTF assembly at a typical eukaryotic promoter
The assembly of the basal transcription machinery is depicted here. A general eukaryotic promoter with a TATA box (TATA), an initiator motif (INR), which overlaps the transcription initiation site (arrow), and two GAGA elements (GAGA, not coloured) is 99 depicted. TBP (pink) is assembled when one or more GAGA factors interact with one or more GAGA elements. Several TAFs (pale pink) then join the basal complex followed by TFIIA (TFs not coloured). Stepwise addition of TFIIB, RNA pol IIa (red)±TFIIF dimer,
TFIIE, TFIIH and the mediator (dark pink) complex takes place after isomerisation of the
TFIIA±TFIID complex. This pre-formed RNA pol II holoenzyme increases the frequency of transcription initiation. Next step involves DNA melting and CTD phosphorylation in order for elongation to take place. Recycling of the various parts of the spent GTFs
(broken arrows) helps to increase the rate of re-initiation. [Figure taken from Ogbourne et al. (1998). Biochem Journal. 331: 1-14]. (Ogbourne and Antalis 1998).
100
Figure 1.5 Depiction of functional interactions that affect basal (Upper) and activator-dependent transcription (Lower).
The “pol II holoenzyme” components are denoted by square brackets while the basal coactivators (TBP, TFIIB, TFIIF, TFIIE, and TFIIH and pol II) are shown in yellow symbols. [Figure taken Nikolov et al. (1997). PNAS. 94:15-22]. (Nikolov and Burley
1997).
101
Figure 1.6 Proteins interacting with p68/Dbp2 and the different biological functions carried out by them.
The different roles of the DExD/H box protein are shown here. P68 found to co-purify with spliceosomes has an important function in the splicing process. P68 transcriptionally coactivates a number of genes including ERα, Smad3, SRA, SRC1,
RNA Pol II/CBP/p300 and functions as a transcriptional repressor for HDAC1 mediated transcription. P68 is also found to be involved in rRNA processing, mRNA decay and
RNAi but the precise role is not yet known. [Figure taken Fuller-Pace et al. (2006).
Nucleic Acids Research. 34(15): 4206-4215]. (Fuller-Pace 2006).
102
Table 1.1 Expression of TPPP/p25 in mouse tissues
The table summarizes the different regions or cell types with TPPP/p25 expression. It is expressed both in the nucleus and the cytoplasm. “+” represents low levels of expression while “++” and “+++” denotes moderate and high levels respectively. Tissues without TPPP/p25 expression are as −. [The table is taken from Acevedo et al. (2007).
Experimental Cell Research. 313(20): 4091-4106]. (Acevedo et al. 2007).
Tissue IB IHC Cell-type or region Brain +++ +++ Neuropil, neuroglia, cortical neurons Heart ++ +++ Cardiac muscle cells Kidney − − Glomeruli, distal and proximal convoluted tubules Lung ++ ++ Bronchiole epithelium, alveolar cells Liver ++ − − Stomach + ++ Parietal cells in funding glands Crypts of Lieberkühn, lamina propria containing smooth muscle Intestine ++ ++ bundles, muscularis mucosae Spleen ++ ++ B lymphocytes (lymphoid follicles) Testis − +++ elongated spermatids, spermatocytes, early spermatids Follicles—oocytes, granulosa cells, follicular epithelium, corpus Ovaries − +++ luteum—granulosa lutein cells Skeletal − +++ Dark and light striations in muscle fibres Muscle Retina—photoreceptors (cones and rods), outer and inner Eye − +++ plexiform layer and ganglion cell fibre layer Lens—anterior epithelium and lens fibres
103
CHAPTER 2
PHOSPHORYLATION OF P68 RNA HELICASE BY P38 MAP-KINASE
CONTRIBUTES TO COLON CANCER CELLS APOPTOSIS INDUCED BY
OXALIPLATIN
This chapter is published in BMC Cell Biol. 2012 Oct 31; 13(1):27.
2.1 ABSTRACT
It was shown initially that phosphorylation of p68 at threonine was associated with cancer cell apoptosis under the treatments of TNF-α and TRAIL (Yang, Lin et al.
2005). The role of p68 phosphorylation in apoptosis induction following the treatment of colon cancer cells in culture with oxaliplatin was investigated in this study. Our data indicated that oxaliplatin treatment activates p38 MAP-kinase, which subsequently phosphorylates p68 at T564 and/or T446. P68 phosphorylation, at least partially, mediates the effects of the drug on apoptosis induction, as mutations at these two sites greatly reduce the cancer cell death. This study shows an important mechanism of action of the anti-cancer drug which could be used for improving cancer treatment.
2.2 INTRODUCTION
Oxaliplatin belongs to a new generation of platinum compounds currently used in the front line for human colorectal cancer and other cancers treatment (Raymond,
Faivre et al. 1998). The therapeutic functions of oxaliplatin are from the DNA damage caused by the compound, which leads to arrest of the cell cycle and apoptosis (Faivre, 104
Le Chevalier et al. 2002; Rakitina, Vasilevskaya et al. 2007). The compound can damage DNA by crosslinking DNA thereby blocking DNA replication and transcription
(Faivre, Le Chevalier et al. 2002; Fischel, Formento et al. 2002; Ang, Myint et al. 2010).
It activates multiple signaling pathways in mediating apoptosis induction (Wang, Li et al.
2006; Chiu, Lee et al. 2009). Oxaliplatin treatment causes activation of p38 and/or JNK kinases, which subsequently targets a number of downstream effector molecules leading to cancer cell apoptosis. Although the mechanism underlying the tumor apoptosis induced by the drug has been intensively studied, the detailed mechanism, especially the cellular molecules that contribute to the effects of the drug, is not fully understood. P38 is a stress-activated MAP-kinase that is activated by cellular stresses such as oxidative stress and toxic chemicals (Gould, Cuenda et al. 1995; Lu, Rau et al.
2011). Activated p38 relays stress signals in the induction of cell apoptosis (Xia,
Dickens et al. 1995; Zarubin and Han 2005). A number of anti-cancer agents act via activation of p38, such as platinum compounds (Wang and Lippard 2005), etoposide
(Wood, Nail et al. 2006), and taxol (Shtil, Mandlekar et al. 1999). Phosphorylation of p38
MAP-kinase at Thr180 and Tyr182 residues in its conserved TGY motif leads to its activation (New and Han 1998; Gong, Ming et al. 2010). The p38 MAP-kinase targets a number of very important downstream proteins to exert its effects on apoptosis induction. It is reported that phosphorylation of p53 on Ser46 by p38 is essential for apoptosis induction by several anti-cancer drugs or by certain viruses (Perfettini,
Castedo et al. 2005; Perfettini, Castedo et al. 2005). Oxaliplatin treatment of colon cancer cells leads to activation of p38 MAP-kinase, which subsequently phosphorylates 105 gamma-H2AX and securin. These phosphorylation events lead to cancer cell apoptosis caused by oxaliplatin (Chiu, Chao et al. 2008; Liu, Liu et al. 2010).
P68 RNA helicase is a RNA helicase with a DEAD-box motif (Lane and Hoeffler
1980; Crawford, Leppard et al. 1982). It is implicated in cellular proliferation, differentiation (Stevenson, Hamilton et al. 1998) and cancer progression (Causevic,
Hislop et al. 2001). P68 RNA helicase gets phosphorylated at several residues (Yang,
Lin et al. 2005). Tyrosine phosphorylation of p68 is demonstrated in several cancer cells. C-abl phosphorylates p68 in HT-29 cells following PDGF-BB stimulation. P68 phosphorylation at Y593 promotes EMT by allowing nuclear translocation of β-catenin
(Yang, Lin et al. 2006). P68 phosphorylation in T98G glioblastoma cells causes resistance to apoptosis induced by TRAIL. Interestingly, when the cancer cells become apoptotic resistant, the double tyrosine phosphorylations of p68 increase while the phosphorylation of p68 at threonine decreases implying that phosphorylation of p68 at threonine may be important in the induction of apoptosis induced by the anti-cancer drug (Yang, Lin et al. 2005). We report here that, upon the anti-cancer drug oxaliplatin treatment, p68 RNA helicase becomes threonine-phosphorylated in colon cancer
HCT116 cells. Oxaliplatin treatment activates p38 MAP-kinase in the cells, which subsequently phosphorylates p68 at T564 and/or T446. The phosphorylation of p68 at
T564 and/or T446 is found to be important for the apoptosis induction by the drug. This study demonstrates an important factor responsible for the effects of oxaliplatin in apoptosis induction and may suggest a potential therapeutic strategy for cancer treatment.
106
2.3 RESULTS
2.3.1 Oxaliplatin treatment of colon cancer cells induced p68-threonine phosphorylation
A previous study showed that p68 tyrosyl-phosphorylation is associated with tumor development (Yang, Lin et al. 2005). In studying the effects of several anti-cancer drugs and p68 phosphorylation status, p68 threonine phosphorylation was reported in the colon cancer cells following the treatment with those anti-cancer drugs (Yang, Lin et al. 2005). So, the next question is whether p68 phosphorylation at threonine plays a role in mediating the anti-cancer drug effects. We used oxaliplatin which is used in the treatment of colon cancer patients and HCT116 as the study system. HCT116 is a colon cancer cell-line with a positive expression for transforming growth factor-beta. It has a mutation in the β-catenin gene (gain of function mutation). This mutation causes constitutive activation of a number of β-catenin-regulated downstream genes as a result of prevention of degradation of β-catenin. It also contains a homozygous mutation in mismatch repair gene hMLH1 (mutL homolog1), a gene whose mutation increases susceptibility to sporadic colorectal cancer. HCT116 cells has wild-type p53 gene and undergo apoptosis in a p53-responsive manner after exposure to different anti-cancer agents (Vikhanskaya, Colella et al. 1999). Treatment of HCT116 cells with different dosages of oxaliplatin for 24 hours induced cell-death. The cells showed roughly 30 to
32% cell death at 20 μM concentration while 50% of the cells died at 40 μM drug concentration (Figure 2.1A). We then examined the threonine phosphorylation of p68 by using anti-phospho-threonine antibody and using the procedure reported in previous studies (Yang, Lin et al. 2005; Yang, Lin et al. 2007). Oxaliplatin treatment 107 demonstrated increased p68 phosphorylation at threonine (Figure 2.1B). This phosphorylation increase was observed with both the detached cells and the cells that were still attached to the culture plate following 24 hours of drug treatment (Figure
2.1C). We subsequently tested the timing of the p68 threonine phosphorylation following oxaliplatin treatment. It was evident that the p68 threonine phosphorylation reached a peak around 4 – 6 hours of 20 μM treatment and the phosphorylation decreased thereafter (Figure 2.1D).
2.3.2 P68 is phosphorylated by p38 MAP-kinase at T564 and T446 upon the drug treatment
We next sought to investigate the protein kinase that phosphorylates p68 in response to oxaliplatin. It is very well known that oxaliplatin treatment of colon cancer cells activates p38 MAP-kinase which is critical for apoptosis induction in cancer cells
(Xia, Dickens et al. 1995; Holmes, Soprano et al. 2003). To investigate the relation of p68-threonine phosphorylation and p38 MAP-kinase activation, we simultaneously probed threonine phosphorylation of p68 and phosphorylation of p38 MAP-kinase at the
TGY motif using an antibody against phospho-threonine (14B3) after immunoprecipitating p68 (using p68 antibody) and phosphorylated/activated p38 (p-p38 antibody) respectively in the HCT116 cells. It was clear that p38 MAP-kinase was activated upon the oxaliplatin treatment (Figure 2.2A). Interestingly, the timing of p38
MAP-kinase activation/phosphorylation correlated with the p68-phosphorylation at threonine with the oxaliplatin treatment, atleast upto 4 hours (Figure 2.2A); indicating the possibility that p68 is a substrate of p38 MAP-kinase following oxaliplatin treatment. 108
This possibility was tested by examining the interaction of p68 and p38 MAP-kinase by co-immunoprecipitation. HCT116 cells expressing endogenous p68 and p38 were treated with 20 μM oxaliplatin for 4 hours. P68 was immunoprecipitated from the oxaliplatin-treated cell lysate using anti-p68 antibody. It was evident that p38 MAP- kinase coimmunoprecipitated with p68 (Figure 2.2B). We then further verified the phosphorylation of p68 by performing in vitro kinase assay with recombinant p68 and p38 MAP-kinase. It was clear that the recombinant p38 MAP-kinase phosphorylated recombinant p68. As a control, BSA was not phosphorylated by the recombinant MAP- kinase (Figure 2.2C). To further confirm that p38 phosphorylated p68 at threonine, a constitutively activated p38 MAP-kinase-mutant D176AF327L was generated by
QuickChange site-directed mutagenesis (Diskin, Askari et al. 2004). D176A-F327L is a constitutively activated p38 MAP-kinase mutant with double mutations at D176 and
F327 sites that induce conformational changes mimicking the naturally imposed changes by dual phosphorylation in the loop region between kinase domains of p38 by upstream p38 MAP-kinase activators. The double mutations render p38 MAP-kinase constitutively active with high intrinsic activity independent of upstream activation and regulation. This mutant retains the ability to phosphorylate and activate downstream p38 substrates (Diskin, Askari et al. 2004). Thereafterm, D176A-F327L was expressed in
HCT116 cells. P68 threonine phosphorylation in the cells was examined by the immunoprecipitation with the anti-p68 antibody and immunoblot procedures with anti- phospho-threonine and anti-p68 antibodies. Apparently, phosphorylation of p68 at threonine was increased upon the p38 MAP-kinase-mutant expression (Figure 2.2D).
We, thus, concluded from our studies that p38 MAP-kinase phosphorylates p68. 109
We next determined the p68 phosphorylation sites recognized by p38 MAP- kinase. Phosphorylation-site search using a web-based program, NetPhos 2.0 was performed. The consensus phosphorylation-site search indicated several potential S/T phosphorylation sites on p68 by p38 MAP-kinase (Figure 2.3A). Based on the phosphorylation-site predictions, several mutants were generated where the threonine
(T) residue at the predicted phosphorylation-sites was mutated to alanine (A) by Quick- change site-directed mutagenesis. This mutation abolished the ability of the mutants to be phosphorylated as alanine did not have any phosphoacceptor site for phoshorylation by p38 MAP-kinase (Figure 2.3A). Data from in vitro phosphorylation reactions with the generated mutants using the recombinant p38 suggested that there was a decrease in p68-phosphorylation with the mutant T564A, while there was almost no change with other mutants (Figure 2.3B, Upper panel), suggesting that T564 phosphorylation may result from activated p38 MAP-kinase. To verify whether the T564 is the phosphorylation site, the T564A mutant or other mutants were transfected in the
HCT116 cells and the phosphorylation of the p68 mutant at threonine was examined after treating the cells with oxaliplatin. Surprisingly, there was no change in p68 threonine phosphorylation with wild-type and any mutant (Figure 2.3C Upper panel).
One possible explanation is that p68 may have additional sites that are phosphorylated by p38 MAP-kinase as p38 is known to often phosphorylate its targets at multiple sites
(Yang, Xiong et al. 2002; De Chiara, Marcocci et al. 2006). To confirm this, we created two p68-double mutants, T564/446A and T446/224A. T564/446A has mutations at
T564 and T446 sites where threonine (T) residue is mutated to alanine (A). Apart from
T564 phosphorylation site, p38 may be phosphorylating p68 at additional minor sites to 110 achieve maximal phosphorylation. T446 and T224 have the p38 consensus sequence and show higher possilbity of being phosphorylated by bioinformative analysis. Hence, double mutants, T564/446A and T446/224A were generated and in vitro phosphorylation was performed with these two mutants. It was clear that p38 MAP- kinase induced phosphorylation of T564/446A was reduced, while the phosphorylation of T446/224A had very minor reduction (Figure 2.3B Lower panel). The in vitro phosphorylation results suggested that it is likely that the T564 and T446 of p68 are the sites phosphorylated by p38. To verify that T564 and T446 are the phosphorylation sites, HA-tagged p68-wild-type (wt), T564/446A, and T446/T224A mutants were expressed in HCT116 cells followed by oxaliplatin treatment. Phosphorylation of the HA- tagged p68-wt and the mutants were examined. Clearly, phosphorylation of
T446/T224A experienced a minor decrease, while phosphorylation of T564/446A was almost abolished (Figure 3.3C Lower panel). The results strongly suggest that p38 phosphorylated p68 at T564 and T446 by the anti-cancer drug.
2.3.3 Phosphorylation of p68 at threonine mediates the effects of oxaliplatin in the induction of apoptosis
We next investigated whether p38 MAP-kinase-induced p68 threonine- phosphorylation is involved in the oxaliplatin-mediated pathway. The HA-tagged wt p68 or T564/446A was expressed in HCT116 cells after knocking down endogenous p68
(Figure 2.4A). The cells were then subsequently treated by oxaliplatin for 24 hrs at a concentration of 10 μM. Cellular apoptosis was measured using caspase-3 colorimetric assay as caspase-3 is an important factor for detection of apoptosis. Caspase-3 111 cleavage and subsequent activation is a primary hallmark of apoptosis mediated by both intrinsic and extrinsic apoptotic pathway. There were no significant changes in cell apoptosis without oxaliplatin treatment. However, oxaliplatin-induced apoptosis was reduced with the T564/446A-expressing cells. This effect was not observed with the wt p68-expressing cells (Figure 2.4B). Similar results were observed with MTT assays
(Figure 2.4C). Thus, we conclude that phosphorylation of p68 at T564/446, at least partially, mediates the effects of oxaliplatin on apoptosis induction.
2.4 DISCUSSION
We found in this study that p68 gets phosphorylated at T564 and/or T446 in
HCT116 colon cancer cells following oxaliplatin treatment. P38 MAP-kinase phosphorylates p68 following the drug treatment. The phosphorylation(s) of p68 appears to be essential for caspase-3 cleavage, an event which culminates in apoptosis. These results echo a report from Yang and colleagues that the loss of p68 threonine phosphorylation correlates with cancer cell TRAIL- resistance (Yang, Lin et al.
2007). Thus, phosphorylation of p68 at T564 and T446 may represent a common molecular mechanism that acts in multiple pathways of apoptosis induction.
Activated p38 MAP-kinase is a common factor in multiple apoptosis induction with a number of anti-cancer drugs with different molecular mechanisms (Wang, Li et al.
2005; Wang, Li et al. 2006; Wood, Nail et al. 2006), oxidative stresses (Lu, Rau et al.
2011), cells damaged by UV light (Tanos, Marinissen et al. 2005). Moreover, the downstream substrates of p38 MAP-kinase that execute the apoptosis effects is not very clear. In fact, only a few substrates of p38 MAP-kinase involved in cell apoptosis 112 induction, including p53 (Perfettini, Castedo et al. 2005) and HSP27 (Deschesnes, Huot et al. 2001; Gonzalez-Mejia, Voss et al. 2010) are known. The mechanism by which phosphorylation of these substrates mediates the effects of apoptosis induction is not fully known.
How the p68 phosphorylation at T564 and T446 mediates cell apoptosis is an open question. One plausible explanation is that the phosphorylated p68 may change p68-interacting partners in the cells, which allows p68 to target a specific apoptosis- mediating protein or complex. The consequence for the p68-targeting is activation of apoptotic function of the targeted protein or complex. Some DEAD-box RNA helicases associate with apoptosis induction protein or complex. For example DDX42 modulates the apoptotic function of ASPP2 by direct interaction with it (Uhlmann-Schiffler,
Kiermayer et al. 2009). Interaction between GABA-receptor associated protein
(GABARAP) and DDX47 is required for induction of neuronal cell apoptosis (Lee, Rho et al. 2005). However, the mechanism by which this DEAD-box RNA helicase regulates the apoptotic process is not known. Thus, it will be very interesting to find whether p68 phosphorylation at T564 and/or T446 mediates the association of the protein with a particular apoptosis inducing complex to activate the complex.
2.5 MATERIALS AND METHODS
2.5.1 Cell Culture and Antibodies
HCT116 cells (Catalog # CRL-247) were obtained from ATCC (Manassas, VA,
USA). They were cultured according to the vendor’s instruction. Antibodies against p68 were raised against C-terminal domain (a.a.437-614) of human p68 (Invitrogen, Grand 113
Island, NY, Carlsbad, CA, USA, and Auburn University Hybridoma Facility). The antibodies used were: anti-phospho-threonine (14B3) antibody (Calbiochem, Billerica,
MA), p38 and phospho-p38 antibodies (Cell Signaling Technology, Beverly, MA), anti-
HA antibody (Abcam, Cambridge, MA and Georgia State University, Animal Center
Facility, Atlanta, GA), anti-GAPDH antibody (Millipore, Billerica, MA) and Flag antibody
(Sigma, St. Louis, MO).
2.5.2 Drug Treatment, DNA constructs, Transfections, and siRNA Interference
Oxaliplatin was bought from Sigma (Sigma, St. Louis, MO). It was diluted with medium to prepare working concentrations. The cDNA of p68 ORF was subcloned into pHM6 vector at HindIII site to get HA-tagged p68 expression vector. The various p68 single and double threonine mutants (threonine replaced by alanine) were made using
Quick-Change mutagenesis kit (Stratagene, Cedar reek, TX) and the mutations were confirmed by DNA sequencing. P38α cDNA (Origene, Rockville, MD) was subcloned into p3XFLAG-myc-CMV™-24 Expression Vector (Sigma, St. Louis, MO). A number of mutations to obtain the constitutively activated p38 MAP-kinase was done according to the studies performed by Diskin and colleagues (Diskin, Askari et al. 2004). All DNA transfections were done using fugene HD and lipofectamine 2000 (Invitrogen, Grand
Island, NY) while siRNA knockdown was done with lipofectamine RNAimax (Invitrogen,
Grand Island, NY). SiRNA against p68 was purchased from Dharmacon (Thermo Fisher
Scientific Dharmacon, Lafayette, CO), and the sequence was as follows: siRNA oligonucleotides against p68 (sense: 5’-GCAAGUAGCUGCUGAAUAUUU-3’; antisense:
5’-AUAUUCAGCAGCUACUUGCUU-3’). Cells were transfected after p68-siRNA 114 knockdown and further treated with the drug for 24 hrs. The cells were then harvested for nuclear extract preparation as p68 is a predominantly nuclear protein using a kit from
Active motif (Active motif, Carlsbad, CA).
2.5.3 Protein Expression and Purification
The procedure used to express and purify p68 was similar to the procedure reported previously. P68 ORF was cloned as well as various mutants into expression vector pET-30a+ using the restriction sites Bam HI/Hind III and subsequently used to transfer on E.coli BL21-CodonPlus bacteria (Stratagene, Cedar Reek, TX) to express protein. The bacteria were subcultured in fresh sterile Luria Bertani (LB) broth until optical density at A600 reached around 0.6. Bacteria were subsequently induced with
IPTG at 16°C overnight for protein expression. The cells were pelleted and stored. The cells were then lyzed by freeze-thaw cycle at -80°C and further lysed in lysis buffer (50 mM Tris-HCl pH 8.0, 300 mM NaCl, 1 mM DTT, 10 mM PMSF, 10% glycerol). They were then subjected to lysozyme (0.5 mg/ml) digestion to ensure complete lysis of the cells. DTT and PMSF were also added at 1 mM final concentration. DTT reduces the disulphide bonds of proteins thereby preventing them from linking the cysteine residues of proteins while PMSF inactivates proteases that digest proteins after cell lysis. The cells were further subjected to ultrasonication and pelleted. After centrifugation, the expressed protein was precipitated which was dissolved in denaturing buffer containing
8 M urea, 250 mM NaCl, 50 mM Tris-HCl pH 8.0, and 0.2% Triton-100. The lysate was passed through Ni-NTA column for purification of recombinant protein by affinity separation and was washed with the denaturing wash buffer (8 M urea, 50 mM Tris-HCl 115 pH 8.0, 250 mM NaCl, 0.2% Triton-100 and 20 mM imidazole pH 8.0). Elution buffer
(250 mM imidazole, 8 M urea, 50 mM Tris-HCl pH 8.0, 250 mM NaCl, 0.2% Triton-100,
0.5 mM DTT and 10% glycerol) was used to elute the protein. The eluted protein solution was refolded using stepwise dialysis procedure (8M→ 6M→ 4M→ 2M→ 0M) to remove urea using refolding buffer (200 mM arginine, 50 mM Tris-HCl pH 8.0, 250 mM
NaCl, 0.2% Triton-100, 0.5 mM DTT and 10% glycerol) and preserved in further 15 to
20% glycerol.
2.5.4 In Vitro Kinase Assay
In the kinase assay, the 25 μl reaction consisted of 1 μg of purified proteins, 200-
250 ng of p38α/SAPK2a enzyme (Upstate cell signaling, Beverly, MA), 10 μCi/μl of [γ-
32P]ATP, 5X buffer (125 mM Tris-HCl, pH 7.5 and 0.1 mM EGTA), and
Magnesium/ATP cocktail (75 mM MgCl2 and 500 μM ATP in 20 mM MOPS, pH 7.2, 25 mM β-glycerol phosphate, 1 mM sodium orthovanadate, 5 mM EGTA, and 1 mM DTT).
The 5X-loading buffer (Fermentas, Glen Burnie, MA) was added after incubation of the reaction mixtures at 30°C for 30 mins. Two 10% SDS-PAGE gels were run to analyse the samples. One of the gels was subjected to autoradiography while other one was treated with Coomassie blue solution followed by destaining.
2.5.5 Cell Viability and Apoptosis Assay
Cell viability of HCT116 cells was analyzed by MTT (Sigma, St. Louis, MO) assay. 4000 cells were seeded 24 hrs before either knockdown or transfection of cells with vectors containing p68 and the mutants. Subsequently, 24 hrs after transfection, 116 the cells were induced for apoptosis by oxaliplatin treatment. The next day, reconstituted MTT-reagent was added in an amount equal to 10% of the volume of the cell culture medium and incubated at 37°C. MTT Solubilization solution used to dissolve the formazan crystals formed during incubation was subsequently added. Cell viability was determined spectrophotometrically by measuring absorbance at A570. Cells plated on 6-well plates were treated with 10 μM oxaliplatin after p68 knockdown and transfection and caspase-3/CPP32 colorimetric assay kit (Biovision Research Products,
Milpitas, CA) was used for measuring caspase-3 cleavage. Briefly, after apoptosis induction, the cells were lyzed in Cell Lysis Buffer for 10 mins, centrifuged and subjected to cleavage assay. The reaction consisted of cell lysate diluted in Cell Lysis
Buffer, 2X Reaction buffer, and 4 mM DEVD-pNA substrate. The samples were read at
A405 using a microtiter plate reader. FITC-Annexin V Apoptosis Detection Kit
(BDBiosciences, San Jose, CA) was also used to measure apoptosis induced by oxaliplatin.
2.6 REFERENCES
Ang, W. H., M. Myint, et al. (2010). "Transcription inhibition by platinum-DNA cross-links in live mammalian cells." Journal of the American Chemical Society 132(21): 7429-
7435.
Causevic, M., R. G. Hislop, et al. (2001). "Over-expression and poly-ubiquitylation of the
DEAD-box RNA helicase p68 in colorectal tumours." Oncogene 20(53): 7734-
7743. 117
Chiu, S. J., J. I. Chao, et al. (2008). "Regulation of gamma-H2AX and securin contribute
to apoptosis by oxaliplatin via a p38 mitogen-activated protein kinase-dependent
pathway in human colorectal cancer cells." Toxicology letters 179(2): 63-70.
Chiu, S. J., Y. J. Lee, et al. (2009). "Oxaliplatin-induced gamma-H2AX activation via
both p53-dependent and -independent pathways but is not associated with cell
cycle arrest in human colorectal cancer cells." Chemico-biological interactions
182(2-3): 173-182.
Crawford, L., K. Leppard, et al. (1982). "Cellular proteins reactive with monoclonal
antibodies directed against simian virus 40 T-antigen." Journal of virology 42(2):
612-620.
De Chiara, G., M. E. Marcocci, et al. (2006). "Bcl-2 Phosphorylation by p38 MAPK:
identification of target sites and biologic consequences." The Journal of biological
chemistry 281(30): 21353-21361.
Deschesnes, R. G., J. Huot, et al. (2001). "Involvement of p38 in apoptosis-associated
membrane blebbing and nuclear condensation." Molecular biology of the cell
12(6): 1569-1582.
Diskin, R., N. Askari, et al. (2004). "Active mutants of the human p38alpha mitogen-
activated protein kinase." The Journal of biological chemistry 279(45): 47040-
47049.
Faivre, S., T. Le Chevalier, et al. (2002). "Phase I-II and pharmacokinetic study of
gemcitabine combined with oxaliplatin in patients with advanced non-small-cell
lung cancer and ovarian carcinoma." Annals of oncology : official journal of the
European Society for Medical Oncology / ESMO 13(9): 1479-1489. 118
Fischel, J. L., P. Formento, et al. (2002). "Impact of the oxaliplatin-5 fluorouracil-folinic
acid combination on respective intracellular determinants of drug activity." British
journal of cancer 86(7): 1162-1168.
Gong, X., X. Ming, et al. (2010). "Mechanisms regulating the nuclear translocation of
p38 MAP kinase." Journal of cellular biochemistry 110(6): 1420-1429.
Gonzalez-Mejia, M. E., O. H. Voss, et al. (2010). "Apigenin-induced apoptosis of
leukemia cells is mediated by a bimodal and differentially regulated residue-
specific phosphorylation of heat-shock protein-27." Cell death & disease 1: e64.
Gould, G. W., A. Cuenda, et al. (1995). "The activation of distinct mitogen-activated
protein kinase cascades is required for the stimulation of 2-deoxyglucose uptake
by interleukin-1 and insulin-like growth factor-1 in KB cells." The Biochemical
journal 311 ( Pt 3): 735-738.
Holmes, W. F., D. R. Soprano, et al. (2003). "Early events in the induction of apoptosis
in ovarian carcinoma cells by CD437: activation of the p38 MAP-kinasesignal
pathway." Oncogene 22(41): 6377-6386.
Lane, D. P. and W. K. Hoeffler (1980). "SV40 large T shares an antigenic determinant
with a cellular protein of molecular weight 68,000." Nature 288(5787): 167-170.
Lee, J. H., S. B. Rho, et al. (2005). "GABAA receptor-associated protein (GABARAP)
induces apoptosis by interacting with DEAD (Asp-Glu-Ala-Asp/His) box
polypeptide 47 (DDX 47)." Biotechnology letters 27(9): 623-628.
Liu, W. M., R. J. Liu, et al. (2010). "[GammaH2AX-mediated repair of DNA damaged
sperm in the zygote]." Zhonghua nan ke xue = National journal of andrology
16(4): 349-353. 119
Lu, Q., T. F. Rau, et al. (2011). "Increased p38 mitogen-activated protein kinase
signaling is involved in the oxidative stress associated with oxygen and glucose
deprivation in neonatal hippocampal slice cultures." The European journal of
neuroscience 34(7): 1093-1101.
New, L. and J. Han (1998). "The p38 MAP-kinasepathway and its biological function."
Trends in cardiovascular medicine 8(5): 220-228.
Perfettini, J. L., M. Castedo, et al. (2005). "Essential role of p53 phosphorylation by p38
MAPK in apoptosis induction by the HIV-1 envelope." The Journal of
experimental medicine 201(2): 279-289.
Perfettini, J. L., M. Castedo, et al. (2005). "Mechanisms of apoptosis induction by the
HIV-1 envelope." Cell death and differentiation 12 Suppl 1: 916-923.
Rakitina, T. V., I. A. Vasilevskaya, et al. (2007). "Inhibition of G1/S transition potentiates
oxaliplatin-induced cell death in colon cancer cell lines." Biochemical
pharmacology 73(11): 1715-1726.
Raymond, E., S. Faivre, et al. (1998). "Oxaliplatin: mechanism of action and
antineoplastic activity." Seminars in oncology 25(2 Suppl 5): 4-12.
Shtil, A. A., S. Mandlekar, et al. (1999). "Differential regulation of mitogen-activated
protein kinases by microtubule-binding agents in human breast cancer cells."
Oncogene 18(2): 377-384.
Stevenson, R. J., S. J. Hamilton, et al. (1998). "Expression of the 'DEAD-box' RNA
helicase p68 is developmentally and growth regulated and correlates with organ
differentiation/maturation in the fetus." The Journal of pathology 184(4): 351-359. 120
Tanos, T., M. J. Marinissen, et al. (2005). "Phosphorylation of c-Fos by members of the
p38 MAPK family. Role in the AP-1 response to UV light." The Journal of
biological chemistry 280(19): 18842-18852.
Uhlmann-Schiffler, H., S. Kiermayer, et al. (2009). "The DEAD-box protein Ddx42p
modulates the function of ASPP2, a stimulator of apoptosis." Oncogene 28(20):
2065-2073.
Wang, D., H. Li, et al. (2005). "Humanin delays apoptosis in K562 cells by
downregulation of P38 MAP kinase." Apoptosis : an international journal on
programmed cell death 10(5): 963-971.
Wang, D. and S. J. Lippard (2005). "Cellular processing of platinum anticancer drugs."
Nature reviews. Drug discovery 4(4): 307-320.
Wang, X., M. Li, et al. (2006). "The BH3-only protein, PUMA, is involved in oxaliplatin-
induced apoptosis in colon cancer cells." Biochemical pharmacology 71(11):
1540-1550.
Wood, L. J., L. M. Nail, et al. (2006). "The cancer chemotherapy drug etoposide (VP-16)
induces proinflammatory cytokine production and sickness behavior-like
symptoms in a mouse model of cancer chemotherapy-related symptoms."
Biological research for nursing 8(2): 157-169.
Xia, Z., M. Dickens, et al. (1995). "Opposing effects of ERK and JNK-p38 MAP kinases
on apoptosis." Science 270(5240): 1326-1331.
Yang, L., C. Lin, et al. (2005). "Phosphorylations of DEAD-box p68 RNA helicase are
associated with cancer development and cell proliferation." Molecular cancer
research : MCR 3(6): 355-363. 121
Yang, L., C. Lin, et al. (2006). "P68 RNA helicase mediates PDGF-induced epithelial
mesenchymal transition by displacing Axin from beta-catenin." Cell 127(1): 139-
155.
Yang, L., C. Lin, et al. (2007). "A double tyrosine phosphorylation of P68 RNA helicase
confers resistance to TRAIL-induced apoptosis." Oncogene 26(41): 6082-6092.
Yang, T. T., Q. Xiong, et al. (2002). "Phosphorylation of NFATc4 by p38 mitogen-
activated protein kinases." Molecular and cellular biology 22(11): 3892-3904.
Zarubin, T. and J. Han (2005). "Activation and signaling of the p38 MAP-
kinasepathway." Cell research 15(1): 11-18.
122
A B 70
60 50 Oxa (μM) 0 20 80 160 40 Series1 IB: 14B3 30
20 % cells apoptotic
IP: p68 IB: p68
% apoptotic cells % apoptotic 10
0 01 202 403 804 Oxa concentration (µM)
C D
Oxa (μM) 0 20 80 160 IB: 14B3 Time (hrs) 0 1 2 4 6 24
IB: 14B3 IP: p68
Adherent IB: p68
IP: p68 IB: p68
IB: 14B3 IP: p68
Floating IB: p68
Figure 2.1. Threonine phosphorylation of p68 in HCT116 cells following oxaliplatin (Oxa) treatment.
(A) Apoptosis of HCT116 cells induced by different concentrations of oxaliplatin was measured and presented as percent of apoptotic cells after 24 hours treatment. Error bars represented standard deviations of four independent experiments.
(B), (C), and (D) Threonine phosphorylations of p68 measured by immunoblotting using anti-phospho-threonine antibody (14B3) (1:1000 dilution) in HCT116 cells that were treated with different oxaliplatin concentration (B) and (C), or 20 μM of oxaliplatin for 123 different times (D) were analyzed by immunoblotting the p68 that was immunoprecipitated (IP: p68) using antibody against anti-phospho-threonine (IB: 14B3).
The immunoblot of p68 (IB: p68) in the immunoprecipitates represented the amount of p68 that was precipitated. In (C), the analyses were carried out with the cells that were already detached and the cells that were still adherent following the treatment for 24 hours.
124
A Time (hrs) 0 1 2 4 6 24 B
IB: 14B3 IP: p68 IP: IgG Oxa - + +
IP: p68 IB: p68 IB: p38
IB: p-p38 IB: p68
IB: p38
F327L C D - p38WT FLAG-p38 Vec D176A
p68 p38 IB: 14B3 BSA BSA+p38 p68+p38 Auto- p68 radiography p38 IP: p68 IB: p68
p68 CBS BSA IB: FLAG
IB: GAPDH
Figure 2.2 P68 Phosphorylation by p38 MAP-kinase
(A) Threonine phosphorylation of p68 in HCT116 cells following treatment of the cells with 20 μM of oxaliplatin for different times were analyzed by immunoblotting the p68 that was immunoprecipitated (IP: p68) using antibody against phospho-threonine (IB:
14B3) from the cell lysates. Phosphorylation of p38 MAP-kinase during the same treatment was analyzed by immunoblot of cell lysates using antibody against the phosphorylated p38. The immunoblot of p68 (IB: p68) in the immunoprecipitates represented the amount of p68 that was precipitated. The immunoblot of p38 in the cell lysate (IB: p38) indicated the cellular levels of p38 as a control. 125
(B) Coimmunoprecipitation of p38 and p68 in the cell extracts of HCT116 cells with/without oxaliplatin treatment (Oxa, +/-) was analyzed by p68 immunoblot with p68 antibody after immunoprecipitation (IP: p68) and by using antibody against p38 (IB: p38). The immunoblot of p68 (IB: p68) from the immunoprecipitates represented the amount of p68 that was precipitated. The IP: IgG was the immunoprecipitation using rabbit IgG, serving as a negative control IP.
(C) Phosphorylation of recombinant His-p68, or BSA as a control, by recombinant p38 was demonstrated by autoradiography. The amount of protein used in the phosphorylation reactions was shown by Coomassie Blue Staining (CBS).
(D) Phosphorylation of p68 by overexpression of Flag-tagged p38 MAPK, wild-type and constitutively active mutant D176A-F327L, in HCT116 cells was analyzed by immunoblotting the p68 that was immunoprecipitated (IP: p68) using antibody against phospho-threonine (IB: 14B3). The immunoblot of p68 (IB: p68) in immunoprecipitates represented the amount of p68 that was precipitated. The immunoblot of Flag-tag (IB:
FLAG) indicated the overexpressed p38 levels. The immunoblot of GAPDH (IB:
GAPDH) served as a loading control.
126
A B MEF2C Q S L A T P V V S His-p68 WT T610A T564A T224A MAPKAPK2 K V P Q T P L H T Autoradiography ATF-2 D Q T P T P T R F P68-T610 Y P M P T G Y S Q CBS P68-T564 T G N P T G T Y Q P68-T446 Y T F F T P N N I P68-T224 I C I A T P G R L
His-p68 WT T564/446A T446/224A C Autoradiography HA-p68 Vec WT T610A T564A T556A T446AT224A
IB: 14B3 CBS
IP: HA IB: p68
HA-p68 Vec WT T564/446A T446/224A Oxa - + - + - + - +
IB: 14B3 IP: HA IB: p68
Figure 2.3 Phosphorylation site(s) of p68 by p38 MAPK
(A) Prediction of potential p38 MAP-kinase-induced phosphorylation site(s) in the p68- reading frame and compared to consensus p38 MAPK phosphorylation sites of several authentic p38 MAP-Kinase substrates by a web-based phosphorylation-site prediction program NetPhos 2.0, (B) Phosphorylation of recombinant His-p68 and mutants with single site mutation (Upper) and double site mutations (Lower) by recombinant p38 was demonstrated by autoradiography. The amount of protein used in the phosphorylation reactions was shown by Coomassie Blue Staining (CBS). (C) Phosphorylation of overexpressed HA-p68s, wild type (WT) and mutants (Single site mutation, Upper, and
Double site mutations, Lower), in HCT116 cells with/without oxaliplatin treatment (Oxa, 127
+/-) was analyzed by immunoblotting the p68 that was immunoprecipitated (IP: p68) using antibody against phospho-threonine (IB: 14B3). The immunoblot of p68 (IB: p68) from immunoprecipitates represented the amount of p68 that was precipitated.
128
Figure 2.4 Effects of p68 phosphorylation on cell apoptosis
(A) HCT116 cells were treated by non-targeting siRNA (NT) or siRNA targeting p68
(p68) to knockdown p68 for 24 hours. Wild type and the different mutants of p68 were overexpressed in the p68 knockdown cells. P68 (IB: p68) immunoblot represented the cellular levels of p68 (both endogenous and overexpressed). The immunoblot of
GAPDH (IB: GAPDH) served as a loading control.
Cell apoptosis (B) and viability (C) of the cells in (A) that were treated or untreated with oxaliplatin were measured by a caspase-3 apoptosis kit (B) or MTT assay (C). The cell apoptosis and viability were presented as relative apoptosis and relative viability by defining the apoptosis and viability of the vector expressing cells without oxaliplatin treatment as 1. Error bars represented standard deviations of four independent experiments. 129
CHAPTER 3
P68 RNA HELICASE REGULATES THE EXPRESSION OF TUBULIN
POLYMERIZATION PROMOTING PROTEIN INVOLVED IN NEURITE
OUTGROWTH AND GLIOMA SUPPRESSION
3.1 ABSTRACT
P68 RNA helicase is a RNA helicase with DEAD-box motif. It functions in the regulation of gene transcription. Previous studies revealed that p68 regulates the expression of several genes whose products are required in controlling the stability and dynamics of different cytoskeleton. Experiments were designed to characterize the function of p68 in transcriptional regulation of tubulin polymerization-promoting protein
(TPPP/p25). P68 is shown to mediate transcriptional regulation of TPPP/p25 gene by associating with TPPP/p25 gene promoter. Expression of TPPP/p25 and its regulation by p68 is found to be an important event for cell differentiation and neurite outgrowth.
Loss of TPPP/p25 expression contributes to the development and progression of gliomas. The studies performed reveal an important molecular factor that regulates
TPPP/p25 to mediate the regulation of differentiation induced by the growth-factor.
3.2 INTRODUCTION
TPPP/p25 was thought to be expressed only in nervous tissues, including in neural cells and myelinating oligodendrocytes (Takahashi, Tomizawa et al. 1993)
(Takahashi, Tomizawa et al. 1991) (Kovacs, Laszlo et al. 2004). Careful analyses revealed that TPPP/p25 is expressed in many tissue types, including liver, heart, and 130 lung tissues (Acevedo, Li et al. 2007). However, the elevated levels of the protein are only observed in a few specific tissue types. The detailed cellular function of TPPP/p25 is not yet well defined. It is believed that the protein is likely involved in stabilizing the microtubular structure/network to maintain specific cell shape or morphology (Lehotzky,
Tirian et al. 2004) (Hlavanda, Kovacs et al. 2002). Abnormal expression of TPPP/p25 has been associated with a number of pathological conditions (Kovacs, Laszlo et al.
2004). Abnormally high levels of TPPP expression that lead to protein deposition is an important characteristic of several neurodegenerative diseases, such as multiple system atrophy (MSA) and Parkinson’s disease (Kovacs, Laszlo et al. 2004) (Kovacs, Gelpi et al. 2007) (Lindersson, Lundvig et al. 2005). Very high levels of TPPP/p25 have been observed to closely correlate with multiple sclerosis (MS) progression (Vincze, Olah et al. 2011). TPPP/p25 expression is almost completely lost in oligodendrogliomas, indicating a critical role of the protein in the disease development and progression
(Preusser, Lehotzky et al. 2007).
P68 RNA helicase is a RNA helicase with DEAD-box motif (Lane and Hoeffler
1980; Crawford, Leppard et al. 1982). It is implicated in cellular proliferation and differentiation (Stevenson, Hamilton et al. 1998), and its abnormal expression is linked to cancer progression (Causevic, Hislop et al. 2001). It is implicated by several independent studies that p68 is involved in regulating the transcription of several genes, including estrogen receptor alpha (ERα) (Endoh, Maruyama et al. 1999), and p53- regulated genes (Bates, Nicol et al. 2005). It interacts with RNA Pol II and p300/CBP
(Rossow and Janknecht 2003). However, molecular mechanism of p68 to execute transcriptional regulation is not well understood. P68 interacts with histone deacetylase 131
1 (HDAC1) to functionally regulate gene expression (Wilson, Bates et al. 2004). Studies suggested the functional involvement of p68 in chromatin remodeling through modulation of various protein interactions in the large, assembled chromatin remodeling-complex, Mi-2/NuRD. This suggests a novel mechanism by which p68 RNA helicase regulates gene expression (Carter, Lin et al. 2010). In this study, p68 is found to be functionally involved in regulating TPPP/p25 expression. P68 regulates the expression of TPPP/p25, and thus, consequently, controls the differentiation of neuronal cells. TPPP/p25 has been shown to be dramatically downregulated in human brain tumors (Preusser, Lehotzky et al. 2007). Our results show that expression of TPPP/p25 in glioma cells significantly reduces the cell growth, indicating a therapeutic potential of this protein.
3.3 RESULTS
3.3.1 P68 RNA helicase regulates transcription of TPPP/p25 gene.
P68 RNA helicase transcriptionally regulates several genes (Endoh, Maruyama et al. 1999) (Bates, Nicol et al. 2005) (Rossow and Janknecht 2003). To further understand the function of p68 in transcription regulation, we carried out a ChIP–on-
Chip study with SW620 colon cancer cells using antibody against p68 and human promoter Tiling 1.0R array (Affymetrix, Santa Clara, CA) which is a single array consisting of probes spanning a subset of human promoter regions selected from NCBI human genome assembly. ChIP-on-Chip analysis indicated that p68 interacted with the promoters of a number of cytoskeleton-regulating genes (Table 3.1). Tubulin
Polymerization Promoting Protein (TPPP/p25) showed a high affinity for the p68 132 promoter from the ChIP-on-ChIP results. Subsequently, ChIP experiments were performed to confirm data from the ChIP-on-Chip analyses of TPPP/p25 promoter using antibody against p68, and suggested that p68 interacted with the TPPP/p25 promoter
(Fig 3.1A). To further confirm the data from ChIP that p68 RNA helicase indeed regulated TPPP/p25 expression, we used RT-PCR analysis to probe the effects on
TPPP/p25 gene expression by knocking down p68 from the cells by siRNA. Data from these analyses indicated that p68 knockdown down-regulated the expression of
TPPP/p25 (Fig 3.1B). Quantitative RT-PCR analysis demonstrated that p68 knockdown decreases TPPP/p25 mRNA by almost 3-fold (Fig 3.1C). Next, the effect of p68 knockdown in the regulation of TPPP/p25 expression at the protein level was further verified by immunoblot analysis. Knockdown of p68 decreases TPPP/p25 protein expression levels in the cells (Fig 3.1D). Overexpression of p68 in the cells after p68 knockdown restored the downregulation of TPPP/p25 expression (Fig. 3.1E). These results together suggested that p68 played a role in TPPP/p25 gene transcription.
3.3.2 P68 RNA helicase regulates the neurite outgrowth of PC12 neuronal cells.
The preceeding experiments demonstrated that p68 regulates TPPP/p25 expression. Next, we explored the physiological relevance of this regulation. To address this issue, we used PC12 cells as our study system. PC12 cells (ATCC, Manassas, VA) are rat adrenal gland pheochromocytoma cells which can differentiate into cells resembling neurons with Nerve-Growth Factor (NGF) stimulation (Greene and Tischler
1976). The expression levels of TPPP/p25 in PC12 cells were first examined using immunoblot analysis. The results showed that TPPP/p25 was expressed in these cells 133
(Fig 3.2A). TPPP/p25 expression was increased upon stimulation of the PC12 cells for 3 days. This increase correlated with the neurite outgrowth of the PC12 cells under NGF stimulation (Fig 3.2B). To further evaluate whether TPPP/p25 expression plays a role in the differentiation, TPPP/p25 was knocked-down in the PC12 cells (Fig. 3.2C). The
TPPP/p25 knockdown cells were induced for differentiation with 50 ng/ml NGF treatment. Data analysis showed that neurite outgrowth was reduced under NGF stimulation, while it was apparent in the cells treated with non-specific siRNA (Fig.
3.2D). We questioned whether the regulation of TPPP/p25 expression by p68 RNA helicase has any functional significance in controlling the differentiation of PC12 cells to neurons. Thus, p68 was knocked-down in PC12 cells. As expected, TPPP/p25 levels in the p68 knockdown PC12 cells were reduced (Fig 3.2E & F). The p68 knockdown PC12 cells were subsequently induced for differentiation by the NGF treatment. It was evident that the PC12 cells displayed a significantly reduced number of neurites upon NGF treatment with p68 knockdown (Fig 3.2G). These experiments indicated that p68 plays a role in PC12 differentiation via regulation of TPPP/p25 transcription.
3.3.3 TPPP/p25 expression plays a role in the progression of gliomas.
High levels of TPPP/p25 are observed in oligodendrocytes and neurons. Upon development and progression of oligodendrogliomas, TPPP/p25 expression is decreased until undetectable (Preusser, Lehotzky et al. 2007). The TPPP/p25 levels in
10 different glioma tissue samples with same number of normal brain tissue sections were examined. Histology analyses revealed that TPPP/p25 levels were very high in both oligodendrocytes and neuronal cells in the normal brain tissues. However, in the 134 corresponding sites from glioma tissues, TPPPp25 levels were very low or undetectable
(Fig 3.3A). Thus, histology analyses suggested that loss of TPPP/p25 expression correlates with the development and progression of the disease. To understand whether
TPPP/p25 expression is involved in glioma development, the growth of several human glioma cell-lines specifically, T98G (ATCC, Manassas, VA), U87MG (ATCC, Manassas,
VA), and LN229 (ATCC, Manassas, VA) were examined after overexpressing
TPPP/p25. We first probed the expression levels of TPPP/p25 in these selected cell lines using RT-PCR and immunoblot analyses. The analyses showed that TPPP/p25 was poorly expressed, if at all in these gliomas cells (Fig. 3.3B & C). We then analyzed its overexpression effects on the cell proliferation of these selected cells transfected with FLAG-TPPP/p25 expression plasmid. TPPP/p25 over-expression led to high levels of expression of TPPP/p25 protein relative to vector alone transfected cells (Fig 3.3D).
Cell proliferation and viability of the TPPP/p25 expressing cells were analyzed by BrDU cell proliferation assay. Expression of TPPP/p25 dramatically decreased the cell proliferation rate of these glioma cells as shown by use of histology and BrDU assay
(Fig 3.3E & F). We further analyzed whether the effects of expression of TPPP/p25 on the growth was mediated by cell apoptosis. To this end, we probed for activation of caspase-3 due to TPPP/p25 expression in T98G and U87MG cells. Data shown in figure 3.3G show that caspase-3 was not activated with or without TPPP/p25 expression (Fig 3.3G). Since TPPP/p25 is a microtubule associated protein (Hlavanda,
Kovacs et al. 2002), we measured the microtubule stability upon TPPP/p25 expression in T98G cells. Analysis of these experiments demonstrated that expression of
TPPP/p25 in these glioma cells caused an increase in microtubule stability. The levels 135 of acetylated tubulin, a modified tubulin that has high tendency to polymerize and is a measure of microtubule stability (Piperno, LeDizet et al. 1987), increased (Fig 3.3H).
3.4 DISCUSSION
In this report, regulation of expression of TPPP/p25 gene is described. P68 is shown to mediate transcriptional regulation of TPPP/p25 gene by associating with
TPPP/p25 gene promoter. The study suggests that p68 is functionally involved in neuronal differentiation, which echoes early observations showing that p68 plays a role in differentiation of adipocytes and skeletal muscle cells (Caretti, Schiltz et al. 2006)
(Kitamura, Nishizuka et al. 2001).
Molecular mechanism by which p68 regulates TPPP/p25 expression is still not known. Clearly, p68 is expressed in high levels in undifferentiated PC12 cells, while
TPPP/p25 levels increase beyond this level during differentiation. There maybe two explanations for the observations: p68 is necessary, but not sufficient for upregulation of
TPPP/p25 expression, and other factors are also required in concert to regulate
TPPP/p25 expression and activate cell differentiation programs; p68 may be posttranslationally modified with growth factor stimulation and may be only a modified sub-population of p68 is active in regulating TPPP/p25 expression. It has been reported that p68 undergoes various posttranslational modifications upon exposure to different growth factors and cytokines stimulation of specific cells (Yang, Lin et al. 2005; Yang,
Lin et al. 2006; Yang, Lin et al. 2007). These modified p68s function in a number of different cellular processes (Yang, Lin et al. 2005; Yang, Lin et al. 2006; Yang, Lin et al. 136
2007). It would be interesting to probe whether p68 is posttranslationally modified during induction of differentiation.
Abnormal overexpression and accumulation of TPPP/p25, and its association with other neuronal-aggregating proteins, are major causes for a number of neuronal degenerative diseases (Kovacs, Laszlo et al. 2004; Lindersson, Lundvig et al. 2005;
Kovacs, Gelpi et al. 2007). TPPP/p25 is believed to co-aggregate with tau and other cytoskeletal associated proteins and this leads to deposition of the peptides cleaved from these proteins especially under several stress conditions (Kovacs, Gelpi et al.
2007). On the other hand, reduction of TPPP/p25 expression in oligodendrogliomas is clearly associated with the development of the disease by an unknown mechanism
(Preusser, Lehotzky et al. 2007). Thus, regulation of the expression of TPPP/p25 needs to be finely balanced. Currently, molecular mechanisms that control TPPP/p25 expression are largely unknown. This report represents the first study of exploring the regulatory mechanism for TPPP/p25 gene expression.
TPPP/p25 is down-regulated in human brain tumors. Overexpression of
TPPP/p25 in transfected glioma cell-lines reduced cancer cell proliferation. How expression of TPPP/p25 arrests glioma cell growth is another unanswered question.
Our results demonstrate that expression of TPPP/p25 does not activate the caspase-3 mediated cell apoptosis signaling. Furthermore, our results showed that the stability of microtubules is increased with the expression of TPPP/p25, suggesting a possibility of interrupting cell-cycle progression at mitosis, where both polymerization/deploymerization of microtubules is supposed to be active. This notion is consistent with one observation that TPPP/p25 expression affects the mitotic spindle 137 assembly. Alternatively, expression of TPPP/p25 may have a role in maintaining the differentiated state of neuronal cells, while loss of TPPP/p25 expression may be important for their de-differentiation.
3.5 MATERIALS AND METHODS
3.5.1 Reagents and Antibodies
NGF was bought from Sigma (Sigma, St. Louis, MO). P68 antibodies were raised against C-terminal domain of p68. Polyclonal antibody was generated from Auburn
University Hybridoma Facility while the monoclonal antibody was obtained from
Invitrogen (Invitrogen, Grand Island, NY). The different commercial antibodies used were: TPPP/p25 antibody from Santa Cruz, Santa Cruz, CA and Abcam, Cambridge,
MA, GAPDH antibody (Millipore, Billerica, MA), caspase-3 and cleaved caspase-3 antibodies (Cell Signaling Technology, Beverly, MA), acetylated tubulin antibody (Cell
Signaling Technology, Beverly, MA) and lamin A/C antibody (Cell Signaling Technology,
Beverly, MA).
3.5.2 Cell Culture, DNA constructs, Transfections, and siRNA Interference
PC12 (Catalog # CRL-1721), HeLa (Catalog # CCL-2), T98G (Catalog # CRL-
1690) and U87MG (Catalog # HTB-14) cells were obtained from ATCC (ATCC,
Manassas, VA). The cDNA of p68 ORF was subcloned into pHM6 (Roche, Indianapolis,
IN) vector at HindIII site to get HA-tagged p68 expression vector. TPPP/p25 cDNA
(Origene, Rockville, MD) was subcloned into p3XFLAG-myc-CMV™-24 Expression
Vector (Sigma, St. Louis, MO). Fugene HD (Roche, Indianapolis, IN) and lipofectamine 138
2000 (Invitrogen, Grand Island, NY) were used to carry out transfections. SiRNA knockdown was done using lipofectamine RNAimax (Invitrogen, Grand Island, NY). P68 siRNA was purchased from Dharmacon (Thermo Fisher Scientific Dharmacon,
Lafayette, CO). SiRNA oligonucleotides with random sequence (non-targeting) was used as negative control. The siRNA sequence was as follows: siRNA oligonucleotides against p68 (sense: 5’-GCAAGUAGCUGCUGAAUAUUU-3’; antisense: 5’-
AUAUUCAGCAGCUACUUGCUU-3’).
3.5.3 Cellular Extract Preparation, Immunoblot Analysis and Immunofluorescence staining
All cell lysates were prepared using 1X RIPA buffer and Bradford assay (Bio-
Rad, Hercules, CA) was used to determine protein concentration. Immunoblot analyses were performed by a previously developed procedure (Liu, Z. R., Sargueil, B. et al.
1998). The immunocomplexes were visualized by chemiluminescence with Supersignal
West Dura Extended Substrate (Pierce, Thermo Fisher Scientific Dharmacon, Lafayette,
CO) and goat anti-mouse IgGs or anti-rabbit IgGs coupled to horseradish peroxidase were used as secondary antibodies (Thermo Fisher Scientific Dharmacon, Lafayette,
CO). The immunofluorescence and confocal imaging procedures were very similar to previous studies (Yang, Lin et al. 2006). Immunohistochemical staining of normal and glioma tissue sections was done by Dr. Daniel Brat’s laboratory using tissue sections obtained from Emory’s tissue bank.
139
3.5.4 RT-PCR
Total RNA extraction kit (Qiagen, Valencia, CA) was used to carry out RNA isolation and Improm II reverse transcription system (Promega, Madison, WI) was used for RT-PCR. The cDNA used in the reaction consisted of cDNA, forward and reverse primers and 1X master mix from Promega (Promega, Madison, WI). The PCR cycle was as: 94°C for 15 sec, 55°C for 30 sec, and 72°C for 30 sec with an additional extension time of 10 mins. RT-PCR results were analysed by running the samples on 2 to 3% agarose gels with ethidium bromide. Primers used were: TPPP/p25 (sense 5’-
CAGGTGAAGAGCCTGGAGTC-3’; antisense 5’- GTTTCCTTGTCTGTGGGTGAA-3’);
GAPDH (sense 5’- GAGTCAACGGATTTGGTCGT-3’; anti-sense 5’-
TTGATTTTGGAGGGATCTCG-3’). GAPDH was used as PCR loading control.
3.5.5 Chromatin Immunoprecipitation (ChIP)
ChIP Kit from IMGENEX (IMGENEX, San Diego, CA) was used for chromatin immunoprecipitation assays. The TPPP/p25 promoter was immunoprecipitated using p68 (poly-p68) antibody. TPPP/p25 promoter immunoprecipitation was detected by
PCR using primers: TPPP/p25 (sense 5’-CAGGTGAAGAGCCTGGAGTC-3’; antisense
5’-GTTTCCTTGTCTGTGGGTGAA-3’); GAPDH (sense 5’-
TACTAGCGGTTTTACGGGCG -3’) antisense 5’-TCGAACAGGAGGAGCAGAGAGCGA
-3’). RNA Pol II (IMGENEX, San Diego, CA) and rabbit IgG (Santa Cruz, Santa Cruz,
CA) antibodies were used for positive and negative controls respectively.
140
3.5.6 Cell Proliferation Assays
Cell proliferation analysis was performed using BrdU cell proliferation kit from
EMD Millipore (Millipore, Billerica, MA). Briefly, BrdU label was added for 18 hrs and the cells were subsequently incubated with anti-BrdU primary antibody (Millipore, Billerica,
MA) and goat anti-mouse secondary IgG (Millipore, Billerica, MA, peroxidase conjugate). The nuclei incorporation of BrdU was measured using a spectrophotometer microplate reader (Victor 3TM; PerkinElmer Life Sciences) at a wavelength of 450nm.
3.6 REFERENCES
Acevedo, K., R. Li, et al. (2007). "The phosphorylation of p25/TPPP by LIM kinase 1
inhibits its ability to assemble microtubules." Experimental cell research 313(20):
4091-4106.
Bates, G. J., S. M. Nicol, et al. (2005). "The DEAD-box protein p68: a novel
transcriptional coactivator of the p53 tumour suppressor." The EMBO journal
24(3): 543-553.
Caretti, G., R. L. Schiltz, et al. (2006). "The RNA helicases p68/p72 and the noncoding
RNA SRA are coregulators of MyoD and skeletal muscle differentiation."
Developmental cell 11(4): 547-560.
Carter, C. L., C. Lin, et al. (2010). "Phosphorylated p68 RNA helicase activates Snail1
transcription by promoting HDAC1 dissociation from the Snail1 promoter."
Oncogene 29(39): 5427-5436. 141
Causevic, M., R. G. Hislop, et al. (2001). "Over-expression and poly-ubiquitylation of the
DEAD-box RNA helicase p68 in colorectal tumours." Oncogene 20(53): 7734-
7743.
Crawford, L., K. Leppard, et al. (1982). "Cellular proteins reactive with monoclonal
antibodies directed against simian virus 40 T-antigen." Journal of virology 42(2):
612-620.
Endoh, H., K. Maruyama, et al. (1999). "Purification and identification of p68 RNA
helicase acting as a transcriptional coactivator specific for the activation function
1 of human estrogen receptor alpha." Molecular and cellular biology 19(8): 5363-
5372.
Greene, L. A. and A. S. Tischler (1976). "Establishment of a noradrenergic clonal line of
rat adrenal pheochromocytoma cells which respond to nerve growth factor."
Proceedings of the National Academy of Sciences of the United States of
America 73(7): 2424-2428.
Hlavanda, E., J. Kovacs, et al. (2002). "Brain-specific p25 protein binds to tubulin and
microtubules and induces aberrant microtubule assemblies at substoichiometric
concentrations." Biochemistry 41(27): 8657-8664.
Kitamura, A., M. Nishizuka, et al. (2001). "Expression of p68 RNA helicase is closely
related to the early stage of adipocyte differentiation of mouse 3T3-L1 cells."
Biochemical and biophysical research communications 287(2): 435-439.
Kovacs, G. G., E. Gelpi, et al. (2007). "The brain-specific protein TPPP/p25 in
pathological protein deposits of neurodegenerative diseases." Acta
neuropathologica 113(2): 153-161. 142
Kovacs, G. G., L. Laszlo, et al. (2004). "Natively unfolded tubulin polymerization
promoting protein TPPP/p25 is a common marker of alpha-synucleinopathies."
Neurobiology of disease 17(2): 155-162.
Lane, D. P. and W. K. Hoeffler (1980). "SV40 large T shares an antigenic determinant
with a cellular protein of molecular weight 68,000." Nature 288(5787): 167-170.
Lehotzky, A., L. Tirian, et al. (2004). "Dynamic targeting of microtubules by TPPP/p25
affects cell survival." Journal of cell science 117(Pt 25): 6249-6259.
Lindersson, E., D. Lundvig, et al. (2005). "p25alpha Stimulates alpha-synuclein
aggregation and is co-localized with aggregated alpha-synuclein in alpha-
synucleinopathies." The Journal of biological chemistry 280(7): 5703-5715.
Piperno, G., M. LeDizet, et al. (1987). "Microtubules containing acetylated alpha-tubulin
in mammalian cells in culture." The Journal of cell biology 104(2): 289-302.
Preusser, M., A. Lehotzky, et al. (2007). "TPPP/p25 in brain tumours: expression in non-
neoplastic oligodendrocytes but not in oligodendroglioma cells." Acta
neuropathologica 113(2): 213-215.
Rossow, K. L. and R. Janknecht (2003). "Synergism between p68 RNA helicase and the
transcriptional coactivators CBP and p300." Oncogene 22(1): 151-156.
Stevenson, R. J., S. J. Hamilton, et al. (1998). "Expression of the 'DEAD-box' RNA
helicase p68 is developmentally and growth regulated and correlates with organ
differentiation/maturation in the fetus." The Journal of pathology 184(4): 351-359.
Takahashi, M., K. Tomizawa, et al. (1993). "A brain-specific protein p25 is localized and
associated with oligodendrocytes, neuropil, and fiber-like structures of the CA3
hippocampal region in the rat brain." Journal of neurochemistry 60(1): 228-235. 143
Takahashi, M., K. Tomizawa, et al. (1991). "A novel brain-specific 25 kDa protein (p25)
is phosphorylated by a Ser/Thr-Pro kinase (TPK II) from tau protein kinase
fractions." FEBS letters 289(1): 37-43.
Vincze, O., J. Olah, et al. (2011). "A new myelin protein, TPPP/p25, reduced in
demyelinated lesions is enriched in cerebrospinal fluid of multiple sclerosis."
Biochemical and biophysical research communications 409(1): 137-141.
Wilson, B. J., G. J. Bates, et al. (2004). "The p68 and p72 DEAD-box RNA helicases
interact with HDAC1 and repress transcription in a promoter-specific manner."
BMC molecular biology 5: 11.
Yang, L., C. Lin, et al. (2005). "Phosphorylations of DEAD-box p68 RNA helicase are
associated with cancer development and cell proliferation." Molecular cancer
research : MCR 3(6): 355-363.
Yang, L., C. Lin, et al. (2006). "P68 RNA helicase mediates PDGF-induced epithelial
mesenchymal transition by displacing Axin from beta-catenin." Cell 127(1): 139-
155.
Yang, L., C. Lin, et al. (2007). "Phosphorylation of p68 RNA helicase plays a role in
platelet-derived growth factor-induced cell proliferation by up-regulating cyclin D1
and c-Myc expression." The Journal of biological chemistry 282(23): 16811-
16819.
144
Table 3.1 ChIP-on-ChIP analysis of cytokeletal genes regulated by p68.
ChIP-on-ChIP study was performed using SW620 cells with pAbp68 and human promoter Tiling 1.0R array (Affymetrix). These genes showed up on all the three different ChIP-on-ChIP experiments for high affinity binding to the p68 promoter.
ID Gene Name Cytoskeleton
NM_007030 Tubulin polymerization promoting protein Microtubule- associated
NM_021046 Keratin associated protein 5-8 Intermediate-filament binding protein
NM_177987.2 Tubulin-β 8 Microtubule- associated
NM_001146225.1 Keratin 72 Intermediate-filament associated
NM_001009931 Hornerin Intermediate-filament associated
NM_000445 Plectin 1, intermediate filament binding Intermediate-filament protein binding protein
NM_007183 Plakophilin 3 Intermediate-filament associated
145
A
ChIP Antibody ChIP Antibody
Input (1:10) Input DNA No
Input Pabp68 IgG POLII IgG
Primers : TPPP/p25 Promoter GAPDH Promoter
Figure 3.1A Chromatin immunoprecipitation (ChIP) of the TPPP/p25 promoter.
HeLa cells grown at 37ºC were harvested for ChIP analyses with either p68-specific antibody (pAbp68) or IgG antibody as a control. PCR products from sheared chromatin served as inputs. Control reactions were set up using ChIP by RNA POL II and IgG antibodies.
146
B siRNA NT p68
TPPP/p25 Primers GAPDH
C 3.5
3
2.5
2 Series1 1.5 Series2
1
0.5
Fold Change in Expression Change in Fold 0 siRNA NT 1 p68
Figure 3.1B & C Qualitative and quantitative RT-PCR demonstrating p68 regulation of TPPP /p25 mRNA expression.
Expression of TPPP/p25 was analyzed by qualitative RT-PCR (B) and real time RT-
PCR (C). Total RNA was isolated from the HeLa cells and used for RT-PCR. GAPDH
RT-PCR was used as a PCR loading control. RT-PCR samples containing no template, no reverse transcriptase or positive control template were additional controls employed.
147
D
siRNA NT p68
IB: P68
IB: TPPP/p25
IB: GAPDH
Figure 3.1D TPPP/p25 protein expression affected by p68 expression
Expression of TPPP/p25 and p68 in HeLa cells were determined by immunoblot analysis of TPPP/p25 and p68 antibodies respectively. The lysate was prepared from cells with non-target (NT) or siRNA targeting p68 (p68). Immunoblot analysis of GAPDH using GAPDH antibody was used as a loading control for loading of total cellular proteins.
148
E
siRNA NT p68
HA-p68 - - HA P68
IB: P68
IB: TPPP/p25
IB: GAPDH
Figure 3.1E P68 upregulates TPPP/p25 expression
Expression of TPPP/p25 and p68 in HeLa cells were determined by immunoblot analysis of TPPP/p25 and p68 antibodies respectively. The lysate was prepared from cells with non-target (NT) or siRNA targeting p68 (p68). HA vector and HA-p68 were exogenously expressed in the cells with p68 knockdown. Immunoblot analysis of
GAPDH using GAPDH antibody was used as a loading control for loading of total cellular proteins.
149
A
PC12 HCT-116
IB: TPPP/p25
IB: GAPDH
Figure 3.2A Expression of TPPP/p25 in PC12 cells
Immunoblot analysis of cellular extracts made from PC12 and HCT-116 cells was used to detect cellular level of TPPP/p25 by using TPPP/p25 antibody. HCT-116 cell lysate served as a positive control. Immunoblot analysis of GAPDH using GAPDH antibody was used as a loading control for loading of total cellular proteins.
150
B - NGF + NGF
NGF - +
IB: TPPP/p25
IB: GAPDH
Figure 3.2B NGF treatment upregulates TPPP/p25 expression
Phase contrast microscopy of PC-12 cells (Upper panel) cultured on poly-lysine with
NGF for 3 days (right column). The left column indicates PC12 cells grown in medium without NGF for 3 days. NGF concentration used was 50 ng/ml. Note the appearance of neurite outgrowth in NGF containing PC12 cell cultures. Expression of TPPP/p25 protein level in PC12 cells was examined by immunoblot analysis of cell lysate with
TPPP/p25 antibody. The cells were harvested for immunoblot analysis after treatment with NGF at 50ng/ml for 3 days. Immunoblot analysis with GAPDH antibody served as a control for equal loading.
151
C siRNA NT TPPP/p25
TPPP/p25 Primers GAPDH
Figure 3.2C Knockdown of TPPP/p25 in PC12 cells
Expression of TPPP/p25 after knockdown was detected by RT-PCR. GAPDH RT-PCR served as a PCR control for loading.
152
D NT NT
With No NGF NGF
K-TPPP/p25 K-TPPP/p25
Figure 3.2D TPPP/p25 regulates the differentiation of PC12 neuronal cells.
Immunofluorescent staining of PC12 cells after knockdown of TPPP/p25. TPPP/p25 was knocked down in PC12 cells with TPPP/p25 siRNA and non-target siRNA was a control. PC12 cells were then stimulated with NGF. NGF was used at 50ng/ml concentration for 3 days. The left columns indicate PC12 cells cultured in medium without NGF for 3 days while the right columns denote PC12 cells with NGF treatment.
The upper two panels represent non-targeting siRNA treated cells while the lower two panels represent TPPP/p25 knockdown cells. Tubulin antibody was used for detection of differentiation. Note the appearance of neurite outgrowth in NGF containing PC12 cell cultures.
153
E
siRNA NT p68
NGF - + - +
IB: TPPP/p25
IB: GAPDH
Figure 3.2E P68 upregulates TPPP/p25 expression under NGF treatment of PC12 neuronal cells at the RNA level.
Expression of TPPP/p25 was examined by RT-PCR. P68 was knocked down in the
PC12 cells and the cells were treated with and without NGF. NGF concentration used was 50 ng/ml. GAPDH RT-PCR served as a PCR control for loading.
154
F
siRNA NT p68
NGF - + - +
IB: P68
IB: TPPP/p25
IB: GAPDH
Figure 3.2F P68 upregulates TPPP/p25 protein expression under NGF treatment of
PC12 neuronal cells.
Expression of TPPP/p25 protein in PC12 cells was determined by immunoblot analysis with TPPP/p25 antibody. The cells were harvested for immunoblot analysis after knockdown with p68 siRNA (p68) and non-target (NT) siRNA served as a control. The cells were grown in with and without NGF medium for 2 days. NGF concentration used was 50 ng/ml. Immunoblot analysis with GAPDH antibody was used as a loading control.
155
G TPPP Tubulin DNA
NT -
NT +
K-p68 -
K-p68 +
Figure 3.2G P68 RNA helicase regulates the differentiation of PC12 neuronal cells.
Immunostaining of PC12 cells after knockdown of p68. PC12 cells with p68 siRNA and non-target siRNA were treated for 2 days with NGF. NGF was used at 50 ng/ml concentration. PC12 cells were stained with tubulin antibody for demonstration of microtubule rearrangement and differentiation and TPPP/p25 antibody to detect expression levels and distribution of TPPP/p25. Note the appearance of neurite outgrowth in NGF containing non-targeting PC12 cell cultures.
156
A Normal Brain Sections Glioblastoma Brain Sections
Figure 3.3A Immunohistochemical staining of TPPP/p25 in sections from normal brain and glioblastoma tissue sections.
Left two panels represent TPPP/p25 staining of normal brain tissue sections while the right two panels denote TPPP/p25 staining of representative cases of glioblastoma tissue sections. In the left two panels, TPPP/p25 expression in paraffin-embedded normal brain tissue specimens was evaluated using anti-TPPP/p25 antibody. Intense brown staining of TPPP/p25 is observed in neuronal cell bodies with diffuse staining of neuropil and neuronal processes. TPPP/p25 immunoreactivity is also observed in oligodendrocytes of non-tumor brain tissue sections. Endothelial cells also stain positive for TPPP/p25. Right two panels represent glioblastoma tissue sections lacking
TPPP/p25 expression in most tumor sections. Strong staining of vascular endothelial cells of native vascular structures and newly developing proliferating endothelial cells is also observed. Blue color indicates haematoxylin nuclear staining of the nuclei of all cells. 157
B
116 116
-
HCT
HEK HEK T98G U87MG LN229
TPPP/p25
Primers GAPDH
Figure 3.3B Expression of TPPP/25 in three different glioma cell-lines at the mRNA level.
RT-PCR analysis of RNA extracted from glioma cells, specifically, T98G, U87MG and
LN229 was performed using TPPP/p25 primers to detect endogenous TPPP/p25 RNA levels. HEK and HCT116 were used as positive controls of TPPP/p25 expression.
GAPDH RT-PCR served as a PCR control for loading.
158
C
116 116
-
HCT
MBE
HEK HEK T98G U87MG LN229
IB: P68
IB: TPPP/p25
IB: GAPDH
Figure 3.3C Expression of TPPP/25 in different glioma cell-lines at the protein level.
Immunoblot analysis of cell lysate prepared from different glioma cells was performed to detect endogenous protein levels using TPPP/p25 antibody. Correspondingly, p68 expression levels in these cells were also probed using p68 antibody. Mouse brain extract (MBE) was used as a positive control along with HEK and HCT-116 cell lysates.
Immunoblot with GAPDH antibody served as a loading control while TPPP/p25 protein was seen as a doublet in these cells.
159
D T98G U87MG
Vec TPPP/p25 Vec TPPP/p25
IB: TPPP/p25
IB: GAPDH
Figure 3.3D Analysis of TPPP/p25 expression in T98G and U87MG cells after transient overexpression of TPPP/p25.
Immunoblot analysis of T98G and U87MG cell lysate after transfecting with FLAG or
FLAG-TPPP/p25 (TPPP/p25) expression plasmid was done. Immunoblot analysis was performed with TPPP/p25 antibody and demonstrated abundant expression of
TPPP/p25 protein. Immunoblot with GAPDH antibody served as a loading control.
160
E T98G U87MG
TPPP/p25
Vector
Figure 3.3E TPPP expression effects on cellular proliferation and morphological features.
Methylene blue staining of T98G and U87MG cells 48 hrs after transfection with FLAG
(Vector) or FLAG-TPPP/p25 (TPPP/p25) was performed to detect morphological features. Two left panels represent T98G cell staining while two right panels denote
U87MG cell staining. Top two panels are U87MG and T98G cells with TPPP/p25 overexpression while bottom two panels represent U87MG and T98G cells without
TPPP/p25 overexpression. Note dendritic processes in TPPP/p25 transfected cells.
161
F T98G U87MG
0.9 0.9 0.8 0.8 0.7 0.7 0.6 0.6 0.5 TPPP/p25 0.5 TPPP/p25 0.4 Vector 0.4 Vector 0.3 0.3
0.2 0.2
OD at at OD 405nm at OD 405nm 0.1 0.1 0 0 481 hrs 72hrs2 481 hrs 72hrs2
Figure 3.3F TPPP/p25 expression decreases cell proliferation
The role of TPPP/p25 overexpression on T98G and U87MG cells was established by
BrdU proliferation assay. Cells were overexpressed with FLAG (Vector) or FLAG-
TPPP/p25 (TPPP/p25) expression plasmids. Growth rate was measured at 48 and 72 hrs after transfection using mean absorbance reading at OD 405 nm. Error bars show standard deviations from three different experiments.
162
G T98G U87MG
Vec
TPPP/p25 TPPP/p25 + Con + FLAG-TPPP/p25 Vec
IB: Caspase-3
IB: Cleaved- Caspase-3
IB: Lamin A/C
Figure 3.3G Detection of caspase-3 activation in apoptosis induction in T98G and
U87MG cells upon expression of TPPP/p25.
Immunoblot analysis was performed to show caspase-3 activation by detection of cleaved caspase-3 peptides using cleaved caspase-3 antibody. Cells were harvested
48 hrs after tranfection with FLAG or FLAG-TPPP/p25 (TPPP/p25) expression plasmids. Immunoblot analysis with caspase-3 antibody was done to detect total caspase-3 levels in the cells. Immunoblot with lamin a/c antibody was the loading control.
163
H T98G
FLAG-TPPP/p25 Vec TPPP/p25
IB: Acetylated Tubulin
IB: Tubulin
IB: TPPP/p25
Figure 3.3H Expression of TPPP/p25 increases stable microtubule levels.
Immunoblot analysis of lysates from T98G cells was performed after transfecting with
FLAG (Vincze, Olah et al.) or FLAG-TPPP/p25 (TPPP/p25) was performed. Immunoblot analysis with acetylated tubulin was done to measure the levels of stable microtubule.
Immunoblot with tubulin antibody was used as a loading control while immunoblot with
TPPP/p25 antibody was used to measure TPPP/p25 expression levels.
164
CHAPTER 4
CONCLUSIONS AND DISCUSSIONS
4.1 INTRODUCTION
P68 RNA helicase is implicated in different biological processes. It has been shown that p68 is an important splicing factor in pre-mRNA splicing (Liu 2002).
Numerous studies have shown that p68 serves as a transcriptional co-activator for a number of different genes such as ERα, p53, Snail etc (Endoh, Maruyama et al. 1999)
(Bates, Nicol et al. 2005; Carter, Lin et al. 2010). Previous reports have indicated the role of p68 in organ development and transformation (Stevenson, Hamilton et al. 1998).
Tyrosine phosphorylation of p68 was studied by Yang et al. and they discovered an unanticipated function of c-abl in the EMT process. Tyrosine phosphorylated p68 interacts with β-catenin and consequently, is involved in cell proliferation (Yang, Lin et al. 2006). Phosphorylated p68 also activates transcription of proliferative genes such as c-myc and cyclin D1 (Yang, Lin et al. 2007). The aim of this dissertation is to elucidate the role(s) of p68 in other processes, including characterizing the function of threonine phosphorylation of p68. This dissertation also aims to understand the transcriptional regulation of a cytoskeletal gene, TPPP by p68 and also study the role of p68 in cellular differentiation.
165
4.2 OXALIPLATIN TREATMENT OF CRC INDUCES P68 THREONINE
PHOSPHORYLATION.
Colorectal cancer was relatively resistant to chemotherapy initially (Blijham
1991). However, the clinical outcomes have improved in the past few years as a result of using a combination of two to three chemotherapeutic agents (Buyse, Zeleniuch-
Jacquotte et al. 1988). Platinum-based DNA damaging agents like oxaliplatin are among the commonly used drugs in colorectal cancer teatment. The apoptosis induced in tumor cells by oxaliplatin has been demonstrated as one of its mechanism of actions in chemotherapy (Zunino, Perego et al. 1997). However, characterization of molecular pathways that mediate the cellular response to oxaliplatin and complete understanding of its mode of action are essential for further improving the therapeutic efficacy of the drug.
In our study, we found that p68 is one of the cellular targets of oxaliplatin that mediates the downstream effects of oxaliplatin in apoptosis. P68 is implicated in p53- mediated apoptosis induced by DNA damaging agent etoposide (Bates, Nicol et al.
2005). Thus, p68 may be a common element in the DNA damaging pathways. Our results show that oxaliplatin treatment dramatically increases p68 threonine phosphorylation. The threonine phosphorylation reaches a peak and then p68 gets dephosphorylated suggesting that oxaliplatin treatment activates a phosphatase that dephosphorylates p68. Phosphorylation and dephosphorylation of proteins represent a common mechanism for regulating enzymatic activity and cellular functions of proteins including numerous transcription factors (Holmberg, Tran et al. 2002). P68 is known to be subjected to modification by phosphorylation and has been demonstrated to be 166 phosphorylated at multiple residues (Yang and Liu 2004). Phosphorylation at multiple sites suggests that p68 regulation is complex. Tyrosine phosphorylation of p68 is observed in several different cancer cells. PDGF-stimulation of HT-29 cells leads to tyrosine phosphorylation of p68 at Y593 by c-abl (Yang, Lin et al. 2005; Yang, Lin et al.
2006) TNF-α treatment phosphorylates p68 at threonine and dephosphorylates p68 at tyrosine residues indicating that TNF-α treatment reciprocally regulates the threonine and tyrosine phosphorylations of p68 (Yang, Lin et al. 2005). Like TNF-α treatment, oxaliplatin also causes threonine phosphorylation of p68 and may also dephosphorylate p68 at tyrosine to affect cell survival. Threonine phosphorylation and tyrosine dephosphorylation may represent a cellular apoptotic response to oxaliplatin treatment.
This may imply that p68 is a multifunctional protein that has different biological roles in multiple cellular pathways and specifically, phosphorylation of p68 regulates the enzymatic activity and cellular functions of p68 in different pathways in response to different external stimuli.
4.3 P68 IS PHOSPHORYLATED BY P38 MAP-KINASE AT T564 AND/OR T446
UPON OXALIPLATIN TREATMENT.
P38 MAP-kinase is known to be activated following treatments with DNA damaging compounds, UV light, ionizing radiation, etoposide. It is involved in mediating cancer cell apoptosis triggered by these agents (Tanos, Marinissen et al. 2005; Wang and Lippard 2005; Wood, Nail et al. 2006; Lu, Rau et al. 2011). Although different activators and substrates of p38 in different DNA damaging pathways are somewhat 167 known, the exact signaling pathway is still unclear and the different molecular factors involved vary and depend on different DNA-damaging agents.
In our studies, we found that oxaliplatin treatment of colon cancer induces p38 activation and phosphorylation in a time dependent manner. P38 activation/phosphorylation follows a similar time course with p68 phosphorylation at threonine suggesting a parallel response. In vitro phosphorylation and co- immunoprecipitation assays demonstrate that p38 interacts with and phosphorylates p68. This data is in consistence with the earlier reports of p68 being a new substrate for p38. P68 is phosphorylated by p38 in response to TNF-α stimulation and this represents a new cellular mechanism by which p38 executes TNF-α signal downstream (Yang, Lin et al. 2005). To further confirm that p38 phosphorylates p68 in vivo, p38 constitutively activated mutant is used. Expression of the p38 constitutively activated mutant increases p68 phosphorylation at threonine. Phosphorylation assays demonstrate T564 and/or T446A as the phosphorylation sites of p38 and it is well established that p38
MAP-kinase often phosphorylates multiple sites in its targets (Yang, Xiong et al. 2002;
De Chiara, Marcocci et al. 2006).
4.4 PHOSPHORYLATION OF P68 AT THREONINE MEDIATES THE EFFECTS OF
OXALIPLATIN IN THE INDUCTION OF APOPTOSIS
Our studies show that p68 phosphorylation at T564/446 by p38, at least partially, mediates the effects of oxaliplatin on apoptosis induction. Phosphorylation causes conformational change in critical domains which may enhance the binding to downstream target proteins functioning in distinct signaling pathways. How the 168 phosphorylation of p68 at T564 and T446 mediates cell apoptosis is an open question.
One plausible explanation is that the phosphorylated p68 may change p68 interacting partners in the cells, which causes p68 to target a particular apoptosis mediating protein or complex. The consequence for the p68 targeting is activation of apoptotic function of the targeted protein or complex. A number of DEAD-box RNA helicases associate with apoptosis induction protein or complex. For example, DDX42 modulates the apoptotic function of ASPP2 by direct interaction with it (Uhlmann-Schiffler, Kiermayer et al.
2009). Interaction between GABA receptor associated protein (GABARAP) and DDX47 is required for induction of neuronal cell apoptosis (Lee, Rho et al. 2005). However, the mechanism by which this DEAD-box RNA helicase regulates the apoptotic process is not known. Thus, it will be very interesting to find whether p68 phosphorylation at T564 and/or T446 mediates the association of the protein with a particular apoptosis inducing complex to activate the complex. Another explanation of p68 phophorylation mediating the effects of oxaliplatin on apoptosis induction may be that p38 MAP-kinase phosphorylates specific transcription factors or other proteins to regulate cell apoptosis, proliferation or inflammatory processes. Also, the involvement of p68 in transcriptional regulation is well studied. Thus, it seems plausible that p38-mediated p68 phosphorylation may promote or activate the transcription activation function of p68 and may represent a new mechanism in regulating gene expression during apoptosis induction in response to oxaliplatin. It is also of interest to note that p68 interacts with p53 tumor suppressor in response to etoposide treatment to stimulate transcription of p53-dependent genes, including p21 and Bax and regulates p53-mediated apoptosis
(Bates, Nicol et al. 2005). It is highly probable that phospho-p68 may be involved in this 169 process, as phosphorylation may be activating the transcription co-activator function of p68 to bind specific promoter DNA sequences. Thus, phospho-p68 may be needed by different stressors to regulate cellular apoptosis in different pathways. It is known that phosphorylation of p53 at key regulatory residue like serine 15 stimulates p53- transcriptional activity (Siliciano, Canman et al. 1997; Banin, Moyal et al. 1998). DDX3
RNA helicase exhibits tumor suppressor function including growth inhibition by transcriptional modulation of p21 gene expression. It activates p21 promoter in an
ATPase-dependent but helicase-independent mechanism through its multiple Sp1 sites
(Chao, Chen et al. 2006). Thus, this study may represent a new and/or alternate pathway for oxaliplatin mediated apoptosis where in response to oxaliplatin, p38- mediated p68 phosphorylation could activate gene expression by interacting with other transcriptional factors to promote apoptosis.
4.5 P68 RNA HELICASE REGULATES TRANSCRIPTION OF THE TPPP/25 GENE.
In this study, we report that p68 plays a role in TPPP/p25 gene transcription.
TPPP/p25 is a microtubule-associated protein belonging to the cytoskeletal gene family.
Oncomine meta-analysis study of p68 showed that p68 is co-expressed with several other cytoskeletal genes and p68 probably regulates these genes via transcription or splicing (Wilson and Giguere 2007). This study was confirmed by Chip-on-chip analysis in our lab using p68 antibody. The study indicated that p68 interacts with the promoters of a number of cytoskeleton-regulating genes. Further studies were done to narrow down p68 regulation to a particular cytoskeletal gene, TPPP/p25. Chip experiment demonstrated that p68 is associated with the TPPP/p25 promoter. TPPP/p25 RNA and 170 protein levels in p68 knockdown cells showed that when p68 is knocked down,
TPPP/p25 levels decrease whereas when p68 is not knocked down, TPPP/p25 expression is maintained at normal levels. All these results indicate that p68 positively regulates TPPP/p25 expression.
Interestingly, TPPP/p25 is not the only gene that is regulated by p68. P68 is known to transcriptionally coactivate a number of genes such as ERα, p53, Snail etc
(Endoh, Maruyama et al. 1999) (Bates, Nicol et al. 2005; Carter, Lin et al. 2010).
Moreover, how p68 functions in transcription co-activation is not very well defined. It is quite possible that p68 regulates the formation of a competent transcription complex. It may either act as an adaptor protein for recruiting or facilitating the assembly of transcription factors or stabilizing their interactions with chromatin via chromatin remodeling by acting as an ATPase motor. P68 has been shown to participate in active recruitment of TBP, RNA Pol II and chromatin remodeling SWI/SNF complex to the muscle transcriptome and facilitates chromatin remodeling (Caretti, Schiltz et al. 2006).
It also directly interacts with the transcriptional co-activators p300 and CBP to facilitate gene transcription by RNA Pol II. ATPase and unwinding activity of p68 are essential in this case (Rossow and Janknecht 2003). Alternatively, p68 could influence transcription by interacting with transcriptional repressor HDAC1. P68 can also function as a transcriptional corepressor depending on the transcriptional complex and promoter on which it is recruited. It is known to repress transcription by associating with HDAC1
(Wilson, Bates et al. 2004). Phospho-p68 interacts with HDAC1 and MBD3:Mi-2/NuRD in the nuclear remodeling and deacetylation complex promoting release of HDAC1 from the complex thereby activating Snail1 gene transcription. Thus, this Snail1 171 transcriptional regulation, in turn, suppresses E-cadherin expression (Carter, Lin et al.
2010). Interestingly, phosphorylated form of p68 has also been involved in transcriptional regulation. Phosphorylation of p68 at Y593 is found to activate cyclin D1 and c-myc transcription thereby promoting cell proliferation induced by PDGF. Phospho- p68 is recruited to cyclin D1 and c-myc promoters by its interaction with β- catenin.TCF/LEF complex (Yang, Lin et al. 2007). Thus, transcriptional regulation by phospho-p68 adds another dimension to the function of p68 in the transcriptional regulation process.
4.6 P68 RNA HELICASE REGULATES PC12 NEURITE OUTGROWTH VIA
REGULATION OF TPPP/p25 EXPRESSION.
Functional study of TPPP/p25 regulation showed that p68 coactivates TPPP/p25 transcription and is necessary for neuronal cells to differentiate. Reduction of p68 levels in PC12 cells leads to dramatic reduction of TPPP/p25 levels and failure of neurite formation of PC12 cells indicating that p68, in part, is crucial for the differentiation process. In another study, p68 has been found to be involved in PC12 differentiation by functioning as an adaptor protein in mediating the association of v-src with PtdIns-3 kinase. This interaction is critical in cytoskeletal rearrangement responsible for the outgrowth of neurites in PC12 cells (Haefner and Frame 1997). Likewise, knockdown of
TPPP/p25 in PC12 cells partially blocked the neurite formation process. Overall, our results indicate that p68 and TPPP/p25 are necessary for PC12 neurite formation and that p68 plays a role in PC12 differentiation via regulation of TPPP/p25 expression. 172
P68 has been showed to be involved not only in PC12 cell differentiation but also in adipocyte differentiation. Knockdown of p68 in mouse 3T3-L1 cells blocked differentiation of these cells into adipocytes (Kitamura, Nishizuka et al. 2001). DDX17
(p72) found in the cells in a heterodimeric form with DDX5 (p68) has been implicated in cellular differentiation process where DDX17 transcripts are in very high levels in rat brain during embryogenesis but found in the adult stage. This suggests that DDX17 plays a role in neuronal differentiation during CNS development (IP, Chung et al. 2000)
Similarly, transcripts of chick and mouse homologs of p68 has been found to be in high abundance in different embryonic tissues while p68 is implicated in the differentiation of the monocytic leukemia cells U937 to macrophages (Stevenson, Hamilton et al. 1998;
Jost, Schwarz et al. 1999; Gingras and Margolin 2000; Seufert, Kos et al. 2000).
Furthermore, p68 is also found to be essential for skeletal myogenesis and plays a critical role in co-regulating MyoD transcription and skeletal muscle differentiation
(Caretti, Schiltz et al. 2006). DDX3 is essential for spermatogenesis and DDX4 is required for oogenesis (Lasko and Ashburner 1988; Lasko and Ashburner 1990;
Tomancak, Guichet et al. 1998; Foresta, Ferlin et al. 2000). DDX41 is involved in visual and CNS system development while DDX25 is critical for spermatogenesis (Schmucker,
Vorbruggen et al. 2000; Tsai-Morris, Sheng et al. 2004). Tight regulation of gene expression is important during differentiation and since these RNA helicases participate in various stages of RNA metabolism like transcription etc, it indicates the importance of
RNA helicases as regulators of differentiation. Nonetheless, the precise role of p68 in differentiation is still unknown. This poses several questions where future research could be targeted: What is the role of p68 in differentiation? Could p68 engage in 173 transcriptional programs that control differentiation? What are the downstream targets of p68 in its function as differentiation regulator?
4.7 TPPP/p25 EXPRESSION IS IMPORTANT IN GLIOMA PROGRESSION
Glioblastomas are the most common and the most aggressive malignant tumors in humans, involving glial cells with a median survival of 10 to 12 months (Westermark and Nister 1995; Schechter 1999). It is reported that TPPP/p25 is highly expressed in oligodendrocytes suggesting their role in the normal functioning of the central nervous system (Takahashi, Tomizawa et al. 1991; Takahashi, Tomizawa et al. 1993; Vincze,
Tokesi et al. 2006). However, study on the functional role of TPPP/p25 expression in glioblastomas is not established. In our study, we found through immunohistological analysis of tissue samples from glioblastoma patients that TPPP/p25 levels are very low or absent. This is also confirmed by undetectable levels in several glioblastoma cell lines. This indicates that loss of TPPP/p25 expression correlates with the development and progression of glioblastoma as reduced expression of this protein may be involved in the providing growth advantage to tumor cells. We also report in this study that
TPPP/p25 inhibits tumorigenicity of glioma cells in vitro. Overexpression of TPPP/p25 in glioma cells results in significant decrease in cell proliferation suggesting that TPPP/p25 is a negative regulator of growth in glioblastomas and deregulation of expression of
TPPP/p25 may be linked with their transformed phenotype. TPPP/p25 overexpression did not activate caspase-3 implying that TPPP/p25 suppresses glioma cell growth by its inhibitory effect on the cell proliferation rate. 174
The reason for downregulation of TPPP/p25 in brain tumors at the RNA and protein levels is not known. It may be possible that TPPP/25 gene may be silenced by promoter hypermethylation in glioblastomas indicating that the role of TPPP/p25 is in either maintaining the differentiated phenotype or triggering anti-proliferative effect.
Also, since TPPP/p25 is a microtubule-associated protein that stabilizes microtubules in
T98G glioblastoma cells, induction of this microtubule stabilizing protein in glioblastoma may have implications for not only tumor progression but also to sensitize tumors to MT agents. MT agents like vinca alkaloids and taxols are used for the treatment for several cancers, however, drug resistance is the major setback for treatment (Dumontet and
Sikic 1999). Cancer cells activate mechanisms to counteract these drugs by overexpressing MT-destabilizing proteins or covalently modifying tubulins to render themselves resistant to the effects of MT stabilizing drugs such as taxol resulting in drug resistance (Alli, Bash-Babula et al. 2002; Martello, Verdier-Pinard et al. 2003). Thus, re- expression of TPPP/p25 by gene therapy may overcome such resistance and may have beneficial effects on glioblastoma aggressive tumors.
4.8 REFERENCES
Alli, E., J. Bash-Babula, et al. (2002). "Effect of stathmin on the sensitivity to
antimicrotubule drugs in human breast cancer." Cancer research 62(23): 6864-
6869.
Banin, S., L. Moyal, et al. (1998). "Enhanced phosphorylation of p53 by ATM in
response to DNA damage." Science 281(5383): 1674-1677. 175
Bates, G. J., S. M. Nicol, et al. (2005). "The DEAD box protein p68: a novel
transcriptional coactivator of the p53 tumour suppressor." The EMBO journal
24(3): 543-553.
Blijham, G. H. (1991). "Chemotherapy of colorectal cancer." Anti-cancer drugs 2(3):
233-245.
Buyse, M., A. Zeleniuch-Jacquotte, et al. (1988). "Adjuvant therapy of colorectal cancer.
Why we still don't know." JAMA : the journal of the American Medical Association
259(24): 3571-3578.
Caretti, G., R. L. Schiltz, et al. (2006). "The RNA helicases p68/p72 and the noncoding
RNA SRA are coregulators of MyoD and skeletal muscle differentiation."
Developmental cell 11(4): 547-560.
Carter, C. L., C. Lin, et al. (2010). "Phosphorylated p68 RNA helicase activates Snail1
transcription by promoting HDAC1 dissociation from the Snail1 promoter."
Oncogene 29(39): 5427-5436.
Chao, C. H., C. M. Chen, et al. (2006). "DDX3, a DEAD box RNA helicase with tumor
growth-suppressive property and transcriptional regulation activity of the
p21waf1/cip1 promoter, is a candidate tumor suppressor." Cancer research
66(13): 6579-6588.
De Chiara, G., M. E. Marcocci, et al. (2006). "Bcl-2 Phosphorylation by p38 MAPK:
identification of target sites and biologic consequences." The Journal of biological
chemistry 281(30): 21353-21361.
Dumontet, C. and B. I. Sikic (1999). "Mechanisms of action of and resistance to
antitubulin agents: microtubule dynamics, drug transport, and cell death." Journal 176
of clinical oncology : official journal of the American Society of Clinical Oncology
17(3): 1061-1070.
Endoh, H., K. Maruyama, et al. (1999). "Purification and identification of p68 RNA
helicase acting as a transcriptional coactivator specific for the activation function
1 of human estrogen receptor alpha." Molecular and cellular biology 19(8): 5363-
5372.
Foresta, C., A. Ferlin, et al. (2000). "Deletion and expression analysis of AZFa genes on
the human Y chromosome revealed a major role for DBY in male infertility."
Human molecular genetics 9(8): 1161-1169.
Gingras, M. C. and J. F. Margolin (2000). "Differential expression of multiple unexpected
genes during U937 cell and macrophage differentiation detected by suppressive
subtractive hybridization." Experimental hematology 28(1): 65-76.
Haefner, B. and M. C. Frame (1997). "Distinctive regulation of v-Src-associated
phosphatidylinositol 3-kinase during PC12 cell differentiation." The Biochemical
journal 328 ( Pt 2): 649-655.
Holmberg, C. I., S. E. Tran, et al. (2002). "Multisite phosphorylation provides
sophisticated regulation of transcription factors." Trends in biochemical sciences
27(12): 619-627.
Ip, F. C., S. S. Chung, et al. (2000). "Developmental and tissue-specific expression of
DEAD box protein p72." Neuroreport 11(3): 457-462.
Jost, J. P., S. Schwarz, et al. (1999). "A chicken embryo protein related to the
mammalian DEAD box protein p68 is tightly associated with the highly purified 177
protein-RNA complex of 5-MeC-DNA glycosylase." Nucleic acids research
27(16): 3245-3252.
Kitamura, A., M. Nishizuka, et al. (2001). "Expression of p68 RNA helicase is closely
related to the early stage of adipocyte differentiation of mouse 3T3-L1 cells."
Biochemical and biophysical research communications 287(2): 435-439.
Lasko, P. F. and M. Ashburner (1988). "The product of the Drosophila gene vasa is very
similar to eukaryotic initiation factor-4A." Nature 335(6191): 611-617.
Lasko, P. F. and M. Ashburner (1990). "Posterior localization of vasa protein correlates
with, but is not sufficient for, pole cell development." Genes & development 4(6):
905-921.
Lee, J. H., S. B. Rho, et al. (2005). "GABAA receptor-associated protein (GABARAP)
induces apoptosis by interacting with DEAD (Asp-Glu-Ala-Asp/His) box
polypeptide 47 (DDX 47)." Biotechnology letters 27(9): 623-628.
Liu, Z. R. (2002). "p68 RNA helicase is an essential human splicing factor that acts at
the U1 snRNA-5' splice site duplex." Molecular and cellular biology 22(15): 5443-
5450.
Lu, Q., T. F. Rau, et al. (2011). "Increased p38 mitogen-activated protein kinase
signaling is involved in the oxidative stress associated with oxygen and glucose
deprivation in neonatal hippocampal slice cultures." The European journal of
neuroscience 34(7): 1093-1101.
Martello, L. A., P. Verdier-Pinard, et al. (2003). "Elevated levels of microtubule
destabilizing factors in a Taxol-resistant/dependent A549 cell line with an alpha-
tubulin mutation." Cancer research 63(6): 1207-1213. 178
Rossow, K. L. and R. Janknecht (2003). "Synergism between p68 RNA helicase and the
transcriptional coactivators CBP and p300." Oncogene 22(1): 151-156.
Schechter, C. B. (1999). "Re: Brain and other central nervous system cancers: recent
trends in incidence and mortality." Journal of the National Cancer Institute 91(23):
2050-2051.
Schmucker, D., G. Vorbruggen, et al. (2000). "The Drosophila gene abstrakt, required
for visual system development, encodes a putative RNA helicase of the DEAD
box protein family." Mechanisms of development 91(1-2): 189-196.
Seufert, D. W., R. Kos, et al. (2000). "p68, a DEAD-box RNA helicase, is expressed in
chordate embryo neural and mesodermal tissues." The Journal of experimental
zoology 288(3): 193-204.
Siliciano, J. D., C. E. Canman, et al. (1997). "DNA damage induces phosphorylation of
the amino terminus of p53." Genes & development 11(24): 3471-3481.
Stevenson, R. J., S. J. Hamilton, et al. (1998). "Expression of the 'dead box' RNA
helicase p68 is developmentally and growth regulated and correlates with organ
differentiation/maturation in the fetus." The Journal of pathology 184(4): 351-359.
Tanos, T., M. J. Marinissen, et al. (2005). "Phosphorylation of c-Fos by members of the
p38 MAPK family. Role in the AP-1 response to UV light." The Journal of
biological chemistry 280(19): 18842-18852.
Tomancak, P., A. Guichet, et al. (1998). "Oocyte polarity depends on regulation of
gurken by Vasa." Development 125(9): 1723-1732.
Tsai-Morris, C. H., Y. Sheng, et al. (2004). "Gonadotropin-regulated testicular RNA
helicase (GRTH/Ddx25) is essential for spermatid development and completion 179
of spermatogenesis." Proceedings of the National Academy of Sciences of the
United States of America 101(17): 6373-6378.
Uhlmann-Schiffler, H., S. Kiermayer, et al. (2009). "The DEAD box protein Ddx42p
modulates the function of ASPP2, a stimulator of apoptosis." Oncogene 28(20):
2065-2073.
Wang, D. and S. J. Lippard (2005). "Cellular processing of platinum anticancer drugs."
Nature reviews. Drug discovery 4(4): 307-320.
Westermark, B. and M. Nister (1995). "Molecular genetics of human glioma." Current
opinion in oncology 7(3): 220-225.
Wilson, B. J., G. J. Bates, et al. (2004). "The p68 and p72 DEAD box RNA helicases
interact with HDAC1 and repress transcription in a promoter-specific manner."
BMC molecular biology 5: 11.
Wilson, B. J. and V. Giguere (2007). "Identification of novel pathway partners of p68 and
p72 RNA helicases through Oncomine meta-analysis." BMC genomics 8: 419.
Wood, L. J., L. M. Nail, et al. (2006). "The cancer chemotherapy drug etoposide (VP-16)
induces proinflammatory cytokine production and sickness behavior-like
symptoms in a mouse model of cancer chemotherapy-related symptoms."
Biological research for nursing 8(2): 157-169.
Yang, L., C. Lin, et al. (2005). "Signaling to the DEAD box--regulation of DEAD-box p68
RNA helicase by protein phosphorylations." Cellular signalling 17(12): 1495-
1504. 180
Yang, L., C. Lin, et al. (2006). "P68 RNA helicase mediates PDGF-induced epithelial
mesenchymal transition by displacing Axin from beta-catenin." Cell 127(1): 139-
155.
Yang, L., C. Lin, et al. (2007). "Phosphorylation of p68 RNA helicase plays a role in
platelet-derived growth factor-induced cell proliferation by up-regulating cyclin D1
and c-Myc expression." The Journal of biological chemistry 282(23): 16811-
16819.
Yang, L. and Z. R. Liu (2004). "Bacterially expressed recombinant p68 RNA helicase is
phosphorylated on serine, threonine, and tyrosine residues." Protein expression
and purification 35(2): 327-333.
Yang, T. T., Q. Xiong, et al. (2002). "Phosphorylation of NFATc4 by p38 mitogen-
activated protein kinases." Molecular and cellular biology 22(11): 3892-3904.
Zunino, F., P. Perego, et al. (1997). "Role of apoptotic response in cellular resistance to
cytotoxic agents." Pharmacology & therapeutics 76(1-3): 177-185.
181
CHAPTER 5
MATERIALS AND METHODS
5.1 MAMMALIAN CELL CULTURE TECHNIQUES
5.1.1 Mammalian Cell Culture
The cell lines used were HCT116 (Catalog # CCL-247), HeLa CCL2 (Catalog #
CCL-2), PC12 (Catalog # CRL-1721) and T98G (Catalog # CRL-1690) obtained from
ATCC (American Type Culture Collection, Manassas, VA) and were grown in McCoy’s
5A medium, MEM, DMEM and MEM respectively. Media contained Fetal Bovine Serum
(FBS) (Hyclone, Logan, UT) as a supplement. The cells were routinely passaged until they were subconfluent (70 to 80%), which was approximately every two to three days, and were incubated at 37°C incubator. Trypsin (Cellgro, Manassas, VA) was used to detach the cells from the T175 cm2 flasks. After detachment, the cells were centrifuged for 5 mins at 1200 rpm to eliminate trypsin, and then cultured in the respective fresh medium as described above.
5.1.2 Mammalian Cell Storage and Thawing
The cells were stored for long-term by freezing and storing them in liquid nitrogen. Before placing the cells in the liquid nitrogen, they were detached from the flasks by trypsination, centrifuged at 1200 rpm and resuspended in their normal medium containing 20% FBS and 10% DMSO (Sigma, St. Louis, MO). The cells were added to special cryotubes for storing cells at -80°C, slowly frozen in an isopropanol bath overnight and left in liquid nitrogen. 182
The frozen cells were thawed by placing in a water bath, centrifuged and resuspended in required culture medium containing 10% FBS.
5.1.3 Transfection
5.1.3.1 Plasmid Transfection
Fugene HD or X-tremeGENE 9 DNA transfection reagents (Roche, Indianapolis,
IN) were used for most of the transfection experiments. The cells were trypsinized 24 hours before transfection and 3-5 x 105 cells were seeded in medium containing 10%
FBS without antibiotics in 6-well plate so that the cell density would be approximately 60 to 70% confluent the next day. Transfection reagent, diluent and the DNA that was to be transfected were allowed to equilibrate to room temperature (22°C) and mixed well before proceeding. The DNA (2 µg) was diluted in 100 µl Optimem-reduced serum medium (Invitrogen, Grand Island, NY) placed in polystyrene tube and gently mixed.
The transfection reagent (3 µl) was then added to the mixture in a 3:2 ratio. The complex was allowed to form by incubating the mix for 15 mins and added into the wells. After incubation of the cells at 37°C incubator for 24-48 hrs, they were either treated or harvested.
5.1.3.2 siRNA Transfection
RNA oligonucleotides used to knockdown p68 gene expression were siGENOME duplex siRNA from Dharmacon (Thermo Fisher Scientific Dharmacon, Lafayette, CO).
The sequences of the duplex siRNA against p68 were as follows: siRNA oligonucleotides against p68 (sense: 5’-GCAAGUAGCUGCUGAAUAUUU-3’; antisense: 183
5’- AUAUUCAGCAGCUACUUGCUU-3’). The siRNA knockdown was done using
Lipofectamine RNAimax (Invitrogen, Grand Island, NY) reagent. A day before siRNA knockdown, 2-4 x105 cells were seeded. The siRNA duplex was dissolved in 1X siRNA buffer (Thermo Fisher Scientific Dharmacon, Lafayette, CO) at a concentration of 40 pmol/µl and RNase-free water by rotating in a rocking platform for 30 mins. About 3µl
(120 pmol) of siRNA was added to 250 µl of Optimem-reduced serum medium
(Invitrogen, Grand Island, NY) in a polystyrene tube and mixed gently. Lipofectamine
RNAimax (5μl) was added to 250 µl of Optimem medium in another tube and also mixed well. An irrelevant siRNA or non-targeting siRNA (Thermo Fisher Scientific
Dharmacon, Lafayette, CO) served as a negative control. The siRNA-lipofectamine complex was then allowed to form by adding the siRNA mixture slowly to the lipofectamine mixture and incubating for 25 mins at room temperature. After incubation, the complex (500 µl) was added dropwise to the cells that have been washed two times with Optimem medium, incubated for 4 hrs and feedbacked with complete medium.
After 24 hrs, fresh medium with 10% FBS (Hyclone, Logan, UT) was added. After 48 hrs, they were then harvested or the p68 wild-type or mutants were transfected the same day using fugene HD transfection reagent and harvested after an additional 48 hrs. The transiently expressed p68 wild-type and the mutants were blocked from knockdown by mutating four nucleotides in the siRNA targeting sequence such that the amino-acid sequence was not altered.
184
5.2 BACTERIAL CULTURE TECHNIQUES
5.2.1 Culture of Bacterial Cells and their Storage
Plasmid DNA that was used for transfection, cloning, and other techniques was amplified using bacterial E.coli strains JM109 (Promega, Madison, WI), DH5α
(Promega, Madison, WI) and XL-1 blue (Stratagene, Cedar reek, TX), while BL21- codon Plus (Stratagene, Cedar reek, TX) was used for the expression of recombinant protein. The bacteria were inoculated in sterile Luria-Bertani (LB) medium in a 37ºC shaker set to 220 rpm. The composition of LB medium was as: 1% tryptone, 1% NaCl,
0.5% yeast extract, and 50 µg/ml of Ampillicin or kanamycin for antibiotic-resistant strain selection. The antibiotics were added to autoclaved medium approximately around 40 to
50°C. The LB agar plates contained 1.5% agar in addition to the above mentioned composition of LB medium. The bacteria were either inoculated into sterile LB medium using a sterile inoculation loop or spread onto the agar plates using a sterile plastic spreader, and incubated in an incubator at 37°C for 16-18 hrs.
5.2.2 Competent Cell Preparation
Competent cells are bacterial cells whose cell walls are rendered porous to allow the plasmid DNA to enter the cells. E.coli strains JM109 and DH5α were made competent using the following steps. An isolated bacterial colony was seeded into sterile 10 ml LB broth, and grown overnight in a 37°C shaker. Next day, culture (1 ml) was inoculated into sterile LB medium (50 ml) and grown till OD600 of 0.375. The culture was then aliquoted into 50 ml of sterile, pre-chilled, polypropylene tubes (or 50 ml centrifuge tubes). After placing the cells for 10 mins on ice, the pelleted cells were 185
resuspended in CaCl2 solution (10 ml) and centrifuged again. After resuspension in
CaCl2 solution (10 ml), the cells were left on ice for 30 mins. After this final incubation step, the pelleted competent cells were resuspended in ice-cold CaCl2 solution (1 ml) and dispensed into prechilled, sterile micro-centrifuge tubes (100 µl each). Prechilled pipette tips were used for dispensing. The tubes were then immediately transferred and transferred at -80°C until further use.
5.2.3 Transformation
E.coli competent cells (JM109 or DH5α) were used for transformation of plasmid
DNA. Competent cells (100 µl) were placed in a sterile micro-centrifuge tube and 10-
500 ng of plasmid DNA was then added to the tube. The DNA/competent cells were placed for 30 mins in an ice bucket and then heat-shocked at 42°C waterbath for 90 seconds. After heat-shock, the mix was immediately placed on ice for 2 to 3 mins.
Thereafter, 200 µl of prewarmed sterile LB medium without any antibiotics was added to and further incubated in a shaker maintained at 37°C with a speed of 220 rpm for 1 hour. The cells were then spread onto sterile LB agar plates with either ampicillin or kanamycin and incubated overnight at 37°C.
5.3 DNA RELATED TECHNIQUES
5.3.1 Isolation of Plasmid DNA
5.3.1.1 Isolation of Plasmid DNA in a Mini-Scale (Mini-prep)
Plasmid DNA isolation and purification were performed using Qiaprep Spin Mini
Kit (Qiagen, Valencia, CA). An isolated bacterial colony, inoculated into 2 ml of sterile 186
LB medium, was incubated for 16 to 18 hrs in a 37°C shaker set to 220 rpm. The pelleted cells were resuspended in the resuspension buffer P1. Around 250 µl of lysis buffer P2 was added to the tube which was inverted 4-6 times. This step lysed the bacteria. After the lysis, neutralization buffer N3 (300 µl) was immediately added to neutralize the alkaline conditions generated by the lysis buffer and the contents of the tube were again mixed by inverting 4-6 times. The mixture was then subjected to centrifugation and the supernatant containing the DNA solution was applied to the spin column. It was again centrifuged to enable the DNA to bind to the silica column. The column was rinsed with buffer PB (500 µl) to eliminate the endonuclease present in endA+ bacteria such as JM109 and subsequently washed again with buffer PE (750 µl) containing ethanol and centrifuged. Elution was done with elution buffer TE (10 M Tris-
HCl, pH 8.5) or water and confirmed by either agarose gel electrophoresis or DNA sequencing.
5.3.1.2 Isolation of Plasmid DNA in a large-scale (Midi-prep)
Large scale DNA purification was done using Wizard Plus DNA Purification
System (Promega, Madison, WI). Plasmid DNA containing bacteria were seeded into sterile LB medium with required antibiotic and grown in 37°C shaker for 18 hrs. After centrifugation, the pellet was dissolved in resuspension buffer (3 ml). Lysis buffer (3 ml) was added and then the solution was inverted 4 to 6 times to mix. The lysate was then neutralized by adding 3ml of neutralization buffer and centrifuged at 13000 rpm for 20 mins. Pellet was mixed with DNA purification resin. This mixture was then added to a midiprep column and vacuum was used to remove the solution. The DNA-resin mix in 187 the column was rinsed two times with column wash buffer with ethanol (15 ml) and the supernatant was removed each time with the application of vacuum. After the wash solution was removed from the column, the vacuum was allowed to further run for additional 30 seconds for the complete removal of wash solution. However, the resin in the column was always prevented from being dried for too long as the DNA yield would decrease. The column was then centrifuged to eliminate any trace wash buffer. The
DNA was then eluted with pre-warmed (60 to 70°C) 300 µl of nuclease free water. After adding water to the column, it was incubated for 1 min and then centrifuged to elute the
DNA. DNA solution was then further centrifuged for 5 mins to remove any white resin that might be left in the solution. The supernatant containing the DNA was then concentrated and stored at -20°C.
5.3.2 Concentration of DNA
DNA was purified by ethanol precipitation to remove any salt or protein contamination.
In this method, 3M sodium acetate (1/10th volume) and 100% ethanol (2 volumes) were added to the DNA sample. After thorough mixing, the sample was kept at -20°C for 18 hrs. The tube was centrifuged for 15 mins to pellet DNA which was rinsed with 80% ethanol and centrifuged. The pellet was then dried and dissolved in sterile D/W. The
DNA concentration was then measured using a spectrophotometer (UV-1700
Spectrophotometer, Shimadzu Corporation) at OD260.
188
5.3.3 Measurement of DNA Quality and Concentration
DNA concentration was measured photometrically using a spectrophotometer. The absorbance was measured at OD260 and applied to the following formula which gives the DNA concentration: DNA concentration (µg/ml) = OD260 X Dilution factor X (50 µg
DNA/ml)/ (1 OD260 unit). DNA quality was determined by measuring the ratio of absorbance at OD260 and at OD280. A ratio between 1.65 and 1.85 was acceptable.
5.3.4 Agarose Gel Electrophoresis
Agarose gel electrophoresis is the technique for purification and visualization of nucleic acids on agarose gel using a double stranded DNA binding dye such as
Ethidium Bromide. Larger molecular weight DNAs ranging from 0.5 to 2 kbp like plasmids and genomic DNA were separated on 1% agarose gels (w/v) while smaller molecular DNAs (less than 0.5 kbp) were separated on 2-3% gel. 2% agarose gel was prepared by adding 2 gm of agarose (EMD, San Diego, CA) in 100 ml of 1X TAE buffer
(Tris-Base, Glacial acetic acid, EDTA, pH 8.0). The mix was heated in a microwave till the agarose was completely melted and ethidium bromide was added. Ethidium bromide is a DNA binding dye that intercalates between DNA and allows for visualization of DNA using UV light. This agarose solution was then poured onto gel casting apparatus with a comb containing well inserts to make suitable wells and allowed to set for 30 mins. After solidification of the gel, 1X TAE buffer was used as the running buffer and poured into the gel running unit after removing the comb. Next, the
DNA sample was mixed with 6X DNA loading buffer (Fermentas, Glen Burnie, MA) to a final concentration of 1X and loaded into the wells. DNA marker was also loaded to 189 determine the DNA size. The gel was run at a voltage at 120 V and 200 mA for 1 hour and visualized using a UV transilluminator.
5.3.5 Gel Extraction of DNA
After agarose gel electrophoresis, DNA purified by QIAquick Gel Extraction Kit
(Qiagen, Valencia, CA) can be used for restriction enzyme digestion, ligation and purification of PCR products. The DNA is excised from the gel after electrophoresis using a scalpel and weighed after placing in a microcentrifuge tube. Buffer QG provided with the kit was then added to the DNA sample which solubilizes the agarose gel fragment enabling the DNA to bind to the silica membrane and determine the optimum pH for DNA binding. Three times the volume of Buffer QG was added per gram of the weight of the gel (100 mg of agarose slice = 300 µl of Buffer QG). The DNA was placed in a 50°C waterbath to enable the gel to dissolve. After 10 mins, if the color of the solution was orange or purple, it meant that the pH of the solution was not appropriate for the proper binding of the DNA to the column. In this case, 3M sodium acetate, pH
5.0 (10 μl) was added so that the pH of the solution would turn to <7.5. Next, one gel volume of isopropanol was added to increase the yield of DNA. The solution was then loaded onto a QIAquick column and centrifuged. The column was then rinsed with buffer QG again and centrifuged. Finally, ethanol containing buffer PE was added to the column to remove the residual salts, agarose and dyes. The column was let to sit for 1 min and centrifuged until completely dried. DNA eluted using water or buffer EB (10 mM
Tris-HCl, pH 8.5) was used for subsequent applications.
190
5.3.6 Polymerase Chain Reaction
Polymerase chain reaction (PCR) is used in applications such as mutagenesis
(to mutate specific sequence), RT-PCR (amplify cDNA from mRNA), cloning (cloning specific sequences of genes in plasmid vector) etc. A typical PCR reaction consisted of the following: 1 unit of DNA polymerase- Hotstart pfuTurbo (Stratagene, Cedar reek,
TX), 10X cloned pfu buffer at a final concentration of 1X, 100 ng of template DNA, 1 mM dNTP and 100 ng of forward and reverse primers specific for the DNA to be amplified and nuclease free water to make up the volume to 50 µl. The primers were designed using the Primer3 software. The PCR mix containing the template was first denatured at
95°C for 2 mins to unwind the double helix. Next, 28-33 cycles of the following steps were performed: 95°C for 30 seconds, 55°C for 30 seconds and 72°C for 30 seconds.
Elongation at 72°C for 10 mins was done to make sure that all the PCR products were double stranded and then ectrophoresed.
5.3.7 Restriction Enzyme Digestion
Restriction enzyme digestion is an important tool in recombinant DNA technology and molecular biology. The process employs a restriction enzyme which recognizes specific DNA sequences and cleaves them at those sites. These DNA sequences can then be ligated into another plasmid which also has been cleaved at the same site. The standard components for restriction enzyme digestion were as: water, appropriate buffer, DNA upto 1 μg and restriction enzyme upto 1μl. The mixture was incubated at a temperature that was optimal for the enzyme which was mostly around 37°C. The digestion products were extracted after electrophoresis. A double restriction enzyme 191 digestion was also performed using the above procedure with the exception of using two enzymes instead of one. Also, the buffer and other conditions were compatible for both the enzymes. If two enzymes were not compatible for single reaction, then sequential restriction digestion was performed.
5.3.8 DNA ligation
Ligation is the process of joining the linearized cut segments of DNA that has been either digested by restriction enzyme or phosphorylated at 5’ phosphate end of the insert DNA and dephosphorylated at the 3’ hydroxyl end of the vector. Ligation is performed by an enzyme called DNA ligase that joins the 5’ phosphate and 3’ hydroxyl groups of DNA segments that have either overhangs generated by restriction enzyme digestion or cohesive ends generated by PCR products. T4 DNA ligase (Fermentas,
Glen Burnie, MA) was used for the ligation. A typical ligation reaction consisted of the following: 5X ligation buffer used at a final concentration of 1X, insert DNA, vector DNA and T4 DNA ligase. After vortexing and centrifuging, the reactions were left for 4 hours at room temperature and for 18 hrs at 4°C and finally transformed into competent bacterial cells for amplification or stored at -20°C.
5.3.9 Insert DNA Phosphorylation and Vector DNA Dephosphorylation
For some applications that required single restriction enzyme digestion instead of using two restriction enzymes, the following procedure was followed to prevent the single restriction site digested vector DNA from self recircularization and ligation.
Alkaline phosphatases catalyze the removal of phosphate group from 5’ end of DNA 192 thereby preventing the DNA from self recircularization. Shrimp alkaline phosphatase
(Fermentas, Glen Burnie, MA) was used for this purpose. 1 unit of the phosphatase, 1
µg of cut vector DNA were mixed in 1X SAP buffer and incubated for 30 mins at 37°C.
Phosphorylation of the insert DNA was the next step for ligating the dephosphorylated vector. Phosphorylation was generally performed using T4
Polynucleotide Kinase (T4 PNK) (Fermentas, Glen Burnie, MA) which catalyses γ- phosphate transfer from ATP to the 5’ terminal of polynucleotides or 3’ phosphate bearing mononucleotides. A typical reaction consists of: 10X reaction buffer, water,
PCR product and T4 PNK. The DNA then was subsequently used for the ligation reaction.
5.3.10 DNA Sequencing
Sequencing of the plasmid DNA after ligation or mutagenesis was done at the
Georgia State University Core Facility. Sequencing primers such as T7 or SP6 were provided by the facility while some application specific primers were designed using
Primer3 software. The primers were suspended in nuclease free water and used.
5.3.11 Cloning of TPPP/P25/p68/p68 mutants/p38 mutants
The cDNA of p68 ORF was subcloned into mammalian expression vector pHM6
(Roche, Indianapolis, IN) at HindIII site to get HA-tagged p68 expression vector. The expressed protein has HA tag at the N-terminus. Quick-Change site-directed mutagenesis kit (Stratagene, Cedar reek, TX) was used to prepare various p68 single and double threonine mutants (threonine replaced by alanine) and the mutations were 193 confirmed by DNA sequencing. P38α cDNA (Origene, Rockville, MD) was subcloned into p3XFLAG-myc-CMV™-24 Expression Vector (Sigma, St. Louis, MO). Mutations to get the constitutively active form of p38 were done using the reference (Diskin, Askari et al. 2004). TPPP/p25 cDNA was subcloned into p3XFLAG-myc-CMV™-24 Expression
Vector (Sigma, St. Louis, MO). P38 and TPPP/p25 expressed proteins have FLAG tag at the N-terminus.
5.4 RNA RELATED TECHNIQUES
5.4.1 RNA Isolation
RNeasy Plus kit (Qiagen, Valencia, CA) was employed for RNA extraction. To isolate RNA, the cells were grown on 6-well plates until they reached 80-90% confluence and then rinsed twice with cold 1X PBS. The cell lysis was done with 350 µl buffer RLT supplemented with β-mercaptoethanol (Sigma, St. Louis, MO). The cells were lifted from the plates with cell lifters (Corning Costar, Corning, NY), added to
Qiashredder column (Qiagen, Valencia, CA) for homogenization and centrifuged.
Homogenized lysate was then loaded onto gDNA eliminator column for removal of the genomic DNA and centrifuged for 1 min. Ice-cold 70% ethanol was then mixed with equal volume of supernatent and applied to RNeasy column and centrifuged for 30 seconds. Buffer RW1 was used to wash the column and subsequently rinsed twice with buffer RPE (500 µl). After centrifugation, the RNA was eluted twice with 30–50 µl DEPC treated water. The RNA concentration was measured using a spectrophotometer and stored at -20°C.
194
5.4.2 Measurement of RNA Concentration
The RNA concentration was measured photometrically using a spectrophotometer (UV-
1700 Spectrophotometer, Shimadzu Corporation). The absorbance was measured at
OD260 and applied to the following formula which gives the RNA concentration: RNA concentration (µg/ml) = OD260 X Dilution factor X (50 µg RNA/ml)/ (1 OD260 unit).
5.4.3 Reverse Transcription – Polymerase Chain Reaction (RT-PCR)
RT-PCR couples reverse transcription and PCR methods to generate double stranded cDNA from mRNA to examine gene expression. Two step RT-PCR was performed using the kit, ImProm II Reverse Transcription System (Promega, Madison,
WI). The first step of RT-PCR is reverse transcription. RNA isolated from the mammalian cells was converted to cDNA and PCR was performed in the second step. 1
µg of RNA was added in the RNase-free PCR tube along with 1 µl of Oligo dt and water.
A positive control containing 1.2 kb kanamycin RNA and a negative control without any
RNA were also set up according to the same procedure mentioned above. The samples were incubated at 70°C and then placed in ice water for atleast 5 mins. The following concoction consists of: 5X reaction buffer (4 µl), 5 mM MgCl2 (4 µl), water (4 µl), 100 mM dNTP (1 µl), RNase inhibitor (1 µl) and Reverse transcriptase (1 µl). The reactions were then subjected to the following cycle: 25°C for 5 mins, 45°C for 1 hour and 70°C for 15 mins in the PCR machine. Once the RNA was transcribed to cDNA, the amplification of the cDNAs was performed using PCR. PCR reactions were set up using roughly 2 µl (100ng) of cDNA, 50-100 ng of appropriate forward and reverse primers and 1X master mix from Promega, Madison, WI (containing DNA polymerase, dNTPs 195
and MgCl2). The PCR cycle was as: initial denaturation (94°C for 2 minutes), followed by 30 cycles of 94°C for 15 sec, 55°C for 30 sec, and 72°C for 30 sec with an additional extension time of 10 mins. Primers used were: TPPP/p25 (sense 5’-
CAGGTGAAGAGCCTGGAGTC-3’; antisense 5’- GTTTCCTTGTCTGTGGGTGAA-3’);
GAPDH (sense 5’- GAGTCAACGGATTTGGTCGT-3’; anti-sense 5’-
TTGATTTTGGAGGGATCTCG-3’). RT-PCR results were analyzed by running the samples on 2 to 3% agarose gels with ethidium bromide.
5.4.4 Real time RT-PCR
Quantitative RT-PCR allows simultaneous visualization and quantification of the
PCR product. The reverse transcription was performed to generate the cDNA before its amplification. For the real time PCR, the following concoction was prepared: 100 ng of cDNA, 1X Fast SYBR Green master mix (Applied Biosystems, Foster City, CA), primers, water to 25 μl. The mixture was loaded to a specific 96 well PCR plate (Applied
Biosystems, Foster City, CA). Applied Biosystems 7500 Fast Real Time machine was used for PCR: 95ºC for 15 seconds, then 40 cycles of 95ºC for 3 seconds and 60ºC for
30 seconds. Plate analysis was performed using Applied Biosystems SDS v1.4 program. A dissociation curve was generated to examine the purity of the PCR product and the results were analyzed using relative analysis. From the Ct values and the formula 2-(dCt), dCt and ddCt values were calculated and the results were shown as fold change.
196
5.5 PROTEIN RELATED TECHNIQUES
5.5.1 Cell Lysate Preparation
5.5.1.1 Whole Cell Lysate Preparation
Mammalian cells subjected to various treatments such as transfection or drug treatment have to be lysed in order to release different cellular proteins that need to be investigated. The cells were initially rinsed twice with 1X PBS. The PBS was removed and required volume of cold 1X PBS containing Protease inhibitor cocktail (Sigma, St.
Louis, MO), Phosphatase inhibitor cocktail 2 (Tyrosine phosphatase inhibitor (Sigma, St.
Louis, MO) and Phosphatase inhibitor cocktail 3 (Threonine phosphatase inhibitor
(Sigma, St. Louis, MO) were added. Cell lifter (Corning Costar, Corning, NY) was used to harvest the cells and the cells were pelleted. Cell lysis was done using 1X RIPA
(Radioimmunoprecipitation) buffer (Millipore, Billerica, MA) (0.5M Tris-HCl, pH 7.4, 2.6% deoxycholic acid, 1.5M NaCl, 10mM EDTA, 10% NP-40) containing 1mM PMSF
(phenylmethylsulphonyl fluoride), 1mM NaF, 1:100 dilution Protease inhibitor cocktail,
Phosphatase inhibitor cocktail 2, and Phosphatase inhibitor cocktail 3 and rotated. After one hour, the tubes were centrifuged for 10 mins at 13,200 rpm to remove the cellular debris. The supernatant which contained the desired protein was placed in another centrifuge tube and stored at -80°C.
5.5.1.2 Nuclear and Cytoplasmic Extract Preparation
Some proteins are expressed in the nucleus and it is often necessary to separate them from the cytoplasm for downstream applications. Nuclear extract kit (Active motif,
Carlsbad, CA) was used for preparation of nuclear fraction of the cells. Cells treated 197 according to the application, were first rinsed with 1X PBS and subsequently harvested in cold 1X PBS supplemented with Phosphatase inhibitor cocktail to limit protein modifications. The pellet was dissolved in 1X Hypotonic Buffer (500 µl) and placed for
15 mins on ice to make the cell membrane fragile. Detergent (25 µl) was added into the tubes and vortexed. The tubes were then centrifuged at 13000 rpm for 30 seconds to pellet the nuclear fraction and collect the cytoplasmic extract in the supernatant in another tube. The nuclear pellet was then rinsed with 1X PBS buffer to prevent cytoplasmic extract contamination into the nuclear pellet. The nuclei were then lysed in
AMI lysis buffer with PIC and DTT and rotated on a rotating platform. After vortexing for
30 seconds, the tubes were centrifuged to pellet the nuclear debris. The supernatant representing the nuclear extract was collected.
5.5.2 Recombinant Protein Expression and Purification
The procedure used to express and purify p68 is similar to the procedure reported previously. P68 ORF and various mutants were cloned into pET-30a+ expression vector and transformed into E.coli BL21-CodonPlus bacteria (Stratagene,
Cedar reek, TX) were used to express protein. The bacteria were subcultured in fresh st. LB broth till OD600 reached around 0.6. Induction of the cells was done with IPTG for
18 hr and washed with 1X PBS buffer after harvesting, pelleted and stored at - 80°C.
They were then disrupted by freeze-thaw cycle at -80°C, resuspended in lysis buffer (50 mM Tris-HCl pH 8.0, 1 mM DTT, 10 mM PMSF, 300 mM NaCl ad 10% glycerol). They were then subjected to lysozyme (0.5 mg/ml) digestion. DTT and PMSF were also added at 1 mM final concentration. The cells were further subjected to ultrasonication 198 and pelleted. After centrifugation, the expressed protein was found in the precipitate which was dissolved in denaturing buffer containing 8 M urea, 50 mM Tris-HCl pH 8.0,
0.2% Triton-100 and 250 mM NaCl. The lysate was passed through Ni-NTA column for purification of recombinant protein by affinity separation. After column wash using the denaturing wash buffer (8 M urea, 50 mM Tris-HCl pH 8.0, 250 mM NaCl, 20 mM imidazole pH 8.0, and 0.2% Triton-100), the protein was eluted using elution buffer with
8 M urea, 250 mM Imidazole, 50 mM Tris-HCl pH 8.0, 250 mM NaCl, 0.5 mM DTT and
10% glycerol, and 0.2% Triton-100. Refolding of the eluted protein was done by stepwise dialysis procedure (8 M→6 M→4 M→2 M→0 M) to remove urea using refolding buffer (200 mM arginine, 50 mM Tris-HCl pH 8.0, 250 mM NaCl, 0.5 mM DTT,
10% glycerol, and 0.2% Triton-100) and preserved in further 15 to 20% glycerol.
5.5.3 Determination of Protein Concentration by Biorad Method
The proteins obtained from either whole cell lysate or nuclear/cytoplasmic extract or pure recombinant protein preparation was accurately quantified by modified Bradford
Assay using Coomassie Brilliant Blue (Bio-Rad, Hercules, CA). 200 µl of 5X Biorad dye solution was added in a cuvette to which appropriate amount of either standard protein or 1 µl of sample whose concentration has to be determined was added. A volume of
800 µl was made up for each dilution with sterile distilled water so that the total volume of each reaction was 1 ml. The absorbance was determined at an OD595 using a spectrophometer (Shimadzu) after incubation at room temperature for 5 mins. Those absorbance values were applied to the slope-intercept formula generated by the standard curve using Excel to give the protein concentration. 199
5.5.4 In Vitro Kinase Assay
In this assay, about 1μg of purified proteins were added to the reaction consisting of 200-250ng of p38α/SAPK2a enzyme (Upstate cell signaling), 10 μCi/μl of [γ-
32P]ATP, Magnesium/ATP cocktail (75 mM MgCl2 and 25 mM β-glycerol phosphate,
500 μM ATP in 20 mM MOPS, pH 7.2, 1 mM sodium orthovanadate, 5 mM EGTA, and
1mM dithiothreitol) and 5X reaction buffer (125 mM Tris-HCl, pH 7.5, 0.1 mM EGTA) in a volume of 25μl. After incubation for 30 mins at 30°C, 5X loading buffer (Fermentas,
Glen Burnie, MA) were added. The samples run on two SDS-PAGE gels were subjected to either autoradiography or Coomassie blue staining.
5.5.5 SDS-PolyAcrylamide Gel Electrophoresis (SDS-PAGE)
SDS-PAGE (Sodium dodecyl sulphate polyacrylamide gel electrophoresis) separates proteins according to their electrophoretic mobilities. SDS is an anionic detergent whose binding to proteins gives uniform distribution of charge per unit mass on the proteins so that during electrophoresis, they can be fractionated based on their size. The electrophoretic apparatus used to separate proteins was bought from BioRad and assembled. Polyacrylamide gels consisted of acrylamide, bisacrylamide, SDS, a buffer of designated pH and stabilizer to initiate polymerization. Normally, by varying the acrylamide concentrations in the gel, 5 to 25% acrylamide gels can be prepared with higher percentage gels used to separate smaller proteins and lower percentage gels used to separate proteins with higher molecular weight. Normally, 10 to 14% gels were used to study p68 and TPPP/P25 expression. The separating gel consisting of polyacrylamide 29:1, 40%, 1.5 mM Tris-HCl, pH 8.8, 10% ammonium persulphate, 10% 200
SDS, TEMED, and water was poured into the casting system formed from two glass plates and allowed to polymerize for atleast 40 mins. A layer of isopropanol was added during the polymerization procedure to remove any bubbles. After polymerization of the separating gel, the isopropanol was poured off and the region above the gel was washed with distilled water. 4% stacking gel was prepared which consisted of the same components as mentioned for the separating gel except 0.5 mM Tris-HCl, pH 6.8 was used instead of 1.5 mM Tris-HCl, pH 8.8. Stacking gel was allowed to polymerize for 10 mins after which they were ready for electrophoresis.
The protein samples (roughly 50 µg) to be separated were denatured by mixing with 2X SDS loading buffer containing either DTT or β-mercaptoethanol and placed for
10 mins at 100°C. The1X SDS-PAGE running buffer was added to the gel running unit consisting of the prepared gels. The samples loaded were first run at 60 V and then run for 120 V till the dye ran out of the gel. Appropriate molecular weight maker was also simultaneously run with the gel and any unused wells were filled with 2X SDS loading buffer. Gel was subsequently either stained with Coomassie Blue dye to visualize the protein bands or subjected to transfer to nitrocellulose membrane if immunoblotting was to be performed.
5.5.6 Coomassie Blue Staining
The proteins on a polyacrylamide gel can be observed by staining with coomassie blue stain (0.1% Coomassie Brilliant Blue, 10% acetic acid, 20% methanol, and water). After staining with coomassie blue stain on a rotator, the gel was placed in destaining buffer (40% methanol, 10% acetic acid, water) overnight. They were washed 201 with water and visualized using UVP Bioimaging and Analysis System (White light only) attached to CCD camera.
5.5.7 Generation of anti-p68 antibody
Anti-p68 antibody was generated from the C-terminal region of human p68 (a.a
437-614). Polyclonal (from rabbit) antibody was generated at Auburn Hybridoma
Facility) while monoclonal (from mouse) antibody against p68 was obtained from
Invitrogen.
5.5.8 Immunoblotting
Immunoblotting is a technique used for detection of expression and regulation of proteins from either pure protein preparation or whole cell lysate or extract. The proteins separated on a gel by electrophoresis are examined for the expression of the protein using an antibody against the protein. In a typical western blot experiment, the protein sample in the extract was denatured by heating at 100°C and loaded onto a gel of appropriate concentration. It was run at appropriate voltage and the proteins from the gel were transferred. The gel was placed on a sheet of 3 MM Whatman filter paper prewetted with the transfer buffer and a presoaked nitrocellulose membrane was then placed on top of the gel. The air bubbles trapped in between the layers were removed using a roller apparatus and another filter paper was placed. The cassette was then placed in a tank submerged with transfer buffer and the transfer was allowed to take place either at 50 mA for overnight at 4°C or 120 mA at RT for 2 hrs. It is generally preferred to transfer the proteins overnight for larger molecular weight proteins. After the 202 transfer was complete, the membrane was rinsed with water and then stained with
Ponceau S stain (VWR International, West Chester, PA) for 2 mins to visualize the complete transfer of proteins and equal loading of the samples. The membrane was then again rinsed with water and then with 1X TBS containing 0.1% Tween-20 until the
Ponceau S stain was completely removed. The membrane was subsequently incubated on a rocking platform with a blocking buffer containing 5% BSA in 1X TBST for 1 hour to mask non-specific binding sites. Next, the membrane was exposed to primary antibody diluted in 1X TBST buffer containing 5% BSA at an appropriate dilution ranging from
1:500 to 1:2000 and incubated overnight. It was rinsed with 1X TBST for five minutes three times each and then incubated with secondary antibody (Pierce, Thermo Fisher
Scientific Dharmacon, Lafayette, CO) (1: 4000 dilution in 1X TBST containing 5% BSA) for 1 hr. After another wash, SuperSignal West Dura Extended Duration Substrate
(Pierce, Thermo Fisher Scientific Dharmacon, Lafayette, CO) was developed. Blot was incubated with the substrate for 2 mins and the signal was detected with the x-ray machine.
The blotted membrane could be re-used and re-blotted two to three times with another antibody by stripping the previous primary antibody. Restore Plus Stripping
Buffer (Pierce, Thermo Fisher Scientific Dharmacon, Lafayette, CO) was used to strip the primary antibody from the membranes. The membrane was washed and incubated with the stripping buffer (4 to 5 ml per blot) for 45 mins. After washing, the membrane was blocked with 5% BSA in 1X TBST for 1 hr. A different antibody at an appropriate dilution was added for another round of blotting.
203
5.5.9 Immunoprecipitation (IP)
Immunoprecipitation is a method used to pull down proteins using protein G beads followed by SDS-PAGE and immunoblotting. Usually, 200 to 300 μg of nuclear extract or upto 1 mg of whole-cell extract diluted in either RIPA buffer or NETS buffer were used. 1-3 μg of primary antibody was added and incubated at 4°C for overnight.
After adding Protein G beads and washing with 1X RIPA buffer, the proteins captured by the antibody-bead complex were eluted by denaturing with 2X sample buffer containing β-mercaptoethanol for 10 mins at 95°C. The immunoprecipitated protein was then detected by SDS-PAGE followed by immunoblotting.
5.5.10 Chromatin Immunoprecipitation (ChIP) Assay
Chromatin Immunoprecipitation is a technique used to identify DNA-protein association. QuickChIPTM kit from Imgenex (Imgenex Corp, San Diego, CA) was used to carry out the ChIP assay. Cells were grown till they were around 70 to 80% confluent.
The next day, the cells were fixed and crosslinked with formaldehyde. The crosslinking process was stopped by adding glycine directly to the formaldehyde/media solution for 5 mins at RT with frequent swirling. The fixed cells after washing with 1X PBS supplemented with 1X PMSF and 1X PIC were harvested in 1X PBS. Lysis of the harvested cells was done with SDS lysis buffer. Sonication of the lysate was done on the ice using a sonicator and centrifuged. To check if the shearing process generated on an average 500 bp DNA fragments, 25 μl of the sheared chromatin was reverse crosslinked and agarose gel electrophoresis was carried out. Next, 100 μl of salmon sperm DNA/protein G beads was used to pre-clear the sheared chromatin for 1 hr. The 204 precleared chromatin was then used for immunoprecipitation with the appropriate ChIP grade antibody. Next day, protein G beads (60 μl) added to the complex were incubated for 2 hrs. After washing the complex extensively with different wash buffers with increasing salt concentrations to prevent non-specific binding, the immunocomplex was eluted from the beads, reverse crosslinked and the released chromatin was purified.
The purified DNA was amplified by PCR and analyzed.
5.5.11 Immunostaining
For immunostaining, the cells were seeded on culture plates with coverslips or chambered slides and either transfected or treated with the respective drug. Fixing of the cells was done with 4% paraformaldehyde in PBS for 15 mins. Permeabilization was done with 0.25% Triton X-100 in PBS after washing with 1X PBS. After blocking the cells with 3% BSA in PBST, the cells were incubated with appropriate primary antibody for 1 hr. Secondary antibody, either anti-Alexa Fluor 555 (orange, anti-rabbit) or anti-
FITC (green, anti-mouse) IgG antibodies in 3% BSA in PBST (0.1%) was added to the cells and incubated at RT for 1 hr in the dark. After washing with PBS for three times five mins each, Prolong Gold antifade reagent containing DAPI (Molecular Probes) was used to mount the slides. The slides were cured overnight at RT and viewed using Zeiss
LSM Confocal Microscope or fluorescent microscope.
205
5.5.12 Cell Proliferation Assay
5.5.12.1 MTT Assay
Cell viability was measured using MTT assay (Sigma, St. Louis, MO). 4000 cells were seeded 24 hrs before knockdown and transfection of cells with vectors containing p68 and the mutants. Subsequently, 24 hrs after transfection and different drug treatment, reconstituted MTT-reagent (5 mg/ml MTT in RPMI-1640 without phenol red) was added to the cells and left at 37°C for 2-4 hours. Formazan crystals were dissolved with the MTT Solubilization solution (0.1 N HCl in isopropanol). Cell proliferation was measured using a spectrophotometric plate reader (Victor 3TM; PerkinElmer Life
Sciences) by reading the absorbance at A570.
5.5.12.2 BrdU Cell Proliferation Assay
BrdU cell proliferation assay (Millipore, Billerica, MA) was used for measuring cell proliferation. Briefly, 4000 cells were seeded, treated and incubated with the BrdU label diluted in fresh cell culture medium at 37°C incubator. Cells were treated with
Fixative/Denaturing solution and subsequently, incubated with anti-BrdU primary antibody (Millipore, Billerica, MA). After washing the unbound primary antibodies, secondary goat anti-mouse secondary IgG (Millipore, Billerica, MA, peroxidase conjugate) was used at RT for 30 mins. After incubation with the substrate and stop solutions, the nuclei incorporation of BrdU was measured using a spectrophotometer microplate reader (Victor 3TM; PerkinElmer Life Sciences) at a wavelength of 450nm.
206
5.5.12.3 Caspase-3/CPP32 Colorimetric Assay
Cells plated on 6-well plates were treated with 10 μM oxaliplatin after p68 knockdown and transfection and caspase-3/CPP32 colorimetric assay (Biovision
Research Products, Milpitas, CA) was used to measure the activity of caspase-3.
Briefly, after apoptosis induction, the cells were lysed in Cell Lysis Buffer. Cell lysate in
Cell Lysis Buffer, 2X buffer and 4 mM DEVD-pNA substrate were incubated at 37°C.
They were read at A405 using a microtiter plate reader (Victor 3TM; PerkinElmer Life
Sciences).
5.6 Materials
Table 5.1 Cell-lines
Cell-line ATCC Number Origin Culture Medium
HeLa CCL-2 Human epithelial MEM + 10% FBS + 1mM
cervical adenocarcinoma Sodium Pyruvate + 1mM
Non-essential amino-acids
HEK 293 CRL-1573 Human kidney epithelial DMEM + 10% FBS
cells immortalized by
adenovirus
HCT 116 CRL-247 Human colorectal McCoy’s 5A + 10% FBS
carcinoma
LN229 CRL-2611 Human glioblastoma DMEM + 10% FBS
PC12 CRL-1721 Rat adrenal gland DMEM + 10% FBS + 5% 207
pheochromocytoma horse serum
SW620 CCL-227 Human colorectal L-15 Medium + 10% FBS
adenocarcinoma from
lymph node (metastatic
site)
T98G CRL-1690 Human glioblastoma MEM + 10% FBS + 1mM
multiforme Sodium Pyruvate + 1mM
Non-essential amino-acids
U-87MG HTB-14 Human glioblastoma, MEM + 10% FBS + 1mM
astrocytoma Sodium Pyruvate + 1mM
Non-essential amino-acids
Table 5.2 Bacterial Strains
Bacterial Strains Company
BL21-CodonPlus (DE3)-RIL Stratagene, Cedar reek, TX
JM109 Promega, Madison, WI
XL-1 Blue Supercompetent Cells Stratagene, Cedar reek, TX
Table 5.3 Antibodies
Antibody Animal of origin Company
Acetylated tubulin Rabbit polyclonal Cell Signaling Technology,
Beverly, MA 208
α-tubulin Mouse monoclonal Sigma Aldrich, St. Louis. MO
Caspase-3 Rabbit polyclonal Cell Signaling Technology,
Beverly, MA
Cleaved-caspase-3 Rabbit polyclonal Cell Signaling Technology,
Beverly, MA
FLAG Mouse monoclonal Sigma Aldrich, St. Louis, MO
GAPDH Mouse monoclonal Millipore, Billerica, MA
HA Rabbit polyclonal Georgia State University, Animal
center facility
HA, chip grade Rabbit polyclonal Abcam, Cambridge, MA
Lamin A/C Rabbit polyclonal Cell Signaling Technology,
Beverly, MA
P38 Rabbit polyclonal Cell Signaling Technology,
Beverly, MA
P-p38 Rabbit polyclonal Cell Signaling Technology,
Beverly, MA
P68 Rabbit polyclonal Georgia State University, Animal
center facility
P68-rgg Mouse monoclonal Auburn University Hybridoma
Facility
P-threonine (14B3) Mouse monoclonal Calbiochem, Billerica, MA
TPPP Rabbit polyclonal Santa Cruz Biotechnology,
Santa Cruz, CA 209
TPPP Rabbit monoclonal Abcam, Cambridge, MA
Table 5.4 Chemicals/Reagents
Chemical Name Company
γ-32P] ATP PerkinElmer, Waltham, MA
Acetic acid VWR International, West Chester, PA
Acetone VWR International, West Chester, PA
Acrylamide/bisacrylamide Fisher BioReagent, Fairlawn, NJ
Adenosine triphosphate Fermentas, Glen Burnie, MA
Agar Sigma Aldrich, St. Louis, MO
Agarose MP Biomedicals, Aurora, OH
Alcohol VWR International, West Chester, PA
Ammonium persulfate Sigma Aldrich, St. Louis, MO
Ampicillin Sigma Aldrich, St. Louis, MO
Bacto Yeast Extract BD Bioscience, Spark, MD
Bacto Tryptone BD Bioscience, Spark, MD
β-Mercaptoethanol Sigma Aldrich, St.Louis, MO
Bovine serum albumin Promega, Madison, WI 210
Bromophenol Blue EMD Biosciences, San Diego, CA
Cell culture media Mediatech, Herndon, VA
Coomassie blue Sigma Aldrich, St. Louis, MO
Dithiothreitol Shelton Scientific, Shelton, CT
Ethanol AAPER Alcohol & Chemical,
Shelbyville, KY
Ethidium bromide Sigma, St. Louis, MO
Ethylenedinitro-tetraacetic acid (EDTA) Sigma Aldrich, St. Louis, MO
Ethylene glycol bis(2-aminoethyl ether)-
N,N,N'N'-tetraacetic acid (EGTA) Sigma Aldrich, St. Louis, MO
Fetal calf serum Hyclone, Logan, UT
Formaldehyde Calbiochem, San Diego, CA
FuGENE HD Transfection Reagent Roche Applied Science, Indianapolis,
IN
Glycine MP Biomedicals, Aurora, OH
Hydrochloric acid VWR International, West Chester, PA
Imidazole Sigma Aldrich, St. Louis, MO
Isopropyl-ß-D-thiogalactopyranosid Sigma Aldrich, St. Louis, MO
Isopropanol VWR International, West Chester, PA
Kanamycin Sigma Aldrich, St. Louis, MO 211
Lipofectamine 2000 Invitrogen, Grand Island, NY
Lipofectamine RNAimax Invitrogen, Grand Island, NY
Lysozyme Sigma Aldrich, St. Louis, MO
Magnesium/ATP Cocktail Upstate, Charlottesville, VA
Magnesium Chloride Fisher Biotech, Fairlawn, NJ
Methanol VWR International, West Chester, PA
Methylene blue Sigma Aldrich, St. Louis, MO
Molecular weight marker (DNA) Fermentas, Glen Burnie, MA
Molecular weight marker (protein) Fermentas, Glen Burnie, MA
N- (2-hydroxyethyl) piperazine-N`-(2- Sigma Aldrich, St. Louis, MO ethanesulfonic acid) (HEPES)
Nickel-nitrilotriacetic acid (Ni-NTA) Qiagen, Valencia, CA agarose
Nonidet P40 Roche Applied Science, Indianapolis,
IN
Oligonucleotides Sigma-Genosys, Woodlands, TX
Penicillin-Streptomycin solutions Mediatech, Herndon, VA
Phenol/Chloroform Promega, Madison, WI
Phenylmethylsulfonyl fluoride Fluka, Switzerland
Phosphatase inhibitor cocktail Sigma Aldrich, St. Louis, MO
Phorbol 12-Myristate 13-acetate (PMA) Promega, Madison, WI
Poly-L-lysine solution Sigma Aldrich, St. Louis, MO
Ponceau S Sigma Aldrich, St. Louis, MO 212
2-Propanol VWR International, West Chester, PA
Protease inhibitor cocktail Sigma Aldrich, St. Louis, MO
Protein G agarose Upstate, Charlottesville, VA
RNasin Promega, Madison, WI
Sodium acetate Promega, Madison, WI
Sodium azide Fluka, Switzerland
Sodium bicarbonate Sigma Aldrich, St. Louis, MO
Sodium chloride Fisher BioReagent, Fairlawn, NJ
Sodium dodecyl sulfate Fisher BioReagent, Fairlawn, NJ
Sodium fluoride Fluka, Switzerland
Sodium hydroxide Fisher BioReagent, Fairlawn, NJ
Sodium orthovanadate EMD Biosciences, San Diego, CA
Sodium pyruvate Cellgro, Herndon, VA
SYBR Green RT-PCR Master Mix Applied Biosystems, Foster City, CA
Taxol USB, Cleveland, OH
Tris base Fisher Biotech, Fairlawn, NJ
Triton X-100 Sigma Aldrich, St. Louis, MO
Trypan Blue Sigma Aldrich, St. Louis, MO
0.25% Trypsin-EDTA Cellgro, Herndon, VA
Tween-20 Sigma Aldrich, St. Louis, MO
Urea Fisher Biotech, Fairlawn, NJ
213
Table 5.5 Experimental Kits
Name of the kit Company
Bio-Rad Protein Assay Bio-Rad, Hercules, CA
BrDU Cell Proliferation assay Calbiochem, Billerica, MA
ChIP-IT™ Chromatin Immunoprecipitation Kit Active Motif, Carlsbad, CA
Improm-II Reverse Transcription System Promega, Madison, WI
Nuclear Extraction Kit Active Motif, Carlsbad, CA
RNeasy® Mini Kit Qiagen, Valencia, CA
QIAprep Spin Miniprep Kit Qiagen, Valencia, CA
QIAquick Gel Extraction Kit Qiagen, Valencia, CA
QuikChange® II Site-Directed Mutagenesis Stratagene, Cedar reek, TX
Kit
Quick-ChIP Kit Imgenex, San Diego, CA
Wizard® plus DNA purification System Promega, Madison, WI
214
Table 5.6 Laboratory Equipments
Name of the Euipment Company
AllegraTM 6R Centrifuge Beckman Coulter, Fullerton, CA
C25 Incubator shaker NewBrunswick Scientific, Edison, NJ
EpiChemi3™ Darkroom Bioimaging System UVP, Inc., Upland, CA
Eppendorf Centrifuge 5415D Eppendorf AG, Hamburg, Germany
Eppendorf Mastercycler Eppendorf AG, Hamburg, Germany
Mini-PROTEAN® II Electrophoresis Cell Biorad Laboratories, Hercules, CA
NuAire™ CO2 Water-Jacketed Incubator NuAire, Plymouth, MN
Purifier Class II Biosafety Cabinet Labconco, Kansas City, MO
Centrifuge Thermo Electron Corporation, Asheville, NC
Sonic Dismembrator 500 Fisherscientific, Fairlawn, NJ
UV-1700 UV-Visible Spectrophotometer Shimadzu Corporation, Kyoto, Japan
Victor3V 1420 Multilabel Counter PerkinElmer PerkinElmer, Waltham, MA